KR102138495B1 - miRNA polymer and the method for preparing the same - Google Patents

Abstract

The present invention provides a miRNA polymer that can be used for various purposes and a method for producing the same, and more particularly, as a double-stranded oligonucleotide, a first strand comprising a desired first oligonucleotide and a first extended oligonucleotide; And a second strand comprising a desired second oligonucleotide and a second extended oligonucleotide, wherein the first extended oligonucleotide can be hybridized with the second oligonucleotide, and the second extended oligonucleotide is It relates to a double-stranded oligonucleotide capable of hybridizing with the first oligonucleotide.

Description

Double stranded oligonucleotide and its manufacturing method{miRNA polymer and the method for preparing the same}

The present invention relates to a double-stranded oligonucleotide that can be used for various purposes, and a method for manufacturing the same.

Micro RNA (micro RNA; miRNA) is a small non-coding RNA composed of 18-25 nucleotides (nucleotide, nt), which binds to the 3'-untranslated region (UTR) of the target gene and regulates gene expression. (Bartel DP, et al., Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), intron, exon or intergenic region ) (Rodriguez A, et al., Genome Res 14: 1902-1910, 2004). First, miRNA is transcribed by RNA polymerase into an initial miRNA (pri-miRNA) molecule containing thousands of nucleotides. Then, the pri-miRNA is a microprocessor (DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8) to form a roughly 70 nt stem ring intermediate known as a miRNA precursor. ] (Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci US A100: 9779-9784, 2003). Then, the pre-miRNA is transferred from the nucleus to the cytoplasm through the cofactors Ran-GTP with Exopoltin-5 (EXPORTin-5, EXP5), where the pre-miRNA is 18-25 by RNase endonuclease dicer. nt mature miRNA duplex (Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev28: 369-378, 2009). The mature miRNA duplex is integrated into the RNA-induced silencing complex (RISC) as a single-stranded RNA with Argonaute protein, which induces either cleavage or translational inhibition of the target mRNA (Diederichs S, et al., Cell 131: 1097-1108, 2007; Hammond SM, et al., Nature 404: 293-296, 2000; Martinez et al., Cell 110: 563-574, 2002).

The present invention provides a double-stranded oligonucleotide that can be used for various purposes and a method for manufacturing the same.

The present invention provides a double-stranded oligonucleotide that can be used for various purposes and a method for manufacturing the same.

The term "hybridization" as used herein means that two single-stranded nucleic acids form a duplex structure by pairing complementary base sequences. Hybridization can occur when the complementarity between single-stranded nucleic acid sequences is a perfect match or even if some mismatch bases are present.

The term "complementary" as used herein means that both strands of an oligonucleotide can form a base pair. Both strands of complementary oligonucleotides form base pairs in a Watson-Crick fashion to form double strands. In the present invention, when the base U is mentioned, it can be substituted with the base T unless otherwise specified.

In the present invention, the "oligonucleotide" is a DNA, RNA, or DNA/RNA hybrid molecule, and more preferably, may be an oligonucleotide that is an RNA molecule.

In the present invention, the oligonucleotide may contain a naturally occurring or modified, non-naturally occurring base, and may contain modified sugars, phosphates, and/or terminals. For example, in addition to phosphodiester linkages, phosphate modifications include, but are not limited to, methyl phosphonate, phosphorothioate, phosphoramidate (crosslinked or non-crosslinked), phosphotriester and phosphorodithioate It may not be used in any combination. In some embodiments, the RNA oligonucleotide has a phosphorothioate linkage alone, a phosphodiester linkage alone, or a combination of phosphodiester and phosphorothioate linkages.

Sugar modifications known in the art, such as 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA/DNA chimeras and herein Others described may also be made and combined with any phosphate modification. Examples of base modifications are for the C-5 and/or C-6 of the cytosine of the oligonucleotide (e.g., 5-bromocytosine, 5-chlorocytosine, 5-fluorocytosine, 5-iodocytosine). C-5 and/or addition of electron-withdrawing moieties and uracil (eg, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, 5-iodouracil) of oligonucleotides of the invention) Including but not limited to the addition of an electron-withdrawing moiety to C-6. As mentioned above, the use of base modifications in palindrome sequences of the oligonucleotides should not interfere with the self-complementarity of the bases involved for Watson-Crick base pairing. However, outside the palindrome sequence, modified bases can be used without these limitations. For example, 2'-O-methyl-uridine and 2'-O-methyl-cytidine can be used outside the palindrome sequence, while 5-bromo-2'-deoxycytidine is It can be used both inside and outside the literary sequence. Other modified nucleotides that can be used both inside and outside of palindrome sequences include 7-deaza-8-aza-dG, 2-amino-dA, and 2-thio-dT.

In the present invention, the oligonucleotide may include a phosphate-modified oligonucleotide, some of which are known to stabilize the oligonucleotide. Thus, some embodiments of the invention include stabilized oligonucleotides. Synthesis of oligonucleotides containing modified phosphate linkages or non-phosphate linkages is also known in the art (see, e.g., Matteucci "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (DJ Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY, 1997). Phosphor derivatives (or modified phosphate groups) that can be attached to sugars or sugar analogue moieties in oligonucleotides include monophosphates, diphosphates, triphosphates, alkylphosphonates, phosphorothioates, phosphorodithioates, phos It may be, for example, poramidate. Preparation of the above-mentioned phosphate analogs and their incorporation into nucleotides, modified nucleotides and oligonucleotides has already been widely described per se (see, eg, Peyrottes et al., Nucleic Acids Res, 24:1841-). 1848, 1996; Chaturvedi et al., Nucleic Acids Res, 24:2318-2323, 1996; and Schultz et al., Nucleic Acids Res, 24:2966-2973, 1996). For example, synthesis of phosphorothioate oligonucleotides is similar to that described above for naturally occurring oligonucleotides except that the oxidation step is replaced by a sulfidation step (Zon "Oligonucleoside Phosphorothioates" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190, 1993).

In the present invention, the oligonucleotide may include one or more ribonucleotides (containing ribose as the sole or main sugar component), deoxyribonucleotides (containing deoxyribose as the main sugar component), modified sugars or sugar analogs. Thus, in addition to ribose and deoxyribose, sugar moieties can be pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxos, and sugar analog cyclopentyl groups. Sugars can exist in the form of pyranosyl or furanosyl. In the oligonucleotides of the present invention, the sugar moiety is preferably a furanoside of ribose, deoxyribose, arabinose or 2'-0-alkyl (e.g. methyl, ethyl) ribose, and the sugar is each heterocyclic It can be attached to the base in an annodic configuration. Sugar modifications include 2'-alkoxy (eg methoxy, ethoxy)-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-RNA, 2'-fluoro-DNA, and 2'-alkoxy- Or amino-RNA/DNA chimeras. The preparation of these sugars or sugar analogs and each nucleoside to which these sugars or analogs are themselves attached to a heterocyclic base (nucleic acid base) is known and therefore need not be described herein. Sugar modifications can also be made in the preparation of oligonucleotides of the invention and combined with any phosphate modifications.

The heterocyclic base, or nucleic acid base, incorporated in the oligonucleotide in the present invention is a naturally occurring major purine and pyrimidine base (ie, uracil, thymine, cytosine, adenine and guanine as mentioned above), as well as It can be naturally occurring and synthetic. Accordingly, the oligonucleotide of the present invention may include one or more of inosine, 2'-deoxyuridine and 2-amino-2'-deoxyadenosine.

The oligonucleotides of the present invention can be modified using various strategies known in the art to produce various effects, including, for example, improved potency and stability in vitro and in vivo. Among such strategies are artificial nucleic acids, such as 2'-0-methyl-substituted RNA; 2'-fluoro-2' deoxy RNA, peptide nucleic acid (PNA); Morpholino; Locked nucleic acids (LNA); Non-locked nucleic acids (UNA); Crosslinked nucleic acids (BNA); Glycol nucleic acids (GNA); And throse nucleic acid (TNA); More generally nucleic acid analogs, such as bicyclic and tricyclic nucleoside analogs, which are structurally similar to naturally occurring RNA and DNA, but modified in one or more of the phosphate backbone, sugar or nucleobase portion of the naturally occurring molecule. Have Typically, analog nucleobases confer, among other things, different base pairing and base stacking properties. Examples include universal bases capable of pairing with four canon bases. Examples of phosphate-sugar backbone analogs include PNA. Morpholino-based oligomeric compounds are described in Brasch et al., Biochemistry, 41(14): 4503-4510 (2002) and US Pat. Nos. 5,539,082, 5,714,331, 5,719,262 and 5,034,506.

In the present invention, the oligonucleotide may be modified by substitution with a chemical functional group at the terminal end. Substitutions can be performed at the 3'or 5'end of the oligonucleotide, preferably at the 3'end of both the sense and antisense strands of the monomer, but are not always limited thereto. Chemical functional groups are, for example, sulfhydryl groups (-SH), carboxyl groups (-COOH), amine groups (-NH ₂ ), hydroxy groups (-OH), formyl groups (-CHO), carbonyl groups (-CO-), ether groups (-O-), ester groups (-COO-), nitro groups (-NO ₂ ), azide groups (-N ₃ ) or sulfonic acid groups (-SO ₃ H). Can.

According to an embodiment of the present invention, as a double-stranded oligonucleotide,

A first strand comprising a desired first oligonucleotide and a first extended oligonucleotide; And

And a second strand comprising a desired second oligonucleotide and a second extended oligonucleotide.

The first extended oligonucleotide is capable of hybridizing with the second oligonucleotide,

The second extended oligonucleotide relates to a double-stranded oligonucleotide capable of hybridizing with the first oligonucleotide.

In the present invention, the first oligonucleotide and the second oligonucleotide function by controlling the expression of the target gene, and may be identical to or different from each other, and specific sequences are not particularly limited.

In the present invention, the first oligonucleotide is a full sequence of a miRNA (hereinafter referred to as a'target first miRNA') or some fragment thereof known to function as a desired function by regulating the expression of a target gene. It can contain.

In the present invention, the second oligonucleotide is a full sequence of a miRNA (hereinafter referred to as a'target second miRNA') or some fragment thereof known to function as a desired function by regulating the expression of a target gene. It can contain.

In the present invention, the desired miRNA of each of the first oligonucleotide and the second oligonucleotide may be the same or different from the desired first miRNA and the desired second miRNA.

In the present invention, the length of the entire chain of each of the target first miRNA and the target second miRNA is not particularly limited, but is preferably 18 to 25 nucleotides (hereinafter referred to as'nt'). It can be length.

In addition, in the present invention, each of the first oligonucleotide and the second oligonucleotide may include the entire chain of a mature miRNA or a fragment thereof, but miRNA precursor, primary miRNA (pri-miRNA) or plasmid (plasmid) Form may include the entire chain of miRNA precursors or fragments thereof. However, in the present invention, the nucleic acid molecule constituting the miRNA precursor or primary miRNA may have a length of 50 to 100nt, more preferably 65 to 95nt, but is not limited thereto.

In the present invention, the miRNA fragment includes a seed sequence of a desired miRNA, or 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more with the seed sequence, It may include a miRNA consisting of a base sequence having a homology of 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology.

In the present invention, the "seed sequence (seed sequence)" refers to the nucleotide sequence of a portion of the miRNA in the miRNA that binds with full complementarity when the miRNA recognizes the target, which is a required part of the miRNA to bind to the target It is an effective and effective part.

In the present invention, the length of the miRNA fragment is not particularly limited, but may preferably be 9 to 11 nt.

In the present invention, the miRNA fragment is produced by cutting the desired miRNA, or 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more and the base sequence of any one fragment of the desired miRNA , 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.

In the present invention, the first extended oligonucleotide is capable of hybridizing with the second oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the second oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology.

In the present invention, the first extended oligonucleotide may form a bubble structure by including the second oligonucleotide and one or more mis-matching nucleotides (ie, non-complementary base pairs).

In the present invention, the mismatch is G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T , And U:T.

In the present invention, the second extended oligonucleotide can be hybridized with the first oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the first oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology.

In the present invention, the second extended oligonucleotide may form a bubble structure by including the first oligonucleotide and one or more mismatching nucleotides.

In the present invention, the mismatch is G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T , And U:T.

In the present invention, any one end of the first extended oligonucleotide may be connected to any one end of the first oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is 3'of the first oligonucleotide. It may be linked to the terminal, or the 5'end of the first oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.

In the present invention, one end of the second extended oligonucleotide may be connected to any one end of the second oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is 3'of the second oligonucleotide. It may be linked to the end, or the 5'end of the second oligonucleotide may be linked to the 3'end of the second extended oligonucleotide.

In the present invention, preferably, the 5'end of the first extended oligonucleotide is connected to the 3'end of the first oligonucleotide, and the 5'end of the second extended oligonucleotide is 3'end of the second oligonucleotide. Can be connected to.

In the present invention, preferably, the 5'end of the first oligonucleotide is connected to the 3'end of the first extended oligonucleotide, and the 5'end of the second oligonucleotide is 3'end of the second extended oligonucleotide. Can be connected to.

Figure 1 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, each of the two strands comprises a first oligonucleotide (10) and a second oligonucleotide (11), the first oligo At the 3'end of the nucleotide 10, the 5'end of the first extended oligonucleotide 20 complementary to the sequence in the 3'-5' direction of the second oligonucleotide 11 is connected to form a first strand. Can. In addition, the 5'end of the second extended oligonucleotide 21 complementary to the 3'-5' direction sequence of the first oligonucleotide 10 is connected to the 3'end of the second oligonucleotide 11. To form a second strand.

Figure 2 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, each of the two strands comprises a first oligonucleotide (10) and a second oligonucleotide (11), the second oligo The 5'end of the first oligonucleotide 10 is connected to the 3'end of the first extended oligonucleotide 20 complementary to the sequence in the 3'-5' direction of the nucleotide 11 to form a first strand. have. In addition, the 5'end of the second oligonucleotide 11 is connected to the 3'end of the second extended oligonucleotide 21 that is complementary to the 3'-5' direction sequence of the first oligonucleotide 10. The second strand can be achieved.

In the present invention, the first oligonucleotide and the first extended oligonucleotide may be directly linked, but may further include a first linker nucleotide or a first linker oligonucleotide as a first linker therebetween, in which specific sequence Is not particularly limited, a nucleotide having an adenine (A) base, a nucleotide having a base uracil (U), a nucleotide having a base guanine (G), a nucleotide having a base cytosine (C), or It can be a combination of these.

In the present invention, the second oligonucleotide and the second extended oligonucleotide may be directly linked, but may further include a second linker nucleotide or a second linker oligonucleotide as a second linker therebetween. Is not particularly limited, a nucleotide having an adenine (A) base, a nucleotide having a base uracil (U), a nucleotide having a base guanine (G), a nucleotide having a base cytosine (C), or It can be a combination of these.

When the first linker and the second linker are included in the present invention, they may be disposed to face each other in a double strand.

In addition, in the present invention, the first linker and the second linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

Figure 3 shows the structure of the double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the first extended oligonucleotide 20 is the first oligonucleotide 10 through the first linker 300 ) May be connected to the 3'end, and the 5'end of the second extended oligonucleotide 21 may be connected to the 3'end of the second oligonucleotide 11 through the second linker 300'.

Figure 4 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the first oligonucleotide 10 is the first extended oligonucleotide 20 through the first linker 300 ) May be connected to the 3'end, and the 5'end of the second oligonucleotide 11 may be connected to the 3'end of the second extended oligonucleotide 21 through the second linker 300'.

In the present invention, the 5'end of the first strand, the 5'end of the first oligonucleotide or the 5'end of the first extended oligonucleotide may further include a first cap nucleotide or a first cap oligonucleotide.

In the present invention, the sequence of the first cap nucleotide is not particularly limited, but may be a nucleotide whose base is uracil (U), or a first or second nucleotide from the 5'end of the desired first miRNA, but is not limited thereto. It does not work.

In the present invention, the sequence of the first cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from 1 to 3 of the 5'end of the desired first miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.

In the present invention, the 5'end of the second strand, the 5'end of the second oligonucleotide or the 5'end of the second extended oligonucleotide may further include a second cap nucleotide or a second cap oligonucleotide.

In the present invention, the sequence of the second cap nucleotide is not particularly limited, but may be a nucleotide whose base is uracil (U) or a first or second nucleotide from the 5'end of the desired second miRNA, but is not limited thereto. It does not work.

In the present invention, the sequence of the second cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from 1 to 3 of the 5'end of the desired second miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.

Figure 5 shows the structure of the double-stranded oligonucleotide according to an embodiment of the present invention, 3'-5' direction of the second oligonucleotide 11 at the 3'end of the first oligonucleotide 10 The 5'end of the first extended oligonucleotide 20 complementary to the sequence of the first strand is connected to form a first strand, and the 3'end of the first oligonucleotide 10 is 3'to the 3'end of the second oligonucleotide 11 The 5'end of the second extended oligonucleotide 21 complementary to the sequence in the -5' direction may be connected to form a second strand. At this time, the 5'end of the first oligonucleotide 10, which is the 5'end of the first strand, the first cap nucleotide or the first cap oligonucleotide 100 is extended, and the second is the 5'end of the second strand At the 5'end of the oligonucleotide 11, a second cap nucleotide or a second cap oligonucleotide 100' may be extended.

Figure 6 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the first extended oligonucleotide 20 complementary to the sequence in the 3'-5' direction of the second oligonucleotide 11 5'end of the first oligonucleotide 10 is connected to the 3'end of the second strand to form a first strand, and a second extended oligonucleotide complementary to the sequence in the 3'-5' direction of the first oligonucleotide 10 The 5'end of the second oligonucleotide 11 is connected to the 3'end of (21) to form a second strand. At this time, at the 5'end of the first extension oligonucleotide 20, which is the 5'end of the first strand, the first cap nucleotide or the first cap oligonucleotide 100 is extended, and the 5'end of the second strand is 2 At the 5'end of the extended oligonucleotide 21, a second cap nucleotide or a second cap oligonucleotide 100' may be extended.

In the present invention, a 3'end of the first strand, a 3'end of the first extended oligonucleotide, or a 3'end of the first oligonucleotide may further include a first terminal nucleotide or a first terminal oligonucleotide.

In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A), or a first or second nucleotide from the 3'end of the desired first miRNA. It is not limited.

In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but may include a nucleotide whose base is adenine (A), or 1 to 3 from the 3'end of the desired first miRNA. It may be a continuous oligonucleotide, or 1 to 2 consecutive oligonucleotides, but is not limited thereto.

In the present invention, the 3'end of the second strand, the 3'end of the second extended oligonucleotide, or the 3'end of the second oligonucleotide may further include a second terminal nucleotide or a second terminal oligonucleotide.

In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A), or a first or second nucleotide from the 3'end of the desired second miRNA. It is not limited.

In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but may include a nucleotide whose base is adenine (A), or 1 to 3 from the 3'end of the desired second miRNA. It may be a continuous oligonucleotide, or 1 to 2 consecutive oligonucleotides, but is not limited thereto.

Figure 7 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 3'-5' direction of the second oligonucleotide 11 at the 3'end of the first oligonucleotide 10 The 5'end of the first extended oligonucleotide 20 complementary to the sequence of the first strand is connected to form a first strand, and the 3'end of the first oligonucleotide 10 is 3'to the 3'end of the second oligonucleotide 11 The 5'end of the second extended oligonucleotide 21 complementary to the sequence in the -5' direction may be connected to form a second strand. In this case, the first terminal nucleotide or the first terminal oligonucleotide 200 is extended to the 3'terminal of the first extension oligonucleotide 20 which is the 3'terminal of the first strand, and the second terminal is the 3'terminal of the second strand. A second terminal nucleotide or a second terminal oligonucleotide 200' may be extended to the 3'end of the extended oligonucleotide 21.

Figure 8 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the first extended oligonucleotide 20 complementary to the sequence in the 3'-5' direction of the second oligonucleotide 11 5'end of the first oligonucleotide 10 is connected to the 3'end of the second strand to form a first strand, and a second extended oligonucleotide complementary to the sequence in the 3'-5' direction of the first oligonucleotide 10 The 5'end of the second oligonucleotide 11 is connected to the 3'end of (21) to form a second strand. At this time, the first nucleotide or the first oligonucleotide 200 is extended to the 3'end of the first oligonucleotide 10, which is the 3'end of the first strand, and the second oligo is the 3'end of the second strand. A second terminal nucleotide or a second terminal oligonucleotide 200' may be extended to the 3'end of the nucleotide 11.

In the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide; if included, they may be arranged to face each other in the double strand.

In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In addition, the second cap nucleotide or the second cap oligonucleotide in the present invention; And the first terminal nucleotide or the first terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.

In addition, in the present invention, the second cap nucleotide or the second cap oligonucleotide; And the first terminal nucleotide or the first terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

Figure 9 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the first cap nucleotide or the first cap nucleotide at the 5'end of the first oligonucleotide 10, the 5'end of the first strand The cap oligonucleotide 100 may be extended, and a second cap nucleotide or a second cap oligonucleotide 100' may be extended to the 5'end of the second oligonucleotide 11, which is the 5'end of the second strand. In addition, a first terminal nucleotide or a first terminal oligonucleotide 200 is extended to the 3'terminal of the first extended oligonucleotide 20 which is the 3'terminal of the first strand, and the 3'terminal of the second strand is A second terminal nucleotide or a second terminal oligonucleotide 200' may be extended to the 3'end of the second extended oligonucleotide 21. The first cap nucleotide or the first cap oligonucleotide 100 is disposed opposite to the second terminal nucleotide or the second terminal oligonucleotide 200', and the second cap nucleotide or the second cap oligonucleotide 100 ') may be disposed to face each other with the first terminal nucleotide or the first terminal oligonucleotide 200.

Figure 10 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, a first cap nucleotide or a 5'end of the first extension oligonucleotide 20, which is the 5'end of the first strand One cap oligonucleotide 100 is extended, and a second cap nucleotide or a second cap oligonucleotide 100' may be extended to the 5'end of the second extended oligonucleotide 21, which is the 5'end of the second strand. have. In addition, a first terminal nucleotide or a first terminal oligonucleotide 200 is extended to the 3'terminal of the first oligonucleotide 10, which is the 3'terminal of the first strand, and the agent that is the 3'terminal of the second strand is 2 The second terminal nucleotide or oligonucleotide 200' may be extended to the 3'end of the oligonucleotide 11. The first cap nucleotide or the first cap oligonucleotide 100 is disposed opposite to the second terminal nucleotide or the second terminal oligonucleotide 200', and the second cap nucleotide or the second cap oligonucleotide 100 ') may be disposed to face each other with the first terminal nucleotide or the first terminal oligonucleotide 200.

Figure 11 shows the structure of the double-stranded oligonucleotide according to an embodiment of the present invention, the 3'end of the first oligonucleotide 10, the 5'end of the first extended oligonucleotide 20 is removed 1 connected through the linker 300 to form a first strand, and the 5'end of the second extended oligonucleotide 21 to the 3'end of the second oligonucleotide 11 is connected through the second linker 300' To form a second strand. In addition, a first cap nucleotide or a first cap oligonucleotide 100 is extended to the 5'end of the first oligonucleotide 10, which is the 5'end of the first strand, and the 5'end of the second strand is 2 The second cap nucleotide or the second cap oligonucleotide 100' may be extended to the 5'end of the oligonucleotide 11.

FIG. 12 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, wherein the 5'end of the first oligonucleotide 10 is 3'to the 3'end of the first extended oligonucleotide 20. It is connected through the linker 300 to form a first strand, and the 5'end of the second oligonucleotide 11 is connected to the 3'end of the second extended oligonucleotide 21 through the second linker 300'. The second strand can be achieved. In addition, a first cap nucleotide or a first cap oligonucleotide 100 is extended to the 5'end of the first extended oligonucleotide 20, which is the 5'end of the first strand, and the 5'end of the second strand A second cap nucleotide or a second cap oligonucleotide 100' may be extended to the 5'end of the phosphorus second extension oligonucleotide 21.

13 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, wherein the 5'end of the first extended oligonucleotide 20 is 3'to the 3'end of the first oligonucleotide 10. It is connected through the linker 300 to form a first strand, and the 5'end of the second extended oligonucleotide 21 is connected to the 3'end of the second oligonucleotide 11 through the second linker 300'. The second strand can be achieved. In addition, a first terminal nucleotide or a first terminal oligonucleotide 200 is extended to the 3'terminal of the first extended oligonucleotide 20 which is the 3'terminal of the first strand, and the 3'terminal of the second strand is A second terminal nucleotide or a second terminal oligonucleotide 200' may be extended to the 3'end of the second extended oligonucleotide 21.

FIG. 14 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, wherein the 5′ end of the first oligonucleotide 10 is the 3′ end of the first extended oligonucleotide 20. It is connected through the linker 300 to form a first strand, and the 5'end of the second oligonucleotide 11 is 3'to the 3'end of the second extended oligonucleotide 21 through the second linker 300'. Connected to form a second strand. In addition, a first terminal nucleotide or a first terminal oligonucleotide 200 is extended to the 3'terminal of the first oligonucleotide 10, which is the 3'terminal of the first strand, and the agent that is the 3'terminal of the second strand is 2 The second terminal nucleotide or the second terminal oligonucleotide 200' may be extended to the 3'end of the oligonucleotide 20.

15 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, and the 5'end of the first extended oligonucleotide 20 is 3'to the 3'end of the first oligonucleotide 10. Connected through the linker 300 to form a first strand, the 5'end of the second extended oligonucleotide 21 to the 3'end of the second oligonucleotide 11 through the second linker 300' Connected to form a second strand. In addition, a first cap nucleotide or a first cap oligonucleotide 100 is extended to the 5'end of the first oligonucleotide 10, which is the 5'end of the first strand, and the 5'end of the second strand is 2 The second cap nucleotide or the second cap oligonucleotide 100' may be extended to the 5'end of the oligonucleotide 11. In addition, a first terminal nucleotide or a first terminal oligonucleotide 200 is extended to the 3'terminal of the first extended oligonucleotide 20 which is the 3'terminal of the first strand, and the 3'terminal of the second strand is A second terminal nucleotide or a second terminal oligonucleotide 200' may be extended to the 3'end of the second extended oligonucleotide 21. In this case, the first cap nucleotide or the first cap oligonucleotide 100 is disposed opposite to the second terminal nucleotide or the second terminal oligonucleotide 200', and the second cap nucleotide or the second cap oligonucleotide (100') is disposed opposite to the first terminal nucleotide or the first terminal oligonucleotide 200, and the first linker 300 may be disposed opposite to the second linker 300'. .

FIG. 16 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, wherein the 5'end of the first oligonucleotide 10 is 3'to the 3'end of the first extended oligonucleotide 20. It is connected through the linker 300 to form a first strand, and the 5'end of the second oligonucleotide 11 is 3'to the 3'end of the second extended oligonucleotide 21 through the second linker 300'. Connected to form a second strand. In addition, a first cap nucleotide or a first cap oligonucleotide 100 is extended to the 5'end of the first extension oligonucleotide 20, which is the 5'end of the first strand, and the 5'end of the second strand is A second cap nucleotide or a second cap oligonucleotide 100' may be extended to the 5'end of the second extended oligonucleotide 21. In addition, a first terminal nucleotide or a first terminal oligonucleotide 200 is extended to the 3'terminal of the first oligonucleotide 10, which is the 3'terminal of the first strand, and the agent that is the 3'terminal of the second strand is 2 The second terminal nucleotide or the second terminal oligonucleotide 200' may be extended to the 3'end of the oligonucleotide 11. In this case, the first cap nucleotide or the first cap oligonucleotide 100 is disposed opposite to the second terminal nucleotide or the second terminal oligonucleotide 200', and the second cap nucleotide or the second cap oligonucleotide (100') is disposed opposite to the first terminal nucleotide or the first terminal oligonucleotide 200, and the first linker 300 may be disposed opposite to the second linker 300'. .

According to one embodiment of the invention, as a double-stranded oligonucleotide,

a first strand comprising a first oligonucleotide and a first extended oligonucleotide composed of a s to p s consecutive sequences from the 5'end of the m nucleotide (nt) miRNA; And

and a second strand comprising a second oligonucleotide and a second extended oligonucleotide consisting of a sequential sequential sequence of b th to q th from 5'end of miRNA of n nucleotide length (nt).

The first extended oligonucleotide may be hybridized with the second oligonucleotide,

The second extended oligonucleotide may be hybridized with the first oligonucleotide,

m and n are each independently an integer from 18 to 25,

a and b are each independently an integer from 1 to 3,

p is an integer from 10 to m,

q is an integer from 10 to n.

In the present invention, each of the first oligonucleotide and the second oligonucleotide includes the entire chain or a fragment of a desired miRNA that is the same or different from each other. More specifically, a mature miRNA, a miRNA precursor, a primary miRNA (pri-miRNA) or a full chain of miRNA precursors in the form of a plasmid (plasmid) or fragments thereof.

In the present invention, the m nucleotide (nt) length miRNA (target first miRNA) and the n nucleotide (nt) length miRNA (target second miRNA) may be the same or different from each other.

In the present invention, the sequences of the first oligonucleotide and the second oligonucleotide may be identical to or different from each other.

In the present invention, the first oligonucleotide may be composed of 1 to p consecutive sequences from the 5'end of miRNA of m nucleotides (nt) in length.

In the present invention, the first oligonucleotide may be composed of 2 to p-th consecutive base sequences from the 5'end of miRNAs of m nucleotides (nt) in length.

In the present invention, the second oligonucleotide may be composed of 1 to q sequential sequencing sequences from the 5'end of miRNA of n nucleotides (nt) in length.

In the present invention, the second oligonucleotide may be composed of 2 to q sequential sequencing sequences from the 5'end of miRNA of n nucleotides (nt) in length.

In the present invention, the first extended oligonucleotide is capable of hybridizing with the second oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the second oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology to be composed of base sequences having homology. have.

In the present invention, the first extended oligonucleotide may form a bubble structure by including the second oligonucleotide and one or more mismatching nucleotides.

In the present invention, the second extended oligonucleotide can be hybridized with the first oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the first oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology to be composed of base sequences having homology. have.

In the present invention, the second extended oligonucleotide may form a bubble structure by including the first oligonucleotide and one or more mismatching nucleotides.

In addition, in the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% with an oligonucleotide complementary to the 1st to qbth nucleotide sequence of the 3'-5' direction of the second oligonucleotide. Above, 93%, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.

In addition, in the present invention, the first extended oligonucleotide is 90% or more, 91% or more with an oligonucleotide complementary to the 1st to qb-1th nucleotide sequence of the 3'-5' direction of the second oligonucleotide. It can be synthesized and produced to consist of a base sequence having a homology of 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology. .

In addition, in the present invention, the second extended oligonucleotide is 90% or more, 91% or more, 92% with an oligonucleotide complementary to the 1st to path nucleotide sequence of the 3'-5' direction of the first oligonucleotide. Or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.

In addition, in the present invention, the second extended oligonucleotide is 90% or more, 91% or more, with an oligonucleotide complementary to the 1st to pa-1th nucleotide sequence of the 3'-5' direction of the first oligonucleotide. It can be synthesized and produced to consist of a base sequence having a homology of 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology. .

In the present invention, any one end of the first extended oligonucleotide may be connected to any one end of the first oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is 3'of the first oligonucleotide. It may be linked to the terminal, or the 5'end of the first oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.

In the present invention, one end of the second extended oligonucleotide may be connected to any one end of the second oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is 3'of the second oligonucleotide. It may be linked to the end, or the 5'end of the second oligonucleotide may be linked to the 3'end of the second extended oligonucleotide.

In the present invention, preferably, the 5'end of the first extended oligonucleotide is connected to the 3'end of the first oligonucleotide, and the 5'end of the second extended oligonucleotide is 3'end of the second oligonucleotide. Can be connected to.

In the present invention, preferably, the 5'end of the first oligonucleotide is connected to the 3'end of the first extended oligonucleotide, and the 5'end of the second oligonucleotide is 3'end of the second extended oligonucleotide. Can be connected to.

In the present invention, the first oligonucleotide and the first extended oligonucleotide may be directly linked, but as the first linker between the first oligonucleotide and the first extended oligonucleotide, a first linker nucleotide or a first linker oligo It may further include a nucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, the first linker nucleotide may be a p+1 th nucleotide from the 5'end of the mRNA of m nucleotides (nt) in length. However, the p may be an integer of 10 to m-1.

In the present invention, the first linker oligonucleotide may be an oligonucleotide consisting of p+1 th to p+r th consecutive nucleotide sequences from the 5'end of the m nucleotide (nt) length miRNA. Here, r may be an integer from 2 to 4. However, where p is an integer of 10 or more, the maximum value may be an integer of m-4 to m-2.

In the present invention, the second oligonucleotide and the second extended oligonucleotide may be directly linked, but as a second linker between the second oligonucleotide and the second extended oligonucleotide, a second linker nucleotide or a second linker oligo It may further include a nucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, the second linker nucleotide may be a q+1 th nucleotide from the 5'end of the n nucleotide (nt) length miRNA. However, the q may be an integer of 10 to n-1.

In the present invention, the second linker oligonucleotide may be an oligonucleotide consisting of a sequence of q+1 th to q+s th consecutive sequences from the 5'end of the n nucleotide (nt) miRNA. Here, s may be an integer from 2 to 4. However, where q is an integer of 10 or more, the maximum value may be an integer of n-4 to n-2.

When the first linker and the second linker are included in the present invention, they may be disposed to face each other in a double strand.

In addition, in the present invention, the first linker and the second linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, the 5'end of the first strand, the 5'end of the first oligonucleotide or the 5'end of the first extended oligonucleotide may further include a first cap nucleotide or a first cap oligonucleotide, preferably Is that the first oligonucleotide consists of 2 to p-th consecutive sequences or 3 to p-th consecutive sequences from the 5'end of miRNAs of m nucleotides (nt) in length. The 5'end of the oligonucleotide may further include a first cap nucleotide or a first cap oligonucleotide.

In the present invention, the sequence of the first cap nucleotide is not particularly limited, but the base is uracil (U) nucleotide, or the first or second nucleotide from the 5'end of the m nucleotide (nt) length miRNA. However, it is not limited thereto.

In the present invention, the sequence of the first cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from the 5′ end of the m nucleotide (nt) length miRNA. The third to third consecutive oligonucleotides, or the first to second consecutive oligonucleotides, but are not limited thereto.

In the present invention, the 5'end of the second strand, the 5'end of the second oligonucleotide or the 5'end of the second extended oligonucleotide may further include a second cap nucleotide or a second cap oligonucleotide, preferably Is the second oligonucleotide is composed of a 2nd to qth consecutive base sequence or a 3rd to qth consecutive base sequence from the 5'end of the n nucleotide (nt) length miRNA, wherein the second A second cap nucleotide or a second cap oligonucleotide may be further included at the 5'end of the oligonucleotide.

In the present invention, the sequence of the second cap nucleotide is not particularly limited, but the base is a uracil (U) nucleotide, or the first or second nucleotide from the 5'end of the n nucleotide (nt) length miRNA. However, it is not limited thereto.

In the present invention, the sequence of the second cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from the 5'end of the n nucleotide (nt) length miRNA 1 The third to third consecutive oligonucleotides, or the first to second consecutive oligonucleotides, but are not limited thereto.

In the present invention, at least one of the first cap nucleotide and the second cap nucleotide is a nucleotide having a base of uracil (U), thereby enhancing a cross-linking ability with a target gene.

In the present invention, at least one of the first cap oligonucleotide and the second cap oligonucleotide includes a nucleotide having a base of uracil (U), thereby increasing a binding force with a target gene.

In the present invention, the 3'end of the first strand, the 3'end of the first extended oligonucleotide or the 3'end of the first oligonucleotide may further include a first terminal nucleotide or a first terminal oligonucleotide.

In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or m th nucleotide of the m nucleotide (nt) length miRNA.

In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but includes a nucleotide whose base is adenine (A), or mc th to m from the 5'end of the m nucleotide (nt) length miRNA. It may consist of a sequence of sequential sequences. Here, c may be an integer from 1 to 3, or an integer from 1 to 2.

In the present invention, a second terminal nucleotide or a second terminal oligonucleotide may be further included in the 3'terminal of the second strand, the 3'terminal of the second extended oligonucleotide, or the 3'terminal of the second oligonucleotide.

In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or the n th nucleotide of the n nucleotide (nt) length miRNA.

In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but includes a nucleotide whose base is adenine (A), or nd th to n from the 5'end of the n nucleotide (nt) length miRNA. It may consist of a sequence of sequential sequences. Here, d may be an integer from 1 to 3, or an integer from 1 to 2.

In the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.

In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In addition, the second cap nucleotide or the second cap oligonucleotide in the present invention; And the first terminal nucleotide or the first terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.

In addition, in the present invention, the second cap nucleotide or the second cap oligonucleotide; And the first terminal nucleotide or the first terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

According to another embodiment of the invention, as a double-stranded oligonucleotide,

A first strand comprising a 1-1 oligonucleotide, which is one fragment of the desired first miRNA precursor, and a 1-2 oligonucleotide, which is the other fragment;

A second strand comprising a 2-1 oligonucleotide which is a fragment of one desired fragment of the second miRNA precursor and a second 2-2 oligonucleotide which is the other fragment;

A third strand comprising a 1-3 oligonucleotide, which is another fragment of the desired first miRNA precursor;

And a fourth strand comprising a second-3 oligonucleotide, another fragment of the desired second miRNA precursor,

One end of the first strand is connected to one end of the second strand or the fourth strand,

One end of the third strand relates to the oligonucleotide of the double strand, which is connected to either end of the fourth strand or the second strand.

In the present invention, the first miRNA precursor and the second miRNA precursor are precursors of miRNAs (hereinafter referred to as'target miRNAs') which are known to function as targets by regulating the expression of target genes. Although not, it may be in the form of a hairpin. The nucleic acid molecules constituting this may have a length of 50 to 150 nt, preferably 60 to 100 nt, and more preferably 65 to 95 nt.

In the present invention, the first miRNA precursor and the second miRNA precursor may be the same or different.

In the present invention, each of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide is any fragment of the first miRNA precursor, and these sequences are completely different from each other, partially overlapping, or identical It is possible, and their sequence is not particularly limited.

However, in the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be any two fragments that are continuously arranged in the first miRNA precursor and can be cleaved by the action of a dicer. Can.

Preferably, in the present invention, the 1-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.

In the present invention, each of the 2-1 oligonucleotide, 2-2 oligonucleotide, and 2-3 oligonucleotide is any fragment of the second miRNA precursor, and these sequences are completely different from each other, partially overlapped, It may be the same, and their sequence is not particularly limited.

However, in the present invention, the 2-1 oligonucleotide and the 2-2 oligonucleotide may be any two fragments that are continuously disposed on the second miRNA precursor and can be cleaved by the action of a dicer.

In the present invention, the 2-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.

17 to 24 are 1-1 oligonucleotides (50a), 1-2 oligonucleotides (50b) and 1-3 oligonucleotides (50c) of the hairpin-shaped first miRNA precursor according to an embodiment of the present invention. As an example of arrangement, each of the 1-1 oligonucleotide (50a), 1-2 oligonucleotide (50b) and 1-3 oligonucleotide (50c) is 5'-3 of the first miRNA precursor It can be any three intercepts that are arranged consecutively in the'direction or 3'-5' direction. Here, the 1-1 oligonucleotide may include the entire sequence or seed sequence of a miRNA that is cleaved from the first miRNA precursor in the human body and controls the expression of the target gene to perform a desired function. In addition, the 1-2 oligonucleotide is, but is not limited to, a fragment arranged adjacent to the 1-1 oligonucleotide in the first miRNA precursor, and the 1- by the action of a dicer. It can be separated and cleaved from 1 oligonucleotide. In addition, the 1-2 oligonucleotide and the 1-3 oligonucleotide are not limited thereto, but may be any two fragments located in a loop in the hairpin-shaped first miRNA.

Although not shown in the drawings in the present invention, the 2-1 oligonucleotide, the 2-2 oligonucleotide and the 2-3 oligonucleotide are also in the 5'-3' or 3'-5' direction of the second miRNA precursor. It can be any three segments arranged in succession. Here, the 2-1 oligonucleotide may include the entire sequence or seed sequence of the miRNA that is cleaved from the second miRNA precursor in the human body and controls the expression of the target gene to perform the desired function. In addition, the 2-2 oligonucleotide is, but is not limited to, a fragment disposed adjacent to the 2-1 oligonucleotide in the second miRNA precursor, and the 2- by the action of a dicer. It can be separated and cleaved from 1 oligonucleotide. In addition, the 2-2 oligonucleotide and the 2-3 oligonucleotide are not limited thereto, but may be any two fragments located in a loop in the hairpin-shaped first miRNA.

In the present invention, the 1-1 oligonucleotide and the 2-1 oligonucleotide may be the same or different from each other.

In the present invention, the 1-2 oligonucleotide and the 2-2 oligonucleotide may be the same or different from each other.

In the present invention, the 1-3 oligonucleotide and the 2-3 oligonucleotide may be the same or different from each other.

Any one end of the 1-1 oligonucleotide in the first strand of the present invention may be connected to any one end of the 1-2 oligonucleotide, preferably the 5'end of the 1-2 oligonucleotide May be connected to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be connected to the 3'end of the 1-2 oligonucleotide.

In the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be directly linked, or as a 1-1 linker between the 1-1 oligonucleotide and the 1-2 oligonucleotide, the It may further include a 1-1 linker nucleotide or a 1-1 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In addition, one end of the 2-1 oligonucleotide in the second strand of the present invention may be connected to any one end of the 2-2 oligonucleotide, preferably 5 of the 2-1 oligonucleotide The'end' may be linked to the 3'end of the 2-2 oligonucleotide, or the 5'end of the 2-2 oligonucleotide may be linked to the 3'end of the 2-1 oligonucleotide.

In the present invention, the 2-2 oligonucleotide and the 2-1 oligonucleotide may be directly linked, or a 2-1 linker between the 2-2 oligonucleotide and the 2-1 oligonucleotide may be used. It may further include a 2-1 linker nucleotide or a 2-1 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

Further, in the present invention, the third strand may further include a first extended oligonucleotide.

In the present invention, the first extended oligonucleotide may be hybridized with the first 1-1 oligonucleotide.

In the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more with a sequence complementary to a 3'-5' nucleotide sequence of the 1-1 oligonucleotide. Above, 95%, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.

In the present invention, the first extended oligonucleotide may form a bubble structure by including the first-1-1 oligonucleotide and one or more miss-matching nucleotides.

In the present invention, one end of the 1-3 oligonucleotide in the third strand may be connected to any one end of the first extended oligonucleotide, preferably the 5'end of the first extended oligonucleotide is It may be linked to the 3'end of the 1-3 oligonucleotide, or the 5'end of the 1-3 oligonucleotide may be connected to the 3'end of the first extended oligonucleotide.

In the present invention, the 1-3 oligonucleotide and the first extended oligonucleotide may be directly linked, or as a 1-2 linker between the 1-3 oligonucleotide and the first extended oligonucleotide, the first- It may further include 2 linker nucleotides or 1-2 linker oligonucleotides. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, when the 1-1 linker and the 1-2 linker are included, they may be disposed to face each other in a double strand.

In addition, in the present invention, the 1-1 linker and the 1-2 linker may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.

In the present invention, the 1-2 oligonucleotide and the 1-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

Further, in the present invention, the fourth strand may further include a second extended oligonucleotide.

In the present invention, the second extended oligonucleotide may be hybridized with the 2-1 oligonucleotide.

In the present invention, the second extended oligonucleotide is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more with a sequence complementary to a 3'-5' nucleotide sequence of the 2-1 oligonucleotide. Above, 95%, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.

In the present invention, the second extended oligonucleotide may form a bubble structure by including the 2-1 oligonucleotide and one or more mismatching nucleotides.

In the present invention, one end of the second extended oligonucleotide may be connected to any one end of the second-3 oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is the second-3 oligonucleotide. It may be linked to the 3'end of the nucleotide, or the 5'end of the 2-3 oligonucleotide may be linked to the 3'end of the second extended oligonucleotide.

In the present invention, the second extended oligonucleotide and the second-3 oligonucleotide may be directly linked, or as a second-2 linker between the second extended oligonucleotide and the second-3 oligonucleotide, second- It may further include a 2 linker nucleotide or a 2-2 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

When the 2-1 linker and the 2-2 linker are included in the present invention, they may be disposed to face each other in a double strand.

In addition, in the present invention, the 2-1 linker and the 2-2 linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.

In the present invention, one end of the first strand may be connected to one end of the second strand or the fourth strand. Preferably, the 3'end of the first strand is connected to the 5'end of the second strand, or the 3'end of the first strand is connected to the 5'end of the fourth strand, or the second The 3'end of the strand may be connected to the 5'end of the first strand, or the 3'end of the fourth strand may be connected to the 5'end of the first strand.

In the present invention, one end of the third strand may be connected to one end of the fourth strand or the second strand. Preferably, the 3'end of the fourth strand is connected to the 5'end of the third strand, or the 3'end of the second strand is connected to the 5'end of the third strand, or the third The 3'end of the strand may be connected to the 5'end of the fourth strand, or the 3'end of the third strand may be connected to the 5'end of the second strand.

Figure 25 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the 1-2 oligonucleotide (50b) at the 3'end of the 1-1 oligonucleotide (50a) This is connected to form a first strand, and the 2'oligonucleotide 3'end of the 2-2 oligonucleotide 60b is connected to the 5'end of the 2-1 oligonucleotide 60a to form the second strand. In addition, at the 3'end of the 1-3 oligonucleotide 50c, the 5'end of the first extended oligonucleotide 70 complementary to the sequence in the 3'-5' direction of the 1-1 oligonucleotide 50a. 2-2 oligonucleotides at the 3'end of the second extended oligonucleotide 71 complementary to the sequence in the 3'-5' direction of the 2-1 oligonucleotide 60a. The 5'end of (60b) may be connected to form a fourth strand. At this time, the 5'end of the 2'oligonucleotide 2b, which is the 5'end of the 2nd strand, is connected to the 3'end of the 1-2 oligonucleotide 50b, which is the 3'end of the first strand. Can form a strand of In addition, the 5'end of the 1-3' oligonucleotide 50c of the third strand is connected to the 3'end of the 2-3 oligonucleotide 60c of the fourth strand, and the other strand is connected. Can achieve

Figure 26 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the 1-2 oligonucleotide (50b) to the 3'end of the 1-1 oligonucleotide (50a) This is connected to form a first strand, and the 2'oligonucleotide 60' of the 2'oligonucleotide 60b is connected to the 5'end of the 2'oligonucleotide 60a to form the second strand. In addition, at the 3'end of the 1-3 oligonucleotide 50c, the 5'end of the first extended oligonucleotide 70 complementary to the sequence in the 3'-5' direction of the 1-1 oligonucleotide 50a. The second extended oligonucleotide complementary to the sequence in the 3'-5' direction of the 2-1 oligonucleotide (60a) at the 3'end of the 2-3 oligonucleotide (60c) to form a third strand. The 5'end of (71) may be connected to form a fourth strand. At this time, the 5'end of the 2'oligonucleotide 60c of the 5'end of the 4th strand is connected to the 3'end of the 1-2 oligonucleotide 50b of the 3'end of the first strand. Can form a strand of In addition, the 3'end of the 2-2 oligonucleotide 60b, which is the 3'end of the second strand, and the 5'end of the 1-3 oligonucleotide 50c, which is the 5'end of the third strand, are Connected to form another strand.

Figure 27 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the 1-1 oligonucleotide (50a) to the 3'end of the 1-2 oligonucleotide (50b) This is connected to form a first strand, and the 2'oligonucleotide 3'end of the 2-2 oligonucleotide 60b is connected to the 5'end of the 2-1 oligonucleotide 60a to form the second strand. In addition, the 5'end of the 1-3 oligonucleotide 50c at the 3'end of the first extended oligonucleotide 70 complementary to the 3'-5' direction sequence of the 1-1 oligonucleotide 50a. 2-3 oligonucleotides at the 3'end of the second extended oligonucleotide 71 complementary to the sequence in the 3'-5' direction of the 2-1 oligonucleotide 60a. The 5'end of (60c) may be connected to form a fourth strand. At this time, the 5'end of the 1-2 oligonucleotide 50b, which is the 5'end of the first strand, is connected to the 3'end of the 2-3 oligonucleotide 60c, which is the 3'end of the 4th strand. To form a single strand. In addition, the 5'end of the 2-2 oligonucleotide 60b, which is the 5'end of the second strand, is located at the 3'end of the 1-3 oligonucleotide 50c, which is the 3'end of the third strand. Connected to form another strand.

According to one embodiment of the invention, as a double-stranded oligonucleotide,

1-1 oligonucleotides consisting of A s to B sequential nucleotide sequences from 5'end or 3'end of the first miRNA precursor of t nucleotides (nt) in length, and B+e th to B+f th A first strand comprising a 1-2 oligonucleotide consisting of a continuous base sequence;

2-1 oligonucleotides consisting of C-th to D-th consecutive nucleotide sequences from the 5'end or 3'end of the second nucleotide (nt) length of u nucleotides, and D+g th to D+h th contiguous A second strand comprising a 2-2 oligonucleotide consisting of a base sequence;

A third strand comprising 1-3 oligonucleotides consisting of B+w th to B+x th consecutive nucleotide sequences from the 5'end or the 3'end of the t mi nucleotide (nt) first miRNA precursor; And

A fourth strand comprising a 2-3 oligonucleotide consisting of D+y th to D+z th consecutive nucleotide sequences from the 5'end or 3'end of the second nucleotide (nt) length of the u nucleotides (nt). Including,

One end of the first strand is connected to one end of the second strand or the fourth strand,

One end of the third strand is connected to one end of the fourth strand or the second strand,

The t and u are each independently an integer of 60 to 150,

A and C are each independently an integer of 1 to 10,

B and D are each independently an integer of 18 to 25,

E and g are each independently an integer of 1 to 5,

F and h are each independently an integer of 5 to 57,

W and y are each independently an integer of 6 to 62,

The x and z may be each independently an integer of 11 to 119.

In the present invention, the first miRNA precursor and the second miRNA precursor may be the same or different.

In the present invention, each of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide is any fragment of the first miRNA precursor, and these sequences are completely different from each other, partially overlapping, or identical It is possible, and their sequence is not particularly limited.

However, in the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be any two fragments that are continuously disposed on the first miRNA precursor and can be cleaved by the action of a dicer.

Preferably, in the present invention, the 1-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.

In the present invention, each of the 2-1 oligonucleotide, 2-2 oligonucleotide, and 2-3 oligonucleotide is any fragment of the second miRNA precursor, and these sequences are completely different from each other, partially overlapped, It may be the same, and their sequence is not particularly limited.

However, in the present invention, the 2-1 oligonucleotide and the 2-2 oligonucleotide may be any two fragments that are continuously disposed on the second miRNA precursor and can be cleaved by the action of a dicer.

In the present invention, the 2-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.

In the present invention, the 1-1 oligonucleotide and the 2-1 oligonucleotide may be the same or different from each other.

In the present invention, the 1-2 oligonucleotide and the 2-2 oligonucleotide may be the same or different from each other.

In the present invention, the 1-3 oligonucleotide and the 2-3 oligonucleotide may be the same or different from each other.

Any one end of the 1-1 oligonucleotide in the first strand of the present invention may be connected to any one end of the 1-2 oligonucleotide, preferably the 5'end of the 1-2 oligonucleotide May be connected to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be connected to the 3'end of the 1-2 oligonucleotide.

In the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be directly linked, or as a 1-1 linker between the 1-1 oligonucleotide and the 1-2 oligonucleotide, the It may further include a 1-1 linker nucleotide or a 1-1 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In addition, one end of the 2-1 oligonucleotide in the second strand of the present invention may be connected to any one end of the 2-2 oligonucleotide, preferably 5 of the 2-1 oligonucleotide The'end' may be linked to the 3'end of the 2-2 oligonucleotide, or the 5'end of the 2-2 oligonucleotide may be linked to the 3'end of the 2-1 oligonucleotide.

In the present invention, the 2-2 oligonucleotide and the 2-1 oligonucleotide may be directly linked, or a 2-1 linker between the 2-2 oligonucleotide and the 2-1 oligonucleotide may be used. It may further include a 2-1 linker nucleotide or a 2-1 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, the third strand may further include a first extended oligonucleotide.

In the present invention, the first extended oligonucleotide may be hybridized with the first 1-1 oligonucleotide.

In the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more with a sequence complementary to a 3'-5' nucleotide sequence of the 1-1 oligonucleotide. Above, 95%, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.

In the present invention, the first extended oligonucleotide may form a bubble structure by including the first-1-1 oligonucleotide and one or more miss-matching nucleotides.

In the present invention, any one end of the first-3 oligonucleotide may be connected to any one end of the first extended oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is the first-3 oligonucleotide. It may be linked to the 3'end of the nucleotide, or the 5'end of the 1-3 oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.

In the present invention, the 1-3 oligonucleotide and the first extended oligonucleotide may be directly linked, or as a 1-2 linker between the 1-3 oligonucleotide and the first extended oligonucleotide, the first- It may further include 2 linker nucleotides or 1-2 linker oligonucleotides. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, when the 1-1 linker and the 1-2 linker are included, they may be disposed to face each other in a double strand.

In addition, in the present invention, the 1-1 linker and the 1-2 linker may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.

In the present invention, the 1-2 oligonucleotide and the 1-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, the fourth strand may further include a second extended oligonucleotide.

In the present invention, the second extended oligonucleotide may be hybridized with the 2-1 oligonucleotide.

In the present invention, the second extended oligonucleotide is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more with a sequence complementary to a 3'-5' nucleotide sequence of the 2-1 oligonucleotide. Above, 95%, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.

In the present invention, the second extended oligonucleotide may form a bubble structure by including the 2-1 oligonucleotide and one or more mismatching nucleotides.

In the present invention, one end of the second extended oligonucleotide may be connected to any one end of the second-3 oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is the second-3 oligonucleotide. It may be linked to the 3'end of the nucleotide, or the 5'end of the 2-3 oligonucleotide may be linked to the 3'end of the second extended oligonucleotide.

In the present invention, the second extended oligonucleotide and the second-3 oligonucleotide may be directly linked, or as a second-2 linker between the second extended oligonucleotide and the second-3 oligonucleotide, second- It may further include a 2 linker nucleotide or a 2-2 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, when the 2-1 linker and the 2-2 linker are included, they may be disposed to face each other in a double strand.

In addition, in the present invention, the 2-1 linker and the 2-2 linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, one end of the first strand may be connected to one end of the second strand or the fourth strand. Preferably, the 3'end of the first strand is connected to the 5'end of the second strand, or the 3'end of the first strand is connected to the 5'end of the fourth strand, or the second The 3'end of the strand may be connected to the 5'end of the first strand, or the 3'end of the fourth strand may be connected to the 5'end of the first strand.

In the present invention, one end of the third strand may be connected to one end of the fourth strand or the second strand. Preferably, the 3'end of the fourth strand is connected to the 5'end of the third strand, or the 3'end of the second strand is connected to the 5'end of the third strand, or the third The 3'end of the strand may be connected to the 5'end of the fourth strand, or the 3'end of the third strand may be connected to the 5'end of the second strand.

According to another embodiment of the present invention, as a method for preparing a double-stranded oligonucleotide,

Preparing a desired first oligonucleotide and a second oligonucleotide;

Synthesizing a first extended oligonucleotide capable of hybridizing with the second oligonucleotide; And

And synthesizing a second extended oligonucleotide capable of hybridizing with the first oligonucleotide.

In the present invention, the first oligonucleotide may include the entire chain of the desired first miRNA or a partial fragment thereof, which is known to function by controlling the expression of the target gene.

In the present invention, the second oligonucleotide may include the entire chain of the desired second miRNA or some fragment thereof, which is known to function by controlling the expression of the target gene.

In the present invention, the desired miRNA of each of the first oligonucleotide and the second oligonucleotide may be the same or different from the desired first miRNA and the desired second miRNA.

In the present invention, the length of the entire chain of each of the target first miRNA and the target second miRNA is not particularly limited, but may preferably be 18 to 25 nucleotides in length.

In addition, in the present invention, each of the first oligonucleotide and the second oligonucleotide may be a mature miRNA as described above, but miRNA precursor in the form of miRNA precursor, primary miRNA (pri-miRNA) or plasmid (plasmid). It may include the entire chain or fragments thereof. However, in the present invention, the nucleic acid molecule constituting the miRNA precursor or the primary miRNA may have a length of 50 to 100 nt, more preferably 65 to 95 nt.

In the present invention, the miRNA fragment may include a desired miRNA seed sequence, or may be composed of a nucleotide sequence having 90% or more homology with the seed sequence.

In the present invention, the length of the miRNA fragment is not particularly limited, but may preferably be 9 to 11 nt.

In the present invention, the miRNA fragment is produced by cutting the desired miRNA, or 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more and the base sequence of any one fragment of the desired miRNA , 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.

In the present invention, the first extended oligonucleotide is capable of hybridizing with the second oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the second oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology.

In the present invention, the first extended oligonucleotide may form a bubble structure by including the second oligonucleotide and one or more mis-matching nucleotides (ie, non-complementary base pairs).

In the present invention, the second extended oligonucleotide can be hybridized with the first oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the first oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology.

In the present invention, the second extended oligonucleotide may form a bubble structure by including the first oligonucleotide and one or more mismatching nucleotides.

In the present invention, any one end of the first extended oligonucleotide may be connected to any one end of the first oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is 3 of the first oligonucleotide. It can be linked to the'end, or the 5'end of the first oligonucleotide to the 3'end of the first extended oligonucleotide.

In the present invention, any one end of the second extended oligonucleotide may be linked to any one end of the second oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is 3 of the second oligonucleotide. It can be linked to the'end, or the 5'end of the second oligonucleotide to the 3'end of the second extended oligonucleotide.

In the present invention, preferably, the 5'end of the first extended oligonucleotide is connected to the 3'end of the first oligonucleotide, and the 5'end of the second extended oligonucleotide is 3'end of the second oligonucleotide. Can be connected to.

In the present invention, preferably, the 5'end of the first oligonucleotide is connected to the 3'end of the first extended oligonucleotide, and the 5'end of the second oligonucleotide is 3'end of the second extended oligonucleotide. Can be connected to.

In the present invention, the first cap nucleotide or the first cap oligonucleotide may be further extended to the 5'end of the first strand, the 5'end of the first oligonucleotide, or the 5'end of the first extended oligonucleotide.

In the present invention, the sequence of the first cap nucleotide is not particularly limited, but may be a nucleotide whose base is uracil (U), or a first or second nucleotide from the 5'end of the desired first miRNA, but is not limited thereto. It does not work.

In the present invention, the sequence of the first cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from 1 to 3 of the 5'end of the desired first miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.

In the present invention, the second cap nucleotide or the second cap oligonucleotide may be further extended to the 5'end of the second strand, the 5'end of the second oligonucleotide, or the 5'end of the second extended oligonucleotide.

In the present invention, the sequence of the second cap nucleotide is not particularly limited, but may be a nucleotide whose base is uracil (U) or a first or second nucleotide from the 5'end of the desired second miRNA, but is not limited thereto. It does not work.

In the present invention, the sequence of the second cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from 1 to 3 of the 5'end of the desired second miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.

In the present invention, the first oligonucleotide and the first extended oligonucleotide can be directly linked, but a first linker nucleotide or a first linker oligonucleotide may be further included as a first linker therebetween. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, the second oligonucleotide and the second extended oligonucleotide may be directly linked, but a second linker nucleotide or a second linker oligonucleotide may be further included as a second linker therebetween. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

When the first linker and the second linker are included in the present invention, they may be disposed to face each other in a double strand.

In addition, in the present invention, the first linker and the second linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, the first terminal nucleotide or the first terminal oligonucleotide may be further extended to the 3'terminal of the first strand, the 3'terminal of the first extended oligonucleotide, or the 3'terminal of the first oligonucleotide.

In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or a first or second nucleotide from the 3'end of the desired first miRNA, but is not limited thereto. It does not work.

In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but may include a nucleotide whose base is adenine (A), or from 1 to 3 of the 3'end of the desired first miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.

In the present invention, the second terminal nucleotide or the second terminal oligonucleotide may be further extended to the 3'terminal of the second strand, the 3'terminal of the second extended oligonucleotide, or the 3'terminal of the second oligonucleotide.

In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or a first or second nucleotide from the 3'end of the desired second miRNA, but is not limited thereto. It does not work.

In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but may include a nucleotide whose base is adenine (A), or the first to third from the 3'end of the desired second miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.

In the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide; when extended, they may be arranged to face each other in a double strand.

In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In addition, the second cap nucleotide or the second cap oligonucleotide in the present invention; And the first terminal nucleotide or the first terminal oligonucleotide; when extending, they may be arranged to face each other in a double strand.

In addition, in the present invention, the second cap nucleotide or the second cap oligonucleotide; And the first terminal nucleotide or the first terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

However, in the production method of the present invention, the order of synthesizing each oligonucleotide and the order of linking each synthesized oligonucleotide is not particularly limited.

According to an embodiment of the present invention, as a method for preparing a double-stranded oligonucleotide,

preparing a first oligonucleotide composed of a s to p sequential sequencing from the 5'end of the m nucleotide (nt) miRNA;

preparing a second oligonucleotide consisting of consecutive sequences of b th to q th from the 5'end of the n nucleotide (nt) miRNA;

Synthesizing a first extended oligonucleotide capable of hybridizing with the second oligonucleotide; And

And synthesizing a second extended oligonucleotide capable of hybridizing with the first oligonucleotide,

M and n are each independently an integer of 18 to 25,

a and b are each independently an integer from 1 to 3,

P is an integer from 10 to m,

Q is an integer of 10 to n.

In the present invention, each of the first oligonucleotide and the second oligonucleotide is a full sequence of miRNA or a fragment thereof, wherein mature miRNA, miRNA precursor, primary miRNA (pri-miRNA) or plasmid miRNA It may include the entire sequence of a precursor or a fragment thereof.

In the present invention, the m nucleotide (nt) length of the miRNA and the n nucleotide (nt) length of the miRNA may be the same or different from each other.

In the present invention, the sequences of the first oligonucleotide and the second oligonucleotide may be identical to or different from each other.

In the present invention, the first oligonucleotide may be composed of 1 to p consecutive sequences from the 5'end of miRNA of m nucleotides (nt) in length.

In the present invention, the first oligonucleotide may be composed of 2 to p-th consecutive base sequences from the 5'end of miRNAs of m nucleotides (nt) in length.

In the present invention, the second oligonucleotide may be composed of 1 to q sequential sequencing sequences from the 5'end of miRNA of n nucleotides (nt) in length.

In the present invention, the second oligonucleotide may be composed of 2 to q sequential sequencing sequences from the 5'end of miRNA of n nucleotides (nt) in length.

In the present invention, the first extended oligonucleotide is capable of hybridizing with the second oligonucleotide, 90% or more with an oligonucleotide capable of hybridizing with the nucleotide sequence in the 3'-5' direction of the second oligonucleotide, 91 % Or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homogeneous sequence Can be produced.

In the present invention, the first extended oligonucleotide may form a bubble structure by including the second oligonucleotide and one or more mismatching nucleotides.

In the present invention, the second extended oligonucleotide can be hybridized with the first oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the first oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology to be composed of base sequences having homology. have.

In the present invention, the second extended oligonucleotide may form a bubble structure by including the first oligonucleotide and one or more mismatching nucleotides.

In the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% or more with an oligonucleotide complementary to the 1st to qbth nucleotide sequence of the 3'-5' direction of the second oligonucleotide. It can be synthesized to be composed of a base sequence having a homology of 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology.

In the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% with an oligonucleotide complementary to the 1st to qb-1th nucleotide sequence of the 3'-5' nucleotide sequence of the second oligonucleotide. Or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.

In addition, in the present invention, the second extended oligonucleotide is 90% or more, 91% or more, 92% with an oligonucleotide complementary to the 1st to path nucleotide sequence of the 3'-5' direction of the first oligonucleotide. Or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.

In addition, in the present invention, the second extended oligonucleotide is 90% or more, 91% or more, with an oligonucleotide complementary to the 1st to pa-1th nucleotide sequence of the 3'-5' direction of the first oligonucleotide. It can be synthesized and produced to consist of a base sequence having a homology of 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology. .

In the present invention, any one end of the first extended oligonucleotide may be connected to any one end of the first oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is 3 of the first oligonucleotide. It can be linked to the'end, or the 5'end of the first oligonucleotide to the 3'end of the first extended oligonucleotide.

In the present invention, any one end of the second extended oligonucleotide may be linked to any one end of the second oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is 3 of the second oligonucleotide. It can be linked to the'end, or the 5'end of the second oligonucleotide to the 3'end of the second extended oligonucleotide.

In the present invention, preferably, the 5'end of the first extended oligonucleotide can be linked to the 3'end of the first oligonucleotide, and the 5'end of the second extended oligonucleotide is 3 of the second oligonucleotide. 'Can be connected to the terminal.

In the present invention, preferably, the 5'end of the first oligonucleotide can be linked to the 3'end of the first extended oligonucleotide, and the 5'end of the second oligonucleotide is 3 of the second extended oligonucleotide. 'Can be connected to the terminal.

In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide may be further extended to the 5'end of the first strand, the 5'end of the first oligonucleotide, or the 5'end of the first extended oligonucleotide. have.

In the present invention, the sequence of the first cap nucleotide is not particularly limited, but the base is uracil (U) nucleotide, or the first or second nucleotide from the 5'end of the m nucleotide (nt) length miRNA. However, it is not limited thereto.

In the present invention, the sequence of the first cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from the 5′ end of the m nucleotide (nt) length miRNA. The third to third consecutive oligonucleotides, or the first to second consecutive oligonucleotides, but are not limited thereto.

In the present invention, a second cap nucleotide or a second cap oligonucleotide may be further extended to the 5'end of the second strand, the 5'end of the second oligonucleotide, or the 5'end of the second extended oligonucleotide.

In the present invention, the sequence of the second cap nucleotide is not particularly limited, but the base is a uracil (U) nucleotide, or the first or second nucleotide from the 5'end of the n nucleotide (nt) length miRNA. However, it is not limited thereto.

In the present invention, the sequence of the second cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from the 5'end of the n nucleotide (nt) length miRNA 1 The third to third consecutive oligonucleotides, or the first to second consecutive oligonucleotides, but are not limited thereto.

In the present invention, at least one of the first cap nucleotide and the second cap nucleotide is a nucleotide having a base of uracil (U), thereby enhancing a cross-linking ability with a target gene.

In the present invention, at least one of the first cap oligonucleotide and the second cap oligonucleotide includes a nucleotide having a base of uracil (U), thereby increasing a binding force with a target gene.

In the present invention, prior to connecting the 5'end of the first oligonucleotide to the 3'end of the first oligonucleotide, to the 3'end of the first oligonucleotide or the 5'end of the first extended oligonucleotide. The first linker nucleotide or the first linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, the first linker nucleotide may be a p+1 th nucleotide from the 5'end of the mRNA of m nucleotides (nt) in length. However, the p may be an integer of 10 to m-1.

In the present invention, the first linker oligonucleotide may be an oligonucleotide consisting of p+1 th to p+r th consecutive nucleotide sequences from the 5'end of the m nucleotide (nt) length miRNA. Here, r may be an integer from 2 to 4. However, where p is 10 or more, the maximum value may be an integer of m-4 to m-2.

In addition, prior to linking the 5'end of the second oligonucleotide to the 3'end of the second oligonucleotide in the present invention, the 3'end of the second oligonucleotide or the 5'end of the second extended oligonucleotide. The terminal may further include a second linker nucleotide or a second linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, the second linker nucleotide may be a q+1 th nucleotide from the 5'end of the n nucleotide (nt) length miRNA. However, the q may be an integer of 10 to n-1.

In the present invention, the second linker oligonucleotide may be an oligonucleotide consisting of a sequence of q+1 th to q+s th consecutive sequences from the 5'end of the n nucleotide (nt) miRNA. Here, s may be an integer from 2 to 4. However, where p is 10 or more, the maximum value may be an integer of n-4 to n-2.

When the first linker and the second linker are included in the present invention, they may be disposed to face each other in a double strand.

In addition, in the present invention, the first linker and the second linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

Further, in the present invention, the first terminal nucleotide or the first terminal oligonucleotide may be further extended to the 3'terminal of the first strand, the 3'terminal of the first extended oligonucleotide, or the 3'terminal of the first oligonucleotide. .

In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or m th nucleotide of the m nucleotide (nt) length miRNA.

In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but includes a nucleotide whose base is adenine (A), or mc th to m from the 5'end of the m nucleotide (nt) length miRNA. It may consist of a sequence of sequential sequences. Here, c may be an integer from 1 to 3, or an integer from 1 to 2.

In the present invention, a second terminal nucleotide or a second terminal oligonucleotide may be further extended to the 3'end of the second strand, the 3'end of the second extended oligonucleotide, or the 3'end of the second oligonucleotide. .

In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or the n th nucleotide of the n nucleotide (nt) length miRNA.

In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but includes a nucleotide whose base is adenine (A), or nd th to n from the 5'end of the n nucleotide (nt) length miRNA. It may consist of a sequence of sequential sequences. Here, d may be an integer from 1 to 3, or an integer from 1 to 2.

In the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.

In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In addition, the second cap nucleotide or the second cap oligonucleotide in the present invention; And the first terminal nucleotide or the first terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.

In addition, in the present invention, the second cap nucleotide or the second cap oligonucleotide; And the first terminal nucleotide or the first terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

However, in the production method of the present invention, the order of synthesizing each oligonucleotide and the order of linking each synthesized oligonucleotide is not particularly limited.

According to another embodiment of the present invention, as a method for preparing a double-stranded oligonucleotide,

Preparing a first strand comprising a 1-1 oligonucleotide which is a fragment of the desired first miRNA precursor and a 1-2 oligonucleotide that is the other fragment;

Preparing a second strand comprising a second 1 oligonucleotide, which is a fragment of the desired second miRNA precursor, and a second fragment, the second oligonucleotide;

Preparing a third strand comprising 1-3 oligonucleotides, which is another fragment of the desired first miRNA precursor;

Preparing a fourth strand comprising 2-3 oligonucleotides, which is another fragment of the desired second miRNA precursor; And

One end of the first strand is connected to one end of the second strand or the fourth strand, and one end of the third strand is connected to one end of the fourth strand or the second strand It may include a step.

In the present invention, the first miRNA precursor and the second miRNA precursor are precursors of the desired miRNA, and the shape thereof is not particularly limited, but may be a hairpin shape. The nucleic acid molecules constituting this may have a length of 50 to 150 nt, preferably 60 to 100 nt, and more preferably 65 to 95 nt.

In the present invention, the first miRNA precursor and the second miRNA precursor may be the same or different.

In the present invention, each of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide is any fragment of the first miRNA precursor, and these sequences are completely different from each other, partially overlapping, or identical It is possible, and their sequence is not particularly limited.

However, in the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be any two fragments that are continuously disposed on the first miRNA precursor and can be cleaved by the action of a dicer.

Preferably, in the present invention, the 1-1 oligonucleotide may include a seed sequence or a full-length sequence of miRNA that performs a desired function by regulating the expression of a target gene in the human body.

In the present invention, each of the 2-1 oligonucleotide, 2-2 oligonucleotide, and 2-3 oligonucleotide is any fragment of the second miRNA precursor, and these sequences are completely different from each other, partially overlapped, It may be the same, and their sequence is not particularly limited.

However, in the present invention, the 2-1 oligonucleotide and the 2-2 oligonucleotide may be any two fragments that are continuously disposed on the second miRNA precursor and can be cleaved by the action of a dicer.

In the present invention, the 2-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.

In the present invention, the 1-1 oligonucleotide and the 2-1 oligonucleotide may be the same or different from each other.

In the present invention, the 1-2 oligonucleotide and the 2-2 oligonucleotide may be the same or different from each other.

In the present invention, the 1-3 oligonucleotide and the 2-3 oligonucleotide may be the same or different from each other.

Any one end of the 1-1 oligonucleotide in the first strand of the present invention can be connected to any one end of the 1-2 oligonucleotide, preferably 5'of the 1-2 oligonucleotide The terminal may be linked to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be linked to the 3'end of the 1-2 oligonucleotide.

Before linking any one end of the 1-2 oligonucleotide to any one end of the 1-1 oligonucleotide in the present invention, the first 1 oligonucleotide and the 1-2 oligonucleotide between the oligonucleotide. As a 1-1 linker, a 1-1 linker nucleotide or a 1-1 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In addition, in the second strand of the present invention, any one end of the 2-2 oligonucleotide may be connected to any one end of the 2-1 oligonucleotide, preferably the 2-1 oligonucleotide The 5'end can be linked to the 3'end of the 2-2 oligonucleotide, or the 5'end of the 2-2 oligonucleotide can be linked to the 3'end of the 2-1 oligonucleotide. .

Before connecting any one end of the 2-1 oligonucleotide to any one end of the 2-2 oligonucleotide in the present invention, the second between the 2-2 oligonucleotide and the 2-1 oligonucleotide. As a -1 linker, a 2-1 linker nucleotide or a 2-1 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

The third strand of the present invention may further include a first extended oligonucleotide.

In the present invention, the first extended oligonucleotide can be hybridized with the 1-1 oligonucleotide, and 90% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the 1-1 oligonucleotide. , 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology with a base sequence It can be synthesized and produced.

In addition, in the present invention, the first extended oligonucleotide may form a bubble structure including the first-1-1 oligonucleotide and one or more miss-matching nucleotides.

In the present invention, any one end of the first extended oligonucleotide in the third strand may be linked to any one end of the 1-3 oligonucleotide, preferably the 5'end of the first extended oligonucleotide. It may be linked to the 3'end of the 1-3 oligonucleotide, or the 5'end of the 1-3 oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.

Before linking any one end of the first extended oligonucleotide to any one end of the first-3 oligonucleotide in the present invention, a first-between the first-3 oligonucleotide and the first extended oligonucleotide is obtained. As a 2 linker, a 1-2 linker nucleotide or a 1-2 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, when the 1-1 linker and the 1-2 linker are included, they may be disposed to face each other in a double strand.

In addition, in the present invention, the 1-1 linker and the 1-2 linker may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.

In the present invention, the 1-2 oligonucleotide and the 1-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

The fourth strand of the present invention may further include a second extended oligonucleotide.

In the present invention, the second extended oligonucleotide may be hybridized with the 2-1 oligonucleotide, and 90% or more of the oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the 2-1 oligonucleotide. , 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology with a base sequence It can be synthesized and produced.

In addition, in the present invention, the second extended oligonucleotide may form a bubble structure by including the 2-1 oligonucleotide and one or more miss-matching nucleotides or miss-matching oligonucleotides.

In the present invention, any one end of the second extended oligonucleotide in the fourth strand may be connected to any one end of the second-3 oligonucleotide, preferably the 5'end of the second-3 oligonucleotide. Can be linked to the 3'end of the second extended oligonucleotide, or the 5'end of the second extended oligonucleotide to the 3'end of the 2-3 oligonucleotide.

Before linking one end of the second oligonucleotide to any one end of the second extended oligonucleotide in the present invention, a second between the second extended oligonucleotide and the second-3 oligonucleotide. As a -2 linker, a 2-2 linker nucleotide or a 2-2 linker oligonucleotide may be further included. In this case, the specific sequence is not particularly limited, and the nucleotide whose base is adenine (A) and uracil base ( uracil, U) nucleotide, guanine (G) base nucleotide, cytosine (cytosine, C) nucleotide, or a combination thereof.

In the present invention, when the 2-1 linker and the 2-2 linker are included, they may be disposed to face each other in a double strand.

In addition, in the present invention, the 2-1 linker and the 2-2 linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.

In the present invention, one end of the first strand may be connected to one end of the second strand or the fourth strand. Preferably, the 3'end of the first strand is connected to the 5'end of the second strand, or the 3'end of the first strand is connected to the 5'end of the fourth strand, or the second The 3'end of the strand may be connected to the 5'end of the first strand, or the 3'end of the fourth strand may be connected to the 5'end of the first strand.

In the present invention, one end of the third strand may be connected to one end of the fourth strand or the second strand. Preferably, the 3'end of the fourth strand is connected to the 5'end of the third strand, or the 3'end of the second strand is connected to the 5'end of the third strand, or the third The 3'end of the strand may be connected to the 5'end of the fourth strand, or the 3'end of the third strand may be connected to the 5'end of the second strand.

According to an embodiment of the present invention, as a method for preparing a double-stranded oligonucleotide,

1-1 oligonucleotides consisting of A s to B sequential nucleotide sequences from 5'end or 3'end of the first miRNA precursor of t nucleotides (nt) in length, and B+e th to B+f th Preparing a first strand comprising a 1-2 oligonucleotide consisting of a continuous base sequence;

2-1 oligonucleotides consisting of C-th to D-th consecutive nucleotide sequences from the 5'end or 3'end of the second nucleotide (nt) length of u nucleotides, and D+g th to D+h th contiguous Preparing a second strand comprising a 2-2 oligonucleotide consisting of a nucleotide sequence;

A third strand comprising a 1-3 oligonucleotide consisting of B+w th to B+x th consecutive sequences from the 5'end or the 3'end of the first miRNA precursor of t nucleotides (nt) in length Preparing;

A fourth strand comprising a 2-3 oligonucleotide consisting of D+y th to D+z th consecutive nucleotide sequences from the 5'end or 3'end of the second nucleotide (nt) length of the u nucleotides (nt). Preparing; And

One end of the first strand is connected to one end of the second strand or the fourth strand, and one end of the third strand is connected to one end of the fourth strand or the second strand It includes the steps of

The t and u are each independently an integer of 60 to 150,

A and C are each independently an integer of 1 to 10,

B and D are each independently an integer of 18 to 25,

E and g are each independently an integer of 1 to 5,

F and h are each independently an integer of 5 to 57,

W and y are each independently an integer of 6 to 62,

The x and z may be each independently an integer of 11 to 119.

In the present invention, the first miRNA precursor and the second miRNA precursor are precursors of a desired miRNA, and the shape thereof is not particularly limited, but may be a hairpin shape. The nucleic acid molecules constituting this may have a length of 50 to 150 nt, preferably 60 to 100 nt, and more preferably 65 to 95 nt.

In the present invention, the first miRNA precursor and the second miRNA precursor may be the same or different.

In the present invention, each of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide is any fragment of the first miRNA precursor, and these sequences are completely different from each other, partially overlapping, or identical It is possible, and their sequence is not particularly limited.

However, in the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be any two fragments that are continuously disposed on the first miRNA precursor and can be cleaved by the action of a dicer.

Preferably, in the present invention, the 1-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.

In the present invention, each of the 2-1 oligonucleotide, 2-2 oligonucleotide, and 2-3 oligonucleotide is any fragment of the second miRNA precursor, and these sequences are completely different from each other, partially overlapped, It may be the same, and their sequence is not particularly limited.

However, in the present invention, the 2-1 oligonucleotide and the 2-2 oligonucleotide may be any two fragments that are continuously disposed on the second miRNA precursor and can be cleaved by the action of a dicer.

In the present invention, the 2-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.

In the present invention, the 1-1 oligonucleotide and the 2-1 oligonucleotide may be the same or different from each other.

In the present invention, the 1-2 oligonucleotide and the 2-2 oligonucleotide may be the same or different from each other.

In the present invention, the 1-3 oligonucleotide and the 2-3 oligonucleotide may be the same or different from each other.

Any one end of the 1-1 oligonucleotide in the first strand of the present invention can be connected to any one end of the 1-2 oligonucleotide, preferably 5'of the 1-2 oligonucleotide The terminal may be linked to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be linked to the 3'end of the 1-2 oligonucleotide.

Before linking one end of the 1-2 oligonucleotide to one end of the 1-1 oligonucleotide in the present invention, between the 1-1 oligonucleotide and the 1-2 oligonucleotide. As the 1-1 linker, a 1-1 linker nucleotide or a 1-1 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In addition, one end of the 2-2 oligonucleotide in the second strand of the present invention can be connected to any one end of the 2-1 oligonucleotide, preferably of the 2-1 oligonucleotide The 5'end can be linked to the 3'end of the 2-2 oligonucleotide, or the 5'end of the 2-2 oligonucleotide can be linked to the 3'end of the 2-1 oligonucleotide. .

Before linking any one end of the 2-1 oligonucleotide to any one end of the 2-2 oligonucleotide in the present invention, the second 2 oligonucleotide and the 2-1 oligonucleotide between As a 2-1 linker, a 2-1 linker nucleotide or a 2-1 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, the first extension oligonucleotide may be further extended to any one end of the 1-3 oligonucleotide in the third strand.

In the present invention, the first extended oligonucleotide can be hybridized with the 1-1 oligonucleotide, and 90% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the 1-1 oligonucleotide. , 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology with a base sequence It can be synthesized and produced.

In the present invention, the first extended oligonucleotide may form a bubble structure by including the first-1-1 oligonucleotide and one or more miss-matching nucleotides.

In the third strand of the present invention, one end of the first extended oligonucleotide may be linked to any one end of the first-3 oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is It may be linked to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.

Before linking any one end of the first extended oligonucleotide to any one end of the 1-3 oligonucleotide in the present invention, a first between the first-3 oligonucleotide and the first extended oligonucleotide. As a -2 linker, a 1-2 linker nucleotide or a 1-2 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, when the 1-1 linker and the 1-2 linker are included, they may be disposed to face each other in a double strand.

In addition, in the present invention, the 1-1 linker and the 1-2 linker may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.

In the present invention, the 1-2 oligonucleotide and the 1-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, a second extended oligonucleotide may be further extended to one end of the 2-3 extended oligonucleotide in the fourth strand.

In the present invention, the second extended oligonucleotide may be hybridized with the 2-1 oligonucleotide, and 90% or more of the oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the 1-1 oligonucleotide. , 91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology sequence It can be synthesized and produced.

In the present invention, the second extended oligonucleotide may form a bubble structure by including the 2-1 oligonucleotide and one or more mismatching nucleotides.

In the present invention, any one end of the second-3 oligonucleotide in the fourth strand may be linked to any one end of the second extended oligonucleotide, preferably the 5'end of the second-3 oligonucleotide. Can be linked to the 3'end of the second extended oligonucleotide, or the 5'end of the second extended oligonucleotide to the 3'end of the 2-3 oligonucleotide.

Before linking one end of the second oligonucleotide to any one end of the second extended oligonucleotide in the present invention, a second between the second extended oligonucleotide and the second-3 oligonucleotide. As a -2 linker, a 2-2 linker nucleotide or a 2-2 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.

In the present invention, when the 2-1 linker and the 2-2 linker are included, they may be disposed to face each other in a double strand.

In addition, in the present invention, the 2-1 linker and the 2-2 linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.

In the present invention, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.

In the present invention, one end of the first strand may be connected to one end of the second strand or the fourth strand. Preferably, the 3'end of the first strand is connected to the 5'end of the second strand, or the 3'end of the first strand is connected to the 5'end of the fourth strand, or the second The 3'end of the strand may be connected to the 5'end of the first strand, or the 3'end of the fourth strand may be connected to the 5'end of the first strand.

In the present invention, one end of the third strand may be connected to one end of the fourth strand or the second strand. Preferably, the 3'end of the fourth strand is connected to the 5'end of the third strand, or the 3'end of the second strand is connected to the 5'end of the third strand, or the third The 3'end of the strand may be connected to the 5'end of the fourth strand, or the 3'end of the third strand may be connected to the 5'end of the second strand.

However, in the production method of the present invention, the order of synthesizing each oligonucleotide and the order of linking each synthesized oligonucleotide is not particularly limited.

The double-stranded oligonucleotide provided by the present invention regulates the expression of the target gene to simultaneously contain two strands of miRNA functioning as a desired function, its precursor, or a fragment thereof, so that they can maintain a stable double-stranded form, respectively. It is possible to significantly increase the efficiency of delivery to the target site and to give a synergistic effect to the expression of its function than when treated with the miRNA alone.

1 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
Figure 2 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
Figure 3 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
Figure 4 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
5 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
Figure 6 shows the structure of the double-stranded oligonucleotide according to an embodiment of the present invention.
7 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
8 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
9 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
10 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
11 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
12 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
13 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
14 illustrates the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
15 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
16 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
17 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
18 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in a hairpin-shaped first miRNA precursor.
19 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
20 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
21 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
22 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
23 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in a hairpin-shaped first miRNA precursor.
24 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
25 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
26 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
27 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
28 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
29 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
30 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
31 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
32 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
In FIGS. 28 to 32, PSI-502 may correspond to hsa-miR-6514-5p miRNA, and PSI-503 may correspond to hsa-miR-503-3p miRNA.
33 is a graph showing the results of measuring the change in cell viability of cancer cells after treating a double-stranded oligonucleotide according to the present invention to SK-MEL28 cancer cells in one embodiment of the present invention.
34 is a graph showing the results of measuring the change in the number of colonies after treating a double-stranded oligonucleotide according to the present invention to SK-MEL28 cancer stem cells in one embodiment of the present invention.
35 is a graph showing the results of analyzing the cell invasion capacity of the cancer stem cells after treating the double-stranded oligonucleotide according to the present invention with SK-MEL28 cancer stem cells in one embodiment of the present invention.
FIG. 36 shows the expression level of Nanog, a gene related to the stem function of the cancer stem cell, after treating the double-stranded oligonucleotide according to the present invention with SK-MEL28 cancer stem cells in one embodiment of the present invention. It shows the result of analyzing the change in a graph.
FIG. 37 analyzes the change in the expression level of TYRP1, a gene whose expression is inhibited in the cancer stem cell, after treating a double-stranded oligonucleotide according to the present invention to a SK-MEL28 cancer stem cell in one embodiment of the present invention. One result is graphed.
38 is a concentration of GI ₅₀ that can induce the death of 50% of cancer cells after treatment of SK-MEL28 cancer cells with a double-stranded oligonucleotide according to the present invention in one embodiment of the present invention. The results are graphed.
FIG. 39 shows a concentration (GI ₅₀ ) capable of inducing the death of 50% of cancer cells after treatment with a double-stranded oligonucleotide according to the present invention in Malme-3m cancer cells in one embodiment of the present invention. The results are graphed.
FIG. 40 shows the result of measuring the concentration (GI ₅₀ ) that can induce death of 50% of cancer cells after treating a double-stranded oligonucleotide according to the present invention to A549 cancer cells in one embodiment of the present invention. It is shown graphically.
41 is a concentration of GI ₅₀ that can induce the death of 50% of cancer cells after treating the double-stranded oligonucleotide according to the present invention to NCI-H460 cancer cells in one embodiment of the present invention. The results are graphed.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

[Preparation Example 1] Preparation of desired miRNA precursor

Hsa-miR-6514-5p miRNA and hsa-miR-503-3p miRNA composed of the nucleotide sequences shown in Table 1 below and precursors thereof were prepared.

miRNA type Sequence hsa-miR-6514-5p miRNA uauggaguggacuuucagcuggc (SEQ ID NO: 3)
hsa-miR-503-3p miRNA gggguauuguuuccgcugccagg (SEQ ID NO: 4) hsa-miR-6514-5p miRNA precursor uauggaguggacuuucagcuggcauuuacgagucagaguucuuacagagcugccuguucuuccacuccag (SEQ ID NO: 35) hsa-miR-503-3p miRNA precursor ugcccuagcagcgggaacaguucugcagugagcgaucggugcucugggguauuguuuccgcugccagggua (SEQ ID NO: 36)

[Example 1] Preparation of double-stranded oligonucleotide (PSI-50B-2.3)

The double-stranded oligonucleotide shown in FIG. 28 was prepared. More specifically, first, hsa-miR-6514-5p miRNA represented by SEQ ID NO: 3 and hsa-miR-503-3p miRNA represented by SEQ ID NO: 4 were prepared as a first oligonucleotide and a second oligonucleotide, respectively. Then, from the 3'end of the first oligonucleotide, the first extended oligonucleotide represented by SEQ ID NO: 5 complementary to the 3'-5' direction of the hsa-miR-503-3p miRNA is synthesized and linked. Did. In addition, from the 3'end of the second oligonucleotide, a second extended oligonucleotide represented by SEQ ID NO: 6 complementary to the 3'-5' nucleotide sequence of the hsa-miR-6514-5p miRNA is synthesized and linked. Did. The first strand of the double-stranded oligonucleotide thus synthesized is represented by SEQ ID NO: 1, and the second strand is represented by SEQ ID NO: 2 (Table 2).

miRNA type Sequence 1st strand uauggaguggacuuucagcuggcccuggcagcggaaacaauacccc (SEQ ID NO: 1) 2nd strand gggguauuguuuccgcugccagggccagcugaaaguccacuccaua (SEQ ID NO: 2)

[Example 2] Preparation of double-stranded oligonucleotide (PSI-50A-2.3)

The double-stranded oligonucleotide shown in FIG. 29 was prepared. More specifically, a first oligonucleotide corresponding to a miRNA fragment consisting of a 1 to 11 nucleotide sequence (SEQ ID NO: 9) from the 5'end of the hsa-miR-6514-5p miRNA is prepared, and hsa-miR-503 From the 5'end of -3p miRNA, a second oligonucleotide corresponding to a miRNA fragment consisting of a 1-12th nucleotide sequence (SEQ ID NO: 10) was prepared. Thereafter, the first extended oligonucleotide represented by SEQ ID NO: 11 complementary to the base sequence in the 3'-5' direction of the second oligonucleotide at the 3'end of the first oligonucleotide was synthesized and extended. In addition, at the 3'end of the second oligonucleotide, a second extended oligonucleotide represented by SEQ ID NO: 12 complementary to the base sequence in the 3'-5' direction of the first oligonucleotide was synthesized and extended. The first strand of the double-stranded oligonucleotide thus synthesized is represented by SEQ ID NO: 7, and the second strand is represented by SEQ ID NO: 8 (Table 3).

miRNA type Sequence 1st strand uauggaguggaaaacaauacccc (SEQ ID NO: 7) 2nd strand gggguauuguuuuccacuccaua (SEQ ID NO: 8)

[Example 3] Preparation of double-stranded oligonucleotide (PSI-50C-2.3)

The double-stranded oligonucleotide shown in FIG. 30 was prepared. More specifically, a first oligonucleotide represented by SEQ ID NO: 15, which is a miRNA fragment consisting of 2 to 11 nucleotide sequences from the 5'end of the hsa-miR-6514-5p miRNA, is prepared, and a first at the 5'end thereof The nucleotide whose base is uracil was further extended with the cap nucleotide. In addition, a second oligonucleotide represented by SEQ ID NO: 16, which is a miRNA fragment consisting of 2 to 12 nucleotide sequences from the 5'end of the hsa-miR-503-3p miRNA, is prepared, and a 5 nd end is used as a second cap nucleotide. The nucleotide whose base is uracil was further extended. In addition, at the 3'end of the first oligonucleotide, the first extension nucleotide represented by SEQ ID NO: 17 complementary to the base sequence in the 3'-5' direction of the second oligonucleotide is synthesized and extended, and the first extension At the 3'end of the nucleotide, a nucleotide whose base is adenine complementary to the second cap nucleotide was further extended to the first end nucleotide. In addition, after synthesizing and extending the second extended oligonucleotide represented by SEQ ID NO: 18 complementary to the 3'-5' nucleotide sequence of the first oligonucleotide at the 3'end of the second oligonucleotide, A nucleotide whose base is adenine complementary to the first cap nucleotide was further extended to the 3'end of the second extension oligonucleotide. The first strand of the double-stranded oligonucleotide thus synthesized is represented by SEQ ID NO: 13, and the second strand is represented by SEQ ID NO: 14 (Table 4).

miRNA type Sequence 1st strand uauggaguggaaaacaauaccca (SEQ ID NO: 13) 2nd strand uggguauuguuuuccacuccaua (SEQ ID NO: 14)

[Example 4] Preparation of double-stranded oligonucleotide (PSI-50D-2.3)

The double-stranded oligonucleotide shown in FIG. 31 was prepared. More specifically, a first oligonucleotide represented by SEQ ID NO: 21, which is a miRNA fragment consisting of 2 to 11 nucleotide sequences from the 5'end of the hsa-miR-6514-5p miRNA, is prepared, and a first at the 5'end thereof The nucleotide whose base is uracil was further extended with the cap nucleotide. In addition, a second oligonucleotide represented by SEQ ID NO: 22, which is a miRNA fragment consisting of a 2-11th nucleotide sequence from the 5'end of the hsa-miR-503-3p miRNA, is prepared, and a 5 nd end is used as a second cap nucleotide. The nucleotide whose base is uracil was further extended. Thereafter, a 12th nucleotide from the 5'end of the hsa-miR-6514-5p miRNA at the 3'end of the first oligonucleotide was additionally extended as a first linker nucleotide, followed by the first linker nucleotide followed by the second oligo The first extended oligonucleotide represented by SEQ ID NO: 23 complementary to the 1st to 9th base sequences in the 3'-5' direction of the nucleotide was synthesized and extended. At the 3'end of the first extended oligonucleotide, a continuous oligonucleotide of 22 to 23rd from the 5'end of the hsa-miR-6514-5p miRNA (1 to 2nd from the 3'end) is a first end oligonucleotide. Further extended. In addition, a 12th nucleotide from the 5'end of the hsa-miR-503-3p miRNA at the 3'end of the second oligonucleotide was additionally extended as a second linker nucleotide, followed by the second linker nucleotide followed by the first oligonucleotide. The second extended oligonucleotide represented by SEQ ID NO: 24 complementary to the 1st to 9th base sequences in the 3'-5' direction was synthesized and extended. At the 3'end of the second extended oligonucleotide, 22 to 23 rd consecutive oligonucleotide from the 5'end of the hsa-miR-503-3p miRNA (1 to 2nd from the 3'end) is a second end oligonucleotide. Further extended. The first strand of the double-stranded oligonucleotide thus synthesized is represented by SEQ ID NO: 19, and the second strand is represented by SEQ ID NO: 20 (Table 5).

miRNA type Sequence 1st strand uauggaguggacaacaauaccgc (SEQ ID NO: 19) 2nd strand uggguauuguuuuccacuccagg (SEQ ID NO: 20)

[Example 5] Preparation of double-stranded oligonucleotide (PSI-50E-2.3)

The double-stranded oligonucleotide shown in FIG. 32 was prepared. More specifically, the 1-1 oligonucleotide consisting of the 1 to 23 nucleotide sequence (SEQ ID NO: 27) from the 5'end of the hsa-miR-6514-5p miRNA precursor, and the 24 to 34 nucleotide sequence (SEQ ID NO: A 1-2 oligonucleotide consisting of No. 28) was prepared, and the 5'end of the 1-2 oligonucleotide was connected to the 3'end of the 1-1 oligonucleotide. The 1-1 oligonucleotide may be separated from the hsa-miR-6514-5p miRNA precursor by a dicer functional group. In addition, from the 3'end of the hsa-miR-503-3p miRNA precursor to the 2-1 oligonucleotide consisting of 4 to 26 nucleotide sequence (SEQ ID NO: 30), and 27 to 33 nucleotide sequence (SEQ ID NO: 31) After the prepared 2-2 oligonucleotide was prepared, the 5'end of the 2-1 oligonucleotide was connected to the 3'end of the 2-2 oligonucleotide. Here, the 2-1 oligonucleotide can also be separated from the hsa-miR-503-3p miRNA precursor by a dicer functional group. Then, a 1-3 oligonucleotide consisting of the 38th to 48th consecutive base sequences (SEQ ID NO: 29) from the 5'end of the hsa-miR-6514-5p miRNA precursor was prepared, and the hsa-miR-503- From the 3'end of the 3p miRNA precursor, 2-3 oligonucleotides consisting of 37 to 45 consecutive sequences (SEQ ID NO: 32) were prepared. Subsequently, the first extension oligonucleotide represented by SEQ ID NO: 33 complementary to the base sequence in the 3'-5' direction of the 1-1 oligonucleotide is additionally synthesized at the 3'end of the 1-3 oligonucleotide. Did. In addition, at the 5'end of the 2-3 oligonucleotide, a second extension oligonucleotide represented by SEQ ID NO: 34 complementary to the base sequence in the 3'-5' direction of the 2-1 oligonucleotide is further extended and synthesized. Did. Then, the 5'end of the 2-2 oligonucleotide is connected to the 3'end of the 1-2 oligonucleotide to synthesize a single-stranded oligonucleotide represented by SEQ ID NO: 25, and the 2-3 oligonucleotide The 5'end of the 1-3 oligonucleotide was connected to the 3'end to synthesize a single-stranded oligonucleotide represented by SEQ ID NO: 26 (Table 6). The oligonucleotide represented by SEQ ID NO: 25 and the oligonucleotide represented by SEQ ID NO: 26 may be hybridized with each other to form a double strand.

miRNA type Sequence 1st strand + 2nd strand uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg
(SEQ ID NO: 25) 3rd strand + 4th strand ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua
(SEQ ID NO: 26)

[Preparation Example 1] Preparation of cancer cells and cancer stem cells

SK-MEL28, MALME-3M, A549, and NCI-H460 cancer cell lines were purchased from ATCC and cultured. The SK-MEL28 cancer cell line was cultured in DMEM/F12 medium containing B27 supplement and growth factors (FGF and EGF 20 ng/mL) to induce cancer stem cells. Only cells expressing the cancer stem cell marker CD44+ were selected and cultured for about 2 weeks.

[Experimental Example 1] Evaluation of survival rate of cancer cells and cancer stem cells

Cells after introducing 5 double-stranded oligonucleotides prepared in Examples 1 to 5 to the SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 1 using lipofectamine for 9 days The change in survival rate is compared and shown in FIG. 33.

As shown in FIG. 33, it was confirmed that when cancer cells and cancer stem cells were treated with oligoribonucleotides according to the present invention, the survival rate of the cancer cells and cancer stem cells was significantly reduced.

Through this, it can be seen that the double-stranded oligonucleotide according to the present invention has an effect of inhibiting proliferation and apoptosis of cancer cells and cancer stem cells.

[Experimental Example 2] Evaluation of cancer stem cell proliferation inhibition

In the same manner as in Experimental Example 1, after introducing the 5 double-stranded oligonucleotides of Examples 1 to 5 into each of the SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 1, the number of colonies was changed. It is shown in Figure 34 for comparison.

As shown in FIG. 34, when the oligoribonucleotides according to the present invention were treated to cancer cells and cancer stem cells, it was confirmed that the number of colonies of the cancer cells and cancer stem cells was significantly reduced.

Through this, it can be seen that the double-stranded oligonucleotide according to the present invention has an excellent effect of inhibiting proliferation and inducing death of cancer cells and cancer stem cells.

[Experimental Example 3] Evaluation of cancer stem cell metastasis inhibition

In the same manner as in Experimental Example 1, after introducing the 5 double-stranded oligoribonucleotides obtained in Examples 1 to 5 into the SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 1, changes in cell infiltration ability It is shown in Figure 35 by comparing

As shown in FIG. 35, it was confirmed that when cancer cells and cancer stem cells were treated with oligoribonucleotides according to the present invention, the cell invasion capacity of cancer stem cells was significantly reduced.

Through this, it can be seen that the double-stranded oligonucleotide according to the present invention can effectively suppress the cell invasion ability of cancer cells and cancer stem cells.

[Experimental Example 4] Evaluation of induction of differentiation of cancer stem cells

In the same manner as in Experimental Example 1, after introducing the 5 oligoribonucleotides of Examples 1 to 5 into each of the SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 1, cancer stem cells into which oligoribonucleotides were introduced After harvesting (harvesting) to isolate RNA, synthesized cDNA and quantified by quantifying the real-time amplifying cycle of Nanog and TYRP1 genes through qPCR technique using the primers shown in Table 7. The results are shown in Figs. 36 and 37.

Primer name Primer sequence Nanog Forward CCCCAGCCTTTACTCTTCCTA Reverse CCAGGTTGAATTGTTCCAGGTC TYRP1 Forward TGGCCAAGTCGGGAGTTTAG
Reverse CATACTGCGTCTGGCACGAA
GAPDH Forward AATCCCATCACCATCTTCCA Reverse TGGACTCCACGACGTACTCA

As shown in FIG. 36, it was confirmed that the level of expression of Nanog, a gene related to stemness, was significantly reduced when SK-MEL28 cancer stem cells were treated with the oligonucleotide according to the present invention.

On the other hand, as shown in Figure 37, it can be seen that the expression level of TYRP1 whose expression is suppressed in cancer stem cells is increased.

Through this, it can be seen that the double-stranded oligonucleotide according to the present invention has an effect of losing the stem cell function of cancer stem cells.

[Experimental Example 5] Evaluation of cancer cell proliferation inhibition

The concentrations of five double-stranded oligonucleotides of Examples 1 to 5 were concentrated on each of SK-MEL28, Malme-3m, A549, and NCI-H460 cancer cells prepared in Preparation Example 1 using lipofectamine. After introducing into stars (0.01, 1, 10, 100, 1000, 10000 nM), changes in cell viability were measured and the results are shown in FIGS. 38 to 41, respectively.

38 to 41, it was confirmed that when the cancer cells were treated with the oligoribonucleotides according to the present invention, the cancer cells were killed at a concentration of about 50%.

Through this, it can be seen that the double-stranded oligonucleotide according to the present invention has an excellent effect of inhibiting proliferation of cancer cells and inducing death.

10: first oligonucleotide
11: second oligonucleotide
20: first extended oligonucleotide
21: second extended oligonucleotide
50a: 1-1 oligonucleotide
50b: 1-2 oligonucleotide
50c: 1-3 oligonucleotide
60a: 2-1 oligonucleotide
60b: 2-2 oligonucleotide
60c: 2-3 oligonucleotide
70: first extended oligonucleotide
71: second extended oligonucleotide
100: first cap nucleotide or first cap oligonucleotide
100': second cap nucleotide or second cap oligonucleotide
200: first terminal nucleotide or first terminal oligonucleotide
200': second terminal nucleotide or second terminal oligonucleotide
300: first linker
300': second linker
[Sequence list]
SEQ ID NO: 1st strand
5'-uauggaguggacuuucagcuggcccuggcagcggaaacaauacccc-3'
SEQ ID NO: 2nd strand
5'-gggguauuguuuccgcugccagggccagcugaaaguccacuccaua-3'
SEQ ID NO: 3: first oligonucleotide
5'-uauggaguggacuuucagcuggc-3'
SEQ ID NO: 2nd oligonucleotide
5'-gggguauuguuuccgcugccagg-3'
SEQ ID NO: 5 First extended oligonucleotide
5'-ccuggcagcggaaacaauacccc-3'
SEQ ID NO: 6: second extended oligonucleotide
5'-gccagcugaaaguccacuccaua-3'
SEQ ID NO: 7 first strand
5'-uauggaguggaaaacaauacccc-3'
SEQ ID NO: 8: second strand
5'-gggguauuguuuuccacuccaua-3'
SEQ ID NO: 9 first oligonucleotide
5'-uauggagugga-3'
SEQ ID NO: 10: Second oligonucleotide
5'-gggguauuguuu-3'
SEQ ID NO: 11: first extended oligonucleotide
5'-aaacaauacccc-3'
SEQ ID NO: 12 Second extended oligonucleotide
5'-uccacuccaua-3'
SEQ ID NO: 13 First strand
5'-uauggaguggaaaacaauaccca-3'
SEQ ID NO: 14 Second strand
5'-uggguauuguuuuccacuccaua-3'
SEQ ID NO: 15 First oligonucleotide
5'-auggagugga-3'
SEQ ID NO: 16: Second oligonucleotide
5'-ggguauuguuu-3'
SEQ ID NO: 17 First extended oligonucleotide
5'-aaacaauaccc-3'
SEQ ID NO: 18 second extended oligonucleotide
5'-uccacuccau-3'
SEQ ID NO: 19 First strand
5'-uauggaguggacaacaauaccgc-3'
SEQ ID NO: 20 Second strand
5'-uggguauuguuuuccacuccagg-3'
SEQ ID NO: 21 First oligonucleotide
5'-auggagugga-3'
SEQ ID NO: 22 Second oligonucleotide
5'-ggguauuguu-3'
SEQ ID NO: 23 First extended oligonucleotide
5'-aacaauacc-3'
SEQ ID NO: 24 Second extended oligonucleotide
5'-uccacucca-3'
SEQ ID NO: 25
5'-uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg-3'
SEQ.ID No. 26
5'-ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua-3'
SEQ ID NO: 27-1-1 oligonucleotide
5'-uauggaguggacuuucagcuggc-3'
SEQ ID NO: 28 1-2 oligonucleotide
5'-auuuacgaguc-3'
SEQ ID NO: 29 1-3 Oligonucleotide
5'-guucuuacaga-3'
SEQ ID NO: 30-2-1 oligonucleotide
5'-gggguauuguuuccgcugccagg-3'
SEQ ID NO: 31 2-2 oligonucleotide
5'-gugcucu-3'
SEQ ID NO: 32 2-3 oligonucleotide
5'-agugagcga-3'
SEQ ID NO: 33 First extended oligonucleotide
5'-gccagcugaaaguccacuccaua-3'
SEQ ID NO: 34: Second extended oligonucleotide
5'-ccuggcagcggaaacaauacccc-3'
SEQ ID NO: 35: hsa-miR-6514-5p miRNA precursor
5'-uauggaguggacuuucagcuggcauuuacgagucagaguucuuacagagcugccuguucuuccacuccag-3'
SEQ ID NO: 36 hsa-miR-6514-5p miRNA precursor
5'-ugcccuagcagcgggaacaguucugcagugagcgaucggugcucugggguauuguuuccgcugccagggua-3'

<110> PROSTEMICS CO., LTD. <120> miRNA polymer and the method for preparing the same <130> DPB174159.k01 <150> KR 10-2017-0159668 <151> 2017-11-27 <160> 36 <170> KoPatentIn 3.0 <210> 1 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 1 uauggagugg acuuucagcu ggcccuggca gcggaaacaa uacccc 46 <210> 2 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 2 gggguauugu uuccgcugcc agggccagcu gaaaguccac uccaua 46 <210> 3 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 3 uauggagugg acuuucagcu ggc 23 <210> 4 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 4 gggguauugu uuccgcugcc agg 23 <210> 5 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 5 ccuggcagcg gaaacaauac ccc 23 <210> 6 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 6 gccagcugaa aguccacucc aua 23 <210> 7 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 7 uauggagugg aaaacaauac ccc 23 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 8 gggguauugu uuuccacucc aua 23 <210> 9 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 9 uauggagugg a 11 <210> 10 <211> 12 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 10 gggguauugu uu 12 <210> 11 <211> 12 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 11 aaacaauacc cc 12 <210> 12 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 12 uccacuccau a 11 <210> 13 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 13 uauggagugg aaaacaauac cca 23 <210> 14 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 14 uggguauugu uuuccacucc aua 23 <210> 15 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 15 auggagugga 10 <210> 16 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 16 ggguauuguu u 11 <210> 17 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 17 aaacaauacc c 11 <210> 18 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 18 uccacuccau 10 <210> 19 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 19 uauggagugg acaacaauac cgc 23 <210> 20 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 20 uggguauugu uuuccacucc agg 23 <210> 21 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 21 auggagugga 10 <210> 22 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 22 ggguauuguu 10 <210> 23 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 23 aacaauacc 9 <210> 24 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 24 uccacucca 9 <210> 25 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 25 uauggagugg acuuucagcu ggcauuuacg agucgugcuc ugggguauug uuuccgcugc 60 cagg 64 <210> 26 <211> 66 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 26 ccuggcagcg gaaacaauac cccagugagc gaguucuuac agagccagcu gaaaguccac 60 uccaua 66 <210> 27 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 27 uauggagugg acuuucagcu ggc 23 <210> 28 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 28 auuuacgagu c 11 <210> 29 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 29 guucuuacag a 11 <210> 30 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 30 gggguauugu uuccgcugcc agg 23 <210> 31 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 31 gugcucu 7 <210> 32 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 32 agugagcga 9 <210> 33 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 33 gccagcugaa aguccacucc aua 23 <210> 34 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 34 ccuggcagcg gaaacaauac ccc 23 <210> 35 <211> 70 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 35 uauggagugg acuuucagcu ggcauuuacg agucagaguu cuuacagagc ugccuguucu 60 uccacuccag 70 <210> 36 <211> 71 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 36 ugcccuagca gcgggaacag uucugcagug agcgaucggu gcucuggggu auuguuuccg 60 cugccagggu a 71

Claims (41)

As a double-stranded oligonucleotide,
A first strand comprising a desired first oligonucleotide and a first extended oligonucleotide; And
And a second strand comprising a desired second oligonucleotide and a second extended oligonucleotide.
The first extended oligonucleotide may be hybridized with the second oligonucleotide,
The second extended oligonucleotide, in the double-stranded oligonucleotide capable of hybridizing with the first oligonucleotide,
The double-stranded oligonucleotide,
The first oligonucleotide is represented by SEQ ID NO: 3, the second oligonucleotide is represented by SEQ ID NO: 4;
The first oligonucleotide is represented by SEQ ID NO: 9, the second oligonucleotide is represented by SEQ ID NO: 10;
The first oligonucleotide is represented by SEQ ID NO: 15, the second oligonucleotide is represented by SEQ ID NO: 16; or
The first oligonucleotide is represented by SEQ ID NO: 21, and the second oligonucleotide is an oligonucleotide represented by SEQ ID NO: 22; a double-stranded oligonucleotide. According to claim 1,
The oligonucleotide is a DNA, RNA or DNA/RNA hybrid molecule, double-stranded oligonucleotide. delete According to claim 1,
The first oligonucleotide or the second oligonucleotide includes a mature miRNA, a miRNA precursor, a primary miRNA (pri-miRNA), an entire chain of miRNA precursors in a plasmid form, or fragments thereof Phosphorus, double stranded oligonucleotide. According to claim 1,
The first oligonucleotide and the second oligonucleotide are the same or different from each other, double-stranded oligonucleotide. According to claim 1,
The length of the first oligonucleotide or the second oligonucleotide is 18-25 nt, double-stranded oligonucleotide. According to claim 1,
The length of the first oligonucleotide or the second oligonucleotide is 9 to 11 nt, a double-stranded oligonucleotide. The oligonucleotide of claim 1, further comprising a cap nucleotide at the end of the first or second strand. The double-stranded oligonucleotide of claim 1, further comprising a nucleotide at the end of the desired first or second oligonucleotide. delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete

Images