KR102138495B1 - miRNA polymer and the method for preparing the same - Google Patents
miRNA polymer and the method for preparing the same Download PDFInfo
- Publication number
- KR102138495B1 KR102138495B1 KR1020180148846A KR20180148846A KR102138495B1 KR 102138495 B1 KR102138495 B1 KR 102138495B1 KR 1020180148846 A KR1020180148846 A KR 1020180148846A KR 20180148846 A KR20180148846 A KR 20180148846A KR 102138495 B1 KR102138495 B1 KR 102138495B1
- Authority
- KR
- South Korea
- Prior art keywords
- oligonucleotide
- nucleotide
- present
- strand
- extended
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering N.A.
- C12N2310/141—MicroRNAs, miRNAs
Abstract
본 발명은 다양한 용도로 사용될 수 있는 miRNA 중합체와 그 제조 방법을 제공하는 것으로, 보다 상세하게는 이중 가닥의 올리고뉴클레오티드로서, 목적하는 제1 올리고뉴클레오티드 및 제1 연장 올리고뉴클레오티드를 포함하는 제1 가닥; 및 목적하는 제2 올리고뉴클레오티드 및 제2 연장 올리고뉴클레오티드를 포함하는 제2 가닥;을 포함하며, 상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 혼성화될 수 있고, 상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 혼성화될 수 있는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다. The present invention provides a miRNA polymer that can be used for various purposes and a method for producing the same, and more particularly, as a double-stranded oligonucleotide, a first strand comprising a desired first oligonucleotide and a first extended oligonucleotide; And a second strand comprising a desired second oligonucleotide and a second extended oligonucleotide, wherein the first extended oligonucleotide can be hybridized with the second oligonucleotide, and the second extended oligonucleotide is It relates to a double-stranded oligonucleotide capable of hybridizing with the first oligonucleotide.
Description
본 발명은 다양한 용도로 사용될 수 있는 이중 가닥의 올리고뉴클레오티드와, 그 제조 방법에 관한 것이다. The present invention relates to a double-stranded oligonucleotide that can be used for various purposes, and a method for manufacturing the same.
마이크로 RNA(micro RNA; miRNA)는 18-25 뉴클레오티드(nucleotide, nt)로 구성된 작은 비-암호화 RNA로서, 표적 유전자의 3'-비번역 부위(untranslated region, UTR)에 결합하여 유전자 발현을 조절하고(Bartel DP, et al., Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), 인트론(intron), 엑손(exon) 또는 유전자 간 부위(intergenic region)로부터 공정된다(Rodriguez A, et al., Genome Res14: 1902-1910, 2004). 첫째로, miRNA는 수천 개의 뉴클레오티드를 포함하는 초기 miRNA(pri-miRNA) 분자 내로 RNA 폴리머라아제 에 의해 전사된다. 그런 다음, pri-miRNA는 miRNA 전구체로 알려진 대략 70 nt 줄기 고리 중간체를 형성하기 위해 마이크로프로세서[DroshaRNase 엔도뉴클레아제 및 디조지증후군 부위 유전자 8 단백질(DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8)]에 의해 연속적으로 공정된다(Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci U S A100: 9779-9784, 2003). 그런 다음, pre-miRNA는 엑소폴틴-5(Exportin-5, EXP5)와 공동인자 Ran-GTP를 통해 핵으로부터 세포질로 이동되고, 여기서 pre-miRNA는 RNase 엔도뉴클레아제 다이서에 의해 18-25 nt 성숙 miRNA 듀플렉스(duplexe)로 공정된다(Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev28: 369-378, 2009). 성숙 miRNA 듀플렉스는 RNA-유도 침묵 복합체(RNA-induced silencing complex, RISC) 내로 아르고노트(Argonaute) 단백질과 단일 가닥 RNA로서 통합되고, 이는 표적 mRNA의 절단 또는 번역 억제 중 어느 하나를 유도한다(Diederichs S, et al., Cell131: 1097-1108, 2007; Hammond SM, et al., Nature404: 293-296, 2000; Martinez et al., Cell 110: 563-574, 2002).Micro RNA (micro RNA; miRNA) is a small non-coding RNA composed of 18-25 nucleotides (nucleotide, nt), which binds to the 3'-untranslated region (UTR) of the target gene and regulates gene expression. (Bartel DP, et al., Cell 116: 281-297, 2004; Lewis BP, et al., Cell 120: 15-20, 2005), intron, exon or intergenic region ) (Rodriguez A, et al., Genome Res 14: 1902-1910, 2004). First, miRNA is transcribed by RNA polymerase into an initial miRNA (pri-miRNA) molecule containing thousands of nucleotides. Then, the pri-miRNA is a microprocessor (DroshaRNase endonuclease and DiGeorge syndrome region gene 8 protein, DGCR8) to form a roughly 70 nt stem ring intermediate known as a miRNA precursor. ] (Lee Y, et al., EMBO J21: 4663-4670, 2000; Zeng Y, et al., Proc Natl Acad Sci US A100: 9779-9784, 2003). Then, the pre-miRNA is transferred from the nucleus to the cytoplasm through the cofactors Ran-GTP with Exopoltin-5 (EXPORTin-5, EXP5), where the pre-miRNA is 18-25 by RNase endonuclease dicer. nt mature miRNA duplex (Lee Y, et al., EMBO J23: 4051-4060, 2004; Shenouda SK, et al., Cancer Metastasis Rev28: 369-378, 2009). The mature miRNA duplex is integrated into the RNA-induced silencing complex (RISC) as a single-stranded RNA with Argonaute protein, which induces either cleavage or translational inhibition of the target mRNA (Diederichs S, et al., Cell 131: 1097-1108, 2007; Hammond SM, et al., Nature 404: 293-296, 2000; Martinez et al., Cell 110: 563-574, 2002).
본 발명은 다양한 용도로 사용될 수 있는 이중 가닥의 올리고뉴클레오티드와 그 제조 방법을 제공하는 것이다. The present invention provides a double-stranded oligonucleotide that can be used for various purposes and a method for manufacturing the same.
본 발명은 다양한 용도로 사용될 수 있는 이중 가닥의 올리고뉴클레오티드와 그 제조 방법을 제공하는 것이다. The present invention provides a double-stranded oligonucleotide that can be used for various purposes and a method for manufacturing the same.
본 명세서에서 용어 "혼성화(hybridization)"란 2개의 단일 가닥 핵산이 상보적인 염기 서열들의 페어링(pairing)에 의하여 이합체 구조(duplex structure)를 형성하는 것을 의미한다. 혼성화는 단일 가닥의 핵산 서열 간의 상보성이 완전할 경우(perfect match) 일어나거나 일부 미스매치(mismatch) 염기가 존재하여도 일어날 수 있다.The term "hybridization" as used herein means that two single-stranded nucleic acids form a duplex structure by pairing complementary base sequences. Hybridization can occur when the complementarity between single-stranded nucleic acid sequences is a perfect match or even if some mismatch bases are present.
본 명세서에서 용어 "상보적"이라 함은 올리고뉴클레오타이드의 양 가닥이 염기쌍을 형성할 수 있음을 의미한다. 상보적 올리고뉴클레오타이드의 양 가닥은 왓슨-크릭 방식으로 염기쌍을 형성하여 이중 가닥을 형성한다. 본 발명에서 염기 U가 언급되는 경우, 별다른 언급이 없는 한 염기 T로 치환가능하다.The term "complementary" as used herein means that both strands of an oligonucleotide can form a base pair. Both strands of complementary oligonucleotides form base pairs in a Watson-Crick fashion to form double strands. In the present invention, when the base U is mentioned, it can be substituted with the base T unless otherwise specified.
본 발명에서 상기 "올리고뉴클레오티드"는 DNA, RNA 또는 DNA/RNA 하이브리드 분자이며, 보다 바람직하게는 RNA 분자인 올리고리보뉴클레오티드일 수 있다. In the present invention, the "oligonucleotide" is a DNA, RNA, or DNA/RNA hybrid molecule, and more preferably, may be an oligonucleotide that is an RNA molecule.
본 발명에서 상기 올리고뉴클레오티드는 자연 발생 또는 변형된, 비-자연 발생 염기를 함유할 수 있고, 변형된 당, 포스페이트, 및/또는 말단을 함유할 수 있다. 예를 들어, 포스포디에스테르 연결 이외에도, 포스페이트 변형은 메틸 포스포네이트, 포스포로티오에이트, 포스포르아미데이트 (가교 또는 비-가교), 포스포트리에스테르 및 포스포로디티오에이트를 포함하나, 이에 제한되지는 않고, 임의의 조합으로 사용될 수 있다. 일부 실시양태에서, 상기 RNA 올리고뉴클레오티드는 포스포로티오에이트 연결 단독, 포스포디에스테르 연결 단독, 또는 포스포디에스테르 및 포스포로티오에이트 연결의 조합을 갖는다.In the present invention, the oligonucleotide may contain a naturally occurring or modified, non-naturally occurring base, and may contain modified sugars, phosphates, and/or terminals. For example, in addition to phosphodiester linkages, phosphate modifications include, but are not limited to, methyl phosphonate, phosphorothioate, phosphoramidate (crosslinked or non-crosslinked), phosphotriester and phosphorodithioate It may not be used in any combination. In some embodiments, the RNA oligonucleotide has a phosphorothioate linkage alone, a phosphodiester linkage alone, or a combination of phosphodiester and phosphorothioate linkages.
관련 기술분야에 공지된 당 변형, 예컨대 2'-알콕시-RNA 유사체, 2'-아미노-RNA 유사체, 2'-플루오로-DNA, 및 2'-알콕시- 또는 아미노-RNA/DNA 키메라 및 본원에 기재된 다른 것이 또한 제조되고 임의의 포스페이트 변형과 조합될 수 있다. 염기 변형의 예는 상기 올리고뉴클레오티드의 시토신 (예를 들어, 5-브로모시토신, 5-클로로시토신, 5-플루오로시토신, 5-아이오도시토신)의 C-5 및/또는 C-6에 대한 전자-끄는 모이어티의 첨가 및 본 발명의 올리고뉴클레오티드의 우라실 (예를 들어, 5-브로모우라실, 5-클로로우라실, 5-플루오로우라실, 5-아이오도우라실)의 C-5 및/또는 C-6에 대한 전자-끄는 모이어티의 첨가를 포함하나 이에 제한되지는 않는다. 상기 언급된 바와 같이, 상기 올리고뉴클레오티드의 회문식 서열에서의 염기 변형의 사용은 왓슨-크릭 염기 쌍형성을 위해 수반된 염기의 자기-상보성을 방해하여서는 안 된다. 그러나, 회문식 서열의 외부에서, 변형된 염기는 이러한 제한 없이 사용될 수 있다. 예를 들어, 2'-O-메틸-우리딘 및 2'-O-메틸-시티딘은 회문식 서열의 외부에서 사용될 수 있는 반면에, 5-브로모-2'-데옥시시티딘은 회문식 서열 내부 및 외부 둘 다에서 사용될 수 있다. 회문식 서열의 내부 및 외부 둘 다에서 사용될 수 있는 다른 변형된 뉴클레오티드는 7-데아자-8-아자-dG, 2-아미노-dA, 및 2-티오-dT를 포함한다.Sugar modifications known in the art, such as 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA/DNA chimeras and herein Others described may also be made and combined with any phosphate modification. Examples of base modifications are for the C-5 and/or C-6 of the cytosine of the oligonucleotide (e.g., 5-bromocytosine, 5-chlorocytosine, 5-fluorocytosine, 5-iodocytosine). C-5 and/or addition of electron-withdrawing moieties and uracil (eg, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, 5-iodouracil) of oligonucleotides of the invention) Including but not limited to the addition of an electron-withdrawing moiety to C-6. As mentioned above, the use of base modifications in palindrome sequences of the oligonucleotides should not interfere with the self-complementarity of the bases involved for Watson-Crick base pairing. However, outside the palindrome sequence, modified bases can be used without these limitations. For example, 2'-O-methyl-uridine and 2'-O-methyl-cytidine can be used outside the palindrome sequence, while 5-bromo-2'-deoxycytidine is It can be used both inside and outside the literary sequence. Other modified nucleotides that can be used both inside and outside of palindrome sequences include 7-deaza-8-aza-dG, 2-amino-dA, and 2-thio-dT.
본 발명에서 상기 올리고뉴클레오티드는 포스페이트-변형된 올리고뉴클레오티드를 포함할 수 있으며, 그의 일부는 올리고뉴클레오티드를 안정화시키는 것으로 공지되어 있다. 따라서, 본 발명의 일부 실시양태는 안정화된 올리고뉴클레오티드를 포함한다. 변형된 포스페이트 연결 또는 비-포스페이트 연결을 함유하는 올리고뉴클레오티드의 합성은 또한 관련 기술분야에 공지되어 있다 (예를 들어, 문헌 [Matteucci "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (D.J. Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY, 1997] 참조). 올리고뉴클레오티드에서 당 또는 당 유사체 모이어티에 부착될 수 있는 인 유도체 (또는 변형된 포스페이트 기)는, 모노포스페이트, 디포스페이트, 트리포스페이트, 알킬포스포네이트, 포스포로티오에이트, 포스포로디티오에이트, 포스포르아미데이트 등일 수 있다. 상기-언급된 포스페이트 유사체의 제조 및 뉴클레오티드, 변형된 뉴클레오티드 및 올리고뉴클레오티드로의 그의 혼입은 이미 그 자체로 널리 기재되어 있다 (예를 들어, 문헌 [Peyrottes et al., Nucleic Acids Res, 24:1841-1848, 1996; Chaturvedi et al., Nucleic Acids Res, 24:2318-2323, 1996; 및 Schultz et al., Nucleic Acids Res, 24:2966-2973, 1996] 참조). 예를 들어, 포스포로티오에이트 올리고뉴클레오티드의 합성은 산화 단계가 황화 단계에 의해 대체된다는 것을 제외하고는 자연 발생 올리고뉴클레오티드에 대해 상기 기재된 것과 유사하다 (Zon "Oligonucleoside Phosphorothioates" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190, 1993).In the present invention, the oligonucleotide may include a phosphate-modified oligonucleotide, some of which are known to stabilize the oligonucleotide. Thus, some embodiments of the invention include stabilized oligonucleotides. Synthesis of oligonucleotides containing modified phosphate linkages or non-phosphate linkages is also known in the art (see, e.g., Matteucci "Oligonucleotide Analogs: an Overview" in Oligonucleotides as Therapeutic Agents, (DJ Chadwick and G. Cardew, ed.) John Wiley and Sons, New York, NY, 1997). Phosphor derivatives (or modified phosphate groups) that can be attached to sugars or sugar analogue moieties in oligonucleotides include monophosphates, diphosphates, triphosphates, alkylphosphonates, phosphorothioates, phosphorodithioates, phos It may be, for example, poramidate. Preparation of the above-mentioned phosphate analogs and their incorporation into nucleotides, modified nucleotides and oligonucleotides has already been widely described per se (see, eg, Peyrottes et al., Nucleic Acids Res, 24:1841-). 1848, 1996; Chaturvedi et al., Nucleic Acids Res, 24:2318-2323, 1996; and Schultz et al., Nucleic Acids Res, 24:2966-2973, 1996). For example, synthesis of phosphorothioate oligonucleotides is similar to that described above for naturally occurring oligonucleotides except that the oxidation step is replaced by a sulfidation step (Zon "Oligonucleoside Phosphorothioates" in Protocols for Oligonucleotides and Analogs, Synthesis and Properties (Agrawal, ed.) Humana Press, pp. 165-190, 1993).
본 발명에서 상기 올리고뉴클레오티드는 하나 이상의 리보뉴클레오티드 (단독 또는 주요 당 성분으로서 리보스 함유), 데옥시리보뉴클레오티드 (주요 당 성분으로서 데옥시리보스 함유), 변형된 당 또는 당 유사체를 포함할 수 있다. 따라서, 리보스 및 데옥시리보스 이외에도, 당 모이어티는 펜토스, 데옥시펜토스, 헥소스, 데옥시헥소스, 글루코스, 아라비노스, 크실로스, 릭소스, 및 당 유사체 시클로펜틸기일 수 있다. 당은 피라노실 또는 푸라노실 형태로 존재할 수 있다. 본 발명의 상기 올리고뉴클레오티드에서, 당 모이어티는 바람직하게는 리보스, 데옥시리보스, 아라비노스 또는 2'-O-알킬(예: 메틸, 에틸)리보스의 푸라노시드이고, 당은 각 헤테로시클릭 염기에 아노머 배위로 부착될 수 있다. 당 변형은 2'-알콕시(예: 메톡시, 에톡시)-RNA 유사체, 2'-아미노-RNA 유사체, 2'-플루오로-RNA, 2'-플루오로-DNA, 및 2'-알콕시- 또는 아미노-RNA/DNA 키메라를 포함하나, 이에 제한되지는 않는다. 이들 당 또는 당 유사체 및 이러한 당 또는 유사체가 그 자체로 헤테로시클릭 염기 (핵산 염기)에 부착되는 각 뉴클레오시드의 제조는 공지되어 있고, 따라서 여기서 기재될 필요는 없다. 당 변형은 또한 본 발명의 올리고뉴클레오티드의 제조에서 제조되고 임의의 포스페이트 변형과 조합될 수 있다.In the present invention, the oligonucleotide may include one or more ribonucleotides (containing ribose as the sole or main sugar component), deoxyribonucleotides (containing deoxyribose as the main sugar component), modified sugars or sugar analogs. Thus, in addition to ribose and deoxyribose, sugar moieties can be pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxos, and sugar analog cyclopentyl groups. Sugars can exist in the form of pyranosyl or furanosyl. In the oligonucleotides of the present invention, the sugar moiety is preferably a furanoside of ribose, deoxyribose, arabinose or 2'-0-alkyl (e.g. methyl, ethyl) ribose, and the sugar is each heterocyclic It can be attached to the base in an annodic configuration. Sugar modifications include 2'-alkoxy (eg methoxy, ethoxy)-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-RNA, 2'-fluoro-DNA, and 2'-alkoxy- Or amino-RNA/DNA chimeras. The preparation of these sugars or sugar analogs and each nucleoside to which these sugars or analogs are themselves attached to a heterocyclic base (nucleic acid base) is known and therefore need not be described herein. Sugar modifications can also be made in the preparation of oligonucleotides of the invention and combined with any phosphate modifications.
본 발명에서 상기 올리고뉴클레오티드에 혼입된 헤테로시클릭 염기, 또는 핵산 염기는 자연 발생 주요 퓨린 및 피리미딘 염기 (즉 상기 언급된 바와 같은 우라실, 티민, 시토신, 아데닌 및 구아닌) 뿐만 아니라, 상기 주요 염기의 자연 발생 및 합성 변형일 수 있다. 따라서, 본 발명의 올리고뉴클레오티드는 이노신, 2'-데옥시우리딘 및 2-아미노-2'-데옥시아데노신 중 하나 이상을 포함할 수 있다.The heterocyclic base, or nucleic acid base, incorporated in the oligonucleotide in the present invention is a naturally occurring major purine and pyrimidine base (ie, uracil, thymine, cytosine, adenine and guanine as mentioned above), as well as It can be naturally occurring and synthetic. Accordingly, the oligonucleotide of the present invention may include one or more of inosine, 2'-deoxyuridine and 2-amino-2'-deoxyadenosine.
본 발명의 올리고뉴클레오티드는 예를 들면 시험관 내 및 생체 내 개선된 효력 및 안정성을 포함한 각종 효과를 생성하는 것으로 당업계에 공지된 다양한 전략을 사용하여 변형될 수 있다. 그러한 전략 중에서 인공 핵산, 예를 들면 2'-O-메틸-치환된 RNA; 2'-플루오로-2'데옥시 RNA, 펩티드 핵산(PNA); 모르폴리노; 로킹된 핵산(LNA); 비로킹된 핵산(UNA); 가교된 핵산(BNA); 글리콜 핵산(GNA); 및 트레오스 핵산(TNA); 보다 일반적으로 핵산 유사체, 예를 들면 비시클릭 및 트리시클릭 뉴클레오시드 유사체이며, 이는 천연 발생 RNA 및 DNA와 구조적으로 유사하지만, 천연 발생 분자의 포스페이트 백본, 당 또는 핵염기 부분 중 하나 이상에서의 변형을 갖는다. 통상적으로, 유사체 핵염기는 무엇보다도 상이한 염기쌍 형성 및 염기 적층 성질을 부여한다. 그의 예는 4종의 캐논(canon) 염기와 쌍을 형성할 수 있는 보편적인 염기를 포함한다. 포스페이트-당 백본 유사체의 예는 PNA를 포함한다. 모르폴리노계 올리고머 화합물은 문헌[Braasch et al., Biochemistry, 41(14): 4503-4510 (2002)] 및 미국 특허 제5,539,082호, 제5,714,331호, 제5,719,262호 및 제5,034,506호에 기재되어 있다.The oligonucleotides of the present invention can be modified using various strategies known in the art to produce various effects, including, for example, improved potency and stability in vitro and in vivo. Among such strategies are artificial nucleic acids, such as 2'-0-methyl-substituted RNA; 2'-fluoro-2' deoxy RNA, peptide nucleic acid (PNA); Morpholino; Locked nucleic acids (LNA); Non-locked nucleic acids (UNA); Crosslinked nucleic acids (BNA); Glycol nucleic acids (GNA); And throse nucleic acid (TNA); More generally nucleic acid analogs, such as bicyclic and tricyclic nucleoside analogs, which are structurally similar to naturally occurring RNA and DNA, but modified in one or more of the phosphate backbone, sugar or nucleobase portion of the naturally occurring molecule. Have Typically, analog nucleobases confer, among other things, different base pairing and base stacking properties. Examples include universal bases capable of pairing with four canon bases. Examples of phosphate-sugar backbone analogs include PNA. Morpholino-based oligomeric compounds are described in Brasch et al., Biochemistry, 41(14): 4503-4510 (2002) and US Pat. Nos. 5,539,082, 5,714,331, 5,719,262 and 5,034,506.
본 발명에서 상기 올리고뉴클레오티드는 말단 단부에서 화학적 작용성 기로의 치환에 의하여 변형될 수 있다. 치환은 올리고뉴클레오티드의 3' 또는 5' 단부에서 수행될 수 있으며, 단량체의 센스 및 안티센스 가닥 둘다의 3' 단부에서 수행되는 것이 바람직하지만, 항상 이에 제한되는 것은 아니다. 화학적 작용기는 예를 들면 술프히드릴 기(-SH), 카르복실 기(-COOH), 아민 기(-NH2), 히드록시 기(-OH), 포르밀 기(-CHO), 카르보닐 기(-CO-), 에테르 기(-O-), 에스테르 기(-COO-), 니트로 기(-NO2), 아지드 기(-N3) 또는 술폰산 기(-SO3H)를 포함할 수 있다.In the present invention, the oligonucleotide may be modified by substitution with a chemical functional group at the terminal end. Substitutions can be performed at the 3'or 5'end of the oligonucleotide, preferably at the 3'end of both the sense and antisense strands of the monomer, but are not always limited thereto. Chemical functional groups are, for example, sulfhydryl groups (-SH), carboxyl groups (-COOH), amine groups (-NH 2 ), hydroxy groups (-OH), formyl groups (-CHO), carbonyl groups (-CO-), ether groups (-O-), ester groups (-COO-), nitro groups (-NO 2 ), azide groups (-N 3 ) or sulfonic acid groups (-SO 3 H). Can.
본 발명의 일 구현 예에 따르면, 이중 가닥의 올리고뉴클레오티드로서, According to an embodiment of the present invention, as a double-stranded oligonucleotide,
목적하는 제1 올리고뉴클레오티드 및 제1 연장 올리고뉴클레오티드를 포함하는 제1 가닥; 및A first strand comprising a desired first oligonucleotide and a first extended oligonucleotide; And
목적하는 제2 올리고뉴클레오티드 및 제2 연장 올리고뉴클레오티드를 포함하는 제2 가닥;을 포함하며, And a second strand comprising a desired second oligonucleotide and a second extended oligonucleotide.
상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 혼성화할 수 있고, The first extended oligonucleotide is capable of hybridizing with the second oligonucleotide,
상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 혼성화할 수 있는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다. The second extended oligonucleotide relates to a double-stranded oligonucleotide capable of hybridizing with the first oligonucleotide.
본 발명에서 상기 제1 올리고뉴클레오티드 및 상기 제2 올리고뉴클레오티드는 타겟 유전자의 발현을 조절하여 목적하는 기능을 하는 것으로, 서로 동일하거나 상이할 수 있으며 구체적인 서열은 특별히 제한하지 않는다.In the present invention, the first oligonucleotide and the second oligonucleotide function by controlling the expression of the target gene, and may be identical to or different from each other, and specific sequences are not particularly limited.
본 발명에서 상기 제1 올리고뉴클레오티드는 타겟 유전자의 발현을 조절하여 목적하는 기능을 하는 것으로 알려진 miRNA(이하, '목적하는 제1 miRNA'라 한다.)의 전 사슬(full sequence) 또는 그 일부 단편을 포함할 수 있다. In the present invention, the first oligonucleotide is a full sequence of a miRNA (hereinafter referred to as a'target first miRNA') or some fragment thereof known to function as a desired function by regulating the expression of a target gene. It can contain.
본 발명에서 상기 제2 올리고뉴클레오티드는 타겟 유전자의 발현을 조절하여 목적하는 기능을 하는 것으로 알려진 miRNA(이하, '목적하는 제2 miRNA'라 한다.)의 전 사슬(full sequence) 또는 그 일부 단편을 포함할 수 있다. In the present invention, the second oligonucleotide is a full sequence of a miRNA (hereinafter referred to as a'target second miRNA') or some fragment thereof known to function as a desired function by regulating the expression of a target gene. It can contain.
본 발명에서 상기 제1 올리고뉴클레오티드 및 상기 제2 올리고뉴클레오티드 각각의 목적하는 miRNA로, 상기 목적하는 제1 miRNA 및 상기 목적하는 제2 miRNA는 서로 동일하거나 상이할 수 있다. In the present invention, the desired miRNA of each of the first oligonucleotide and the second oligonucleotide may be the same or different from the desired first miRNA and the desired second miRNA.
본 발명에서 상기 상기 목적하는 제1 miRNA 및 상기 목적하는 제2 miRNA 각각의 전 사슬의 길이는 특별히 제한하지는 않지만, 바람직하게는 18~25개의 뉴클레오티드(nucleotide: 이하, 'nt'라 한다.)의 길이일 수 있다. In the present invention, the length of the entire chain of each of the target first miRNA and the target second miRNA is not particularly limited, but is preferably 18 to 25 nucleotides (hereinafter referred to as'nt'). It can be length.
또한, 본 발명에서 상기 제1 올리고뉴클레오티드 및 제2 올리고뉴클레오티드 각각은 성숙한 miRNA의 전 사슬 또는 그 단편을 포함할 수 있으나, miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA) 또는 플라스미드 (plasmid) 형태의 miRNA 전구체의 전 사슬 또는 이들의 단편을 포함할 수 있다. 다만, 본 발명에서 상기 miRNA 전구체 또는 일차 miRNA를 구성하는 핵산 분자는 50 내지 100nt, 더욱 바람직하게는 65 내지 95nt 길이를 가질 수 있으나, 이에 제한되는 것은 아니다.In addition, in the present invention, each of the first oligonucleotide and the second oligonucleotide may include the entire chain of a mature miRNA or a fragment thereof, but miRNA precursor, primary miRNA (pri-miRNA) or plasmid (plasmid) Form may include the entire chain of miRNA precursors or fragments thereof. However, in the present invention, the nucleic acid molecule constituting the miRNA precursor or primary miRNA may have a length of 50 to 100nt, more preferably 65 to 95nt, but is not limited thereto.
본 발명에서 상기 miRNA 단편은, 목적하는 miRNA의 종자 서열(seed sequence)을 포함하거나, 상기 종자 서열과 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상 또는 100%의 상동성을 갖는 염기 서열로 이루어지는 miRNA를 포함할 수 있다. In the present invention, the miRNA fragment includes a seed sequence of a desired miRNA, or 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more with the seed sequence, It may include a miRNA consisting of a base sequence having a homology of 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology.
본 발명에서 상기 "종자 서열(seed sequence)"이란 miRNA가 타겟을 인식할 때 완전한 상보성을 가지고 결합하는 miRNA 내 일부 영역의 뉴클레오타이드 서열을 의미하며, 이는 miRNA가 타겟에 결합하기 위해 필수적으로 요구되는 부분이자 실질적으로 유효한 기능을 하는 부위이다.In the present invention, the "seed sequence (seed sequence)" refers to the nucleotide sequence of a portion of the miRNA in the miRNA that binds with full complementarity when the miRNA recognizes the target, which is a required part of the miRNA to bind to the target It is an effective and effective part.
본 발명에서 상기 miRNA 단편의 길이는 특별히 제한하지는 않지만, 바람직하게는 9~11 nt일 수 있다. In the present invention, the length of the miRNA fragment is not particularly limited, but may preferably be 9 to 11 nt.
본 발명에서 상기 miRNA 단편은 목적하는 miRNA를 절단하여 제작하거나, 목적하는 miRNA의 어느 일 단편의 염기서열과 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다. In the present invention, the miRNA fragment is produced by cutting the desired miRNA, or 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more and the base sequence of any one fragment of the desired miRNA , 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상 또는 100%의 상동성을 갖는 염기서열로 이루어질 수 있다. In the present invention, the first extended oligonucleotide is capable of hybridizing with the second oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the second oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 하나 이상의 미스 매칭(mis-matching) 뉴클레오티드 (즉, 비상보적 염기쌍)를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the first extended oligonucleotide may form a bubble structure by including the second oligonucleotide and one or more mis-matching nucleotides (ie, non-complementary base pairs).
본 발명에서 상기 미스 매칭은 G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, 및 U:T로 구성된 군으로부터 선택될 수 있다. In the present invention, the mismatch is G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T , And U:T.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상 또는 100%의 상동성을 갖는 염기서열로 이루어질 수 있다.In the present invention, the second extended oligonucleotide can be hybridized with the first oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the first oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the second extended oligonucleotide may form a bubble structure by including the first oligonucleotide and one or more mismatching nucleotides.
본 발명에서 상기 미스 매칭은 G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T, 및 U:T로 구성된 군으로부터 선택될 수 있다. In the present invention, the mismatch is G:G, G:A, G:U, G:T, A:A, A:C, C:C, C:U, C:T, U:U, T:T , And U:T.
본 발명에서 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단은 상기 제1 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단은 상기 제1 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제1 올리고뉴클레오티드의 5' 말단은 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, any one end of the first extended oligonucleotide may be connected to any one end of the first oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is 3'of the first oligonucleotide. It may be linked to the terminal, or the 5'end of the first oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단은 상기 제2 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제2 연장 올리고뉴클레오티드의 5' 말단은 상기 제2 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제2 올리고뉴클레오티드의 5' 말단은 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, one end of the second extended oligonucleotide may be connected to any one end of the second oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is 3'of the second oligonucleotide. It may be linked to the end, or the 5'end of the second oligonucleotide may be linked to the 3'end of the second extended oligonucleotide.
본 발명에서 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단은 상기 제1 올리고뉴클레오티드의 3' 말단에 연결되고, 상기 제2 연장 올리고뉴클레오티드의 5' 말단은 상기 제2 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, preferably, the 5'end of the first extended oligonucleotide is connected to the 3'end of the first oligonucleotide, and the 5'end of the second extended oligonucleotide is 3'end of the second oligonucleotide. Can be connected to.
본 발명에서 바람직하게는 상기 제1 올리고뉴클레오티드의 5' 말단은 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결되고, 상기 제2 올리고뉴클레오티드의 5' 말단은 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다.In the present invention, preferably, the 5'end of the first oligonucleotide is connected to the 3'end of the first extended oligonucleotide, and the 5'end of the second oligonucleotide is 3'end of the second extended oligonucleotide. Can be connected to.
도 1은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 두 가닥 각각은 제1 올리고뉴클레오티드(10) 및 제2 올리고뉴클레오티드(11)를 포함하고, 상기 제1 올리고뉴클레오티드(10)의 3' 말단에는, 상기 제2 올리고뉴클레오티드(11)의 3'-5' 방향의 서열에 상보적인 제1 연장 올리고뉴클레오티드(20)의 5' 말단이 연결되어 제1 가닥을 이룰 수 있다. 또한, 상기 제2 올리고뉴클레오티드(11)의 3' 말단에는, 상기 제1 올리고뉴클레오티드(10)의 3'-5' 방향의 서열에 상보적인 제2 연장 올리고뉴클레오티드(21)의 5' 말단이 연결되어 제2 가닥을 이룰 수 있다.Figure 1 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, each of the two strands comprises a first oligonucleotide (10) and a second oligonucleotide (11), the first oligo At the 3'end of the
도 2는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 두 가닥 각각은 제1 올리고뉴클레오티드(10) 및 제2 올리고뉴클레오티드(11)를 포함하고, 상기 제2 올리고뉴클레오티드(11)의 3'-5' 방향의 서열에 상보적인 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 상기 제1 올리고뉴클레오티드(10)의 5' 말단이 연결되어 제1 가닥을 이룰 수 있다. 또한, 상기 제1 올리고뉴클레오티드(10)의 3'-5' 방향의 서열에 상보적인 제2 연장 올리고뉴클레오티드(21)의 3' 말단에 상기 제2 올리고뉴클레오티드(11)의 5' 말단이 연결되어 제2 가닥을 이룰 수 있다.Figure 2 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, each of the two strands comprises a first oligonucleotide (10) and a second oligonucleotide (11), the second oligo The 5'end of the
본 발명에서 상기 제1 올리고뉴클레오티드와 상기 제1 연장 올리고뉴클레오티드는 직접적으로 연결될 수 있으나, 그 사이에 제1 링커로, 제1 링커 뉴클레오티드 또는 제1 링커 올리고뉴클레오티드를 더 포함할 수 있으며, 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the first oligonucleotide and the first extended oligonucleotide may be directly linked, but may further include a first linker nucleotide or a first linker oligonucleotide as a first linker therebetween, in which specific sequence Is not particularly limited, a nucleotide having an adenine (A) base, a nucleotide having a base uracil (U), a nucleotide having a base guanine (G), a nucleotide having a base cytosine (C), or It can be a combination of these.
본 발명에서 상기 제2 올리고뉴클레오티드와 상기 제2 연장 올리고뉴클레오티드는 직접적으로 연결될 수 있으나, 그 사이에 제2 링커로, 제2 링커 뉴클레오티드 또는 제2 링커 올리고뉴클레오티드를 더 포함할 수 있으며, 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다.In the present invention, the second oligonucleotide and the second extended oligonucleotide may be directly linked, but may further include a second linker nucleotide or a second linker oligonucleotide as a second linker therebetween. Is not particularly limited, a nucleotide having an adenine (A) base, a nucleotide having a base uracil (U), a nucleotide having a base guanine (G), a nucleotide having a base cytosine (C), or It can be a combination of these.
본 발명에서 상기 제1 링커 및 제2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. When the first linker and the second linker are included in the present invention, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제1 링커 및 제2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the first linker and the second linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
도 3은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 연장 올리고뉴클레오티드(20)의 5' 말단은 제1 링커(300)를 통하여 제1 올리고뉴클레오티드(10)의 3' 말단에 연결될 수 있고, 제2 연장 올리고뉴클레오티드(21)의 5' 말단은 제2 링커(300')를 통하여 제2 올리고뉴클레오티드(11)의 3' 말단에 연결될 수 있다. Figure 3 shows the structure of the double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the first
도 4는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 올리고뉴클레오티드(10)의 5' 말단은 제1 링커(300)를 통하여 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 연결될 수 있고, 제2 올리고뉴클레오티드(11)의 5' 말단은 제2 링커(300')를 통하여 제2 연장 올리고뉴클레오티드(21)의 3' 말단에 연결될 수 있다. Figure 4 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the
본 발명에서 상기 제1 가닥의 5' 말단, 제1 올리고뉴클레오티드의 5' 말단 또는 제1 연장 올리고뉴클레오티드의 5' 말단에, 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드를 더 포함할 수 있다. In the present invention, the 5'end of the first strand, the 5'end of the first oligonucleotide or the 5'end of the first extended oligonucleotide may further include a first cap nucleotide or a first cap oligonucleotide.
본 발명에서 상기 제1 캡 뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드이거나, 목적하는 제1 miRNA의 5' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first cap nucleotide is not particularly limited, but may be a nucleotide whose base is uracil (U), or a first or second nucleotide from the 5'end of the desired first miRNA, but is not limited thereto. It does not work.
본 발명에서 상기 제1 캡 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드를 포함할 수 있고, 혹은 목적하는 제1 miRNA의 5' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from 1 to 3 of the 5'end of the desired first miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.
본 발명에서 상기 제2 가닥의 5' 말단, 제2 올리고뉴클레오티드의 5' 말단 또는 제2 연장 올리고뉴클레오티드의 5' 말단에, 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드를 더 포함할 수 있다.In the present invention, the 5'end of the second strand, the 5'end of the second oligonucleotide or the 5'end of the second extended oligonucleotide may further include a second cap nucleotide or a second cap oligonucleotide.
본 발명에서 상기 제2 캡 뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드이거나, 목적하는 제2 miRNA의 5' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second cap nucleotide is not particularly limited, but may be a nucleotide whose base is uracil (U) or a first or second nucleotide from the 5'end of the desired second miRNA, but is not limited thereto. It does not work.
본 발명에서 상기 제2 캡 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드를 포함할 수 있고, 혹은 목적하는 제2 miRNA의 5' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from 1 to 3 of the 5'end of the desired second miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.
도 5는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 올리고뉴클레오티드(10)의 3' 말단에 상기 제2 올리고뉴클레오티드(11)의 3'-5' 방향의 서열에 상보적인 제1 연장 올리고뉴클레오티드(20)의 5' 말단이 연결되어 제1 가닥을 이루고, 상기 제2 올리고뉴클레오티드(11)의 3' 말단에 상기 제1 올리고뉴클레오티드(10)의 3'-5' 방향의 서열에 상보적인 제2 연장 올리고뉴클레오티드(21)의 5' 말단이 연결되어 제2 가닥을 이룰 수 있다. 이때 상기 제1 가닥의 5' 말단인 제1 올리고뉴클레오티드(10)의 5' 말단에, 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)가 연장되고, 제2 가닥의 5' 말단인 제2 올리고뉴클레오티드(11)의 5' 말단에는, 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')가 연장될 수 있다.Figure 5 shows the structure of the double-stranded oligonucleotide according to an embodiment of the present invention, 3'-5' direction of the
도 6은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제2 올리고뉴클레오티드(11)의 3'-5' 방향의 서열에 상보적인 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 제1 올리고뉴클레오티드(10)의 5' 말단이 연결되어 제1 가닥을 이루고, 상기 제1 올리고뉴클레오티드(10)의 3'-5' 방향의 서열에 상보적인 제2 연장 올리고뉴클레오티드(21)의 3' 말단에 상기 제2 올리고뉴클레오티드(11)의 5' 말단이 연결되어 제2 가닥을 이룰 수 있다. 이때 상기 제1 가닥의 5' 말단인 제1 연장 올리고뉴클레오티드(20)의 5' 말단에, 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)가 연장되고, 제2 가닥의 5' 말단인 제2 연장 올리고뉴클레오티드(21)의 5' 말단에는, 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')가 연장될 수 있다.Figure 6 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the first
본 발명에서 상기 제1 가닥의 3' 말단, 제1 연장 올리고뉴클레오티드의 3' 말단, 또는 제1 올리고뉴클레오티드의 3' 말단에, 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드를 더 포함할 수 있다.In the present invention, a 3'end of the first strand, a 3'end of the first extended oligonucleotide, or a 3'end of the first oligonucleotide may further include a first terminal nucleotide or a first terminal oligonucleotide.
본 발명에서 상기 제1 말단 뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드이거나, 상기 목적하는 제1 miRNA의 3' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A), or a first or second nucleotide from the 3'end of the desired first miRNA. It is not limited.
본 발명에서 상기 제1 말단 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드를 포함할 수 있고, 혹은 상기 목적하는 제1 miRNA의 3' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but may include a nucleotide whose base is adenine (A), or 1 to 3 from the 3'end of the desired first miRNA. It may be a continuous oligonucleotide, or 1 to 2 consecutive oligonucleotides, but is not limited thereto.
본 발명에서 상기 제2 가닥의 3' 말단, 제2 연장 올리고뉴클레오티드의 3' 말단, 또는 제2 올리고뉴클레오티드의 3' 말단에, 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드를 더 포함할 수 있다. In the present invention, the 3'end of the second strand, the 3'end of the second extended oligonucleotide, or the 3'end of the second oligonucleotide may further include a second terminal nucleotide or a second terminal oligonucleotide.
본 발명에서 상기 제2 말단 뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드이거나, 상기 목적하는 제2 miRNA의 3' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A), or a first or second nucleotide from the 3'end of the desired second miRNA. It is not limited.
본 발명에서 상기 제2 말단 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드를 포함할 수 있고, 혹은 상기 목적하는 제2 miRNA의 3' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but may include a nucleotide whose base is adenine (A), or 1 to 3 from the 3'end of the desired second miRNA. It may be a continuous oligonucleotide, or 1 to 2 consecutive oligonucleotides, but is not limited thereto.
도 7은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 올리고뉴클레오티드(10)의 3' 말단에 상기 제2 올리고뉴클레오티드(11)의 3'-5' 방향의 서열에 상보적인 제1 연장 올리고뉴클레오티드(20)의 5' 말단이 연결되어 제1 가닥을 이루고, 상기 제2 올리고뉴클레오티드(11)의 3' 말단에 상기 제1 올리고뉴클레오티드(10)의 3'-5' 방향의 서열에 상보적인 제2 연장 올리고뉴클레오티드(21)의 5' 말단이 연결되어 제2 가닥을 이룰 수 있다. 이때 상기 제1 가닥의 3' 말단인 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)가 연장되고, 제2 가닥의 3' 말단인 제2 연장 올리고뉴클레오티드(21)의 3' 말단에는 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')가 연장될 수 있다.Figure 7 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 3'-5' direction of the
도 8은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제2 올리고뉴클레오티드(11)의 3'-5' 방향의 서열에 상보적인 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 제1 올리고뉴클레오티드(10)의 5' 말단이 연결되어 제1 가닥을 이루고, 상기 제1 올리고뉴클레오티드(10)의 3'-5' 방향의 서열에 상보적인 제2 연장 올리고뉴클레오티드(21)의 3' 말단에 상기 제2 올리고뉴클레오티드(11)의 5' 말단이 연결되어 제2 가닥을 이룰 수 있다. 이때 상기 제1 가닥의 3' 말단인 제1 올리고뉴클레오티드(10)의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)가 연장되고, 제2 가닥의 3' 말단인 제2 올리고뉴클레오티드(11)의 3' 말단에는 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')가 연장될 수 있다.Figure 8 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the first
본 발명에서 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드; 및 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드;를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide; if included, they may be arranged to face each other in the double strand.
또한 본 발명에서 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드; 및 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드;는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
또한, 본 발명에서 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드; 및 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드;를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In addition, the second cap nucleotide or the second cap oligonucleotide in the present invention; And the first terminal nucleotide or the first terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.
또한 본 발명에서 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드; 및 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드;는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the second cap nucleotide or the second cap oligonucleotide; And the first terminal nucleotide or the first terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
도 9는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 가닥의 5' 말단인 제1 올리고뉴클레오티드(10)의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)가 연장되고, 제2 가닥의 5' 말단인 제2 올리고뉴클레오티드(11)의 5' 말단에는 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')가 연장될 수 있다. 또한, 상기 제1 가닥의 3' 말단인 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)가 연장되고, 상기 제2 가닥의 3' 말단인 제2 연장 올리고뉴클레오티드(21)의 3' 말단에는 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')가 연장될 수 있다. 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)는 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')와 서로 대향하여 배치되고, 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')는 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)와 서로 대향하여 배치될 수 있다. Figure 9 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the first cap nucleotide or the first cap nucleotide at the 5'end of the
도 10은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 가닥의 5' 말단인 제1 연장 올리고뉴클레오티드(20)의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)가 연장되고, 제2 가닥의 5' 말단인 제2 연장 올리고뉴클레오티드(21)의 5' 말단에는 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')가 연장될 수 있다. 또한, 상기 제1 가닥의 3' 말단인 제1 올리고뉴클레오티드(10)의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)가 연장되고, 상기 제2 가닥의 3' 말단인 제2 올리고뉴클레오티드(11)의 3' 말단에는 제2 말단 뉴클레오티드 또는 올리고뉴클레오티드(200')가 연장될 수 있다. 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)는 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')와 서로 대향하여 배치되고, 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')는 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)와 서로 대향하여 배치될 수 있다. Figure 10 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, a first cap nucleotide or a 5'end of the
도 11은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 올리고뉴클레오티드(10)의 3' 말단에, 제1 연장 올리고뉴클레오티드(20)의 5' 말단이 제1 링커(300)를 통하여 연결되어 제1 가닥을 이루고, 제2 올리고뉴클레오티드(11)의 3' 말단에 제2 연장 올리고뉴클레오티드(21)의 5' 말단이 제2 링커(300')를 통하여 연결되어 제2 가닥을 이룰 수 있다. 또한, 상기 제1 가닥의 5' 말단인 제1 올리고뉴클레오티드(10)의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)가 연장되고, 상기 제2 가닥의 5' 말단인 제2 올리고뉴클레오티드(11)의 5' 말단에는 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')가 연장될 수 있다.Figure 11 shows the structure of the double-stranded oligonucleotide according to an embodiment of the present invention, the 3'end of the
도 12는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 제1 올리고뉴클레오티드(10)의 5' 말단이 제1 링커(300)를 통하여 연결되어 제1 가닥을 이루고, 제2 연장 올리고뉴클레오티드(21)의 3' 말단에 제2 올리고뉴클레오티드(11)의 5' 말단이 제2 링커(300')를 통하여 연결되어 제2 가닥을 이룰 수 있다. 또한, 상기 제1 가닥의 5' 말단인 상기 제1 연장 올리고뉴클레오티드(20)의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)가 연장되고, 상기 제2 가닥의 5' 말단인 제2 연장 올리고뉴클레오티드(21)의 5' 말단에는 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')가 연장될 수 있다.FIG. 12 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, wherein the 5'end of the
도 13은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 올리고뉴클레오티드(10)의 3' 말단에 제1 연장 올리고뉴클레오티드(20)의 5' 말단이 제1 링커(300)를 통하여 연결되어 제1 가닥을 이루고, 제2 올리고뉴클레오티드(11)의 3' 말단에 제2 연장 올리고뉴클레오티드(21)의 5' 말단이 제2 링커(300')를 통하여 연결되어 제2 가닥을 이룰 수 있다. 또한, 상기 제1 가닥의 3' 말단인 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)가 연장되고, 상기 제2 가닥의 3' 말단인 제2 연장 올리고뉴클레오티드(21)의 3' 말단에는 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')가 연장될 수 있다.13 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, wherein the 5'end of the first
도 14는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 제1 올리고뉴클레오티드(10)의 5' 말단이 제1 링커(300)를 통하여 연결되어 제1 가닥을 이룰 수 있고, 제2 연장 올리고뉴클레오티드(21)의 3' 말단에 제2 올리고뉴클레오티드(11)의 5' 말단이 제2 링커(300')를 통하여 연결되어 제2 가닥을 이룰수 있다. 또한, 상기 제1 가닥의 3' 말단인 제1 올리고뉴클레오티드(10)의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)가 연장되고, 상기 제2 가닥의 3' 말단인 제2 올리고뉴클레오티드(20)의 3' 말단에는 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')가 연장될 수 있다.FIG. 14 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, wherein the 5′ end of the
도 15는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 올리고뉴클레오티드(10)의 3' 말단에 제1 연장 올리고뉴클레오티드(20)의 5' 말단이 제1 링커(300)를 통하여 연결되어 제1 가닥을 이룰 수 있고, 제2 올리고뉴클레오티드(11)의 3' 말단에 제2 연장 올리고뉴클레오티드(21)의 5' 말단이 제2 링커(300')를 통하여 연결되어 제2 가닥을 이룰 수 있다. 또한, 상기 제1 가닥의 5' 말단인 제1 올리고뉴클레오티드(10)의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)가 연장되고, 상기 제2 가닥의 5' 말단인 제2 올리고뉴클레오티드(11)의 5' 말단에는 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')가 연장될 수 있다. 또한, 상기 제1 가닥의 3' 말단인 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)가 연장되고, 상기 제2 가닥의 3' 말단인 제2 연장 올리고뉴클레오티드(21)의 3' 말단에는 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')가 연장될 수 있다. 이때, 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)는 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')와 서로 대향하여 배치되고, 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')는 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)와 서로 대향하여 배치되며, 상기 제1 링커(300)는 상기 제2 링커(300')와 서로 대향하여 배치될 수 있다.15 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, and the 5'end of the first
도 16은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1 연장 올리고뉴클레오티드(20)의 3' 말단에 제1 올리고뉴클레오티드(10)의 5' 말단이 제1 링커(300)를 통하여 연결되어 제1 가닥을 이룰 수 있고, 제2 연장 올리고뉴클레오티드(21)의 3' 말단에 제2 올리고뉴클레오티드(11)의 5' 말단이 제2 링커(300')를 통하여 연결되어 제2 가닥을 이룰 수 있다. 또한, 상기 제1 가닥의 5' 말단인 제1 연장 올리고뉴클레오티드(20)의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)가 연장되고, 상기 제2 가닥의 5' 말단인 제2 연장 올리고뉴클레오티드(21)의 5' 말단에는 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')가 연장될 수 있다. 또한, 상기 제1 가닥의 3' 말단인 제1 올리고뉴클레오티드(10)의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)가 연장되고, 상기 제2 가닥의 3' 말단인 제2 올리고뉴클레오티드(11)의 3' 말단에는 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')가 연장될 수 있다. 이때, 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드(100)는 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드(200')와 서로 대향하여 배치되고, 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드(100')는 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드(200)와 서로 대향하여 배치되며, 상기 제1 링커(300)는 상기 제2 링커(300')와 서로 대향하여 배치될 수 있다.FIG. 16 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, wherein the 5'end of the
본 발명의 일 구체 예에 따르면, 이중 가닥의 올리고뉴클레오티드로서,According to one embodiment of the invention, as a double-stranded oligonucleotide,
m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 a 번째 내지 p 번째의 연속된 염기서열로 이루어지는 제1 올리고뉴클레오티드 및 제1 연장 올리고뉴클레오티드를 포함하는 제1 가닥; 및a first strand comprising a first oligonucleotide and a first extended oligonucleotide composed of a s to p s consecutive sequences from the 5'end of the m nucleotide (nt) miRNA; And
n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 b 번째 내지 q 번째의 연속된 염기서열로 이루어지는 제2 올리고뉴클레오티드 및 제2 연장 올리고뉴클레오티드를 포함하는 제2 가닥;을 포함하고, and a second strand comprising a second oligonucleotide and a second extended oligonucleotide consisting of a sequential sequential sequence of b th to q th from 5'end of miRNA of n nucleotide length (nt).
상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 혼성화될 수 있고, The first extended oligonucleotide may be hybridized with the second oligonucleotide,
상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 혼성화될 수 있으며,The second extended oligonucleotide may be hybridized with the first oligonucleotide,
m 및 n은 각각 독립적으로 18 내지 25의 정수이고,m and n are each independently an integer from 18 to 25,
a 및 b는 각각 독립적으로 1 내지 3의 정수이며, a and b are each independently an integer from 1 to 3,
p는 10 내지 m의 정수이고,p is an integer from 10 to m,
q는 10 내지 n의 정수이다. q is an integer from 10 to n.
본 발명에서 상기 제1 올리고뉴클레오티드 및 제2 올리고뉴클레오티드 각각은, 서로 동일하거나 상이한 목적하는 miRNA의 전 사슬 또는 그 단편을 포함하는 것으로, 보다 상세하게는 성숙한 miRNA, miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA) 또는 플라스미드 (plasmid) 형태의 miRNA 전구체의 전 사슬 또는 이들의 단편을 포함할 수 있다. In the present invention, each of the first oligonucleotide and the second oligonucleotide includes the entire chain or a fragment of a desired miRNA that is the same or different from each other. More specifically, a mature miRNA, a miRNA precursor, a primary miRNA (pri-miRNA) or a full chain of miRNA precursors in the form of a plasmid (plasmid) or fragments thereof.
본 발명에서 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA(목적하는 제1 miRNA)와 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA(목적하는 제2 miRNA)는 서로 동일하거나 상이할 수 있다. In the present invention, the m nucleotide (nt) length miRNA (target first miRNA) and the n nucleotide (nt) length miRNA (target second miRNA) may be the same or different from each other.
본 발명에서 상기 제1 올리고뉴클레오티드 및 제2 올리고뉴클레오티드의 서열은 서로 동일하거나 상이할 수 있다. In the present invention, the sequences of the first oligonucleotide and the second oligonucleotide may be identical to or different from each other.
본 발명에서 상기 제1 올리고뉴클레오티드는 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 내지 p 번째의 연속된 염기서열로 이루어질 수 있다. In the present invention, the first oligonucleotide may be composed of 1 to p consecutive sequences from the 5'end of miRNA of m nucleotides (nt) in length.
본 발명에서 상기 제1 올리고뉴클레오티드는 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 2 번째 내지 p 번째의 연속된 염기서열로 이루어질 수 있다. In the present invention, the first oligonucleotide may be composed of 2 to p-th consecutive base sequences from the 5'end of miRNAs of m nucleotides (nt) in length.
본 발명에서 상기 제2 올리고뉴클레오티드는 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 내지 q 번째의 연속된 염기서열로 이루어질 수 있다. In the present invention, the second oligonucleotide may be composed of 1 to q sequential sequencing sequences from the 5'end of miRNA of n nucleotides (nt) in length.
본 발명에서 상기 제2 올리고뉴클레오티드는 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 2 번째 내지 q 번째의 연속된 염기서열로 이루어질 수 있다.In the present invention, the second oligonucleotide may be composed of 2 to q sequential sequencing sequences from the 5'end of miRNA of n nucleotides (nt) in length.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the first extended oligonucleotide is capable of hybridizing with the second oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the second oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology to be composed of base sequences having homology. have.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the first extended oligonucleotide may form a bubble structure by including the second oligonucleotide and one or more mismatching nucleotides.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the second extended oligonucleotide can be hybridized with the first oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the first oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology to be composed of base sequences having homology. have.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the second extended oligonucleotide may form a bubble structure by including the first oligonucleotide and one or more mismatching nucleotides.
또한, 본 발명에서 상기 제1 연장 올리고뉴클레오티드는 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열의 1 번째 내지 q-b 번째 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In addition, in the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% with an oligonucleotide complementary to the 1st to qbth nucleotide sequence of the 3'-5' direction of the second oligonucleotide. Above, 93%, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.
또한, 본 발명에서 상기 제1 연장 올리고뉴클레오티드는 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열의 1 번째 내지 q-b-1 번째 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In addition, in the present invention, the first extended oligonucleotide is 90% or more, 91% or more with an oligonucleotide complementary to the 1st to qb-1th nucleotide sequence of the 3'-5' direction of the second oligonucleotide. It can be synthesized and produced to consist of a base sequence having a homology of 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology. .
또한, 본 발명에서 상기 제2 연장 올리고뉴클레오티드는 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열의 1 번째 내지 p-a 번째 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In addition, in the present invention, the second extended oligonucleotide is 90% or more, 91% or more, 92% with an oligonucleotide complementary to the 1st to path nucleotide sequence of the 3'-5' direction of the first oligonucleotide. Or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.
또한, 본 발명에서 상기 제2 연장 올리고뉴클레오티드는 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열의 1 번째 내지 p-a-1 번째 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In addition, in the present invention, the second extended oligonucleotide is 90% or more, 91% or more, with an oligonucleotide complementary to the 1st to pa-1th nucleotide sequence of the 3'-5' direction of the first oligonucleotide. It can be synthesized and produced to consist of a base sequence having a homology of 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology. .
본 발명에서 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단은 상기 제1 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단은 상기 제1 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제1 올리고뉴클레오티드의 5' 말단은 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, any one end of the first extended oligonucleotide may be connected to any one end of the first oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is 3'of the first oligonucleotide. It may be linked to the terminal, or the 5'end of the first oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단은 상기 제2 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제2 연장 올리고뉴클레오티드의 5' 말단은 상기 제2 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제2 올리고뉴클레오티드의 5' 말단은 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, one end of the second extended oligonucleotide may be connected to any one end of the second oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is 3'of the second oligonucleotide. It may be linked to the end, or the 5'end of the second oligonucleotide may be linked to the 3'end of the second extended oligonucleotide.
본 발명에서 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단은 상기 제1 올리고뉴클레오티드의 3' 말단에 연결되고, 상기 제2 연장 올리고뉴클레오티드의 5' 말단은 상기 제2 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, preferably, the 5'end of the first extended oligonucleotide is connected to the 3'end of the first oligonucleotide, and the 5'end of the second extended oligonucleotide is 3'end of the second oligonucleotide. Can be connected to.
본 발명에서 바람직하게는 상기 제1 올리고뉴클레오티드의 5' 말단은 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결되고, 상기 제2 올리고뉴클레오티드의 5' 말단은 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다.In the present invention, preferably, the 5'end of the first oligonucleotide is connected to the 3'end of the first extended oligonucleotide, and the 5'end of the second oligonucleotide is 3'end of the second extended oligonucleotide. Can be connected to.
본 발명에서 상기 제1 올리고뉴클레오티드와 상기 제1 연장 올리고뉴클레오티드는 직접적으로 연결될 수 있으나, 상기 제1 올리고뉴클레오티드와 상기 제1 연장 올리고뉴클레오티드 사이에 제1 링커로, 제1 링커 뉴클레오티드 또는 제1 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the first oligonucleotide and the first extended oligonucleotide may be directly linked, but as the first linker between the first oligonucleotide and the first extended oligonucleotide, a first linker nucleotide or a first linker oligo It may further include a nucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제1 링커 뉴클레오티드는 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 p+1 번째 뉴클레오티드일 수 있다. 단, 여기서 상기 p는 10 내지 m-1의 정수일 수 있다. In the present invention, the first linker nucleotide may be a p+1 th nucleotide from the 5'end of the mRNA of m nucleotides (nt) in length. However, the p may be an integer of 10 to m-1.
본 발명에서 상기 제1 링커 올리고뉴클레오티드는 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 p+1 번째 내지 p+r 번째의 연속된 염기서열로 이루어지는 올리고뉴클레오티드일 수 있다. 여기서 상기 r은 2 내지 4의 정수일 수 있다. 단, 여기서 상기 p는 10 이상의 정수이되, 그 최대값은 m-4 내지 m-2의 정수일 수 있다.In the present invention, the first linker oligonucleotide may be an oligonucleotide consisting of p+1 th to p+r th consecutive nucleotide sequences from the 5'end of the m nucleotide (nt) length miRNA. Here, r may be an integer from 2 to 4. However, where p is an integer of 10 or more, the maximum value may be an integer of m-4 to m-2.
본 발명에서 상기 제2 올리고뉴클레오티드와 상기 제2 연장 올리고뉴클레오티드는 직접적으로 연결될 수 있으나, 상기 제2 올리고뉴클레오티드와 상기 제2 연장 올리고뉴클레오티드 사이에 제2 링커로, 제2 링커 뉴클레오티드 또는 제2 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the second oligonucleotide and the second extended oligonucleotide may be directly linked, but as a second linker between the second oligonucleotide and the second extended oligonucleotide, a second linker nucleotide or a second linker oligo It may further include a nucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제2 링커 뉴클레오티드는 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 q+1 번째 뉴클레오티드일 수 있다. 단, 여기서 상기 q는 10 내지 n-1의 정수일 수 있다.In the present invention, the second linker nucleotide may be a q+1 th nucleotide from the 5'end of the n nucleotide (nt) length miRNA. However, the q may be an integer of 10 to n-1.
본 발명에서 상기 제2 링커 올리고뉴클레오티드는 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 q+1 번째 내지 q+s 번째의 연속된 염기서열로 이루어지는 올리고뉴클레오티드일 수 있다. 여기서 상기 s는 2 내지 4의 정수일 수 있다. 단, 여기서 상기 q는 10 이상의 정수이되, 그 최대값은 n-4 내지 n-2의 정수일 수 있다.In the present invention, the second linker oligonucleotide may be an oligonucleotide consisting of a sequence of q+1 th to q+s th consecutive sequences from the 5'end of the n nucleotide (nt) miRNA. Here, s may be an integer from 2 to 4. However, where q is an integer of 10 or more, the maximum value may be an integer of n-4 to n-2.
본 발명에서 상기 제1 링커 및 제2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. When the first linker and the second linker are included in the present invention, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제1 링커 및 제2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the first linker and the second linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1 가닥의 5' 말단, 제1 올리고뉴클레오티드의 5' 말단 또는 제1 연장 올리고뉴클레오티드의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드를 더 포함할 수 있고, 바람직하게는 상기 제1 올리고뉴클레오티드는 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 2 번째 내지 p 번째의 연속된 염기서열 또는 3 번째 내지 p 번째의 연속된 염기서열로 이루어지고, 이때 상기 제1 올리고뉴클레오티드의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드를 더 포함할 수 있다. In the present invention, the 5'end of the first strand, the 5'end of the first oligonucleotide or the 5'end of the first extended oligonucleotide may further include a first cap nucleotide or a first cap oligonucleotide, preferably Is that the first oligonucleotide consists of 2 to p-th consecutive sequences or 3 to p-th consecutive sequences from the 5'end of miRNAs of m nucleotides (nt) in length. The 5'end of the oligonucleotide may further include a first cap nucleotide or a first cap oligonucleotide.
본 발명에서 상기 제1 캡 뉴클레오티드의 서열은 특별히 제한하지는 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드이거나, 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first cap nucleotide is not particularly limited, but the base is uracil (U) nucleotide, or the first or second nucleotide from the 5'end of the m nucleotide (nt) length miRNA. However, it is not limited thereto.
본 발명에서 상기 제1 캡 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드를 포함할 수 있고, 혹은 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from the 5′ end of the m nucleotide (nt) length miRNA. The third to third consecutive oligonucleotides, or the first to second consecutive oligonucleotides, but are not limited thereto.
본 발명에서 상기 제2 가닥의 5' 말단, 제2 올리고뉴클레오티드의 5' 말단 또는 제2 연장 올리고뉴클레오티드의 5' 말단에 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드를 더 포함할 수 있고, 바람직하게는 상기 제2 올리고뉴클레오티드는 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 2 번째 내지 q 번째의 연속된 염기서열 또는 3 번째 내지 q 번째의 연속된 염기서열로 이루어지고, 이때 상기 제2 올리고뉴클레오티드의 5' 말단에 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드를 더 포함할 수 있다. In the present invention, the 5'end of the second strand, the 5'end of the second oligonucleotide or the 5'end of the second extended oligonucleotide may further include a second cap nucleotide or a second cap oligonucleotide, preferably Is the second oligonucleotide is composed of a 2nd to qth consecutive base sequence or a 3rd to qth consecutive base sequence from the 5'end of the n nucleotide (nt) length miRNA, wherein the second A second cap nucleotide or a second cap oligonucleotide may be further included at the 5'end of the oligonucleotide.
본 발명에서 상기 제2 캡 뉴클레오티드의 서열은 특별히 제한하지는 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드이거나, 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second cap nucleotide is not particularly limited, but the base is a uracil (U) nucleotide, or the first or second nucleotide from the 5'end of the n nucleotide (nt) length miRNA. However, it is not limited thereto.
본 발명에서 상기 제2 캡 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드를 포함할 수 있고, 혹은 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from the 5'end of the n nucleotide (nt) length miRNA 1 The third to third consecutive oligonucleotides, or the first to second consecutive oligonucleotides, but are not limited thereto.
본 발명에서 상기 제1 캡 뉴클레오티드 및 제2 캡 뉴클레오티드 중 적어도 하나는 염기가 우라실(uracil, U)인 뉴클레오티드인 것이 타겟 유전자와의 상호 결합력을 높일 수 있다. In the present invention, at least one of the first cap nucleotide and the second cap nucleotide is a nucleotide having a base of uracil (U), thereby enhancing a cross-linking ability with a target gene.
본 발명에서 상기 제1 캡 올리고뉴클레오티드 및 제2 캡 올리고뉴클레오티드 중 적어도 하나는 염기가 우라실(uracil, U)인 뉴클레오티드를 포함하는 것이 타겟 유전자와의 상호 결합력을 높일 수 있다. In the present invention, at least one of the first cap oligonucleotide and the second cap oligonucleotide includes a nucleotide having a base of uracil (U), thereby increasing a binding force with a target gene.
본 발명에서 상기 제1 가닥의 3' 말단, 제1 연장 올리고뉴클레오티드의 3' 말단 또는 제1 올리고뉴클레오티드의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드를 더 포함할 수 있다. In the present invention, the 3'end of the first strand, the 3'end of the first extended oligonucleotide or the 3'end of the first oligonucleotide may further include a first terminal nucleotide or a first terminal oligonucleotide.
본 발명에서 상기 제1 말단 뉴클레오티드의 서열을 특별히 제한하지는 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드이거나, 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 m 번째 뉴클레오티드일 수 있다. In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or m th nucleotide of the m nucleotide (nt) length miRNA.
본 발명에서 상기 제1 말단 올리고뉴클레오티드의 서열을 특별히 제한하지는 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드를 포함하거나, 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 m-c 번째 내지 m 번째의 연속된 염기서열로 이루어질 수 있다. 여기서, 상기 c는 1 내지 3의 정수, 또는 1 또는 2의 정수일 수 있다. In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but includes a nucleotide whose base is adenine (A), or mc th to m from the 5'end of the m nucleotide (nt) length miRNA. It may consist of a sequence of sequential sequences. Here, c may be an integer from 1 to 3, or an integer from 1 to 2.
본 발명에서 상기 제2 가닥의 3' 말단, 제2 연장 올리고뉴클레오티드의 3' 말단, 또는 제2 올리고뉴클레오티드의 3' 말단에 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드를 더 포함할 수 있다.In the present invention, a second terminal nucleotide or a second terminal oligonucleotide may be further included in the 3'terminal of the second strand, the 3'terminal of the second extended oligonucleotide, or the 3'terminal of the second oligonucleotide.
본 발명에서 상기 제2 말단 뉴클레오티드의 서열을 특별히 제한하지는 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드이거나, 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 n 번째 뉴클레오티드일 수 있다. In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or the n th nucleotide of the n nucleotide (nt) length miRNA.
본 발명에서 상기 제2 말단 올리고뉴클레오티드의 서열을 특별히 제한하지는 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드를 포함하거나, 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 n-d 번째 내지 n 번째의 연속된 염기서열로 이루어질 수 있다. 여기서, 상기 d는 1 내지 3의 정수, 또는 1 또는 2의 정수일 수 있다. In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but includes a nucleotide whose base is adenine (A), or nd th to n from the 5'end of the n nucleotide (nt) length miRNA. It may consist of a sequence of sequential sequences. Here, d may be an integer from 1 to 3, or an integer from 1 to 2.
본 발명에서 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드; 및 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드;를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.
또한 본 발명에서 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드; 및 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드;는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
또한, 본 발명에서 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드; 및 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드;를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In addition, the second cap nucleotide or the second cap oligonucleotide in the present invention; And the first terminal nucleotide or the first terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.
또한 본 발명에서 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드; 및 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드;는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the second cap nucleotide or the second cap oligonucleotide; And the first terminal nucleotide or the first terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명의 다른 구현 예에 따르면, 이중 가닥의 올리고뉴클레오티드로서, According to another embodiment of the invention, as a double-stranded oligonucleotide,
목적하는 제1 miRNA 전구체의 어느 일 단편인 제1-1 올리고뉴클레오티드 및 다른 일 단편인 제1-2 올리고뉴클레오티드를 포함하는 제1 가닥;A first strand comprising a 1-1 oligonucleotide, which is one fragment of the desired first miRNA precursor, and a 1-2 oligonucleotide, which is the other fragment;
목적하는 제2 miRNA 전구체의 어느 일 단편인 제2-1 올리고뉴클레오티드 및 다른 일 단편인 제2-2 올리고뉴클레오티드를 포함하는 제2 가닥;A second strand comprising a 2-1 oligonucleotide which is a fragment of one desired fragment of the second miRNA precursor and a second 2-2 oligonucleotide which is the other fragment;
목적하는 제1 miRNA 전구체의 또 다른 일 단편인 제1-3 올리고뉴클레오티드를 포함하는 제3 가닥;A third strand comprising a 1-3 oligonucleotide, which is another fragment of the desired first miRNA precursor;
목적하는 제2 miRNA 전구체의 또 다른 일 단편인 제2-3 올리고뉴클레오티드를 포함하는 제4 가닥을 포함하고, And a fourth strand comprising a second-3 oligonucleotide, another fragment of the desired second miRNA precursor,
상기 제1 가닥의 어느 일 말단은 상기 제2 가닥 또는 상기 제4 가닥의 어느 일 말단과 연결되며, One end of the first strand is connected to one end of the second strand or the fourth strand,
상기 제3 가닥의 어느 일 말단은 상기 제4 가닥 또는 상기 제2 가닥의 어느 일 말단과 연결되는, 이중 가닥의 올리고뉴클레오티드에 관한 것이다. One end of the third strand relates to the oligonucleotide of the double strand, which is connected to either end of the fourth strand or the second strand.
본 발명에서 상기 제1 miRNA 전구체 및 제2 miRNA 전구체는 타겟 유전자의 발현을 조절하여 목적하는 기능을 하는 것으로 알려진 miRNA(이하, '목적하는 miRNA'라 한다.)의 전구체로, 그 형상을 특별히 제한하지는 않으나 헤어핀(hairpin) 형상일 수 있다. 이를 구성하는 핵산 분자는 50 내지 150nt, 바람직하게는 60 내지 100nt, 더욱 바람직하게는 65 내지 95nt 길이를 가질 수 있다.In the present invention, the first miRNA precursor and the second miRNA precursor are precursors of miRNAs (hereinafter referred to as'target miRNAs') which are known to function as targets by regulating the expression of target genes. Although not, it may be in the form of a hairpin. The nucleic acid molecules constituting this may have a length of 50 to 150 nt, preferably 60 to 100 nt, and more preferably 65 to 95 nt.
본 발명에서 상기 제1 miRNA 전구체 및 제2 miRNA 전구체는 동일하거나 상이할 수 있다. In the present invention, the first miRNA precursor and the second miRNA precursor may be the same or different.
본 발명에서 상기 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드 각각은 상기 제1 miRNA 전구체의 임의의 단편이고, 이들 서열은 서로 전혀 상이하거나, 일부 중복되거나, 동일할 수 있으며, 이들의 서열은 특별히 제한하지 않는다.In the present invention, each of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide is any fragment of the first miRNA precursor, and these sequences are completely different from each other, partially overlapping, or identical It is possible, and their sequence is not particularly limited.
다만, 본 발명에서 상기 제1-1 올리고뉴클레오티드 및 상기 제1-2 올리고뉴클레오티드는 상기 제1 miRNA 전구체에 연속하여 배치되되, 다이서(dicer)의 작용에 의해 절단될 수 있는 임의의 두 단편일 수 있다. However, in the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be any two fragments that are continuously arranged in the first miRNA precursor and can be cleaved by the action of a dicer. Can.
바람직하게는, 본 발명에서 상기 제1-1 올리고뉴클레오티드는 인체 내에서 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 전 서열 또는 종자 서열을 포함할 수 있다. Preferably, in the present invention, the 1-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.
본 발명에서 상기 제2-1 올리고뉴클레오티드, 제2-2 올리고뉴클레오티드 및 제2-3 올리고뉴클레오티드는 각각은 상기 제2 miRNA 전구체의 임의의 단편이고, 이들 서열은 서로 전혀 상이하거나, 일부 중복되거나, 동일할 수 있으며, 이들의 서열은 특별히 제한하지 않는다. In the present invention, each of the 2-1 oligonucleotide, 2-2 oligonucleotide, and 2-3 oligonucleotide is any fragment of the second miRNA precursor, and these sequences are completely different from each other, partially overlapped, It may be the same, and their sequence is not particularly limited.
다만, 본 발명에서 상기 제2-1 올리고뉴클레오티드 및 상기 제2-2 올리고뉴클레오티드는 상기 제2 miRNA 전구체에 연속하여 배치되되, 다이서의 작용에 의해 절단될 수 있는 임의의 두 단편일 수 있다. However, in the present invention, the 2-1 oligonucleotide and the 2-2 oligonucleotide may be any two fragments that are continuously disposed on the second miRNA precursor and can be cleaved by the action of a dicer.
본 발명에서 상기 제2-1 올리고뉴클레오티드는 인체 내에서 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 전 서열 또는 종자 서열을 포함할 수 있다.In the present invention, the 2-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.
도 17 내지 24는 본 발명의 일 실시예 따라 헤어핀 형상의 제1 miRNA 전구체에서 제1-1 올리고뉴클레오티드(50a), 제1-2 올리고뉴클레오티드(50b) 및 제1-3 올리고뉴클레오티드(50c)의 배치의 일 예시를 나타낸 것으로, 상기 제1-1 올리고뉴클레오티드(50a), 제1-2 올리고뉴클레오티드(50b) 및 제1-3 올리고뉴클레오티드(50c) 각각은 상기 제1 miRNA 전구체의 5'-3' 방향 또는 3'-5' 방향으로 연속하여 배치되는 임의의 세 절편일 수 있다. 여기서, 상기 제1-1 올리고뉴클레오티드는 인체 내에서 상기 제1 miRNA 전구체로부터 절단되어 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 전 서열 또는 종자 서열을 포함할 수 있다. 또한, 상기 제1-2 올리고뉴클레오티드는, 이에 제한되는 것은 아니지만 상기 제1 miRNA 전구체 내에서 상기 제1-1 올리고뉴클레오티드에 이웃하여 배치되는 단편으로, 다이서(dicer)의 작용에 의해 상기 1-1 올리고뉴클레오티드와 분리 및 절단될 수 있다. 또한, 상기 제1-2 올리고뉴클레오티드 및 상기 제1-3 올리고뉴클레오티드는 이에 제한되는 것은 아니지만, 상기 헤어핀 형상의 제1 miRNA 내 루프(loop)에 위치하는 임의의 두 단편일 수 있다. 17 to 24 are 1-1 oligonucleotides (50a), 1-2 oligonucleotides (50b) and 1-3 oligonucleotides (50c) of the hairpin-shaped first miRNA precursor according to an embodiment of the present invention. As an example of arrangement, each of the 1-1 oligonucleotide (50a), 1-2 oligonucleotide (50b) and 1-3 oligonucleotide (50c) is 5'-3 of the first miRNA precursor It can be any three intercepts that are arranged consecutively in the'direction or 3'-5' direction. Here, the 1-1 oligonucleotide may include the entire sequence or seed sequence of a miRNA that is cleaved from the first miRNA precursor in the human body and controls the expression of the target gene to perform a desired function. In addition, the 1-2 oligonucleotide is, but is not limited to, a fragment arranged adjacent to the 1-1 oligonucleotide in the first miRNA precursor, and the 1- by the action of a dicer. It can be separated and cleaved from 1 oligonucleotide. In addition, the 1-2 oligonucleotide and the 1-3 oligonucleotide are not limited thereto, but may be any two fragments located in a loop in the hairpin-shaped first miRNA.
본 발명에서 도면으로 도시하지는 않았지만, 제2-1 올리고뉴클레오티드, 제2-2 올리고뉴클레오티드 및 제2-3 올리고뉴클레오티드 또한 상기 제2 miRNA 전구체의 5'-3' 방향 또는 3'-5' 방향으로 연속하여 배치되는 임의의 세 절편일 수 있다. 여기서, 상기 제2-1 올리고뉴클레오티드는 인체 내에서 상기 제2 miRNA 전구체로부터 절단되어 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 전 서열 또는 종자 서열을 포함할 수 있다. 또한, 상기 제2-2 올리고뉴클레오티드는, 이에 제한되는 것은 아니지만 상기 제2 miRNA 전구체 내에서 상기 제2-1 올리고뉴클레오티드에 이웃하여 배치되는 단편으로, 다이서(dicer)의 작용에 의해 상기 2-1 올리고뉴클레오티드와 분리 및 절단될 수 있다. 또한, 상기 제2-2 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드는 이에 제한되는 것은 아니지만, 상기 헤어핀 형상의 제1 miRNA 내 루프(loop)에 위치하는 임의의 두 단편일 수 있다.Although not shown in the drawings in the present invention, the 2-1 oligonucleotide, the 2-2 oligonucleotide and the 2-3 oligonucleotide are also in the 5'-3' or 3'-5' direction of the second miRNA precursor. It can be any three segments arranged in succession. Here, the 2-1 oligonucleotide may include the entire sequence or seed sequence of the miRNA that is cleaved from the second miRNA precursor in the human body and controls the expression of the target gene to perform the desired function. In addition, the 2-2 oligonucleotide is, but is not limited to, a fragment disposed adjacent to the 2-1 oligonucleotide in the second miRNA precursor, and the 2- by the action of a dicer. It can be separated and cleaved from 1 oligonucleotide. In addition, the 2-2 oligonucleotide and the 2-3 oligonucleotide are not limited thereto, but may be any two fragments located in a loop in the hairpin-shaped first miRNA.
본 발명에서 상기 제1-1 올리고뉴클레오티드 및 상기 제2-1 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-1 oligonucleotide and the 2-1 oligonucleotide may be the same or different from each other.
본 발명에서 상기 제1-2 올리고뉴클레오티드 및 상기 제2-2 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-2 oligonucleotide and the 2-2 oligonucleotide may be the same or different from each other.
본 발명에서 상기 제1-3 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-3 oligonucleotide and the 2-3 oligonucleotide may be the same or different from each other.
본 발명의 상기 제1 가닥에서 상기 제1-1 올리고뉴클레오티드의 어느 일 말단은 상기 제1-2 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제1-2 올리고뉴클레오티드의 5' 말단은 제1-1 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제1-1 올리고뉴클레오티드의 5' 말단은 상기 제1-2 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. Any one end of the 1-1 oligonucleotide in the first strand of the present invention may be connected to any one end of the 1-2 oligonucleotide, preferably the 5'end of the 1-2 oligonucleotide May be connected to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be connected to the 3'end of the 1-2 oligonucleotide.
본 발명에서 상기 제1-1 올리고뉴클레오티드와 상기 제1-2 올리고뉴클레오티드는 직접 연결될 수 있지만, 혹은 상기 제1-1 올리고뉴클레오티드와 상기 제1-2 올리고뉴클레오티드 사이에 제1-1 링커로, 제1-1 링커 뉴클레오티드 또는 제1-1 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be directly linked, or as a 1-1 linker between the 1-1 oligonucleotide and the 1-2 oligonucleotide, the It may further include a 1-1 linker nucleotide or a 1-1 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
또한, 본 발명의 상기 제2 가닥에서 상기 제2-1 올리고뉴클레오티드의 어느 일 말단은 상기 제2-2 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제2-1 올리고뉴클레오티드의 5' 말단은 상기 제2-2 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제2-2 올리고뉴클레오티드의 5' 말단은 상기 제2-1 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In addition, one end of the 2-1 oligonucleotide in the second strand of the present invention may be connected to any one end of the 2-2 oligonucleotide, preferably 5 of the 2-1 oligonucleotide The'end' may be linked to the 3'end of the 2-2 oligonucleotide, or the 5'end of the 2-2 oligonucleotide may be linked to the 3'end of the 2-1 oligonucleotide.
본 발명에서 상기 제2-2 올리고뉴클레오티드와 상기 제2-1 올리고뉴클레오티드는 직접 연결될 수 있지만, 혹은 상기 제2-2 올리고뉴클레오티드와 상기 제2-1 올리고뉴클레오티드 사이에 제2-1 링커로, 제2-1 링커 뉴클레오티드 또는 제2-1 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the 2-2 oligonucleotide and the 2-1 oligonucleotide may be directly linked, or a 2-1 linker between the 2-2 oligonucleotide and the 2-1 oligonucleotide may be used. It may further include a 2-1 linker nucleotide or a 2-1 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
또한, 본 발명에서 상기 제3 가닥은 제1 연장 올리고뉴클레오티드를 더 포함할 수 있다. Further, in the present invention, the third strand may further include a first extended oligonucleotide.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드와 혼성화될 수 있다. In the present invention, the first extended oligonucleotide may be hybridized with the first 1-1 oligonucleotide.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열과 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more with a sequence complementary to a 3'-5' nucleotide sequence of the 1-1 oligonucleotide. Above, 95%, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the first extended oligonucleotide may form a bubble structure by including the first-1-1 oligonucleotide and one or more miss-matching nucleotides.
본 발명에서 상기 제3 가닥에서 상기 제1-3 올리고뉴클레오티드의 어느 일 말단은 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단은 상기 제1-3 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제1-3 올리고뉴클레오티드의 5' 말단은 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, one end of the 1-3 oligonucleotide in the third strand may be connected to any one end of the first extended oligonucleotide, preferably the 5'end of the first extended oligonucleotide is It may be linked to the 3'end of the 1-3 oligonucleotide, or the 5'end of the 1-3 oligonucleotide may be connected to the 3'end of the first extended oligonucleotide.
본 발명에서 상기 제1-3 올리고뉴클레오티드와 상기 제1 연장 올리고뉴클레오티드는 직접 연결될 수 있지만, 혹은 상기 제1-3 올리고뉴클레오티드와 상기 제1 연장 올리고뉴클레오티드 사이에 제1-2 링커로, 제1-2 링커 뉴클레오티드 또는 제1-2 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the 1-3 oligonucleotide and the first extended oligonucleotide may be directly linked, or as a 1-2 linker between the 1-3 oligonucleotide and the first extended oligonucleotide, the first- It may further include 2 linker nucleotides or 1-2 linker oligonucleotides. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제1-1 링커 및 제1-2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, when the 1-1 linker and the 1-2 linker are included, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제1-1 링커 및 제1-2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the 1-1 linker and the 1-2 linker may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1-2 올리고뉴클레오티드 및 상기 제1-3 올리고뉴클레오티드는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다.In the present invention, the 1-2 oligonucleotide and the 1-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
또한, 본 발명에서 상기 제4 가닥은 제2 연장 올리고뉴클레오티드를 더 포함할 수 있다. Further, in the present invention, the fourth strand may further include a second extended oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드와 혼성화될 수 있다. In the present invention, the second extended oligonucleotide may be hybridized with the 2-1 oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열과 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the second extended oligonucleotide is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more with a sequence complementary to a 3'-5' nucleotide sequence of the 2-1 oligonucleotide. Above, 95%, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the second extended oligonucleotide may form a bubble structure by including the 2-1 oligonucleotide and one or more mismatching nucleotides.
본 발명에서 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단은 상기 제2-3 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제2 연장 올리고뉴클레오티드의 5' 말단은 상기 제2-3 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제2-3 올리고뉴클레오티드의 5' 말단은 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, one end of the second extended oligonucleotide may be connected to any one end of the second-3 oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is the second-3 oligonucleotide. It may be linked to the 3'end of the nucleotide, or the 5'end of the 2-3 oligonucleotide may be linked to the 3'end of the second extended oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드와 상기 제2-3 올리고뉴클레오티드는 직접 연결될 수 있지만, 혹은 상기 제2 연장 올리고뉴클레오티드와 상기 제2-3 올리고뉴클레오티드 사이에 제2-2 링커로, 제2-2 링커 뉴클레오티드 또는 제2-2 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the second extended oligonucleotide and the second-3 oligonucleotide may be directly linked, or as a second-2 linker between the second extended oligonucleotide and the second-3 oligonucleotide, second- It may further include a 2 linker nucleotide or a 2-2 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제2-1 링커 및 제2-2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. When the 2-1 linker and the 2-2 linker are included in the present invention, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제2-1 링커 및 제2-2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the 2-1 linker and the 2-2 linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제2-2 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다.In the present invention, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1 가닥의 어느 일 말단은 상기 제2 가닥 또는 상기 제4 가닥의 어느 일 말단과 연결될 수 있다. 바람직하게는 상기 제1 가닥의 3' 말단은 상기 제2 가닥의 5' 말단에 연결되거나, 또는 상기 제1 가닥의 3' 말단은 상기 제4 가닥의 5' 말단에 연결되거나, 또는 상기 제2 가닥의 3' 말단은 상기 제1 가닥의 5' 말단에 연결되거나, 또는 상기 제4 가닥의 3' 말단은 상기 제1 가닥의 5' 말단에 연결될 수 있다. In the present invention, one end of the first strand may be connected to one end of the second strand or the fourth strand. Preferably, the 3'end of the first strand is connected to the 5'end of the second strand, or the 3'end of the first strand is connected to the 5'end of the fourth strand, or the second The 3'end of the strand may be connected to the 5'end of the first strand, or the 3'end of the fourth strand may be connected to the 5'end of the first strand.
본 발명에서 상기 제3 가닥의 어느 일 말단은 상기 제4 가닥 또는 상기 제2 가닥의 어느 일 말단과 연결될 수 있다. 바람직하게는 상기 제4 가닥의 3' 말단은 상기 제3 가닥의 5' 말단에 연결되거나, 또는 상기 제2 가닥의 3' 말단은 상기 제3 가닥의 5' 말단에 연결되거나, 또는 상기 제3 가닥의 3' 말단은 상기 제4 가닥의 5' 말단에 연결되거나, 또는 상기 제3 가닥의 3' 말단은 상기 제2 가닥의 5' 말단에 연결될 수 있다.In the present invention, one end of the third strand may be connected to one end of the fourth strand or the second strand. Preferably, the 3'end of the fourth strand is connected to the 5'end of the third strand, or the 3'end of the second strand is connected to the 5'end of the third strand, or the third The 3'end of the strand may be connected to the 5'end of the fourth strand, or the 3'end of the third strand may be connected to the 5'end of the second strand.
도 25는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1-1 올리고뉴클레오티드(50a)의 3' 말단에 제1-2 올리고뉴클레오티드(50b)의 5' 말단이 연결되어 제1 가닥을 이루고, 제2-2 올리고뉴클레오티드(60b)의 3' 말단에 제2-1 올리고뉴클레오티드(60a)의 5' 말단이 연결되어 제2 가닥을 이룰 수 있다. 또한, 제1-3 올리고뉴클레오티드(50c)의 3' 말단에 상기 제1-1 올리고뉴클레오티드(50a)의 3'-5' 방향의 서열에 상보적인 제1 연장 올리고뉴클레오티드(70)의 5' 말단이 연결되어 제3 가닥을 이루고, 상기 제2-1 올리고뉴클레오티드(60a)의 3'-5' 방향의 서열에 상보적인 제2 연장 올리고뉴클레오티드(71)의 3' 말단에 제2-2 올리고뉴클레오티드(60b)의 5' 말단이 연결되어 제4 가닥을 이룰 수 있다. 이때 상기 제1 가닥의 3' 말단인 제1-2 올리고뉴클레오티드(50b)의 3' 말단에 상기 제2 가닥의 5' 말단인 제2-2 올리고뉴클레오티드(60b)의 5' 말단이 연결되어 하나의 가닥을 이룰 수 있다. 또한, 상기 제4 가닥의 제2-3 올리고뉴클레오티드(60c)의 3' 말단에 상기 제3 가닥의 5' 말단인 제1-3 올리고뉴클레오티드(50c)의 5' 말단이 연결되어 다른 하나의 가닥을 이룰 수 있다. Figure 25 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the 1-2 oligonucleotide (50b) at the 3'end of the 1-1 oligonucleotide (50a) This is connected to form a first strand, and the 2'oligonucleotide 3'end of the 2-2
도 26은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1-1 올리고뉴클레오티드(50a)의 3' 말단에 제1-2 올리고뉴클레오티드(50b)의 5' 말단이 연결되어 제1 가닥을 이루고, 제2-1 올리고뉴클레오티드(60a)의 3' 말단에 제2-2 올리고뉴클레오티드(60b)의 5' 말단이 연결되어 제2 가닥을 이룰 수 있다. 또한, 제1-3 올리고뉴클레오티드(50c)의 3' 말단에 상기 제1-1 올리고뉴클레오티드(50a)의 3'-5' 방향의 서열에 상보적인 제1 연장 올리고뉴클레오티드(70)의 5' 말단이 연결되어 제3 가닥을 이루고, 제2-3 올리고뉴클레오티드(60c)의 3' 말단에 상기 제2-1 올리고뉴클레오티드(60a)의 3'-5' 방향의 서열에 상보적인 제2 연장 올리고뉴클레오티드(71)의 5' 말단이 연결되어 제4 가닥을 이룰 수 있다. 이때 상기 제1 가닥의 3' 말단인 제1-2 올리고뉴클레오티드(50b)의 3' 말단에 상기 제4 가닥의 5' 말단인 제2-3 올리고뉴클레오티드(60c)의 5' 말단이 연결되어 하나의 가닥을 이룰 수 있다. 또한, 상기 제2 가닥의 3' 말단인 상기 제2-2 올리고뉴클레오티드(60b)의 3' 말단에 상기 제3 가닥의 5' 말단인 상기 제1-3 올리고뉴클레오티드(50c)의 5' 말단이 연결되어 다른 하나의 가닥을 이룰 수 있다. Figure 26 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the 1-2 oligonucleotide (50b) to the 3'end of the 1-1 oligonucleotide (50a) This is connected to form a first strand, and the 2'oligonucleotide 60' of the 2'oligonucleotide 60b is connected to the 5'end of the
도 27은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것으로, 제1-2 올리고뉴클레오티드(50b)의 3' 말단에 제1-1 올리고뉴클레오티드(50a)의 5' 말단이 연결되어 제1 가닥을 이루고, 제2-2 올리고뉴클레오티드(60b)의 3' 말단에 제2-1 올리고뉴클레오티드(60a)의 5' 말단이 연결되어 제2 가닥을 이룰 수 있다. 또한, 상기 제1-1 올리고뉴클레오티드(50a)의 3'-5' 방향의 서열에 상보적인 제1 연장 올리고뉴클레오티드(70)의 3' 말단에 제1-3 올리고뉴클레오티드(50c)의 5' 말단이 연결되어 제3 가닥을 이루고, 상기 제2-1 올리고뉴클레오티드(60a)의 3'-5' 방향의 서열에 상보적인 제2 연장 올리고뉴클레오티드(71)의 3' 말단에 제2-3 올리고뉴클레오티드(60c)의 5' 말단이 연결되어 제4 가닥을 이룰 수 있다. 이때 상기 제1 가닥의 5' 말단인 상기 제1-2 올리고뉴클레오티드(50b)의 5' 말단은 상기 제4 가닥의 3' 말단인 상기 제2-3 올리고뉴클레오티드(60c)의 3' 말단이 연결되어 하나의 가닥을 이룰 수 있다. 또한, 상기 제3 가닥의 3' 말단인 상기 제1-3 올리고뉴클레오티드(50c)의 3' 말단에 상기 제2 가닥의 5' 말단인 상기 제2-2 올리고뉴클레오티드(60b)의 5' 말단이 연결되어 다른 하나의 가닥을 이룰 수 있다. Figure 27 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention, the 5'end of the 1-1 oligonucleotide (50a) to the 3'end of the 1-2 oligonucleotide (50b) This is connected to form a first strand, and the 2'oligonucleotide 3'end of the 2-2
본 발명의 일 구체 예에 따르면, 이중 가닥의 올리고뉴클레오티드로서,According to one embodiment of the invention, as a double-stranded oligonucleotide,
t 개의 뉴클레오티드(nt) 길이의 제1 miRNA 전구체의 5' 말단 또는 3' 말단으로부터 A 번째 내지 B 번째의 연속된 염기서열로 이루어지는 제1-1 올리고뉴클레오티드 및 B+e 번째 내지 B+f 번째의 연속된 염기서열로 이루어지는 제1-2 올리고뉴클레오티드를 포함하는 제1 가닥;1-1 oligonucleotides consisting of A s to B sequential nucleotide sequences from 5'end or 3'end of the first miRNA precursor of t nucleotides (nt) in length, and B+e th to B+f th A first strand comprising a 1-2 oligonucleotide consisting of a continuous base sequence;
u 개의 뉴클레오티드(nt) 길이의 제2 miRNA 전구체의 5' 말단 또는 3' 말단으로부터 C 번째 내지 D 번째 연속된 염기서열로 이루어지는 제2-1 올리고뉴클레오티드 및 D+g 번째 내지 D+h 번째 연속된 염기서열로 이루어지는 제2-2 올리고뉴클레오티드를 포함하는 제2 가닥; 2-1 oligonucleotides consisting of C-th to D-th consecutive nucleotide sequences from the 5'end or 3'end of the second nucleotide (nt) length of u nucleotides, and D+g th to D+h th contiguous A second strand comprising a 2-2 oligonucleotide consisting of a base sequence;
상기 t 개의 뉴클레오티드(nt) 길이의 제1 miRNA 전구체의 5' 말단 또는 3' 말단으로부터 B+w 번째 내지 B+x 번째 연속된 염기서열로 이루어지는 제1-3 올리고뉴클레오티드를 포함하는 제3 가닥; 및A third strand comprising 1-3 oligonucleotides consisting of B+w th to B+x th consecutive nucleotide sequences from the 5'end or the 3'end of the t mi nucleotide (nt) first miRNA precursor; And
상기 u 개의 뉴클레오티드(nt) 길이의 제2 miRNA 전구체의 5' 말단 또는 3' 말단으로부터 D+y 번째 내지 D+z 번째 연속된 염기서열로 이루어지는 제2-3 올리고뉴클레오티드를 포함하는 제4 가닥을 포함하고, A fourth strand comprising a 2-3 oligonucleotide consisting of D+y th to D+z th consecutive nucleotide sequences from the 5'end or 3'end of the second nucleotide (nt) length of the u nucleotides (nt). Including,
상기 제1 가닥의 어느 일 말단은 상기 제2 가닥 또는 상기 제4 가닥의 어느 일 말단과 연결되며, One end of the first strand is connected to one end of the second strand or the fourth strand,
상기 제3 가닥의 어느 일 말단은 상기 제4 가닥 또는 상기 제2 가닥의 어느 일 말단과 연결되고, One end of the third strand is connected to one end of the fourth strand or the second strand,
상기 t 및 u는 각각 독립적으로 60 내지 150의 정수이고, The t and u are each independently an integer of 60 to 150,
상기 A 및 C는 각각 독립적으로 1 내지 10의 정수이며,A and C are each independently an integer of 1 to 10,
상기 B 및 D는 각각 독립적으로 18 내지 25의 정수이고,B and D are each independently an integer of 18 to 25,
상기 e 및 g는 각각 독립적으로 1 내지 5의 정수이며,E and g are each independently an integer of 1 to 5,
상기 f 및 h는 각각 독립적으로 5 내지 57의 정수이고, F and h are each independently an integer of 5 to 57,
상기 w 및 y는 각각 독립적으로 6 내지 62의 정수이며,W and y are each independently an integer of 6 to 62,
상기 x 및 z는 각각 독립적으로 11 내지 119의 정수일 수 있다. The x and z may be each independently an integer of 11 to 119.
본 발명에서 상기 제1 miRNA 전구체 및 제2 miRNA 전구체는 동일하거나 상이할 수 있다. In the present invention, the first miRNA precursor and the second miRNA precursor may be the same or different.
본 발명에서 상기 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드 각각은 상기 제1 miRNA 전구체의 임의의 단편이고, 이들 서열은 서로 전혀 상이하거나, 일부 중복되거나, 동일할 수 있으며, 이들의 서열은 특별히 제한하지 않는다.In the present invention, each of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide is any fragment of the first miRNA precursor, and these sequences are completely different from each other, partially overlapping, or identical It is possible, and their sequence is not particularly limited.
다만, 본 발명에서 상기 제1-1 올리고뉴클레오티드 및 상기 제1-2 올리고뉴클레오티드는 상기 제1 miRNA 전구체에 연속하여 배치되되, 다이서의 작용에 의해 절단될 수 있는 임의의 두 단편일 수 있다. However, in the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be any two fragments that are continuously disposed on the first miRNA precursor and can be cleaved by the action of a dicer.
바람직하게는, 본 발명에서 상기 제1-1 올리고뉴클레오티드는 인체 내에서 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 전 서열 또는 종자 서열을 포함할 수 있다. Preferably, in the present invention, the 1-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.
본 발명에서 상기 제2-1 올리고뉴클레오티드, 제2-2 올리고뉴클레오티드 및 제2-3 올리고뉴클레오티드는 각각은 상기 제2 miRNA 전구체의 임의의 단편이고, 이들 서열은 서로 전혀 상이하거나, 일부 중복되거나, 동일할 수 있으며, 이들의 서열은 특별히 제한하지 않는다. In the present invention, each of the 2-1 oligonucleotide, 2-2 oligonucleotide, and 2-3 oligonucleotide is any fragment of the second miRNA precursor, and these sequences are completely different from each other, partially overlapped, It may be the same, and their sequence is not particularly limited.
다만, 본 발명에서 상기 제2-1 올리고뉴클레오티드 및 상기 제2-2 올리고뉴클레오티드는 상기 제2 miRNA 전구체에 연속하여 배치되되, 다이서의 작용에 의해 절단될 수 있는 임의의 두 단편일 수 있다. However, in the present invention, the 2-1 oligonucleotide and the 2-2 oligonucleotide may be any two fragments that are continuously disposed on the second miRNA precursor and can be cleaved by the action of a dicer.
본 발명에서 상기 제2-1 올리고뉴클레오티드는 인체 내에서 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 전 서열 또는 종자 서열을 포함할 수 있다.In the present invention, the 2-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.
본 발명에서 상기 제1-1 올리고뉴클레오티드 및 상기 제2-1 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-1 oligonucleotide and the 2-1 oligonucleotide may be the same or different from each other.
본 발명에서 상기 제1-2 올리고뉴클레오티드 및 상기 제2-2 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-2 oligonucleotide and the 2-2 oligonucleotide may be the same or different from each other.
본 발명에서 상기 제1-3 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-3 oligonucleotide and the 2-3 oligonucleotide may be the same or different from each other.
본 발명의 상기 제1 가닥에서 상기 제1-1 올리고뉴클레오티드의 어느 일 말단은 상기 제1-2 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제1-2 올리고뉴클레오티드의 5' 말단은 상기 제1-1 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제1-1 올리고뉴클레오티드의 5' 말단은 상기 제1-2 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. Any one end of the 1-1 oligonucleotide in the first strand of the present invention may be connected to any one end of the 1-2 oligonucleotide, preferably the 5'end of the 1-2 oligonucleotide May be connected to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be connected to the 3'end of the 1-2 oligonucleotide.
본 발명에서 상기 제1-1 올리고뉴클레오티드와 상기 제1-2 올리고뉴클레오티드는 직접 연결될 수 있지만, 혹은 상기 제1-1 올리고뉴클레오티드와 상기 제1-2 올리고뉴클레오티드 사이에 제1-1 링커로, 제1-1 링커 뉴클레오티드 또는 제1-1 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be directly linked, or as a 1-1 linker between the 1-1 oligonucleotide and the 1-2 oligonucleotide, the It may further include a 1-1 linker nucleotide or a 1-1 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
또한, 본 발명의 상기 제2 가닥에서 상기 제2-1 올리고뉴클레오티드의 어느 일 말단은 상기 제2-2 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제2-1 올리고뉴클레오티드의 5' 말단은 상기 제2-2 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제2-2 올리고뉴클레오티드의 5' 말단은 상기 제2-1 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In addition, one end of the 2-1 oligonucleotide in the second strand of the present invention may be connected to any one end of the 2-2 oligonucleotide, preferably 5 of the 2-1 oligonucleotide The'end' may be linked to the 3'end of the 2-2 oligonucleotide, or the 5'end of the 2-2 oligonucleotide may be linked to the 3'end of the 2-1 oligonucleotide.
본 발명에서 상기 제2-2 올리고뉴클레오티드와 상기 제2-1 올리고뉴클레오티드는 직접 연결될 수 있지만, 혹은 상기 제2-2 올리고뉴클레오티드와 상기 제2-1 올리고뉴클레오티드 사이에 제2-1 링커로, 제2-1 링커 뉴클레오티드 또는 제2-1 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the 2-2 oligonucleotide and the 2-1 oligonucleotide may be directly linked, or a 2-1 linker between the 2-2 oligonucleotide and the 2-1 oligonucleotide may be used. It may further include a 2-1 linker nucleotide or a 2-1 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제3 가닥은 제1 연장 올리고뉴클레오티드를 더 포함할 수 있다. In the present invention, the third strand may further include a first extended oligonucleotide.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드와 혼성화될 수 있다. In the present invention, the first extended oligonucleotide may be hybridized with the first 1-1 oligonucleotide.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열과 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more with a sequence complementary to a 3'-5' nucleotide sequence of the 1-1 oligonucleotide. Above, 95%, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the first extended oligonucleotide may form a bubble structure by including the first-1-1 oligonucleotide and one or more miss-matching nucleotides.
본 발명에서 상기 제1-3 올리고뉴클레오티드의 어느 일 말단은 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단은 상기 제1-3 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제1-3 올리고뉴클레오티드의 5' 말단은 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, any one end of the first-3 oligonucleotide may be connected to any one end of the first extended oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is the first-3 oligonucleotide. It may be linked to the 3'end of the nucleotide, or the 5'end of the 1-3 oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.
본 발명에서 상기 제1-3 올리고뉴클레오티드와 상기 제1 연장 올리고뉴클레오티드는 직접 연결될 수 있지만, 혹은 상기 제1-3 올리고뉴클레오티드와 상기 제1 연장 올리고뉴클레오티드 사이에 제1-2 링커로, 제1-2 링커 뉴클레오티드 또는 제1-2 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the 1-3 oligonucleotide and the first extended oligonucleotide may be directly linked, or as a 1-2 linker between the 1-3 oligonucleotide and the first extended oligonucleotide, the first- It may further include 2 linker nucleotides or 1-2 linker oligonucleotides. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제1-1 링커 및 제1-2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, when the 1-1 linker and the 1-2 linker are included, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제1-1 링커 및 제1-2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the 1-1 linker and the 1-2 linker may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1-2 올리고뉴클레오티드 및 상기 제1-3 올리고뉴클레오티드는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다.In the present invention, the 1-2 oligonucleotide and the 1-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제4 가닥은 제2 연장 올리고뉴클레오티드를 더 포함할 수 있다. In the present invention, the fourth strand may further include a second extended oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드와 혼성화될 수 있다. In the present invention, the second extended oligonucleotide may be hybridized with the 2-1 oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열과 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the second extended oligonucleotide is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more with a sequence complementary to a 3'-5' nucleotide sequence of the 2-1 oligonucleotide. Above, 95%, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homogeneity of the base sequence having a homology can be prepared.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the second extended oligonucleotide may form a bubble structure by including the 2-1 oligonucleotide and one or more mismatching nucleotides.
본 발명에서 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단은 상기 제2-3 올리고뉴클레오티드의 어느 일 말단에 연결될 수 있고, 바람직하게는 상기 제2 연장 올리고뉴클레오티드의 5' 말단은 상기 제2-3 올리고뉴클레오티드의 3' 말단에 연결될 수 있고, 혹은 상기 제2-3 올리고뉴클레오티드의 5' 말단은 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결될 수 있다. In the present invention, one end of the second extended oligonucleotide may be connected to any one end of the second-3 oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is the second-3 oligonucleotide. It may be linked to the 3'end of the nucleotide, or the 5'end of the 2-3 oligonucleotide may be linked to the 3'end of the second extended oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드와 상기 제2-3 올리고뉴클레오티드는 직접 연결될 수 있지만, 혹은 상기 제2 연장 올리고뉴클레오티드와 상기 제2-3 올리고뉴클레오티드 사이에 제2-2 링커로, 제2-2 링커 뉴클레오티드 또는 제2-2 링커 올리고뉴클레오티드를 더 포함할 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the second extended oligonucleotide and the second-3 oligonucleotide may be directly linked, or as a second-2 linker between the second extended oligonucleotide and the second-3 oligonucleotide, second- It may further include a 2 linker nucleotide or a 2-2 linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제2-1 링커 및 제2-2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, when the 2-1 linker and the 2-2 linker are included, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제2-1 링커 및 제2-2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다.In addition, in the present invention, the 2-1 linker and the 2-2 linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제2-2 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다.In the present invention, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1 가닥의 어느 일 말단은 상기 제2 가닥 또는 상기 제4 가닥의 어느 일 말단과 연결될 수 있다. 바람직하게는 상기 제1 가닥의 3' 말단은 상기 제2 가닥의 5' 말단에 연결되거나, 또는 상기 제1 가닥의 3' 말단은 상기 제4 가닥의 5' 말단에 연결되거나, 또는 상기 제2 가닥의 3' 말단은 상기 제1 가닥의 5' 말단에 연결되거나, 또는 상기 제4 가닥의 3' 말단은 상기 제1 가닥의 5' 말단에 연결될 수 있다. In the present invention, one end of the first strand may be connected to one end of the second strand or the fourth strand. Preferably, the 3'end of the first strand is connected to the 5'end of the second strand, or the 3'end of the first strand is connected to the 5'end of the fourth strand, or the second The 3'end of the strand may be connected to the 5'end of the first strand, or the 3'end of the fourth strand may be connected to the 5'end of the first strand.
본 발명에서 상기 제3 가닥의 어느 일 말단은 상기 제4 가닥 또는 상기 제2 가닥의 어느 일 말단과 연결될 수 있다. 바람직하게는 상기 제4 가닥의 3' 말단은 상기 제3 가닥의 5' 말단에 연결되거나, 또는 상기 제2 가닥의 3' 말단은 상기 제3 가닥의 5' 말단에 연결되거나, 또는 상기 제3 가닥의 3' 말단은 상기 제4 가닥의 5' 말단에 연결되거나, 또는 상기 제3 가닥의 3' 말단은 상기 제2 가닥의 5' 말단에 연결될 수 있다. In the present invention, one end of the third strand may be connected to one end of the fourth strand or the second strand. Preferably, the 3'end of the fourth strand is connected to the 5'end of the third strand, or the 3'end of the second strand is connected to the 5'end of the third strand, or the third The 3'end of the strand may be connected to the 5'end of the fourth strand, or the 3'end of the third strand may be connected to the 5'end of the second strand.
본 발명의 다른 구현 예에 따르면, 이중 가닥의 올리고뉴클레오티드를 제조하는 방법으로서, According to another embodiment of the present invention, as a method for preparing a double-stranded oligonucleotide,
목적하는 제1 올리고뉴클레오티드 및 제2 올리고뉴클레오티드를 준비하는 단계;Preparing a desired first oligonucleotide and a second oligonucleotide;
상기 제2 올리고뉴클레오티드와 혼성화될 수 있는 제1 연장 올리고뉴클레오티드를 합성하는 단계; 및Synthesizing a first extended oligonucleotide capable of hybridizing with the second oligonucleotide; And
상기 제1 올리고뉴클레오티드와 혼성화될 수 있는 제2 연장 올리고뉴클레오티드를 합성하는 단계를 포함할 수 있다. And synthesizing a second extended oligonucleotide capable of hybridizing with the first oligonucleotide.
본 발명에서 상기 제1 올리고뉴클레오티드는 타겟 유전자의 발현을 조절하여 목적하는 기능을 하는 것으로 알려진 목적하는 제1 miRNA의 전 사슬 또는 그 일부 단편을 포함할 수 있다. In the present invention, the first oligonucleotide may include the entire chain of the desired first miRNA or a partial fragment thereof, which is known to function by controlling the expression of the target gene.
본 발명에서 상기 제2 올리고뉴클레오티드는 타겟 유전자의 발현을 조절하여 목적하는 기능을 하는 것으로 알려진 목적하는 제2 miRNA의 전 사슬 또는 그 일부 단편을 포함할 수 있다.In the present invention, the second oligonucleotide may include the entire chain of the desired second miRNA or some fragment thereof, which is known to function by controlling the expression of the target gene.
본 발명에서 상기 제1 올리고뉴클레오티드 및 상기 제2 올리고뉴클레오티드 각각의 목적하는 miRNA로, 상기 목적하는 제1 miRNA 및 상기 목적하는 제2 miRNA는 서로 동일하거나 상이할 수 있다. In the present invention, the desired miRNA of each of the first oligonucleotide and the second oligonucleotide may be the same or different from the desired first miRNA and the desired second miRNA.
본 발명에서 상기 목적하는 제1 miRNA 및 상기 목적하는 제2 miRNA 각각의 전 사슬의 길이는 특별히 제한하지는 않지만, 바람직하게는 18~25개의 뉴클레오티드의 길이일 수 있다. In the present invention, the length of the entire chain of each of the target first miRNA and the target second miRNA is not particularly limited, but may preferably be 18 to 25 nucleotides in length.
또한, 본 발명에서 상기 제1 올리고뉴클레오티드 및 제2 올리고뉴클레오티드 각각은 상기한 바와 같이 성숙한 miRNA일 수 있으나, miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA) 또는 플라스미드 (plasmid) 형태의 miRNA 전구체의 전 사슬 또는 이들의 단편을 포함할 수 있다. 다만, 본 발명에서 miRNA 전구체 또는 일차 miRNA를 구성하는 핵산 분자는 50 내지 100nt, 더욱 바람직하게는 65 내지 95nt 길이를 가질 수 있다.In addition, in the present invention, each of the first oligonucleotide and the second oligonucleotide may be a mature miRNA as described above, but miRNA precursor in the form of miRNA precursor, primary miRNA (pri-miRNA) or plasmid (plasmid). It may include the entire chain or fragments thereof. However, in the present invention, the nucleic acid molecule constituting the miRNA precursor or the primary miRNA may have a length of 50 to 100 nt, more preferably 65 to 95 nt.
본 발명에서 상기 miRNA 단편은, 목적하는 miRNA의 종자 서열을 포함하거나, 상기 종자 서열과 90% 이상의 상동성을 갖는 염기서열로 이루어질 수 있다. In the present invention, the miRNA fragment may include a desired miRNA seed sequence, or may be composed of a nucleotide sequence having 90% or more homology with the seed sequence.
본 발명에서 상기 miRNA 단편의 길이는 특별히 제한하지는 않지만, 바람직하게는 9~11 nt일 수 있다. In the present invention, the length of the miRNA fragment is not particularly limited, but may preferably be 9 to 11 nt.
본 발명에서 상기 miRNA 단편은 목적하는 miRNA를 절단하여 제작하거나, 목적하는 miRNA의 어느 일 단편의 염기서열과 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다. In the present invention, the miRNA fragment is produced by cutting the desired miRNA, or 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more and the base sequence of any one fragment of the desired miRNA , 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상 또는 100%의 상동성을 갖는 염기서열로 이루어질 수 있다. In the present invention, the first extended oligonucleotide is capable of hybridizing with the second oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the second oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 하나 이상의 미스 매칭(mis-matching) 뉴클레오티드 (즉, 비상보적 염기쌍)를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the first extended oligonucleotide may form a bubble structure by including the second oligonucleotide and one or more mis-matching nucleotides (ie, non-complementary base pairs).
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상 또는 100%의 상동성을 갖는 염기서열로 이루어질 수 있다.In the present invention, the second extended oligonucleotide can be hybridized with the first oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the first oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the second extended oligonucleotide may form a bubble structure by including the first oligonucleotide and one or more mismatching nucleotides.
본 발명에서 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단을 상기 제1 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단을 상기 제1 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제1 올리고뉴클레오티드의 5' 말단을 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다. In the present invention, any one end of the first extended oligonucleotide may be connected to any one end of the first oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is 3 of the first oligonucleotide. It can be linked to the'end, or the 5'end of the first oligonucleotide to the 3'end of the first extended oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단을 상기 제2 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제2 연장 올리고뉴클레오티드의 5' 말단을 상기 제2 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제2 올리고뉴클레오티드의 5' 말단을 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다. In the present invention, any one end of the second extended oligonucleotide may be linked to any one end of the second oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is 3 of the second oligonucleotide. It can be linked to the'end, or the 5'end of the second oligonucleotide to the 3'end of the second extended oligonucleotide.
본 발명에서 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단을 상기 제1 올리고뉴클레오티드의 3' 말단에 연결시키고, 상기 제2 연장 올리고뉴클레오티드의 5' 말단을 상기 제2 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다. In the present invention, preferably, the 5'end of the first extended oligonucleotide is connected to the 3'end of the first oligonucleotide, and the 5'end of the second extended oligonucleotide is 3'end of the second oligonucleotide. Can be connected to.
본 발명에서 바람직하게는 상기 제1 올리고뉴클레오티드의 5' 말단을 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결시키고, 상기 제2 올리고뉴클레오티드의 5' 말단을 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다.In the present invention, preferably, the 5'end of the first oligonucleotide is connected to the 3'end of the first extended oligonucleotide, and the 5'end of the second oligonucleotide is 3'end of the second extended oligonucleotide. Can be connected to.
본 발명에서 상기 제1 가닥의 5' 말단, 제1 올리고뉴클레오티드의 5' 말단 또는 제1 연장 올리고뉴클레오티드의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드를 추가로 연장시킬 수 있다. In the present invention, the first cap nucleotide or the first cap oligonucleotide may be further extended to the 5'end of the first strand, the 5'end of the first oligonucleotide, or the 5'end of the first extended oligonucleotide.
본 발명에서 상기 제1 캡 뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드이거나, 목적하는 제1 miRNA의 5' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first cap nucleotide is not particularly limited, but may be a nucleotide whose base is uracil (U), or a first or second nucleotide from the 5'end of the desired first miRNA, but is not limited thereto. It does not work.
본 발명에서 상기 제1 캡 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드를 포함할 수 있고, 혹은 목적하는 제1 miRNA의 5' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from 1 to 3 of the 5'end of the desired first miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.
본 발명에서 상기 제2 가닥의 5' 말단, 제2 올리고뉴클레오티드의 5' 말단 또는 제2 연장 올리고뉴클레오티드의 5' 말단에 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드를 추가로 연장시킬 수 있다.In the present invention, the second cap nucleotide or the second cap oligonucleotide may be further extended to the 5'end of the second strand, the 5'end of the second oligonucleotide, or the 5'end of the second extended oligonucleotide.
본 발명에서 상기 제2 캡 뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드이거나, 목적하는 제2 miRNA의 5' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second cap nucleotide is not particularly limited, but may be a nucleotide whose base is uracil (U) or a first or second nucleotide from the 5'end of the desired second miRNA, but is not limited thereto. It does not work.
본 발명에서 상기 제2 캡 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드를 포함할 수 있고, 혹은 목적하는 제2 miRNA의 5' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from 1 to 3 of the 5'end of the desired second miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.
본 발명에서 상기 제1 올리고뉴클레오티드와 상기 제1 연장 올리고뉴클레오티드를 직접적으로 연결시킬 수 있으나, 그 사이에 제1 링커로, 제1 링커 뉴클레오티드 또는 제1 링커 올리고뉴클레오티드를 추가로 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, the first oligonucleotide and the first extended oligonucleotide can be directly linked, but a first linker nucleotide or a first linker oligonucleotide may be further included as a first linker therebetween. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제2 올리고뉴클레오티드와 상기 제2 연장 올리고뉴클레오티드를 직접적으로 연결시킬 수 있으나, 그 사이에 제2 링커로, 제2 링커 뉴클레오티드 또는 제2 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다.In the present invention, the second oligonucleotide and the second extended oligonucleotide may be directly linked, but a second linker nucleotide or a second linker oligonucleotide may be further included as a second linker therebetween. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제1 링커 및 제2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. When the first linker and the second linker are included in the present invention, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제1 링커 및 제2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the first linker and the second linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1 가닥의 3' 말단, 제1 연장 올리고뉴클레오티드의 3' 말단 또는 제1 올리고뉴클레오티드의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드를 추가로 연장시킬 수 있다.In the present invention, the first terminal nucleotide or the first terminal oligonucleotide may be further extended to the 3'terminal of the first strand, the 3'terminal of the first extended oligonucleotide, or the 3'terminal of the first oligonucleotide.
본 발명에서 상기 제1 말단 뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드이거나, 목적하는 제1 miRNA의 3' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or a first or second nucleotide from the 3'end of the desired first miRNA, but is not limited thereto. It does not work.
본 발명에서 상기 제1 말단 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드를 포함할 수 있고, 혹은 목적하는 제1 miRNA의 3' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but may include a nucleotide whose base is adenine (A), or from 1 to 3 of the 3'end of the desired first miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.
본 발명에서 상기 제2 가닥의 3' 말단, 제2 연장 올리고뉴클레오티드의 3' 말단, 또는 제2 올리고뉴클레오티드의 3' 말단에 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드를 추가로 연장시킬 수 있다. In the present invention, the second terminal nucleotide or the second terminal oligonucleotide may be further extended to the 3'terminal of the second strand, the 3'terminal of the second extended oligonucleotide, or the 3'terminal of the second oligonucleotide.
본 발명에서 상기 제2 말단 뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드이거나, 목적하는 제2 miRNA의 3' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or a first or second nucleotide from the 3'end of the desired second miRNA, but is not limited thereto. It does not work.
본 발명에서 상기 제2 말단 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드를 포함할 수 있고, 혹은 목적하는 제2 miRNA의 3' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but may include a nucleotide whose base is adenine (A), or the first to third from the 3'end of the desired second miRNA. It may be a continuous oligonucleotide, or a first to second consecutive oligonucleotide, but is not limited thereto.
본 발명에서 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드; 및 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드;를 연장하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide; when extended, they may be arranged to face each other in a double strand.
또한 본 발명에서 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드; 및 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드;는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
또한, 본 발명에서 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드; 및 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드;를 연장하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In addition, the second cap nucleotide or the second cap oligonucleotide in the present invention; And the first terminal nucleotide or the first terminal oligonucleotide; when extending, they may be arranged to face each other in a double strand.
또한 본 발명에서 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드; 및 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드;는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the second cap nucleotide or the second cap oligonucleotide; And the first terminal nucleotide or the first terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
다만, 본 발명의 제조 방법에서 각 올리고뉴클레오티드를 합성하는 순서 및 합성된 각 올리고뉴클레오티드를 연결하는 순서는 특별히 제한하지 않는다. However, in the production method of the present invention, the order of synthesizing each oligonucleotide and the order of linking each synthesized oligonucleotide is not particularly limited.
본 발명의 일 구체 예에 따르면, 이중 가닥의 올리고뉴클레오티드를 제조하는 방법으로서,According to an embodiment of the present invention, as a method for preparing a double-stranded oligonucleotide,
m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 a 번째 내지 p 번째의 연속된 염기서열로 이루어지는 제1 올리고뉴클레오티드를 준비하는 단계; preparing a first oligonucleotide composed of a s to p sequential sequencing from the 5'end of the m nucleotide (nt) miRNA;
n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 b 번째 내지 q 번째의 연속된 염기서열로 이루어지는 제2 올리고뉴클레오티드를 준비하는 단계; preparing a second oligonucleotide consisting of consecutive sequences of b th to q th from the 5'end of the n nucleotide (nt) miRNA;
상기 제2 올리고뉴클레오티드와 혼성화될 수 있는 제1 연장 올리고뉴클레오티드를 합성하는 단계; 및Synthesizing a first extended oligonucleotide capable of hybridizing with the second oligonucleotide; And
상기 제1 올리고뉴클레오티드와 혼성화될 수 있는 제2 연장 올리고뉴클레오티드를 합성하는 단계를 포함하며, And synthesizing a second extended oligonucleotide capable of hybridizing with the first oligonucleotide,
상기 m 및 n은 각각 독립적으로 18 내지 25의 정수이고, M and n are each independently an integer of 18 to 25,
a 및 b는 각각 독립적으로 1 내지 3의 정수이며, a and b are each independently an integer from 1 to 3,
상기 p는 10 내지 m의 정수이고,P is an integer from 10 to m,
상기 q는 10 내지 n의 정수이다. Q is an integer of 10 to n.
본 발명에서 상기 제1 올리고뉴클레오티드 및 제2 올리고뉴클레오티드 각각은 miRNA의 전 서열이거나 그 단편으로, 이때 성숙한 miRNA, miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA) 또는 플라스미드 (plasmid) 형태의 miRNA 전구체의 전 서열 또는 그 단편을 포함할 수 있다. In the present invention, each of the first oligonucleotide and the second oligonucleotide is a full sequence of miRNA or a fragment thereof, wherein mature miRNA, miRNA precursor, primary miRNA (pri-miRNA) or plasmid miRNA It may include the entire sequence of a precursor or a fragment thereof.
본 발명에서 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA와 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA는 서로 동일하거나 상이할 수 있다. In the present invention, the m nucleotide (nt) length of the miRNA and the n nucleotide (nt) length of the miRNA may be the same or different from each other.
본 발명에서 상기 제1 올리고뉴클레오티드 및 제2 올리고뉴클레오티드의 서열은 서로 동일하거나 상이할 수 있다.In the present invention, the sequences of the first oligonucleotide and the second oligonucleotide may be identical to or different from each other.
본 발명에서 상기 제1 올리고뉴클레오티드는 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 내지 p 번째의 연속된 염기서열로 이루어질 수 있다. In the present invention, the first oligonucleotide may be composed of 1 to p consecutive sequences from the 5'end of miRNA of m nucleotides (nt) in length.
본 발명에서 상기 제1 올리고뉴클레오티드는 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 2 번째 내지 p 번째의 연속된 염기서열로 이루어질 수 있다. In the present invention, the first oligonucleotide may be composed of 2 to p-th consecutive base sequences from the 5'end of miRNAs of m nucleotides (nt) in length.
본 발명에서 상기 제2 올리고뉴클레오티드는 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 내지 q 번째의 연속된 염기서열로 이루어질 수 있다. In the present invention, the second oligonucleotide may be composed of 1 to q sequential sequencing sequences from the 5'end of miRNA of n nucleotides (nt) in length.
본 발명에서 상기 제2 올리고뉴클레오티드는 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 2 번째 내지 q 번째의 연속된 염기서열로 이루어질 수 있다.In the present invention, the second oligonucleotide may be composed of 2 to q sequential sequencing sequences from the 5'end of miRNA of n nucleotides (nt) in length.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열과 혼성화할 수 있는 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the first extended oligonucleotide is capable of hybridizing with the second oligonucleotide, 90% or more with an oligonucleotide capable of hybridizing with the nucleotide sequence in the 3'-5' direction of the second oligonucleotide, 91 % Or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homogeneous sequence Can be produced.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the first extended oligonucleotide may form a bubble structure by including the second oligonucleotide and one or more mismatching nucleotides.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열과 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the second extended oligonucleotide can be hybridized with the first oligonucleotide, 90% or more, 91% or more with an oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the first oligonucleotide. , 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology to be composed of base sequences having homology. have.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the second extended oligonucleotide may form a bubble structure by including the first oligonucleotide and one or more mismatching nucleotides.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열의 1 번째 내지 q-b 번째 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다. In the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% or more with an oligonucleotide complementary to the 1st to qbth nucleotide sequence of the 3'-5' direction of the second oligonucleotide. It can be synthesized to be composed of a base sequence having a homology of 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열의 1 번째 내지 q-b-1 번째 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다. In the present invention, the first extended oligonucleotide is 90% or more, 91% or more, 92% with an oligonucleotide complementary to the 1st to qb-1th nucleotide sequence of the 3'-5' nucleotide sequence of the second oligonucleotide. Or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.
또한, 본 발명에서 상기 제2 연장 올리고뉴클레오티드는 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열의 1 번째 내지 p-a 번째 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In addition, in the present invention, the second extended oligonucleotide is 90% or more, 91% or more, 92% with an oligonucleotide complementary to the 1st to path nucleotide sequence of the 3'-5' direction of the first oligonucleotide. Or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology to be composed of base sequences having homology.
또한, 본 발명에서 상기 제2 연장 올리고뉴클레오티드는 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열의 1 번째 내지 p-a-1 번째 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In addition, in the present invention, the second extended oligonucleotide is 90% or more, 91% or more, with an oligonucleotide complementary to the 1st to pa-1th nucleotide sequence of the 3'-5' direction of the first oligonucleotide. It can be synthesized and produced to consist of a base sequence having a homology of 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology. .
본 발명에서 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단을 상기 제1 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단을 상기 제1 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제1 올리고뉴클레오티드의 5' 말단을 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다. In the present invention, any one end of the first extended oligonucleotide may be connected to any one end of the first oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is 3 of the first oligonucleotide. It can be linked to the'end, or the 5'end of the first oligonucleotide to the 3'end of the first extended oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단을 상기 제2 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제2 연장 올리고뉴클레오티드의 5' 말단을 상기 제2 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제2 올리고뉴클레오티드의 5' 말단을 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다. In the present invention, any one end of the second extended oligonucleotide may be linked to any one end of the second oligonucleotide, and preferably the 5'end of the second extended oligonucleotide is 3 of the second oligonucleotide. It can be linked to the'end, or the 5'end of the second oligonucleotide to the 3'end of the second extended oligonucleotide.
본 발명에서 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단을 상기 제1 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 상기 제2 연장 올리고뉴클레오티드의 5' 말단을 상기 제2 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다. In the present invention, preferably, the 5'end of the first extended oligonucleotide can be linked to the 3'end of the first oligonucleotide, and the 5'end of the second extended oligonucleotide is 3 of the second oligonucleotide. 'Can be connected to the terminal.
본 발명에서 바람직하게는 상기 제1 올리고뉴클레오티드의 5' 말단을 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 상기 제2 올리고뉴클레오티드의 5' 말단을 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다.In the present invention, preferably, the 5'end of the first oligonucleotide can be linked to the 3'end of the first extended oligonucleotide, and the 5'end of the second oligonucleotide is 3 of the second extended oligonucleotide. 'Can be connected to the terminal.
또한, 본 발명에서 상기 제1 가닥의 5' 말단, 제1 올리고뉴클레오티드의 5' 말단, 또는 제1 연장 올리고뉴클레오티드의 5' 말단에 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드를 추가로 연장시킬 수 있다. In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide may be further extended to the 5'end of the first strand, the 5'end of the first oligonucleotide, or the 5'end of the first extended oligonucleotide. have.
본 발명에서 상기 제1 캡 뉴클레오티드의 서열은 특별히 제한하지는 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드이거나, 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first cap nucleotide is not particularly limited, but the base is uracil (U) nucleotide, or the first or second nucleotide from the 5'end of the m nucleotide (nt) length miRNA. However, it is not limited thereto.
본 발명에서 상기 제1 캡 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드를 포함할 수 있고, 혹은 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the first cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from the 5′ end of the m nucleotide (nt) length miRNA. The third to third consecutive oligonucleotides, or the first to second consecutive oligonucleotides, but are not limited thereto.
본 발명에서 상기 제2 가닥의 5' 말단, 제2 올리고뉴클레오티드의 5' 말단, 또는 제2 연장 올리고뉴클레오티드의 5' 말단에 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드를 추가로 연장시킬 수 있다. In the present invention, a second cap nucleotide or a second cap oligonucleotide may be further extended to the 5'end of the second strand, the 5'end of the second oligonucleotide, or the 5'end of the second extended oligonucleotide.
본 발명에서 상기 제2 캡 뉴클레오티드의 서열은 특별히 제한하지는 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드이거나, 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 또는 2 번째 뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second cap nucleotide is not particularly limited, but the base is a uracil (U) nucleotide, or the first or second nucleotide from the 5'end of the n nucleotide (nt) length miRNA. However, it is not limited thereto.
본 발명에서 상기 제2 캡 올리고뉴클레오티드의 서열은 특별히 제한하지 않으나, 염기가 우라실(uracil, U)인 뉴클레오티드를 포함할 수 있고, 혹은 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 1 번째 내지 3 번째의 연속하는 올리고뉴클레오티드, 또는 1 번째 내지 2 번째의 연속하는 올리고뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the sequence of the second cap oligonucleotide is not particularly limited, but may include a nucleotide whose base is uracil (U), or from the 5'end of the n nucleotide (nt) length miRNA 1 The third to third consecutive oligonucleotides, or the first to second consecutive oligonucleotides, but are not limited thereto.
본 발명에서 상기 제1 캡 뉴클레오티드 및 제2 캡 뉴클레오티드 중 적어도 하나는 염기가 우라실(uracil, U)인 뉴클레오티드인 것이 타겟 유전자와의 상호 결합력을 높일 수 있다. In the present invention, at least one of the first cap nucleotide and the second cap nucleotide is a nucleotide having a base of uracil (U), thereby enhancing a cross-linking ability with a target gene.
본 발명에서 상기 제1 캡 올리고뉴클레오티드 및 제2 캡 올리고뉴클레오티드 중 적어도 하나는 염기가 우라실(uracil, U)인 뉴클레오티드를 포함하는 것이 타겟 유전자와의 상호 결합력을 높일 수 있다. In the present invention, at least one of the first cap oligonucleotide and the second cap oligonucleotide includes a nucleotide having a base of uracil (U), thereby increasing a binding force with a target gene.
본 발명에서 상기 제1 연장 올리고뉴클레오티드의 5' 말단을 상기 제1 올리고뉴클레오티드의 3' 말단에 연결시키기에 앞서, 상기 제1 올리고뉴클레오티드의 3' 말단 또는 상기 제1 연장 올리고뉴클레오티드의 5' 말단에 제1 링커 뉴클레오티드 또는 제1 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In the present invention, prior to connecting the 5'end of the first oligonucleotide to the 3'end of the first oligonucleotide, to the 3'end of the first oligonucleotide or the 5'end of the first extended oligonucleotide. The first linker nucleotide or the first linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제1 링커 뉴클레오티드는 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 p+1 번째 뉴클레오티드일 수 있다. 단, 여기서 상기 p는 10 내지 m-1의 정수일 수 있다. In the present invention, the first linker nucleotide may be a p+1 th nucleotide from the 5'end of the mRNA of m nucleotides (nt) in length. However, the p may be an integer of 10 to m-1.
본 발명에서 상기 제1 링커 올리고뉴클레오티드는 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 p+1 번째 내지 p+r 번째의 연속된 염기서열로 이루어지는 올리고뉴클레오티드일 수 있다. 여기서 상기 r은 2 내지 4의 정수일 수 있다. 단, 여기서 상기 p는 10 이상이되, 그 최대값은 m-4 내지 m-2의 정수일 수 있다.In the present invention, the first linker oligonucleotide may be an oligonucleotide consisting of p+1 th to p+r th consecutive nucleotide sequences from the 5'end of the m nucleotide (nt) length miRNA. Here, r may be an integer from 2 to 4. However, where p is 10 or more, the maximum value may be an integer of m-4 to m-2.
또한, 본 발명에서 상기 제2 연장 올리고뉴클레오티드의 5' 말단을 상기 제2 올리고뉴클레오티드의 3' 말단에 연결시키기에 앞서, 상기 제2 올리고뉴클레오티드의 3' 말단 또는 상기 제2 연장 올리고뉴클레오티드의 5' 말단에 제2 링커 뉴클레오티드 또는 제2 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. In addition, prior to linking the 5'end of the second oligonucleotide to the 3'end of the second oligonucleotide in the present invention, the 3'end of the second oligonucleotide or the 5'end of the second extended oligonucleotide. The terminal may further include a second linker nucleotide or a second linker oligonucleotide. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제2 링커 뉴클레오티드는 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 q+1 번째 뉴클레오티드일 수 있다. 단, 여기서 상기 q는 10 내지 n-1의 정수일 수 있다.In the present invention, the second linker nucleotide may be a q+1 th nucleotide from the 5'end of the n nucleotide (nt) length miRNA. However, the q may be an integer of 10 to n-1.
본 발명에서 상기 제2 링커 올리고뉴클레오티드는 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 q+1 번째 내지 q+s 번째의 연속된 염기서열로 이루어지는 올리고뉴클레오티드일 수 있다. 여기서 상기 s는 2 내지 4의 정수일 수 있다. 단, 여기서 상기 p는 10 이상이되, 그 최대값은 n-4 내지 n-2의 정수일 수 있다.In the present invention, the second linker oligonucleotide may be an oligonucleotide consisting of a sequence of q+1 th to q+s th consecutive sequences from the 5'end of the n nucleotide (nt) miRNA. Here, s may be an integer from 2 to 4. However, where p is 10 or more, the maximum value may be an integer of n-4 to n-2.
본 발명에서 상기 제1 링커 및 제2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. When the first linker and the second linker are included in the present invention, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제1 링커 및 제2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the first linker and the second linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
또한, 본 발명에서 상기 제1 가닥의 3' 말단, 제1 연장 올리고뉴클레오티드의 3' 말단 또는 제1 올리고뉴클레오티드의 3' 말단에 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드를 추가로 연장할 수 있다. Further, in the present invention, the first terminal nucleotide or the first terminal oligonucleotide may be further extended to the 3'terminal of the first strand, the 3'terminal of the first extended oligonucleotide, or the 3'terminal of the first oligonucleotide. .
본 발명에서 상기 제1 말단 뉴클레오티드의 서열을 특별히 제한하지는 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드이거나, 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 m 번째 뉴클레오티드일 수 있다. In the present invention, the sequence of the first terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or m th nucleotide of the m nucleotide (nt) length miRNA.
본 발명에서 상기 제1 말단 올리고뉴클레오티드의 서열을 특별히 제한하지는 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드를 포함하거나, 상기 m 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 m-c 번째 내지 m 번째의 연속된 염기서열로 이루어질 수 있다. 여기서, 상기 c는 1 내지 3의 정수, 또는 1 또는 2의 정수일 수 있다. In the present invention, the sequence of the first terminal oligonucleotide is not particularly limited, but includes a nucleotide whose base is adenine (A), or mc th to m from the 5'end of the m nucleotide (nt) length miRNA. It may consist of a sequence of sequential sequences. Here, c may be an integer from 1 to 3, or an integer from 1 to 2.
본 발명에서 상기 제2 가닥의 3' 말단, 상기 제2 연장 올리고뉴클레오티드의 3' 말단 또는 상기 제2 올리고뉴클레오티드의 3' 말단에 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드를 추가로 연장할 수 있다.In the present invention, a second terminal nucleotide or a second terminal oligonucleotide may be further extended to the 3'end of the second strand, the 3'end of the second extended oligonucleotide, or the 3'end of the second oligonucleotide. .
본 발명에서 상기 제2 말단 뉴클레오티드의 서열을 특별히 제한하지는 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드이거나, 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 n 번째 뉴클레오티드일 수 있다. In the present invention, the sequence of the second terminal nucleotide is not particularly limited, but may be a nucleotide whose base is adenine (A) or the n th nucleotide of the n nucleotide (nt) length miRNA.
본 발명에서 상기 제2 말단 올리고뉴클레오티드의 서열을 특별히 제한하지는 않으나, 염기가 아데닌(adenine, A)인 뉴클레오티드를 포함하거나, 상기 n 개의 뉴클레오티드(nt) 길이의 miRNA의 5' 말단으로부터 n-d 번째 내지 n 번째의 연속된 염기서열로 이루어질 수 있다. 여기서, 상기 d는 1 내지 3의 정수, 또는 1 또는 2의 정수일 수 있다. In the present invention, the sequence of the second terminal oligonucleotide is not particularly limited, but includes a nucleotide whose base is adenine (A), or nd th to n from the 5'end of the n nucleotide (nt) length miRNA. It may consist of a sequence of sequential sequences. Here, d may be an integer from 1 to 3, or an integer from 1 to 2.
본 발명에서 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드; 및 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드;를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.
또한 본 발명에서 상기 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드; 및 상기 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드;는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the first cap nucleotide or the first cap oligonucleotide; And the second terminal nucleotide or the second terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
또한, 본 발명에서 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드; 및 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드;를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In addition, the second cap nucleotide or the second cap oligonucleotide in the present invention; And the first terminal nucleotide or the first terminal oligonucleotide; if included, they may be arranged to face each other in a double strand.
또한 본 발명에서 상기 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드; 및 상기 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드;는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the second cap nucleotide or the second cap oligonucleotide; And the first terminal nucleotide or the first terminal oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
다만, 본 발명의 제조 방법에서 각 올리고뉴클레오티드를 합성하는 순서 및 합성된 각 올리고뉴클레오티드를 연결하는 순서는 특별히 제한하지 않는다. However, in the production method of the present invention, the order of synthesizing each oligonucleotide and the order of linking each synthesized oligonucleotide is not particularly limited.
본 발명의 다른 구현 예에 따르면, 이중 가닥의 올리고뉴클레오티드를 제조하는 방법으로서, According to another embodiment of the present invention, as a method for preparing a double-stranded oligonucleotide,
목적하는 제1 miRNA 전구체의 어느 일 단편인 제1-1 올리고뉴클레오티드 및 다른 일 단편인 제1-2 올리고뉴클레오티드를 포함하는 제1 가닥을 준비하는 단계; Preparing a first strand comprising a 1-1 oligonucleotide which is a fragment of the desired first miRNA precursor and a 1-2 oligonucleotide that is the other fragment;
목적하는 제2 miRNA 전구체의 어느 일 단편인 제2-1 올리고뉴클레오티드 및 다른 일 단편인 제2-2 올리고뉴클레오티드를 포함하는 제2 가닥을 준비하는 단계; Preparing a second strand comprising a second 1 oligonucleotide, which is a fragment of the desired second miRNA precursor, and a second fragment, the second oligonucleotide;
목적하는 제1 miRNA 전구체의 또 다른 일 단편인 제1-3 올리고뉴클레오티드를 포함하는 제3 가닥을 준비하는 단계;Preparing a third strand comprising 1-3 oligonucleotides, which is another fragment of the desired first miRNA precursor;
목적하는 제2 miRNA 전구체의 또 다른 일 단편인 제2-3 올리고뉴클레오티드를 포함하는 제4 가닥을 준비하는 단계; 및Preparing a fourth strand comprising 2-3 oligonucleotides, which is another fragment of the desired second miRNA precursor; And
상기 제1 가닥의 어느 일 말단을 상기 제2 가닥 또는 상기 제4 가닥의 어느 일 말단과 연결시키고, 상기 제3 가닥의 어느 일 말단을 상기 제4 가닥 또는 상기 제2 가닥의 어느 일 말단과 연결시키는 단계를 포함할 수 있다. One end of the first strand is connected to one end of the second strand or the fourth strand, and one end of the third strand is connected to one end of the fourth strand or the second strand It may include a step.
본 발명에서 상기 제1 miRNA 전구체 및 제2 miRNA 전구체는 목적하는 miRNA의 전구체로, 그 형상을 특별히 제한하지는 않으나 헤어핀(hairpin) 형상일 수 있다. 이를 구성하는 핵산 분자는 50 내지 150nt, 바람직하게는 60 내지 100nt, 더욱 바람직하게는 65 내지 95nt 길이를 가질 수 있다.In the present invention, the first miRNA precursor and the second miRNA precursor are precursors of the desired miRNA, and the shape thereof is not particularly limited, but may be a hairpin shape. The nucleic acid molecules constituting this may have a length of 50 to 150 nt, preferably 60 to 100 nt, and more preferably 65 to 95 nt.
본 발명에서 상기 제1 miRNA 전구체 및 제2 miRNA 전구체는 동일하거나 상이할 수 있다. In the present invention, the first miRNA precursor and the second miRNA precursor may be the same or different.
본 발명에서 상기 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드 각각은 상기 제1 miRNA 전구체의 임의의 단편이고, 이들 서열은 서로 전혀 상이하거나, 일부 중복되거나, 동일할 수 있으며, 이들의 서열은 특별히 제한하지 않는다. In the present invention, each of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide is any fragment of the first miRNA precursor, and these sequences are completely different from each other, partially overlapping, or identical It is possible, and their sequence is not particularly limited.
다만, 본 발명에서 상기 제1-1 올리고뉴클레오티드 및 상기 제1-2 올리고뉴클레오티드는 상기 제1 miRNA 전구체에 연속하여 배치되되, 다이서의 작용에 의해 절단될 수 있는 임의의 두 단편일 수 있다. However, in the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be any two fragments that are continuously disposed on the first miRNA precursor and can be cleaved by the action of a dicer.
바람직하게는, 본 발명에서 상기 제1-1 올리고뉴클레오티드는 인체 내에서 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 종자 서열 또는 전장 서열을 포함할 수 있다. Preferably, in the present invention, the 1-1 oligonucleotide may include a seed sequence or a full-length sequence of miRNA that performs a desired function by regulating the expression of a target gene in the human body.
본 발명에서 상기 제2-1 올리고뉴클레오티드, 제2-2 올리고뉴클레오티드 및 제2-3 올리고뉴클레오티드는 각각은 상기 제2 miRNA 전구체의 임의의 단편이고, 이들 서열은 서로 전혀 상이하거나, 일부 중복되거나, 동일할 수 있으며, 이들의 서열은 특별히 제한하지 않는다. In the present invention, each of the 2-1 oligonucleotide, 2-2 oligonucleotide, and 2-3 oligonucleotide is any fragment of the second miRNA precursor, and these sequences are completely different from each other, partially overlapped, It may be the same, and their sequence is not particularly limited.
다만, 본 발명에서 상기 제2-1 올리고뉴클레오티드 및 상기 제2-2 올리고뉴클레오티드는 상기 제2 miRNA 전구체에 연속하여 배치되되, 다이서의 작용에 의해 절단될 수 있는 임의의 두 단편일 수 있다. However, in the present invention, the 2-1 oligonucleotide and the 2-2 oligonucleotide may be any two fragments that are continuously disposed on the second miRNA precursor and can be cleaved by the action of a dicer.
본 발명에서 상기 제2-1 올리고뉴클레오티드는 인체 내에서 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 전 서열 또는 종자 서열을 포함할 수 있다.In the present invention, the 2-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.
본 발명에서 상기 제1-1 올리고뉴클레오티드 및 상기 제2-1 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-1 oligonucleotide and the 2-1 oligonucleotide may be the same or different from each other.
본 발명에서 상기 제1-2 올리고뉴클레오티드 및 상기 제2-2 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-2 oligonucleotide and the 2-2 oligonucleotide may be the same or different from each other.
본 발명에서 상기 제1-3 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-3 oligonucleotide and the 2-3 oligonucleotide may be the same or different from each other.
본 발명의 상기 제1 가닥에서 상기 제1-1 올리고뉴클레오티드의 어느 일 말단을 상기 제1-2 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제1-2 올리고뉴클레오티드의 5' 말단을 상기 제1-1 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제1-1 올리고뉴클레오티드의 5' 말단을 상기 제1-2 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다.Any one end of the 1-1 oligonucleotide in the first strand of the present invention can be connected to any one end of the 1-2 oligonucleotide, preferably 5'of the 1-2 oligonucleotide The terminal may be linked to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be linked to the 3'end of the 1-2 oligonucleotide.
본 발명에서 상기 제1-1 올리고뉴클레오티드의 어느 일 말단에 상기 제1-2 올리고뉴클레오티드의 어느 일 말단을 연결시키에 앞서, 상기 제1-1 올리고뉴클레오티드 및 상기 제1-2 올리고뉴클레오티드 사이에 제1-1 링커로, 제1-1 링커 뉴클레오티드 또는 제1-1 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. Before linking any one end of the 1-2 oligonucleotide to any one end of the 1-1 oligonucleotide in the present invention, the first 1 oligonucleotide and the 1-2 oligonucleotide between the oligonucleotide. As a 1-1 linker, a 1-1 linker nucleotide or a 1-1 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
또한, 본 발명의 상기 제2 가닥에서 상기 제2-1 올리고뉴클레오티드의 어느 일 말단에 상기 제2-2 올리고뉴클레오티드의 어느 일 말단을 연결시킬 수 있고, 바람직하게는 상기 제2-1 올리고뉴클레오티드의 5' 말단을 상기 제2-2 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제2-2 올리고뉴클레오티드의 5' 말단을 상기 제2-1 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다.In addition, in the second strand of the present invention, any one end of the 2-2 oligonucleotide may be connected to any one end of the 2-1 oligonucleotide, preferably the 2-1 oligonucleotide The 5'end can be linked to the 3'end of the 2-2 oligonucleotide, or the 5'end of the 2-2 oligonucleotide can be linked to the 3'end of the 2-1 oligonucleotide. .
본 발명에서 상기 제2-2 올리고뉴클레오티드의 어느 일 말단에 상기 제2-1 올리고뉴클레오티드의 어느 일 말단을 연결시키에 앞서 상기 제2-2 올리고뉴클레오티드 및 상기 제2-1 올리고뉴클레오티드 사이에 제2-1 링커로, 제2-1 링커 뉴클레오티드 또는 제2-1 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. Before connecting any one end of the 2-1 oligonucleotide to any one end of the 2-2 oligonucleotide in the present invention, the second between the 2-2 oligonucleotide and the 2-1 oligonucleotide. As a -1 linker, a 2-1 linker nucleotide or a 2-1 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명의 상기 제3 가닥은 제1 연장 올리고뉴클레오티드를 더 포함할 수 있다.The third strand of the present invention may further include a first extended oligonucleotide.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제1-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the first extended oligonucleotide can be hybridized with the 1-1 oligonucleotide, and 90% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the 1-1 oligonucleotide. , 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology with a base sequence It can be synthesized and produced.
또한, 본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In addition, in the present invention, the first extended oligonucleotide may form a bubble structure including the first-1-1 oligonucleotide and one or more miss-matching nucleotides.
본 발명에서 상기 제3 가닥에서 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단을 상기 제1-3 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단을 상기 제1-3 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제1-3 올리고뉴클레오티드의 5' 말단을 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다. In the present invention, any one end of the first extended oligonucleotide in the third strand may be linked to any one end of the 1-3 oligonucleotide, preferably the 5'end of the first extended oligonucleotide. It may be linked to the 3'end of the 1-3 oligonucleotide, or the 5'end of the 1-3 oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.
본 발명에서 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단을 상기 제1-3 올리고뉴클레오티드의 어느 일 말단에 연결시키에 앞서, 상기 제1-3 올리고뉴클레오티드 및 상기 제1 연장 올리고뉴클레오티드 사이에 제1-2 링커로, 제1-2 링커 뉴클레오티드 또는 제1-2 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. Before linking any one end of the first extended oligonucleotide to any one end of the first-3 oligonucleotide in the present invention, a first-between the first-3 oligonucleotide and the first extended oligonucleotide is obtained. As a 2 linker, a 1-2 linker nucleotide or a 1-2 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제1-1 링커 및 제1-2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, when the 1-1 linker and the 1-2 linker are included, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제1-1 링커 및 제1-2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the 1-1 linker and the 1-2 linker may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1-2 올리고뉴클레오티드 및 상기 제1-3 올리고뉴클레오티드는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다.In the present invention, the 1-2 oligonucleotide and the 1-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명의 상기 제4 가닥은 제2 연장 올리고뉴클레오티드를 더 포함할 수 있다.The fourth strand of the present invention may further include a second extended oligonucleotide.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제2-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the second extended oligonucleotide may be hybridized with the 2-1 oligonucleotide, and 90% or more of the oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the 2-1 oligonucleotide. , 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology with a base sequence It can be synthesized and produced.
또한, 본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드 또는 미스 매칭 올리고뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In addition, in the present invention, the second extended oligonucleotide may form a bubble structure by including the 2-1 oligonucleotide and one or more miss-matching nucleotides or miss-matching oligonucleotides.
본 발명에서 상기 제4 가닥에서 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단을 상기 제2-3 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제2-3 올리고뉴클레오티드의 5' 말단을 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제2 연장 올리고뉴클레오티드의 5' 말단을 상기 제2-3 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다.In the present invention, any one end of the second extended oligonucleotide in the fourth strand may be connected to any one end of the second-3 oligonucleotide, preferably the 5'end of the second-3 oligonucleotide. Can be linked to the 3'end of the second extended oligonucleotide, or the 5'end of the second extended oligonucleotide to the 3'end of the 2-3 oligonucleotide.
본 발명에서 상기 제2-3 올리고뉴클레오티드의 어느 일 말단을 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단에 연결시키에 앞서, 상기 제2 연장 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드의 사이에 제2-2 링커로, 제2-2 링커 뉴클레오티드 또는 제2-2 링커 올리고뉴클레오티드를 더 포함시킬 수 있다.이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. Before linking one end of the second oligonucleotide to any one end of the second extended oligonucleotide in the present invention, a second between the second extended oligonucleotide and the second-3 oligonucleotide. As a -2 linker, a 2-2 linker nucleotide or a 2-2 linker oligonucleotide may be further included. In this case, the specific sequence is not particularly limited, and the nucleotide whose base is adenine (A) and uracil base ( uracil, U) nucleotide, guanine (G) base nucleotide, cytosine (cytosine, C) nucleotide, or a combination thereof.
본 발명에서 상기 제2-1 링커 및 제2-2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, when the 2-1 linker and the 2-2 linker are included, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제2-1 링커 및 제2-2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the 2-1 linker and the 2-2 linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제2-2 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다.In the present invention, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1 가닥의 어느 일 말단은 상기 제2 가닥 또는 상기 제4 가닥의 어느 일 말단과 연결될 수 있다. 바람직하게는 상기 제1 가닥의 3' 말단은 상기 제2 가닥의 5' 말단에 연결되거나, 또는 상기 제1 가닥의 3' 말단은 상기 제4 가닥의 5' 말단에 연결되거나, 또는 상기 제2 가닥의 3' 말단은 상기 제1 가닥의 5' 말단에 연결되거나, 또는 상기 제4 가닥의 3' 말단은 상기 제1 가닥의 5' 말단에 연결될 수 있다. In the present invention, one end of the first strand may be connected to one end of the second strand or the fourth strand. Preferably, the 3'end of the first strand is connected to the 5'end of the second strand, or the 3'end of the first strand is connected to the 5'end of the fourth strand, or the second The 3'end of the strand may be connected to the 5'end of the first strand, or the 3'end of the fourth strand may be connected to the 5'end of the first strand.
본 발명에서 상기 제3 가닥의 어느 일 말단은 상기 제4 가닥 또는 상기 제2 가닥의 어느 일 말단과 연결될 수 있다. 바람직하게는 상기 제4 가닥의 3' 말단은 상기 제3 가닥의 5' 말단에 연결되거나, 또는 상기 제2 가닥의 3' 말단은 상기 제3 가닥의 5' 말단에 연결되거나, 또는 상기 제3 가닥의 3' 말단은 상기 제4 가닥의 5' 말단에 연결되거나, 또는 상기 제3 가닥의 3' 말단은 상기 제2 가닥의 5' 말단에 연결될 수 있다.In the present invention, one end of the third strand may be connected to one end of the fourth strand or the second strand. Preferably, the 3'end of the fourth strand is connected to the 5'end of the third strand, or the 3'end of the second strand is connected to the 5'end of the third strand, or the third The 3'end of the strand may be connected to the 5'end of the fourth strand, or the 3'end of the third strand may be connected to the 5'end of the second strand.
본 발명의 일 구체 예에 따르면, 이중 가닥의 올리고뉴클레오티드를 제조하는 방법으로서,According to an embodiment of the present invention, as a method for preparing a double-stranded oligonucleotide,
t 개의 뉴클레오티드(nt) 길이의 제1 miRNA 전구체의 5' 말단 또는 3' 말단으로부터 A 번째 내지 B 번째의 연속된 염기서열로 이루어지는 제1-1 올리고뉴클레오티드 및 B+e 번째 내지 B+f 번째의 연속된 염기서열로 이루어지는 제1-2 올리고뉴클레오티드를 포함하는 제1 가닥을 준비하는 단계; 1-1 oligonucleotides consisting of A s to B sequential nucleotide sequences from 5'end or 3'end of the first miRNA precursor of t nucleotides (nt) in length, and B+e th to B+f th Preparing a first strand comprising a 1-2 oligonucleotide consisting of a continuous base sequence;
u 개의 뉴클레오티드(nt) 길이의 제2 miRNA 전구체의 5' 말단 또는 3' 말단으로부터 C 번째 내지 D 번째 연속된 염기서열로 이루어지는 제2-1 올리고뉴클레오티드 및 D+g 번째 내지 D+h 번째 연속된 염기서열로 이루어지는 제2-2 올리고뉴클레오티드를 포함하는 제2 가닥을 준비하는 단계; 2-1 oligonucleotides consisting of C-th to D-th consecutive nucleotide sequences from the 5'end or 3'end of the second nucleotide (nt) length of u nucleotides, and D+g th to D+h th contiguous Preparing a second strand comprising a 2-2 oligonucleotide consisting of a nucleotide sequence;
상기 t 개의 뉴클레오티드(nt) 길이의 제1 miRNA 전구체의 5' 말단 또는 3' 말단으로부터 B+w 번째 내지 B+x 번째 연속된 염기서열로 이루어지는 제1-3 올리고뉴클레오티드를 포함하는 제3 가닥을 준비하는 단계; A third strand comprising a 1-3 oligonucleotide consisting of B+w th to B+x th consecutive sequences from the 5'end or the 3'end of the first miRNA precursor of t nucleotides (nt) in length Preparing;
상기 u 개의 뉴클레오티드(nt) 길이의 제2 miRNA 전구체의 5' 말단 또는 3' 말단으로부터 D+y 번째 내지 D+z 번째 연속된 염기서열로 이루어지는 제2-3 올리고뉴클레오티드를 포함하는 제4 가닥을 준비하는 단계; 및A fourth strand comprising a 2-3 oligonucleotide consisting of D+y th to D+z th consecutive nucleotide sequences from the 5'end or 3'end of the second nucleotide (nt) length of the u nucleotides (nt). Preparing; And
상기 제1 가닥의 어느 일 말단을 상기 제2 가닥 또는 상기 제4 가닥의 어느 일 말단과 연결시키고, 상기 제3 가닥의 어느 일 말단을 상기 제4 가닥 또는 상기 제2 가닥의 어느 일 말단과 연결시키는 단계를 포함하며, One end of the first strand is connected to one end of the second strand or the fourth strand, and one end of the third strand is connected to one end of the fourth strand or the second strand It includes the steps of
상기 t 및 u는 각각 독립적으로 60 내지 150의 정수이고, The t and u are each independently an integer of 60 to 150,
상기 A 및 C는 각각 독립적으로 1 내지 10의 정수이며,A and C are each independently an integer of 1 to 10,
상기 B 및 D는 각각 독립적으로 18 내지 25의 정수이고,B and D are each independently an integer of 18 to 25,
상기 e 및 g는 각각 독립적으로 1 내지 5의 정수이며,E and g are each independently an integer of 1 to 5,
상기 f 및 h는 각각 독립적으로 5 내지 57의 정수이고, F and h are each independently an integer of 5 to 57,
상기 w 및 y는 각각 독립적으로 6 내지 62의 정수이며,W and y are each independently an integer of 6 to 62,
상기 x 및 z는 각각 독립적으로 11 내지 119의 정수일 수 있다. The x and z may be each independently an integer of 11 to 119.
본 발명에서 상기 제1 miRNA 전구체 및 제2 miRNA 전구체는 목적하는 miRNA 의 전구체로, 그 형상을 특별히 제한하지는 않으나 헤어핀(hairpin) 형상일 수 있다. 이를 구성하는 핵산 분자는 50 내지 150nt, 바람직하게는 60 내지 100nt, 더욱 바람직하게는 65 내지 95nt 길이를 가질 수 있다.In the present invention, the first miRNA precursor and the second miRNA precursor are precursors of a desired miRNA, and the shape thereof is not particularly limited, but may be a hairpin shape. The nucleic acid molecules constituting this may have a length of 50 to 150 nt, preferably 60 to 100 nt, and more preferably 65 to 95 nt.
본 발명에서 상기 제1 miRNA 전구체 및 제2 miRNA 전구체는 동일하거나 상이할 수 있다. In the present invention, the first miRNA precursor and the second miRNA precursor may be the same or different.
본 발명에서 상기 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드 각각은 상기 제1 miRNA 전구체의 임의의 단편이고, 이들 서열은 서로 전혀 상이하거나, 일부 중복되거나, 동일할 수 있으며, 이들의 서열은 특별히 제한하지 않는다. In the present invention, each of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide is any fragment of the first miRNA precursor, and these sequences are completely different from each other, partially overlapping, or identical It is possible, and their sequence is not particularly limited.
다만, 본 발명에서 상기 제1-1 올리고뉴클레오티드 및 상기 제1-2 올리고뉴클레오티드는 상기 제1 miRNA 전구체에 연속하여 배치되되, 다이서의 작용에 의해 절단될 수 있는 임의의 두 단편일 수 있다. However, in the present invention, the 1-1 oligonucleotide and the 1-2 oligonucleotide may be any two fragments that are continuously disposed on the first miRNA precursor and can be cleaved by the action of a dicer.
바람직하게는, 본 발명에서 상기 제1-1 올리고뉴클레오티드는 인체 내에서 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 전 서열 또는 종자 서열을 포함할 수 있다. Preferably, in the present invention, the 1-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.
본 발명에서 상기 제2-1 올리고뉴클레오티드, 제2-2 올리고뉴클레오티드 및 제2-3 올리고뉴클레오티드는 각각은 상기 제2 miRNA 전구체의 임의의 단편이고, 이들 서열은 서로 전혀 상이하거나, 일부 중복되거나, 동일할 수 있으며, 이들의 서열은 특별히 제한하지 않는다. In the present invention, each of the 2-1 oligonucleotide, 2-2 oligonucleotide, and 2-3 oligonucleotide is any fragment of the second miRNA precursor, and these sequences are completely different from each other, partially overlapped, It may be the same, and their sequence is not particularly limited.
다만, 본 발명에서 상기 제2-1 올리고뉴클레오티드 및 상기 제2-2 올리고뉴클레오티드는 상기 제2 miRNA 전구체에 연속하여 배치되되, 다이서의 작용에 의해 절단될 수 있는 임의의 두 단편일 수 있다. However, in the present invention, the 2-1 oligonucleotide and the 2-2 oligonucleotide may be any two fragments that are continuously disposed on the second miRNA precursor and can be cleaved by the action of a dicer.
본 발명에서 상기 제2-1 올리고뉴클레오티드는 인체 내에서 타겟 유전자의 발현을 조절하여 목적하는 기능을 수행하는 miRNA의 전 서열 또는 종자 서열을 포함할 수 있다.In the present invention, the 2-1 oligonucleotide may include the entire sequence or seed sequence of miRNA that performs a desired function by regulating the expression of the target gene in the human body.
본 발명에서 상기 제1-1 올리고뉴클레오티드 및 상기 제2-1 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-1 oligonucleotide and the 2-1 oligonucleotide may be the same or different from each other.
본 발명에서 상기 제1-2 올리고뉴클레오티드 및 상기 제2-2 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-2 oligonucleotide and the 2-2 oligonucleotide may be the same or different from each other.
본 발명에서 상기 제1-3 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드는 서로 동일하거나 상이할 수 있다.In the present invention, the 1-3 oligonucleotide and the 2-3 oligonucleotide may be the same or different from each other.
본 발명의 상기 제1 가닥에서 상기 제1-1 올리고뉴클레오티드의 어느 일 말단을 상기 제1-2 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제1-2 올리고뉴클레오티드의 5' 말단을 상기 제1-1 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제1-1 올리고뉴클레오티드의 5' 말단을 상기 제1-2 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다.Any one end of the 1-1 oligonucleotide in the first strand of the present invention can be connected to any one end of the 1-2 oligonucleotide, preferably 5'of the 1-2 oligonucleotide The terminal may be linked to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be linked to the 3'end of the 1-2 oligonucleotide.
본 발명에서 상기 제1-2 올리고뉴클레오티드의 어느 일 말단을 상기 제1-1 올리고뉴클레오티드의 어느 일 말단에 연결시키에 앞서, 상기 제1-1 올리고뉴클레오티드 및 상기 제1-2 올리고뉴클레오티드의 사이에 제1-1 링커로, 제1-1 링커 뉴클레오티드 또는 제1-1 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. Before linking one end of the 1-2 oligonucleotide to one end of the 1-1 oligonucleotide in the present invention, between the 1-1 oligonucleotide and the 1-2 oligonucleotide. As the 1-1 linker, a 1-1 linker nucleotide or a 1-1 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
또한, 본 발명의 상기 제2 가닥에서 상기 제2-2 올리고뉴클레오티드의 어느 일 말단을 상기 제2-1 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제2-1 올리고뉴클레오티드의 5' 말단을 상기 제2-2 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제2-2 올리고뉴클레오티드의 5' 말단을 상기 제2-1 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다.In addition, one end of the 2-2 oligonucleotide in the second strand of the present invention can be connected to any one end of the 2-1 oligonucleotide, preferably of the 2-1 oligonucleotide The 5'end can be linked to the 3'end of the 2-2 oligonucleotide, or the 5'end of the 2-2 oligonucleotide can be linked to the 3'end of the 2-1 oligonucleotide. .
본 발명에서 상기 제2-1 올리고뉴클레오티드의 어느 일 말단을 상기 제2-2 올리고뉴클레오티드의 어느 일 말단에 연결시키에 앞서, 상기 제2-2 올리고뉴클레오티드 및 상기 제2-1 올리고뉴클레오티드 사이에 제2-1 링커로, 제2-1 링커 뉴클레오티드 또는 제2-1 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. Before linking any one end of the 2-1 oligonucleotide to any one end of the 2-2 oligonucleotide in the present invention, the second 2 oligonucleotide and the 2-1 oligonucleotide between As a 2-1 linker, a 2-1 linker nucleotide or a 2-1 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제3 가닥에서 제1-3 올리고뉴클레오티드의 어느 일 말단에 제1 연장 올리고뉴클레오티드를 추가로 연장할 수 있다. In the present invention, the first extension oligonucleotide may be further extended to any one end of the 1-3 oligonucleotide in the third strand.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제1-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the first extended oligonucleotide can be hybridized with the 1-1 oligonucleotide, and 90% or more with an oligonucleotide complementary to the 3'-5' nucleotide sequence of the 1-1 oligonucleotide. , 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% homology with a base sequence It can be synthesized and produced.
본 발명에서 상기 제1 연장 올리고뉴클레오티드는 상기 제1-1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the first extended oligonucleotide may form a bubble structure by including the first-1-1 oligonucleotide and one or more miss-matching nucleotides.
본 발명의 상기 제3 가닥에서 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단을 상기 제1-3 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제1 연장 올리고뉴클레오티드의 5' 말단을 상기 제1-1 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제1-1 올리고뉴클레오티드의 5' 말단을 상기 제1 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다. In the third strand of the present invention, one end of the first extended oligonucleotide may be linked to any one end of the first-3 oligonucleotide, and preferably the 5'end of the first extended oligonucleotide is It may be linked to the 3'end of the 1-1 oligonucleotide, or the 5'end of the 1-1 oligonucleotide may be linked to the 3'end of the first extended oligonucleotide.
본 발명에서 상기 제1 연장 올리고뉴클레오티드의 어느 일 말단을 상기 제1-3 올리고뉴클레오티드의 어느 일 말단에 연결시키에 앞서, 상기 제1-3 올리고뉴클레오티드 및 상기 제1 연장 올리고뉴클레오티드의 사이에 제1-2 링커로, 제1-2 링커 뉴클레오티드 또는 제1-2 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. Before linking any one end of the first extended oligonucleotide to any one end of the 1-3 oligonucleotide in the present invention, a first between the first-3 oligonucleotide and the first extended oligonucleotide. As a -2 linker, a 1-2 linker nucleotide or a 1-2 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제1-1 링커 및 제1-2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, when the 1-1 linker and the 1-2 linker are included, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제1-1 링커 및 제1-2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the 1-1 linker and the 1-2 linker may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1-2 올리고뉴클레오티드 및 상기 제1-3 올리고뉴클레오티드는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다.In the present invention, the 1-2 oligonucleotide and the 1-3 oligonucleotide may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제4 가닥에서 제2-3 연장 올리고뉴클레오티드의 어느 일 말단에 제2 연장 올리고뉴클레오티드를 추가로 연장할 수 있다.In the present invention, a second extended oligonucleotide may be further extended to one end of the 2-3 extended oligonucleotide in the fourth strand.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드와 혼성화될 수 있는 것으로, 상기 제1-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 올리고뉴클레오티드와 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 100%의 상동성을 갖는 염기서열로 이루어지도록 합성하여 제작할 수 있다.In the present invention, the second extended oligonucleotide may be hybridized with the 2-1 oligonucleotide, and 90% or more of the oligonucleotide complementary to the nucleotide sequence in the 3'-5' direction of the 1-1 oligonucleotide. , 91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, or 100% homology sequence It can be synthesized and produced.
본 발명에서 상기 제2 연장 올리고뉴클레오티드는 상기 제2-1 올리고뉴클레오티드와 하나 이상의 미스 매칭 뉴클레오티드를 포함하여 버블 구조를 이룰 수 있다. In the present invention, the second extended oligonucleotide may form a bubble structure by including the 2-1 oligonucleotide and one or more mismatching nucleotides.
본 발명에서 상기 제4 가닥에서 상기 제2-3 올리고뉴클레오티드의 어느 일 말단을 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단에 연결시킬 수 있고, 바람직하게는 상기 제2-3 올리고뉴클레오티드의 5' 말단을 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있고, 혹은 상기 제2 연장 올리고뉴클레오티드의 5' 말단을 상기 제2-3 올리고뉴클레오티드의 3' 말단에 연결시킬 수 있다.In the present invention, any one end of the second-3 oligonucleotide in the fourth strand may be linked to any one end of the second extended oligonucleotide, preferably the 5'end of the second-3 oligonucleotide. Can be linked to the 3'end of the second extended oligonucleotide, or the 5'end of the second extended oligonucleotide to the 3'end of the 2-3 oligonucleotide.
본 발명에서 상기 제2-3 올리고뉴클레오티드의 어느 일 말단을 상기 제2 연장 올리고뉴클레오티드의 어느 일 말단에 연결시키에 앞서, 상기 제2 연장 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드의 사이에 제2-2 링커로, 제2-2 링커 뉴클레오티드 또는 제2-2 링커 올리고뉴클레오티드를 더 포함시킬 수 있다. 이때 구체적인 서열은 특별히 제한하지 않으며, 염기가 아데닌(adenine, A)인 뉴클레오티드, 염기가 우라실(uracil, U)인 뉴클레오티드, 염기가 구아닌(guanine, G)인 뉴클레오티드, 염기가 시토신(cytosine, C)인 뉴클레오티드 또는 이들의 조합일 수 있다. Before linking one end of the second oligonucleotide to any one end of the second extended oligonucleotide in the present invention, a second between the second extended oligonucleotide and the second-3 oligonucleotide. As a -2 linker, a 2-2 linker nucleotide or a 2-2 linker oligonucleotide may be further included. At this time, the specific sequence is not particularly limited, the nucleotide is adenine (adenine, A), nucleotide base is uracil (uracil, U), nucleotide base is guanine (guanine, G) nucleotide, base is cytosine (cytosine, C) Phosphorus nucleotides or combinations thereof.
본 발명에서 상기 제2-1 링커 및 제2-2 링커를 포함하는 경우, 이들은 이중 가닥 내에서 서로 대향하여 배치될 수 있다. In the present invention, when the 2-1 linker and the 2-2 linker are included, they may be disposed to face each other in a double strand.
또한 본 발명에서 상기 제2-1 링커 및 제2-2 링커는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다. In addition, in the present invention, the 2-1 linker and the 2-2 linker may be complementary or non-complementary to each other, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제2-2 올리고뉴클레오티드 및 상기 제2-3 올리고뉴클레오티드는 서로 상보적이거나 비상보적일 수 있고, 혹은 일부 서열이 미스 매칭되어 버블 구조를 형성할 수 있다.In the present invention, the 2-2 oligonucleotide and the 2-3 oligonucleotide may be complementary to each other or non-complementary, or some sequences may be mismatched to form a bubble structure.
본 발명에서 상기 제1 가닥의 어느 일 말단은 상기 제2 가닥 또는 상기 제4 가닥의 어느 일 말단과 연결될 수 있다. 바람직하게는 상기 제1 가닥의 3' 말단은 상기 제2 가닥의 5' 말단에 연결되거나, 또는 상기 제1 가닥의 3' 말단은 상기 제4 가닥의 5' 말단에 연결되거나, 또는 상기 제2 가닥의 3' 말단은 상기 제1 가닥의 5' 말단에 연결되거나, 또는 상기 제4 가닥의 3' 말단은 상기 제1 가닥의 5'말단에 연결될 수 있다. In the present invention, one end of the first strand may be connected to one end of the second strand or the fourth strand. Preferably, the 3'end of the first strand is connected to the 5'end of the second strand, or the 3'end of the first strand is connected to the 5'end of the fourth strand, or the second The 3'end of the strand may be connected to the 5'end of the first strand, or the 3'end of the fourth strand may be connected to the 5'end of the first strand.
본 발명에서 상기 제3 가닥의 어느 일 말단은 상기 제4 가닥 또는 상기 제2 가닥의 어느 일 말단과 연결될 수 있다. 바람직하게는 상기 제4 가닥의 3' 말단은 상기 제3 가닥의 5' 말단에 연결되거나, 또는 상기 제2 가닥의 3' 말단은 상기 제3 가닥의 5' 말단에 연결되거나, 또는 상기 제3 가닥의 3' 말단은 상기 제4 가닥의 5' 말단에 연결되거나, 또는 상기 제3 가닥의 3' 말단은 상기 제2 가닥의 5' 말단에 연결될 수 있다.In the present invention, one end of the third strand may be connected to one end of the fourth strand or the second strand. Preferably, the 3'end of the fourth strand is connected to the 5'end of the third strand, or the 3'end of the second strand is connected to the 5'end of the third strand, or the third The 3'end of the strand may be connected to the 5'end of the fourth strand, or the 3'end of the third strand may be connected to the 5'end of the second strand.
다만, 본 발명의 제조 방법에서 각 올리고뉴클레오티드를 합성하는 순서 및 합성된 각 올리고뉴클레오티드를 연결하는 순서는 특별히 제한하지 않는다. However, in the production method of the present invention, the order of synthesizing each oligonucleotide and the order of linking each synthesized oligonucleotide is not particularly limited.
본 발명에서 제공하는 이중 가닥의 올리고뉴클레오티드는 타겟 유전자의 발현을 조절하여 목적하는 기능을 하는 miRNA, 그 전구체 또는 그 단편을 2가닥을 동시에 포함하면서 이들이 안정적인 이중 가닥의 형태를 유지할 수 있도록 하여, 각각의 miRNA를 단독으로 처리하였을 때 보다 타겟 부위로의 전달 효율을 현저히 높이고 그 기능 발현에 시너지 효과 또한 부여할 수 있다. The double-stranded oligonucleotide provided by the present invention regulates the expression of the target gene to simultaneously contain two strands of miRNA functioning as a desired function, its precursor, or a fragment thereof, so that they can maintain a stable double-stranded form, respectively. It is possible to significantly increase the efficiency of delivery to the target site and to give a synergistic effect to the expression of its function than when treated with the miRNA alone.
도 1은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 2는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 3은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 4는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 5는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 6은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 7은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 8은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 9는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 10은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 11은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 12는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 13은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 14는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 15는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 16은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 17은 본 발명의 일 실시예로, 헤어핀 형상의 제1 miRNA 전구체 내 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드의 배치 구조를 나타낸 것이다.
도 18은 본 발명의 일 실시예로, 헤어핀 형상의 제1 miRNA 전구체 내 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드의 배치 구조를 나타낸 것이다.
도 19는 본 발명의 일 실시예로, 헤어핀 형상의 제1 miRNA 전구체 내 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드의 배치 구조를 나타낸 것이다.
도 20은 본 발명의 일 실시예로, 헤어핀 형상의 제1 miRNA 전구체 내 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드의 배치 구조를 나타낸 것이다.
도 21은 본 발명의 일 실시예로, 헤어핀 형상의 제1 miRNA 전구체 내 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드의 배치 구조를 나타낸 것이다.
도 22는 본 발명의 일 실시예로, 헤어핀 형상의 제1 miRNA 전구체 내 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드의 배치 구조를 나타낸 것이다.
도 23은 본 발명의 일 실시예로, 헤어핀 형상의 제1 miRNA 전구체 내 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드의 배치 구조를 나타낸 것이다.
도 24는 본 발명의 일 실시예로, 헤어핀 형상의 제1 miRNA 전구체 내 제1-1 올리고뉴클레오티드, 제1-2 올리고뉴클레오티드 및 제1-3 올리고뉴클레오티드의 배치 구조를 나타낸 것이다.
도 25는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 26은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 27은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 28은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 29는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 30은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 31은 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
도 32는 본 발명의 일 실시예에 따른 이중 가닥의 올리고뉴클레오티드의 구조를 도시한 것이다.
상기 도 28 내지 32에서, PSI-502는 hsa-miR-6514-5p miRNA에 해당하고, PSI-503은 hsa-miR-503-3p miRNA에 해당할 수 있다.
도 33은 본 발명의 일 실시예에서 SK-MEL28 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 상기 암 세포의 세포 생존율의 변화를 측정한 결과를 그래프로 나타낸 것이다.
도 34는 본 발명의 일 실시예에서 SK-MEL28 암 줄기세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 콜로니의 수의 변화를 측정한 결과를 그래프로 나타낸 것이다.
도 35는 본 발명의 일 실시예에서 SK-MEL28 암 줄기세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 상기 암 줄기세포의 세포 침윤능을 분석한 결과를 그래프로 나타낸 것이다.
도 36은 본 발명의 일 실시예에서 SK-MEL28 암 줄기세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 상기 암 줄기세포의 줄기능(stemness)과 관련된 유전자인 Nanog의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 37은 본 발명의 일 실시예에서 SK-MEL28 암 줄기세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 상기 암 줄기세포에서 발현이 억제되는 유전자인 TYRP1의 발현 수준의 변화를 분석한 결과를 그래프로 나타낸 것이다.
도 38은 본 발명의 일 실시예에서 SK-MEL28 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 암 세포 50%의 사멸을 유도할 수 있는 농도(GI50)를 측정하여 그 결과를 그래프로 나타낸 것이다.
도 39는 본 발명의 일 실시예에서 Malme-3m 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 암 세포 50%의 사멸을 유도할 수 있는 농도(GI50)를 측정하여 그 결과를 그래프로 나타낸 것이다.
도 40은 본 발명의 일 실시예에서 A549 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 암 세포 50%의 사멸을 유도할 수 있는 농도(GI50)를 측정하여 그 결과를 그래프로 나타낸 것이다.
도 41은 본 발명의 일 실시예에서 NCI-H460 암 세포에 본 발명에 따른 이중 가닥의 올리고리보뉴클레오티드를 처리한 뒤 암 세포 50%의 사멸을 유도할 수 있는 농도(GI50)를 측정하여 그 결과를 그래프로 나타낸 것이다. 1 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
Figure 2 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
Figure 3 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
Figure 4 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
5 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
Figure 6 shows the structure of the double-stranded oligonucleotide according to an embodiment of the present invention.
7 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
8 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
9 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
10 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
11 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
12 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
13 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
14 illustrates the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
15 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
16 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
17 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
18 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in a hairpin-shaped first miRNA precursor.
19 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
20 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
21 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
22 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
23 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in a hairpin-shaped first miRNA precursor.
24 is an embodiment of the present invention, showing the arrangement structure of the 1-1 oligonucleotide, 1-2 oligonucleotide and 1-3 oligonucleotide in the hairpin-shaped first miRNA precursor.
25 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
26 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
27 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
28 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
29 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
30 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
31 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
32 shows the structure of a double-stranded oligonucleotide according to an embodiment of the present invention.
In FIGS. 28 to 32, PSI-502 may correspond to hsa-miR-6514-5p miRNA, and PSI-503 may correspond to hsa-miR-503-3p miRNA.
33 is a graph showing the results of measuring the change in cell viability of cancer cells after treating a double-stranded oligonucleotide according to the present invention to SK-MEL28 cancer cells in one embodiment of the present invention.
34 is a graph showing the results of measuring the change in the number of colonies after treating a double-stranded oligonucleotide according to the present invention to SK-MEL28 cancer stem cells in one embodiment of the present invention.
35 is a graph showing the results of analyzing the cell invasion capacity of the cancer stem cells after treating the double-stranded oligonucleotide according to the present invention with SK-MEL28 cancer stem cells in one embodiment of the present invention.
FIG. 36 shows the expression level of Nanog, a gene related to the stem function of the cancer stem cell, after treating the double-stranded oligonucleotide according to the present invention with SK-MEL28 cancer stem cells in one embodiment of the present invention. It shows the result of analyzing the change in a graph.
FIG. 37 analyzes the change in the expression level of TYRP1, a gene whose expression is inhibited in the cancer stem cell, after treating a double-stranded oligonucleotide according to the present invention to a SK-MEL28 cancer stem cell in one embodiment of the present invention. One result is graphed.
38 is a concentration of GI 50 that can induce the death of 50% of cancer cells after treatment of SK-MEL28 cancer cells with a double-stranded oligonucleotide according to the present invention in one embodiment of the present invention. The results are graphed.
FIG. 39 shows a concentration (GI 50 ) capable of inducing the death of 50% of cancer cells after treatment with a double-stranded oligonucleotide according to the present invention in Malme-3m cancer cells in one embodiment of the present invention. The results are graphed.
FIG. 40 shows the result of measuring the concentration (GI 50 ) that can induce death of 50% of cancer cells after treating a double-stranded oligonucleotide according to the present invention to A549 cancer cells in one embodiment of the present invention. It is shown graphically.
41 is a concentration of GI 50 that can induce the death of 50% of cancer cells after treating the double-stranded oligonucleotide according to the present invention to NCI-H460 cancer cells in one embodiment of the present invention. The results are graphed.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
실시예Example
[준비예 1] 목적하는 miRNA 전구체의 준비[Preparation Example 1] Preparation of desired miRNA precursor
하기 표 1에 나타내는 염기서열로 이루어지는 hsa-miR-6514-5p miRNA 및 hsa-miR-503-3p miRNA 및 이들의 전구체를 준비하였다. Hsa-miR-6514-5p miRNA and hsa-miR-503-3p miRNA composed of the nucleotide sequences shown in Table 1 below and precursors thereof were prepared.
uauggaguggacuuucagcuggc (SEQ ID NO: 3)
[실시예 1] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50B-2.3)[Example 1] Preparation of double-stranded oligonucleotide (PSI-50B-2.3)
도 28에 나타낸 이중 가닥의 올리고뉴클레오티드를 제작하였다. 보다 상세하게는, 우선 서열번호 3으로 표시되는 hsa-miR-6514-5p miRNA와 서열번호 4로 표시되는 hsa-miR-503-3p miRNA를 각각 제1 올리고뉴클레오티드와 제2 올리고뉴클레오티드로 준비하였다. 이후, 상기 제1 올리고뉴클레오티드의 3' 말단으로부터, 상기 hsa-miR-503-3p miRNA의 3'-5' 방향의 염기서열에 상보적인 서열번호 5로 표시되는 제1 연장 올리고뉴클레오티드를 합성 및 연결하였다. 또한, 상기 제2 올리고뉴클레오티드의 3' 말단으로부터, 상기 hsa-miR-6514-5p miRNA의 3'-5' 방향의 염기서열에 상보적인 서열번호 6으로 표시되는 제2 연장 올리고뉴클레오티드를 합성 및 연결하였다. 이렇게 합성된 이중 가닥의 올리고뉴클레오티드 중 제1 가닥은 서열번호 1로 표시되고, 제2 가닥은 서열번호 2로 표시된다(표 2).The double-stranded oligonucleotide shown in FIG. 28 was prepared. More specifically, first, hsa-miR-6514-5p miRNA represented by SEQ ID NO: 3 and hsa-miR-503-3p miRNA represented by SEQ ID NO: 4 were prepared as a first oligonucleotide and a second oligonucleotide, respectively. Then, from the 3'end of the first oligonucleotide, the first extended oligonucleotide represented by SEQ ID NO: 5 complementary to the 3'-5' direction of the hsa-miR-503-3p miRNA is synthesized and linked. Did. In addition, from the 3'end of the second oligonucleotide, a second extended oligonucleotide represented by SEQ ID NO: 6 complementary to the 3'-5' nucleotide sequence of the hsa-miR-6514-5p miRNA is synthesized and linked. Did. The first strand of the double-stranded oligonucleotide thus synthesized is represented by SEQ ID NO: 1, and the second strand is represented by SEQ ID NO: 2 (Table 2).
[실시예 2] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50A-2.3)[Example 2] Preparation of double-stranded oligonucleotide (PSI-50A-2.3)
도 29에 나타낸 이중 가닥의 올리고뉴클레오티드를 제작하였다. 보다 상세하게는, 상기 hsa-miR-6514-5p miRNA의 5' 말단으로부터 1 내지 11번째 염기서열(서열번호 9)로 이루어지는 miRNA 단편에 해당하는 제1 올리고뉴클레오티드를 준비하고, hsa-miR-503-3p miRNA의 5' 말단으로부터 1 내지 12번째 염기서열(서열번호 10)로 이루어지는 miRNA 단편에 해당하는 제2 올리고뉴클레오티드를 준비하였다. 이후, 상기 제1 올리고뉴클레오티드의 3' 말단에 상기 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열번호 11로 표시되는 제1 연장 올리고뉴클레오티드를 합성 및 연장하였다. 또한, 상기 제2 올리고뉴클레오티드의 3' 말단에 상기 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열번호 12로 표시되는 제2 연장 올리고뉴클레오티드를 합성 및 연장하였다. 이렇게 합성된 이중 가닥의 올리고뉴클레오티드 중 제1 가닥은 서열번호 7로 표시되고, 제2 가닥은 서열번호 8로 표시된다(표 3).The double-stranded oligonucleotide shown in FIG. 29 was prepared. More specifically, a first oligonucleotide corresponding to a miRNA fragment consisting of a 1 to 11 nucleotide sequence (SEQ ID NO: 9) from the 5'end of the hsa-miR-6514-5p miRNA is prepared, and hsa-miR-503 From the 5'end of -3p miRNA, a second oligonucleotide corresponding to a miRNA fragment consisting of a 1-12th nucleotide sequence (SEQ ID NO: 10) was prepared. Thereafter, the first extended oligonucleotide represented by SEQ ID NO: 11 complementary to the base sequence in the 3'-5' direction of the second oligonucleotide at the 3'end of the first oligonucleotide was synthesized and extended. In addition, at the 3'end of the second oligonucleotide, a second extended oligonucleotide represented by SEQ ID NO: 12 complementary to the base sequence in the 3'-5' direction of the first oligonucleotide was synthesized and extended. The first strand of the double-stranded oligonucleotide thus synthesized is represented by SEQ ID NO: 7, and the second strand is represented by SEQ ID NO: 8 (Table 3).
[실시예 3] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50C-2.3)[Example 3] Preparation of double-stranded oligonucleotide (PSI-50C-2.3)
도 30에 나타낸 이중 가닥의 올리고뉴클레오티드를 제작하였다. 보다 상세하게는, hsa-miR-6514-5p miRNA의 5' 말단으로부터 2 내지 11번째 염기서열로 이루어지는 miRNA 단편인 서열번호 15로 표시되는 제1 올리고뉴클레오티드를 준비하고, 이의 5' 말단에 제1 캡 뉴클레오티드로 염기가 우라실인 뉴클레오티드를 추가 연장하였다. 또한, hsa-miR-503-3p miRNA의 5' 말단으로부터 2 내지 12번째 염기서열로 이루어지는 miRNA 단편인 서열번호 16으로 표시되는 제2 올리고뉴클레오티드를 준비하고, 이의 5' 말단에 제2 캡 뉴클레오티드로 염기가 우라실인 뉴클레오티드를 추가 연장하였다. 또한, 상기 제1 올리고뉴클레오티드의 3' 말단에 상기 제2 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열번호 17로 표시되는 제1 연장 뉴클레오티드를 합성 및 연장하고, 상기 제1 연장 뉴클레오티드의 3' 말단에는 상기 제2 캡 뉴클레오티드에 상보적인 염기가 아데닌인 뉴클레오티드를 제1 말단 뉴클레오티드로 추가 연장하였다. 또한, 상기 제2 올리고뉴클레오티드의 3' 말단에, 상기 제1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열번호 18로 표시되는 제2 연장 올리고뉴클레오티드를 합성 및 연장한 뒤, 상기 제2 연장 올리고뉴클레오티드의 3' 말단에 상기 제1 캡 뉴클레오티드에 상보적인 염기가 아데닌인 뉴클레오티드를 추가 연장하였다. 이렇게 합성된 이중 가닥의 올리고뉴클레오티드 중 제1 가닥은 서열번호 13로 표시되고, 제2 가닥은 서열번호 14로 표시된다(표 4).The double-stranded oligonucleotide shown in FIG. 30 was prepared. More specifically, a first oligonucleotide represented by SEQ ID NO: 15, which is a miRNA fragment consisting of 2 to 11 nucleotide sequences from the 5'end of the hsa-miR-6514-5p miRNA, is prepared, and a first at the 5'end thereof The nucleotide whose base is uracil was further extended with the cap nucleotide. In addition, a second oligonucleotide represented by SEQ ID NO: 16, which is a miRNA fragment consisting of 2 to 12 nucleotide sequences from the 5'end of the hsa-miR-503-3p miRNA, is prepared, and a 5 nd end is used as a second cap nucleotide. The nucleotide whose base is uracil was further extended. In addition, at the 3'end of the first oligonucleotide, the first extension nucleotide represented by SEQ ID NO: 17 complementary to the base sequence in the 3'-5' direction of the second oligonucleotide is synthesized and extended, and the first extension At the 3'end of the nucleotide, a nucleotide whose base is adenine complementary to the second cap nucleotide was further extended to the first end nucleotide. In addition, after synthesizing and extending the second extended oligonucleotide represented by SEQ ID NO: 18 complementary to the 3'-5' nucleotide sequence of the first oligonucleotide at the 3'end of the second oligonucleotide, A nucleotide whose base is adenine complementary to the first cap nucleotide was further extended to the 3'end of the second extension oligonucleotide. The first strand of the double-stranded oligonucleotide thus synthesized is represented by SEQ ID NO: 13, and the second strand is represented by SEQ ID NO: 14 (Table 4).
[실시예 4] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50D-2.3)[Example 4] Preparation of double-stranded oligonucleotide (PSI-50D-2.3)
도 31에 나타낸 이중 가닥의 올리고뉴클레오티드를 제작하였다. 보다 상세하게는, hsa-miR-6514-5p miRNA의 5' 말단으로부터 2 내지 11번째 염기서열로 이루어지는 miRNA 단편인 서열번호 21로 표시되는 제1 올리고뉴클레오티드를 준비하고, 이의 5' 말단에 제1 캡 뉴클레오티드로 염기가 우라실인 뉴클레오티드를 추가 연장하였다. 또한, hsa-miR-503-3p miRNA의 5' 말단으로부터 2 내지 11번째 염기서열로 이루어지는 miRNA 단편인 서열번호 22로 표시되는 제2 올리고뉴클레오티드를 준비하고, 이의 5' 말단에 제2 캡 뉴클레오티드로 염기가 우라실인 뉴클레오티드를 추가 연장하였다. 이후, 상기 제1 올리고뉴클레오티드의 3' 말단에 상기 hsa-miR-6514-5p miRNA의 5' 말단으로부터 12번째 뉴클레오티드를 제1 링커 뉴클레오티드로 추가 연장하였고, 상기 제1 링커 뉴클레오티드에 이어서 상기 제2 올리고뉴클레오티드의 3'-5' 방향에서 1번째 내지 9번째 염기서열에 상보적인 서열번호 23으로 표시되는 제1 연장 올리고뉴클레오티드를 합성 및 연장하였다. 상기 제1 연장 올리고뉴클레오티드의 3' 말단에는 상기 hsa-miR-6514-5p miRNA의 5' 말단으로부터 22 내지 23번째(3' 말단으로부터 1 내지 2번째)의 연속된 올리고뉴클레오티드를 제1 말단 올리고뉴클레오티드로 추가 연장하였다. 또한, 제2 올리고뉴클레오티드의 3' 말단에 상기 hsa-miR-503-3p miRNA의 5' 말단으로부터 12번째 뉴클레오티드를 제2 링커 뉴클레오티드로 추가 연장하였고, 상기 제2 링커 뉴클레오티드에 이어서 상기 제1 올리고뉴클레오티드의 3'-5' 방향에서 1번째 내지 9번째 염기서열에 상보적인 서열번호 24로 표시되는 제2 연장 올리고뉴클레오티드를 합성 및 연장하였다. 상기 제2 연장 올리고뉴클레오티드의 3' 말단에는 상기 hsa-miR-503-3p miRNA의 5' 말단으로부터 22 내지 23번째(3' 말단으로부터 1 내지 2번째)의 연속된 올리고뉴클레오티드를 제2 말단 올리고뉴클레오티드로 추가 연장하였다. 이렇게 합성된 이중 가닥의 올리고뉴클레오티드 중 제1 가닥은 서열번호 19로 표시되고, 제2 가닥은 서열번호 20으로 표시된다(표 5).The double-stranded oligonucleotide shown in FIG. 31 was prepared. More specifically, a first oligonucleotide represented by SEQ ID NO: 21, which is a miRNA fragment consisting of 2 to 11 nucleotide sequences from the 5'end of the hsa-miR-6514-5p miRNA, is prepared, and a first at the 5'end thereof The nucleotide whose base is uracil was further extended with the cap nucleotide. In addition, a second oligonucleotide represented by SEQ ID NO: 22, which is a miRNA fragment consisting of a 2-11th nucleotide sequence from the 5'end of the hsa-miR-503-3p miRNA, is prepared, and a 5 nd end is used as a second cap nucleotide. The nucleotide whose base is uracil was further extended. Thereafter, a 12th nucleotide from the 5'end of the hsa-miR-6514-5p miRNA at the 3'end of the first oligonucleotide was additionally extended as a first linker nucleotide, followed by the first linker nucleotide followed by the second oligo The first extended oligonucleotide represented by SEQ ID NO: 23 complementary to the 1st to 9th base sequences in the 3'-5' direction of the nucleotide was synthesized and extended. At the 3'end of the first extended oligonucleotide, a continuous oligonucleotide of 22 to 23rd from the 5'end of the hsa-miR-6514-5p miRNA (1 to 2nd from the 3'end) is a first end oligonucleotide. Further extended. In addition, a 12th nucleotide from the 5'end of the hsa-miR-503-3p miRNA at the 3'end of the second oligonucleotide was additionally extended as a second linker nucleotide, followed by the second linker nucleotide followed by the first oligonucleotide. The second extended oligonucleotide represented by SEQ ID NO: 24 complementary to the 1st to 9th base sequences in the 3'-5' direction was synthesized and extended. At the 3'end of the second extended oligonucleotide, 22 to 23 rd consecutive oligonucleotide from the 5'end of the hsa-miR-503-3p miRNA (1 to 2nd from the 3'end) is a second end oligonucleotide. Further extended. The first strand of the double-stranded oligonucleotide thus synthesized is represented by SEQ ID NO: 19, and the second strand is represented by SEQ ID NO: 20 (Table 5).
[실시예 5] 이중 가닥의 올리고뉴클레오티드의 제작(PSI-50E-2.3)[Example 5] Preparation of double-stranded oligonucleotide (PSI-50E-2.3)
도 32에 나타낸 이중 가닥의 올리고뉴클레오티드를 제작하였다. 보다 상세하게는, 상기 hsa-miR-6514-5p miRNA 전구체의 5' 말단으로부터 1 내지 23번째 염기서열(서열번호 27)로 이루어지는 제1-1 올리고뉴클레오티드와, 24번째 내지 34번째 염기서열(서열번호 28)로 이루어지는 제1-2 올리고뉴클레오티드를 준비하고, 상기 제1-1 올리고뉴클레오티드의 3' 말단에 상기 제1-2 올리고뉴클레오티드의 5' 말단을 연결하였다. 상기 제1-1 올리고뉴클레오티드는 다이서 작용기에 의해 hsa-miR-6514-5p miRNA 전구체로부터 분리될 수 있다. 또한, hsa-miR-503-3p miRNA 전구체의 3' 말단으로부터 4 내지 26번째 염기서열(서열번호 30)로 이루어지는 제2-1 올리고뉴클레오티드와, 27번째 내지 33번째 염기서열(서열번호 31)로 이루어지는 제2-2 올리고뉴클레오티드를 준비한 뒤, 상기 제2-2 올리고뉴클레오티드의 3' 말단에 상기 제2-1 올리고뉴클레오티드의 5' 말단을 연결하였다. 여기서 상기 제2-1 올리고뉴클레오티드 또한 다이서 작용기에 의해 hsa-miR-503-3p miRNA 전구체로부터 분리될 수 있는 것이다. 이후 상기 hsa-miR-6514-5p miRNA 전구체의 5' 말단으로부터 38번째 내지 48번째의 연속된 염기서열(서열번호 29)로 이루어지는 제1-3 올리고뉴클레오티드를 준비하고, 상기 hsa-miR-503-3p miRNA 전구체의 3' 말단으로부터 37번째 내지 45번째의 연속된 염기서열(서열번호 32)로 이루어지는 제2-3 올리고뉴클레오티드를 준비하였다. 이어서, 상기 제1-3 올리고뉴클레오티드의 3' 말단에 상기 제1-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열번호 33으로 표시되는 제1 연장 올리고뉴클레오티드를 추가로 연장 합성하였다. 또한, 상기 제2-3 올리고뉴클레오티드의 5' 말단에는 상기 제2-1 올리고뉴클레오티드의 3'-5' 방향의 염기서열에 상보적인 서열번호 34로 표시되는 제2 연장 올리고뉴클레오티드를 추가로 연장 합성하였다. 이후 상기 제1-2 올리고뉴클레오티드의 3' 말단에 상기 제2-2 올리고뉴클레오티드의 5' 말단을 연결하여 서열번호 25로 표시되는 단일 가닥의 올리고뉴클레오티드를 합성하고, 상기 제2-3 올리고뉴클레오티드의 3' 말단에 상기 제1-3 올리고뉴클레오티드의 5' 말단을 연결하여 서열번호 26으로 표시되는 단일 가닥의 올리고뉴클레오티드를 합성하였다(표 6). 상기 서열번호 25로 표시되는 올리고뉴클레오티드와 상기 서열번호 26으로 표시되는 올리고뉴클레오티드는 서로 혼성화되어 이중 가닥을 이룰 수 있다. The double-stranded oligonucleotide shown in FIG. 32 was prepared. More specifically, the 1-1 oligonucleotide consisting of the 1 to 23 nucleotide sequence (SEQ ID NO: 27) from the 5'end of the hsa-miR-6514-5p miRNA precursor, and the 24 to 34 nucleotide sequence (SEQ ID NO: A 1-2 oligonucleotide consisting of No. 28) was prepared, and the 5'end of the 1-2 oligonucleotide was connected to the 3'end of the 1-1 oligonucleotide. The 1-1 oligonucleotide may be separated from the hsa-miR-6514-5p miRNA precursor by a dicer functional group. In addition, from the 3'end of the hsa-miR-503-3p miRNA precursor to the 2-1 oligonucleotide consisting of 4 to 26 nucleotide sequence (SEQ ID NO: 30), and 27 to 33 nucleotide sequence (SEQ ID NO: 31) After the prepared 2-2 oligonucleotide was prepared, the 5'end of the 2-1 oligonucleotide was connected to the 3'end of the 2-2 oligonucleotide. Here, the 2-1 oligonucleotide can also be separated from the hsa-miR-503-3p miRNA precursor by a dicer functional group. Then, a 1-3 oligonucleotide consisting of the 38th to 48th consecutive base sequences (SEQ ID NO: 29) from the 5'end of the hsa-miR-6514-5p miRNA precursor was prepared, and the hsa-miR-503- From the 3'end of the 3p miRNA precursor, 2-3 oligonucleotides consisting of 37 to 45 consecutive sequences (SEQ ID NO: 32) were prepared. Subsequently, the first extension oligonucleotide represented by SEQ ID NO: 33 complementary to the base sequence in the 3'-5' direction of the 1-1 oligonucleotide is additionally synthesized at the 3'end of the 1-3 oligonucleotide. Did. In addition, at the 5'end of the 2-3 oligonucleotide, a second extension oligonucleotide represented by SEQ ID NO: 34 complementary to the base sequence in the 3'-5' direction of the 2-1 oligonucleotide is further extended and synthesized. Did. Then, the 5'end of the 2-2 oligonucleotide is connected to the 3'end of the 1-2 oligonucleotide to synthesize a single-stranded oligonucleotide represented by SEQ ID NO: 25, and the 2-3 oligonucleotide The 5'end of the 1-3 oligonucleotide was connected to the 3'end to synthesize a single-stranded oligonucleotide represented by SEQ ID NO: 26 (Table 6). The oligonucleotide represented by SEQ ID NO: 25 and the oligonucleotide represented by SEQ ID NO: 26 may be hybridized with each other to form a double strand.
(서열번호 25)uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg
(SEQ ID NO: 25)
(서열번호 26)ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua
(SEQ ID NO: 26)
[준비예 1] 암 세포 및 암 줄기세포의 준비[Preparation Example 1] Preparation of cancer cells and cancer stem cells
ATCC로부터 SK-MEL28, MALME-3M, A549, NCI-H460 암 세포주를 구매한 뒤 배양하였다. SK-MEL28 암세포주는 B27 supplement와 성장 인자(FGF 및 EGF 20 ng/mL)가 첨가된 DMEM/F12 배지에서 배양하며 암 줄기세포를 유도하였다. 암 줄기세포 마커인 CD44+가 발현된 세포 만을 선별하여 약 2주 동안 배양하였다. SK-MEL28, MALME-3M, A549, and NCI-H460 cancer cell lines were purchased from ATCC and cultured. The SK-MEL28 cancer cell line was cultured in DMEM/F12 medium containing B27 supplement and growth factors (FGF and
[실험예 1] 암 세포 및 암 줄기세포의 생존율 평가[Experimental Example 1] Evaluation of survival rate of cancer cells and cancer stem cells
리포펙타민(lipofectamine)을 이용하여 상기 준비예 1에서 준비된 SK-MEL28 암 세포 및 암 줄기세포에 상기 실시예 1 내지 5에서 준비된 5종의 이중 가닥의 올리고리보뉴클레오타이드를 9일 동안 도입한 뒤 세포 생존율의 변화를 비교하여 도 33에 나타내었다. Cells after introducing 5 double-stranded oligonucleotides prepared in Examples 1 to 5 to the SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 1 using lipofectamine for 9 days The change in survival rate is compared and shown in FIG. 33.
도 33에서 보는 바와 같이, 암 세포 및 암 줄기세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 상기 암 세포 및 암 줄기세포의 생존율이 현저히 감소하는 것을 확인할 수 있었다. As shown in FIG. 33, it was confirmed that when cancer cells and cancer stem cells were treated with oligoribonucleotides according to the present invention, the survival rate of the cancer cells and cancer stem cells was significantly reduced.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 세포 및 암 줄기세포의 증식 억제 및 사멸 유도 효과가 있음을 알 수 있다. Through this, it can be seen that the double-stranded oligonucleotide according to the present invention has an effect of inhibiting proliferation and apoptosis of cancer cells and cancer stem cells.
[실험예 2] 암 줄기세포의 증식 억제 평가[Experimental Example 2] Evaluation of cancer stem cell proliferation inhibition
상기 실험예 1과 동일한 방법으로 상기 준비예 1에서 준비된 SK-MEL28 암 세포 및 암 줄기세포 각각에 상기 실시예 1 내지 5의 5종의 이중 가닥의 올리고리보뉴클레오타이드를 도입한 뒤 콜로니 수의 변화를 비교하여 도 34에 나타내었다. In the same manner as in Experimental Example 1, after introducing the 5 double-stranded oligonucleotides of Examples 1 to 5 into each of the SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 1, the number of colonies was changed. It is shown in Figure 34 for comparison.
도 34에서 보는 바와 같이, 암 세포 및 암 줄기세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 상기 암 세포 및 암 줄기세포의 콜로니 수가 현저히 감소하는 것을 확인할 수 있었다. As shown in FIG. 34, when the oligoribonucleotides according to the present invention were treated to cancer cells and cancer stem cells, it was confirmed that the number of colonies of the cancer cells and cancer stem cells was significantly reduced.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 세포 및 암 줄기세포의 증식 억제 및 사멸 유도 효과가 매우 뛰어남을 알 수 있다. Through this, it can be seen that the double-stranded oligonucleotide according to the present invention has an excellent effect of inhibiting proliferation and inducing death of cancer cells and cancer stem cells.
[실험예 3] 암 줄기세포의 전이 억제 평가[Experimental Example 3] Evaluation of cancer stem cell metastasis inhibition
상기 실험예 1과 동일한 방법으로 상기 준비예 1에서 준비된 SK-MEL28 암세포 및 암 줄기세포에 상기 실시예 1 내지 5에서 얻어진 5종의 이중 가닥의 올리고리보뉴클레오타이드를 도입한 뒤 세포의 침윤능의 변화를 비교하여 도 35에 나타내었다 In the same manner as in Experimental Example 1, after introducing the 5 double-stranded oligoribonucleotides obtained in Examples 1 to 5 into the SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 1, changes in cell infiltration ability It is shown in Figure 35 by comparing
도 35에서 보는 바와 같이, 암 세포 및 암 줄기세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 암 줄기세포의 세포 침윤능이 현저히 감소하는 것을 확인할 수 있었다. As shown in FIG. 35, it was confirmed that when cancer cells and cancer stem cells were treated with oligoribonucleotides according to the present invention, the cell invasion capacity of cancer stem cells was significantly reduced.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 세포, 및 암 줄기세포의 세포 침윤능을 효과적으로 억제할 수 있는 것을 알 수 있다. Through this, it can be seen that the double-stranded oligonucleotide according to the present invention can effectively suppress the cell invasion ability of cancer cells and cancer stem cells.
[실험예 4] 암 줄기세포의 분화 유도 평가[Experimental Example 4] Evaluation of induction of differentiation of cancer stem cells
상기 실험예 1과 동일한 방법으로 상기 준비예 1에서 준비된 SK-MEL28 암세포 및 암 줄기세포 각각에 상기 실시예 1 내지 5의 5종의 올리고리보뉴클레오타이드를 도입한 뒤 올리고리보뉴클레오타이드가 도입된 암 줄기세포를 수확(harvesting)하여 RNA를 분리한 뒤 cDNA를 합성하고 하기 표 7에 나타낸 프라이머를 이용하여 qPCR 기법을 통해 Nanog 및 TYRP1 유전자의 실시간 증폭되는 사이클(cycle)을 수치화해 정량화 하였다. 그 결과는 도 36 및 37과 같다.In the same manner as in Experimental Example 1, after introducing the 5 oligoribonucleotides of Examples 1 to 5 into each of the SK-MEL28 cancer cells and cancer stem cells prepared in Preparation Example 1, cancer stem cells into which oligoribonucleotides were introduced After harvesting (harvesting) to isolate RNA, synthesized cDNA and quantified by quantifying the real-time amplifying cycle of Nanog and TYRP1 genes through qPCR technique using the primers shown in Table 7. The results are shown in Figs. 36 and 37.
TGGCCAAGTCGGGAGTTTAG
CATACTGCGTCTGGCACGAA
도 36에서 보는 바와 같이, SK-MEL28 암 줄기세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 줄기능(stemness)과 관련된 유전자인 Nanog의 발현 수준이 현저히 저감된 것을 확인할 수 있었다.As shown in FIG. 36, it was confirmed that the level of expression of Nanog, a gene related to stemness, was significantly reduced when SK-MEL28 cancer stem cells were treated with the oligonucleotide according to the present invention.
한편, 도 37에서 보는 바와 같이, 암 줄기세포에서 그 발현이 억제된 TYRP1의 발현 수준은 증가한 것을 볼 수 있다. On the other hand, as shown in Figure 37, it can be seen that the expression level of TYRP1 whose expression is suppressed in cancer stem cells is increased.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 줄기세포의 줄기세포능(stemness)을 상실하도록 하는 효과가 있음을 알 수 있다. Through this, it can be seen that the double-stranded oligonucleotide according to the present invention has an effect of losing the stem cell function of cancer stem cells.
[실험예 5] 암 세포의 증식 억제 평가[Experimental Example 5] Evaluation of cancer cell proliferation inhibition
리포펙타민(lipofectamine)을 이용하여 상기 준비예 1에서 준비된 SK-MEL28, Malme-3m, A549, NCI-H460 암 세포 각각에 상기 실시예 1 내지 5의 5종의 이중 가닥의 올리고리보뉴클레오타이드를 농도별(0.01, 1, 10, 100, 1000, 10000 nM)로 도입한 뒤 세포 생존율의 변화를 측정하여 그 결과를 각각 도 38 내지 도 41에 나타내었다. The concentrations of five double-stranded oligonucleotides of Examples 1 to 5 were concentrated on each of SK-MEL28, Malme-3m, A549, and NCI-H460 cancer cells prepared in Preparation Example 1 using lipofectamine. After introducing into stars (0.01, 1, 10, 100, 1000, 10000 nM), changes in cell viability were measured and the results are shown in FIGS. 38 to 41, respectively.
도 38 내지 도 41에서 보는 바와 같이, 암 세포에 본 발명에 따른 올리고리보뉴클레오타이드를 처리하자 상기 암 세포가 50% 정도 사멸되는 물질 농도가 매우 낮은 것을 확인할 수 있었다. 38 to 41, it was confirmed that when the cancer cells were treated with the oligoribonucleotides according to the present invention, the cancer cells were killed at a concentration of about 50%.
이를 통하여 본 발명에 따른 이중 가닥의 올리고리보뉴클레오타이드는 암 세포의 증식 억제 및 사멸 유도 효과가 매우 뛰어남을 알 수 있다. Through this, it can be seen that the double-stranded oligonucleotide according to the present invention has an excellent effect of inhibiting proliferation of cancer cells and inducing death.
10: 제1 올리고뉴클레오티드
11: 제2 올리고뉴클레오티드
20: 제1 연장 올리고뉴클레오티드
21: 제2 연장 올리고뉴클레오티드
50a: 제1-1 올리고뉴클레오티드
50b: 제1-2 올리고뉴클레오티드
50c: 제1-3 올리고뉴클레오티드
60a: 제2-1 올리고뉴클레오티드
60b: 제2-2 올리고뉴클레오티드
60c: 제2-3 올리고뉴클레오티드
70: 제1 연장 올리고뉴클레오티드
71: 제2 연장 올리고뉴클레오티드
100: 제1 캡 뉴클레오티드 또는 제1 캡 올리고뉴클레오티드
100': 제2 캡 뉴클레오티드 또는 제2 캡 올리고뉴클레오티드
200: 제1 말단 뉴클레오티드 또는 제1 말단 올리고뉴클레오티드
200': 제2 말단 뉴클레오티드 또는 제2 말단 올리고뉴클레오티드
300: 제1 링커
300': 제2 링커
[서열목록]
서열번호 1: 제1 가닥
5'-uauggaguggacuuucagcuggcccuggcagcggaaacaauacccc-3'
서열번호 2: 제2 가닥
5'-gggguauuguuuccgcugccagggccagcugaaaguccacuccaua-3'
서열번호 3: 제1 올리고뉴클레오티드
5'-uauggaguggacuuucagcuggc-3'
서열번호 4: 제2 올리고뉴클레오티드
5'-gggguauuguuuccgcugccagg-3'
서열번호 5: 제1 연장 올리고뉴클레오티드
5'-ccuggcagcggaaacaauacccc-3'
서열번호 6: 제2 연장 올리고뉴클레오티드
5'-gccagcugaaaguccacuccaua-3'
서열번호 7: 제1 가닥
5'-uauggaguggaaaacaauacccc-3'
서열번호 8: 제2 가닥
5'-gggguauuguuuuccacuccaua-3'
서열번호 9: 제1 올리고뉴클레오티드
5'-uauggagugga-3'
서열번호 10: 제2 올리고뉴클레오티드
5'-gggguauuguuu-3'
서열번호 11: 제1 연장 올리고뉴클레오티드
5'-aaacaauacccc-3'
서열번호 12: 제2 연장 올리고뉴클레오티드
5'-uccacuccaua-3'
서열번호 13: 제1 가닥
5'-uauggaguggaaaacaauaccca-3'
서열번호 14: 제2 가닥
5'-uggguauuguuuuccacuccaua-3'
서열번호 15: 제1 올리고뉴클레오티드
5'-auggagugga-3'
서열번호 16: 제2 올리고뉴클레오티드
5'-ggguauuguuu-3'
서열번호 17: 제1 연장 올리고뉴클레오티드
5'-aaacaauaccc-3'
서열번호 18: 제2 연장 올리고뉴클레오티드
5'-uccacuccau-3'
서열번호 19: 제1 가닥
5'-uauggaguggacaacaauaccgc-3'
서열번호 20: 제2 가닥
5'-uggguauuguuuuccacuccagg-3'
서열번호 21: 제1 올리고뉴클레오티드
5'-auggagugga-3'
서열번호 22: 제2 올리고뉴클레오티드
5'-ggguauuguu-3'
서열번호 23: 제1 연장 올리고뉴클레오티드
5'-aacaauacc-3'
서열번호 24: 제2 연장 올리고뉴클레오티드
5'-uccacucca-3'
서열번호 25
5'-uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg-3'
서열번호 26
5'-ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua-3'
서열번호 27: 제1-1 올리고뉴클레오티드
5'-uauggaguggacuuucagcuggc-3'
서열번호 28: 제1-2 올리고뉴클레오티드
5'-auuuacgaguc-3'
서열번호 29: 제1-3 올리고뉴클레오티드
5'-guucuuacaga-3'
서열번호 30: 제2-1 올리고뉴클레오티드
5'-gggguauuguuuccgcugccagg-3'
서열번호 31: 제2-2 올리고뉴클레오티드
5'-gugcucu-3'
서열번호 32: 제2-3 올리고뉴클레오티드
5'-agugagcga-3'
서열번호 33: 제1 연장 올리고뉴클레오티드
5'-gccagcugaaaguccacuccaua-3'
서열번호 34: 제2 연장 올리고뉴클레오티드
5'-ccuggcagcggaaacaauacccc-3'
서열번호 35: hsa-miR-6514-5p miRNA 전구체
5'-uauggaguggacuuucagcuggcauuuacgagucagaguucuuacagagcugccuguucuuccacuccag-3'
서열번호 36: hsa-miR-6514-5p miRNA 전구체
5'-ugcccuagcagcgggaacaguucugcagugagcgaucggugcucugggguauuguuuccgcugccagggua-3'10: first oligonucleotide
11: second oligonucleotide
20: first extended oligonucleotide
21: second extended oligonucleotide
50a: 1-1 oligonucleotide
50b: 1-2 oligonucleotide
50c: 1-3 oligonucleotide
60a: 2-1 oligonucleotide
60b: 2-2 oligonucleotide
60c: 2-3 oligonucleotide
70: first extended oligonucleotide
71: second extended oligonucleotide
100: first cap nucleotide or first cap oligonucleotide
100': second cap nucleotide or second cap oligonucleotide
200: first terminal nucleotide or first terminal oligonucleotide
200': second terminal nucleotide or second terminal oligonucleotide
300: first linker
300': second linker
[Sequence list]
SEQ ID NO: 1st strand
5'-uauggaguggacuuucagcuggcccuggcagcggaaacaauacccc-3'
SEQ ID NO: 2nd strand
5'-gggguauuguuuccgcugccagggccagcugaaaguccacuccaua-3'
SEQ ID NO: 3: first oligonucleotide
5'-uauggaguggacuuucagcuggc-3'
SEQ ID NO: 2nd oligonucleotide
5'-gggguauuguuuccgcugccagg-3'
SEQ ID NO: 5 First extended oligonucleotide
5'-ccuggcagcggaaacaauacccc-3'
SEQ ID NO: 6: second extended oligonucleotide
5'-gccagcugaaaguccacuccaua-3'
SEQ ID NO: 7 first strand
5'-uauggaguggaaaacaauacccc-3'
SEQ ID NO: 8: second strand
5'-gggguauuguuuuccacuccaua-3'
SEQ ID NO: 9 first oligonucleotide
5'-uauggagugga-3'
SEQ ID NO: 10: Second oligonucleotide
5'-gggguauuguuu-3'
SEQ ID NO: 11: first extended oligonucleotide
5'-aaacaauacccc-3'
SEQ ID NO: 12 Second extended oligonucleotide
5'-uccacuccaua-3'
SEQ ID NO: 13 First strand
5'-uauggaguggaaaacaauaccca-3'
SEQ ID NO: 14 Second strand
5'-uggguauuguuuuccacuccaua-3'
SEQ ID NO: 15 First oligonucleotide
5'-auggagugga-3'
SEQ ID NO: 16: Second oligonucleotide
5'-ggguauuguuu-3'
SEQ ID NO: 17 First extended oligonucleotide
5'-aaacaauaccc-3'
SEQ ID NO: 18 second extended oligonucleotide
5'-uccacuccau-3'
SEQ ID NO: 19 First strand
5'-uauggaguggacaacaauaccgc-3'
SEQ ID NO: 20 Second strand
5'-uggguauuguuuuccacuccagg-3'
SEQ ID NO: 21 First oligonucleotide
5'-auggagugga-3'
SEQ ID NO: 22 Second oligonucleotide
5'-ggguauuguu-3'
SEQ ID NO: 23 First extended oligonucleotide
5'-aacaauacc-3'
SEQ ID NO: 24 Second extended oligonucleotide
5'-uccacucca-3'
SEQ ID NO: 25
5'-uauggaguggacuuucagcuggcauuuacgagucgugcucugggguauuguuuccgcugccagg-3'
SEQ.ID No. 26
5'-ccuggcagcggaaacaauaccccagugagcgaguucuuacagagccagcugaaaguccacuccaua-3'
SEQ ID NO: 27-1-1 oligonucleotide
5'-uauggaguggacuuucagcuggc-3'
SEQ ID NO: 28 1-2 oligonucleotide
5'-auuuacgaguc-3'
SEQ ID NO: 29 1-3 Oligonucleotide
5'-guucuuacaga-3'
SEQ ID NO: 30-2-1 oligonucleotide
5'-gggguauuguuuccgcugccagg-3'
SEQ ID NO: 31 2-2 oligonucleotide
5'-gugcucu-3'
SEQ ID NO: 32 2-3 oligonucleotide
5'-agugagcga-3'
SEQ ID NO: 33 First extended oligonucleotide
5'-gccagcugaaaguccacuccaua-3'
SEQ ID NO: 34: Second extended oligonucleotide
5'-ccuggcagcggaaacaauacccc-3'
SEQ ID NO: 35: hsa-miR-6514-5p miRNA precursor
5'-uauggaguggacuuucagcuggcauuuacgagucagaguucuuacagagcugccuguucuuccacuccag-3'
SEQ ID NO: 36 hsa-miR-6514-5p miRNA precursor
5'-ugcccuagcagcgggaacaguucugcagugagcgaucggugcucugggguauuguuuccgcugccagggua-3'
<110> PROSTEMICS CO., LTD. <120> miRNA polymer and the method for preparing the same <130> DPB174159.k01 <150> KR 10-2017-0159668 <151> 2017-11-27 <160> 36 <170> KoPatentIn 3.0 <210> 1 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 1 uauggagugg acuuucagcu ggcccuggca gcggaaacaa uacccc 46 <210> 2 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 2 gggguauugu uuccgcugcc agggccagcu gaaaguccac uccaua 46 <210> 3 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 3 uauggagugg acuuucagcu ggc 23 <210> 4 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 4 gggguauugu uuccgcugcc agg 23 <210> 5 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 5 ccuggcagcg gaaacaauac ccc 23 <210> 6 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 6 gccagcugaa aguccacucc aua 23 <210> 7 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 7 uauggagugg aaaacaauac ccc 23 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 8 gggguauugu uuuccacucc aua 23 <210> 9 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 9 uauggagugg a 11 <210> 10 <211> 12 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 10 gggguauugu uu 12 <210> 11 <211> 12 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 11 aaacaauacc cc 12 <210> 12 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 12 uccacuccau a 11 <210> 13 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 13 uauggagugg aaaacaauac cca 23 <210> 14 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 14 uggguauugu uuuccacucc aua 23 <210> 15 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 15 auggagugga 10 <210> 16 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 16 ggguauuguu u 11 <210> 17 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 17 aaacaauacc c 11 <210> 18 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 18 uccacuccau 10 <210> 19 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 19 uauggagugg acaacaauac cgc 23 <210> 20 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 20 uggguauugu uuuccacucc agg 23 <210> 21 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 21 auggagugga 10 <210> 22 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 22 ggguauuguu 10 <210> 23 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 23 aacaauacc 9 <210> 24 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 24 uccacucca 9 <210> 25 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 25 uauggagugg acuuucagcu ggcauuuacg agucgugcuc ugggguauug uuuccgcugc 60 cagg 64 <210> 26 <211> 66 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 26 ccuggcagcg gaaacaauac cccagugagc gaguucuuac agagccagcu gaaaguccac 60 uccaua 66 <210> 27 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 27 uauggagugg acuuucagcu ggc 23 <210> 28 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 28 auuuacgagu c 11 <210> 29 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 29 guucuuacag a 11 <210> 30 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 30 gggguauugu uuccgcugcc agg 23 <210> 31 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 31 gugcucu 7 <210> 32 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 32 agugagcga 9 <210> 33 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 33 gccagcugaa aguccacucc aua 23 <210> 34 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 34 ccuggcagcg gaaacaauac ccc 23 <210> 35 <211> 70 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 35 uauggagugg acuuucagcu ggcauuuacg agucagaguu cuuacagagc ugccuguucu 60 uccacuccag 70 <210> 36 <211> 71 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 36 ugcccuagca gcgggaacag uucugcagug agcgaucggu gcucuggggu auuguuuccg 60 cugccagggu a 71 <110> PROSTEMICS CO., LTD. <120> miRNA polymer and the method for preparing the same <130> DPB174159.k01 <150> KR 10-2017-0159668 <151> 2017-11-27 <160> 36 <170> KoPatentIn 3.0 <210> 1 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 1 uauggagugg acuuucagcu ggcccuggca gcggaaacaa uacccc 46 <210> 2 <211> 46 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 2 gggguauugu uuccgcugcc agggccagcu gaaaguccac uccaua 46 <210> 3 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 3 uauggagugg acuuucagcu ggc 23 <210> 4 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 4 gggguauugu uuccgcugcc agg 23 <210> 5 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 5 ccuggcagcg gaaacaauac ccc 23 <210> 6 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 6 gccagcugaa aguccacucc aua 23 <210> 7 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 7 uauggagugg aaaacaauac ccc 23 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 8 gggguauugu uuuccacucc aua 23 <210> 9 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 9 uauggagugg a 11 <210> 10 <211> 12 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 10 gggguauugu uu 12 <210> 11 <211> 12 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 11 aaacaauacc cc 12 <210> 12 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 12 uccacuccau a 11 <210> 13 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 13 uauggagugg aaaacaauac cca 23 <210> 14 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 14 uggguauugu uuuccacucc aua 23 <210> 15 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 15 auggagugga 10 <210> 16 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 16 ggguauuguu u 11 <210> 17 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 17 aaacaauacc c 11 <210> 18 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 18 uccacuccau 10 <210> 19 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 19 uauggagugg acaacaauac cgc 23 <210> 20 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 20 uggguauugu uuuccacucc agg 23 <210> 21 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 21 auggagugga 10 <210> 22 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 22 ggguauuguu 10 <210> 23 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 23 aacaauacc 9 <210> 24 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 24 uccacucca 9 <210> 25 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 25 uauggagugg acuuucagcu ggcauuuacg agucgugcuc ugggguauug uuuccgcugc 60 cagg 64 <210> 26 <211> 66 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 26 ccuggcagcg gaaacaauac cccagugagc gaguucuuac agagccagcu gaaaguccac 60 uccaua 66 <210> 27 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 27 uauggagugg acuuucagcu ggc 23 <210> 28 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 28 auuuacgagu c 11 <210> 29 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 29 guucuuacag a 11 <210> 30 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 30 gggguauugu uuccgcugcc agg 23 <210> 31 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 31 gugcucu 7 <210> 32 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 32 agugagcga 9 <210> 33 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 33 gccagcugaa aguccacucc aua 23 <210> 34 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 34 ccuggcagcg gaaacaauac ccc 23 <210> 35 <211> 70 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 35 uauggagugg acuuucagcu ggcauuuacg agucagaguu cuuacagagc ugccuguucu 60 uccacuccag 70 <210> 36 <211> 71 <212> RNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 36 ugcccuagca gcgggaacag uucugcagug agcgaucggu gcucuggggu auuguuuccg 60 cugccagggu a 71
Claims (41)
목적하는 제1 올리고뉴클레오티드 및 제1 연장 올리고뉴클레오티드를 포함하는 제1 가닥; 및
목적하는 제2 올리고뉴클레오티드 및 제2 연장 올리고뉴클레오티드를 포함하는 제2 가닥;을 포함하며,
상기 제1 연장 올리고뉴클레오티드는 상기 제2 올리고뉴클레오티드와 혼성화될 수 있고,
상기 제2 연장 올리고뉴클레오티드는 상기 제1 올리고뉴클레오티드와 혼성화될 수 있는, 이중 가닥의 올리고뉴클레오티드에서,
상기 이중 가닥의 올리고뉴클레오티드는,
상기 제1 올리고뉴클레오티드는 서열번호 3으로 표시되고, 상기 제2 올리고뉴클레오티드는 서열번호 4로 표시되는 올리고뉴클레오티드;
상기 제1 올리고뉴클레오티드는 서열번호 9로 표시되고, 상기 제2 올리고뉴클레오티드는 서열번호 10으로 표시되는 올리고뉴클레오티드;
상기 제1 올리고뉴클레오티드는 서열번호 15로 표시되고, 상기 제2 올리고뉴클레오티드는 서열번호 16으로 표시되는 올리고뉴클레오티드; 또는
상기 제1 올리고뉴클레오티드는 서열번호 21로 표시되고, 상기 제2 올리고뉴클레오티드는 서열번호 22로 표시되는 올리고뉴클레오티드;인 이중 가닥의 올리고뉴클레오티드.As a double-stranded oligonucleotide,
A first strand comprising a desired first oligonucleotide and a first extended oligonucleotide; And
And a second strand comprising a desired second oligonucleotide and a second extended oligonucleotide.
The first extended oligonucleotide may be hybridized with the second oligonucleotide,
The second extended oligonucleotide, in the double-stranded oligonucleotide capable of hybridizing with the first oligonucleotide,
The double-stranded oligonucleotide,
The first oligonucleotide is represented by SEQ ID NO: 3, the second oligonucleotide is represented by SEQ ID NO: 4;
The first oligonucleotide is represented by SEQ ID NO: 9, the second oligonucleotide is represented by SEQ ID NO: 10;
The first oligonucleotide is represented by SEQ ID NO: 15, the second oligonucleotide is represented by SEQ ID NO: 16; or
The first oligonucleotide is represented by SEQ ID NO: 21, and the second oligonucleotide is an oligonucleotide represented by SEQ ID NO: 22; a double-stranded oligonucleotide.
상기 올리고뉴클레오티드는 DNA, RNA 또는 DNA/RNA 하이브리드 분자인, 이중 가닥의 올리고뉴클레오티드. According to claim 1,
The oligonucleotide is a DNA, RNA or DNA/RNA hybrid molecule, double-stranded oligonucleotide.
상기 제1 올리고뉴클레오티드 또는 상기 제2 올리고뉴클레오티드는, 성숙한 miRNA, miRNA 전구체(miRNA precursor), 일차 miRNA (pri-miRNA), 플라스미드 (plasmid) 형태의 miRNA 전구체의 전 사슬 또는 이들의 단편을 포함하는 것인, 이중 가닥의 올리고뉴클레오티드.According to claim 1,
The first oligonucleotide or the second oligonucleotide includes a mature miRNA, a miRNA precursor, a primary miRNA (pri-miRNA), an entire chain of miRNA precursors in a plasmid form, or fragments thereof Phosphorus, double stranded oligonucleotide.
상기 제1 올리고뉴클레오티드 및 상기 제2 올리고뉴클레오티드는 서로 동일하거나 상이한, 이중 가닥의 올리고뉴클레오티드.According to claim 1,
The first oligonucleotide and the second oligonucleotide are the same or different from each other, double-stranded oligonucleotide.
상기 제1 올리고뉴클레오티드 또는 상기 제2 올리고뉴클레오티드의 길이는 18~25 nt인, 이중 가닥의 올리고뉴클레오티드.According to claim 1,
The length of the first oligonucleotide or the second oligonucleotide is 18-25 nt, double-stranded oligonucleotide.
상기 제1 올리고뉴클레오티드 또는 상기 제2 올리고뉴클레오티드의 길이는 9~11 nt인, 이중 가닥의 올리고뉴클레오티드.According to claim 1,
The length of the first oligonucleotide or the second oligonucleotide is 9 to 11 nt, a double-stranded oligonucleotide.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20170159668 | 2017-11-27 | ||
KR1020170159668 | 2017-11-27 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20190062290A KR20190062290A (en) | 2019-06-05 |
KR102138495B1 true KR102138495B1 (en) | 2020-07-28 |
Family
ID=66630756
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020180148846A KR102138495B1 (en) | 2017-11-27 | 2018-11-27 | miRNA polymer and the method for preparing the same |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR102138495B1 (en) |
WO (1) | WO2019103581A1 (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060130176A1 (en) * | 2004-10-12 | 2006-06-15 | The Rockefeller University | MicroRNAs |
US20090208564A1 (en) | 2007-08-27 | 2009-08-20 | Chiang Jia Li | Compositions of asymmetric interfering RNA and uses thereof |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011028550A1 (en) * | 2009-08-24 | 2011-03-10 | Merck Sharp & Dohme Corp. | Segmented micro rna mimetics |
KR101206374B1 (en) * | 2010-03-18 | 2012-11-29 | 경희대학교 산학협력단 | Pharmaceutical Composition for Treating Cancer Comprising Double-stranded miRNAs as Active Ingredient |
BR112017018318A2 (en) * | 2015-02-25 | 2018-07-10 | Bioneer Corporation | A pharmaceutical composition for treating cancer comprising a micro RNA as an active ingredient |
EP3357498A4 (en) * | 2015-09-28 | 2019-05-15 | National University Corporation Chiba University | Method for suppressing tumors by mir-200 family inhibition |
-
2018
- 2018-11-27 KR KR1020180148846A patent/KR102138495B1/en active IP Right Grant
- 2018-11-27 WO PCT/KR2018/014742 patent/WO2019103581A1/en active Application Filing
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20060130176A1 (en) * | 2004-10-12 | 2006-06-15 | The Rockefeller University | MicroRNAs |
US20090208564A1 (en) | 2007-08-27 | 2009-08-20 | Chiang Jia Li | Compositions of asymmetric interfering RNA and uses thereof |
Non-Patent Citations (2)
Title |
---|
논문1: J Pharmacol Exp Ther. 2015 |
논문2: Briefings in Bioinformatics, 2016 |
Also Published As
Publication number | Publication date |
---|---|
WO2019103581A1 (en) | 2019-05-31 |
KR20190062290A (en) | 2019-06-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10526602B2 (en) | Segmented micro RNA mimetics | |
US20230220393A1 (en) | METHODS AND MODIFICATIONS THAT PRODUCE ssRNAi COMPOUNDS WITH ENHANCED ACTIVITY, POTENCY AND DURATION OF EFFECT | |
AU777499B2 (en) | Antisense oligonucleotides comprising universal and/or degenerate bases | |
JP2018516091A5 (en) | ||
WO2012027206A1 (en) | SINGLE-STRANDED RNAi AGENTS CONTAINING AN INTERNAL, NON-NUCLEIC ACID SPACER | |
AU2014230000B2 (en) | Tricyclic nucleosides and oligomeric compounds prepared therefrom | |
JP6486836B2 (en) | Artificial mimic miRNA for gene expression control and use thereof | |
WO2015023937A1 (en) | Heterochromatin forming non-coding rnas | |
KR20220069103A (en) | Chemical modification of small interfering RNAs with minimal fluorine content | |
WO2012069059A1 (en) | Oligonucleotides for modulation of target rna activity | |
JPWO2019004420A1 (en) | Heteroduplex antimiR | |
KR102138495B1 (en) | miRNA polymer and the method for preparing the same | |
WO2008011473A2 (en) | Compositions and their uses directed to hbxip | |
JP6934695B2 (en) | Nucleic acid medicine and its use | |
CN111226114A (en) | Method for identifying improved variants of antisense oligonucleotides using a subset of sterically defined oligonucleotides | |
IL159759A (en) | Oligoribonucleotide derivatives for the targeted inhibition of gene expression, pharmaceutical compositions comprising them, method for their preparation and use thereof | |
JPWO2019044974A1 (en) | Small Guide Antisense Nucleic Acids and Their Use | |
KR102145176B1 (en) | Oligonucleotide, and pharmaceutical composition for prevention or treatment of cancer comprising the same | |
WO2023127848A1 (en) | Nucleic acid drug targeting ebv-related disorders | |
WO2021039598A1 (en) | Rna action inhibitor and use thereof | |
TW202309286A (en) | Asymmetric short duplex dna as a novel gene silencing technology and use thereof | |
TW202313977A (en) | Short duplex dna as a novel gene silencing technology and use thereof | |
WO2023076710A1 (en) | Stabilized rna agents | |
CN117795072A (en) | Products and compositions | |
JP2024056820A (en) | Oligonucleotides for modulating SCN9A expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
N231 | Notification of change of applicant | ||
GRNT | Written decision to grant |