WO2019098512A1 - Allele specific primer of nucleic acids, and method for identifying genotype by using same - Google Patents

Allele specific primer of nucleic acids, and method for identifying genotype by using same Download PDF

Info

Publication number
WO2019098512A1
WO2019098512A1 PCT/KR2018/010206 KR2018010206W WO2019098512A1 WO 2019098512 A1 WO2019098512 A1 WO 2019098512A1 KR 2018010206 W KR2018010206 W KR 2018010206W WO 2019098512 A1 WO2019098512 A1 WO 2019098512A1
Authority
WO
WIPO (PCT)
Prior art keywords
primer
nucleotide
nitropyrrol
complementary
nitrobenzimidazole
Prior art date
Application number
PCT/KR2018/010206
Other languages
French (fr)
Korean (ko)
Inventor
김민진
박혜시
정지현
김정민
강병규
홍민의
Original Assignee
제노플랜코리아 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 제노플랜코리아 주식회사 filed Critical 제노플랜코리아 주식회사
Priority to JP2018564352A priority Critical patent/JP2020503838A/en
Publication of WO2019098512A1 publication Critical patent/WO2019098512A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/34—Allele or polymorphism specific uses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/30—Oligonucleotides characterised by their secondary structure
    • C12Q2525/307—Circular oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the present invention relates to a primer that increases the hybridization specificity to a sequence having a single base polymorphism, and a genotyping method using the primer.
  • Nucleotide polymorphism refers to a variation in the nucleotide sequence that occurs in excess of 1%, of which 90% is single nucleotide polymorphism (SNP).
  • SNP single nucleotide polymorphism
  • the human genetic sequence is 99.9% identical, the SNP appears about every 250 to 1000 bp, the human genome has about 2 million SNPs, and the double gene has about 21,000 genes. Mutations of other single bases, which occur at a frequency of 1% or less, are commonly referred to as mutations.
  • Sequence mutation analysis or SNPs play an important role as markers that can be used to determine DNA sequencing as well as to identify genes that cause diseases such as cancer, asthma, diabetes, or certain diseases, as well as to analyze Ye S 1, Dhillon S, Ke X, Collins AR, Day IN.
  • An efficient procedure for genotyping single nucleotide polymorphisms Nucleic Acids Res 2001 Sep 1; 29 (17): E88-8; 1999 Jul 8; 234 (2): 177-86.).
  • PCR-RFLP PCR-restriction fragment length polymorphism
  • SSP Sequence-Specific Primed PCR
  • Real-time PCR that measures PCR amplified DNA in real time using a fluorescent substance. Restriction enzyme is reacted at both ends of the primer Strand displacement amplification (SDA) in which a primer which has been additionally inserted into the amplification reaction after the reaction of the primer is used for the amplification reaction is known.
  • SDA Strand displacement amplification
  • the present invention aims to increase the detection sensitivity of a single nucleotide polymorphism by providing a primer that increases the hybridization specificity to a sequence having a single nucleotide polymorphism (SNP) and a genotyping method using the primer.
  • SNP single nucleotide polymorphism
  • An aspect of the present invention provides a primer set comprising a primer represented by the following formula 1:
  • X is a first binding site comprising a hybridization nucleotide sequence of 15 to 25 bp complementary to a template nucleic acid to be hybridized
  • Y is a ring forming site of 3 to 10 bp
  • Z is a nucleotide sequence complementary to the template nucleic acid, 10 bp
  • a second binding site comprising a nucleotide corresponding to an allele and a non-complementary nucleotide of 1 to 3 bp consecutive thereto, wherein X, Y and Z are deoxyribonucleotides or ribonucleotides.
  • the non-complementary nucleotide at the second binding site may be contiguous to the 5 ' position of the nucleotide corresponding to the allelic trait.
  • the non-complementary nucleotide may be 1 bp.
  • the ring-forming moiety is selected from the group consisting of inosine, dioxyinosine, 7-diaza-2-deoxyinosine, 2-aza-2-deoxyinosine, 2-OMe- 3-nitropyrrol, 2'-OMe-3-nitropyrrol, 2'-F 3-nitropyrrol, 1- (2-deoxy-beta-D 5-nitroindole, 2'-OMe-5-nitroindole, 2'-F-5-nitroindole, dioxy-4-nitro Benzimidazole, 4-nitrobenzimidazole, dioxy 4-aminobenzimidazole, 4-aminobenzimidazole, dioxine nebulin, 2'-F nebulin, 2'-F 4-nitrobenzimide PNA-4-nitrobenzimidazole, PNA-3-nitropyrrol, morpholino-5-nitroindole, morpholino-ne Morpholino-3-nitropropyl, morpholino
  • the hybridizing template nucleic acid may be selected from the group consisting of the SLC23A1 gene, the APOE gene, the AQP3 gene, and a combination of the genes.
  • One aspect of the present invention provides a composition for discriminating mononucleotide alleles comprising the above primer set.
  • Another aspect of the present invention provides a method for discriminating mononucleotide alleles using the composition for discriminating mononucleotide alleles.
  • the primer set of the present invention can increase single nucleotide polymorphism detection sensitivity by increasing the hybridization specificity for a nucleic acid template having a single nucleotide polymorphism (SNP), and can provide more accurate results in genotype discrimination of a target template.
  • SNP single nucleotide polymorphism
  • Figure 1 shows a primer according to the invention.
  • Fig. 2 shows the template-specific binding of the primer according to the present invention and whether or not it is cloned.
  • Fig. 3 shows the concept of a method for discriminating a genotype using a primer set according to the present invention.
  • FIG. 5 shows the result of discrimination of the genotype of the SNP rs11950646 of the SLC23A1 gene using the primer according to the present invention according to the temperature.
  • FIG. 6 shows the genotyping results of the SNP rs429358 of the APOE gene according to the primer according to the present invention and the primer according to the comparative example.
  • Fig. 7 shows the result of discrimination of the genotype of SNP rs429358 of the APOE gene using the primer according to the present invention according to the temperature.
  • FIG. 9 shows the result of discrimination of genotype of SNP rs34391490 of AQP3 gene using primers according to the present invention at different temperatures.
  • the invention is an oligonucleotide primer having a first binding site, a ring forming site and a second binding site, wherein the oligonucleotide primer comprises a nucleotide corresponding to an allele at the second binding site and a non-complementary nucleotide contiguous thereto.
  • the present invention provides a primer set comprising a primer represented by the following formula 1:
  • X is a first binding site comprising a hybridization nucleotide sequence of 15 to 25 bp, preferably 21 to 23 bp complementary to the template nucleic acid to be hybridized
  • Y is a ring-forming site of 3 to 10 bp, preferably 5 to 7 bp
  • Z is a second binding site comprising a hybridization nucleotide sequence of 5 to 10 bp, preferably 6 or 7 bp, complementary to the template nucleic acid, and a nucleotide corresponding to the allele and a 1 to 3 bp non-complementary nucleotide contiguous thereto
  • X, Y and Z are deoxyribonucleotides or ribonucleotides.
  • the term " primer" is a single strand oligonucleotide complementary to a template (nucleic acid) to be cloned and acting as a starting point of the cloning synthesis.
  • a synthetic enzyme polymerase Quot; refers to a nucleic acid molecule in which a nucleotide is extended and added by a covalent bond.
  • Each nucleotide of the oligonucleotide constituting the primer may be a deoxyribonucleotide or a ribonucleotide, but a deoxyribonucleotide is preferred.
  • the primer according to the present invention comprises a first binding site, a ring forming site and a second binding site (Fig. 1), and the binding specificity of the primer to the binding template is doubly determined by the first binding site and the second binding site do.
  • the second binding site except for the first binding site and the non-complementary site has a sequence complementary to the binding target sequence of the template.
  • the non-complementary sequence may be 1 to 3 bp and 1 or 2 bp at the first binding site and the second binding site, respectively.
  • the second binding site may comprise a nucleotide corresponding to an allele and a non-complementary nucleotide contiguous thereto.
  • the second binding site may comprise a polynucleotide represented by the following formula 2:
  • Z 1 is a hybridization nucleotide sequence of 2 to 5 bp, preferably 2 or 3 bp complementary to the template nucleic acid to be hybridized
  • Z 2 is a non-complementary nucleotide of 1 to 3 bp, preferably 1 bp
  • Z 3 is a nucleotide corresponding to alleles
  • Z 4 is a hybridization nucleotide sequence of 2 to 8 bp, preferably 3 to 5 bp, more preferably 3 bp complementary to the template nucleic acid.
  • nucleotide corresponding to an allele in the present invention is a position at which a single nucleotide polymorphism (SNP) is observed due to a common mutation appearing in one of several DNA bases in a single site of a chromosome.
  • SNP single nucleotide polymorphism
  • A, C, G, and T may be observed, and single nucleotide polymorphisms in the present invention are observed by A and G or T and C. Accordingly, there are AA, AG and GG types or TT, TC and TC types in the observable SNP genotypes.
  • non-complementary nucleotide is a region which is arbitrarily changed by selection among the sequences complementary to the template and is not capable of binding with the nucleotide of the template, and is composed of 1 to 3 bp, preferably 1 bp.
  • the non-complementary nucleotides may be present contiguous to the SNP, and may preferably be contiguous to the 5 'position of the SNP (upstream).
  • the non-complementary nucleotide can be selected from three nucleotides except for one nucleotide complementary to the template. For example, when the base complementary to the template is A, any of G, C, and T except for A may be selected and substituted for the non-complementary nucleotide.
  • the non-complementary nucleotide is selected according to the ranking shown in Table 1 below, the higher the non-complementary nucleotide with the higher ranking, the more the single base polymorphism detection sensitivity .
  • Non-complementary nucleotide Existing sequence 1st place 2nd place 3 ranks A G C T T C G A G A T C C T A G
  • the ring-forming site connects the first binding site and the second binding site, is independent of the type of nucleotide constituting the binding site, and forms a loop without binding to the template.
  • the ring-forming site is 3 to 10 bp, preferably 5 to 7 bp, more preferably 5 bp.
  • the ring-forming moiety is selected from the group consisting of inosine, dioxyinosine, 7-diaza-2-deoxyinosine, 2-aza-2-deoxyinosine, 2-OMe-inosine, 2'- Nitro-beta-D-ribofuranosyl) -3-nitropyrrole, 2'-OMe-3-nitropyrrol, 5-nitroindole, 2'-F-5-nitroindole, dioxy-4-nitrobenzimidazole, 4-nitrobenzimidazole, 4-aminobenzimidazole, 4-aminobenzimidazole, dioxine nebulin, 2'-F nebulolin, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA -Nonboline, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrol, morpholino-5-nitroindole, morpholino-nebularine,
  • the term "template" means a DNA or RNA nucleic acid sequence to be subjected to replication or synthesis, and short-chain DNA, double-stranded DNA, short-chain RNA, and double-stranded RNA can act as templates.
  • the template is a double-stranded DNA or a double-stranded RNA, both strands of the polynucleotide chain can serve as templates.
  • the sequence that can be a template to be cloned or synthesized There is no limitation on the sequence that can be a template to be cloned or synthesized.
  • the present inventors have found that the SNP rs11950646 of the SLC23A1 gene, the SNP rs429358 of the APOE gene and the SNP rs34391490 of the AQP3 gene contain non-complementary nucleotides at the second binding site (See FIGS. 4, 6 and 8), it is possible to obtain accurate results when the primer according to the present invention is used.
  • the present invention provides a composition for distinguishing a single base allele comprising a primer set according to the present invention.
  • the composition for discriminating mononucleotide alleles according to the present invention may contain dNTPs, buffers, magnesium chloride and DNA polymerases in addition to the primer set according to the present invention. Further, in order to improve the reactivity, materials such as betaine and DMSO may be further included, but the present invention is not limited thereto.
  • the present invention provides a method for discriminating mononucleotide alleles using the composition for discriminating mononucleotide alleles according to the present invention.
  • the method of discriminating single alleles according to the present invention can confirm the genotype by cloning a template in a sample using a primer in the composition for discriminating mononucleotide alleles according to the present invention and confirming the base peaks in the alleles, , But is not limited thereto.
  • a primer set was prepared as shown in Table 2 in order to confirm whether the alleles of the SLC23A1 gene could be specifically detected using the locus rs11950646.
  • the nucleotide sequence of the target gene was obtained through the SNP database of NCBI (National Center for Biotechnology Information; www.ncbi.nlm.nih.gov) for the accurate discrimination of single nucleotide polymorphisms at the locus rs11950646 of the SLC23A1 gene, and the detection primer of rs11950646 .
  • inosine was designed to be between the 19th and 24th bases as the ring forming site.
  • the cytosine (C) is designed to be replaced with the thymine (T).
  • a primer set was prepared for detection of alleles A and G.
  • each primer sequence designed according to one embodiment of the invention is as set forth in Table 2 below.
  • each primer sequence was verified using NCBI, Genbank, and Blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi). As a result, there was no matching nucleotide sequence except for the corresponding gene.
  • a primer set was constructed as shown in Table 3 in order to confirm whether the alleles of APOE gene could be specifically detected using the locus rs429358.
  • the nucleotide sequence of the target gene was obtained through the SNP database of NCBI and used for the detection primer of rs429358 for accurate discrimination of single nucleotide polymorphism to the locus rs429358 of the APOE gene.
  • inosine was designed to be between the 18th and 23th bases as the ring-forming site.
  • G guanine
  • T thymine
  • each primer sequence designed according to one embodiment of the invention is as set forth in Table 3 below.
  • each primer sequence was verified using NCBI, GenBank, and Blast. As a result, there was no matching nucleotide sequence except for the corresponding gene.
  • a primer set was prepared as shown in Table 4 in order to confirm whether the alleles of the AQP3 gene could be specifically detected using the locus of rs34391490.
  • the nucleotide sequence of the target gene was obtained through the SNP database of NCBI and used for the detection primer of rs34391490 for accurate discrimination of the single nucleotide polymorphism to the locus of rs34391490 of the AQP3 gene.
  • inosine was designed to be between the 22nd and 28th bases as the ring-forming site.
  • guanine (G) exists in the 5 'direction of the locus of rs34391490 of the AQP3 gene, the adenine (A) is designed instead of this.
  • a primer set was prepared for detection of alleles A and G.
  • each primer sequence designed according to one embodiment of the invention is as set forth in Table 4 below.
  • each primer sequence was verified using NCBI, GenBank, and Blast. As a result, there was no matching nucleotide sequence except for the corresponding gene.
  • Genotyping of the SLC23A1 gene to the locus rs11950646 was carried out by comparing the specificity of the primers according to the examples and the comparative examples in all genotypes (AA / AG / GG) using the genotypic samples.
  • DNA samples of each genotype to the locus of rs11950646 of the SLC23A1 gene were amplified by PCR using the primer set according to Example 1 and Comparative Example 1. Amplification was performed according to the protocol under PCR conditions, starting at 95 ° C for 5 minutes (95 ° C for 30 seconds, 66 ° C for 30 seconds and 72 ° C for 30 seconds) 35 times, and final 72 ° C for 5 minutes.
  • PCR products using the primers of Example 1 and Comparative Example 1 were sequenced bidirectionally and their genotype peaks were analyzed using Lightcycler SW 1.1 (Fig. 4, red: A-peak; blue: G-peak).
  • the temperature of the annealing in PCR using the AA genotype sample and the primer set prepared in Example 1 was changed to 60 ° C, 62 ° C, 64 ° C, 66 ° C and 68 ° C Respectively.
  • accurate results were confirmed at 64 ° C and 66 ° C (FIG. 5).
  • DNA samples of the AA genotype to the locus of rs429358 of the APOE gene were PCR amplified. Amplification was performed according to the protocol, starting at 95 ° C for 5 minutes, followed by 35 cycles of 95 ° C for 30 seconds, 64 ° C for 30 seconds and 72 ° C for 30 seconds, and final treatment at 72 ° C for 5 minutes.
  • FIG. 6 (a) shows the result of genotyping analysis of the PCR amplification product using the primer set of Example 2 and (b) of the primer set of Comparative Example 2.
  • Fig. In the case of Comparative Example 2, the TT genotype was analyzed as TC type by nonspecific binding of the primer, and an incorrect result was obtained. On the other hand, in Example 1, the TT genotype was correctly matched.
  • the temperature of the binding step was tested at 60 ° C., 63 ° C., 66 ° C. and 69 ° C. in PCR using the TT genotype sample and the primer set prepared in Example 2. As a result of the experiment, an accurate result was confirmed at 63 ° C (FIG. 7).
  • a DNA sample of the GG genotype for the locus of rs34391490 of the AQP3 gene was PCR amplified. Amplification was performed according to the protocol, starting at 95 ° C for 5 minutes, followed by 35 cycles of 95 ° C for 30 seconds, 64 ° C for 30 seconds and 72 ° C for 30 seconds, and final treatment at 72 ° C for 5 minutes.
  • PCR products using the primers of Example 3 and Comparative Example 3 were sequenced bidirectionally and their genotype peaks were analyzed using Lightcycler SW 1.1 (Fig. 8, red: A-peak; blue: G-peak).
  • Example 3 nonspecific primer attachment to the A genotype was not observed at all, whereas in Comparative Example 3, A-peak was observed due to primers that were relatively lower than G but non-specifically bound I could.
  • the temperature of the binding step was tested at 55 ° C, 58 ° C, 62 ° C and 64 ° C in the PCR using the GG genotype sample and the primer set prepared in Example 3.
  • the experimental result is 55 °C. 58 ° C and 62 ° C (Fig. 9).

Abstract

The present invention relates to a primer set comprising a primer represented by formula 1 below. [Formula 1] 5'-X-Y-Z-3', In the formula, X is a first binding region comprising a 15 to 25 bp hybridizing nucleotide sequence complementary to a template nucleic acid to be hybridized, Y is a 3 to 10 bp ring forming region, and Z is a second binding region comprising a 5 to 10 bp hybridizing nucleotide sequence complementary to the template nucleic acid, and nucleotides corresponding to an allele and 1 to 3 bp non-complementary nucleotides continuously binding thereto, wherein X, Y and Z are deoxyribonucleotides or ribonucleotides.

Description

핵산의 대립형질 특이적 프라이머 및 이를 이용한 유전형 판별 방법Allele-specific primers of nucleic acid and genotype discrimination method using the same
본 발명은 단일염기 다형성을 갖는 서열에 대한 혼성화 특이성을 증대시킨 프라이머 및 이를 이용한 유전형 판별 방법에 관한 것이다.The present invention relates to a primer that increases the hybridization specificity to a sequence having a single base polymorphism, and a genotyping method using the primer.
염기서열 다형성(Polymorphism)은 1% 초과하는 빈도로 나타나는 염기 서열의 변이를 일컫는 것으로, 이 중 90%는 단일염기 다형성(Single Nucleotide polymorphism, SNP)이다. 인간 유전적 서열은 99.9% 동일하고, SNP는 약 250~1000bp 마다 하나씩 나타나며, 인간 유전체의 경우 약 2백만개의 SNP가 존재하고 이중 유전자에는 약 21,000개가 존재한다. 또한 1% 이하의 빈도로 나타나는 다른 단일염기의 변이는 통상 돌연변이(mutation)로 칭한다.Nucleotide polymorphism refers to a variation in the nucleotide sequence that occurs in excess of 1%, of which 90% is single nucleotide polymorphism (SNP). The human genetic sequence is 99.9% identical, the SNP appears about every 250 to 1000 bp, the human genome has about 2 million SNPs, and the double gene has about 21,000 genes. Mutations of other single bases, which occur at a frequency of 1% or less, are commonly referred to as mutations.
염기서열 돌연변이 분석 또는 SNP는 DNA 서열분석은 분석은 물론, 질환 예를 들면 암, 천식, 당뇨병과 같은 질환을 야기하는 유전자 발굴 또는 특정 질환과의 연관성을 판단할 수 있는 마커로서 중요한 역할을 한다(Ye S1, Dhillon S, Ke X, Collins AR, Day IN. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 2001 Sep 1;29(17):E88-8; ookes AJ. The essence of SNPs. Gene. 1999 Jul 8;234(2):177-86.).Sequence mutation analysis or SNPs play an important role as markers that can be used to determine DNA sequencing as well as to identify genes that cause diseases such as cancer, asthma, diabetes, or certain diseases, as well as to analyze Ye S 1, Dhillon S, Ke X, Collins AR, Day IN. An efficient procedure for genotyping single nucleotide polymorphisms Nucleic Acids Res 2001 Sep 1; 29 (17): E88-8; 1999 Jul 8; 234 (2): 177-86.).
따라서 단일염기서열 변이 또는 SNP를 분석함으로써 사람의 경우 특정 질환에 대한 개인의 감수성을 파악하여 염기서열의 차이로 인해 발생하는 선천성 질병에 대한 예방 또는 발병한 질환의 치료에 도움이 될 수 있다.Therefore, analysis of single nucleotide sequence variation or SNP can be helpful in the prevention of congenital disease caused by differences in nucleotide sequence or in the treatment of diseases caused by human, by grasping individual susceptibility to a specific disease.
단일염기 변이를 분석하는 방법으로는 중합효소 연쇄반응인 PCR을 실시한 후 특이적 제한효소를 사용하여 증폭 산물의 단편 길이 차이로 확인하는 PCR-RFLP(PCR-restriction fragment length polymorphism), 대립형질에 특이적 프라이머를 사용하여 DNA를 증폭한 후 전기영동으로 확인하는 SSP(Sequence-Specific Primed PCR), PCR 증폭 DNA를 형광 물질을 이용하여 실시간으로 측정하는 Real-time PCR, 프라이머 양쪽 말단에 제한효소가 반응할 수 있는 염기서열을 추가적으로 넣어 프라이머의 반응 후 제한효소로 인해 잘려진 프라이머가 다시 증폭반응에 사용되는 SDA(Strand Displacement Amplification) 등의 방법이 알려져 있다.PCR-restriction fragment length polymorphism (PCR-RFLP) was used to identify single nucleotide polymorphisms. PCR-restriction fragment length polymorphism (PCR-RFLP) Sequence-Specific Primed PCR (SSP), which amplifies DNA using a primer and confirms it by electrophoresis. Real-time PCR that measures PCR amplified DNA in real time using a fluorescent substance. Restriction enzyme is reacted at both ends of the primer Strand displacement amplification (SDA) in which a primer which has been additionally inserted into the amplification reaction after the reaction of the primer is used for the amplification reaction is known.
하지만 이들의 방법은 과다한 시간이 소요되고, 비특이적 PCR 산물의 오염 가능성, 고가의 장비 및 시약 등의 단점이 있었다. 또한, 대립형질에 특이적 프라이머를 사용하는 경우에 있어, 프라이머의 주형에 대한 특이성을 향상시키기 위한 시도들이 있어 왔으나, 여전히 유전형 판별에 정확한 결과를 얻지 못하는 경우가 있었다. 이에, 단일염기 다형성에 대하여 보다 신속하고 정확한 판별 결과를 얻을 수 있는 방법에 대한 요구가 계속되어 왔다.However, these methods are time-consuming, have the disadvantage of contamination of nonspecific PCR products, expensive equipment and reagents. Further, in the case of using an allele specific primer, attempts have been made to improve the specificity of the primer to the template, but there are cases in which accurate discrimination can not be obtained in genotype discrimination. Thus, there is a continuing need for a method for obtaining faster and more accurate discrimination results for single nucleotide polymorphisms.
본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허 문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.
본 발명은 단일염기 다형성(SNP)을 갖는 서열에 대한 혼성화 특이성을 증대시킨 프라이머 및 이를 이용한 유전형 판별 방법을 제공함으로써, 단일염기 다형성 검출 감도를 증대시키는 것을 목적으로 한다.The present invention aims to increase the detection sensitivity of a single nucleotide polymorphism by providing a primer that increases the hybridization specificity to a sequence having a single nucleotide polymorphism (SNP) and a genotyping method using the primer.
본 발명의 기술적 과제들은 이상에서 언급한 기술적 과제들로 제한되지 않으며, 언급되지 않은 또 다른 기술적 과제들은 아래의 기재들로부터 당업자에게 명확하게 이해될 수 있을 것이다.The technical problems of the present invention are not limited to the above-mentioned technical problems, and other technical problems which are not mentioned can be understood by those skilled in the art from the following description.
상기 문제점을 해결하기 위하여, 본 발명자들은 기존의 DPO(Dual Priming Oligonucleotide) 방식의 프라이머 내 SNP의 바로 앞에 비상보적 뉴클레오티드를 삽입하므로써 SNP를 포함하는 주형에의 특이성이 향상되는 것을 발견하고, 본 발명을 완성하였다.DISCLOSURE OF THE INVENTION In order to solve the above problems, the present inventors have found that the specificity to the template including the SNP is improved by inserting the non-complementary nucleotide immediately before the SNP in the primer of the existing DPO (Dual Priming Oligonucleotide) system, Completed.
본 발명의 일 양태는 하기 식 1로 나타나는 프라이머를 포함하는 프라이머 세트를 제공한다:An aspect of the present invention provides a primer set comprising a primer represented by the following formula 1:
[식 1][Formula 1]
5'-X-Y-Z-3'5'-X-Y-Z-3 '
상기 식에서, X는 혼성화 되는 주형 핵산에 상보적인 15 내지 25bp의 혼성화 뉴클레오티드 서열을 포함하는 제1 결합 부위이고, Y는 3 내지 10bp의 고리 형성 부위이고, Z는 상기 주형 핵산에 대하여 상보적인 5 내지 10bp의 혼성화 뉴클레오티드 서열, 및 대립형질에 상응하는 뉴클레오티드와 이에 연속된 1 내지 3bp의 비상보적 뉴클레오티드를 포함하는 제2 결합 부위이고, 상기 X, Y 및 Z는 디옥시리보뉴클레오티드 또는 리보뉴클레오티드이다.Wherein X is a first binding site comprising a hybridization nucleotide sequence of 15 to 25 bp complementary to a template nucleic acid to be hybridized, Y is a ring forming site of 3 to 10 bp, and Z is a nucleotide sequence complementary to the template nucleic acid, 10 bp, and a second binding site comprising a nucleotide corresponding to an allele and a non-complementary nucleotide of 1 to 3 bp consecutive thereto, wherein X, Y and Z are deoxyribonucleotides or ribonucleotides.
본 발명의 일 실시예에 따르면, 상기 제2 결합 부위에서 비상보적 뉴클레오티드는 상기 대립형질에 상응하는 뉴클레오티드의 5' 위치에 연속될 수 있다.According to one embodiment of the present invention, the non-complementary nucleotide at the second binding site may be contiguous to the 5 ' position of the nucleotide corresponding to the allelic trait.
본 발명의 일 실시예에 따르면, 상기 비상보적 뉴클레오티드는 1bp일 수 있다.According to one embodiment of the present invention, the non-complementary nucleotide may be 1 bp.
본 발명의 일 실시예에 따르면, 상기 고리 형성 부위는 이노신, 디옥시이노신, 7-디아자-2-디옥시이노신, 2-아자-2-디옥시이노신, 2-OMe-이노신, 2'-F-이노신, 디옥시 3-니트로피롤, 3-니트로피롤, 2'-OMe-3-니트로피롤, 2'-F 3-니트로피롤, 1-(2-디옥시-베타-D-리보푸라노실)-3-니트로피롤, 디옥시 5-니트로피롤, 5-니트로인돌, 2'-OMe-5-니트로인돌, 2'-F-5-니트로인돌, 디옥시 4-니트로벤즈이미다졸, 4-니트로벤즈이미다졸, 디옥시 4-아미노벤즈이미다졸, 4-아미노벤즈이미다졸, 디옥시 네불라린, 2'-F 네불라린, 2'-F 4-니트로벤즈이미다졸, PNA-5-인트로인돌, PNA-네불라린, PNA-이노신, PNA-4-니트로벤즈이미다졸, PNA-3-니트로피롤, 모르포리노-5-니트로인돌, 모르포리노-네불라린, 모르포리노-이노신, 모르포리노-4-니트로벤즈이미다졸, 모르포리노-3-니트로피롤, 포스포라미데이트-5-니트로인돌, 포스포라미데이트-네불라린, 포스포라미데이트-이노신, 포스포라미데이트-4-니트로벤즈이미다졸, 포스포라미데이트-3-니트로피롤, 2'-0-메톡시에틸이노신, 2'-0-메톡시에틸 네불라린, 2'-0-메톡시에틸 5-니트로인돌, 2'-0-메톡시에틸 4-니트로-벤즈이미다졸, 2'-0-메톡시에틸 3-니트로피롤 및 상기 염기의 조합으로 구성된 군으로부터 선택될 수 있다.According to one embodiment of the present invention, the ring-forming moiety is selected from the group consisting of inosine, dioxyinosine, 7-diaza-2-deoxyinosine, 2-aza-2-deoxyinosine, 2-OMe- 3-nitropyrrol, 2'-OMe-3-nitropyrrol, 2'-F 3-nitropyrrol, 1- (2-deoxy-beta-D 5-nitroindole, 2'-OMe-5-nitroindole, 2'-F-5-nitroindole, dioxy-4-nitro Benzimidazole, 4-nitrobenzimidazole, dioxy 4-aminobenzimidazole, 4-aminobenzimidazole, dioxine nebulin, 2'-F nebulin, 2'-F 4-nitrobenzimide PNA-4-nitrobenzimidazole, PNA-3-nitropyrrol, morpholino-5-nitroindole, morpholino-ne Morpholino-3-nitropropyl, morpholino-3-nitrophenol, morpholino-3- 4-nitrobenzimidazole, phosphoramidate-3-nitropyrrol, 2'-O-methoxyethyl-phospholamidate-norbornane, phosphoramidate- Methoxyethyl norbornane, 2'-O-methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitro-benzimidazole, 2'-O-methoxy Ethyl 3-nitropyrrol, and combinations of the above bases.
본 발명의 일 실시예에 따르면, 상기 혼성화 되는 주형 핵산은 SLC23A1 유전자, APOE 유전자, AQP3 유전자 및 상기 유전자의 조합으로 구성된 군으로부터 선택될 수 있다.According to an embodiment of the present invention, the hybridizing template nucleic acid may be selected from the group consisting of the SLC23A1 gene, the APOE gene, the AQP3 gene, and a combination of the genes.
본 발명의 일 실시예에 따르면, 상기 프라이머 세트는 서열번호 1 내지 서열번호 3의 염기서열, 서열번호 4 내지 서열번호 6의 염기서열 및 서열번호 7 내지 서열번호 9의 염기서열로 구성된 군으로부터 선택되는 염기서열을 갖는 올리고뉴클레오티드로 구성되는 프라이머를 포함할 수 있다.According to an embodiment of the present invention, the primer set is selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3, the nucleotide sequences of SEQ ID NOS: 4 to 6, and the nucleotide sequences of SEQ ID NOS: 7 to 9 Lt; RTI ID = 0.0 > oligonucleotides. ≪ / RTI >
본 발명의 일 양태는 상기 프라이머 세트를 포함하는 단일염기 대립형질 판별용 조성물을 제공한다.One aspect of the present invention provides a composition for discriminating mononucleotide alleles comprising the above primer set.
본 발명의 또다른 일 양태는 상기 단일염기 대립형질 판별용 조성물을 이용하는 단일염기 대립형질 판별 방법을 제공한다.Another aspect of the present invention provides a method for discriminating mononucleotide alleles using the composition for discriminating mononucleotide alleles.
본 발명에 프라이머 세트는 단일염기 다형성(SNP)을 갖는 핵산 주형에 대한 혼성화 특이성을 증대시킴으로써 단일염기 다형성 검출 감도를 증대시켜, 대상 주형의 유전형 판별에 있어 보다 정확한 결과를 제공할 수 있다.The primer set of the present invention can increase single nucleotide polymorphism detection sensitivity by increasing the hybridization specificity for a nucleic acid template having a single nucleotide polymorphism (SNP), and can provide more accurate results in genotype discrimination of a target template.
본 발명의 상세한 설명에서 인용되는 도면을 보다 충분히 이해하기 위하여 각 도면의 간단한 설명이 제공된다.BRIEF DESCRIPTION OF THE DRAWINGS A brief description of each drawing is provided to more fully understand the drawings recited in the description of the invention.
도 1은 본 발명에 따른 프라이머를 나타낸다.Figure 1 shows a primer according to the invention.
도 2는 본 발명에 따른 프라이머의 주형 특이적 결합 및 그에 의한 복제 여부를 나타낸다.Fig. 2 shows the template-specific binding of the primer according to the present invention and whether or not it is cloned.
도 3은 본 발명에 따른 프라이머 세트를 이용하여 유전형을 판별하는 방법의 개념을 나타낸다.Fig. 3 shows the concept of a method for discriminating a genotype using a primer set according to the present invention.
도 4는 본 발명에 따른 프라이머와 비교예에 따른 프라이머에 따른 SLC23A1 유전자의 SNP rs11950646의 유전자형 판별 결과를 나타낸다.4 shows the genotyping results of the SNP rs11950646 of the SLC23A1 gene according to the primer according to the present invention and the primer according to the comparative example.
도 5는 온도에 따른 본 발명에 따른 프라이머를 이용한 SLC23A1 유전자의 SNP rs11950646의 유전자형의 판별 결과를 나타낸다.FIG. 5 shows the result of discrimination of the genotype of the SNP rs11950646 of the SLC23A1 gene using the primer according to the present invention according to the temperature.
도 6은 본 발명에 따른 프라이머와 비교예에 따른 프라이머에 따른 APOE 유전자의 SNP rs429358의 유전자형 판별 결과를 나타낸다.6 shows the genotyping results of the SNP rs429358 of the APOE gene according to the primer according to the present invention and the primer according to the comparative example.
도 7는 온도에 따른 본 발명에 따른 프라이머를 이용한 APOE 유전자의 SNP rs429358의 유전자형의 판별 결과를 나타낸다.Fig. 7 shows the result of discrimination of the genotype of SNP rs429358 of the APOE gene using the primer according to the present invention according to the temperature.
도 8는 본 발명에 따른 프라이머와 비교예에 따른 프라이머에 따른 AQP3 유전자의 SNP rs34391490의 유전자형 판별 결과를 나타낸다.8 shows the genotyping results of the SNP rs34391490 of the AQP3 gene according to the primer according to the present invention and the primer according to the comparative example.
도 9는 온도에 따른 본 발명에 따른 프라이머를 이용한 AQP3 유전자의 SNP rs34391490의 유전자형의 판별 결과를 나타낸다.FIG. 9 shows the result of discrimination of genotype of SNP rs34391490 of AQP3 gene using primers according to the present invention at different temperatures.
이하, 첨부 도면을 참조하여 본 발명에 따른 실시 양태에 대하여 상세하게 설명한다. 이하 설명은 본 발명에 실시 양태들을 용이하게 이해하기 위한 것일 뿐이며, 보호범위를 제한하기 위한 것은 아니다.Hereinafter, embodiments according to the present invention will be described in detail with reference to the accompanying drawings. The following description is merely for a better understanding of the embodiments of the present invention, and is not intended to limit the scope of protection.
본 발명은 제1 결합 부위, 고리 형성 부위 및 제2 결합 부위를 가지는 올리고뉴클레오티드 프라이머로서, 제2 결합 부위에 대립형질에 상응하는 뉴클레오티드와 이에 연속된 비상보적 뉴클레오티드를 포함하는 것을 특징으로 한다.The invention is an oligonucleotide primer having a first binding site, a ring forming site and a second binding site, wherein the oligonucleotide primer comprises a nucleotide corresponding to an allele at the second binding site and a non-complementary nucleotide contiguous thereto.
이하 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.
본 발명은 하기 식 1로 나타나는 프라이머를 포함하는 프라이머 세트를 제공한다:The present invention provides a primer set comprising a primer represented by the following formula 1:
[식 1][Formula 1]
5'-X-Y-Z-3'5'-X-Y-Z-3 '
상기 식에서,In this formula,
X는 혼성화 되는 주형 핵산에 상보적인 15 내지 25bp, 바람직하게는 21 내지 23bp의 혼성화 뉴클레오티드 서열을 포함하는 제1 결합 부위이고, Y는 3 내지 10bp, 바람직하게는 5 내지 7bp의 고리 형성 부위이고, Z는 상기 주형 핵산에 대하여 상보적인 5 내지 10bp, 바람직하게는 6 또는 7bp의 혼성화 뉴클레오티드 서열, 및 대립형질에 상응하는 뉴클레오티드와 이에 연속된 1 내지 3bp의 비상보적 뉴클레오티드를 포함하는 제2 결합 부위이고, 상기 X, Y 및 Z는 디옥시리보뉴클레오티드 또는 리보뉴클레오티드이다.X is a first binding site comprising a hybridization nucleotide sequence of 15 to 25 bp, preferably 21 to 23 bp complementary to the template nucleic acid to be hybridized, Y is a ring-forming site of 3 to 10 bp, preferably 5 to 7 bp, Z is a second binding site comprising a hybridization nucleotide sequence of 5 to 10 bp, preferably 6 or 7 bp, complementary to the template nucleic acid, and a nucleotide corresponding to the allele and a 1 to 3 bp non-complementary nucleotide contiguous thereto , X, Y and Z are deoxyribonucleotides or ribonucleotides.
본 발명에서 "프라이머"는 복제 대상인 주형(핵산)에 상보적으로 결합하여 복제 합성의 개시점으로 작용하는 단일 가닥의 올리고뉴클레오티드로서, 합성효소(폴리머라제)를 이용한 핵산 증폭 또는 합성 반응에서 그 3' 말단에 뉴클레오티드가 공유 결합에 의해 추가되어 연장되는 핵산 분자를 지칭한다. 프라이머를 구성하는 올리고뉴클레오티드의 각 뉴클레오티드는 디옥시리보뉴클레오티드 또는 리보뉴클레오티드일 수 있으나, 디옥시리보뉴클레오티드가 바람직하다.In the present invention, the term " primer " is a single strand oligonucleotide complementary to a template (nucleic acid) to be cloned and acting as a starting point of the cloning synthesis. In the nucleic acid amplification or synthesis reaction using a synthetic enzyme (polymerase) Quot; refers to a nucleic acid molecule in which a nucleotide is extended and added by a covalent bond. Each nucleotide of the oligonucleotide constituting the primer may be a deoxyribonucleotide or a ribonucleotide, but a deoxyribonucleotide is preferred.
본 발명에 따른 프라이머는 제1 결합 부위, 고리 형성 부위 및 제2 결합 부위를 포함하며(도 1), 결합 주형에 대한 프라이머의 결합 특이성은 제1 결합 부위 및 제2 결합 부위에 의해 이중으로 결정된다.The primer according to the present invention comprises a first binding site, a ring forming site and a second binding site (Fig. 1), and the binding specificity of the primer to the binding template is doubly determined by the first binding site and the second binding site do.
주형의 복제 등에 있어, 고리 형성 부위에 의해 연결된 제1 결합 부위와 제2 결합 부위가 모두 주형에 결합된 경우에는 당해 프라이머로부터 시작되는 주형 복제가 시작되나, 제1 결합 부위와 제2 결합 부위 중 어느 한 결합 부위만이 결합된 경우 또는 두 결합 부위가 모두 결합되지 않은 경우에는 주형의 복제가 일어나지 않는다(도 2).When the first binding site and the second binding site linked by the ring forming site are both bound to the template in replication of the template and the like, replication of the template starting from the primer starts, but the replication of the first binding site and the second binding site When only one binding site is bound, or when both binding sites are not bound, replication of the template does not occur (FIG. 2).
본 발명에서, 제1 결합 부위와 비상보적 부위를 제외한 제2 결합 부위는 주형의 결합 대상 서열과 상보적인 서열을 갖는 것이 바람직하나, 비상보적 서열을 포함하는 경우라도, 프라이머와 주형의 결합이 가능한 경우라면 비상보적 서열을 포함할 수 있다. 이때, 비상보적 서열은 제1 결합 부위와 제2 결합 부위에서 각각 1 내지 3bp, 및 1 또는 2bp일 수 있다.In the present invention, it is preferable that the second binding site except for the first binding site and the non-complementary site has a sequence complementary to the binding target sequence of the template. However, even when the non-complementary sequence is included, In some cases, it may contain non-consensus sequences. At this time, the non-complementary sequence may be 1 to 3 bp and 1 or 2 bp at the first binding site and the second binding site, respectively.
본 발명에서, 제2 결합 부위는 대립형질에 상응하는 뉴클레오티드와 이에 연속된 비상보적 뉴클레오티드를 포함할 수 있다. In the present invention, the second binding site may comprise a nucleotide corresponding to an allele and a non-complementary nucleotide contiguous thereto.
본 발명에서, 제2 결합 부위는 하기 식 2로 나타나는 폴리뉴클레오티드를 포함할 수 있다:In the present invention, the second binding site may comprise a polynucleotide represented by the following formula 2:
[식 2][Formula 2]
5'-Z1-Z2-Z3-Z4-3'5'-Z 1 -Z 2 -Z 3 -Z 4 -3 '
상기 식에서,In this formula,
Z1은 혼성화 되는 주형 핵산에 상보적인 2 내지 5bp, 바람직하게는 2 또는 3bp의 혼성화 뉴클레오티드 서열, Z2는 1 내지 3bp, 바람직하게는 1bp의 비상보적 뉴클레오티드, Z3은 대립형질에 상응하는 뉴클레오티드, 및 Z4는 상기 주형 핵산에 대하여 상보적인 2 내지 8bp, 바람직하게는 3 내지 5bp, 보다 바람직하게는 3bp의 혼성화 뉴클레오티드 서열이다.Z 1 is a hybridization nucleotide sequence of 2 to 5 bp, preferably 2 or 3 bp complementary to the template nucleic acid to be hybridized, Z 2 is a non-complementary nucleotide of 1 to 3 bp, preferably 1 bp, and Z 3 is a nucleotide corresponding to alleles , And Z 4 is a hybridization nucleotide sequence of 2 to 8 bp, preferably 3 to 5 bp, more preferably 3 bp complementary to the template nucleic acid.
본 발명에서 "대립형질에 상응하는 뉴클레오티드"는 염색체의 단일부위에서 여러 DNA 염기들 중 하나에 나타나는 일반적인 돌연변이로 단일염기 다형성(SNP)이 관찰되는 위치이다. 일반적으로는 A, C, G 및 T에 의한 단일염기 다형성이 관찰될 수도 있고, 본 발명에서의 단일염기 다형성은 A와 G 또는 T와 C에 의한 것이 관찰된다. 이에 따라, 관찰가능한 SNP 유전형에는 AA형, AG형 및 GG형, 또는 TT, TC 및 TC형이 존재한다.The term " nucleotide corresponding to an allele in the present invention " is a position at which a single nucleotide polymorphism (SNP) is observed due to a common mutation appearing in one of several DNA bases in a single site of a chromosome. In general, single nucleotide polymorphisms by A, C, G, and T may be observed, and single nucleotide polymorphisms in the present invention are observed by A and G or T and C. Accordingly, there are AA, AG and GG types or TT, TC and TC types in the observable SNP genotypes.
본 발명에서 "비상보적 뉴클레오티드"는 주형에 상보적인 서열 중 선택에 의해 임의적으로 변경되어 주형의 뉴클레오티드와 결합을 이루지 못하는 부위로서, 1 내지 3bp, 바람직하게는 1bp로 이루어져 있다. 비상보적 뉴클레오티드는 SNP에 연속되어 존재할 수 있으며, 바람직하게는 SNP의 5' 위치에 연속될 수 있다(업스트림).In the present invention, " non-complementary nucleotide " is a region which is arbitrarily changed by selection among the sequences complementary to the template and is not capable of binding with the nucleotide of the template, and is composed of 1 to 3 bp, preferably 1 bp. The non-complementary nucleotides may be present contiguous to the SNP, and may preferably be contiguous to the 5 'position of the SNP (upstream).
비상보적 뉴클레오티드는 주형에 상보적인 뉴클레오티드 1종을 제외한 3종의 뉴클레오티드 중에서 선택될 수 있다. 예를 들어, 주형에 상보적인 염기가 A인 경우, 비상보적 뉴클레오티드로서는 A를 제외한 G, C 및 T 중 어느 하나가 선택되어 대체될 수 있다. 상기 3종의 뉴클레오티드 중 어느 것이 선택되어도 본 발명에 따른 프라이머를 제작할 수 있으나, 하기 표 1에 기재된 순위에 따라 비상보적 뉴클레오티드가 선택되는 경우, 순위가 높은 비상보적 뉴클레오티드를 선택할수록 단일염기 다형성 검출 감도가 보다 향상된다.The non-complementary nucleotide can be selected from three nucleotides except for one nucleotide complementary to the template. For example, when the base complementary to the template is A, any of G, C, and T except for A may be selected and substituted for the non-complementary nucleotide. When the non-complementary nucleotide is selected according to the ranking shown in Table 1 below, the higher the non-complementary nucleotide with the higher ranking, the more the single base polymorphism detection sensitivity .
비상보적 뉴클레오티드Non-complementary nucleotide
기존 서열Existing sequence 1순위1st place 2순위 2nd place 3순위3 ranks
AA GG CC TT
TT CC GG AA
GG AA TT CC
CC TT AA GG
본 발명에서 고리 형성 부위는 제1 결합 부위와 제2 결합 부위를 연결하며, 결합 부위를 구성하는 뉴클레오티드의 종류에 무관하고, 주형에 결합됨이 없이 고리(loop)을 형성한다. 고리 형성 부위는 3 내지 10bp, 바람직하게는 5 내지 7bp, 보다 바람직하게는 5bp이다. 고리형성 부위는 이노신, 디옥시이노신, 7-디아자-2-디옥시이노신, 2-아자-2-디옥시이노신, 2-OMe-이노신, 2'-F-이노신, 디옥시 3-니트로피롤, 3-니트로피롤, 2'-OMe-3-니트로피롤, 2'-F 3-니트로피롤, 1-(2-디옥시-베타-D-리보푸라노실)-3-니트로피롤, 디옥시 5-니트로피롤, 5-니트로인돌, 2'-OMe-5-니트로인돌, 2'-F-5-니트로인돌, 디옥시 4-니트로벤즈이미다졸, 4-니트로벤즈이미다졸, 디옥시 4-아미노벤즈이미다졸, 4-아미노벤즈이미다졸, 디옥시 네불라린, 2'-F 네불라린, 2'-F 4-니트로벤즈이미다졸, PNA-5-인트로인돌, PNA-네불라린, PNA-이노신, PNA-4-니트로벤즈이미다졸, PNA-3-니트로피롤, 모르포리노-5-니트로인돌, 모르포리노-네불라린, 모르포리노-이노신, 모르포리노-4-니트로벤즈이미다졸, 모르포리노-3-니트로피롤, 포스포라미데이트-5-니트로인돌, 포스포라미데이트-네불라린, 포스포라미데이트-이노신, 포스포라미데이트-4-니트로벤즈이미다졸, 포스포라미데이트-3-니트로피롤, 2'-0-메톡시에틸이노신, 2'-0-메톡시에틸 네불라린, 2'-0-메톡시에틸 5-니트로인돌, 2'-0-메톡시에틸 4-니트로-벤즈이미다졸, 2'-0-메톡시에틸 3-니트로피롤 및 상기 염기의 조합으로 구성된 군으로부터 선택될 수 있으나, 이에 한정되는 것은 아니며, 바람직하게는 이노신이다.In the present invention, the ring-forming site connects the first binding site and the second binding site, is independent of the type of nucleotide constituting the binding site, and forms a loop without binding to the template. The ring-forming site is 3 to 10 bp, preferably 5 to 7 bp, more preferably 5 bp. The ring-forming moiety is selected from the group consisting of inosine, dioxyinosine, 7-diaza-2-deoxyinosine, 2-aza-2-deoxyinosine, 2-OMe-inosine, 2'- Nitro-beta-D-ribofuranosyl) -3-nitropyrrole, 2'-OMe-3-nitropyrrol, 5-nitroindole, 2'-F-5-nitroindole, dioxy-4-nitrobenzimidazole, 4-nitrobenzimidazole, 4-aminobenzimidazole, 4-aminobenzimidazole, dioxine nebulin, 2'-F nebulolin, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA -Nonboline, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrol, morpholino-5-nitroindole, morpholino-nebularine, morpholino-inosine, Mo 4-nitrobenzimidazole, mofolino-3-nitropropol, phosphoramidate-5-nitroindole, phosphoramidate- Phosphoramidate-3-nitropyrrol, 2'-O-methoxyethylinosine, 2'-O-methoxyethyl Methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitro-benzimidazole, 2'-O-methoxyethyl 3-nitropyrrol and the base , But is not limited thereto, and is preferably inosine.
본 발명에서 "주형"은 복제 또는 합성의 대상이 되는 DNA 또는 RNA 핵산 서열을 의미하며, 단쇄 DNA, 복쇄 DNA, 단쇄 RNA, 복쇄 RNA 등이 주형으로서 작용할 수 있다. 주형이 복쇄 DNA 또는 복쇄 RNA인 경우, 두 가닥의 폴리뉴클레오티드 사슬 양 방이 주형으로 작용할 수 있다. In the present invention, the term " template " means a DNA or RNA nucleic acid sequence to be subjected to replication or synthesis, and short-chain DNA, double-stranded DNA, short-chain RNA, and double-stranded RNA can act as templates. When the template is a double-stranded DNA or a double-stranded RNA, both strands of the polynucleotide chain can serve as templates.
복제 또는 합성의 대상이 되는 주형이 될 수 있는 서열에는 한정이 없으나, 본 발명자들은 SLC23A1 유전자의 SNP rs11950646, APOE 유전자의 SNP rs429358 및 AQP3 유전자의 SNP rs34391490에서, 제2 결합 부위에 비상보적 뉴클레오티드를 포함하지 않는 프라이머를 사용하는 경우 부정확하게 분석되는 것과 달리, 본 발명에 따른 프라이머를 사용하는 경우 정확한 결과를 얻을 수 있음을 확인하였다(도 4, 6 및 8 참조).There is no limitation on the sequence that can be a template to be cloned or synthesized. However, the present inventors have found that the SNP rs11950646 of the SLC23A1 gene, the SNP rs429358 of the APOE gene and the SNP rs34391490 of the AQP3 gene contain non-complementary nucleotides at the second binding site (See FIGS. 4, 6 and 8), it is possible to obtain accurate results when the primer according to the present invention is used.
본 발명은 본 발명에 따른 프라이머 세트를 포함하는 단일염기 대립형질 판별용 조성물을 제공한다. 본 발명에 따른 단일염기 대립형질 판별용 조성물은 본 발명에 따른 프라이머 세트 이외에 dNTP, 완충액, 염화마그네슘 및 DNA 폴리머라제를 포함할 수 있다. 또한, 반응성 향상을 위하여, 베타인, DMSO 등의 물질을 추가로 포함할 수 있으나, 이에 한정되는 것은 아니다.The present invention provides a composition for distinguishing a single base allele comprising a primer set according to the present invention. The composition for discriminating mononucleotide alleles according to the present invention may contain dNTPs, buffers, magnesium chloride and DNA polymerases in addition to the primer set according to the present invention. Further, in order to improve the reactivity, materials such as betaine and DMSO may be further included, but the present invention is not limited thereto.
본 발명은 본 발명에 따른 단일염기 대립형질 판별용 조성물을 이용하는 단일염기 대립형질 판별 방법을 제공한다. 본 발명에 따른 단일염기 대립형질 판별 방법은 본 발명에 따른 단일염기 대립형질 판별용 조성물 중의 프라이머를 이용하여 시료 중의 주형을 복제 합성하고, 해당 대립형질에서의 염기 피크를 확인함으로써 유전자형을 확인할 수 있으나, 이에 한정되는 것은 아니다.The present invention provides a method for discriminating mononucleotide alleles using the composition for discriminating mononucleotide alleles according to the present invention. The method of discriminating single alleles according to the present invention can confirm the genotype by cloning a template in a sample using a primer in the composition for discriminating mononucleotide alleles according to the present invention and confirming the base peaks in the alleles, , But is not limited thereto.
이하 하나 이상의 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to one or more embodiments. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.
실시예Example
실시예 1. 프라이머 세트의 디자인 및 제조(SLC23A1)Example 1. Design and preparation of primer sets (SLC23A1)
SLC23A1 유전자의 rs11950646 좌위를 사용하여 이의 대립형질을 특이적으로 검출할 수 있는지를 확인하고자, 표 2와 같이 프라이머 세트를 제작하였다.A primer set was prepared as shown in Table 2 in order to confirm whether the alleles of the SLC23A1 gene could be specifically detected using the locus rs11950646.
SLC23A1 유전자의 rs11950646 좌위에 대한 단일염기 다형성의 정확한 판별을 위해 표적 유전자의 염기서열을 NCBI(National Center for Biotechnology Information; www.ncbi.nlm.nih.gov)의 SNP 데이터베이스를 통해 수득하여 rs11950646의 검출 프라이머 제작에 사용하였다.The nucleotide sequence of the target gene was obtained through the SNP database of NCBI (National Center for Biotechnology Information; www.ncbi.nlm.nih.gov) for the accurate discrimination of single nucleotide polymorphisms at the locus rs11950646 of the SLC23A1 gene, and the detection primer of rs11950646 .
SLC23A1 유전자의 rs11950646 좌위의 서열을 기본으로 하되, 고리 형성 부위로서 19번 및 24번 염기 사이에 이노신이 오도록 디자인하였다. 또한, SLC23A1 유전자의 rs11950646 좌위의 5' 방향에는 티민(T)이 존재하므로, 이 대신 시토신(C)이 오도록 디자인 하였다. 상기 서열을 표적 핵산으로 하여 대립형질 A와 G의 검출용으로 프라이머 세트를 완성하였다.Based on the sequence of the locus rs11950646 of the SLC23A1 gene, inosine was designed to be between the 19th and 24th bases as the ring forming site. In addition, since the thymine (T) exists in the 5 'direction of the locus of rs11950646 of the SLC23A1 gene, the cytosine (C) is designed to be replaced with the thymine (T). Using this sequence as a target nucleic acid, a primer set was prepared for detection of alleles A and G.
프라이머 명칭Name of the primer 서열 (5'→3')The sequence (5 '- > 3') 서열번호SEQ ID NO:
주 대립유전자 정방향 프라이머Primary allele forward primer GCTGCCGTCCTCTGGGGCTIIIIIGGCC GCAGGCTGCCGTCCTCTGGGGCTIIIIIGGC C G CAG 1One
부 대립유전자정방향 프라이머Negative allele forward primer GCTGCCGTCCTCTGGGGCTIIIIIGGCC ACAGGCTGCCGTCCTCTGGGGCTIIIIIGGC C A CAG 22
역방향 프라이머 Reverse primer GCCAGGGCACTAGGACTAGCTCTGGCCAGGGCACTAGGACTAGCTCTG 33
**밑줄: 비상보적 부위; 볼드체: SNP** Underline: Emergency area; Bold: SNP
본원의 일 구현예에 따라 디자인된 각 프라이머 서열을 하기 표 2에 기재된 바와 같다. 또한 각 프라이머 염기서열은 NCBI, Genbank 및 Blast(http://blast.ncbi.nlm.nih.gov/Blast.cgi)를 이용하여 검증한 결과 해당 유전자 외에 일치하는 염기서열이 존재하지 않았다.Each primer sequence designed according to one embodiment of the invention is as set forth in Table 2 below. In addition, each primer sequence was verified using NCBI, Genbank, and Blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi). As a result, there was no matching nucleotide sequence except for the corresponding gene.
실시예 2. 프라이머 세트의 디자인 및 제조(APOE)Example 2. Design and manufacture of primer sets (APOE)
APOE 유전자의 rs429358 좌위를 사용하여 이의 대립형질을 특이적으로 검출할 수 있는지를 확인하고자, 표 3과 같이 프라이머 세트를 제작하였다.A primer set was constructed as shown in Table 3 in order to confirm whether the alleles of APOE gene could be specifically detected using the locus rs429358.
APOE 유전자의 rs429358 좌위에 대한 단일염기 다형성의 정확한 판별을 위해 표적 유전자의 염기서열을 NCBI의 SNP 데이터베이스를 통해 수득하여 rs429358의 검출 프라이머 제작에 사용하였다.The nucleotide sequence of the target gene was obtained through the SNP database of NCBI and used for the detection primer of rs429358 for accurate discrimination of single nucleotide polymorphism to the locus rs429358 of the APOE gene.
APOE 유전자의 rs429358 좌위의 서열을 기본으로 하되, 고리 형성 부위로서 18번 및 23번 염기 사이에 이노신이 오도록 디자인하였다. 또한, APOE 유전자의 rs429358 좌위의 5' 방향에는 구아닌(G)이 존재하므로, 이 대신 티민(T)이 오도록 디자인 하였다. 상기 서열을 표적 핵산으로 하여 대립형질 C와 T의 검출용으로 프라이머 세트를 완성하였다.Based on the sequence of the locus of rs429358 of the APOE gene, inosine was designed to be between the 18th and 23th bases as the ring-forming site. In addition, since guanine (G) exists in the 5 'direction of the locus of rs429358 of the APOE gene, it is designed so that the thymine (T) comes instead. A primer set was prepared for the detection of alleles C and T using the above sequence as a target nucleic acid.
프라이머 명칭Name of the primer 서열 (5'→3')The sequence (5 '- > 3') 서열번호SEQ ID NO:
주 대립유전자정방향 프라이머Primary allele forward primer CGGCTGGGCGCGGACATGIIIIICGTT TGCGCGGCTGGGCGCGGACATGIIIIICGT T T GCG 44
부 대립유전자 정방향 프라이머Negative allele forward primer CGGCTGGGCGCGGACATGIIIIICGTT CGCGCGGCTGGGCGCGGACATGIIIIICGT T C GCG 55
역방향 프라이머Reverse primer AGGTGGGAGGCGAGGCGCACAGGTGGGAGGCGAGGCGCAC 66
**밑줄: 비상보적 부위; 볼드체: SNP** Underline: Emergency area; Bold: SNP
본원의 일 구현예에 따라 디자인된 각 프라이머 서열을 하기 표 3에 기재된 바와 같다. 또한 각 프라이머 염기서열은 NCBI, Genbank 및 Blast를 이용하여 검증한 결과 해당 유전자 외에 일치하는 염기서열이 존재하지 않았다.Each primer sequence designed according to one embodiment of the invention is as set forth in Table 3 below. In addition, each primer sequence was verified using NCBI, GenBank, and Blast. As a result, there was no matching nucleotide sequence except for the corresponding gene.
실시예 3. 프라이머 세트의 디자인 및 제조(AQP3)Example 3. Design and preparation of primer set (AQP3)
AQP3 유전자의 rs34391490 좌위를 사용하여 이의 대립형질을 특이적으로 검출할 수 있는지를 확인하고자, 표 4와 같이 프라이머 세트를 제작하였다.A primer set was prepared as shown in Table 4 in order to confirm whether the alleles of the AQP3 gene could be specifically detected using the locus of rs34391490.
AQP3 유전자의 rs34391490 좌위에 대한 단일염기 다형성의 정확한 판별을 위해 표적 유전자의 염기서열을 NCBI의 SNP 데이터베이스를 통해 수득하여 rs34391490의 검출 프라이머 제작에 사용하였다.The nucleotide sequence of the target gene was obtained through the SNP database of NCBI and used for the detection primer of rs34391490 for accurate discrimination of the single nucleotide polymorphism to the locus of rs34391490 of the AQP3 gene.
AQP3 유전자의 rs34391490 좌위의 서열을 기본으로 하되, 고리 형성 부위로서 22번 및 28번 염기 사이에 이노신이 오도록 디자인하였다. 또한, AQP3 유전자의 rs34391490 좌위의 5' 방향에는 구아닌(G)이 존재하므로, 이 대신 아데닌(A)이 오도록 디자인 하였다. 상기 서열을 표적 핵산으로 하여 대립형질 A와 G의 검출용으로 프라이머 세트를 완성하였다.Based on the sequence of the locus rs34391490 of the AQP3 gene, inosine was designed to be between the 22nd and 28th bases as the ring-forming site. In addition, since guanine (G) exists in the 5 'direction of the locus of rs34391490 of the AQP3 gene, the adenine (A) is designed instead of this. Using this sequence as a target nucleic acid, a primer set was prepared for detection of alleles A and G.
프라이머 명칭Name of the primer 서열 (5'→3')The sequence (5 '- > 3') 서열번호SEQ ID NO:
주 대립유전자 정방향 프라이머Primary allele forward primer GAGAGGAGCCACACAGATCCCTIIIIITAA GACCGAGAGGAGCCACACAGATCCCTIIIIITA A G ACC 77
부 대립유전자 정방향 프라이머Negative allele forward primer GAGAGGAGCCACACAGATCCCTIIIIITAA AACCGAGAGGAGCCACACAGATCCCTIIIIITA A A ACC 88
역방향 프라이머Reverse primer GTCCCCCTCAACAACCTCCCCGTCCCCCTCAACAACCTCCCC 99
**밑줄: 비상보적 부위; 볼드체: SNP** Underline: Emergency area; Bold: SNP
본원의 일 구현예에 따라 디자인된 각 프라이머 서열을 하기 표 4에 기재된 바와 같다. 또한 각 프라이머 염기서열은 NCBI, Genbank 및 Blast를 이용하여 검증한 결과 해당 유전자 외에 일치하는 염기서열이 존재하지 않았다.Each primer sequence designed according to one embodiment of the invention is as set forth in Table 4 below. In addition, each primer sequence was verified using NCBI, GenBank, and Blast. As a result, there was no matching nucleotide sequence except for the corresponding gene.
비교예 1 내지 3. 비상보적 부위가 부재하는 프라이머의 제조COMPARATIVE EXAMPLES 1 to 3 Preparation of primers in which the non-complementary region was absent
프라이머 제작 시 각 유전자에서 SNP 상보적 부위의 5' 방향에 존재하는 염기에 비상보적인 염기를 위치시키는 것을 제외하고는, 상기 실시예 1 내지 3에 기재된 방법과 동일한 방법으로 각각 비교예 1 내지 3의 프라이머(표 5)를 제조하였다.In the same manner as described in Examples 1 to 3 above, except that non-rescued bases were placed in the bases existing in the 5 'direction of the SNP complementary site in each gene in preparing the primers, (Table 5) were prepared.
SNPSNP 프라이머 명칭Name of the primer 서열(5'→3')The sequence (5 '- > 3') 서열번호SEQ ID NO:
rs11950646rs11950646 주 대립유전자 정방향 프라이머Primary allele forward primer GCTGCCGTCCTCTGGGGCTIIIIIGGCTGCAGGCTGCCGTCCTCTGGGGCTIIIIIGGCT G CAG 1010
부 대립유전자 정방향 프라이머Negative allele forward primer GCTGCCGTCCTCTGGGGCTIIIIIGGCTACAGGCTGCCGTCCTCTGGGGCTIIIIIGGCT A CAG 1111
역방향 프라이머 Reverse primer GCCAGGGCACTAGGACTAGCTCTGGCCAGGGCACTAGGACTAGCTCTG 33
rs429358rs429358 주 대립유전자 정방향 프라이머Primary allele forward primer CGGCTGGGCGCGGACATGIIIIICGTGTGCGCGGCTGGGCGCGGACATGIIIIICGTG T GCG 1212
부 대립유전자 정방향 프라이머Negative allele forward primer CGGCTGGGCGCGGACATGIIIIICGTGCGCGCGGCTGGGCGCGGACATGIIIIICGTG C GCG 1313
역방향 프라이머Reverse primer AGGTGGGAGGCGAGGCGCACAGGTGGGAGGCGAGGCGCAC 66
rs34391490rs34391490 주 대립유전자 정방향 프라이머Primary allele forward primer GAGAGGAGCCACACAGATCCCTIIIIITAGAACCGAGAGGAGCCACACAGATCCCTIIIIITAG A ACC 1414
부 대립유전자 정방향 프라이머Negative allele forward primer GAGAGGAGCCACACAGATCCCTIIIIITAGGACC GAGAGGAGCCACACAGATCCCTIIIIITAG G ACC 1515
역방향 프라이머Reverse primer GTCCCCCTCAACAACCTCCCCGTCCCCCTCAACAACCTCCCC 99
**볼드체: SNP** Bold: SNP
실험예 1. 유전자형의 판별(SLC23A1)Experimental Example 1. Identification of genotype (SLC23A1)
SLC23A1 유전자의 rs11950646 좌위에 대한 유전자형은 유전자형 별 샘플을 이용하여, 모든 유전자형(AA/AG/GG)에서 실시예와 비교예에 따른 프라이머의 특이성 비교를 수행하였다.Genotyping of the SLC23A1 gene to the locus rs11950646 was carried out by comparing the specificity of the primers according to the examples and the comparative examples in all genotypes (AA / AG / GG) using the genotypic samples.
실시예 1 및 비교예 1에 따른 프라이머 세트를 이용하여 SLC23A1 유전자의 rs11950646 좌위에 대한 각 유전자형의 DNA 샘플을 PCR 증폭하였다. 증폭은 프로토콜에 따라, PCR 조건, 95℃ 5분에서 시작하여 (95℃ 30초, 66℃ 30초 및 72℃ 30초)을 35회 반복하였고, 최종 72℃에서 5분간 처리하여 수행하였다.DNA samples of each genotype to the locus of rs11950646 of the SLC23A1 gene were amplified by PCR using the primer set according to Example 1 and Comparative Example 1. Amplification was performed according to the protocol under PCR conditions, starting at 95 ° C for 5 minutes (95 ° C for 30 seconds, 66 ° C for 30 seconds and 72 ° C for 30 seconds) 35 times, and final 72 ° C for 5 minutes.
실시예 1 및 비교예 1의 프라이머를 이용한 PCR산물을 양방향으로 시퀀싱하였으며, Lightcycler SW 1.1을 사용하여 이의 유전자형 피크를 분석하였다(도 4, 적색: A-피크; 청색: G-피크).PCR products using the primers of Example 1 and Comparative Example 1 were sequenced bidirectionally and their genotype peaks were analyzed using Lightcycler SW 1.1 (Fig. 4, red: A-peak; blue: G-peak).
도 4의 (a)는 실시예 1의 프라이머 세트를, (b)는 비교예 1의 프라이머 세트를 사용한 PCR 증폭 산물에 대한 크로마토그램 결과이다. 비교예 1의 경우 프라이머의 비특이적 결합에 의해, AA 및 GG 유전자형에서도 AG형으로 분석이 되어, 부정확한 결과를 수득한 반면, 실시예 1의 경우 모든 유전형에서 정확한 결과를 얻을 수 있었다.4 (a) shows the result of the chromatogram of the PCR amplification product using the primer set of Example 1 and (b) of the primer set of Comparative Example 1. Fig. In the case of Comparative Example 1, the AA and GG genotypes were also analyzed as AG type due to nonspecific binding of the primers, and inaccurate results were obtained, whereas in Example 1, accurate results were obtained in all genotypes.
유전자형 분석의 적정 온도를 결정하기 위해, AA 유전자형 샘플 및 실시예 1에서 제조된 프라이머 세트를 이용한 PCR에서 결합 단계(annealing)의 온도를 60℃, 62℃, 64℃, 66℃ 및 68℃로 달리하여 시험하였다. 실험 결과, 64℃ 및 66℃에서 정확한 결과를 확인할 수 있었다(도 5).In order to determine the appropriate temperature for genotyping, the temperature of the annealing in PCR using the AA genotype sample and the primer set prepared in Example 1 was changed to 60 ° C, 62 ° C, 64 ° C, 66 ° C and 68 ° C Respectively. As a result of the experiment, accurate results were confirmed at 64 ° C and 66 ° C (FIG. 5).
실험예 2. 유전자형의 판별(APOE)Experimental Example 2. Determination of genotype (APOE)
APOE 유전자의 rs429358 좌위에 대한 TT 유전자형 샘플을 이용하여, 상기 좌위에서의 실시예와 비교예에 따른 프라이머의 특이성 비교를 수행하였다.A comparison of the specificity of the primers according to the examples and the comparative examples in the above loci was performed using a TT genotype sample for the locus rs429358 of the APOE gene.
실시예 2 및 비교예 2에 따른 프라이머 세트를 이용하여 APOE 유전자의 rs429358 좌위에 대한 AA 유전자형의 DNA 샘플을 PCR 증폭하였다. 증폭은 프로토콜에 따라, PCR 조건, 95℃ 5분에서 시작하여 95℃ 30초, 64℃ 30초 및 72℃ 30초를 35회 반복하였고, 최종 72℃에서 5분간 처리하여 수행하였다.Using the primer set according to Example 2 and Comparative Example 2, DNA samples of the AA genotype to the locus of rs429358 of the APOE gene were PCR amplified. Amplification was performed according to the protocol, starting at 95 ° C for 5 minutes, followed by 35 cycles of 95 ° C for 30 seconds, 64 ° C for 30 seconds and 72 ° C for 30 seconds, and final treatment at 72 ° C for 5 minutes.
실시예 2 및 비교예 2의 프라이머를 이용한 PCR 산물을 양방향으로 시퀀싱하였으며, Lightcycler SW 1.1을 사용하여 이의 유전자형 피크를 분석하였다 (도 6, 적색: T-피크; 청색: C-피크).The PCR products using the primers of Example 2 and Comparative Example 2 were sequenced in both directions and their genotype peaks were analyzed using Lightcycler SW 1.1 (Fig. 6, red: T-peak; blue: C-peak).
도 6의 (a)는 실시예 2의 프라이머 세트를, (b)는 비교예 2의 프라이머 세트를 사용한 PCR 증폭 산물에 대한 유전자형 분석 결과이다. 비교예 2의 경우 프라이머의 비특이적 결합에 의해, TT 유전자형에서 TC형으로 분석이 되어, 부정확한 결과를 수득한 반면, 실시예 1의 경우 TT 유전형으로 정확히 일치한 결과를 얻을 수 있었다.6 (a) shows the result of genotyping analysis of the PCR amplification product using the primer set of Example 2 and (b) of the primer set of Comparative Example 2. Fig. In the case of Comparative Example 2, the TT genotype was analyzed as TC type by nonspecific binding of the primer, and an incorrect result was obtained. On the other hand, in Example 1, the TT genotype was correctly matched.
유전자형 분석의 적정 온도를 결정하기 위해, TT 유전자형 샘플 및 실시예 2에서 제조된 프라이머 세트를 이용한 PCR에서 결합 단계의 온도를 60℃, 63℃, 66℃ 및 69℃로 달리하여 시험하였다. 실험 결과, 63℃에서 정확한 결과를 확인할 수 있었다(도 7).To determine the appropriate temperature for genotyping, the temperature of the binding step was tested at 60 ° C., 63 ° C., 66 ° C. and 69 ° C. in PCR using the TT genotype sample and the primer set prepared in Example 2. As a result of the experiment, an accurate result was confirmed at 63 ° C (FIG. 7).
실험예 3. 유전자형의 판별(AQP3)Experimental Example 3. Determination of genotype (AQP3)
AQP3 유전자의 rs34391490 좌위에 대한 GG 유전자형 샘플을 이용하여, 상기 좌위에서의 실시예와 비교예에 따른 프라이머의 특이성 비교를 수행하였다.A comparison of the specificity of the primers according to the above example and the comparative example was performed using the GG genotype sample for the locus of rs34391490 of the AQP3 gene.
실시예 3 및 비교예 3에 따른 프라이머 세트를 이용하여 AQP3 유전자의 rs34391490 좌위에 대한 GG 유전자형의 DNA 샘플을 PCR 증폭하였다. 증폭은 프로토콜에 따라, PCR 조건, 95℃ 5분에서 시작하여 95℃ 30초, 64℃ 30초 및 72℃ 30초를 35회 반복하였고, 최종 72℃에서 5분간 처리하여 수행하였다.Using the primer set according to Example 3 and Comparative Example 3, a DNA sample of the GG genotype for the locus of rs34391490 of the AQP3 gene was PCR amplified. Amplification was performed according to the protocol, starting at 95 ° C for 5 minutes, followed by 35 cycles of 95 ° C for 30 seconds, 64 ° C for 30 seconds and 72 ° C for 30 seconds, and final treatment at 72 ° C for 5 minutes.
실시예 3 및 비교예 3의 프라이머를 이용한 PCR 산물을 양방향으로 시퀀싱하였으며, Lightcycler SW 1.1을 사용하여 이의 유전자형 피크를 분석하였다 (도 8, 적색: A-피크; 청색: G-피크).PCR products using the primers of Example 3 and Comparative Example 3 were sequenced bidirectionally and their genotype peaks were analyzed using Lightcycler SW 1.1 (Fig. 8, red: A-peak; blue: G-peak).
도 8의 (a)는 실시예 3의 프라이머 세트를, (b)는 비교예 3의 프라이머 세트를 사용한 PCR 증폭 산물에 대한 크로마토그램 결과이다. 실시예 3과 비교예 3의 프라이머 모두 정확한 유전자형이 확인되었다.8 (a) shows the result of the chromatogram of the PCR-amplified product using the primer set of Example 3 and (b) of the primer set of Comparative Example 3. Fig. All the primers of Example 3 and Comparative Example 3 were confirmed to have correct genotypes.
하지만 결과 피크를 살펴보면, 실시예 3에서는 A 유전자형에 대한 비특이적 프라이머 부착이 전혀 관찰되지 않은 반면에, 비교예 3에서는 G 보다 상대적으로 낮기는 하지만 비특이적으로 결합한 프라이머들에 의해 A-피크가 나타나는 것을 확인할 수 있었다.However, in the resultant peak, in Example 3, nonspecific primer attachment to the A genotype was not observed at all, whereas in Comparative Example 3, A-peak was observed due to primers that were relatively lower than G but non-specifically bound I could.
유전자형 분석의 적정 온도를 결정하기 위해, GG 유전자형 샘플 및 실시예 3에서 제조된 프라이머 세트를 이용한 PCR에서 결합 단계의 온도를 55℃, 58℃, 62℃ 및 64℃로 달리하여 시험하였다. 실험 결과, 55℃. 58℃ 및 62℃에서 정확한 유전자형 분석 결과를 확인할 수 있었다(도 9).To determine the appropriate temperature for genotyping, the temperature of the binding step was tested at 55 ° C, 58 ° C, 62 ° C and 64 ° C in the PCR using the GG genotype sample and the primer set prepared in Example 3. The experimental result is 55 ℃. 58 ° C and 62 ° C (Fig. 9).
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로, 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 상세한 설명보다는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than the foregoing description, and all changes or modifications derived from the meaning and scope of the claims and equivalents thereof are included in the scope of the present invention. .

Claims (8)

  1. 하기 식 1로 나타나는 프라이머를 포함하는 프라이머 세트.A primer set comprising a primer represented by the following formula (1).
    [식 1][Formula 1]
    5'-X-Y-Z-3'5'-X-Y-Z-3 '
    상기 식에서,In this formula,
    X는 혼성화 되는 주형 핵산에 상보적인 15 내지 25bp의 혼성화 뉴클레오티드 서열을 포함하는 제1 결합 부위이고,X is a first binding site comprising a hybridized nucleotide sequence of 15 to 25 bp complementary to the template nucleic acid to be hybridized,
    Y는 3 내지 10bp의 고리 형성 부위이고,Y is a ring forming moiety of 3 to 10 bp,
    Z는 상기 주형 핵산에 대하여 상보적인 5 내지 10bp의 혼성화 뉴클레오티드 서열, 및 대립형질에 상응하는 뉴클레오티드와 이에 연속된 1 내지 3bp의 비상보적 뉴클레오티드를 포함하는 제2 결합 부위이고,Z is a second binding site comprising a hybridization nucleotide sequence of 5 to 10 bp complementary to the template nucleic acid, and a nucleotide corresponding to the allele and a non-complementary nucleotide sequence of 1 to 3 bp consecutively thereto,
    상기 X, Y 및 Z는 디옥시리보뉴클레오티드 또는 리보뉴클레오티드이다.X, Y and Z are deoxyribonucleotides or ribonucleotides.
  2. 제 1 항에 있어서,The method according to claim 1,
    상기 제2 결합 부위에서 비상보적 뉴클레오티드는 상기 대립형질에 상응하는 뉴클레오티드의 5' 위치에 연속된 것인 프라이머 세트.Wherein the non-complementary nucleotide at the second binding site is contiguous to the 5 ' position of the nucleotide corresponding to the allele.
  3. 제 2 항에 있어서,3. The method of claim 2,
    상기 비상보적 뉴클레오티드는 1bp인 것인 프라이머 세트.Wherein the non-complementary nucleotide is 1 bp.
  4. 제 1 항에 있어서,The method according to claim 1,
    상기 고리 형성 부위는 이노신, 디옥시이노신, 7-디아자-2-디옥시이노신, 2-아자-2-디옥시이노신, 2-OMe-이노신, 2'-F-이노신, 디옥시 3-니트로피롤, 3-니트로피롤, 2'-OMe-3-니트로피롤, 2'-F 3-니트로피롤, 1-(2-디옥시-베타-D-리보푸라노실)-3-니트로피롤, 디옥시 5-니트로피롤, 5-니트로인돌, 2'-OMe-5-니트로인돌, 2'-F-5-니트로인돌, 디옥시 4-니트로벤즈이미다졸, 4-니트로벤즈이미다졸, 디옥시 4-아미노벤즈이미다졸, 4-아미노벤즈이미다졸, 디옥시 네불라린, 2'-F 네불라린, 2'-F 4-니트로벤즈이미다졸, PNA-5-인트로인돌, PNA-네불라린, PNA-이노신, PNA-4-니트로벤즈이미다졸, PNA-3-니트로피롤, 모르포리노-5-니트로인돌, 모르포리노-네불라린, 모르포리노-이노신, 모르포리노-4-니트로벤즈이미다졸, 모르포리노-3-니트로피롤, 포스포라미데이트-5-니트로인돌, 포스포라미데이트-네불라린, 포스포라미데이트-이노신, 포스포라미데이트-4-니트로벤즈이미다졸, 포스포라미데이트-3-니트로피롤, 2'-0-메톡시에틸이노신, 2'-0-메톡시에틸 네불라린, 2'-0-메톡시에틸 5-니트로인돌, 2'-0-메톡시에틸 4-니트로-벤즈이미다졸, 2'-0-메톡시에틸 3-니트로피롤 및 상기 염기의 조합으로 구성된 군으로부터 선택되는 것인 프라이머 세트.The ring-forming moiety may be selected from the group consisting of inosine, dioxyinosine, 7-diaza-2-deoxyinosine, 2-aza-2-deoxyinosine, 2-OMe-inosine, 2'- 3-nitropyrrol, 2'-OMe-3-nitropyrrol, 2'-F 3-nitropyrrol, 1- (2-deoxy-beta-D- ribofuranosyl) Nitro-indole, 2'-F-5-nitroindole, dioxy-4-nitrobenzimidazole, 4-nitrobenzimidazole, 4-aminobenzimidazole, 4-aminobenzimidazole, dioxine nebulin, 2'-F nebulanarin, 2'-F 4-nitrobenzimidazole, PNA-5-introindol, PNA-nervuline, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrol, morpholino-5-nitroindole, morpholino-nebulalin, morpholino- Morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrol, phosphoramidate-5-nitroindole, phosphoramidate- Phosphoramidate-3-nitropyrrol, 2'-O-methoxyethylinosine, 2'-O-methoxyphenylamine, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole, Methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitro-benzimidazole, 2'-O-methoxyethyl 3-nitropyrrol and the base ≪ / RTI > or a combination thereof.
  5. 제 1 항에 있어서,The method according to claim 1,
    상기 혼성화 되는 주형 핵산은 SLC23A1 유전자, APOE 유전자, AQP3 유전자 및 상기 유전자의 조합으로 구성된 군으로부터 선택되는 것인 프라이머 세트.Wherein the hybridizing template nucleic acid is selected from the group consisting of the SLC23A1 gene, the APOE gene, the AQP3 gene and a combination of the genes.
  6. 제 1 항에 있어서,The method according to claim 1,
    상기 프라이머 세트는 서열번호 1 내지 서열번호 3의 염기서열, 서열번호 4 내지 서열번호 6의 염기서열 및 서열번호 7 내지 서열번호 9의 염기서열로 구성된 군으로부터 선택되는 염기서열을 갖는 올리고뉴클레오티드로 구성되는 프라이머를 포함하는 프라이머 세트.The primer set is composed of an oligonucleotide having a base sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 3, the nucleotide sequences of SEQ ID NOS: 4 to 6, and the nucleotide sequences of SEQ ID NOS: 7 to 9 ≪ / RTI >
  7. 제 1 항 내지 제 6 항 중 어느 한 항에 따른 프라이머 세트를 포함하는 단일염기 대립형질 판별용 조성물.A composition for discriminating single base allelic features comprising a primer set according to any one of claims 1 to 6.
  8. 제 7 항에 따른 단일염기 대립형질 판별용 조성물을 이용하는 단일염기 대립형질 판별 방법.A method for determining a single base allele using the composition for discriminating mononucleotide alleles according to claim 7.
PCT/KR2018/010206 2017-11-16 2018-09-03 Allele specific primer of nucleic acids, and method for identifying genotype by using same WO2019098512A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2018564352A JP2020503838A (en) 2017-11-16 2018-09-03 Allele-specific primers for nucleic acids and genotyping methods using the same

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0153351 2017-11-16
KR1020170153351A KR101856205B1 (en) 2017-11-16 2017-11-16 Allele specific primer and method for analyzing identifying genotype of the allele using same

Publications (1)

Publication Number Publication Date
WO2019098512A1 true WO2019098512A1 (en) 2019-05-23

Family

ID=62769989

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/010206 WO2019098512A1 (en) 2017-11-16 2018-09-03 Allele specific primer of nucleic acids, and method for identifying genotype by using same

Country Status (3)

Country Link
JP (1) JP2020503838A (en)
KR (1) KR101856205B1 (en)
WO (1) WO2019098512A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101856205B1 (en) * 2017-11-16 2018-06-20 제노플랜코리아 주식회사 Allele specific primer and method for analyzing identifying genotype of the allele using same

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5478835B2 (en) * 2008-04-04 2014-04-23 Ｇ＆Ｇサイエンス株式会社 Genetic risk detection method for lipid metabolism disorders
KR101856205B1 (en) * 2017-11-16 2018-06-20 제노플랜코리아 주식회사 Allele specific primer and method for analyzing identifying genotype of the allele using same

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001042498A1 (en) * 1999-12-10 2001-06-14 Toyo Boseki Kabushiki Kaisha Method of detecting nucleotide polymorphism
AU2002222737A1 (en) * 2001-12-08 2003-06-23 Seegene, Inc Annealing control primer system for regulating primer annealing specificity and its applications
JP2004121088A (en) * 2002-10-02 2004-04-22 Fuji Photo Film Co Ltd Method for detecting single nucleotide polymorphism
JP4116856B2 (en) * 2002-10-02 2008-07-09 富士フイルム株式会社 Single nucleotide polymorphism detection method
WO2006095941A1 (en) * 2005-03-05 2006-09-14 Seegene, Inc. Processes using dual specificity oligonucleotide and dual specificity oligonucleotide
WO2007129778A1 (en) * 2006-05-04 2007-11-15 Seegene, Inc. Method for amplifying unknown dna sequence adjacent to known sequence
KR20080037128A (en) * 2006-10-25 2008-04-30 주식회사 씨젠 Method for detecting nucleotide variations

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5478835B2 (en) * 2008-04-04 2014-04-23 Ｇ＆Ｇサイエンス株式会社 Genetic risk detection method for lipid metabolism disorders
KR101856205B1 (en) * 2017-11-16 2018-06-20 제노플랜코리아 주식회사 Allele specific primer and method for analyzing identifying genotype of the allele using same

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
10 November 2017 (2017-11-10), ANONYMOUS, retrieved from NCBI Database accession no. rs11950646 *
CHUN, J.-Y. -DELTA: "Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene", NUCLEIC ACIDS RESEARCH, vol. 32, no. 6, 7 February 2007 (2007-02-07), pages e40, XP055052962 *
DATABASE NCBI 10 November 2017 (2017-11-10), Database accession no. rs34391490 *
DATABASE NCBI 10 November 2017 (2017-11-10), Database accession no. rs429358 *

Also Published As

Publication number Publication date
KR101856205B1 (en) 2018-06-20
JP2020503838A (en) 2020-02-06

Similar Documents

Publication Publication Date Title
US9133516B2 (en) Methods for identification of alleles using allele-specific primers for amplification
Okimoto et al. Improved PCR amplification of multiple specific alleles (PAMSA) using internally mismatched primers
JP5518719B2 (en) Primer for PCR amplification containing an abasic part in the sequence
US8771952B2 (en) Substances and methods for a DNA based profiling assay
WO2018174318A1 (en) Method for melting curves analysis using bifunctional pna probe, and method for diagnosing microsatellite instability and kit for diagnosing microsatellite instability using same
WO2017030322A1 (en) Probes for identifying region-specific genotypes of viral hemorrhagic septicemia virus and use of same
Varawalla et al. Rare β‐thalassaemia mutations in Asian Indians
WO2019151751A1 (en) Gene panel for personalized medicine, method for forming same, and personalized treatment method using same
WO2017099445A1 (en) Genetic marker for discriminating and detecting causative bacteria of fish edwardsiellosis and streptococcosis, and method for discriminating and detecting causative bacteria using same
WO2014163225A1 (en) Nucleic acid amplification method using allele-specific reactive primer
WO2019098512A1 (en) Allele specific primer of nucleic acids, and method for identifying genotype by using same
WO2013122319A1 (en) Method for detecting target gene or mutation thereof using ligase reaction and nicking enzyme amplification reaction
WO2018194437A2 (en) Nucleic acid molecule template for detecting target point mutation gene and genetic analysis method using same
WO2018070659A1 (en) Method for detecting single nucleotide variation on basis of lamp by using primers specific to allele or mutation in target nucleic acid
WO2021162228A1 (en) Primer set for analyzing hiv-1 drug resistance, kit comprising same, and anaysis method using same
US10907203B1 (en) DNA methylation assays for body fluid identification
WO2018048021A1 (en) Method for analyzing snp of mitochondrial dna by using pna probe and melting curve analysis
WO2021182850A1 (en) Method for simultaneous detection of multiple mirnas and mirna detection kit using same
WO2016137031A1 (en) Dumbbell-structure oligonucleotide, nucleic acid amplification primer comprising same, and nucleic acid amplification method using same
WO2018016683A1 (en) Target nucleic acid sequence detection method using multiple amplification nested signal amplification
WO2011159004A1 (en) Snp for predicting the sensitivity to anticancer targeted therapeutic formulation
WO2018026039A1 (en) Kit and method for detecting single nucleotide polymorphism
WO2019151757A1 (en) Target nucleic acid-detecting method using three-way junction structure-induced isothermal amplification
WO2018186680A1 (en) Composition comprising genomic dna-based long pcr primer set for diagnosing neurofibromatosis
Lee et al. A new method for ABO genotyping using fluorescence melting curve analysis based on peptide nucleic acid probes

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 2018564352

Country of ref document: JP

Kind code of ref document: A

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18879290

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18879290

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 26/01/2021)

122 Ep: pct application non-entry in european phase

Ref document number: 18879290

Country of ref document: EP

Kind code of ref document: A1