WO2019092939A1 - Method for producing cultured cell, and method for producing therapeutic agent for spinal cord injury disease - Google Patents

Abstract

[Problem] To provide a cell culture method which can achieve the increase in safe expression of GDNF gene (mRNA) without needing to employ a gene transfer method using a virus. [Solution] A method for producing a cultured cell containing mRNA for glial cell line derived neurotrophic factor (GDNF), the method including a culture step of culturing a human skin-derived stem cell in a serum-free culture medium containing at least one component selected from SAG, purmorphamine and sonic hedgehog (SHH) protein, wherein the serum-free culture medium may additionally contain a B-27 supplement, a ROCK inhibitor, EGF and FGF2.

Description

Method of producing cultured cells, method of producing therapeutic agent for spinal cord injury disease

The present invention relates to a method for producing cells obtained by culturing cells obtained from human skin tissue for treating a spinal cord injury disease group, and cells obtained by the above-mentioned method or a secretion such as culture medium or Exosome. The present invention relates to a method for producing a medical drug for treating a spinal cord injury disease group containing

Spinal cord injury is a condition in which the spine is damaged mainly by applying a strong external force to the spinal column, and the spinal cord is damaged. Similar disorders also occur with internal causes such as spinal cord tumors, hernias and cervical spinal myelopathy. The estimated number of patients with spinal cord injury is 100,000 in Japan. Most of the causes of spinal cord injuries are injuries due to traffic or falling from high places.

Unlike peripheral nerves, the central nervous system including the spinal cord can not be repaired or regenerated once it is damaged. Regeneration of the destroyed spinal cord and regaining its function are the wishes of spinal cord all over the world, and research is underway in various fields.

At present, immediately after injury, in the United States, a large amount of steroid agent administration is performed within 48 to 72 hours immediately after injury. For patients immediately after injury at Kansai Medical University in Japan, their bone marrow fluid is cultured and injected into the spinal cord, and groups such as Keio University in Japan have injured the spinal cord within 78 hours after an accident, etc. Attempts have been made to administer hepatocyte growth factor (HFG) and the like.

In the chronic phase, rehabilitation is performed. However, rehabilitation of spinal cord injury is not to restore lost function. That is because it is impossible if the nerve does not regenerate. The purpose of rehabilitation is "how to use the remaining functions and enable ADL (Daily life movement)". Furthermore, complications such as hemorrhoids and urinary tract infections occur in the chronic stage, and care becomes extremely difficult.

Even in the chronic phase, attempts at nerve regeneration using bone marrow and neural stem cells are currently most promising as effective treatments. Although partial effects have been reported in animal experiments, it is still a basic research stage to be applied to the human body and to be useful for treatment, and strong promotion of research is desired. Although mainly the use of induced pluripotent stem cells and embryonic stem cells has been studied, there are also many issues to be solved. As an example, when induced pluripotent stem cells (iPS) are used, although it is thought that the immune response can be avoided, the possibility of becoming a tumor is pointed out. In addition to the problems of immune response and tumorigenesis, there are also ethical issues with embryonic stem cells.

However, it has been announced in 2010 from Japan that a tumor can be generated in the spinal cord by administration to spinal cord animals using iPS cells produced from gene transfer that has cleared the issue of ethics and immune rejection (non-patented in 2010) Literature 1).

As of 2005, the only clinical treatment that has been performed is that, at Beijing Metropolitan Medical University in China, regeneration of the spinal cord is intended by injecting nasal olfactory membrane cells (OEG). However, from the same university in the long-term examination of the therapeutic effect, there is no submission of data convincing researchers in the world, leaving the problem of intense pain, the source of OEG (from abortion fetus) and the problem of cross transplantation ing. No dramatic effects (walkable cases) have been reported in Japanese clinical trials for transplanting the own nasal mucosa, which were announced in 2014.

In October 2010, Geron in the US launched a clinical trial using ES cells in four patients with spinal cord injury, but announced withdrawal in November 2011. Although the cause is unknown, it is likely that the clinical effect was poor or immunologic rejection occurred or that Teratoma occurred in the spinal cord.
A group of Associate Professors Masaya Nakamura of Keio University announced a plan to start clinical research on iPS cells for patients with spinal cord injury in 2017 at the Japan Society for Regenerative Medicine held in Kyoto City. Subjects are patients 2 to 4 weeks after the accident, before the inflammation in the affected area subsides and the wound starts to harden, and patients in the chronic phase are not indicated.

As such, although stem cell therapy has attracted attention, there is only one marketed regenerative medicine product in the United States that uses stem cells, and one in the EU as Advanced Therapy Medicinal Products. However, there is currently no regenerative medicine product approved for spinal cord injury.

In addition, human skin-derived stem cells (Mesenchymal stem cells) are difficult to induce in neurons after transplantation and are likely to become chondrocytes and osteocytes, and brain-derived neural stem cells have disadvantages such as low therapeutic effect (Non-Patent Document 13).

On the other hand, it has been reported that precursor cells from the skin are more effective in treating spinal cord injury than neural stem cells from the brain (Non-patent Document 14).

Furthermore, Inoue & Kumagaya et al. Also recently reported that human epidermal keratinocytes also have a healing effect on spinal cord injury (Non-patent Document 2).

However, for spinal cord injury, there are still no markers of therapeutic effect, and there is no culture preparation method for cells expressing them.

On the other hand, as cytokines, glial cell line-derived neurotrophic factor (GDNF) is the one most clearly shown to be effective in spinal cord injury (Non-patent Document 4-8).

Therefore, an attempt to further create a healing effect of spinal cord injury is an attempt to further introduce the gene of GDNF into cells expected to have a healing effect (Non-patent Document 8-10). As cells into which genes are introduced, Olfactory ensheathing cells, Schwann cells, etc. are used, and since these cells themselves have a healing effect, there is a further increase in the therapeutic effect.

However, the drawback of this method is that the gene is transferred using a virus, so there is a high possibility of becoming cancerous when transplanted into a living body.

Conversely, GDNF protein itself is unstable and difficult to handle (Non-patent Document 15).

GDNF has also been reported as an intrinsic factor required for the recovery of spinal cord injury (Non-patent Document 16).

Furthermore, GDNF has also been reported to be effective in suppressing allodynia that afflicts patients with spinal cord injury (Non-patent Literature 17-18).

Most of the treatments for spinal cord injuries are for patients who have entered the chronic phase, and treatments that are effective in the chronic phase are most desirable. Fortunately, GDNF has also been reported to be effective in chronic spinal cord injury (Non-patent Document 19).

Therefore, expressing GDNF in cells to be transplanted leads to a breakthrough in the therapeutic effect of spinal cord injury (Non-patent Document 20).

JP, 2012-29684, A

An object of the present invention is to provide a cell culture method for safely increasing GDNF gene expression (mRNA) without adopting viral gene transfer method.

An object of the present invention is to provide a cell culture method which also expresses various markers such as markers of neural stem cells.

An object of the present invention is to provide a method for producing a therapeutic agent for spinal cord injury.

Basically, the present invention is a serum-free medium containing human skin-derived stem cells and any one or more of SAG, palmorphamine and sonic hedgehog (SHH) proteins. It is based on the findings from the example that by culturing, glial cell line-derived neurotrophic factor (GDNF) mRNA can be highly expressed (for example, 10 times or more of that in normal culture).

A first aspect of the present invention relates to a method for producing a cultured cell containing glial cell line-derived neurotrophic factor (GDNF) mRNA. This method involves culturing a human skin-derived stem cell in a serum-free medium containing one or more of SAG, palmorphamine (Purmorphamine) and Sonic hedgehog (SHH) proteins. Including. This method highly expresses glial cell line-derived neurotrophic factor (GDNF) mRNA.

Human skin-derived stem cells are preferably derived from skin cells of the patient himself. In particular, it is preferable to collect cells from skin tissue that causes a slight damage to the tissue at the time of collection and recovers quickly, and to obtain cultured cells. Since methods for culturing stem cells are known, basically, cells are cultured according to the methods described herein and the known methods (for example, the methods described in Japanese Patent No. 5409359 and Japanese Patent No. 6041270). do it. The method for producing human skin-derived stem cells is also known techniques as described in the above-mentioned publication.

SAG is known by CAS No. 364590-63-6, and the chemical name is N-methyl-N '-(3-pyridinylbenzyl) -N'-(3-chlorobenzo [b] thiophene-2-carbonyl) It is a compound which is -1,4-diaminocyclohexane (N-Methyl-N '-(3-pyridinylbenzyl) -N'-(3-chlorobenzo [b] thiophene-2-carbonyl) -1,4-diaminocyclohexane).

SAG is a protein that activates sonic hedgehog (Shh) as disclosed in WO 2014-084085 pamphlet. SAG 1.1 has the chemical name N-methyl-N '-(3- (4-benzonitrile) -4-methoxybenzyl) -N- (3-chlorobenzo [b] thiophene-2-carbonyl) -1, 4-Diaminocyclohexane (N-Methyl-N- (3- (4-benzonitrole) -4-methoxybenzyl) -N '-(3-chlorobenzo [b] thiophene-2-carbonyl) -1,4-diaminocyclohexane)) is there. SAG is described in the document Sinha S, Chen JK. Nat Chem Biol. 2006 Jan; 2 (1): 29-30. And Chen JK, Taipale J, Young KE, Maiti T, Beachy PA. Proc Natl Acad Sci USA. 2002 Oct 29; 99 (22): 14071-6. Similarly, for SAG 1.1, the documents Chen, W., Ren, X. R., Nelson, C. D., Barak, L. S., Chen, J. K., Beachy, P. A., de Sauvage, F. & Lefkowitz, R. J. (2004) Science 306, (5705) 2257-2260.

Palmorphamine (Purmorphamine) can be prepared by using (9-Cyclohexyl-N- [4- (4-morpholinyl) phenyl] -2- (1-naphthalenyloxy) -9H-purin-6-amine)) ((9- It is a general name of Cyclohexyl-N- [4- (4-morpholinyl) phenyl] -2- (1-naphthalenyloxy) -9H-purin-6-amine)). Palmorphamine is a smoothed agonist also called purmorphamine and is described in Patents 6210881 and 5620821 (2 uM is added to the medium).

The Sonic hedgehog (SHH) protein is a known protein, and for example, in Japanese Patent No. 4900587, 200 to 400 ng / ml of SHH protein is added to a serum-free medium.

Serum-free medium The medium of the present invention is a serum-free medium, and may contain components in known media as appropriate. Also, for example, Japanese Patent No. 4385076 and Japanese Patent Application Laid-Open No. 2012-157263 disclose a medium for serum-free culturing of animal cells. Thus, the elements described in the known literature may be appropriately added to the medium of the present invention.

The culture medium of the present invention may be appropriately used as a basic culture medium. Examples of such a basic medium include MEM medium, Dulbecco's MEM (registered trademark) medium, MCDB 153, Ham's F12 (registered trademark) medium, McCoy 5A (registered trademark) medium, 199 medium air solution (registered trademark), RPMI 1640 (Registered trademark) medium, F-10 ham medium, MEM-α medium, DMEM / F12 medium, MCDB131, MCDB153 and MCDB201.

The pH of the culture medium is adjusted in the range of pH 6.8-7.8 when equilibrated in a 5% CO ₂ environment, and more preferably pH 7.2 (± 0.1). The acidity of the basic medium may be appropriately adjusted using a pH adjuster such as a buffer (for example, sodium bicarbonate) or hydrochloric acid and sodium hydroxide.

The culture medium of the present invention may optionally contain various low molecular weight compounds. For example, the medium of the present invention preferably contains an antioxidant. An example of an antioxidant is one or more components selected from the group consisting of melatonin (Melatonin), n-acetyl-L-cysteine, reduced glutathione and ascorbic acid. The medium of the present invention includes phospholipids (eg, phosphatidylserine, phosphatidylethanolamine, and phosphatidylcholine) and fatty acids (eg, linoleic acid, oleic acid, linoleic acid, arachidonic acid, myristic acid, palmitoyl) Acid, palmitic acid, and stearic acid) may be included as appropriate. You may add to the culture medium of this invention. Examples of other components are transferrin, selenate, glucose, D-biotin, D-calcium pantothenate, choline chloride, folate, myoinositol, nicotinamide, p-aminobenzoic acid, pyridoxal hydrochloride, pyridoxi hydrochloride, riboflavin, Thiamine hydrochloride, vitamin B12, sodium pyruvate, thymidine, hypoxanthine, sodium selenite, streptomycin sulfate, penicillin G potassium salt, and phenol red.

In the method for producing cultured cells described above, the serum-free medium preferably further comprises a B-27 supplement. When serum-free medium contains B-27 supplement, nestin mRNA is highly expressed as shown in the examples. The nestin gene is a marker for neural stem cells. B-27 supplement is a known element to be added to the culture medium, for example, in Patents 6185907 and 6137626.

In the method for producing cultured cells described above, the serum-free medium preferably further comprises a ROCK inhibitor. When serum-free medium contains ROCK inhibitor, stem cell stability is maintained. ROCK inhibitors are defined as substances that inhibit the kinase activity of Rho-kinase (ROCK), for example Y-27632 (4-[(1R) -1-aminoethyl] -N-pyridin-4-ylcyclohexane- 1-carboxamide) or its dihydrochloride (for example, see Ishizaki et al., Mol. Pharmacol. 57, 976-983 (2000); Narumiya et al., Methods Enzymol. 325, 273-284 (2000)), Fasudil / HA1077 (1- (5-isoquinolinesulfonyl) homopiperazine) or its dihydrochloride (see, eg, Uenata et al., Nature 389: 990-994 (1997)), H-1152 ((S)-(+)-2 -Methyl-1-[(4-methyl-5-isoquinolinyl) sulfonyl] -hexahydro-1H-1,4-diazepine) or its dihydrochloride (eg Sasaki et al., Pharmacol. Ther. 93: 225-232) (See 2002), Wf-536 ((+)-(R) -4- (1-aminoethyl) -N- (4-pyridyl) benzamide monohydrochloride) (for example, Nakajima et al., Cancer Chemother. Pharmacol. 52 (4): 319-324 (2003)) and those Derivatives, as well as antisense nucleic acid to ROCK, RNA interference-inducing nucleic acid (e.g., siRNA), dominant negative mutants, and their expression vectors thereof. In addition, since other low molecular weight compounds are known as ROCK inhibitors, such compounds or their derivatives can also be used in the present invention (for example, US Patent Application Publication Nos. 20050209261 and 20050192304, No. 20040014755, No. 20040002508, No. 20040002507, No. 20030125344, No. 20030087919, and International Publication Nos. 2003/062227, 2003-059913, 2003/062225, and 2002/076976, 2004/039796). In the present invention, at least one ROCK inhibitor may be used. ROCK inhibitors are generally used in the range of 100 nM to 50 μM.

In the method for producing cultured cells described above, the serum-free medium preferably further comprises EGF. When serum-free medium contains EGF, neural stem cells are maintained and Nestin mRNA is highly expressed.

EGF is a growth factor selected from the epidermal growth factor (EGF) family. For example, in Japanese Patent No. 6191694, the content of EGF in the medium is set to 0.5 to 200 ng / mL as the final concentration.

GFAP
The GFAP gene is a marker for adult neural stem cells or astrocytes that is considered to be suitable for transplantation into spinal cord injury ( Non-patent Documents 1, 20, 22).

In the method for producing cultured cells described above, the serum-free medium preferably further contains FGF2. When the serum-free medium contains a ROCK inhibitor, EGF mRNA is highly expressed and CD73 protein is further expressed, as shown in the examples. FGF (fibroblast growth factor) 2 is also referred to as FGF-2. For example, in Japanese Patent No. 5856029, FGF2 is added to the medium at a concentration of 0.1 to 50 ng / mL, more preferably 1 to 10 ng / mL, most preferably 5 ng / mL. CD73 (Ecto-5'-nucleotidase: Ecto-5'-nucleotidase) is considered to be highly likely to relieve pain typical of patients with back pain.

In the above-mentioned method for producing cultured cells, the serum-free medium preferably has a calcium ion concentration of not less than 0.03 mM and not more than 0.12 mM. By maintaining the calcium ion concentration within this range, stem cell differentiation can be suppressed.

The above preferred embodiments can be combined as appropriate. Additives such as SAG, palmorphamine, sonic hedgehog (SHH) protein, B-27 supplement, ROCK inhibitor, EGF, FGF2 etc. should be added to the medium in an appropriate amount, taking into consideration the properties of those substances. It may be added. Since these substances are known to be added to the culture medium, the addition amount may be appropriately adjusted based on known materials. For example, it may be added to the culture medium to be 0.1 ng / mL or more and 20 μg / mL or less (or 0.2 ng / mL or more and 10 μg / mL or less). These may be appropriately adjusted and added according to the degree of purification and the required amount.

In the method of producing cultured cells described above, preferably, human skin-derived stem cells are cells obtained by treating collected human skin in the order of dispase treatment, trypsin treatment, and collagenase treatment. Dispase treatment, trypsin treatment, and collagenase treatment are so-called enzyme treatments. The enzyme treatment conditions may be an isotonic salt solution buffered to a physiologically acceptable pH, such as about 6 to 8, preferably about 7.2 to 7.6, such as PBS or Hanks balance salt in the case of trypsin. In solution, eg dispase, collagenase, eg in MEM medium, at about 4-40 ° C., preferably about 4-39 ° C., for a time sufficient to degrade connective tissue, eg about 1-1000 minutes, Preferably, for 5 to 720 minutes, the concentration may be sufficient for that, for example about 0.0001 to 5% w / v, preferably about 0.001% to 0.5% w / v.

The second aspect of the present invention also provides a method of producing a therapeutic agent for spinal cord injury. The spinal cord is a central nerve that passes through the spine, and it is a therapeutic agent for spinal cord injury that is used to repair the nerve. This method produces cultured cells using the method described above. Thereafter, a therapeutic agent for a spinal cord injury disease, which comprises one or more of a cultured cell, a culture medium obtained in a culture step, and a secretion (exosome etc.) obtained in a culture step as an active ingredient Agent). The secretion (such as exosome) may be from culture supernatant. Also, as the medium, only the culture supernatant may be used.

The agent of the present invention may be produced by methods known to those skilled in the art. The agent of the present invention can be manufactured as an oral preparation and a parenteral preparation, but is preferably a parenteral preparation. Such a parenteral preparation may be a solution (aqueous solution, non-aqueous solution, suspension solution, emulsion solution, etc.) or a solid agent (powder filled formulation, freeze-dried preparation, etc.). In addition, the agent of the present invention may be in the form of a sustained release preparation. As a dosage form in the case of using living cells as an agent, a solution is preferable, and as a dosage form in the case of using a partial component of cells or whole dead cells, a solution or a solid agent can be selected.

The main components of the agent of the present invention are any one or more of cultured human skin-derived stem cells, a culture medium obtained in the culturing step, and secretions from cultured cells (exosome etc.). In any case, for example, the effective amount may be designed using the number of cells as an index. Stem cells may be removed as the final agent. The secretion may also be contained in the culture supernatant. The dose and frequency of administration and the frequency of administration per dose vary depending on the subject, age, symptoms, etc. In general, an example of a daily dose of human skin-derived stem cell agent is 1 × 10 ⁵ cells or more and 1 × 10 ⁹ cells or more, preferably 1 × 10 ⁶ cells or more, as one administration unit for intravenous injection. 5 × 10 ⁸ cells, more preferably 1 × 10 ⁷ cells or more and 2 × 10 ⁸ cells. Alternatively, an example of a daily dose of human skin-derived stem cells per kg body weight is 1 × 10 ⁴ cells or more and 1 × 10 ⁸ cells, preferably 1 × 10 ⁵ cells or more and 5 × 10 ⁷ cells, More preferably, it is 1 × 10 ⁶ cells or more and 2 × 10 ⁷ cells. The agent of the present invention may be administered once every three days for a total of eight times, or daily administration may be continued for one week. It can also be used in combination for various frequency administration periods. In the case of significant response, where improvement of symptoms was observed at one time, it may be ended with only the first administration. Thus, the agent of the present invention can be used in a wide variety of ways depending on the background of the disease or condition, and further, the number of transplanted cells in each administration can be arbitrarily set within the above-mentioned range .

The present invention also provides the use of the above-mentioned human skin-derived stem cells of the present invention for producing a therapeutic agent for spinal cord injury.

The invention also provides a method of treating spinal cord injury. The method for treating various diseases comprises the step of administering an effective amount of the agent of the present invention produced as described above to a patient suffering from spinal cord injury.

The present invention can provide a cell culture method for safely increasing GDNF gene expression (mRNA) without employing a viral gene transfer method.

The present invention can provide a cell culture method which also expresses various markers such as neural stem cell markers.

The present invention can provide a method for producing a therapeutic agent for spinal cord injury.

In the method of the present invention, cells for treatment of spinal cord injury can be obtained from the skin which is easy to be collected among human tissues by the serum-free / feeder-free cell culture method. In the method of the present invention, a method of increasing the expression level of GDNF which is most essential for treatment of spinal cord injury by 10 times is found, together with this, nestin of neural stem cell marker is expressed to be effective for treatment of spinal cord injury It was confirmed that cells that are highly effective in healing spinal cord injury, in which CDAP is also expressed, which expresses GFAP and prevents hyperalgesia caused by spinal cord injury, without gene transfer. The cells obtained by the method of the present invention were confirmed to have a healing effect in a rat spinal cord injury model. Also, these cells were negative in oncogenic tests. Furthermore, by administering these cells twice a month by lumbar puncture, it was possible to obtain a result that a 47-year-old patient who could not walk with spinal cord injury (Th3) for more than 2 years could be walked one month after administration. On the other hand, in the odorous membrane transplantation in Japan announced at the 2014 TRI Symposium, there was no one case that could be walked for 4 cases of complete leg paralysis (Th4 ~ 7) under the age of 35 years.

FIG. 1 is a graph replacing the drawing showing the effect of increasing the expression level of GDNF mRNA (Experimental Example 2). FIG. 2 is a graph replaced with a drawing showing expression of Nestin mRNA (Experimental Example 3). FIG. 3 is a graph replaced with a drawing showing expression of GFAP mRNA (Experimental Example 4). FIG. 4 is a graph replaced with a drawing showing expression of CD73 (CD expression profile) (Experimental Example 5). FIG. 5 is a graph replacing the drawing showing the effect (BBB score) (Experimental Example 6) in a rat spinal cord injury model. FIG. 6 is a graph replacing a drawing showing evaluation of carcinogenicity.

Hereinafter, modes for carrying out the present invention will be described. The present invention is not limited to the embodiments described below, and includes those appropriately modified by the person skilled in the art from the following embodiments within the obvious scope.

The present invention is a tissue collecting process for collecting skin from human skin and disinfecting the tissue:
Cell collection and seeding process:
Cell proliferation process:
Passage process:
Differentiation induction process:
Implantation / processing process:
The present invention provides a method for obtaining cells that are highly effective for spinal cord injury through the above steps, and for providing cells to be directly administered, or for providing cells for a medical device combined with another base. Furthermore, a method of administering the post-culture medium component obtained in the above steps is provided.

Hereinafter, the details of each process will be described using an example. The following description is an example, and the present invention is not limited to the following examples, and includes those in which conditions are appropriately changed within the obvious range for those skilled in the art. In addition, u may mean micro.

(Tissue collection process)
The skin collected in this step is desirably located above the neck, and the skin on the back of the pinna is most preferable from the cosmetic point of view after collection. The sex and age of the skin are not limited, and can be up to the 70s. The following steps are all performed aseptically. Bacterial removal of the collected tissue is carried out with 70% ethanol water from which spores have been removed with a 0.1 um pore size removal filter.

(Cell collection and seeding process)
The cut tissue is immersed in 10 μM Y-27632 in Dispase solution (PBS (−)) at 4 ° C. overnight. The tissue is then immersed in Trypsin solution (PBS (−)) containing 10 uM Y-27632 at 37 ° C. for 20 minutes. Furthermore, the tissue is immersed in collagenase solution (DMEM) and stirred at 37 ° C. for 1 to 2 hours with a stirrer to digest the skin. Remove the residue from the stirred suspension through a 100 um mesh. The solution is centrifuged and washed three times with PBS (-) to remove the enzyme and obtain cells. The cells are placed in Trypsin Inhibitor and allowed to stand for 10 minutes. The cells are centrifuged to remove the inhibitor, and then suspended in a medium containing 10 uM Y-27632 and seeded in a culture dish.

(Cell proliferation process)
The medium is not changed until the 6th day of seeding, and only the medium is added. The subsequent medium exchange is carried out by centrifuging and recovering the cells floating in the conditioned medium, and the medium suspended in the new medium is returned to the culture system.

(Passage process)
The cells are treated with 10 uM Y-27632 for 30 minutes or more, and the cells are recovered from the dish with EDTA and TrypLEx Express. Then place in Trypsin Inhibitor and let stand for 10 minutes. After centrifuging the cells to remove the Inhibitor, the cells are suspended in a medium containing 10 uM Y-27632 and seeded in the original dish of 4-5 times area. The cells are cultured in five 100 mm ² dishes at passage 1 and when confluence is reached, three of them are used for transplantation or cryopreserved until transplantation. The remaining 2 sheets are further subcultured to 6 100 mm ² dishes, and when confluence is reached, the process proceeds to the factor addition induction step.

(Factor addition induction process)
The factor addition induction step is a step of carrying out drug treatment on required cells on the third day before transplantation, adding necessary factors, and culturing.
By this step, cells in which GDNF mRNA is highly expressed, for example, cells in which 10 or more times normal culture is expressed are obtained. In addition, this step produces CD13 negative cells (CD13 (−)). In addition, this step produces CD34 negative cells (CD34 (−)). In addition, this step produces CD45 negative cells (CD45 (−)). In addition, cells negative for CD90 can be obtained by this step (CD90 (−)). In addition, CD73-positive cells (CD73 (+)) are obtained by this step. 20% or more and 100% or less, or 40% or more and 100% or less, or 60% or more and 99% or less of the percentage (cell number) of cells (CD 73 (+)) positive in CD73 among the cultured cells % Or less, or 80% or more and 99% or less. It is preferable to use cells for which transplantation has been completed for 3 days after transplantation, or to cryopreserve the cells until transplantation.
(Transplanting and processing process)
The cells that have reached the required number for treatment after each treatment are treated with 10 uM Y-27632 for 30 minutes or more, and the cells are recovered from dish with EDTA and TrypLEx Express. Then place in Trypsin Inhibitor and let stand for 10 minutes. After centrifuging the cells to remove the inhibitor, when transplanting by spinal cord puncture, it is used after suspension in a clinical fluid at a concentration of 10 ⁷ cells / ml. The cells are subjected to processing with other carriers and cells.

Hereinafter, the present invention will be specifically described using examples. The present invention also includes a range that can be appropriately adjusted by those skilled in the art using known techniques based on the following examples.

(Collection and culture of skin stem cells from human skin)
(Collection of tissue)
A full-thickness area of about 2 cm ² of skin tissue resected and discarded from the face during lift-up cosmetic surgery of a 56-year-old woman was used. The following steps were all performed aseptically. This collected tissue is immersed in 70% ethanol water disinfected with a 0.1 um (micron) pore size disinfectant for 30 seconds, and immediately phosphate buffer saline (Phosphate buffer saline) (PBS (-) The ethanol was washed three times with. The subcutaneous fat and the dermal connective tissue were removed as much as possible from this tissue except for the places where hair roots were present, and then cut into a size of about 1 mm ^{2 with a} scalpel.

(Cell collection seeding step 1)
The cut tissue was immersed in 5 ml of a precooled Dispase solution (25 units / ml of PBS (-)) containing 10 uM Y-27632 overnight at 4 ° C.

(Cell collection seeding step 2)
After centrifuging this and removing the supernatant, it was immersed in TrypLE Express solution (5 × diluted PBS (−)) containing 10 uM Y-27632 at 37 ° C. for 20 minutes.

(Cell collection seeding step 3)
The tissue was centrifuged to remove the supernatant, and then immersed in 20 ml of collagenase solution (GIBCO: type I) (1400 units / ml DMEM medium) and stirred with a stirrer at 37 ° C. for 1.5 hours.

(Cell collection seeding step 4)
The suspension after stirring was passed through a 100 um mesh to remove undigested residues. The solution was centrifuged and washed three times with PBS (-) to remove the enzyme, to obtain cells.

(Cell collection seeding step 5)
The cells were placed in 5 ml of soybean trypsin inhibitor (Soy bean Trypsin Inhibitor) (0.25% / PBS (-)) and allowed to stand for 10 minutes.

(Cell collection seeding process 6)
The cells were centrifuged to remove the inhibitor, and then suspended in 10 uM Y-27632-added culture medium and seeded in culture dishes. From the size of the starting tissue (1 to 2 cm ² ), it was seeded to all wells of one 6 well plate (CellBind: COSTAR).

(Media preparation process)
Culture medium was prepared as follows. Specifically, insulin (10 mg / L), holo-transferrin (5.5 mg / L), selenium (6.7 ug / L), ethanolamine (2 mg / L) in MCDB 153 medium (Sigma: Stemline Keratinocyte Basal Medium) as a basic medium. , Vitamin C (L-Ascorbic acid 2-phosphate semimagnesium salt) (50 ug / L), KGF (10 ug / L), lipid (a mixture of fatty acid: arachidonic acid (20 ug / L), cholesterol (2.2 mg / L), DL- a-Tocopherol-acetate (700 ug / L), linoleic acid (100 ug / L), linolenic acid (100 ug / L), myristic acid (100 ug / L), oleic acid (100 ug / L), palmitoleic acid (100 ug / L) , Palmitic acid (100 ug / L), stearic acid (100 ug / L), Tween 80 (22 mg / L), Pluronic F-68 (1000 mg / L), EGF (20 ug / L), FGF (10 ug / L), Y- Prepared by adding 27632 (1 uM), 1% B-27 supplement XenoFree CTS (Invitrogen).

(Cell proliferation step 1)
In primary culture, conditioned culture was performed while adding medium at a rate of 1/3 volume without changing the medium until 7 days of culture. After that, culture was performed while changing the medium every two days. In this medium exchange, the old medium is centrifuged, 2/3 of its volume is discarded, the remaining 1/3 volume of medium and the floating cells precipitated by centrifugation are mixed, and 2/3 volume of new medium is further added to the culture dish. I'm back to. It took 10 days to reach 100% confluence.

(Passage process)
Y-27632 was added at 10 uM concentration to the culture medium of the cultured cells and allowed to stand at 37 ° C. for 30 minutes. Next, the medium was completely removed, and 2 ml / well of 0.05% EDTA / PBS (-) was added and allowed to stand at 37 ° C. for 10 minutes. Furthermore, 0.5 ml / well of TrypLEx Express diluted 5-fold with PBS (−) was added, and the mixture was allowed to stand at 37 ° C. for 5 minutes. Next, the cells were detached from the wells by pipetting. To this, 2.5 ml / well of Trypsin Inhibitor (0.05% / PBS (-)) was added, and the recovered cells were centrifuged. The supernatant was removed, 2.5 ml of Trypsin Inhibitor (0.25% / PBS (-)) was added to suspend the cells, and allowed to stand for 10 minutes. After centrifuging the cells to remove the inhibitor, the cells were suspended in a medium containing 10 uM Y-27632, and seeded in culture dishes on 5 pieces of 6-well plate (CellBind: COSTAR) having a 5-fold area of the original. One week after reaching 100% confluence, it was used as the material of the experiment of the following example.

(Method to increase the expression level of Glial cell-derived neurotrophic factor (GDNF))
The following six possibilities were examined to find compounds or cytokines that increase cellular GLDF (Glial cell-derived neurotrophic factor) mRNA expression. Valproic acid (VA), Platelete-derived growth factor (PDGF), SAG (or Purmorphamine or rh-Sonic Hedgehog (PeproTech)), Bone morphogenic protein 4 (BMP 4) Example 1 in the following combination of these six: The solution was added to the 7 wells. (1) Control (no additive) (2) VA (1 uM) (3) VA (1 uM) + PDGF (10 ng / ml) (4) VA (1 uM) + SAG (0.3 uM) (5) PDGF (10 ng / ml) (6) SAG (0.3 uM) (7) MBP-4 (10 ng / ml): 72 hours after addition, total RNA was extracted from each well by the TRIzol method. Add 0.5ug of each total RNA to the 10μl reaction system of ReverTra Ace qPCR RT Kit using the cDNA synthesis kit for PCR "ReverTra Ace qq RT Kit", and add each cDNA The synthesis was done.
Comparison of GDNF mRNA expression in these cDNA samples by real-time PCR using human GDNF real-time PCR primer set (Roche 5326257) Intercalator assay using ABI PRISM® 7700 from Aply Biosystems I went there. The qRT-PCR reaction was prepared using TOYOBO's SYBR® Green Realtime PCR Master Mix-Plus-.
Preparation of reaction solution
Distilled water 11 μL
SYBR® Green Realtime PCR Master Mix -Plus- 25 μL
Plus solution 5μL
Primer 1 (10 μM) 2 μL
Primer 2 (10 μM) 2 μL
Sample solution 5 μL
Total volume 50 μL
The reaction solution was placed in each well of a 96 well plate to carry out a PCR reaction.
The PCR cycle was a 3-step method, and 40 cycles of (1) to (2) were performed under the conditions of annealing 60 ° C / extension 72 ° C. Melting curve analysis was performed at the last step to confirm that no formation of primer dimer was observed.
95 ° C 60 seconds
(1) ↓
(2) 95 ° C 15 seconds
(3) 60 ° C 15 seconds
(4) 72 ° C 45 seconds (data collection)
At the same time, GAPDH mRNA was detected, and the expression level of GDNF mRNA was corrected as GDNF mRNA / GAPDH mRNA. As a result, (6) only SAG (1) GDNF mRNA expression more than 10 times of control was obtained. In the case of Purmorphamine (1.5 uM) or rh-Sonic Hedgehog (10 ng / ml) instead of SAG of (6), GDNF mRNA expression near 10 times was obtained similarly. (FIG. 1) The primer sequence of GAPDH was synthesized with the following sequence.
Forward primer: ATCTTCTTTTGCGTGCC (SEQ ID NO: 1)
Reverse primer: GATGACAAAGCTTCCCGTTC (SEQ ID NO: 2)
Expression chain length: 250 bp

FIG. 1 is a graph replaced with a drawing showing the measurement results of the expression level of GDNF mRNA in Example 2.

(Expression change of Nestin mRNA by induction of neural differentiation)
Kit for differentiation and identification of neural progenitor cells in 2 wells out of 3 wells that reached confluence in Example 1 7 using the culture medium (medium for NPC differentiation) of Neural Progenitor Cell Functional Identification Kit (R & D Systems SC082) It was cultured for a day. The other well was cultured in the maintenance medium of the invention for the same day. After extracting total RNA similarly to Example 2 on the 7th day, cDNA was prepared. Using this cDNA, the expression comparison of Nestin mRNA, which is a marker for neural stem cells, was measured by RT-PCR with GAPDH mRNA as the ground state. The Primer of Nestin was Forward CGTTGGACAAGAGGTTGGAG (SEQ ID NO: 3) and Reverse TCCTGAAAGCTGAGGGAAG (SEQ ID NO: 4), and the expression chain length was 262 bp. The same GAPDH primer as in Example 2 was used.
The results are shown in FIG.

FIG. 2 is a graph replaced with a drawing showing the expression level of Nestin mRNA in Example 3. As shown in FIG. 2, when changed to the differentiation medium, the expression level of Nestin (Nestin mRNA / GAPDH mRNA) decreased to about 1/7 before differentiation. The results showed that our growth medium maintained neural stem cells, and differentiation medium decreased neural stem cells.

(Expression change of GFAP mRNA by induction of neural differentiation)
Kit for differentiation and identification of neural progenitor cells in 2 wells out of 3 wells that reached confluence in Example 1 7 using the culture medium (medium for NPC differentiation) of Neural Progenitor Cell Functional Identification Kit (R & D Systems SC082) It was cultured for a day. The other well was cultured in the maintenance medium of the invention for the same day. After extracting total RNA similarly to Example 2 on the 7th day, cDNA was prepared. Using this cDNA, the expression comparison of GFAP mRNA, which is a marker of Astrocytes or Adult neural stem cells, was measured by RT-PCR with GAPDH mRNA as the basal state. The GFAP Primer was Forward: ACATCGAGATCGCCCACCTAC (SEQ ID NO: 5) and Reverse: ACATCACATCCTTGTGCTCC (SEQ ID NO: 6), and the expression chain length was 219 bp. The same GAPDH primer as in Example 2 was used. The results are shown in FIG.

FIG. 3 is a graph replaced with a drawing showing the expression level of GFAP mRNA in Example 4. As shown in FIG. 4, the expression level of GFAP (GFAP mRNA / GAPDH mRNA) slightly increased when it was changed to the differentiation medium, compared to before differentiation. The results show that the inventors' growth media maintain neural stem cells and also maintain the expression of GFAP in them.

(CD antigen expression examination by flow cytometry)
The cultured and confluent cells were detached and isolated from culture dishes using trypsin-EDTA solution. Blocking was then performed by placing in a 3% BSA / PBS (-) solution for 30 minutes to prevent nonspecific adsorption. After further fixing for 10 minutes with 4% paraformaldehyde, the cells were incubated at 4 ° C. for 5 minutes in 0.5% Triton X-100 / PBS (-). The cells were incubated at 4 ° C. overnight with the monoclonal antibody CD73-PE (BD 561014) against CD73. The cells were washed 5 times with a washing solution to remove non-bound antibody, and flow cytometry was performed to analyze the expression of the antigen using SONY EC800. The results are shown in FIG.

FIG. 4 is a graph replaced with a drawing showing expression of CD73 (CD expression profile) in Example 5. As shown in FIG. 4, CD13, CD34 and CD45 were negative, indicating that the cells were non-hematologic cells. In addition, CD90 was also negative, indicating that it is not human skin-derived mesenchymal stem cells. In addition, the strong expression of CD73 was the most distinctive feature of CD in this cell.

(Investigation of effect by BBB score method in rat spinal cord injury model)
Cultured cells in which GDNF was not increased by SAG treatment or the like were detached from the culture dish using the enzyme Accutase (GIBCO A11105). The exfoliated cells (1 × 10 ⁵ ) were suspended in 200 ul of culture solution, and one week ago, the spinal cord was injured with a weight and injected and implanted at the site of spinal cord injury in a rat treated with an immunosuppressant. Control rats underwent a sham operation in which only the same amount of culture medium was injected. Five rats were in the cell transplantation group, and four rats in the control group were used for the experiment. The therapeutic effect of spinal cord injury was measured by the BBB Score method in which the movement of the animal was observed with a video device and scored. The results are shown in the figure. In the figure, the horizontal axis shows the number of days after cell transplantation, and the vertical axis shows BBB Score. The solid line shows the result of transplantation of the above cells, the dotted line shows the result of the control, * shows that the result of the significant difference test by Student T test is P <0.05, ** is P <0.01 and *** is P <0.001. Show. From the 3rd day after administration, the cell transplantation group showed a statistically significant effect (P <0.05) with a 2-point difference in BBB Score compared to the control group. After 35 days after transplantation, the cell transplantation group showed a statistically significant effect (P <0.001) with a 4-point difference in BBB Score compared to the control group. In the report of bone marrow stromal cell transplantation (Non-patent Document 23), it takes nearly two weeks until a significant difference is obtained. In addition, it takes three weeks for iPS-derived neural stem cell transplantation (Non-patent Document 1) to produce a significant difference. This result is dramatically faster than these, and the effect from 3 days was seen. Moreover, in the bone marrow stromal cell transplantation, even after 4 weeks, the significant difference was P <0.05, but the present invention was more dominant with P <0.001 at the same time. This result shows that the cells obtained by the present invention are very effective in the treatment of spinal cord injury.

(Evaluation of tumorigenicity)
Animals and Test Methods For the experiments, mice (6 weeks old, rabbit, Central Research Institute for Experimental Animals) having NOD / Shi-scid, IL-2Rγ null (registered trademark) strain were used. After one week of acclimatization period, using a universal grouping system (Visions Co., Ltd.), groups were divided into three groups with the same average weight value as possible, with the right flank of each group of mice. In the same manner as in Example 1 (cultured as cell A), a culture solution as negative control cells, and HeLa S3 (DS Pharma Biomedical Co., Ltd.) as positive control cells were each syringe (Myjector (registered trademark), Needle specifications (27 G) were transplanted (both in 0.2 mL / individual). Let each group be cell A group (10 individuals), culture fluid group (10 individuals), and HeLa S3 group (5 individuals). For cell A, prepare 3 lines of cells cultured in the same manner as in Example 1, suspend each at 1 × 10 ⁷ cells / mL in α-MEM medium, and divide into 2 ml cryotubes so as not to contain air. I ordered. Approximately 3 hours after pipetting, remove the α-MEM medium and resuspend in the culture medium, mix 3 lines in equal numbers of cells to prepare a suspension of 5 × 10 ⁷ cells / mL, and complete transplantation It was stored at 4 ° C., and transplantation was performed within 2 hours after the start of preparation. The survival rate after transplantation of the sample prepared by mixing the three lines measured immediately before was 75%.
The mice in each group are bred 13 weeks after transplantation in accordance with the “Working standard for breeding and management of experimental animals at the Central Research Institute for Experimental Animals of the Public Interest Foundation”, general condition observation, weight measurement and observation of nodules -Size measurement was performed once a week. When observing a nodule, the test substance transplantation site was palpated with a finger, and the formation of a nodule was confirmed when there was a firm feel, and the major diameter (L) and the minor diameter (W) were measured with a caliper. Nodule volume (V) is using the tumor volume simple formula of "nude mice and the anti-cancer agent evaluation" (Noguchi Itarutsugi, Sakurai欽夫, Minoru Inaba written and edited, crab Shobo, June 1991), the calculation formula V = LW ² / Calculated in 2 (in units of mm and mm in diameter, mm ³ in volume). Note that individuals in the HeLaS3 group have 1/10 weight of the body weight (the specific gravity is 1 and the volume is calculated from the volume) during the observation period. Since it was confirmed that it was exceeded, observation was ended as a humanitarian endpoint at weeks 5 to 8, and euthanasia was given.
At the time of euthanasia, the mice were euthanized by total bleeding under isoflurane anesthesia, and the chest and abdominal organs were observed. In addition, the skin at the transplantation site was collected including subcutaneous tissue and fixed with 10% neutral buffered formalin solution. Formalin-fixed specimens were paraffin-embedded, sliced, HE staining, anti-HLA (Human Leucocyte Antigen) immunostaining, and observed with a light microscope in a conventional manner.

Results The results are shown in FIG. FIG. 6 is a graph replacing a drawing showing evaluation of carcinogenicity. In the HeLa S3 group, nodule formation was observed in 100% (5 of 5) individuals at 3 weeks after transplantation, but no nodule formation was observed in the culture fluid group and cell group A until the end of observation The Nodules were formed in all cases in the HeLa S3 group. The nodule was considered to be a tumor derived from HeLa S3 cells, as it showed continuous volume increase and showed anti-HLA reaction together with the histological image of poorly differentiated carcinoma. In the cell group A, histopathological examination confirmed fiber proliferation showing anti-HLA positive in 6/10 cases, and it was judged that the transplanted cells remained. However, no nodule formation was observed in all cases throughout the entire observation period, and no finding of hyperplastic or neoplastic changes was found in the HE staining image in histopathological examination. This result indicates that cell A does not exhibit tumorigenicity under the conditions of this test.

(Evaluation of effects in patients with human spinal cord injury: Effects of GDNF)
Autologous cells were cultured from each autologous skin, and cultured cells that did not increase GDNF using SAG or the like were detached from the culture dishes using the enzyme Accutase (GIBCO A11105). After 1 ml of spinal fluid was collected by lumbar puncture in advance, 1 × 10 ⁷ detached cells suspended in 1 ml of saline for injection were autologously transplanted into the puncture mark. Seven patients with SCI of this case 1 to 7 were 32 to 51 years old, 6 males and 1 female. The administration frequency was 2 to 3 times, and the administration interval was 1 to 3 months. The period from injury to administration was 3 to 23 years, C4 to 7 cervical cord injury and quadriplegia. The side effects were headache and fever on the day of administration. Three out of seven had no therapeutic effect. The other 4 had therapeutic effects, and had subjective symptoms such as arm sweating, cutaneous sensation recovery, urine retention improvement, grip strength improvement, finger movement improvement, etc. Only in case 8 cells were treated with SAG, and cells with increased GDNF mRNA were transplanted. The same number of cells as above was administered twice within one month. The patient of Case 8 was a 47-year-old man with Th3 injury, and the period from injury to administration was 2.5 years, with leg paralysis. Side effects were headaches at the time of administration. The treatment effect appeared one month after administration, and it became possible to stand on foot under assistance. Case 8 was short and two and a half years before administration with leg paralysis and mildness compared to cases 1 to 7, but the effect was dramatic and recovery time was also short.

The present invention can be utilized in the pharmaceutical industry.

Sequence number 1: Primer sequence number 2: Primer sequence number 3: Primer sequence number 4: Primer sequence number 5: Primer sequence number 6: Primer

Claims (8)

1. A method for producing a cultured cell comprising glial cell line-derived neurotrophic factor (GDNF) mRNA and a CD73 protein, comprising a culture step of culturing human skin-derived stem cells in a serum-free medium containing SAG.
2. The method according to claim 1, wherein
   The serum-free medium further comprises either or both of a Parmorphamine (Purmorphamine) and a Sonic hedgehog (SHH) protein.
3. The method according to claim 1, wherein
   The serum-free medium further comprises a B-27 supplement.
4. The method according to claim 1, wherein
   The method wherein the serum-free medium further comprises a ROCK inhibitor.
5. The method according to claim 1, wherein
   The method wherein the serum-free medium further comprises EGF or FGF2.
6. The method according to claim 1, wherein
   The serum-free medium has a calcium ion concentration of not less than 0.03 mM and not more than 0.12 mM.
7. The method according to claim 1, wherein
   The human skin-derived stem cell is a cell obtained by treating collected human skin in the order of dispase treatment, trypsin treatment, and collagenase treatment.
8. Producing a cultured cell using the method according to claim 1;
   A method for producing a therapeutic agent for spinal cord injury, comprising any one or two or more of the cultured cells, the culture medium obtained in the culture step, and the secretion obtained in the culture step.
   
   
   

Images