WO2019083972A1

WO2019083972A1 - Products and methods of producing improved drinking water and micro-rna compositions

Info

Publication number: WO2019083972A1
Application number: PCT/US2018/057059
Authority: WO
Inventors: Brandie Gowey
Original assignee: Gowey Research Group PLLC
Priority date: 2017-10-23
Filing date: 2018-10-23
Publication date: 2019-05-02

Abstract

Methods and compositions of improved drinking water that can treat inflammation, repair DNA damage, and regulate cancer suppression. A method of producing improved drinking water involves obtaining processed water, and adding magnesium, a culture of live bacteria, microRNA-486-5p, or a combination thereof to the processed water. Thus, a drinking water product contains processed water with magnesium, bacteria, miRNA-486-5p, or a combination thereof.

Description

PRODUCTS AND METHODS OF PRODUCING IMPROVED DRINKING WATER AND

MICRO-RNA COMPOSITIONS

CROSS REFERENCE

[0001] This application claims benefit of U.S. Patent Application No. 15/791 ,127 filed October 23, 2017 and U.S. Patent Application No. 15/791 , 147 filed October 23, 2017, the specification(s) of which is/are incorporated herein in their entirety by reference.

REFERENCE TO SEQUENCE LISTING

[0002] Applicant asserts that the information recorded in the form of an Annex C/ST.25 text file submitted under Rule 13fer.1 (a), entitled GOWB_16_03_PCT_Sequence_ST25, is identical to that forming part of the international application as filed. The content of the sequence listing is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

[0003] The present invention relates to drinking water that can improve health, namely drinking water with minerals, microRNAs, bacteria, or a combination thereof. The present invention also features compositions of microRNA and glutathione for DNA damage repair.

BACKGROUND OF THE INVENTION

[0004] Water is essential to the health of all living creatures. Typically, water undergoes purification treatments in order to be potable and deemed safe for human consumption. Examples of such treatments include, but are not limited to, distillation, filtration, irradiation, ozonation, chlorination, and reverse osmosis. While these treatments are intended to remove harmful microorganisms, metals, chemicals, and other contaminants, they can also remove beneficial minerals and bacteria as well as affect the taste of the water or even produce undesirable by-products. In some instances, purified drinking water can have an adverse affect on health; for example, reverse osmosis and distilled water can strip the body of essential minerals.

[0005] MicroRNAs (miRNA) are small non-coding RNA molecules that contain nucleotides. MiRNA are found in plants, animals and some viruses, and have varying purposes known throughout the literature. For example, miRNA can function in RNA silencing and post-transcriptional regulation of gene expression. Their role in regulation of gene and protein expression has led researchers to study miRNA for their potential in identification and resolution of disease states. There are nearly 2000 identified miRNA in the human genome, and as such, they have very complex interactions to maintain proper gene and protein function.

[0006] Conventional medicine describes diseases as a manifestation of biological dysfunctions in the body. Disease states tend to be caused by low DNA repair and imbalances of miRNA profiles, with miRNA being too high or too low relative to normal controls. For example, miRNAs that tend to be high in cancer include miRNA-7, miRNA- 10, and miRNA-30, whereas a miRNA that tends to be low in inflammatory conditions is miRNA-486, which is needed to regulate DNA repair. In some instances, consistent rising or improper regulation of NFKB (nuclear factor kappa-light-chain-enhancer of activated B cells) may be a contributing factor for cancer and/or inflammatory conditions. Hence, a person's DNA requires particular nutrients in order to repair damage, maintain health, and to be free of disease in the body. The present invention feature methods and compositions of improved drinking water that can treat inflammation, repair DNA damage, and regulate cancer suppression.

[0007] Any feature or combination of features described herein are included within the scope of the present invention provided that the features included in any such combination are not mutually inconsistent as will be apparent from the context, this specification, and the knowledge of one of ordinary skill in the art. Additional advantages and aspects of the present invention are apparent in the following detailed description and claims.

SU M MARY OF THE INVENTION

[0008] It is an objective of the present invention to provide methods of producing drinking water and the products thereof. In some aspects, a method of producing improved drinking water may comprise obtaining processed water, and adding magnesium, a culture of live bacteria, microRNA-486-5p, or a combination thereof to said processed water. Thus, the present invention includes a drinking water product comprising processed water with magnesium, bacteria, miRNA-486-5p, or a combination thereof. In other aspects, the present invention further provides methods and products comprising bacteria added to a carrier substrate for oral consumption. [0009] One of the unique and inventive technical features of the present invention is the addition of magnesium , bacteria, and/or miRNA-486-5p to processed water. Without wishing to limit the invention to any theory or mechanism, it is believed that the technical feature of the present invention can advantageously provide essential m inerals, bacteria, and mi-RNAs to treat or prevent inflammatory processes and DNA damage that could lead to disease. None of the presently known prior references or work has the unique inventive technical feature of the present invention.

[0010] In further embodiments, the present invention features compositions comprising microRNA(miR)-486 and glutathione, said composition referred to herein as Sarravis. Without wishing to lim it the invention to any theory or mechanism, it is believed that the Sarravis composition may be used in methods to repair DNA damage.

BRIEF DESCRIPTION OF THE DRAWINGS

[0011] The features and advantages of the present invention will become apparent from a consideration of the following detailed description presented in connection with the accompanying drawings in which:

[0012] FIG. 1 shows microRNA profiles of bacteria found in distilled water and conventional bottled water, which both lack miR-486.

[0013] FIG. 2A shows m icroRNA profiles of patients that have extremely high levels of miR-1 0, miR-7, and miR-30, which are m iRNAs that regulate endothelium and p53. Furthermore, the miRNA trends show that these patients have extremely low levels of miR-486. UNR2 is a patient with prostate cancer; UNR4 is a patient with osteoarthritis spine fusion; UNR5 is a patient with Epstein-Barr virus; and UNR15 is a patient with chronic clots and anem ia.

[0014] FIG. 2B shows a microRNA profile for a subject that drank water without bacteria and another m icroRNA profile for the same subject that drank water with bacteria comprising deltaproteobacteria and nitrospirae bacteria.

[0015] FIG. 3 is a graph of how magnesium affects NFKB activity in a 0.1 -3 mM range of Mg concentration, Con = control treatment with 10mM Mg, LPS = positive control of LPS that is known to increase NFKB activity.

[0016] FIG. 4A shows a bacterial count for an ozonated water sample.

[0017] FIG. 4B shows a bacterial count for a non-ozonated water sample.

[0018] FIG. 5A shows lab results for a patient with Addison's disease that consumed water without bacteria. The ACTH and C-Reactive protein results deviated from reference intervals.

[0019] FIG. 5B shows lab results for the same patient after consuming water with bacteria comprising Deltaproteobacteria and Nitrospirae bacteria. The ACTH and C- Reactive protein results shifted within the reference intervals.

DESCRIPTION OF PREFERRED EMBODIMENTS

[0020] As used herein, the term "processed water" refers to water that has undergone human interaction or treatment and is safe for drinking, consumption and food preparation. Non-limiting examples of processed water includes municipal water or tap water, purified water, and bottled water. Typically, the processed water has undergone treatments that remove minerals and bacteria from the water, such as filtering, reverse osmosis, and disinfection.

[0021] As used herein, the terms "microRNA" and "miRNA" and any derivative thereof may be used interchangeably.

[0022] As used herein, the terms "administering" or "administer" is defined as the introduction of a substance (composition) into cells in vitro or into the body of an individual in vivo and includes any route of administration, including but not limited to parenteral administration such as subcutaneous, intramuscular, and intravenous.

[0023] As defined herein, the terms "treating" or "treatment" of a condition includes: (1 ) preventing the condition, i.e., causing the clinical symptoms of the condition not to develop in a mammal that may be exposed to or predisposed to the condition but does not yet experience or display symptoms of the condition; (2) inhibiting the condition, i.e., arresting or reducing the development of the condition or its clinical symptoms; or (3) ameliorating or relieving the condition, i.e. , causing regression of the condition or its clinical symptoms. As used herein, the terms "treat" or "treatment" refer to both therapeutic treatment or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented or onset delayed. Optionally, the patient may be identified (e.g., diagnosed) as one suffering from the disease or condition prior to administration of the composition of the invention.

[0024] As used herein, the term "therapeutically effective amount" refers to an amount of a compound, i.e. the composition, effective to treat a condition, disease or disorder in a subject, or reduce (i.e., slow to some extent and preferably stop) and/or relieve, to some extent, one or more of the symptoms associated with a disorder or disease. The "therapeutically effective amount" will vary depending on the compound, the condition and its severity and body factors such as age, weight, etc., of the subject to be treated.

[0025] A "subject" is an individual and includes, but is not limited to, a mammal (e.g., a human, horse, pig, rabbit, dog, sheep, goat, non-human primate, cow, cat, guinea pig, or rodent), a fish, a bird, a reptile or an amphibian. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be included. A "patient" is a subject afflicted with a disease or disorder. The term "patient" includes human and veterinary subjects.

[0026] As used herein, the terms "those defined above" and "those defined herein" when referring to a variable incorporates by reference the broad definition of the variable as well as any narrow and/or preferred, more preferred and most preferred definitions, if any.

[0027] According to some embodiments, the present invention features a method of producing improved drinking water. In one embodiment, the method may comprise obtaining processed water, adding magnesium to said processed water, and adding a culture of live bacteria to said processed water. According to other embodiments, the present invention may feature a drinking water product comprising processed water to which has been added at least about 10 mg/L of magnesium and a culture of live bacteria. Without wishing to limit the present invention, it is believed that the drinking water contains microRNA that may originate from bacteria added to the processed water. Thus, the drinking water may contain miRNAs, such as miRNA-486-5p which has a sequence UCCUGUACUGAGCUGCCCCGAG (SEQ ID NO: 1 ).

[0028] As used herein, the live culture may comprise live bacteria. In a non-limiting embodiment, the culture may be in liquid form, freeze-dried, or powdered form. In an example embodiment, the live culture is added to the processed water and mixed to release the bacteria into the water. In some embodiments, the live culture is added to the water in specific amounts that achieves a desired number of colony forming units (CFU) per volume.

[0029] In preferred embodiments, the live bacteria culture may comprise sulfur-fixing bacteria and nitrogen fixing bacteria. In other preferred embodiments, the bacteria may be swamp and bog bacteria. In some embodiments, the live bacteria culture may comprise Deltaproteobacteria bacteria and Nitrospirae bacteria. Non-limiting examples of Deltaproteobacteria bacteria include Bdellovibrio, Desulfovibrio, Desulfobacter, Desulfococcus, Desulfonema, Desulfuromonas, Geobacter, Myxobacteria spp. Non- limiting examples of Nitrospirae bacteria include Nitrospira spp.

[0030] In some embodiments, the live bacteria culture may comprise bacteria in the following phylum: Acidobacteria, Actinobacteria, Armatimonadetes, Bacteroidetes, Cyanobacteria, Firmicutes, Plactomycetes, Proteobacteria, and Verrucomicrobia. In other embodiments, the live bacteria culture may comprise bacteria in the following class: Actinobacteria, Alphaproteobacteria, Bacilli, Betaproteobacteria, Chloroplast, Fimbriimonadia, Flavobactehia, Gammaproteobacteria, Opitutae, Plactomycetacia, and Sphingobateriia.

[0031] In other embodiments, the bacteria culture may comprise bacteria in the following genera: Acinetobacter, Aquabacterium, Bdellovibrio, Bifidobacterium, Bosea, Bradyrhizobium, Brevundimonas, Caulobacter, Cellvibrio, Ferruginibacter, Flavobacterium, Fluviicola, Frigoribacterium, Fusicatenibacter, Herminiimonas, Hydrogenophaga, Lachnoclostridium, Limnobacter, Limnohabitans, Mycobaterium, Nannocystis, Nitrospira, Nordella, Opitutus, Parvibaculum, Pedobacter, Pedomicrobium, Phenylobacterium, Phreatobacter, Pirellula, Planctomyces, Reyranella, Rhizobium, Sediminibacterium, Sorangium, Sphingomonas, Sphingopyxis, Stenotrophobacter, Turicella, Variibacter, and Woodsholea. [0032] In one embodiment, the live bacteria culture may be added to said processed water such that the drinking water contains at least about 500 colony forming units (CFUym l overall. For example, the drinking water may contain at least about 500 CFU/ml of Deltaproteobacteria bacteria and Nitrospirae bacteria. In another embodiment, the processed water may contain at least about 700 CFU/ml of overall bacteria. In yet another embodiment, the processed water may contain more than about 1000 CFU/ml of overall bacteria. For example, as shown in FIG. 4B, the drinking water may have an aerobic plate count of 32,000 CFU/g. Standards established United States Pharmacopeia (USP) for drinking water set a maximum of 500 CFU/ml in drinking water. However, the present invention has surprisingly found that drinking water with at least about 500 CFU/ml of Deltaproteobacteria bacteria and Nitrospirae bacteria can provide miRNAs that promote healing. Further still, another important feature shown in FIG. 4B is that levels of harmful microbes, such as Enterobacteriaceae, Pseudomonas spp., Salmonella, Staphylococcus aureus, yeast and mold, and Escherichia coli and coliforms are well below industry standards.

[0033] In some embodiment, the concentration of magnesium in the drinking water is at least about 10 mg/L. In other embodiments, the concentration of magnesium is about 12 mg/L. In still other embodiments, the concentration of magnesium may be about 10-15 mg/L. In further embodiments, the maximum concentration of magnesium is about 100 mg/L. As shown in FIG. 3, there is a clear effect that higher concentrations of magnesium can decrease N FKB activity. N FKB is considered a prototypical proinflammatory signaling pathway, thus, suppression of NFkB may be desirable for treating inflammation. However, high concentrations of magnesium may cause side effects such as upset stomach, nausea, vomiting, and diarrhea. Without wishing to limit the present invention, the present invention has found that a concentration of range of about 10-15 mg/L magnesium may be critical in shifting and decreasing N FKB activity while preventing unwanted side effects.

[0034] When people are sick, there is an overall elevation in microRNA which reflects inflammation in the endothelium. When studying the profile to see how overactive the endothelium is, miR-10, miR-7, and miR-30 are typically high and miR-486 is low for those who are sick relative to symptom free subjects as shown in FIG. 2A. Without wishing to limit the present invention to a particular theory or mechanism, since the body is primarily made up of water, the drinking water of the present invention can treat or prevent disease states by delivering magnesium and bacteria, which can increase the levels of miR-486.

[0035] Again, without wishing to limit the invention to a particular theory or mechanism, the drinking water of the present invention may stabilize an overactive endothelium because of its magnesium content as well as miRNA content from the bacteria, thus promoting healing responses. The bacteria and magnesium can change the water molecule structure and "program" the water to be endothelial protecting and DNA damage response enhancing (DDR), which are two factors that are required for water to be healing. For example, magnesium is vital for regulating endothelial functions, and as soon as magnesium levels drop, inflammation is signaled via endothelial DNA cells. In addition, magnesium can impact p53 levels by stabilizing the structure of p53, which is a tumor suppressor protein that plays a significant role in apoptosis, and enhance its affinity to DNA to preserve genomic stability.

[0036] Further still, miRNAs, particularly miR-486, from the bacteria may alleviate inflammation by down regulating or inactivating the NFKB signaling pathways. Referring to FIG. 2B, consuming the drinking water with bacteria can increase miR-486-5p levels which can down regulate NFKB. AS another example, FIGs. 5A shows pre-lab results for a patient with Addison's disease, which is a disorder caused by insufficient amounts of certain hormones produced by the adrenal glands. The patient drank water without bacteria. The adrenocorticotropic hormone (ACTH) level is low and the C-Reactive protein, which is an inflammatory marker, is high. Referring to FIG. 5B, after the patient has drank water with bacteria, the ACTH level has risen into its reference interval and the C-Reactive protein has decreased into its reference interval.

[0037] According to another embodiment, the method of producing improved drinking water may comprise obtaining processed water, and adding at least about 10 mg/L of magnesium to said processed water. In some embodiments, the method may further comprise adding at least about 0.001 nmol/ml of miR-486-5p to the processed water. Thus, the present invention also provides a drinking water product comprising processed water and at least about 10 mg/L of magnesium. The drinking water product may further comprise at least about 0.001 nmol/ml of miR-486-5p. Without wishing to limit the present invention, the miR-486-5p content can augment the magnesium activity in the drinking water.

[0038] In some embodiments, the present invention also includes another method of producing improved drinking water comprising obtaining processed water, and adding at least about 0.001 nmol/ml of miR-486-5p to said processed water. In accordance with this embodiment, the drinking water product comprises processed water and at least about 0.001 nmol/ml of miR-486-5p.

[0039] In other embodiments, the present invention further includes a method of producing improved drinking water comprising obtaining processed water, and adding a culture of live bacteria to said processed water. In a preferred embodiment, the bacteria may comprise Deltaproteobacteria bacteria and Nitrospirae bacteria. A drinking water product of the present invention may comprise processed water and a culture of live bacteria comprising Deltaproteobacteria bacteria and Nitrospirae bacteria. In another preferred embodiment, the drinking water contains at least about 500 CFU/ml of overall bacteria. Magnesium may be optionally added in quantities of at least about 10 mg/L, for example, in quantities of 10-12 mg/L.

[0040] In a preferred embodiment, the present invention features a method of producing improved drinking water comprising obtaining processed water sourced from Polar, Wisconsin, and minimally ozonating said processed water with a maximum treatment of 0.1 mg/L of ozone. In a more preferred embodiment, the present invention features a method of producing improved drinking water comprising obtaining processed water sourced from Polar, Wisconsin, and bottling said processed water absent of any disinfectant treatment. For example, the processed water from Polar, Wisconsin is bottled without being ozonated. Without wishing to limit the present invention, the bacteria count is maintained or minimally reduced by not ozonating or minimally ozonating the processed water. For example, the step of not ozonating or minimally ozonating can maintain at least about 500 CFU/ml of Deltaproteobacteria bacteria and Nitrospirae bacteria. FIGs. 4A and 4B show the bacteria count for ozonated and non- ozonated water, respectively.

[0041] Consistent with the embodiments described herein, the potable drinking water is preferably obtained from Langlade Springs, LLC, which a distributor of mineral spring water and located at W6933 State Hwy. 64, Polar, Wl 54418. However, in some embodiments, the present invention is not limited to water sourced from Langlade Springs, LLC.

[0042] In other embodiments, the present invention may include oral compositions not limited to drinking water. In one embodiment, the oral composition is thus comprises a culture of live bacteria in a carrier substrate. In another embodiment, the invention features a method of producing a medicine or supplement for oral consumption comprising adding a culture of live bacteria to a carrier substrate. In some embodiments, the live bacteria culture may comprise Deltaproteobacteria bacteria and Nitrospirae bacteria. Without wishing to limit the present invention, the present invention advantageously provides oral compositions comprising Deltaproteobacteria bacteria and Nitrospirae bacteria that contain miRNAs, particularly miRNA-486-5p. To the knowledge of the inventor, none of the presently known prior works have oral compositions of Deltaproteobacteria bacteria and Nitrospirae bacteria.

[0043] In preferred embodiments, the oral composition may comprise at least about 500 CFU/unit dose of bacteria overall. In some embodiments, the oral composition may comprise at least about 10 billion CFU/unit dose of bacteria, or at least about 25 billion CFU/unit dose of bacteria, or at least about 50 billion CFU/unit dose of bacteria, or at least about 100 billion CFU/unit dose of bacteria. As used herein, a unit dose refers to the live culture of bacteria in a particular configuration (such as a capsule, for example), and portioned into a particular dose. In some embodiments, a unit dose may be portioned into 1 -5 sprays, 1 -5 tablets or capsules, 1 -5 lozenges, or fluid volumes such as 5-30 ml.

[0044] In some embodiments, examples of the carrier substrate include, but are not limited to, a consumable liquid, water, a base oil such as olive oil, avocado oil, or hemp seed oil, a gel, aloe vera gel, a protein base, a sealed capsule, a gelatin or vegetarian capsule. Based on the type of carrier substrate, the oral composition may be in a form of a liquid, a tablet, a capsule, a lozenge, an oral tincture, or a spray.

[0045] SARRAVIS COMPOSITIONS

[0046] As used herein, the term "Sarravis" refers to a composition comprising miR-486- 5p (miR-486) and glutathione. [0047] According to some embodiments, the present invention features a composition for repairing DNA damage. In one embodiment, the composition may comprise at least about 0.001 nmol/ml of microRNA(miR)-486, and at least 0.001 % wt/vol of glutathione. In other embodiments, the Sarravis composition may comprise at least 0.05 nmol/ml of miR-486 and at least 0.01 mg/ml of glutathione. In preferred embodiments, the composition may be in a suitable form for parenteral administration, such as an injectable solution or an intravenous solution.

[0048] According to other embodiments, the present invention also features a method for treating inflammation in a subject in need of such treatment. The method may comprise administering to the subject a therapeutically-effective amount of the Sarravis compositions described herein. In some embodiments, the composition may be administered subcutaneously, intravenously or intramuscularly.

[0049] In some embodiments, miR-486 may be derived from plant or non-human animal sources or synthetically prepared. For example, the miR-486 may be derived from turmeric, Sarracenia species or hybrids thereof, or a non-human animal source. In other embodiments, the miR-486 is a synthetic miR-486. Examples of non-human animals from which the miRNA profiles can be obtained from include, but are not limited to, cows, birds, fish, reptiles, insects, and amphibians.

[0050] In some embodiments, the Sarravis composition may be effective for modulating microRNA levels when administered to the subject. In some preferred embodiments, the Sarravis composition may be administered by subcutaneous or intramuscular injection at, near, or above the spine of the subject. Without wishing to limit the invention to a particular theory, administering the composition near or above the spine was found to be a more effective mechanism of stimulating genome shift to treat systemic diseases. For example, the Sarravis composition may be administered near the spine to facilitate DNA damage repair and stop tumor growth. Furthermore, the spine injections may be impacting the mitochondria. Without wishing to limit the invention to a particular theory, it was discovered that miR-486 (miR-486-5p) is effecting for DNA damage repair. Alternatively or in conjunction, the Sarrravis composition may be administered by IV treatment or injected into or near joints in the extremities to treat injuries.

[0051] Without wishing to limit the invention to a particular theory or mechanism, the Sarravis composition can aid in the upregulation of other medicines. For example, a composition of the present invention may be used in combination with a drug in order to increase an effective intracellular concentration of the drug, or increase bioavailability, or increase tissue penetration of the drug. In some non-limiting embodiments, the Sarravis composition may be used in conjunction with cancer drugs, or with drugs for any deleterious condition, including, but not limited to, diabetes or autoimmune diseases, in order to enhance the drugs' efficiency. In other embodiments, the Sarravis composition may be administered by spine injections in conjunction with oral use of the other drugs and/or an injectable of the drug is mixed with Sarravis for spine injections.

[0052] CASE STUDIES

[0053] The following are non-limiting examples of patients that were treated using the Sarravis compositions and methods. These examples are presented for illustrative purposes only, and are in no way intended to limit the present invention. Equivalents or substitutes are within the scope of the invention.

[0054] EXAMPLE 1 : Inflammation

[0055] A 27-year old female patient has been experiencing pain in her big toe for about a year. The patient received a spine injection of a Sarravis composition. She experienced pain in her left foot, which went away, and she no longer has pain her foot. She was able to hike and run after the treatment.

[0056] EXAMPLE 2: Peripheral Neuropathy

[0057] A 56-year old male patient had peripheral neuropathy caused by interferon injections that he received years ago. His doctor administered a spinal injection of 15 cc (5 of 3 cc syringes) of the Sarravis. He further received 4 more rounds of the Sarravis spinal injection treatment. After completion of the treatments, the neuropathy was gone.

[0058] EXAMPLE 3: Liver Cancer

[0059] As shown in Table 1 , progression of the liver cancer ceased after receiving Sarravis spine injections.

[0060] TABLE 1. Tracking a history of a patient with liver cancer.

Negative for cholelithiasis.

10/21 /2016 Large masses in the liver similar to the previous study. No new abnormality.

02/01 /2017 Stable large hepatic masses consistent with the provided history of cancer. No new findings.

[0061] EXAMPLE 4: Female patient was administered spine injections of Sarravis. Hemoglobin A1 c Reference: 4.8-5.6%. Pre-diabetes: Hemoglobin A1 c = 5.7-6.4%. Pre lab result 5/17/2017: Hemoglobin A1 c = 6.0%, above high normal. Post lab result 07/20/2017: Hemoglobin A1 c = 5.7%. Post lab result 09/1 1/2017: Hemoglobin A1 c = 5.6%. Note that Hemoglobin A1 c decreased to normal levels within 4 months, which usually does not heal quickly and would normally take months to years with diet changes alone.

[0062] EXAMPLE 5: TABLE 2A shows pre lab results and TABLE 2B-2C show post lab progression results for another patient with diabetes and E. coli who was administered spine injections of Sarravis.

[0063] TABLE 2A. Pre Lab Results collected 07/19/2017.

CFU/mL

[0064] TABLE 2B. Post Lab Results collected 08/18/2017.

[0065] TABLE 2C. Post Lab Results collected 09/01 /2017.

[0066] As used herein, the term "about" refers to ±10% of the referenced number.

[0067] Various modifications of the invention, in addition to those described herein, will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. Each reference cited in the present application is incorporated herein by reference in its entirety.

[0068] Although there has been shown and described the preferred embodiment of the present invention, it will be readily apparent to those skilled in the art that modifications may be made thereto which do not exceed the scope of the appended claims. Therefore, the scope of the invention is only to be limited by the following claims. Reference numbers recited in the claims are exemplary and for ease of review by the patent office only, and are not limiting in any way. In some embodiments, the figures presented in this patent application are drawn to scale, including the angles, ratios of dimensions, etc. In some embodiments, the figures are representative only and the claims are not limited by the dimensions of the figures. In some embodiments, descriptions of the inventions described herein using the phrase "comprising" includes embodiments that could be described as "consisting of , and as such the written description requirement for claiming one or more embodiments of the present invention using the phrase "consisting of" is met.

Claims

WHAT IS CLAIMED IS:

1. A method of producing improved drinking water comprising:

a. obtaining processed water;

b. adding at least about 10 mg/L of magnesium to said processed water; and c. adding a culture of live bacteria to said processed water, wherein the live bacteria culture comprises Deltaproteobacteria bacteria and Nitrospirae bacteria.

2. The method of claim 1 , wherein the concentration of magnesium is about 12 mg/L.

3. The method of claim 1 , wherein the live bacteria culture is added to said processed water such that the drinking water contains at least about 500 colony forming units (CFU)/ml overall.

4. A drinking water product comprising processed water to which has been added at least about 10 mg/L of magnesium and a culture of live bacteria comprising Deltaproteobacteria bacteria and Nitrospirae bacteria.

5. The drinking water product of claim 4, wherein the concentration of magnesium is about 12 mg/L.

6. The drinking water product of claim 4 comprising at least about 500 colony forming units (CFU)/ml of bacteria overall.

7. A method of producing improved drinking water comprising:

a. obtaining processed water; and

b. adding at least about 10 mg/L of magnesium to said processed water.

8. The method of claim 7, wherein the concentration of magnesium is about 12 mg/L.

9. The method of claim 7 further comprising adding at least about 0.001 nmol/ml of miR-486-5p.

10. A drinking water product comprising processed water to which has been added at least about 10 mg/L of magnesium.

1 1 . The drinking water product of claim 10, further comprising adding at least about

0.001 nmol/ml of miR-486-5p.

12. A method of producing improved drinking water comprising:

a. obtaining processed water; and

b. adding a culture of live bacteria to said processed water, wherein the live bacteria culture comprises Deltaproteobacteria bacteria and Nitrospirae bacteria.

13. The method of claim 12, wherein the live bacteria culture is added to said processed water such that the drinking water contains at least about 500 colony forming units (CFU)/ml overall.

14. The method of claim 12 further comprising adding at least about 10 mg/L of magnesium.

15. A drinking water product comprising processed water to which has been added a culture of live bacteria comprising Deltaproteobacteria bacteria and Nitrospirae bacteria.

16. The drinking water product of claim 15 comprising at least about 500 colony forming units (CFU)/ml of bacteria overall.

17. A method of producing improved drinking water comprising:

a. obtaining processed water sourced from Polar, Wisconsin; and

b. minimally ozonating said processed water with a maximum treatment of 0.1 mg/L of ozone to maintain at least about 500 colony forming units (CFUyrnl of Deltaproteobacteria bacteria and Nitrospirae bacteria.

18. A method of producing improved drinking water comprising:

a. obtaining processed water sourced from Polar, Wisconsin; and

b. bottling said processed water absent of any disinfectant treatment to maintain at least about 500 colony forming units (CFU)/ml of Deltaproteobacteria bacteria and Nitrospirae bacteria.

19. The method of claim 18, wherein the processed water is bottled without being ozonated.

20. An oral composition comprising a culture of live bacteria in a carrier substrate, wherein the live bacteria culture comprises Deltaproteobacteria bacteria and Nitrospirae bacteria.

21 . The composition of claim 20, wherein the live bacteria culture comprises at least about 500 colony forming units (CFU)/ml of bacteria.

22. The composition of claim 20, wherein the oral composition is in a form of a liquid, a tablet, a capsule, a lozenge, an oral tincture, or a spray.

23. A method of producing a medicine or supplement for oral consumption comprising adding a culture of live bacteria to a carrier substrate, wherein the live bacteria culture comprises Deltaproteobacteria bacteria and Nitrospirae bacteria.

24. The method of claim 23, wherein the medicine or supplement comprises at least about 500 colony forming units (CFU)/ml of bacteria overall.

25. The method of claim 23, wherein the medicine or supplement is in a form of a liquid, a tablet, a capsule, a lozenge, an oral tincture, or a spray.

26. A composition for repairing DNA damage, said composition comprising at least about 0.001 nmol/ml of microRNA(miR)-486, and at least about 0.001 % wt/vol glutathione, wherein the composition is configured for intravenous, intramuscular, or subcutaneous administration.

27. The composition of claim 26, wherein the miR-486 is a synthetic miR-486, or derived from turmeric, Sarracenia flava, Sarracenia purpurea, or hybrids thereof, or derived from a non-human animal.

28. The composition of claim 26, wherein the composition is formulated into an injectable solution or an intravenous solution.

29. A method for repairing DNA damage in a subject in need of such treatment, said method comprising parenterally administering to the subject a therapeutically- effective amount of a composition comprising at least about 0.001 nmol/ml of microRNA(miR)-486, and at least about 0.001 % wt/vol glutathione.