WO2019083333A1 - Tm4sf5 단백질의 발현 변화를 이용한 간질환의 진단방법 및 간질환 치료제 스크리닝 방법 - Google Patents

Tm4sf5 단백질의 발현 변화를 이용한 간질환의 진단방법 및 간질환 치료제 스크리닝 방법

Info

Publication number
WO2019083333A1
WO2019083333A1 PCT/KR2018/012860 KR2018012860W WO2019083333A1 WO 2019083333 A1 WO2019083333 A1 WO 2019083333A1 KR 2018012860 W KR2018012860 W KR 2018012860W WO 2019083333 A1 WO2019083333 A1 WO 2019083333A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
tm4sf5
expression
liver
laminin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2018/012860
Other languages
English (en)
French (fr)
Inventor
이정원
류지혜
정재우
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SNU R&DB Foundation
Original Assignee
Seoul National University R&DB Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seoul National University R&DB Foundation filed Critical Seoul National University R&DB Foundation
Priority to US16/758,016 priority Critical patent/US20210190799A1/en
Publication of WO2019083333A1 publication Critical patent/WO2019083333A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6872Intracellular protein regulatory factors and their receptors, e.g. including ion channels
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027New or modified breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • A01K67/0276Knock-out vertebrates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/052Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/07Animals genetically altered by homologous recombination
    • A01K2217/075Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/15Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/03Animal model, e.g. for test or diseases
    • A01K2267/035Animal model for multifactorial diseases
    • A01K2267/0362Animal model for lipid/glucose metabolism, e.g. obesity, type-2 diabetes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/136Screening for pharmacological compounds
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/475Assays involving growth factors
    • G01N2333/495Transforming growth factor [TGF]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/52Assays involving cytokines
    • G01N2333/521Chemokines
    • G01N2333/523Beta-chemokines, e.g. RANTES, I-309/TCA-3, MIP-1alpha, MIP-1beta/ACT-2/LD78/SCIF, MCP-1/MCAF, MCP-2, MCP-3, LDCF-1or LDCF-2
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/52Assays involving cytokines
    • G01N2333/525Tumor necrosis factor [TNF]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/52Assays involving cytokines
    • G01N2333/54Interleukins [IL]
    • G01N2333/5412IL-6
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/78Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/81Protease inhibitors
    • G01N2333/8107Endopeptidase (E.C. 3.4.21-99) inhibitors
    • G01N2333/8146Metalloprotease (E.C. 3.4.24) inhibitors, e.g. tissue inhibitor of metallo proteinase, TIMP
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2440/00Post-translational modifications [PTMs] in chemical analysis of biological material
    • G01N2440/14Post-translational modifications [PTMs] in chemical analysis of biological material phosphorylation
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/08Hepato-biliairy disorders other than hepatitis
    • G01N2800/085Liver diseases, e.g. portal hypertension, fibrosis, cirrhosis, bilirubin

Definitions

  • Liver is the metabolism of lipids in our body. decoding. Excretion of bile, storage of various nutrients, hematopoiesis, blood coagulation, and control of circulating blood volume. Thus, when a liver failure occurs, various functions are deteriorated, and in the worst case, maintenance of life becomes difficult.
  • hepatocytes are liable to be damaged in this process because they decode drugs, alcohol, and toxic substances in the liver. Thus, liver disease caused by drugs, poisons or alcohol can be common.
  • the liver has a function of excretion of various metabolites into the twelve joints, and immunity function, which is important for life maintenance.
  • Liver disease can be divided into viral liver disease, alcoholic liver disease, drug toxic liver disease, fatty liver, autoimmune liver disease, metabolic liver disease and others, depending on the cause. Since liver disease is not found in the early stages of the disease, there is no initial awareness, so it is the cause of death worldwide as well as Korea and Japan. Therefore, There is a need for studies on the diagnosis and treatment of these disorders.
  • hepatic stellate cells When stimulated by simple alcohol, virus, and harmful environmental factors, hepatic stellate cells are activated and secrete various cytokines including TGFP (transforming growth factor beta).
  • TGFp is a cytokine that is known to play an important role in development and carcinogenesis. TGFp receptor phosphorylates and activates intracellular Smad2 / 3 protein by binding to Smad4 and then into the nucleus by activated TGFP. Promote warriors.
  • TGFP1 proteins whose expression is regulated by TGFP1 are associated with the induction of fatty liver and hepatitis.
  • metabolic functions are abnormally regulated through changes in the expression of proteins that are expressed by TGF-31, excessive intake of nutrients such as carbohydrates, fats, or proteins (including amino acids) It is regulated to improve the expression of enzymes and proteins involved in the signal transduction and uptake of fat, accumulating fat in the liver epithelium, leading to steatosis, and further inflammation leading to steatohepatitis It is known to be able to.
  • Fatty biosynthesis-related enzymes or signaling proteins or factors include Srebpl, Srebp2. Fasn, Ppar [alpha], Ppar [gamma], Leptin, Acc [alpha], AccP. Sirtl, Sir15, SiRt6, insulin. Or glucose, and the enzymes involved in the absorption and accumulation of fat
  • the white matter or factors are CD36.
  • TGFP stimulates collagen synthesis, inducing hepatic fibrosis, and affecting not only the hepatic stellate cells themselves but also the surrounding hepatocytes, causing EMTCepithelial to mesenchymal transition. Understanding the process of liver fibrosis is necessary for the treatment of cirrhosis because liver cirrhosis will eventually lead to liver cirrhosis.
  • Inflammation causes a lot of cytokines such as TGFP1. Hepatic stellate cells and other hepatocytes are activated by secreted cytochalas and collagen I. fibronectin. And laminin, which accumulate outside the cell. In this case, the amount of mRNA and protein of the inflammatory-related factors, MCP1 or F4 / 80 antigen, may increase, and tissue damage, disorder of cell arrangement pattern, or accumulation of collagen I or laminin synthesis Can be seen.
  • Alcoholic liver damage is caused by the alcohol itself or by compounds that are produced in the metabolic process of alcohol, which causes lipid accumulation. Resulting in hepatocyte injury and sexual arousal. Also.
  • Chronic hepatitis B Hepatocytes are damaged by various causes such as chronic hepatitis C, chronic autoimmune disease, chronic biliary disease, chronic heart disease, parasitic layer, Kupffer cells.
  • Various cytokines and active oxygen are produced by the interaction of various cells such as sinusoidal endothelial cells and hepatic stellate cells. This results in damage to the extracellular matrix (ECM), and abnormal proliferation of ECMs such as collagen I and III, leading to hepatic fibrosis.
  • ECM extracellular matrix
  • liver fibrosis is reversible, unlike cirrhosis, is composed of thin fibrils and does not form nodules.
  • hepatic fibrosis can be recovered when the cause of liver damage disappears, but if recurrence of hepatic fibrosis persists repeatedly, crosslinking between the ECMs increases to form thin microfibers and irreversible cirrhosis with nodules It proceeds.
  • Cirrhosis of the liver is pathologically necrotic. It is a chronic disease involving inflammation and fibrosis. Liver cirrhosis eventually leads to liver cancer.
  • Hepatocellular carcinoma is the most common hepatocellular carcinoma (HCC), and it has been reported that hepatocellular carcinoma (HCC) 1 ng alpha), K i -67 (Antigen KI-67), or cyclin D1.
  • TM4SF5 transmembrane 4 L6 family member 5
  • TM4SF5 transmembrane 4 L6 family member 5
  • the TM4SF5 protein is a water-insoluble protein that has four regions that pass through the cell membrane, two ring structures that exist outside the cell. One ring structure present in the cortex, and two end structures. These proteins form a giant tetraspanin-web or tetraspinin-enriched microdomain (TERM ) , a complex in the cell membrane with cell adhesion molecules such as integrins. The complex contributes to a variety of biological functions such as cell adhesion, proliferation and migration.
  • TM4SF5 protein is known to be overexpressed in human liver cancer cells.
  • Korean Patent Registration No. 10-0934706 discloses a method for screening anticancer substances using cancer cells expressing TM4SF5 protein and an anticancer composition comprising a compound inhibiting the activity of TM4SF5 protein. Therefore .
  • the present inventors tried to develop a method for diagnosing liver disease by using the expression change of TM4SF5 protein, and found that TM4SF5 protein was over-expressed (transgenic mouse; TG mouse) or Tm4sf5 gene was knocked out (knockout: 1 (1) Srebpl (Sterol regulatory element-binding protein 1), Srebp2 (Sterol regulatory element-binding protein 2), Fasn (Fatty acid synthase) and CD36 (cluster of differentiation 36) in hepatocytes or hepatocytes obtained from a transgenic mouse ), Fabpl (Fatty Acid-Binding Protein 1), V 1 d 1 r (very low- ) (Ling () s) v s l ⁇ 3 ⁇
  • TM4SF5 plays a positive role in fatty liver, hepatitis, and hepatic emulsification.
  • the expression of the niRNA and the protein is changed and the phosphorylation of the protein is changed, thereby causing liver fibrosis and hepatitis. Cirrhosis.
  • K0 mice lacking the Tm4sf5 gene did not show changes in the expression and phosphorylation of mRNA and proteins of the factors identified in the TG mice or could induce obesity and metabolic diseases Glucose (glucose) resistance due to high fat diets, high carbohydrate diets, high amino acids (arginine), or high sucrose diet.
  • the present inventors completed the present invention by confirming that liver diseases including hepatitis, hepatitis, liver fibrosis, liver cirrhosis and liver cancer caused by the expression of TM4SF5 can be induced.
  • Patent Document 1 Korean Patent No. 1 0934706 DISCLOSURE OF THE INVENTION
  • the present invention provides a method for screening a sample comprising the steps of: 1) selecting a sample having an increased expression level of TM4SF5 (transmembrane 4 L6 family member 5) protein compared to a normal control sample,
  • Src cel lular sarcoma protein.
  • FAK focal adhesion kinase
  • S6K ULK. Measuring the phosphorylation level of at least one protein selected from the group consisting of 4EBP1 and Akt protein; and
  • the level of expression of niRNA or protein of SREBP1 in step 2) and STAT3 protein, c? Src protein, FAK, niTOR, S6K, ULK. 4EBP1, and Akt protein is determined by comparing the level of expression of the SREBP1 mRNA or protein of the normal control sample and the STAT3 protein, the c-Src protein, the FAK. mTOR. S6. ULK, 4EBP1 and an Akt protein.
  • the present invention also provides a method for providing information for diagnosis of liver disease, comprising the step of comparing the level of phosphorylation of at least one protein selected from the group consisting of ULK, 4EBP1 and Akt protein.
  • the present invention provides a method for producing a protein comprising the steps of: 1) treating a test substance with cells expressing TM4SF5 and SREBP1 protein;
  • step 1) 2) the expression level of the mRNA or protein of the SREBP1 protein and STAT3 protein, c-Src protein in the cells of step 1) above.
  • FAK. mTOR. S6K, ULK, 4EBP1 and an Akt protein and a step of measuring the level of phosphorylation of at least one protein selected from the group consisting of:
  • SREBP1 mRNA or protein in the step 2) suppressing the expression level of SREBP1 mRNA or protein in the step 2) as compared with the control group not treated with the test substance.
  • STAT3 protein, c? Src protein, FAK. mTOR, S (5R, ULK, 4EBP1, and an Akt protein Or increase the phosphorylation level of the protein.
  • the present invention also provides a method for screening a candidate for fatty liver therapy.
  • the present invention also relates to a method for producing a TM4SF5 protein comprising the steps of: 1) treating a test substance in a cell or animal model expressing TM4SF5 protein,
  • step 2) measuring the binding of TM4SF5 protein to any one or more selected from the group consisting of mTOR protein, SLC7A1 protein and arginine in the cell or animal model of step 1) above;
  • step 1) measuring the level of monoacyl, diacyl, or triacyl glycerol in the cell or animal model of step 1) above; :
  • Step 3) inhibits the phosphorylation of the niTOR protein, the S6K protein, the UNC-51-! Ike kinase 1 (ULK1) protein or the 4EBP1 protein and inhibits the phosphorylation of monoacyl-, cliacyl-, , And reducing the level of triacylglycerol and reducing the level of glycemia, glucose tolerance, insulin resistance or reversal of the process in step 5) And a method for screening an anti-obesity, fatty liver, or liver cancer therapeutic candidate substance.
  • a method for producing an animal model of portal hypertension comprising a step of crossing with a mouse having a genotype of APC mim / + (adenomatous polyposis coli mm / + ).
  • the present invention provides an animal model of portal hypertension produced by the above method. ⁇ Effects of the Invention ⁇
  • the present invention relates to a method for the metabolism of TM4SF5 protein in overexpressing cells and transgenic mice Function is impaired and the body weight is increased and the expression and accumulation of mRNA and proteins of fat-related biosynthetic factors including TM4SF5 expression-dependent proteins such as SREBPl protein is increased by carbohydrate, fat, and high amino acid diet .
  • the phosphorylation of at least one protein selected from the group consisting of STAT3 protein, (: -Src protein, FAK protein, mTOR protein, S6K protein, LiL protein, 4EBP1 protein and Akt protein is reduced and exhibits characteristics of obesity, , Confirming that the expression of SREBPl protein is decreased, the phosphorylation of STAT3 protein is increased, and the accumulation of expression of extracellular matrix such as collagen and laminin is increased by continuously culturing the transgenic mouse, thereby showing the characteristics of hepatic emulsification or cirrhosis.
  • the expression of TM4SF5 protein can be measured to diagnose obesity and liver disease, or to screen candidates for obesity or liver disease treatment.
  • FIG. 1 is a schematic diagram (A) of a construct expressing TM4SF5 protein and (B) a result of confirming the expression of TM4SF5 gene from the liver tissue of the transformed mouse into which the Construct has been introduced.
  • FIG. 2 is a photograph (A) showing liver tissue of a transgenic mouse (52 weeks old) overexpressing TM4SF5 protein. Photo (B) as a result of staining with oil red 0 or mason trichrome; Tissue was incubated with the antibody
  • FIG. 3 shows the expression of gene (A) and protein (B) associated with fatty liver in the liver tissue of a transgenic mouse (52 weeks old) overexpressing TM4SF5 protein, and the liver tissue of the mouse was confirmed by immunostaining C).
  • FIG. 4 shows the accumulation of fat in hepatocytes isolated from animals overexpressing TM4SF5 protein (A) and the expression of fat-related genes in the graphs (B and C) and normal or Tm4sf5- / + knockout animals (D) for ApoBlOO, Ldlr, Srebp2, Ppar ⁇ , and leptin genes, which are increased in normal animals but increased in knockout animal liver tissue when refeeded .
  • A TM4SF5 protein
  • D normal or Tm4sf5- / + knockout animals
  • FIG. 5 shows the results of confirming expression of SREBP1 protein, phosphorylation of STAT3 protein and expression of PPARy protein in hepatocytes overexpressing TM4SF5 protein (A): the interaction of SREBP1 protein expression of anoxidation of STAT3 protein with free (B) showing the result of treatment with fatty acid (free fatty acid) and the phosphorylation change (C) of STAT3 protein by increasing the expression of SREBP1 protein.
  • A the interaction of SREBP1 protein expression of anoxidation of STAT3 protein with free
  • B showing the result of treatment with fatty acid (free fatty acid) and the phosphorylation change (C) of STAT3 protein by increasing the expression of SREBP1 protein.
  • FIG. 6 is a graph showing the inhibition (A) of lipid production in adipocytes in which the expression of TM4SF5 protein was inhibited, the inhibition of the expression of the gene associated with adipocyte (B), the expression of adipocytes (3T3-L1) (C) showing SREBP1 (precursor pSREBPl and mature form of mSREBPl), which increase in amount, and phosphorylation of STAT3 protein, whose amount decreases as Ppar ⁇ and adipocytes differentiate.
  • A inhibition of lipid production in adipocytes in which the expression of TM4SF5 protein was inhibited
  • B the inhibition of the expression of the gene associated with adipocyte
  • C the expression of adipocytes (3T3-L1)
  • SREBP1 precursor pSREBPl and mature form of mSREBPl
  • FIG. 7 shows changes in expression of SIRT genes (A) in liver tissues of transgenic mice overexpressing 14SF5 protein (52 weeks old); Changes in SOCS Protein Expression (B): Changes in Expression of SOCS Gene (C): Changes in SOCS3 Protein Expression (D) after Culturing Medium with TM4SF5 Protein Expression in Cultured Medium Cultured with Adipocyte Precursor Cells As shown in Fig.
  • FIG. 8 shows the expression of S0CS1 and S0CS3 genes (A) and proteins (B and C) in liver epithelial cells treated with TM4SF5 protein overexpressing TM4SF5, (D) of the S0CS1 and S0CS3 proteins in overexpressed hepatocytes and suppression of the expression of S0CS3 protein in primary hepatic epithelial cells isolated from transgenic mice expressing 52S14SF5 overexpression, SREBP1 The amount of protein is reduced. (E) of phosphorylation of STAT3 protein is shown in FIG.
  • Fig. 9 is a graph showing the results of immunohistochemical staining of the normal animal (WT), Tin4sf5 gene K0 mouse (Exon 1-K0 produced by the method of Example 7 or Exon 3-K0 produced by Macrogen)
  • HFD high fat diet
  • WT normal animal
  • Tm4sf5 gene knockout mice Tni4sf5- / _K0 mice
  • A body weight changes of WT and Tm4sf5 - / - K0 mice were checked weekly (A), and the total body weight change after 10 weeks was checked (B).
  • 11 is a normal animal (WT).
  • Tm4sf5 '/ + K0 mice were fed a high fat diet (HFD) for 10 weeks that resulted in chow or calories of 60 kCal / kg.
  • HFD high fat diet
  • the level of expression of iuRNA of genes Tm4sf5 (A), Srebpl, Srebp2, LdlR, and ApoBlOO (B) was confirmed and the amount of cholesterol and free fatty acid present in the plasma was ascertained (C) .
  • FIG. 12 shows changes in expression of S0CS1 and S0CS3 genes (A) and protein (B) in TM4SF5 gene knockout mice (1 (0) mice) and high fat diet (HFD) (C), and the expression of the mRNA and protein of the fat-related gene (D).
  • Figure 13 shows the expression of TM4SF5 and APC gene expression in the kidney obtained by crossing between the TM4SF5 gene K0 mouse and the APC mim / + mouse
  • A the result of dissociation of the above offspring
  • B ⁇ -catenin
  • C changes in the expression of collagen in the liver tissues of the offspring
  • E confirmation of the fat-related signal transduction mechanism
  • Fig. 14 is a graph showing the effect of TM4SF5 protein and niTOR (A) on the TM4SF5 overexpressed cell line.
  • SLC7AKB SLC38A9
  • C SLC38A9
  • TM4SF5 gene K0 Tm4sf 5- / + - 1 (0) mice
  • A TM4SF5 protein and Castor 1 protein
  • B stronger binding to L-arginine versus MetaP2
  • B stronger binding of arginine to other proteins TM4SF5 or TM4SF4 than similar proteins TM4SF1 or TM4SF4
  • TM4SF5-LEL domain long extracellular loop
  • TM4SF5 determine the concentration dependent binding of the recombinant protein and L- arginine and verify the IC 50 concentration represents the coupling degree (D and E), the total area (full length, FL) of TM4SF5 protein.
  • SEL short extracellular loop, SEL
  • FIG. 17 is a graph showing changes in the weight of TM4SF5 gene 1 (0 mice, A), high arginine diet (B), and fat accumulation in liver tissues of mice infected with high arginine (HR) (C).
  • FIG. 18 shows the change of expression of the corresponding action gene (C) by the inhibition of TM4SF5 protein expression, the phosphorylation of S6K protein (A), the change of glucose reactivity by inhibition of TM4SF5 protein (B)
  • the result is a drawing.
  • FIG. 19 is a graph showing the effect of a high sucrose diet (high concentration sucrose AIN-93G diet: sucrose) in the TM4SF5 gene K0 mouse at 10% compared to a chow diet containing 3.15% The change in body weight due to ingestion
  • A measured weekly for 3 or 10 weeks.
  • B plasma levels of AST, ALT, total cholesterol (TCHO), and triglycerol (TG) levels
  • C Accumulation of lipid droplets
  • D Monoacyl- (nionoacyl-). Diacyl- (diacyl-), and triacylglycerol (glycerol) levels (E).
  • FIG. 20 shows the result of liver phenotype in liver tissues of transgenic mice (78 weeks old) overexpressing TM4SF5 protein (A): extramedullary hematopoiesis (1111130-hematopoiesis), steatohepat itis (B) of the liver fibrosis (fibrosis) phenotype and a change in the expression of fat-related proteins in the liver tissue (C).
  • A extramedullary hematopoiesis (1111130-hematopoiesis), steatohepat itis
  • B steatohepat itis
  • C fat-related proteins in the liver tissue
  • FIG. 21 shows changes in S0CS protein, ECM and STAT3 phosphorylation (A) and expression of genes related to fat metabolism (B and C) in liver tissues of transgenic mice (78 weeks old) overexpressing TM4SF5 protein The result is a graph.
  • FIG. 22 shows the result of observation of the accumulation of collagen in hepatic tissues of animal models induced by liver disease by 4 or 16 weeks treatment of the carbon tetrachloride (CC1 4 ) drug (A) and the TM4SF5 gene (Tm4sf5- ⁇ -K0 ) ⁇ 0
  • 23 is a diagram showing changes in expression of proteins (A) and genes (B) associated with fibrosis in liver tissue of an animal model in which liver disease was induced with a carbon tetrachloride (CC1 4 ) drug.
  • FIG. 24 is a graph showing the expression of a protein associated with fibrosis in liver tissue of an animal model in which liver disease was induced with a carbon tetrachloride (CCl) drug by immunostaining.
  • CCl carbon tetrachloride
  • FIG. 25 shows the expression of collagen and laminin by suppression of the expression of TM4SF5 (A) and STAT3 (B) proteins using primary hepatic epithelial cells isolated from hepatic tissues of an animal model induced by liver cancer with carbon tetrachloride (CC1 4 ) STAT3, STAT5, and F protein.
  • A TM4SF5
  • B STAT3
  • Figure 2 shows the effect of IL-6-induced collagen, laminin, and laminin ⁇ 2 protein on hepatic epithelial cells or HepG2 liver epithelial cells obtained from liver tissue of animal models induced by liver cancer with carbon tetrachloride (CC1 4 )
  • B Laminin protein expression and STAT3 and c-Src protein expression by treatment with c-Src protein inhibitor (PP2) Phosphorylation changes of Src (C): and
  • FIG. 29 shows liver tissue (A), TM4SF5, collagen, laminin, a-SMA and TGFP protein in an animal model in which liver disease was induced by a carbon tetrachloride (CC1 4 ) drug inhibiting the expression of laminin or collagen ni NA expression (B), and TM4SF5, collagen, and laminin.
  • Laminin? 2 protein expression, and phosphorylation change of STAT3 (C).
  • FIG. 30 shows the result of observation of liver tissue of the mouse overexpressing TM4SF5 protein (A), the result of confirming the expression of liver cancer markers (B and E), the expression of inflammation related genes (C ), And CD34, Ki67, Cyclin D1. And
  • HIF1-a Changes in expression of HIF1-a (D). Laminin expression, STAT3 phosphorylation (E), plasma AST ALT, albumin, low-density lipoprotein (LDL), and triglyceride (F) levels.
  • FIG. 31 shows liver tissues (A), changes in expression of TM4SF5 and laminin protein and phosphorylation of STAT3 (B) in an animal model of liver cancer induced by dieth lnitrosamine (DEN) drug.
  • TM4SF5 phosphorylated STAT3, laminins, laminin
  • FIG. 32 is a view showing the results of confirming the expression changes of HCC-tumor obtained from a patient with liver cancer and STAT3, laminins and collagen KcoUagen I phosphorylated at the tumor-near position.
  • the present invention relates to: 1) a sample isolated from a patient suspected of having liver disease
  • TM4SF5 transmembrane 4 L6 family member 5
  • the level of phosphorylation of at least one protein selected from the group consisting of white matter, c-Src protein, FAK, mTOR, S6K, UL, 4EBP1 and Akt protein is expressed as the level of expression of mRNA or protein of SREBP1 in normal control samples and STAT3 protein.
  • the present invention also provides a method for providing information for diagnosis of liver disease, comprising the step of comparing the level of phosphorylation of one or more proteins selected from the group consisting of mTOR, S6K, ULK,
  • TM4SF5 transmembrane 4 L6 family member 5 protein
  • TM4SF transmembrane 4 super family
  • the TM4SF5 protein shares a structure including four hydrophobic regions that are presumed to be biochemically transmembrane domains.
  • SREBPKsterol regulatory element-binding transcription factor 1 protein refers to a factor that regulates the expression of a gene involved in sterol biosynthesis as a transcription factor that binds to a promoter of a gene and regulates transcription.
  • the SREBP1 protein is regulated by insulin and modulates the expression of genes involved in glucose metabolism and fatty acid and fat production.
  • STAT3 signal transducer and activator of
  • liver disease including sexualization and liver cancer.
  • sucrose is broken down into fructose and glucose in the body and is used in cells
  • high sucrose intake may have an effect of ingesting high concentrations of fi-uctose, which may be beneficial in the production of carbonated beverages, juices, (1): 121-131).
  • diabetes mellitus and obesity are associated with metabolic diseases,
  • liver disease is obesity, metabolic disorder. Glucose resistance, insulin resistance. Weight gain. Fatty liver, liver fibrosis. hepatitis. Liver cirrhosis, or liver cancer.
  • the TM4SF5 used in the information providing method of the present invention SREBP1.
  • the Y2 (laminin y2) protein may be a polypeptide consisting of any amino acid sequence known in the art.
  • the polypeptide may comprise a variant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination thereof of amino acid residues to the extent that it does not affect the function of the protein.
  • polypeptide may optionally be phosphorylated, sulfated, acrylated, glycosylated. Methylation, feneticillation, and the like.
  • the TM4SF5 protein may be a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1.
  • TG triglyceride.
  • Vldrr. Ldlr free fatty acid
  • FFA free fatty acid
  • the method of providing an information of the present invention is a TM4SF5-dependent factor or a cell, tissue including a SREBP1 protein expression and a phosphorylation level change of the STAT3 protein. Or identifying features occurring in an individual, thereby providing information for diagnosis of liver disease.
  • the liver disease is fatty liver. Liver cirrhosis. hepatitis . Cirrhosis. Or liver cancer. Terms used herein.
  • the TM4SF5 ⁇ -dependent factor indicates that mRNA or protein increases in tissues or cells, depending on the expression of TM4SF5 protein (increase of TM4SF5 protein), and in the case of fatty liver, SREBP1. SREBP2, Fasn.
  • MCP1 TGF ⁇ 1, and F4 / 80 antigens in hepatitis
  • collagen I TGF ⁇ 1, and F4 / 80 antigen in hepatitis.
  • AFP FUCA
  • CD34 HIF1 a, i- ( 37, or
  • TM4SF5-dependent factors may include signaling proteins that increase phosphorylation in tissues or cells by expression of TM4SF5 protein (increased TM4SF5 protein), including STAT3, c-Src, FAK, mTOR, S6K, ULKL 4EBP1, or Akt protein.
  • signaling proteins that increase phosphorylation in tissues or cells by expression of TM4SF5 protein (increased TM4SF5 protein), including STAT3, c-Src, FAK, mTOR, S6K, ULKL 4EBP1, or Akt protein.
  • TM4SF5-dependent factors may include elevated factors in the plasma due to the development of fatty liver and hepatitis (or hepatitis) along with the expression of TM4SF5 protein (increase of TM4SF5 protein), including triglyceride ), Free fatty acid (FFA). Cholesterol. Alanine aminotransferase (ALT). Aspartate aminotransferase (AST), low-density lipoprotein (LDL), glucose, or insulin.
  • ALT Alanine aminotransferase
  • AST Aspartate aminotransferase
  • LDL low-density lipoprotein
  • glucose or insulin.
  • TM4SF5-dependent cell or tissue the characteristic of the TM4SF5 protein expressing protein increases the expression of the protein, resulting in hepatocyte injury and cell arrange pattern disorder. Or an increase in collagen accumulation or the like.
  • TM4SF5 protein Increased body weight, increased body weight / liver weight, high carbohydrate diet, and high blood pressure in animal subjects due to the expression of TM4SF5 protein (increased TM4SF5 protein). Weight gain due to high fat diets, low fat / high carbohydrate diets, and high arginine diets, insulin resistance
  • SraBP2, Fasn, CD3G, Fabpl, Vlcllr, Ldlr, ApoBlOO, and Ppar a in the information providing method according to the present invention may be used to increase the synthesis of extracellular matrix such as collagen and laminin, , Ppar gamma.
  • the levels of leptin, Acc, or Acc protein were increased in comparison with the normal control group, and in the group consisting of STAT3 protein, c-Src protein, FAK protein, inTOR protein, S6K protein, ULK protein, 4EBP1 protein and Akt protein If the level of phosphorylation of one or more selected proteins is lower than that of the normal control, it can be judged as fatty liver,
  • the expression level of the SREBP1 mRNA or protein is increased as compared with the normal control and the level of monoacyl, diacyl, or triacyl glycerol is increased If it is decreased compared with the normal control group, it can be judged as fatty liver.
  • TMSF5 AFP in patients with liver disease, including liver cancer.
  • FUCA AFU
  • CD4, HIF1 ⁇ , Ki-67 and cyclin Dl, and the TM4SF5 protein binds to inTOR, SLC7A1 protein or arginine, and inTOR protein, S6K protein, and UNC-51-like kinase KULKl. protein. Or the phosphorylation of the 4EBP1 protein is increased.
  • the binding of the TM4SF5 protein to arginine may be mediated by residues 124-129 from the N-terminus of the TM4SF5 protein.
  • the SREBP1. SREBP2, Fasn. CD36, Fabpl, Vldlr, Ldlr. ApoBlOO, Ppar a, Ppar gamma. Leptin. Acc ⁇ , and Accf3 protein levels were decreased compared to normal controls.
  • the level of phosphorylation of STAT3 protein, c-Src protein, FAK protein, or Akt protein is increased and collagen I.
  • laminin laminin ⁇ 2.
  • Increased ⁇ -SMA expression leads to liver fibrosis, hepatitis, and liver cirrhosis. Or liver cancer.
  • the expression level of the SREBP1 protein can be regulated by any one or more proteins selected from the group consisting of SIRT1, SIRT2, SIRT4, SIRT5, SIRT6 and SIRT7.
  • increased expression of SREBP1 and SREBP2 proteins can be regulated by decreased expression of SIRT1, SIRT5, and SIRT6 proteins, and increased expression of SIRT2, SIRT4, and SIRT7 proteins.
  • the samples were analyzed for TM4SF5 and SREBP1, SREBP2, Fasn, CD36, Fabpl, Vldlr. Ldlr, ApoBlOO.
  • Ppar a Ppar ⁇ . Leptin. Acc a, or AccP protein and the level of phosphorylation of STAT3, c-Src, or FAK protein can be used.
  • the sample may be urine, blood, serum, plasma or cerebrospinal fluid.
  • the level of expression of the protein or the level of phosphorylation of the protein can be measured by any method known in the art. Specifically.
  • the expression level of the protein is Western blot. Enzyme-immunochemical detection (ELISA). Proteomic analysis. Immunohistochemistry salt
  • AFP alpha-fetoprotein
  • FUCA alpha-L-fucosidase 1
  • CD34 Hypoxia-inducible factor NA or protein expression in the sample.
  • Laminin ⁇ 2 or laminin ⁇ 3 mRNAs or protein expression levels are decreased compared to the normal control and SREBP2, SREBPlc, CD36, FABP1, FASN, LDLR, VLDLR, PPAR ⁇ , TIMP1, TGF1, TNFa, vinientin, MCP1, SOCS1,
  • the expression level of niRNA or protein of S0CS3, ApoBlOO, PPARa, Leptin, Acca, or Acc is increased as compared with that of the normal control, and the expression levels of monoacyl-, diacyl-, - (tr iacyt) glycase is increased compared to the normal control, and the level of glycerol is higher than that of the normal control and is composed of STAT3 protein, c-Src protein, FAK protein, niTOR protein, S6K protein, ULK protein, 4EBP1 protein and Akt protein If the level of phosphorylation of one or more proteins selected from the group is not decreased or
  • SIRT1, SIRT5, SIRT6, TGF ⁇ 1, TNFa, vinientin, and spermidine were not decreased or changed compared with the normal control group, while the expression levels of niRNA or protein of SREBP2, SREBPlc, CD36, FABP1, FASN, LDLR, VLDLR, collagen type I alpha 1 chain, AFP (alpha-fetoprotein), FUCA (AFU, alpha-1) chain, laminin, laminin, collagen I, SOCSl, SOCS3, F4 / 80 antigen, collagen I, L-fucosidase 1), CD34, HIF1a (Hypoxia-inducible factor), Ki-67, or cyclin Dl niRNA or protein
  • STAT3 protein, c-Src protein, FAK protein, niTOR protein, S6K protein, ULK protein, and the like increase with increasing levels of cytokine / chemokine factors such as MCP1, , 4EBP1 protein and Akt protein, the level of phosphorylation of the protein is higher than that of the normal control group, hepatic fibrosis, hepatitis, liver cirrhosis.
  • SIRBP2, SREBPlc, CD36, FABP1, FASN, LDLR, VLDLR or PPARy mRNA or protein is decreased compared to the normal control and SIRT1, SIRT5, SIRT6, TGF? 1, TNF?
  • collagen type I alpha 1 chain AFP (alpha-fetoprotein), FUCA (AFU), collagen type I alpha 1 chain, collagen type I alpha 1 chain, vimentin, laminin, laminin ⁇ 2, collagen I, SOCS1, SOCS3, F4 / 80 antigen, a lpha-L-fucosidase 1).
  • CD34, HIF1a (Hypoxia-inducible factor), Ki-67, or cyclin Dl mRNA or protein is increased compared to the normal control.
  • AFP, FUCA (AFU) CD34, HIF1 a, Ki-67, cyclin D1, laminin.
  • collagen I, or laminin y 2 mRNA or protein is increased compared to that of the normal control and the group consisting of STAT3 protein, c-Src protein, FAK protein, mTOR protein, S6K protein, ULK protein, 4EBP1 protein and Akt protein
  • the level of the phosphorylation of one or more proteins selected from the group can be determined to be liver cancer.
  • fatty liver and hepatitis develop and triglyceride (TG), free fatty acid
  • TM4SF5 protein hepatocyte damage, cell arrange pattern disorder, or accumulation of collagen I or laminin synthesis may be increased in the tissue as a result of hepatic emulsification, and as the expression of TM4SF5 protein increases, Increase in body weight / liver weight, high carbohydrate diet. Increased body weight gain, increased insulin resistance, increased glucose resistance, increased fatty liver and hepatitis, or increased extracellular matrix synthesis, such as collagen and laminin, due to high fat diets, low fat / high carbohydrate diets, high arginine, and high sucrose diets May appear.
  • the present inventors prepared a construct of transformed mice expressing 14SF5 protein (52 weeks old) (see Fig. 1) (See Fig. 2).
  • SREBPl, SREBP2, SREBPlc, CD36, Fabpl, Fasn, and Acc. A were obtained as a result of hepatic cells obtained from liver tissues or liver tissues of the transgenic mice and confirming the expression of genes and proteins associated with fatty liver.
  • Acc, Ldlr, SOCSl and SOCS3 mRNA or protein expression decreased phosphorylation to STAT3 protein, Increased levels of triglyceride (TG), AST, and ALT in liver tissue
  • TM4SF5 gene or treatment with free fatty acid (FFA) or IL6 treatment in primary liver epithelial cells isolated from 52-week-old TM4SF5 transgenic transgenic mice, fat accumulates in the cells, Expression of SREBP1, SREBP2, SREBPlc, CD36, Fabpl, Fasn, Acca, Acc ⁇ , Ldlr, S0CS1 and S0CS3 niRNA was increased in the tissues.
  • fat accumulation is also dependent on the expression of TM4SF5.
  • the level of niRNA and protein of Ppary, CD36, Fasn, Srebpl, or Fabpl was maintained (see FIG. 6).
  • SIRT1, SIRT5, and SIRT6 genes decreases the expression of the SIRT1, SIRT5, and SIRT6 genes.
  • SIRT2, SIRT4 and SIRT7 genes, and that increased phosphorylation of STAT3 protein is regulated by the expression of S0CS1 and S0CS3 genes and proteins (see FIG. 7). Further, in a specific embodiment of the present invention, from a 52 week old C57BLV6 normal animal
  • Socsl, and Socs3 had a negative feedback with STAT3 protein phosphorylation (see FIG. 8).
  • the ratio of the liver weight to the body weight was found to be low at 3 months or 6 months after birth in the melanocarpa mouse (TM4SF5 gene K0 mouse) from which the TM4SF5 gene was removed (see FIG. 9 ).
  • TM4SF5 gene K0 mouse melanocarpa mouse
  • the increase in body weight in the normal animals was remarkable in comparison with the normal diet, but in the knockout mice, the increase in the cholesterol was insignificant, And FFA levels were low (low) (see FIG. 10).
  • the TM4SF5 protein is expressed by the. niTOR. By forming a bond with SCL7A1 and arginine, it is involved in arginine transport. S61 (see Figs. 14 and 15).
  • TM4SF5 gene 1 (0 mice, unlike normal mice, were inhibited in weight gain, fat accumulation, glucose tolerance, insulin resistance, or liver tissue damage by ingesting high carbohydrate or arginine diet (see Figures 16 and 17)
  • the TM4SF5 gene K0 mouse is. In contrast to normal mice, it was confirmed that glycolysis function for energy production was reduced by ECAR (extracellular acidification rate) by giving drug stress to mitochondria. RNA-Seq analysis showed that TO4SF5 expression (See Fig. 18). In addition, 14SF5 gene K0 mice were hypercoagulable and showed weak fatty liver symptoms and increased levels of AST, ALT, and total cholesterol in plasma. When lipid components are analyzed, monoacyl-, diacyl- (diacyl-) And triacyl- glycerol were lower in normal mice than in Tm4sf5 gene 0 mice (see Fig. 19).
  • the inventors of the present invention prepared an animal model of hepatic disease of liver cirrhosis / cirrhosis by administering CC14 for 4 weeks or 16 weeks according to the conventional method of producing an animal model of liver disease, (See Fig. 22), and the expression of TM4SF5 protein and the increase of phosphorylation of STAT3 protein, resulting in an increase in the expression of niRNA and proteins in collagen and laminin polypeptide chains (See 23). Also, through the liver tissue staining of the animals. Animal models of liver fibrosis / liver cirrhosis and pi-iniary liver epithelium
  • the present inventors confirmed that the phosphorylation of the STAT3 protein binds to collagen type I alpha 1 chain and laminin ⁇ 2 promoter, thereby inducing expression of laminin in collagen and liver epithelial cells in hepatic stellate cells article
  • the present inventors inhibited the expression of the chain of laminin ⁇ 2 or collagen I ci 1 in normal animals and treated CC1 4 to inhibit liver tissue damage and to inhibit TGF I, ⁇ -SMA, and laminin. Or collagen expression and phosphorylation of STAT3 protein were inhibited, it was confirmed that expression of laniinin ⁇ 2 or collagen type I al chain was important for hepatic emulsification (see FIG. 29).
  • TM4SF5 protein when the TM4SF5 protein is increased in the cancerous or cancerous parts of liver tissue samples of patients suspected of having liver disease.
  • Expression of mRNA or protein of SREBP1, SREBP2, SREBPlc, laminin or collagen and the level of phosphorylation of STAT3, c-Src, FAK or Akt protein can be used.
  • the present invention also relates to a method for producing a protein comprising the steps of: 1) treating cells to be tested with TM4SF5 and SREBPl protein-
  • the expression level of SREBP1 mRNA or protein is suppressed in comparison with the control group not treated with the test substance in the step 2), and the group consisting of STAT3 protein, c-Src protein, FAK, niTOR, S6K, ULK, 4EBP1 and Akt protein ,
  • the expression level of SREBP1 mRNA or protein is suppressed as compared with the control group in which the test substance is not treated, and the levels of monoacyl- (diacyl-), diacyl- (diacyl- ) Or triacylglycerol in the presence or absence of a test substance.
  • the present invention also provides a method for screening a candidate fatty acid therapeutic substance, comprising the steps of:
  • the proteins TM4SF5, SREBP1, SREBP2, Fasn, CD36, Fabpl, ApoBlOO, Ppar alpha, Ppar, Leptin, Acca, Acc beta STAT3, collagen type I, laminin and laminin? 2 proteins have the above-described characteristics.
  • the SREBP1 and STAT3 proteins may be of any sequence well known in the art and may include variants or fragments of such sequences. Specifically.
  • the STATS protein may be a polypeptide consisting of the amino acid sequence shown in SEQ ID NOs: 1, 2 and 3, respectively.
  • Triglyceride, Vldlr, Ldlr, and free fatty acid are components of fatty acids and fats commonly known in the art.
  • the method for screening candidates for fatty liver treatment according to the present invention is a method for screening TM4SF5.
  • Candidate substances capable of treating fatty liver can be screened using changes in the phosphorylation level of FA (focal adhesion kinase), mTOR, S6K, ULK1, 4EBP1, or Akt protein.
  • the method for screening candidate therapeutic candidates for liver cancer according to the present invention is characterized by the expression of TM4SF5 protein and the expression of CD34, AFU, FUCA, laniinin ⁇ 2, HIFl ⁇ , and cyclin Dl determine, or may further include a step to determine whether or not binding between the protein and TM4SF5 m T0R, SLC7A1 protein or arginine.
  • the candidate substance for liver disease treatment including liver cancer selected by the screening method according to the present invention can inhibit the binding of TM4SF5 protein to mTOR, SLC7A1 protein or arginine.
  • the present inventors prepared a transgenic mouse expressing the TM4SF5 protein and found that lipid formation
  • the present inventors prepared a transgenic mouse overexpressing the TM4SF5 protein, confirmed that the transfected mouse was promoted to form fat (see FIGS. 1 and 2), and mice in which the TM4SF5 gene was knocked out
  • the body weight of the normal mice is not as high as that of the normal mice (see FIG. 9), and the high carbohydrate diet and the high fat diet. It was confirmed that the weight gain of the normal dogs was increased by the high arginine and the high-krone diet, while the weight increase was small in the knockout mice (see FIG. 10, FIG. 11, and FIG.
  • the present invention also relates to a method for expressing TM4SF5 protein
  • Treating the test substance with the test substance the expression level of the SREBP1 protein and STAT3 protein, c-Src protein in the cell. Measuring the phosphorylation level of any one or more proteins selected from the group consisting of FAK, mTOR, S6K, ULK, 4EBP1 and Akt proteins; increasing the expression level of the SREBP1 protein as compared to the control without the test substance , Screening a test substance that inhibits the phosphorylation level of the STAT3 protein, and screening candidate substances for the treatment of hepatitis C, hepatitis or cirrhosis.
  • the TM4SF5, SREBP1 and STAT3 proteins have the above-described characteristics.
  • the TM4SF5, SREBP1, and STAT3 proteins may be of any sequence well known in the art and may include variants or fragments of such sequences.
  • the TM4SF5 protein may be a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1.
  • the method for screening candidate substances for treating liver cancer according to the present invention is characterized in that TM4SF5 and
  • S6K, ULK, 4EBP1, and Akt protein a candidate substance capable of treating hepatic fibrosis, hepatitis, liver cirrhosis, or liver cancer can be screened using the change in the level of phosphorylation of one or more proteins selected from the group consisting of S6K, ULK, 4EBP1 and Akt protein.
  • the present invention also relates to a method for producing a TM4SF5 protein, comprising: 1)
  • TM4SF5 protein measuring the binding of TM4SF5 protein to any one or more selected from the group consisting of niTOR protein, SLC7A1 protein and arginine in the cell or animal model of step 1) above;
  • step 1) measuring the level of monoacyl-, diacyl-, or triacylglycerol in the cell or animal model of step 1) above;
  • TM4SF5 protein inhibiting the binding of TM4SF5 protein to any one or more selected from the group consisting of niTOR protein, SLC7A1 protein and arginine in step 2), and step 3) niTOR protein.
  • S6K protein UNC-51-like kinase 1 (ULK1) protein.
  • ULK1 UNC-51-like kinase 1
  • An anti-obesity comprising the step of screening a test substance which reduces glucose tolerance, insulin resistance or the antihypertivity of the process. Fatty liver. Or a method for screening candidates for treatment of liver cancer.
  • mTOR is a mammalian target of rapamycin, which can be referred to as a hub signaling (NM-004958.3) for modulation of cell metabolic functions and "SLC7A1 (solute carrier family 7 member 1) Protein "is an arginine transporter present in the cell membrane and lysosomal membrane (GenBank accession number: M_003045.4).
  • the TM4SF5 and SLC7A1 proteins have the above-described characteristics.
  • the TM4SF5 and S1X7A1 proteins may be of any sequence well known in the art. Or a variant or fragment of such a sequence.
  • the TM4SF5 and S1X7A1 proteins may be polypeptides consisting of the amino acid sequences shown in SEQ ID NOS: 1 and 2, respectively.
  • the screening method of an anti-obesity candidate substance according to the present invention can screen candidates inhibiting anti-obesity and hepatoma cell survival by selecting a test substance that inhibits the binding of TM4SF5 protein to mTOR, SLC7A1 protein or arginine.
  • the binding of the TM4SF5 protein to arginine may be mediated by residues 124-129 from the N-terminus of the TM4SF5 protein.
  • the present inventors prepared transgenic mice overexpressing the TM4SF5 protein and confirmed that the transfected mice were promoted to form fat (see FIGS. 1 and 2). It was also confirmed that TM4SF5 protein binds to mTOR, SLC7A1 and arginine, respectively, in the cells overexpressing TM4SF5 protein (see FIGS. 14 and 15).
  • TM4SF5 protein and mTOR in TM4SF5 protein expressing cells SLC7A1 or arginine was inhibited, and it was confirmed that anti-obesity and anti-cancer candidates could be screened.
  • the present invention provides a method for producing an animal model of hyperbaric hypertrophy comprising crossing a mouse having a TM4SF5 gene knock-out (K ()) with a mouse having a genotype of APC mim / + ).
  • the " APC (adenomatoLis polyposis coli) gene" is a gene responsible for familial arteriosclerosis.
  • the product synthesized from the APC gene forms a complex with? -Quaternine to accelerate its degradation.
  • Accession NO. M740878 gene may be a polynucleotide consisting of any base sequence known in the art.
  • the polynucleotide may be a polynucleotide consisting of any base sequence encoding the TM4SF5 protein.
  • the TM4SF5 gene may be a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 3.
  • the TM4SF5 gene may have 70%, 80%, 90%, 95%, or 99% homology with the nucleotide sequence shown in SEQ ID NO: 3.
  • the present inventors produced a mouse knockout (KO) mouse of TM4SF5 gene, and then the mouse was crossed with a mouse having a genotype of APC m im / + to obtain offspring (see FIG. 13A) . And the symptom of hyperbaric hypertension was found in the obtained progeny (see Fig. 13B).
  • an animal model of portal hypertension can be produced by crossing a mouse having a genotype of TM4SF5 gene KO mouse and APC m im / + . Further, the present invention provides an animal model of portal hypertension produced by the above method.
  • the animal model can be produced by the above-described production method.
  • the method may include crossing a TM4SF5 gene K0 mouse with a mouse having a genotype of APC m im / + .
  • the TM4SF5 and APC genes may have the characteristics as described above, and may include mutants and fragments thereof.
  • the TM4SF5 and APC genes may be polynucleotides consisting of the nucleotide sequences shown in SEQ ID NOS: 3 and 4, respectively.
  • transgenic mice were prepared as follows.
  • Example 1-1 Identification of fatty liver phenotype in transgenic mice overexpressing TM4SF5 protein
  • the mice prepared in Example 1-1 were raised for 52 weeks and sacrificed to obtain liver tissue. Observing the appearance of the obtained liver tissue. The results are shown in Fig. 2A. At this time. As a control group, normal mice were used.
  • mice that had been fed for 52 weeks with overexpression of the TMSF5 protein showed characteristics of fatty liver (FIG. 2A).
  • the dissected liver tissues were fixed on paraffin and slides were made. To obtain H & E staining, the obtained liver tissues were left in an oven at 6 ° C for 20 minutes to remove paraffin. The liver tissues were sequentially taken out in 100%, 90%, 80% and 70% ethanol and distilled water for 3 minutes, and then the cells were treated with hematoxylin, After the reaction was completed, the liver tissues were washed with water and immersed in an eosin solution for 20 minutes, washed again with water, resuspended in 70% 80%, 90%, and 100% ethanol, and xylene solution for 3 minutes. The slide glass was observed with a microscope. The photograph is shown in FIG. 2B.
  • the hepatocytes were filtered using a cell filter having a pore size of 40 and centrifuged to obtain pellets.
  • the obtained pellet was mixed with 1 ⁇ 2 penicillin / streptomycin
  • FIG. 2B shows a photograph of a saline colored cell observed using a microscope.
  • TG triglyceride
  • albumin ALT
  • the blood obtained was placed in a 1.5 nil tube coated with 1 M EDTA, and 8 [mu] l of 1 M EDTA
  • the serum was separated by centrifugation at 1,500 xg and 4 ° C for 15 minutes.
  • Triglyceride was separated from the separated serum using a blood analyzer (Dricheni 4000, Fuji, Japan). Albumin and ALT levels were confirmed.
  • the expression of the gene related to fatty liver in the liver tissue of the transgenic mouse prepared in Example 1-1 was confirmed by the following method.
  • RNA pellets For 5 minutes to obtain RNA pellets and dried at room temperature for 10 minutes. To the dried pellet was added 30 of DEPC-distilled water to obtain RNA. The obtained RNA was subjected to removal of gDNA according to the manufacturer's protocol using a reverse kits (Toyobo, Japan) and cDNA was obtained. Were added to the 2x Eva Green Master Mix (Labopass, Republic of Korea), forward and reverse loop primer of 0.4 ⁇ ⁇ described in Table 2 to the resulting cDNA was performed real-time PCR. The expression levels of each of the genes from the PCR results were obtained using the modified delta-delta Ct method of Pfaffl.
  • the expression of the protein related to fatty liver in the liver tissue of the transgenic mouse prepared in Example 1-1 was confirmed by Western blotting.
  • dissolved laminar [50 niM Tris-HCKpH 7.4), 1% NP40. 0.25% Soxylated Deoxycholate, 150 niM NaCl. 1 niM EDTA], SDS (sodium dodecyl sulfate), Na304V, and protease inhibitor cocktail (GenDepot) were added and left at 4 ° C for 15 minutes to dissolve the tissue.
  • the lysate was centrifuged at 13,000 rpm and 4 ° C for 30 minutes to obtain a supernatant. Proteins present in the supernatant were quantitated using BCA reagent (Thermo Scientific).
  • SREBP1 precursor Santa Cruz, USA
  • mature SREBP1 Santa Cruz, USA
  • TP Santa Cruz, USA
  • PPARa Santa Cruz USA
  • pY 706 STAT3 Mi 11 ipore.
  • SREBP1 and ACCl (ACCa) proteins which are fatty-related proteins, in the liver tissues of transgenic mice overexpressing TM4SF5 protein was significantly increased, but phosphorylation of STAT3 protein was inhibited 3B).
  • Example 2-2 The inhibition of phosphorylation of STAT3 protein in transgenic mice overexpressing TM4SF5 protein identified in Example 2-2 was confirmed using a tissue staining method.
  • liver tissue was left in an oven at 60 ° C for 20 minutes to remove the paraffin.
  • the liver tissues from which the paraffin was removed were immersed in the xylene solution for 5 minutes. This was repeated three times.
  • the liver tissue was treated with 100% ethanol. 90%, 80%, 70%, and distilled water for 3 minutes in sequence, and then taken out of the water bath for 10 minutes.
  • the tissue was placed in lOmM citric acid buf fer (pH 6.0), covered with foil and autoclaved. After the autoclave is over, the tissue is allowed to cool well and then treated twice with PBS for 10 min
  • the reaction time varied depending on the antibody used, so the time point was determined compared with the control group.
  • the tissue stained with DAB was immersed in hematoxylin for 5 minutes or more in distilled water. After that, it was rinsed in water, and the solution was sequentially put into ethanol 70%, 80%, 90%, 100% and xylene solution for 3 minutes.
  • Hepatocytes were obtained under the same conditions and in the same manner as described in Example 1-4, except that a C57BL / 6 normal mouse was used in place of the transgenic mice in which the TM4SF5 protein was overexpressed.
  • the obtained hepatocytes were transformed with Construct containing the TM4SF5 gene prepared in Example 1-1. Oil red 0 staining was carried out using the same conditions and procedures as described in Examples 1-4, using construct transfected cells expressing TM4SF5. At this time.
  • hepatocytes obtained from normal mice were treated with fatty acid (FFA). The result of observation of the stained cells by a microscope is shown in FIG. 4A.
  • FFA fatty acid
  • the expression of the locus-related gene was confirmed using the hepatocyte expressing the TM4SF5 protein prepared in Example 3- 1. At this time. Cells are treated with free fatty acids in cells that do not express TM4SF5 or hepatocytes that overexpress T4SF5 protein. TM4SF5 protein-expressing hepatocyte, and IL-6, a cytokine associated with fatty liver
  • hepatocytes overexpressing normal hepatocytes and TM4SF5 protein were compared using IL-6-treated cells. Experiments were carried out under the same conditions and methods as in Example 2-1, except that the primers described in Table 3 were used.
  • Fig. 4B As a result, as shown in FIGS. 4B and 4C, expression of fat-related Srebpl, Srebp2, Fasn, CD36, Fabpl, Vldlr, and Ldlr genes in both liver cells overexpressing TM4SF5 protein and normal liver cells treated with IL- (Figs. 4B and 4C).
  • cont + FFA is a control cell treated with free fatty acid (250 yM steric acid + 250 ⁇ M palmitic acid).
  • Phosphorylation of STAT3 protein to hyeonryanggwa of SREBP 1 is a protein from the ⁇ n ⁇ n -! -1 s ⁇ > - ' , as ⁇ 1 "" ⁇
  • Example 4 B14SF5 of the inhibition of protein expression in fat cells Confirm signal transducer change
  • mouse 3T3-L1 adipose precursor cells were prepared by culturing in a DMEM culture medium containing 10% NBCS (Gi bco, 16010159) and 1% penicillin / strap tomacein. The prepared cells were dispensed into 6-well plates so as to have lxlO 5 per well.
  • the fat precursor cells are filled in the wells, they are further cultured for 48 hours, and then treated with 1 ⁇ M of dexamethasone, 0.5 ⁇ M of I BMX (3- 1 sobu ty 1 - 1-nie t hy 1 xan thi ne)
  • the medium was replaced with an adipocyte differentiation medium (MDI medium containing 10% FBS) containing 10 / g / iii of insulin (Si gma, USA)
  • Adipocyte was transfected with TM4SF5 shRNA (shTM4SF5, 5 '-CCTGGAATGTGACGCTCTTCTCGCTGCTG-3', SEQ ID NO: 35) using 1 ipofectamine 3000.
  • the expression of the TM4SF5 gene in the adipocytes was inhibited by the following method. Specifically, the experiment was carried out under the same conditions and in the same manner as in Example 2-1 except that the differentiated adipocytes obtained in Example 4-1 were treated with shRNA for TM4SF5 and then the primers described in Table 4 were used. .
  • TM4SF5 gene in adipocytes inhibited the expression of fat-related Ppary, CD36, Fasn, Srebpl, and Fabpl genes (Fig. 6B), as shown in Fig. 6B.
  • Mouse 3T3-L1 preadipocytes were cultured in DMEM culture medium containing 10% NBCS (Gibco, 16010159) and 1% penicillin / streptomycin. On day 4, when the preadipocytes were filled 100% in the culture vessel, they were further cultured for an additional 48 hours. Then, 1 ⁇ M Dexaniethasone, 0.5 mM IBMX (3-isobutyl-1-methylxanthine) and 10 ⁇ g / ) And DMEM supplemented with 10% FBS and insulin (10 / m £) were used for 2 days.
  • NBCS Gibco, 16010159
  • penicillin / streptomycin 1% penicillin / streptomycin
  • the cells were treated for 2 days with an adipocyte differentiation medium (MDI medium, manufacturer and catalog number)
  • MDI medium adipocyte differentiation medium
  • the cells were cultured in DMEM culture medium containing 10% NBCS and 1% penicillin / strept lycin for 10 days to differentiate adipocytes.
  • ERK Cell l Signaling Technology, USA
  • p-ERK Cell 1 Signal ing Technology, USA
  • Akt Cell Signaling Technology, USA
  • TM4SF5 TM4SF5
  • FIG. 7A the expressions of SIRT1, SIRT5 and SIRT6 genes were decreased in SIRT2, SIRT4 and SIRT7 genes in liver tissues of transgenic mice overexpressing TM4SF5 protein (Fig. 7A) .
  • construct expressing the TM4SF5 protein is a transformed normal hepatocyte
  • the culture medium in which the AML12 cells were cultured was obtained at 4 days, 8 days, and 12 days of culture,
  • 3T3-L1 cells were cultured using both media. In the cultured 3T3-L1 cells
  • S0CS3 protein was confirmed by Western blotting in the same manner as described above.
  • the culture medium in which the lipid precursor cells were cultured was treated with the TM4SF5 protein expressing hepatic epithelial cells After incubation, the expression level of S0CS3 protein was increased (FIG. 7D).
  • TM4SF5 protein When overexpression of TM4SF5 protein in hepatocytes isolated from normal mice, increased expression of SREBP1 protein and inhibition of phosphorylation of STAT3 protein are associated with these
  • hepatocytes in which TM4SF5 protein was overexpressed were prepared by the same conditions and methods as described in 3-1.
  • the expression of S0CS1 and S0CS3 genes was confirmed under the same conditions and in the same manner as in Example 2-1, except that the prepared hepatocytes were used the primers described in Table 3 above.
  • Fig. 8A expression of S0CS1 and S0CS3 genes was increased by overexpressed TM4SF5 protein, which was similar to that of fatty acid addition (Fig. 8A).
  • S0CS1 and S0CS3 proteins in the hepatocytes were confirmed by immunohistochemical stain. As shown in FIG. 8C, expression of SOCS 1 and SOCS3 proteins was increased in hepatocytes overexpressing TM4SF5 protein compared to the control (FIG. 8C).
  • exon 3 of the Tm4sf5 mouse gene (GenBank accession number: ⁇ _ 029360.3) consisting of 5 exons was removed using C57BL / 6 mouse
  • cas9 / RGEN K0 mice were produced (Macrogen, Seo). At this time, using the RGEN position described in Table 7 below, a mouse in which 522 bp of DNA containing TM4SF5 gene was deleted was obtained. Using the mouse TM4SF5 primer described in Table 7 below, a mouse lacking the TM4SF5 gene was prepared from the mouse obtained above.
  • Mutant mice were selected by observing heterozygous double stranding between wi kltype (normal) and mutant PCR products through T7E1 analysis.
  • mice 69 Respectively.
  • a mouse in which 29 bp of DNA containing TM4SF5 gene was deleted was obtained.
  • mice TM4SF5 primer described in Table 8 below Tm4sf5-Exon 1-K0 mice lacking the TM4SF5 gene were prepared from the mice obtained above.
  • a Tm4sf5-Exon 1-K0 mouse was used as a Tm4sf5-K0 mouse.
  • Mutant mice were selected by observing heterozygous double stranding between normal (wil dtype) and mutant PCR products through T7E1 analysis.
  • S0CS1 and S0CS3 genes which regulate the phosphorylation of STAT3 protein in the TM4SF5 gene K0 mouse prepared in Example 1, was examined. Using the hepatocytes obtained from the mouse thus prepared, the same primers as those described in Table 3 were used, except that the S0CS1 and S0CS3 genes
  • TM4SF5 gene ⁇ 0 mice were fed a high fat diet and the fat accumulation in the liver was confirmed by ⁇ & ⁇ staining.
  • Example 7-1 the TM4SF5 gene K0 mouse prepared in Example 7-1 was fed with 60% kcal of high fat (Harlan, USA) as feed for 10 weeks. Weight changes were measured weekly for 10 weeks during the diet. After 10 weeks. From the mice,
  • Liver tissues were obtained from the TM4SF5 gene K0 mice which ingested the high fat diet, and the expression of genes and proteins associated with fat in the liver tissues was confirmed. The experiment was carried out under the same conditions and in the same manner as in Example 2-1, except that the hepatocytes obtained from the mouse thus prepared were used as the primers shown in Table 9 below.
  • TM4SF5 gene from high-fat diets K0 mice were treated with ⁇ 10 mg of tissue fixed in RNAlater for fat measurement in liver tissue
  • Triglyceride Cell biolabs, STA-3966 was measured.
  • the TM4SF5 gene K0 mouse prepared in Example 7-1 was crossed with mutated APC mim / + mouse (Central Animal Experiment Co., Seoul, Korea) so as to easily develop colon disease, and the phenotype of the offspring was confirmed.
  • TM4SF5 and APC genes were confirmed under the same conditions and in the same manner as in Example 2-1, except that the primers shown in Table 10 were used, using the liver tissue of the obtained progeny.
  • FIG. 13B In addition to the spleen enlargement and abnormal intestine, which are generally observed in APC + / _ mice, the spleen became hypertrophied and showed signs of portal hyper tension ion (Fig. 13B).
  • the paraffin-fixed liver tissue was left in an oven of 6 C for 20 minutes to remove paraffin for the tri-crane staining of Mason.
  • the paraffin-free tissue was placed in a heated bouin's solution and allowed to bounce for 1 hour. After the reaction is over, the liver tissue is washed with water. Were added to the hematoxylin solution for 10 minutes. It was washed again with water and then incubated for 5 minutes in a solution of biebrich scarlet-acid fushsin. After the hepatic liver tissue was placed in distilled water, phosphotungstic acid / phosphomolybdic acid
  • liver tissue in aniline blue (an il i n blue) 10 min and 1% acetic acid solution in 1 minutes each
  • the tissue was dehydrated. After putting the dehydrated tissue in xylene. Mounted on a slide. The cells stained with the two staining methods were observed with a microscope and the photographs are shown in Fig. 13D.
  • Example 2-3 The same conditions and methods as in Example 2-3 were used, except that antibodies against TM4SF5, beta -catenin and HIFla proteins were used.
  • portal hypertension a symptom of vascular enlargement of liver tissue, is related to the expression of H4SF5.
  • portal hypertension is associated with liver fibrosis and cirrhosis
  • TM4SF5 gene Confirmation of fat-related signal transduction in offspring hepatocytes obtained by crossing mouse and APC mim / + mice
  • the fat-related signal transduction mechanism in the progeny liver cells obtained by crossing the TM4SF5 gene 0 mouse and the APC mim / + mouse was confirmed by the Western blot method.
  • Experiments were carried out using the offspring hepatocytes obtained in Example 10-1 and using laminin, fibronectin, ⁇ 42 ⁇ -catenin as primary antibodies.
  • ⁇ 1-catenin, pY705 STAT3, STAT3, pS9-GSK3 ⁇ , GSK3, and 14SF5 proteins in the same manner as in Example 2-3.
  • TM4SF5 protein may cause fibrosis symptoms in the liver by causing disturbances in the blood and the portal of the liver, and promoting expression of extracellular matrix associated with fibrosis.
  • Example 11 Identification of extracellular arginine transport by H4SF5 protein
  • HEK293T cells (KCLB, Korea) were prepared by culturing under DMEM culture medium containing 10% FBS and antibiotics at 37 ° C and 5% CO 2. Prepared cells were plated on 100 uiui plates and cultured to a density of 60%
  • Polyethyleniniine was used to transfect the construct expressing the STE P tagged construct and the HA tagged SLC7A1 or SLC38A9 protein into the TM4SF5 protein.
  • Cells cultured for 2 days after transfection are washed once with PBS and cultured in a culture medium lacking amino acid or arginine for 50 minutes at 37 ° C 5% CO2. After incubation, the cells were washed twice with PBS, and 500 lysis buffer was added thereto, followed by reaction at 4 t ' for 15 minutes. The cell lysate was centrifuged at 4 ° C and 12,000 xg for 15 minutes and the supernatant was taken.
  • the protein contained in the supernatant was quantified using BCA reagent (Thermo Scientifics, USA). Streptavidin-coated beads were added thereto in proportion to the amount of protein.
  • the reaction mixture was reacted by rotating at 4 ° C for 4 hours and then centrifuged at 4 t ' and 7,000 xg for 5 minutes. After centrifugation.
  • the dissolution buffer was added to the obtained pellet, and the mixture was gently mixed.
  • the mixture was centrifuged again at 4 ° C and 7,000 xg for 5 minutes, and the pellet was taken. This washing procedure was repeated twice with PBS and two times with 2x sample buffer in the washed pellet. It was boiled for 5 minutes to prepare a 3 ⁇ 4 plate. ready
  • the TM4SF5 protein was bound to niTOR and SLC7A1 protein or SLC38A9, and the binding was stronger in the case where arginine was deficient in the culture medium for culturing the cells (Fig. 14A, 14B , And 14C).
  • the TM4SF5 protein is not expressed, the phosphorylation of S6K, 4EBP1, and ULK1 is increased by depletion of the amino acid in the cell (replaet km) (FIGS. 14D and 14E).
  • Example 12 Confirmation of the relationship between TM4SF5 protein and arginine transport mechanism
  • T 4SF5 gene K0 mice were starved for 6 hours, and the content of arginase in the liver was determined by measuring the expression of the arginase gene.
  • TM4SF5 gene 1 (0 mouse prepared in Example 7-1 was stopped for 6 hours and regenerated as described above to obtain liver tissue. Using the obtained liver tissue, Using a known primer
  • HEK293FT cells (Thermo, USA) were prepared by culturing under DMEM culture medium containing 10% FBS and antibiotics at 37 ° C and 5% CO 2 . Prepared cells were plated on 150 UIUI plates and cultured to a density of 60% and transfected with constructs expressing the TM4SF5, MetaP2, Castrol, TM4SF1, TM4SF4, and TM4SF5 proteins prepared in Example 11 using PEI. Two days after transfection, the desired proteins were precipitated using strap-coated beads coated with the same conditions and procedures as described in Example 11. [ 10 ⁇ M of [3H] -Arginine (1 ⁇ 2-311 radiolabeled chemicals, USA) was added to the sediment.
  • Example 12-2 When the TM4SF5 protein was found to bind to arginine in Example 12-2, an experiment was conducted to confirm whether the binding was concentration-dependent. The experiment
  • a short extracellular loop (SEL) fragment mutant comprising the 31st to 42nd amino acid residues from the N-terminus in the amino acid sequence (SEQ ID NO: 1) constituting the TM4SF5 protein was prepared, Mutants of the TM4SF5 protein were prepared by preparing a long extracellular loop containing the residues (LED fragment mutation, or by substituting amino acid residues 124 to 129 and 153 to 157 respectively from the N-terminus.) As a result, (WT, full length) was obtained in addition to the above-mentioned mutant proteins, SEL, LEL, W124A, G125A, Y126S, H127A, F128S, E129A, P153A, W154A, N155Q, V156A or T157A mutants.
  • TM4SF5 protein and arginine The binding of TM4SF5 protein and arginine was confirmed by the same conditions and procedures as in Example 12-2. As a result, as shown in Fig. 15F, the TM4SF5 Query short extracellular loop (SEL) mutations could was not combined with arginine (Fig. 15F). Thus, the LEL of the amino acid residues from the protein TM4SF5 seen that the combination with arginine.
  • SEL short extracellular loop
  • mutants substituted with amino acid residues 124-129 in the extracellular loop of TM4SF5 protein failed to bind to arginine (FIG. 15G).
  • the amino acid residues 124 to 129 bind to arginine from the N-terminal of the TM4SF5 protein.
  • the site is known to form cation-pi interactions, and the sequence conserved in most animal TMSF5 proteins
  • TM4SF5 gene K0 mice were weighed in high arginine diet
  • mice The change in body weight of TM4SF5 gene 1 (0 mice) was confirmed by the following method.
  • Example 7-1 the TM4SF5 gene K0 mouse prepared in Example 7-1 was fed with 40 g of L-arginine per kg body weight for 10 weeks as a feed. The weight change was measured weekly for 10 weeks during which the diet was performed and the results are shown in Figure 17A.
  • the normal mice consuming the high arginine diet showed an increase in body weight by about 25% as compared to the mice fed the fixed diet.
  • the TM4SF5 gene K0 mouse increased body weight by about 7% (Fig. 17A).
  • Fig. 17B as a result of checking the weight gain of each of the mouse individuals against the starting point of the high arginine diet.
  • weight gain was significantly reduced (FIG. 17B).
  • H & E staining was performed using the above-described method by extracting liver tissue from the TM4SF5 gene K0 mouse which ingested high arginine diet in Example 13-1.
  • fatty liver was induced in a normal mouse consuming a high arginine diet, whereas fat accumulation was relatively inhibited in the liver tissue of TM4SF5 gene 1 (0 mouse (Fig. 17C).
  • Mass spectrometry was used to analyze proteins binding to TM4SF5 protein.
  • GLUTKSLC2A1 a glucose transporter, is involved in the production of energy by transferring glucose to the cell membrane through the cell membrane by insulin. Therefore .
  • the transformed cells expressing the TM4SF5 protein were used to confirm the phosphorylation of S6Ki nase as follows.
  • HEK293FT cells (Thermo, USA) were prepared by culturing under DMEM culture medium containing 10% FBS and antibiotics under 37t and 5% CO2 conditions. ready
  • the cell viability was confirmed by confirming cell viability under such stress through the supply of glucose deficiency using cells.
  • TM4SF5 expression inhibition cell line In the cells inhibiting the expression of TM4SF5 protein, the corresponding stress was measured using an XF analyzer (Sea Horse). For the production of TM4SF5 expression inhibition cell line
  • shN sequence (shTM4SF5 # 2: 5'-1) targeting TMSF5 to the HEK293FT cell line
  • Hep3B cells were dispensed in an XFp cell culture plate (Sea Horse bioscience, USA) to 5 ⁇ 10 3 cells / well.
  • the dispensed cells were cultured for 16 hours at 37 ° C and 5% CO 2 and replaced with a Sea Horse XF base medium (Sea Horse bioscience, USA). A replacement of the medium the cells C0 2 is not supplied 37 '5 C incubator
  • RNAeasy kit The construct expressing TM4SF5 protein was transformed into SNU449 liver cancer cell line. The cells were lysed by adding liquefied nitrogen. RNAeasy kit
  • High-carbohydrate diet (70% kcal high carbohydrate) or high-sucrose diet (sucrose, AIN-93G diet; sucrose content: 3.15%) in TM4SF5 gene 1 10% higher at 100 g / kg as compared to diet), and the results of body weight changes were shown in FIGS. 16A and 19A, respectively.
  • TM4SF5 gene K0 mice were tested for changes in glucose tolerance by high-carbohydrate diet or high-glucose diet
  • the glucose tolerance of the TM4SF5 gene K0 mouse in which a high carbohydrate or a high sucrose diet was ingested by the same conditions and methods as in Example 8-1 was measured by the following method.
  • the TM4SF5 gene K0 mouse had decreased glucose tolerance due to ingestion of high carbohydrate diet or high sucrose diet for 10 weeks (Fig. 16C And 19B).
  • Insulin resistance of the TM4SF5 gene K0 mouse which ingested high carbohydrate or high sucrose diet under the same conditions and method as in Example 8-1, was measured by the following method.
  • mice receiving 10-week high-carbohydrate or high-sucrose diets were starved for 6 hours and blood was collected from the tail.
  • Blood glucose in the collected blood was measured using a one-touch ultra (Johnsons and Johnsons, USA). After the blood glucose measurement, the mice were injected with 0.5 U / kg of insulin intraperitoneally, and blood was collected from the tail at 30 minutes, 60 minutes, 90 minutes, and 120 minutes after the injection, respectively.
  • Figs. 16D and 19B As a result, as shown in Figs. 16D and 19B. Unlike glucose resistance, insulin resistance was not associated with the presence of the TM4SF5 protein (Fig. 16D). However, in the case of the high-grade cross-breed diet for 10 weeks, the Tm4sf5 gene K0 mouse was improved with low insulin resistance (Fig. 19B).
  • TM4SF5 gene AST in blood by ingestion of high carbohydrate or high sucrose diet in K0 mouse. ALT, Triglyceride and Cholesterol levels
  • the high-carbohydrate or high-solids (sucrose,
  • ALT, AST, total cholesterol, and triglyceride in blood were increased in normal mice fed a high carbohydrate diet, but the increase was small in the TM4SF5 gene K0 mouse 16E).
  • ALT and AST levels in normal mice were increased in normal mice, but the increase was not significant in TM4SF5 gene 0 mice, but the levels of total cholesterol and triglyceride were not changed statistically (Fig. 19C).
  • H & E staining was carried out using the method described above by extracting liver tissue from TM4SF5 gene 1 (0) mice in which high carbohydrate or high sucrose diet was taken in Example 16-1.
  • TM4SF5 gene Monoacyl- (monoacyl-) by ingestion of high carbohydrate or high-solids diet in KO mice. (Uacyl-), and triacyl- glycerol Synthesis Accumulation of TM4SF5 Gene KO mice that received high carbohydrate or high sucrose diet in Example 16-1 After lysophilization and pulverization using a mortar, the lipids were extracted with 0.3 ml of methane and 0.1% butylated hydroxy toluene per 10 mg of liver tissue. After adding tert-butyl ether to the extract, it was shaken at room temperature for 1 hour.
  • TM4SF5 protein was prepared under the same conditions and procedures as in Example 1-1. They were fed for 78 weeks. The breeded mice were sacrificed as described above to obtain liver tissue, which was confirmed by H & E and Mason's tri-cream staining of liver tissue. As a result, as shown in Fig. 20A. Showed phenotypes of liver cirrhosis in which fibrosis of liver tissue was generated (Fig. 20A). Since the mice were 78 weeks old (1 year and 6 months old), the fatty liver symptoms were weak in normal rats. However, TM4SF5 overexpressed animals had more severe fatty liver disease and extra - extraniedullary heniatopoiesis) (Fig. 20B).
  • 20C shows the result of Western blotting the change in the expression of proteins associated with fat as described above using the liver tissue.
  • the STAT4 phosphorylation was increased by overexpression of TM4SF5 protein at 78 weeks of age, and extracellular matrix (ECM), which is a major factor of liver cirrhosis, Respectively.
  • ECM extracellular matrix
  • the expression of SREBP1 protein is inhibited.
  • Increased expression of the SIRT1 protein reduced lipid synthesis and accumulation in liver tissue (Figure 20C).
  • FIG. 21A results of immunostaining as described above using the liver tissue are shown in FIG. 21A.
  • overexpression of TM4SF5 suppressed the expression of S0CS1 and S0CS3 proteins, increased phosphorylation of STAT3, and increased expression of ECM such as? -SMA, collagen 1 and laminin.
  • ECM such as? -SMA, collagen 1 and laminin.
  • mice overexpressing TM4SF5 protein showed cirrhosis and hepatitis symptoms over time.
  • mice administered with carbon tetrachloride for 4 weeks have been reported to have symptoms of liver cirrhosis in mice administered with hepatic fibrosis for 16 weeks.
  • the expression of TM4SF5 protein was confirmed in a model mouse induced by cirrhosis as a drug.
  • FIG. 22A shows the results of H & E and Mason's trichrome staining performed using the manufactured model mouse.
  • FIG. 22A In the liver tissues of mice administered with CC1 4 for 4 weeks or 16 weeks, cells were killed around the blood vessels, and immunoreceptors were formed around the blood vessels, and morphologically modified cells were observed compared with normal cells. In addition, collagen accumulation between cells resulted in length between the blood vessels and the blood vessels (Fig. 22A).
  • FIG. 23A The results of confirming the expression levels of protein and mRNA using the liver tissue of the model mouse as described above are shown in FIG.
  • FIG. 23A expression of TM4SF5 protein, phosphorylation and ECM of STAT3 protein were increased in liver tissues of model mice (FIG. 23A).
  • elastin, laminin ⁇ 2, ⁇ 3, ⁇ 5, and ⁇ 5 were also observed in the control group, which was not treated in the cirrhotic tissues of the CC4 4 treated group for 4 weeks or 16 weeks.
  • ⁇ 2, and ⁇ 3 chains FIG. 23B
  • PP2 inhibited phosphorylation of STAT3 protein and expression of laminin protein (Fig. 26C).
  • hepatocarcinoma cells were used to inhibit the expression of TM4SF5 protein, phosphorylation of STAT3 protein and expression of laminin protein were confirmed by Western blotting as described above.
  • HepG2 Korean Cell Line Bank, Seoul, Korea
  • Fig. 26D suppression of the expression of TM4SF5 protein inhibited phosphorylation of STAT3 protein and expression of laminin (Fig. 26D).
  • the region corresponding to -1871 to +388 (1 kb) and -592 to +388 (2.3 kb) of the LAMC2 promoter and -2865 to +85 (0.9 kb) of the C0L1A1 promoter, -2047 to +89 1 kb) and -845 to +89 (2.9 kb) were amplified by PCR using the primers shown in Table 11 below.
  • the amplified PCR product was inserted into pGL3 vector (Promega, Cat #. E1751, USA) to construct a construct ( Figure 27k).
  • AML12 cells were cultured in a 48-well plate and cultured with the above construct and TM4SF5 or STAT3 protein
  • luciferase activity was measured according to the protocol of the manufacturer ' using Luciferase Reporter Assay Kit (Pi-iega, USA).
  • TM4SF5 protein was increased.
  • Laminin protein was also expressed around the damaged liver tissue (Fig. 28A).
  • hepatocyte marker albumin a hepatic stellate cell marker, was stained in the same manner as described above, such as collagen I and laminin. As a result. 28B and 28C.
  • collagen I was secreted as ⁇ -SMA, and laminin was first stained with a-SMA and albumin. When cirrhosis became worse and cirrhosis was observed, it was stained only with albumin (Figs. 28B and 28C). From this, laminin is expressed in hepatocytes rather than hepatic stellate cells in a pattern different from collagen. And cirrhosis.
  • TM4SF5 protein was inhibited by HepG2 cells in the same manner as in Example 4-1, the expression of the protein was confirmed by the same method as described above.
  • the conditioned medium obtained when the hepatic stellate cells were cultured was treated, or co-cultured with HepG2 cells and hepatic stellate cells in a transwell chamber
  • the expression of collagen is elevated, but the expression level of laminin is not elevated even in the upper chambers and the lower chambers in liver epithelial cell cultures. Therefore, in the liver epithelial cells, phosphorylation of STAT3 in relation to TM4SF5 (Fig. 28D and Fig. 28E).
  • Example 22 Identification of cirrhosis mitigation effect by inhibition of laminin and collagen gene
  • the tail vein of mouse was laminin Y2 (LAMC2) or collagen
  • TM4SF5 protein a 52-week-old FVB / N animal model overexpressing TM4SF5 protein was raised for one year and sacrificed to extract liver tissue. It was confirmed that the TM4SF5 protein was overexpressed in the extracted liver tissue, and nodule was formed in liver tissue (FIG. 30A). Expression of liver cancer markers such as CD34, AFP, AFU, phosphorylated STAT3, laminin, laminin y2 and collagen I was increased in the above liver tissues (Fig. 30B and 30E). Meanwhile. As a result of confirming the expression level of mRNA using the liver tissue, expression of the gene related to fatty liver was not increased (FIG. 30C).
  • liver cancer markers CD34, HIFla, i67 and cyclinD gene was increased together with the expression of HIF1-a (FIG. 30D).
  • Example 24 Changes in expression of T14SF5 protein and related proteins in an animal model of liver fibrosis and liver cancer
  • liver disease was confirmed using transgenic mice as follows. Specifically. Liver cancer was induced by injecting diethylnitrosamine (DEN) drug into the transgenic mice. (FIG. 31A), and phosphorylation and laminin expression of STAT3 protein increased as the expression of TM4SF5 protein increased (FIG. 31B). In addition, . Immunostaining was performed using the obtained liver tissues, and TM4SF5, phosphorylated STAT3, laminins, laminin? 2 and collagen
  • Example 25 Confirmation of Expression Change of T4SF5 Protein in Cancer Tissue of Patients with Liver Cancer
  • the cancer tissues and surrounding tissues were obtained from patients with liver cancer, and the STAT3 phosphorylated in the manner as described above. Laminin, and collagen I expression. At this time, the cancer surrounding tissues were expected to have pathological features such as hepatitis, sexual emulsification and cirrhosis before the onset of cancer.
  • Fig. 32 expression of TM4SF5, phosphorylated STAT3, laminin and collagen I was increased in cancer tissues and cancer surrounding tissues

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Environmental Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • General Engineering & Computer Science (AREA)
  • Animal Behavior & Ethology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 TM4SF5 단백질의 발현 변화를 이용한 비만, 간질환의 진단방법 및 간질환 치료제 스크리닝 방법에 관한 것이다. 구체적으로, 본 발명은 TM4SF5 단백질이 과발현된 형질전환 마우스에서 대사장애가 일어나고, Srebp1, Srebp2, Fasn, CD36, Fabp1, Vldlr, Ldlr, ΑpοΒ100, Ppar α, Ppar γ, Leptin, Acc α, Acc β 또는 SREBP1c의 mRNA또는 단백질의 발현이 증가하고, 모노아실- (monoacyl-), 다이아실 -(diacyl-), 및 트라이아실 -(triacyl-) 글라이세롤 (glycerol)의 수준이 증가하고, STAT3, c-Src, 또는 FAK 단백질의 인산화가 감소 되어 지방간 및 간염의 특징을 나타내고, 상기 형질전환 마우스를 계속 사육하면 SREBP1, SREBP2, Fasn, CD36, Fabp1, Vldlr, Ldlr, ApoB100, Ppar α, Ppar γ, Leptin, Acc α, Acc β 또는 SREBP1c의 단백질의 발현이 감소하고, STAT3, c-Src, 또는 FAK단백질의 인산화가 증가하고 Iaminin γ2, 라미닌, 콜라젠을 포함하는 세포외기질의 합성이 증가하여 간섬유화, 또는 간경화의 특징을 나타내고, 병약 한 마우스종류에 TM4SF5를 과발현시키면 CD34, AFP, FUCA(AFU), Cyclin D1, Ki67, 또는 HIFI-α를 포함하는 간암 마커들의 단백질들의 발현이 증가함을 확인함으로써, TM4SF5 단백질의 발현 변화를 측정하여 비만 및 간질환을 진단하거나, 비만 및 간질환 예방 혹은 치료제 후보물질을 스크리닝하는데 유용하게 사용될 수 있다.

Description

Figure imgf000003_0001
ώ으f一j, cο 7
Figure imgf000004_0001
y,(,aO.,ukrotaseR UOJC ikeaseEBPlEicsc mT6LKN kn) 4 adeis kin) SKih w§,∑i¾oacot:mttn (asformindt ftrc£tttrGtrnlwh Ξ c2Tll TPΕh- - y, (oo.ss accmnct asIVIAoucl)lpe (asoth mtinstunm< (irill 【발명의 배경이 되는 기술】
간은 우리 몸에서 지질 등의 대사 작용. 해독. 담즙의 배설, 각종 영양소 의 저장, 조혈이나 혈액응고 및 순환 혈액량의 조절 등 많은 기능을 한다. 따라 서, 간에 장애가 발생하면 여러 가지 기능이 저하되고, 최악의 경우에는 생명의 유지가 곤란해진다.
간의 기능을 보다 구체적으로 살펴보면, 첫째, 에너지 대사를 관리하는 기능이 있어 음식물로부터 흡수된 탄수화물 , 지방, 및 아미노산을 포함하는 단백 질 등의 모든 영양소들이 간에서 에너지를 생산할 수 있는 물질로 대사되어 전신 에 공급되거나 저장된다. 둘째, 간에 존재하는 약 2 .000여 종의 효소, 알부민, 웅고인자들이 혈청 단백질. 담즙산, 인지질. 콜레스테롤 등의 지방을 합성하고 저장 및 분배한다. 엣째, 해독 및 분해 기능으로서, 간에서 약물, 술, 독성물질 등을 해독시키므로 이 과정에서 간세포가 손상되기 쉽다. 따라서 , 약물 , 독 또는 알코올에 의한 간질환이 흔히 발생할 수 있다. 또한, 간은 각종 대사산물을 십이 지장으로 배설하는 기능ᅳ 면역기능 등이 있어 생명 유지에 증요하다.
간질환은 원인에 따라 바이러스성 간질환, 알코을성 간질환, 약물 독성 간질환, 지방간, 자가면역성 간질환, 대사성 간질환 및 기타로 구분할 수 있다. 간질환은 초기 자각증상이 없어 상당히 진행된 뒤에서야 발견되기 때문에 우리나 라뿐만 아니라 세계적으로 사망원인의 수위를 차지하고 있다. 이에 , 간질환을 효 과적으로 진단하고 이의 치료방법에 관한 연구가 필요하다. 간이 알코올, 바이러스, 유해 환경인자 등에 의해 자극을 받으면 간성상 세포가 활성화되어 TGFP (transforming growth factor β )를 포함하는 다양한 사 이토카인을 분비한다. TGFp는 발생 , 발암 과정에서 중요한 역할을 하는 것으로 알려진 사이토카인으로서 , 활성화된 TGFP에 의해 TGFp 수용체가 세포 내 Smad2/3 단백질 등을 인산화 및 활성화시켜 Smad4와 결합한 후 핵 내로 이동함으 로써 여러 관련 유전자의 전사를 촉진한다.
이러한 TGFP1에 의해서 발현이 조절되는 단백질들 중 많은 것들이 지방 간 및 지방간염의 유발과 연관되어 있다. TGF|31에 의해서 발현이 조껄되는 단백 질들의 발현 변화를 통해서 대사기능이 비정상적으로 조절되면, 탄수화물, 지방, 또는 단백질 (아미노산 포함) 등의 영양분을 과다하게 섭취함에 따라, 지방 생합 성 관련 효소, 신호전달 단백질 또는 지방의 흡수 및 축적에 관련된 효소와 단백 질들의 발현이 향상되도록 조절되어 간상피세포에 지방이 축적되고 지방간 (steatosis)이 발병하며 , 염증이 추가적으로 발달하면 지방간염 (steatohepatitis) 이 유발될 수 있는 것으로 알려져 있다.
지방 생합성 관련 효소 또는 신호전달 단백질 혹은 인자들은 Srebpl, Srebp2. Fasn, Ppar α , Ppar γ , Lept in, Acc α , AccP . Sirtl, S i r 15 , Si rt6, insulin. 또는 glucose 등을 포함하고, 지방의 흡수 및 축적에 관련된 효소와 단 백질 또는 인자들은 CD36. Fabpl. Vlcllr, Lcllr, ApoBlOO 등을 포함한다. 상기와 같은 이유로 지방간이 심화되면 염증이 동반되어 지방간염이 발병될 수 있고, 비 만 및 혈장 내부 트리글리세라이드 (triglyceride 혹은 트리아실글라이세를 triacylglycerol), 자유 지방산 (free fatty acid). 콜레스테롤 (VLDL 및 LDL)의 양이 증가하게 되며. 비만내지는 복부비만의 증상이 유발되고 체중이 증가하게 될 수 있다.
한편 , TGFP는 콜라겐 합성을 촉진하여 간섬유화를 유발하고, 간성상세포 자신뿐만 아니라 주변의 간세포에도 영향을 주어 EMTCepithelial to mesenchymal transition)을 일으킨다. 간¾유화가 지속되면 결국 간경변증이 유발되므로, 간 섬유화의 과정을 이해하는 것은 간경변증을 치료하는데 필요하다.
염증에 의해 TGFP1과 같은 사이토카인이 많이 분비되는데. 분비된 사이 토카이에 의해서 간성상세포 (hepatic stellate cells) 및 다른 간세포들이 활성 화 되고 Collagen I. fibronectin. 및 laminin 등과 같은 세포외기질을 많이 합 성하여 세포 외부에 축적한다. 이러한 경우에, 염증과 관련된 인자들인 MCP1 또 는 F4/80 antigen의 mRNA 및 단백질의 양이 증가할 수 있고, 조직 내 세포의 손 상, 세포 배열 패턴의 무질서화, 또는 collagen I 혹은 laminin 합성 축적이 나 타날 수 있다.
알코올성 간손상을 알코올 자체 또는 알코을의 대사과정에서 생성되는 화 합물에 의해 유발되고, 이는 지질축적. 간세포 손상 및 성유화증을 발생시킨다. 또한. 만성 B형 간염 . 만성 C형 간염, 만성 자가면역 질환, 만성 담관성 질환, 만성 심장질환, 기생층, 약물중동 등과 같은 다양한 원인에 의해 간세포가 손상 되면 간세포. 쿠퍼세포 (kupffer cell). 동모양 혈관 내피세포 (sinusoidal endothelial cell) 및 간성상세포 등 다양한 세포의 상호작용에 의해 각종 사이 토카인 및 활성산소 등이 생성된다. 이로 인해 세포외 기질 (ECM)이 손상되고, 콜 라겐 I 및 III와 같은 ECM의 이상 증식이 유발됨으로써 간섬유화증이 진행된다. 일반적으로, 간섬유화증은 간경변과는 달리 가역적이고, 얇은 미세섬유 (fibril)로 구성되며 결절 (nodule)이 형성되지 않는다. 또한, 간섬유화증은 간이 손상된 원인이 사라지면 정상회복이 가능하나, 간섬유화증의 재발이 반복적으로 지속되면 ECM 사이의 가교 (crosslinking)가 증가하여 얇은 미세섬유를 형성하고 결절이 있는 비가역적인 간경변으로 진행된다. 이와 같이 발생한 간경변은 병리 학적으로 괴사. 염증 및 섬유화를 수반하는 만성질환이며 . 간경변을 방치하는 경 우 궁극적으로 간암으로 진행된다.
보통 임상적으로 간암 환자의 간조직에는 AFP (Alpha-fetoprotein), FUCA ( AFU , Al ha-L-fucosidase) , CD34 (human hematopoietic stem cell and endothelial cell marker ) , HIF1 a (Hypo ia- indue ible factor 1ᅳ alpha), K i -67 (Antigen KI— 67), 또는 Cyclin Dl의 niRNA 혹은 단백질 발현이 증가되어 있는 것 으로 알려져 있다.
한편, TM4SF5( transmembrane 4 L6 family member 5) 단백질은 테트라스패 닌 (tetraspanin)의 한 종류로 알려져 있다. TM4SF5 단백질은 비수용성의 단백질 로서 세포막을 통과하는 4개의 영역 , 세포 외부에 존재하는 2개의 고리구조. 세 포질 내에 존재하는 하나의 고리구조, 및 2개의 말단구조를 포함한다. 이들 단백 질은 인테그린과 같은 세포 부착 분자와 세포막에서 복합체인 거대한 테트라스패 닌-웹 (tetraspanin-web) 또는 테트라스패닌—풍부한 마이크로도메인 (tetraspnin- enriched microdomain, TERM)을 형성한다. 상기 복합체는 세포의 부착, 증식 및 이동 등과 같은 다양한 생물학적 기능에 기여한다 . TM4SF5 단백질을 사람의 간암 세포에서 과발현되는 것으로 알려져 있다.
이와 관련하여. 대한민국 등록특허 제 10-0934706호에는 TM4SF5 단백질을 발현하는 암세포를 이용하여 항암물질을 스크리닝하는 방법과 TM4SF5 단백질의 활성을 억제하는 화합물을 포함하는 항암용 조성물을 개시하고 있다. 이에 . 본 발명자들은 TM4SF5 단백질의 발현 변화를 이용하여 간질환을 진 단하는 방법을 개발하고자 노력하던 중, TM4SF5 단백질이 과발현 (transgenic mouse; TG mouse)되었거나, Tm4sf5 유전자를 녹아웃 (knockout: 1(0 mouse)한 형질 전환 마우스에서 확보한 간조직 혹은 간세포에서 (1) Srebpl (Sterol regulatory element -binding protein 1), Srebp2 (Sterol regulatory element -binding protein 2), Fasn (Fatty acid synthase) , CD36 (cluster of differentiation 36) , Fabpl (Fatty Acid-Binding Protein 1), V 1 d 1 r (very- low-dens i ty- ) (()s) vls一 ς一¾9osuoll E 9suoouDrt il:n- Isl > >-- - -
! (ε!) jS s ppᅳ V.1?¾ l T lsr §jsueouesnue-- -
Figure imgf000010_0001
!二一lp一(n p二lq寸jpu eatosue 30 : odcatQssessn> - (free fatty acid. FFA), 콜레스테롤 (cholesterol) . 알라닌 아미노트랜스퍼라제 (alanine ami not ransf erase, ALT), 아스파르산 아미노트랜스퍼라제 (aspartate aminotransferase, AST) , LDL (ᄂ owᅳ densi ty lipoprotein), 글루코스 (glucose) , 또 는 인슐린 (insulin)의 수준을 확인하고, (5) 체중의 증가를 측정하고. 체중 /간무 게의 증가를 측정하여 TM4SF5가 지방간 및 지방간염 , 간성유화에 긍정적인 역할 함을 밝히고. 상기 형질전환 TG 마우스를 계속 사육하면 상기 niRNA 및 단백질의 발현이 변화하고 상기 단백질의 인산화가 변화하여 간섬유화, 간염 . 간경화. 또 는 간암의 특징을 나타냄을 확인하고, Tm4sf5 유전자가 결여된 K0 마우스의 경우 에는 상기 TG마우스에서 확인된 인자들의 mRNA 및 단백질들의 발현 및 인산화의 변화가 의미 없었거나, 비만 및 대사질환을 유발할 수 있는 고지방 식이, 고탄수 화물 식이, 고아미노산 (아르기닌), 또는 고수크로즈 (sucrose) 식이에 따른 글루 코스 (포도당) 저항성. 인슐린 저항성 , 체중 증가가 유발되는 정도가 미약해지고, 혈장 내 중성지방, 콜레스테롤. AST/ALT 수치 등의 증가가 미약해지는 것을 확인 함으로써 , TM4SF5의 발현에 의한 지방간, 간염 , 간섬유화, 간경화 및 간암을 포 함하는 간질환이 유발될 수 있다는 것을 확인하여, 본 발명을 완성하였다.
【선행기술문헌】
【특허문헌】
(특허문헌 1) 대한민국 등록특허 제 1으 0934706호 【발명의 내용】
【기술적 과제】
본 발명의 목적은 TM4SF5 단백질의 발현 변화를 이용하여 간질환을 진단 하는 방법을 제공하는 것이다.
본 발명의 다른 목적은 TM4SF5 단백질의 발현 변화를 이용하여 간질환을 치료하기 위한 후보물질 또는 항비만 후보물질을 스크리닝하는 방법을 제공하는 것이다 .
본 발명의 또 다른 목적은 TM4SF5 유전자가 녹아웃 (knock-out)된 마우스 를 이용하여 문맥암항진증 동물모델을 제조하는 방법 및 상기 방법으로 제조된 동물모델을 제공하는 것이다.
【기술적 해결방법】
상기 목적을 달성하기 위하여, 본 발명은 1) 간질환 의심 환자로부터 분 리된 시료에서 TM4SF5( transmembrane 4 L6 family member 5) 단백질의 발현 수준 이 정상 대조군에 비해 증가된 시료를 선별하는 단계:
2) 상기 단계 1)에서 선별된 시료에서 SREBP sterol regulatory element -binding transcription factor 1)의 niRNA 또는 단백질의 발현 수준 및 STAT3( si gnal transducer and activator of transcript ion 3) 단백질, c一 Src(cel lular sarcoma) 단백질 . FAK( focal adhesion kinase) 단백질 , niTOR . S6K, ULK. 4EBP1 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질 의 인산화 수준을 측정하는 단계: 및
3) 상기 단계 2)의 SREBP1의 niRNA 또는 단백질의 발현 수준 및 STAT3 단 백질, cᅳ Src단백질, FAK, niTOR, S6K, ULK. 4EBP1 및 Akt 단백질로 이루어진 그룹 에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 정상 대조군 시료의 SREBP1의 mRNA 또는 단백질의 발현 수준 및 STAT3 단백질, cᅳ Src단백질, FAK. mTOR. S6 . ULK, 4EBP1 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준과 비교하는 단계를 포함하는 간질환의 진단을 위한 정보 제공 방법을 제공한다.
또한, 본 발명은 1) TM4SF5 및 SREBP1 단백질을 발현하는 세포에 피검물 질을 처리하는 단계 ;
2) 상기 단계 1)의 세포에서 SREBP1 단백질의 mRNA 또는 단백질의 발현 수준 및 STAT3 단백질, c-Src단백질. FAK. mTOR. S6K, ULK, 4EBP1 및 Akt 단백질 로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 측정하 는 단계: 및
3) 상기 단계 2)에서 피검물질을 처리하지 않은 대조군에 비해 SREBP1 mRNA 또는 단백질의 발현 수준을 억제하고. STAT3 단백질, cᅳ Src단백질, FAK. mTOR, S(5R, ULK, 4EBP1 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 증가시키거나. 피검물질을 처리하지 않은 대조군에 비해 SREBP1 niRNA 또는 단백질의 발현 수준을 억제하고 , 모노아실 -(nionoacyl-) , 다이아실 -((Hacy卜). 또는 트라이아실一 (triacy卜) 글라이세를 (glycerol)의 합성 을 감소시키는 피검물질을 선별하는 단계를 포함하는 지방간 치료 후보물질의 스 크리닝 방법을 제공한다.
또한, 본 발명은 1) TM4SF5 단백질을 발현하는 세포 또는 동물모델에 피 검물질을 처리하는 단계:
2) 상기 단계 1)의 세포 또는 동물모델에서 TM4SF5 단백질과 mTOR 단백질, SLC7A1 단백질 및 아르기닌으로 구성된 군으로부터 선택되는 어느 하나 이상과의 결합을 측정하는 단계;
3) 상기 단계 1)의 세포 또는 동물모델에서 niTOR 단백질, S6K 단백질, UNC-51-like kinase KULK1) 단백질, 또는 4EBP1 단백질의 인산화를 측정하는 단 계;
4) 상기 단계 1)의 세포 또는 동물모델에서 모노아실 -(monoacy卜), 다이 아실ᅳ (diacy卜), 또는 트라이아실ᅳ (tr'iacy卜) 글라이세롤 (glycerol)의 수준을 측정하는 단계:
5) 상기 단계 1)의 세포 또는 동물모델에서 체중 증가, 포도당 저항성, 인슐린 저항성 및 해당과정의 반웅성으로 구성된 군으로부터 어느 하나 이상을 측정하는 단계: 및 6) 상기 단계 1)의 세포 또는 동물모델에서 해당과정 관련된 유전자들의 발현 정도를 측정하는 단계; 및
7) 상기 단계 2)에서 TM4SF5 단백질과 niTOR 단백질, SLC7A1 단백질 및 아 르기닌으로 구성된 군으로부터 선택되는 어느 하나 이상과의 결합을 억제하고. 단계 3) niTOR 단백질, S6K 단백질, UNC-51-!ike kinase 1(ULK1) 단백질, 또는 4EBP1 단백질의 인산화를 억제하며, 단계 4)에서 모노아실- (monoacyl-), 다이아실- (cliacyl-), 및 트라이아실ᅳ (triacy卜) 글라이세를 (glycerol)의 수준을 감소시키 고, 단계 5)에서 체증 증가, 포도당 저항성, 인슐린 저항성 또는 해당과정의 반 응성을 감소시키는 피검물질을 선별하는 단계를 포함하는 항비만, 지방간, 또는 간암 치료 후보물질의 스크리닝 방법 을 제공한다.
또한. TM4SF5 유전자가 녹아웃 (knock-out , K0)된 마우스를
APCmim/+( adenomatous polyposis colimm/+)의 유전형을 갖는 마우스와 교배하는 단 계를 포함하는 문맥압항진증 (portal hypertension) 동물 모¾ 제조 방법을 제공 한다.
나아가, 본 발명은 상기 방법으로 제조된 문맥압항진증 동물 모델을 제공 한다. 【발명의 효과】
본 발명은 TM4SF5 단백질이 과발현된 세포 및 형질전환 마우스에서 대사 기능이 저해되고 체중이 증가하며 , 탄수화물, 지방, 및 아미노산 고함유 식이에 의하여 SREBPl 단백질과 같은 TM4SF5 발현-의존적인 단백질들을 포함하는 지방의 생합성에 관련된 인자들의 mRNA 및 단백질들의 발현과 축적이 증가하고. STAT3 단백질, (: -Src단백질, FAK 단백질, mTOR 단백질, S6K 단백질, LiL 단백질, 4EBP1 단백질 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화가 감소되어 비만. 지방간 및 간염의 특징을 나타내고, 상기 형질전환 마 우스를 계속 사육하면 SREBPl 단백질의 발현이 감소하고, STAT3 단백질의 인산화 가 증가하고 콜라젠, 라미닌 등 세포외기질의 발현 축적이 증가하여 간성유화 또 는 간경화의 특징을 나타냄을 확인함으로써 , TM4SF5 단백질의 발현 변화를 측정 하여 비만 및 간질환을 진단하거나, 비만 혹은 간질환 치료제 후보물질을 스크리 닝하는데 유용하게 사용될 수 있다.
【도면의 간단한 설명】
도 1은 TM4SF5 단백질을 발현하는 컨스트럭트의 모식도 (A ) 및 상기 컨스 트릭트가 도입된 형질전환 마우스의 간조직으로부터 TM4SF5 유전자의 발현을 확 인한 결과 (B)를 나타낸 도면이다.
도 2는 TM4SF5 단백질이 과발현된 형질전환 마우스 ( 52주령 )의 간조직을 관찰한 사진 ( A ) : 상기 마우스의 간조직을 H&E . 오일 레드 0 또는 메이슨의 트리 크롬으로 염색한 결과 사진 ( B ) ; 조직을 해당 항체를 이용하여
14 iiiimunohistochemsitryl- 수행하 ¾을 경우, 1년된 TM4SF5 과발현 동물의 간조직에 서 STAT3의 인산화 정도가 낮고, 대신에 SREBP1의 발현이 높거나 (Fatty liverhigh) 낮은 fatty liverl0,v) 정도를 정상 대조군 (normal )과 대비하여 발병정도를 확인한 결과 그래프 (C): 및 상기 마우스의 혈장에서 트리글리세라이드. 알부민 및 ALT의 수치를 확인한 결과 그래프 (D)이다.
도 3은 TM4SF5 단백질이 과발현된 형질전환 마우스 (52주령 )의 간조직에서 지방간과 관련된 유전자 (A) 및 단백질 (B)의 발현을 확인하고, 상기 마우스의 간 조직을 면역염색으로 확인한 결과 도면 (C)이다.
도 4는 TM4SF5 단백질이 과발현된 동물로부터 분리한 간세포에서 지방이 축적되고 (A), 지방과 관련된 유전자의 발현 변화를 확인한 결과 그래프 (B 및 Cᅳ) 및 정상 혹은 Tm4sf5— /+ 녹아웃 동물을 굶겼다가 다시 음식을 제공 (refed)하였을 경우, 정상동물에서는 증가하지만 녹아웃동물 간조직에서는 증가하는 정도가 미 미한 ApoBlOO, Ldlr, Srebp2, Ppar γ , 및 leptin 유전자들에 대한 분석정보 (D)이 다.
도 5는 TM4SF5 단백질이 과발현된 간세포에서 SREBP1 단백질의 발현 및 STAT3 단백질의 인산화 변화 및 PPARy 단백질의 발현을 확인한 결과 (A): STAT3 단백질의 안산화의 SREBP1 단백질 발현의 상호작용을 간상피세포에 자유지방산 (free fatty acid)을 처리하여 확인한 결과 (B): 및 SREBP1 단백질의 발현 증가에 의해 STAT3 단백질의 인산화 변화 (C)를 확인한 결과 도면이다.
15 도 6은 TM4SF5 단백질의 발현이 억제된 지방세포에서 지방의 생성 억제 (A) 를 확인, 지방과 관련된 유전자의 발현 억제 (B)를 확인, 지방세포 (3T3-L1)가 분 화해 나감에 따라 발현 양이 증가하는 SREBP1 (전구체인 pSREBPl과 성숙한 형태의 mSREBPl), Ppar γ와 지방세포가 분화해 나감에 따라 그 양이 감소하는 STAT3 단 백질의 인산화를 확인 (C)한 도면이다.
도 7은 14SF5 단백질을 과발현하는 형질전환 마우스 (52주령 )의 간조직에 서 SIRT 유전자들의 발현 변화 (A); SOCS 단백질들의 발현 변화 (B): SOCS 유전자 들의 발현 변화 (C): 및 지방전구세포를 배양한 배양 배지를 얻어 TM4SF5 단백질 올 발현하는 간상피세포에게 처리하여 배양한 후 S0CS3 단백질 발현 변화 (D)를 확인한 결과 도면이다.
도 8은 TM4SF5 단백질이 과발현된 간상피세포에서 혹은 TM4SF5를 과발현 하지 않더라도 자유지방산을 처리한 간상피세포에서 S0CS1 및 S0CS3 유전자 (A) 및 단백질 (B 및 C)의 발현 변화를 확인하고, SREBP1 단백질이 과발현된 간세포에 서 S0CS1 및 S0CS3 단백질의 발현 변화 (D)를 확인하고, 52주된 14SF5 과다발현 유전자변형동물 (transgenic mice)로부터 분리한 primary 간상피세포에서 S0CS3 단백질의 발현을 억제시켰을 경우, SREBP1 단백질의 양이 감소하고. STAT3 단백 질의 인산산화가 증가 (E)하는 것을 확인한 결과 도면이다.
도 9는 정상동물 (WT), Tin4sf5 유전자 K0 마우스 (실시예 7의 방법으로 제 조한 K0 마우스인 Exon 1-K0 또는 마크로젠에서 제작한 마우스인 Exon 3-K0) 또
16 는 heterozygote Exon 1-KO 마우스를 3개월 혹은 (3개월 동안 정상식이를 통하여 간무게 및 체중을 측정하고 각 수놈 (male. A)과 암놈 (female, B)의 경우에 있어 녹아웃마우스의 경우가 정상동물의 경우에 대비하여 간무게 /체중의 비율이 감소 함을 확인하는 도면이다.
도 10은 정상동물 (WT), Tm4sf5 유전자 녹아웃 (Tni4sf5— /_ K0) 마우스에게 정상식이 (Chow) 또는 열량 60 kCal/kg을 발생시키는 고지방식이 (high fat diet, HFD)를 10주 동안 자유 급식하였을 경우, WT 및 Tm4sf5-/- K0 마우스의 체중 변 화를 매주 확인 (A)하고, 10주 후 총 체중변화 정도를 확인 (B)하고, 각 동물의 간 조직에서의 콜레스테롤 (C)와 free fatty acid (FFA, D)를 확인한 도면이다. 도 11은 정상동물 (WT). heterozygote Tm4sf5 유전자 녹아웃 (Tni4sf5'/+ K0) 마우스에게 정상식이 (Chow) 또는 열량 60 kCal/kg을 발생시키는 고지방식이 (high fat diet, HFD)를 10주 동안 자유 급식하였을 경우. 유전자 Tm4sf5(A), Srebpl, Srebp2, LdlR, 및 ApoBlOO(B)의 iuRNA의 발현 수준을 확인하였고, 혈장 내에 존재하는 콜레스테롤, 자유 지방산 (free fatty acid)의 양을 확인 (C)한 도 면이다.
도 12는 TM4SF5 유전자 녹아웃 (1(0) 마우스에서 S0CS1 및 S0CS3 유전자 (A) 및 단백질 (B)의 발현 변화와, 상기 마우스에 고지방 식이 (high fat diet . HFD)를 섭취시키고 지방 축적 여부를 확인 (C)하고, 지방과 관련된 유전자의 mRNA 및 단 백질의 발현 변화 (D)를 확인한 결과 도면이다.
17 도 13은 TM4SF5 유전자 K0 마우스와 APCmim/+ 마우스를 교배하여 수득된 자 손에서 TM4SF5 및 APC 유전자의 발현 변화 (A): 상기 자손의 해부 결과 (B): 상기 자손의 간조직에서 β-카테닌 및 HIFla 단백질의 발현 변화 (C): 상기 자손의 간 조직에서 콜라겐의 발현 변화 (D): 및 상기 자손의 간조직에서 지방관련 신호전달 기전 확인 (E) 결과를 나타내는 도면이다.
도 14은 TM4SF5 단백질이 과발현된 세포주에서 TM4SF5 단백질과 niTOR(A). SLC7AKB), 또는 SLC38A9(C)과의 결합을 확인하였고, TM4SF5 단백질을 발현하는 세포외부에 아미노산을 없앴다가 다시 제공하였을 경우에 TM4SF5 단백질의 발현 이 억제된 세포보다 S(3 . UNC-51—like kinase KlL l) 또는 4EBP1의 인산화가 증 가됨 (D와 E)을 확인한 도면이다.
도 15는 TM4SF5 유전자 K0 (Tm4sf 5— /+— 1(0) 마우스의 간조직에서 아르기나 아제 1, Tm4sf5, 및 Tm4sf4 유전자의 발현 변화 (A); TM4SF5 단백질과 Cast or 1 단 백질이 대조군 단백질 MetaP2에 대비하여 L-아르기닌에 더 강하게 결합 (B); TM4SF5 단백질이 유사한 다른 단백질 TM4SF1이나 TM4SF4보다 아르기닌과의 더 강 하게 결합 (C); 세포 추출액 (cell extract)에 존재하는 TM4SF5 단백질 또는
TM4SF5-LEL도메인 (long extracellular loop) 세포막추출액 속의 TM4SF5 혹은
TM4SF5 재조합 단백질과 L-아르기닌과의 농도 의존적 결합을 확인하고 결합정도 를 나타내는 IC50 농도를 확인 (D와 E), TM4SF5 단백질들 중 전체부위 (full length, FL). SEL( short extracellular loop, SEL), 또는 LEL도메인들과 L-아르
18 기닌 사이의 결합을 확인한 결과 (F), 및 TM4SF5의 LEL 도메인 중 다수의 아미노' 산에서 돌연변이가 존재하는 TM4SF5 돌연변이 단백질과 L-아르기닌이 결합하지 못함을 확인 (G)한 결과 도면이다.
도 16은 정상마우스 (WT), Tin4sf5 유전자 녹아웃 (Tm4sf5— Λ 0) 마우스에 게 정상 식이 (Chow) 또는 열량의 70%를 탄수화물에서 얻게되는 70% kCal 고탄수 화물 식이 (high carbohydrate diet , HCD)를 10주 동안 자유 급식하였을 경우, WT 및 Tm4sf5— /_ 1(0 마우스의 체중 변화를 매주 확인 (A)하고, 10주 후 총 체중변화 정도를 확인 (B)하고, 각 동물의 포도당저항성 (C), 인슐린저항성 (D)을 확인하고, 혈.장에서의 AST( aspartate aminotransferase) . ALT( alanine aminotransferase) , 및 콜레스테를 수준 (E)을 확인한 도면이다.
도 17는 고아르기닌 식이 (high arginine, HR)를 섭취한 TM4SF5 유전자 1(0 마우스의 체증변화 (A), 고아르기닌 식이 시작점 대비 체중 증가 (B), 및 상기 마 우스의 간조직에서 지방 축적 여부 (C)를 확인한 결과 도면이다.
도 18는 TM4SF5 단백질의 발현된 세포주에서 S6K 단백질의 인산화 여부 (A), TM4SF5 단백질의 억제에 의한 글루코스 반응성 변화 (B), 및 TM4SF5 단백질 의 억제에 의한 해당작용 관여 유전자의 발현 변화 (C)를 확인한 결과 도면이다. 도 19은 TM4SF5 유전자 K0 마우스에서 고수크로즈 (high sucrose) 식이 (고농도의 수크로즈 AIN-93G diet : suaᅳ ose의 함량이 3.15%인 chow diet에 대비 하여 10%로 수크로즈 농도가 3배 이상 높게 함유됨) 섭취에 의한 체중의 변화를
19 매주 측정하여 3주 혹은 10주 동안 측정한 결과 (A)이고. 포도당저항성 및 인슐린 저항성을 확인한 결과 (B), 혈장에서의 AST, ALT, 콜레스테를 (total cholesterol, TCHO) , 및 triacy卜 glycerol (TG)의 수준 (C), 간조직의 廳 을 통한 조직의 lipid droplet의 축적 여부 (D). 모노아실- (nionoacyl-) . 다이아실 -(diacyl-) , 및 트라 이아실 -(triacy卜) 글라이세롤 (glycerol)의 수준 (E)을 확인한 도면이다.
도 20은 TM4SF5 단백질이 과발현된 형질전환 마우스 ( 78주령 )의 간조직에 서 간조직의 표현형을 확인한 결과 (A): 골수외조혈(6>; -31 (1111130- hematopoiesis) , 지방간 (steatohepat i t i s ) 간섬유화 (fibrosis) 의 표현형을 통 계적으로 확인한 결과 (B): 및 상기 간조직에서 지방과 관련된 단백질들의 발현 변화 (C)를 확인한 결과 그래프이다.
도 21은 TM4SF5 단백질이 과발현된 형질전환 마우스 (78주령 )의 간조직에 서 S0CS 단백질, ECM 및 STAT3 인산화의 변화를 확인한 결과 (A) 및 지방대사와 관련된 유전자의 발현 변화 (B 및 C)를 확인한 결과 그래프이다.
도 22는 사염화탄소 (CC14) 약물의 4주 혹은 16주 처리로 간질환을 유도한 동물모델의 간조직에서 콜라젠의 축적을 염색을 통해 관찰한 결과 (A) 및 TM4SF5 유전자 (Tm4sf5— Λ -K0) Κ0 마우스에 약물로 간질환을 유도한 동물모델의 간조직을 관찰 (Β)하고 콜라렌의 축적을 염색을 통해 관찰 (C)한 결과를 나타내는 도면이다. 도 23은 사염화탄소 (CC14) 약물로 간질환을 유도한 동물모델의 간조직에 서 섬유화와 관련된 단백질 (A) 및 유전자 (B)의 발현 변화를 확인한 도면이다.
20 도 24은 사염화탄소 (CCl ) 약물로 간질환을 유도한 동물모델의 간조직에 서 섬유화와 관련된 단백질의 발현 변화를 면역염색법으로 확인한 도면이다.
도 25는 사염화탄소 (CC14) 약물로 간질환을 유도한 동물모델의 간조직에 서 분리한 primary 간상피세포을 이용하여 TM4SF5(A) 및 STAT3(B) 단백질의 발현 억제에 의한 콜라겐, 라미닌 발현 및 STAT3, STAT5, 및 F 단백질의 인산화의 변화를 확인한 도면이다.
도 2(3은 사염화탄소 (CC14) 약물로 간질환을 유도한 동물모델의 간조직에 서 확보한 간상피세포 혹은 HepG2 간상피세포를 이용하여 IL-6에 의한 콜라젠, 라미닌. 라미닌 γ2 단백질의 발현 및 STAT3. FAK, 및 c— Src 단백질의 인산화 변 화 (A); 라미닌에 의한 단백질 발현 변화 (B): c-Src 단백질의 활성 억제제 (PP2) 처리에 의한 라미닌 단백질 발현 및 STAT3와 c-Src의 인산화 변화 (C): 및
TM4SF5 단백질의 발현 억제에 의한 STAT3 단백질의 인산화 및 콜라젠, 및 라미닌 단백질의 발현 변화 (D)를 확인한 도면이다.
도 27는 STAT3 단백질의 인산화가 라미닌의 프로모터를 통해 이의 발현을 조절하는지 확인하기 위해 제조된 컨스트럭트의 모식도 (A) 및 간상피세포 (AML12) 또는 간성상세포 (LX2 세포)에서 라미닌 γ2 (Lamc2, B) 또는 콜라젠 1 α 1 (Collal, C)의 프로모터가 STAT3 단백질에 의해서 조절되는지 확인한 결과 (B와 C) 를 나타내는 도면이다.
도 28는 사염화탄소 (CC14) 약물의 4주 혹은 16주 처리로 간질환을 유도한
21 동물모델에서 TM4SF5 단백질에 의한 TM4SF5 단백질과 라미닌 단백질의 공동발현 변화를 확인한 결과 (A), 상기 동물모땔의 간조직에서 알부민, α-SMA 및 콜라겐 의 발현변화를 확인한 결과 (B 및 C). 및 TM4SF5 단백질의 발현을 억제시킨 HepG2 세포에서 콜라겐, 라미닌, 및 라미닌 γ2의 발현 변화와 STAT3의 인산화를 확인 한 결과 (D 및 Ε)를 나타내는 도면이다.
도 29은 라미닌 또는 콜라겐의 발현을 억제 시킨 사염화탄소 (CC14) 약물로 간질환을 유도한 동물모델에서 간 조직을 관찰한 결과 (A), TM4SF5, 콜라 겐, 라미닌, a-SMA 및 TGFP 단백질의 ni NA 발현 변화를 확인한 결과 (B)이고, TM4SF5, 콜라겐, 라미닌. 라미닌 γ2, 단백질 발현과 STAT3의 인산화 변화를 확 인한 결과 (C)를 나타내는 도면이다.
도 30은 TM4SF5 단백질이 과발현된 마우스의 간조직을 관찰한 결과 암조 직으로 여겨지는 nodule을 확인 (A), 간암 마커들의 발현 변화를 확인한 결과 (B 및 E), 염증 관련 유전자들의 발현 변화 (C), 및 CD34, Ki67, Cyclin D1. 및
HIFl-a의 발현 변화 (D). 라미닌의 발현과 STAT3의 인산화 확인 (E), 혈장 내 AST ALT, 알부민, LDL( low-density lipoprotein), 트리글리세라이드 (triglyceride의 수준 (F)를 확인한 결과를 나타내는 도면이다.
도 31은 dieth lnitrosamine(DEN) 약물로 간암을 유발시킨 동물모델에서 간조직을 관찰한 결과 (A), TM4SF5 및 라미닌 단백질의 발현 변화와 STAT3의 인산 화를 확인한 결과 (B). TM4SF5, 인산화된 STAT3, 라미닌 ( laminins) , 라미닌
22 2(laminin γ 2) 및 콜라겐 KcoUagen I)의 발현 변화를 조식염색을 통하여 확 인한 결과 (C)를 나타내는 도면이다.
도 32는 간암 환자로부터 수득한 간암조직 (HCC-tumor) 및 암조적 -주변 (tumor-near)에서 인산화된 STAT3 , 라미닌 ( laminins) 및 콜라겐 KcoUagen I)의 발현 변화를 확인한 결과를 나타내는 도면이다.
【발명을 실시하기 위한 최선의 형태】
이하, 본 발명을 상세히 설명한다. 본 발명은 1) 간질환 의심 환자로부터 분리된 시료에서
TM4SF5( transmembrane 4 L6 family member 5) 단백질의 발현 수준이 정상 대조군 에 비해 증가된 시료를 선별하는 단계:
2) 상기 단계 1)에서 선별된 시료에서 SREBPKsterol regulatory- element -binding transcript ion factor 1)의 mR A 또는 단백질의 발현 수준 및 STAT3( si gnal transducer and activator of transcription 3) 단백질, c- Src(cel hilar sarcoma) 단백질 , FAK( focal adhesion kinase) 단백질 . FAK( focal adhesion kinase), mTOR, S6K. UU(, 4EBP1 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 측정하는 단계: 및
3) 상기 단계 2)의 SREBP1의 niRNA 또는 단백질의 발현 수준 및 STAT3 단
23 백질, c-Src단백질, FAK, mTOR, S6K, UL , 4EBP1 및 Akt 단백질로 이루어진 그룹 에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 정상 대조군 시료의 SREBP1의 mRNA 또는 단백질의 발현 수준 및 STAT3 단백질. c—Src단백질, FAK. mTOR, S6K, ULK, 4EBP1 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준과 비교하는 단계를 포함하는 간질환의 진단을 위한 정보 제공 방법을 제공한다.
본 명세서에서 사용된 용어. "TM4SF5( transmembrane 4 L6 family member 5) 단백질''이란. 세포막을 4번 통과하는 막수용체 그룹인 테트라스패닌, 테트라 스판 또는 TM4SF( transmembrane 4 super family)에 포함되는 단백질로서, 세포막 을 4번 통과하는 서로 유사한 구조로 이루어진다. 상기 TM4SF5 단백질은 생화학 적으로 막횡단영역 (transmembrane domain)으로 추정되는 4개의 소수성 부위를 포 함하는 구조를 공유하고 있다.
본 명세서에서 사용된 용어. "SREBPKsterol regulatory element -binding transcription factor 1) 단백질"이란, 유전자의 프로모터에 결합되어 전사를 조 절하는 전사인자로서 스테롤 생합성 (sterol biosynthesis)에 관여하는 유전자의 발현을 조절하는 인자를 의미한다. 상기 SREBP1 단백질은 인슐린에 의해 발현이 조절되고, 글루코스 대사나 지방산 및 지방 생산에 관여하는 유전자의 발현을 조 절한다.
본 명세서에서 사용된 용어, "STAT3(signal transducer and activator of
24
Figure imgf000027_0001
M . tascrirn-
Figure imgf000028_0001
βg g p,¾,/ taott bG(rnsorminrhacoreta)80roten TF 1fw fi 1) 1 --.
y,ct,(e tre creojit twatSsootuscct)coocthlllrn (stu ciSA cimh ml;iin Mllnirin 6)pl I - ώ Stir6 (아르기닌), 고수크로즈 (sucrose) 식이는 비만 및 대사질환과 관련되는 식이이며 혈장의 포도당 저항성 , 인슐린 저항성 , 중성지방, 콜레스테롤, 혹은 AST/ ALT 수 치을 측정하거나, 체중증가가 유발되는 정도를 확인함으로써 지방간, 간염 . 성유 화 및 간암을 포함하는 간질환의 유발 여부를 확인할 수 있다. 특히. 수크로즈는 체내에서 fructose와 glucose로 분해되어 세포에게 이용되므로, 고농도의 수크로 즈 섭취는 고농도의 fi-uctose의 섭취효과가 있을 수 있으며, 이는 탄산음료 (가당 음료), 주스, 아침식사용 시리얼등에 단맛을 위해 많이 포함되고 있어 당뇨병, 비만 등 대사질환의 원인이 되고 있다 (Journal of Korean Oriental Association for Study of Obesity 2005:5(1): 121-131],
본 명세서에서 사용된 용어 , 간질환은 비만, 대사장애. 포도당저항성 , 인 술린저항성 . 체중증가. 지방간, 간섬유화증. 간염. 간경화증, 또는 간암을 포함 하는 것일 수 있다.
본 발명의 정보 제공 방법에서 사용된 TM4SF5, SREBP1. Srebp2, Fasn. CD36, Fabpl, ApoBlOO, Ppar a , Ppar γ , Leptin, Acc a . AccP STATS , 콜라겐 I 형 a 1 체인 (collagen type I alpha 1 chain). 라미닌 ( laniinin) , 및 라미닌
Y2(laminin γ2) 단백질은 통상의 기술분야에 알려진 어떠한 아미노산 서열로 구성된 폴리펩티드일 수 있다. 상기 폴리펩티드는 단백질의 기능에 영향을 미치 지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입 , 치환 또는 이들의 조합에 의 해 상이한 서열을 갖는 아미노산의 변이체 또는 단편을 포함할 수 있다. 분자의
27 활성을 전체적으로 변화시키지 않는 단백질 또는 펩티드에서의 아미노산 교환은 통상의 기술분야에 공지되어 있다. 상기 폴리펩티드는 경우에 따라 인산화, 황화 아크릴화, 당화. 메틸화, 파네실화 등으로 수식 (modification)될 수 있다.
본 발명의 일 실시예에서 , 상기 TM4SF5 단백질은 서열번호 1로 기재되는 아미노산 서열로 구성되는 폴리펩티드일 수 있다. 트리글리세라이드
(triglyceride. TG), Vldlr. Ldlr, 및 자유 지방산 (free fatty acid, FFA)은 통 상의 기술분야에 알려진 지방산 및 지방의 성분이다.
본 발명의 정보 제공 방법은 SREBP1 단백질의 발현 및 STAT3 단백질의 인 산화 수준 변화를 포함한 TM4SF5-의존적 인자 또는 세포, 조직 . 또는 개체에서 발생하는 특징을 확인하여 간질환의 진단을 위한 정보를 제공할 수 있다. 상기 간질환은 지방간. 간섶유화증. 간염 . 간경화. 또는 간암일 수 있다. 본 명세서에서 사용된 용어 . TM4SF5ᅳ의존적 인자는 TM4SF5 단백질의 발현 에 의존 (TM4SF5 단백질의 증가)하여 조직 또는 세포에서 mRNA 혹은 단백질이 증 가하는 것을 의미하며, 지방간의 경우 SREBP1. SREBP2, Fasn. CD36, Fabpl, Vldlr, Ldlr, ApoBlOO, Ppar a , Ppar γ , Leptin, Acc α , 및 Α( β이 있고. 간염 에는 MCP1, TGF β 1 , 및 F4/80 antigen이 있고. 간성유화에는 collagen I, collagen type I alpha 1 chain, laminins . 1 am i n ί n a 5. 1 am i n i n γ 2 , 및 laniinin γ3가 있고, 간암에는 AFP, FUCA(AFU) , CD34 , HIF1 α , i-(37, 또는
28 Cyc l i n Dl가 있다.
또한 , TM4SF5-의존적 인자에는 TM4SF5 단백질의 발현 ( TM4SF5 단백질의 증 가)에 따라 조직 또는 세포에서 인산화가 증가하는 신호 단백질이 포함될 수 있 고, 여기에는 STAT3 , c-Src , FAK, mTOR, S6K, ULKL 4EBP1 , 또는 Akt 단백질 이 속할 수 있다.
또한, TM4SF5-의존적 인자에는 TM4SF5 단백질의 발현 (TM4SF5 단백질의 증 가)에 따라 지방간 및 간염 (또는 지방간염 )이 발병됨에 따라 혈장 내에 증가하는 인자들이 포함될 수 있고, 여기에는 트리글리세라이드 ( triglyceride. TG), 자유 지방산 (free fatty acid, FFA). 콜레스테를 (cholesterol). 알라닌 아미노트랜스퍼라 제 (alanine aminotransferase. ALT). 아스파르산 아미노트랜스퍼라제 (aspartate aminotransferase, AST), LDL(Low-density lipoprotein), 글루코스 (glucose), 또 는 인슐린 (insulin)가 속할 수 있다.
TM4SF5—의존적 세포ᅳ 조직 , 또는 개체에서 발생하는 특징은 TM4SF5 단백 질의 발현 단백질의 증가)에 따른 간섬유화 발병에 따라 간세포의 손상, 세포 배열 패턴 무질서화. 또는 col l agen I 혹은 l anii ni n 합성 축적 증가 등이 포함될 수 있고.
TM4SF5 단백질의 발현 (TM4SF5 단백질의 증가)에 따른 동물 개체에서 체중 의 증가, 체중 /간무게의 증가, 고탄수화물 식이, 고수크로즈 식이 . 고지방 식이 , 저지방 /고탄수화물 식이 , 및 고아르기닌 식이에 따른 체중 증가, 인슬린 저항성
29 의 증가, 글루코즈 저항성의 증가. 지방간 및 지방간염의 증가. 또는 콜라렌 및 라미닌 등의 세포외기질 합성 증가 및 간 조직의 축적 증가 등이 포함될 수 있다 본 발명에 따른 정보 제공 방법에서 상기 SREBP1, SREBP2, Fasn, CD3G, Fabpl, Vlcllr, Ldlr, ApoBlOO, Ppar a , Ppar γ . Leptin, Acc α , 또는 Acc 단백 질의 수준이 정상 대조군에 비해 증가하고ᅳ STAT3 단백질, c-Src단백질, FAK 단 백질, inTOR 단백질, S6K 단백질, ULK 단백질, 4EBP1 단백질 및 Akt 단백질로 이 루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준이 정상 대조군 에 비해 감소하면 지방간으로 판단할 수 있고,
상기 SREBP1의 mRNA 또는 단백질의 발현 수준이 정상 대조군에 비해 증가 하고, 모노아실 -(monoacyl ), 다이아실 -(diacy卜) , 또는 트라이아실 -( tr iacy卜) 글라이세롤 (glycerol)의 수준이 정상 대조군에 비해 감소하는 경우 지방간으로 판단 할 수 있다.
상기 간암을 포함한 간질환으로 판단된 환자의 시료에서 TMSF5, AFP. FUCA(AFU). CD34, HIF1 α , Ki-67, 및 Cyclin Dl의 발현이 증가함을 확인할 수 있 고, TM4SF5 단백질은 inTOR, SLC7A1 단백질 또는 아르기닌과 결합하고 inTOR 단 백질, S6K 단백질, UNC-51-like kinase KULKl) 단백질. 또는 4EBP1 단백질의 인산화가 증가함을 확인할 수 있다. 상기 TM4SF5 단백질과 아르기닌과의 결합은 TM4SF5 단백질의 N-말단으로부터 124 내지 129번째 잔기에 의해 매개될 수 있다.
30 한편. 본 발명에 따른 정보 제공 방법에서 상기 SREBP1. SREBP2 , Fasn. CD36, Fabpl, Vldlr, Ldlr. ApoBlOO, Ppar a , Ppar γ . Leptin. Acc α , 및 Accf3 단백질의 발현 수준이 정상 대조군에 비해 감소하고. STAT3 단백질, c-Src 단백 질, FAK 단백질, 또는 Akt 단백질의 인산화 수준이 증가하고, collagen I.
laminin, laminin γ2. α-SMA의 발현이 증가하면 간섬유화증, 간염, 간경화증. 또는 간암으로 판단할 수 있다.
본 발명에 따른 정보 제공 방법에서 SREBP1 단백질의 발현 수준은 SIRT1, SIRT2, SIRT4, SIRT5, SIRT6 및 SIRT7로 구성된 군으로부터 선택되는 어느 하나 이상의 단백질에 의해 조절될 수 있다. 구체적으로, SREBP1 및 SREBP2 단백질의 발현 증가는 SIRTl, SIRT5 및 SIRT6 단백질의 발현이 감소하고, SIRT2, SIRT4 및 SIRT7 단백질의 발현이 증가함으로써 조겋될 수 있다.
상기 시료는 간질환에 의해 TM4SF5 및 SREBP1 , SREBP2, Fasn, CD36, Fabpl, Vldlr. Ldlr, ApoBlOO. Ppar a , Ppar γ . Leptin. Acc α , 또는 AccP 단백 질의 발현과 STAT3, c-Src, 또는 FAK 단백질에 대한 인산화 수준이 변화할 수 있 는 시료라면 어떠한 시료도 사용할 수 있다. 구체적으로, 상기 시료는 소변, 혈 액, 혈청, 혈장 또는 뇌척수액일 수 있다.
상기 단백질의 발현 수준 또는 단백질의 인산화 수준은 통상의 기술분야 에 알려진 어떠한 방법으로도 측정될 수 있다. 구체적으로. 단백질의 발현 수준 은 웨스턴 블롯. 효소-면역화학 검출법 (ELISA). 단백질체 분석. 면역조직화학 염
31 iggpyp s.cc/, A atee te a FS0nin a coanla34lllh 1
Figure imgf000034_0001
chain), AFP(Alpha-fetoprotein) , FUCA(AFU, alpha-L-fucosidase 1), CD34 , HIFl a (Hypoxia-inducible factor), Ki-67, 및 Cyclin Dl로 구성된 군으로부터 선택되는 어느 하나 이상의 ni NA 또는 단백질의 발현을 측정하는 단계를 추가로 포함할 수 있다. 상기 SIRT1, SIRT5, SIRT6, laminin α5. laminin γ2 또는 laminin γ3의 mRNAs 또는 단백질의 발현 수준이 정상 대조군에 비해 감소하고, SREBP2, SREBPlc , CD36, FABPl , FASN, LDLR, VLDLR, PPAR γ , TIMPl, TGF l, TNFa , vinientin, MCPl, SOCSl , S0CS3, ApoBlOO, PPAR a , Leptin, Acc a , 또는 Acc 의 niRNA 혹은 단백질의 발현 수준이 정상 대조군에 비해 증가하고, 모노아 실- (nionoacyl-), 다이아실 -(di acy卜), 및 트라이아실 -(tr iacy卜) 글라이세를 (glycerol)의 수준이 정상 대조군에 비해 증가하고, STAT3 단백질, c-Src단백질, FAK 단백질, niTOR 단백질, S6K 단백질, ULK 단백질, 4EBP1 단백질 및 Akt 단백질 로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준이 정상 대 조군에 비해 감소하거나 변하지 않으면 지방간으로 판단할 수 있다. 한편, 상기 SREBP2, SREBPlc, CD36, FABPl, FASN, LDLR, VLDLR 또는 PPAR γ의 niRNA 또는 단 백질의 발현 수준이 정상 대조군에 비해 감소하거나 변하지 않고, SIRT1, SIRT5, SIRT6, TGF β 1 , TNFa , vinientin, laminin, laminin γ 2 , collagen I, SOCSl , S0CS3, F4/80 antigen, 콜라겐 I, 콜라겐 I형 a 1 체인 (collagen type I alpha 1 chain), AFP(Alpha-fetoprotein) , FUCA(AFU, alpha-L-fucosidase 1), CD34, HIFl a (Hypoxia-inducible factor), Ki-67, 또는 Cyclin Dl의 niRNA 또는 단백질
33 의 발현 수준이 정상 대조군에 비해 증가하고, MCP1, TGF β 1 , F4/80 antigen와 같은 사이토카인 /케모카인 인자들이 증가하거나 STAT3 단백질, c-Src단백질, FAK 단백질, niTOR 단백질, S6K 단백질, ULK 단백질, 4EBP1 단백질 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준이 정상 대조 군에 비해 증가하면 간섬유화증, 간염 , 간경화증. 또는 간암으로 판단할 수 있고 상기 SREBP2, SREBPlc , CD36, FABP1 , FASN, LDLR, VLDLR 또는 PPARy의 mRNA 또는 단백질의 발현 수준이 정상 대조군에 비해 감소하고, SIRT1, SIRT5, SIRT6, TGF β 1 , TNF α , viment in, laminin, laminin γ 2, collagen I, S0CS1, S0CS3 , F4/80 antigen, 콜라겐 I, 콜라겐 I형 cil 체인 (collagen type I alpha 1 chain), AFP(Alpha-fetoprotein) , FUCA (AFU, a lpha-L- fucosidase 1). CD34, HIFl a (Hypoxia- inducible factor), Ki-67, 또는 Cyclin Dl의 mRNA 또는 단백질 의 발현 수준이 정상 대조군에 비해 증가하고. AFP, FUCA (AFU), CD34, HIFl α , Ki-67, Cyclin Dl, laminin. collagen I, 또는 laminin γ 2의 mRNA 또는 단백질 의 발현 수준이 정상 대조군에 비해 증가하고, STAT3 단백질, c-Src단백질, FAK 단백질, mTOR 단백질, S6K 단백질, ULK 단백질, 4EBP1 단백질 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준이 증가하면 간암으로 판단할 수 있다.
상기 단백질의 발현 증가에 따라 지방간 및 간염이 발병함에 따라 서 혈장 내에서 트리글리세라이드 (triglyceride. TG), 자유 지방산 (free fatty
34 acid, FFA), 콜레스테롤 (cholesterol ) , 알라닌 아미노트랜스퍼라제 (alanine aminotransferase, ALT) , 아스파르산 아미노트랜스퍼라제 ( aspartate
aminotransferase, AST) ,
Figure imgf000037_0001
ty lipoprotein), 글루코스 (glucose) , 및 인슐린 (insulin)으로 구성된 군으로부터 선택되는 어느 하나 이상의 양이 증가될 수 있고. 상기 TM4SF5 단백질의 발현 증가에 따라 간성유화가 발병함에 따라서 조직에서 간세포의 손상, 세포 배열 패턴 무질서화, 또는 콜라겐 I 또는 라미닌 합성 축적 증가가 나타날 수 있고, 상기 TM4SF5 단백질의 발현 증가에 따라 환자 에서 체중의 증가, 체중 /간무게의 증가, 고탄수화물 식이. 고지방 식이 , 저지방 / 고탄수화물 식이, 고아르기닌, 및 고수크로즈 (sucrose) 식이에 따른 체중 증가, 인슐린 저항성 증가, 글루코즈 저항성 증가, 지방간 및 지방간염의 증가, 또는 콜라겐 및 라미닌 등의 세포외기질 합성 증가가 나타날 수 있다.
본 발명의 구체적인 실시예에서, 본 발명자들은 14SF5 단백질을 발현하 는 컨스트럭트가 형질전환된 마우스 (52주령 )를 제조하고 (도 1 참조), 상기 제조 된 마우스의 간조직에서 지방 형성이 촉진된 것을 확인하였다 (도 2 참조).
또한, 상기 제조된 형질전환 마우스의 간조직 또는 상기 간조직으로부터 간세포를 수득하여 지방간과 관련된 유전자 및 단백질의 발현 변화를 확인한 결 과, SREBPl, SREBP2 , SREBPlc , CD36, Fabpl, Fasn, Acc a . Acc , Ldlr, SOCSl 및 S0CS3 mRNA 또는 단백질의 발현이 증가하고, STAT3 단백질에 대한 인산화가 감소하고. 간조직에서 triglyceride(TG), AST, 및 ALT의 수준이 증가한 것을 확
35 인하였다 (도 2 및 3 참조). 또한 . 52주령의 TM4SF5 과발현 형질전환된 마우스로 부터 분리한 primary 간상피세포에 추가적으로 TM4SF5 유전자를 발현시키거나 자 유 지방산 (FFA)을 처리, 또는 IL6를 처리할 경우, 세포에 지방이 축적되고 동물 의 간조직에서 SREBP1, SREBP2 , SREBPlc, CD36, Fabpl, Fasn, Acc α , Acc β , Ldlr, S0CS1 및 S0CS3 niRNA의 발현이 증가하였다.
한편 TM4SF5 과발현되지 않은 정상동물에 비해서 Tm4sf5의 유전자가 heterozygote로 제거된 동물의 간조직에서는 ApoBlOO, LcllR, Srebp2. Ppary, leptin의 증가가 미약함을 확인하였다 (도 4 참조).
세포 모델에서도 TM4SF5를 과발현시키거나 TM4SF5 비발현 세포주에 자유 지방산 (free fatty acid)을 처리할 경우, SREBP1. Ppary 단백질의 발현이 증가가 STAT3 단백질의 인산화와 반대관계에 있음을 확인하였다 (도 5 참조).
지방세포 (3T3— L1)에 있어서도 TM4SF5의 발현에 의존적으로 지방이 축적 되고. Ppary , CD36, Fasn, Srebpl, 또는 Fabpl의 niRNA 및 단백질의 수준이 유지 됨을 확인하였다 (도 6 참조).
상기 SREBP1, SREBP2, 또는 SREBPlc niRNA 또는 단백질의 발현 증가는 SIRT1, SIRT5 및 SIRT6 유전자의 발현이 감소되고. SIRT2, SIRT4 및 SIRT7 유전 자의 발현이 증가함으로써 나타나며 , STAT3 단백질에 대한 인산화 증가는 S0CS1 및 S0CS3 유전자 및 단백질의 발현에 의해 조절됨을 확인하였다 (도 7 참조). 또한, 본 발명의 구체적인 실시예에서 , 52주령의 C57BLV6 정상동물로부터
36 분리한 primary 간상피세포에서 TM4SF5를 발현 또는 자유 지방산 (FFA)을 처리하 는 경우 S0CS1와 S0CS3의 발현이 TM4SF5 발현과 양의 상관성 (또는 연관성)을 가 짐을 확인하였고, SREBP1의 발현과 S0CS3의 발현과의 양의 상관성 (posi t iv'e feedback)을 가짐을 확인하였고, TM4SF5의 발현과 연계된 단백질들 (Srebpl.
Socsl, 및 Socs3)의 발현들은 STAT3 단백질의 인산화와는 음의 상관성 (negative feedback)을 가짐을 확인하였다 (도 8 참조).
나아가, 정상동물에 대비하여 , TM4SF5 유전자가 제거된 녹아옷 마우스 (TM4SF5 유전자 K0 마우스)의 경우 생후 3개월 혹은 6개월의 시점에서 암수 모두 간무게 /체중의 비율이 낮음을 확인하였다 (도 9 참조). 정상동물에 대비하여 . TM4SF5유전자가 제거된 녹아웃 마우스에게 고지방 식이를 10주간 자유 급식하였 을 경우, 정상동물은 정상 식이에 대비하여 체중의 증가가 뚜렷하였으나, 녹아웃 마우스의 경우에는 그 체증 증가가 미약하고 간조직 내 콜레스테를과 FFA의 수준 이 미약함 (낮음)을 확인하였다 (도 10 참조). 또한, 정상동물과는 달리 , Srebpl, srebp2, Ldlr, 및 ΑροΒΙΟΟ의 niRNA의 발현 수준이 고지방 식이에 따라 녹아웃 마 우스에서는 증가하지 않았고, 혈장 내에 트리글리세라이드 (triglyceride, TG), 자유 지방산 (free fatty acid, FFA)의 증가가 미약함을 확인하였다 (도 11 참조).
52주령의 C57BL/6 TM4SF5 녹아웃 마우스 (Tni4sf5— /+)의 간조직은 Socsl 및 Socs3의 niRNA 및 단백질의 수준이 정상마우스의 경우에 대비하여 감소하였고, 고 지방식이를 섭취하게 하였을 경우, 정상동물은 지방간염의 증상이 보였으나, 녹
37 아웃동물의 경우에는 그 정도가 미약하였고, 이때 Srebplc의 niRNA와 Srebpl의 단 백질이 감소하였다 (도 12 참조).
나아가, TM4SF5 단백질은. niTOR. SCL7A1 및 아르기닌과 결합을 형성함으 로써 , 아르기닌 수송에 관여하고. S61 (의 활성을 유발하는 것을 알 수 있었다 (도 14 및 15 참조).
TM4SF5 유전자 1(0 마우스는, 정상마우스와 달리, 고탄수화물 또는 아르 기닌 식이를 섭취하여도 체중 증가, 지방 축적 , 포도당 저항성. 인슐린 저항성, 또는 간조직의 손상이 억제되었다 (도 16 및 17 참조)
TM4SF5 유전자 K0 마우스는. 정상마우스와 달리, 미토콘드리아에 약물적 스트레스를 주어 세포외부산화도 측정 (ECAR, extracellular acidification rate) 을 함으로써 , 에너지생산을 위한 glycolysis의 기능이 감소함을 확인하였고 RNA- Seq 분석을 통하여 TO4SF5의 발현에 의존적으로 변하는 유전자들의 그룹을 확인 하였다 (도 18 참조). 나아가 14SF5 유전자 K0 마우스는 고수크로즈 식이에 의해 서 정상동물과는 달리 지방간 증상이 미약하였고, 혈장 내 AST, ALT, 및 총 콜레 스테를의 수준의 증가가 미약함을 확인하였으며. 지질성분을 분석하였을 경우, 모노아실- (monoacyl-), 다이아실 -(diacy卜). 및 트라이아실 -(triacyl-) 글라이 세를 (glycerol)의 함량이 정상마우스에 대비하여 Tm4sf5 유전자 0 마우스의 경 우에 낮음이 확인되었다 (도 19 참조).
또한, 본 발명자들은 TM4SF5 단백질을 발현하는 컨스트럭트가 형질전환된
38 마우스 (78주령)의 간조직에서 SREBP1 , SREBP2, SREBPlc , S0CS1 및 S0CS3 n舰 또 는 단백질의 발현이 TM4SF5 발현하지 않는 정상대조군에 대비하여 감소하거나 증 가하지 않고, STAT3 단백질에 대한 인산화가 증가하고, 지방간과 관련된 다양한 인자들의 수준이 정상동물에 존재하는 수준과 유사해 '지고 (증가하지 않고). 간성 유화 및 염증 관련한 유전자들의 niRNA 수준이 증가하고, 상기 간조직이 간성유화, 간경화 또는 간염 등의 표현형을 나타냄을 확인하였다 (도 20 및 21 참조).
나아가, 본 발명자들은 종래에 간질환이 유발된 동물모델 제조 방법에 따 라, CC14를 4주 혹은 16주 동안 투여하여 간성유화 /간경화의 간질환 동물모델을 제조하고, 상기 동물모델에서 간조직의 손상 및 콜라렌의 발현 축적을 확인하고 (도 22 참조), TM4SF5 단백질의 발현 및 STAT3 단백질에 대한 인산화가 증가와 더블어 콜라겐 및 라미닌을 이루는 폴리펩타이드 (chain)들의 niRNA 및 단백질들의 발현이 증가함을 확인하였다 (내지 23 참조). 또한, 상기 동물들의 간조직 염색을 통하여. 간섬유화 /간경화의 간질환 동물모델 및 pi-iniary 간상피세포로부터
TM4SF5 발현과 더불어 α-SMA' collagen I , laminin, 또는 laminin γ 2의 발현이 증가하고 STAT3, c-Src, FAK, 또는 Akt 단백질의 인산화가 상관성 있게 증가함을 확인하였다 (도 24, 도 25, 및 도 26 참조).
또한. 본 발명자들은 상기 STAT3 단백질에 대한 인산화는 콜라겐 I형 αΐ 체인 (collagen type I alpha 1 chain) 및 라미닌 γ 2( laminin γ2)의 프로모터에 결합함으로써 간성상세포에서는 콜라겐 및 간상피세포에서는 라미닌의 발현을 조
' 39 절함을 확인하였다 (도 27 및 도 28 참조).
또한, 본 발명자들은 정상동물에 laminin γ 2 혹은 collagen I ci 1의 chain의 발현을 억제하고 CC14를 처리하였을 경우, 간조직의 손상이 억제되고 TGF I, α-SMA, 라미닌. 또는 콜라겐의 발현과 STAT3 단백질의 인산화가 억제됨 을 확인하여 laniinin γ2 혹은 콜라겐 I형 al 체인의 발현이 간성유화에 중요함 을 확인하였다 (도 29 참조).
FVB/N 동물에 Tm4sf5 유전자를 과다발현하게 할 경우, 간조직에 종양을 시사하는 nodule이 확인되고, CD34, a-SMA, AFP, FUCA. laminin, laminin γ2, 콜라젠, MCP— 1, F4/80 antigen, Hifla. Ki67, 또는 Cyclin Dl의 mRNA 혹은 단백 질 발현이 증가하며, 혈장 내의 AST, ALT, LDL, 또는 tr iglyceride(TG)의 수준이 증가하였다 (도 30 참조). 또한, 정상동물에 DEN을 처리한 간암모델에서 간조직에 nodule의 생성과 간조직의 손상을 확인하고 TM4SF5, 라미닌, 콜라젠. 또는 laniinin γ2 의 발현이 증가하고 STAT3 단백질의의 인산화가 증가하는 것을 확인 하였다 (도 31 참조).
따라서. 상기로부터 간질환이 의심되는 환자의 간조직 시료의 암부위 또 는 암주변 부위에서 TM4SF5 단백질이 증가되었을 때. SREBP1, SREBP2, SREBPlc, 라미닌, 또는 콜라렌의 mRNA 또는 단백질의 발현 및 STAT3, c-Src , FAK, 또는 Akt 단백질의 인산화 수준을 측정함 (도 32 참조)으로써, 간질환을 진단하기 위한 정보 제공에 사용될 수 있음을 알 수 있다.
40 또한, 본 발명은 1) TM4SF5 및 SREBPl 단백질을 발현하는 세포에 피검물 질을 처리하는 단계 :
2) 상기 단계 1)의 세포에서 SREBPl 단백질의 mRNA 또는 단백질의 발현 수준 및 STAT3 단백질, c-Snr단백질, FAK, niTOR, S6K, ULK, 4EBP1 및 Akt 단백질 로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 측정하 는 단계; 및
3) 상기 단계 2)에서 피검물질을 처리하지 않은 대조군에 비해 SREBPl mRNA 또는 단백질의 발현 수준을 억제하고, STAT3 단백질, c-Src단백질, FAK, niTOR, S6K, ULK, 4EBP1 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 증가시키거나, 피검물질을 처리하지 않은 대조군에 비해 SREBPl mRNA 또는 단백질의 발현 수준을 억제하고, 모노아실 -(iiionoacyl-) , 다이아실 -((liacy卜), 또는 트라이아실 (triacy卜) 글라이세롤 (glycerol)의 합성 을 감소시키는 피검물질을 선별하는 단계를 포함하는 지방간 치료 후보물질의 스 크리닝 방법을 제공한다.
상기 TM4SF5, SREBPl, SREBP2, Fasn, CD36, Fabpl, ApoBlOO, Ppar α , Ppar , Lept in, Acc a , Acc β STAT3 , collagen type I , laminin, 및 laminin γ2 단백질은 상술한 바와 같은 특징을 갖는다. 일례로, 상기 TM4SF5. SREBPl 및 STAT3 단백질은 통상의 기술분야에 잘 알려진 어떠한 서열일 수 있고, 상기 서열 의 변이체 또는 단편을 포함할 수 있다. 구체적으로. 상기 TM4SF5, SREBPl 및
41 STATS 단백질은 각각 서열번호 1, 2 및 3으로 기재되는 아미노산 서열로 구성되 는 폴리펩티드일 수 있다. 또한, Triglyceride, Vldlr, Ldlr, free fatty acid는 통상의 기술분야에 알려진 지방산 및 지방의 성분이다.
본 발명에 따른 지방간 치료 후보물질의 스크리닝 방법은 TM4SF5.
SREBP1, Srebp2. Fasn. CD36. Fabpl . ApoBIOO. Ppara, Ppary, Leptin, Acca, 또는 Accp 단백질을 발현하는 세포에서 그 단백질들의 발현 및 STAT3, c-Src. FA (focal adhesion kinase), mTOR, S6K, ULK1, 4EBP1, 또는 Akt 단백질의 인 산화 수준 변화를 이용하여 지방간을 치료할 수 있는 후보물질을 스크리닝할 수 있다.
본 발명에 따른 간암의 치료 후보물질의 스크리닝 방법은 TM4SF5의 단백 질 발현과 더블어 CD34 , AFU, FUCA, laniinin γ2, HIFl α , 및 cyclin Dl 들로 구 성되는 그룹에서 선택된 어느 하나 이상과 함께 발현 증가를 확인하거나, TM4SF5 단백질과 mT0R, SLC7A1 단백질 또는 아르기닌과의 결합 여부를 확인하는 단계를 추가로 포함할 수 있다. 본 발명에 따른 스크리닝 방법으로 선별된 간암을 포함 하는 간질환 치료 후보물질은 상기 TM4SF5 단백질과 mTOR, SLC7A1 단백질 또는 아르기닌과의 결합을 억제할 수 있다. 본 발명의 구체적인 실시예에서. 본 발명자들은 TM4SF5 단백질을 발현하 는 형질전환 마우스를 제조하고, 상기 제조된 마우스의 간조직에서 지방 형성이
42 촉진되어 지방간의 표현형을 나타냄을 확인하였다 (도 1 및 2 참조). 또한, 상기 제조된 형질전환 마우스의 간조직 또는 상기 간조직으로부터 수득된 간세포에서 SREBP1, SREBP2, SREBPlc, CD36, Fabpl, Fasn, Acc α , Acc β , Ldlr, S0CS1 또는 S0CS3 ni NA 또는 단백질의 발현이 증가하고, STAT3 단백질에 대한 인산화가 감소하고. 간조직에서 triglyceride (TG), AST, 및 ALT의 수준이 증가한 것을 확인하였다 (도 2 및 3 참조), 이는 TM4SF5 단백질을 과발현하는 세 포 모델에서도 동일하였다 (도 5 참조ᅳ).
따라서 , TM4SF5 단백질을 발현하는 세포에서 SREBP1, SREBP2 , SREBPlc , CD36 , Fabpl, Fasn, Acc α , Acc , Ldlr, S0CS1 또는 S0CS3 단백질의 발현량 및 STAT3, c-Src. 또는 FAK 단백질의 인산화를 측정하여 지방간의 치료를 위한 후보 물질을 스크리닝할 수 있음을 확인하였다.
본 발명의 구체적인 실시예에서, 본 발명자들은 TM4SF5 단백질을 과발현 하는 형질전환 마우스를 제조하고, 상기 형질전환 마우스에서 지방 형성이 촉진 됨을 확인하고 (도 1 및 2 참조), TM4SF5 유전자가 녹아웃된 마우스에서는 정상 식이에 의해서도 체중이 정상마우스에 대비하여 증가정도가 미약하고 (도 9 참조), 고탄수화물 식이, 고지방 식이 . 고아르기닌, 고수크로즈 식이에 의해서도 정상동 물은 체중증가가 큰 반면, 녹아웃마우스에서는 체중 증가가 미약함을 확인하였다 (도 10, 도 11, 도 17. 도 19 참조).
또한, 본 발명은 TM4SF5 단백질을 발현하고, STAT3 단백질이 인산화된 세
43 포에 피검물질을 처리하는 단계: 상기 세포에서 SREBP1 단백질의 발현 수준 및 STAT3 단백질, c-Src단백질. FAK , mTOR , S6K , ULK , 4EBP1 및 Akt 단백질로 이루 어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 측정하는 단계: 상기 피검물질을 처리하지 않은 대조군에 비해 SREBP1 단백질의 발현 수준을 증 가시키고, STAT3 단백질의 인산화 수준을 억제하는 피검물질을 선별하는 단계를 포함하는 간성유화증ᅳ 간염 또는 간경화증 치료 후보물질의 스크리닝 방법을 제 공한다.
상기 TM4SF5 , SREBP1 및 STAT3 단백질은 상술한 바와 같은 특징을 갖는다. 일례로, 상기 TM4SF5 , SREBP1 및 STAT3 단백질은 통상의 기술분야에 잘 알려진 어떠한 서열일 수 있고, 상기 서열의 변이체 또는 단편을 포함할 수 있다. 구체 적으로, 상기 TM4SF5 단백질은 서열번호 1로 기재되는 아미노산 서열로 구성되는 폴리펩티드일 수 있다.
본 발명에 따른 지방간 치료 후보물질의 스크리닝 방법은 TM4SF5 및
SREBP1 단백질을 발현하는 세포에서 SREBP1 단백질의 발현 및 STAT3 단백질, c- Src단백질, FAK , mTOR . S6K , ULK , 4EBP1 및 Akt 단백질로 이루어진 그룹에서 선 택되는 어느 하나 이상 단백질의 인산화 수준 변화를 이용하여 간섬유화증, 간염, 간경화증, 또는 간암을 치료할 수 있는 후보물질을 스크리닝할 수 있다. 또한, 본 발명은 1 ) TM4SF5 단백질을 발현하는 세포 또는 동물모델에 피
44 검물질을 처리하는 단계 ;
2) 상기 단계 1)의 세포 또는 동물모델에서 TM4SF5 단백질과 niTOR 단백질, SLC7A1 단백질 및 아르기닌으로 구성된 군으로부터 선택되는 어느 하나 이상과의 결합을 측정하는 단계;
3) 상기 단계 1)의 세포 또는 동물모델에서 niTOR 단백질, S6K 단백질, UNC-51-like kinase 1(LLK1) 단백질 , 또는 4EBP1 단백질의 인산화를 측정하는 단계 :
4) 상기 단계 1)의 세포 또는 동물모델에서 모노아실 -(monoacyl-), 다이 아실 (diacyl-), 또는 트라이아실 -(triacy卜) 글라이세롤 (glycerol)의 수준을 측정하는 단계:
5) 상기 단계 1)의 세포 또는 동물모델에서 체중 증가, 포도당 저항성. 인슬린 저항성 및 해당과정의 반응성으로 구성된 군으로부터 어느 하나 이상을 측정하는 단계: 및
6) 상기 단계 1)의 세포 또는 동물모델에서 해당과정 관련된 유전자들의 발현 정도를 측정하는 단계: 및
7) 상기 단계 2)에서 TM4SF5 단백질과 niTOR 단백질, SLC7A1 단백질 및 아 르기닌으로 구성된 군으로부터 선택되는 어느 하나 이상과의 결합을 억제하고, 단계 3) niTOR 단백질. S6K 단백질, UNC-51-like kinase 1(ULK1) 단백질. 또는 4EBP1 단백질의 인산화를 억제하며 . 단계 4)에서 모노아실- (monoacyl-), 다이아실- (diacyl-), 및 트라이아실 -Uriacy卜) 글라이세롤 (glycerol)의 수준을 감소시키
45 고, 단계 5)에서 체중 증가. 포도당 저항성ᅳ 인슐린 저항성 또는 해당과정의 반 웅성을 감소시키는 피검물질을 선별하는 단계를 포함하는 항비만. 지방간. 또는 간암 치료 후보물질의 스크리닝 방법을 제공한다.
본 명세서에 사용된 용어 , mTOR는 mammalian target of rapamycin로 세포 의 대사 기능의 조절을 위한 허브 신호전달이라고 할 수 있다 (GenBank accession number: NM— 004958.3 )이고, "SLC7A1 (solute carrier family 7 member 1) 단백질 "은 세포막 및 라이소좀막에 존재하는 아르기닌수송체이다 (GenBank access i on number: M_003045.4) .
상기 TM4SF5 및 SLC7A1 단백질은 상술한 바와 같은 특징을 갖는다. 일례 로, 상기 TM4SF5 및 S1X7A1 단백질은 통상의 기술분야에 잘 알려진 어떠한 서열 일 수 있고. 상기 서열의 변이체 또는 단편을 포함할 수 있다. 구체적으로. 상기 TM4SF5 및 S1X7A1 단백질은 각각 서열번호 1 및 2로 기재되는 아미노산 서열로 구성되는 폴리펩티드일 수 있다.
본 발명에 따른 항비만 후보물질의 스크리닝 방법은 TM4SF5 단백질이 mTOR, SLC7A1 단백질 또는 아르기닌과 결합하는 것을 억제하는 피검물질을 선별 함으로써 , 항비만 및 간암세포 생존 억제 후보물질을 스크리닝할 수 있다. 상기 TM4SF5 단백질과 아르기닌과의 결합은 TM4SF5 단백질의 N-말단으로부터 124 내지 129번째 잔기에 의해 매개될 수 있다.
46 본 발명의 구체적인 실시예에서 . 본 발명자들은 TM4SF5 단백질을 과발현 하는 형질전환 마우스를 제조하고ᅳ 상기 형질전환 마우스에서 지방 형성이 촉진 됨을 확인하였다 (도 1 및 2 참조). 또한 이는 TM4SF5 단백질을 과발현하는 세포 에서도 동일하고, 상기 세포에서 TM4SF5 단백질이 mTOR, SLC7A1 및 아르기닌과 각각 결합하는 것을 확인하였다 (도 14 및 15 참조).
따라서, TM4SF5 단백질을 발현하는 세포에서 TM4SF5 단백질과 mTOR. SLC7A1 또는 아르기닌의 결합 억제 여부를 측정하여 항비만 및 항암용 후보물질 을 스크리닝할 수 있음을 확인하였다. 또한, 본 발명은 TM4SF5 유전자가 녹아웃 (knock-out, K())된 마우스를 APCmim/+의 유전형을 갖는 마우스와 교배하는 단계를 포함하는 문맥압항진증 동물 모델 제조 방법을 제공한다 (도 13 참조).
본 명세서에서 사용된 "APC(adenomatoLis polyposis coli) 유전자 "는 가족 성 대장선종증의 원인 유전자로서. 상기 APC 유전자로부터 합성된 산물은 β-카 테닌과 복합체를 형성하여 그 분해를 촉진시킨다.
상기 TM4SF5(GenBank Accession NO. 刚 _003963) 및 APC GenBank
Accession NO. M74088) 유전자는 통상의 기술분야에 알려진 어떠한 염기서열로 구성된 폴리뉴클레오티드일 수 있다. 상기 폴리뉴클레오티드는 TM4SF5 단백질을 암호화하는 어떠한 염기서열로 구성된 폴리뉴클레오티드일 수 있다. 본 발명의
47 TM4SF5 유전자는 서열번호 3으로 기재되는 염기서열로 구성된 폴리뉴클레오티드 일 수 있다. 상기 TM4SF5 유전자는 상기 서열번호 3으로 기재되는 염기서열과 70% , 80% , 90% , 95% 또는 99%의 상동성을 가질 수 있다. 본 발명의 구체적인 실시예에서 , 본 발명자들은 TM4SF5 유전자가 녹아웃 ( K0)된 마우스를 제조한 뒤 , 상기 마우스를 APCm im/+의 유전자형을 갖는 마우스와 교배하여 자손을 수득하였다 (도 13A 참조) . 상기 수득된 자손에서 문맥압항진증 의 증상을 나타내는 것을 확인하였다 (도 13B 참조) .
따라서 , TM4SF5 유전자 K0 마우스 및 APCm im/+의 유전자형을 갖는 마우스를 교배함으로써 문맥압항진증의 동물 모델을 제조할 수 있음을 확인하였다. 나아가, 본 발명은 상기 방법으로 제조된 문맥압항진증 동물 모델을 제공 한다.
상기 동물 모델은 상술한 바와 같은 제조 방법으로 제조될 수 있다. 일례 로, 상기 제조 방법은 TM4SF5 유전자 K0 마우스를 APCm im/+의 유전자형을 갖는 마 우스와 교배하는 단계를 포함할 수 있다. 이때, TM4SF5 및 APC 유전자는 상술한 바와 같은 특징을 가질 수 있으며, 이의 변이체 및 단편을 포함할 수 있다. 상기 TM4SF5 및 APC 유전자는 각각 서열번호 3 및 4로 기재된 염기 서열로 구성되는 폴리뉴클레오티드일 수 있다.
48 본 발명의 구체적인 실시예에서, 본 발명자들은 TM4SF5 유전자 K0 마우스 및 APCmim/+의 유전자형을 갖는 마우스를 교배하여 문맥압항진증의 동물 모델을 제조하였다 (도 13A 및 13B 참조). 이하. 본 발명을 다음 실시예에 의해 상세히 설명한다. 단, 하기 실시예 는 본 발명을 예시하는 것일 뿐. 본 발명이 이들에 의해 제한되는 것은 아니다. 실시예 1. TM4SF5 단백질을 과발현하는 형질전환 마우스의 제조
1-1. TM4SF5 단백질을 과발현하는 형질전환 마우스의 제조
TM4SF5 단백질을 과발현하는 마우스의 간 질환 표현형을 확인하기 위해 다음과 같은 방법으로 형질전환 마우스를 제조하였다.
먼저 , CMV 프로모터의 조절 하에 Flag가 표지된 TM4SF5 단백질 (GenBank Accession NO. CAG33206) 및 BGH( bovine growth hormone) 폴리 -A 영역 (마크로전 1, 대한민국)이 발현되도록 컨스트릭트를 제작하였다 ( J Cell Sci . 2012, 125(Pt 24 ):5960-73). 제작된 컨스트럭트를 C57BL/6 마우스의 수정란에 미세주입법을 사 용하여 주입하였다. 주입 2주 후, 상기 마우스로부터 간조직을 채취하고 하기 표 1에 기재된 프라이머를 사용하여 통상적인 방법으로 PCR을 수행한 뒤 (도 1A). 그
49 결과를 도 1B 1 나타내었다.
【표 1】
Figure imgf000052_0001
도 1B에 나타난 바와 같이 , 약 0.6 kb의 CMV 프로모터 및 TM4SF4 유전자 단편이 탐지됨으로써, 마우스에 TM4SF5 유전자가 삽입된 것을 확인하였다 (도 1B ) .
1-2. TM4SF5 단백질을 과발현하는 형질전환 마우스의 지방간 표현형 확인 실시예 1-1에서 제조된 마우스를 52주 동안 사육한 뒤 , 이를 희생시켜 간 조직을 수득하였다. 수득된 간 조직의 외형을 관찰하여 . 그 결과를 도 2A에 나타 내었다. 이때. 대조군으로서는 정상 마우스를 사용하였다.
도 2A에 나타난 바와 같이, TMSF5 단백질이 과발현되는 상태로 52주 동 안 사육된 마우스는 지방간의 특징을 나타내었다 (도 2A ) .
1-3. TM4SF5 단백질을 과발현하는 형질전환 마우스의 지방간 표현형 확인 실시예 1-1에서 수득된 TM4SF5 단백질을 과발현하는 형질전환 마우스의 간 조직을 이용하여 H&E 염낵을 수행하였다.
50 먼저 , 해부한 간조직을 파라핀에 고정 후 슬라이드를 만들고, H&E 염색을 위해, 수득된 간 조직을 6( C의 오븐에 20분 정도 방치하여 파라핀을 제거하였다. 파라핀을 제거한 간 조직을 자일렌 용액에 5분씩 담그고. 이를 3회 반복하였다. 다음으로, 상기 간 조직을 100%, 90%, 80% 및 70% 에탄올, 및 증류수에 순차적으 로 3분씩 넣었다 꺼낸 뒤 이를 헤마토자일린 (hematoxylin) 용액에 넣어 5분 동 안 반웅시켰다. 반응이 끝난 간 조직을 수듯물을 이용하여 세척하고, 에오신 (eosin) 용액에 넣어 20분 동안 반웅시켰다. 이를 다시 수듯물을 이용하여 세척 하고, 70%, 80%, 90% 및 100% 에탄올, 및 자일렌 용액에 순차적으로 3분씩 넣었 다 꺼낸 뒤, 슬라이드에 놓고 마운팅하였다. 현미경을 이용하여 슬라이드 글라스 를 관찰한 결과 사진을 도 2B에 나타내었다.
도 2B에 나타난 바와 같이 , TM4SF5 단백질을 과발현하는 형질전환 마우스 의 간 조직에 지방이 축적된 것을 확인하였다 (도 2B).
1-4. TM4SF5 단백질을 과발현하는 형질전환 마우스의 지방간 표현형 확인 실시예 1-1에서 수득된 TM4SF5 단백질을 과발현하는 형질전환 마우스의 간 조직을 이용하여 다음과 같은 방법으로 오일 레드 0 염색을 수행하였다.
먼저, 실시예 1-1에서 제조된 형질전환 마우스에서 혈액 대신 관류액을 넣어 혈액을 제거하고, 제 2형 콜라겐을 사용하여 간세포를 분리하였다. 분리된
51 간세포를 40 의 포어 크기를 갖는 세포 여과기를 이용하여 여과하고 원심분리 를 수행하여 펠렛을 수득하였다. 수득된 펠렛을 ½ 페니실린 /스트렙토마이신과
10% FBS를 포함하는 월리엄 's E 배양배지 (Willian's E medium)를 이용하여 배양 하였다. 이때 배양은 콜라겐으로 코팅된 플레이트를 사용하여 수행하였다.
배양된 간세포를 1 포르말린에 넣어 15분 동안 고정시키고, 이를 PBS로 세척하였다. 한편, 오일 레드 0 염색약 (Sigma, 독일)을 멸균 증류수와 흔합하여 흔합액을 제조하고, 제조된 흔합액을 여과하여 준비하였다. 여과된 오일 레드 0 용액을 세척된 세포에 첨가하여 30분 동안 염색한 뒤. 증류수로 세척하였다. 염 색된 세포를 현미경을 이용하여 관찰한 사진을 도 2B에 나타내었다.
도 2B에 나타난 바와 같이 . TM4SF5 단백질을 과발현하는 형질전환 마우스 로부터 수득한 간세포에 지방이 축적된 것을 확인하였다 (도 2B 및 도 2C).
1-5. TM4SF5 단백질을 과발현하는 형질전환 마우스의 지방간 표현형 확인 그
실시예 1-1에서 수득된 TM4SF5 단백질을 과발현하는 형질전환 마우스의 혈액으로부터 트리글리세라이드 (triglyceride, TG), 알부민 및 ALT의 수치를 다 음과 같은 방법으로 측정하였다.
먼저, 상기 형질전환 마우스를 희생시키기 전에 혈액을 수득하였다. 수득 된 혈액을 1 M의 EDTA가 코팅된 1.5 nil' 튜브에 넣고, 여기에 8 // ('의 1 M EDTA를
52 첨가하였다. 이를 1,500 xg 및 4°C에서 15분 동안 원심분리하여 혈청을 분리하였 다. 분리된 혈청으로부터 혈액 분석기 (Dricheni 4000, Fuji, 일본)를 사용하여 트 리글리세라이드. 알부민 및 ALT의 수치를 확인하였다.
그 결과, 도 2D에 나타난 바와 같이 , 14SF5 단백질을 과발현하는 형질전 환 마우스의 간 조직에서 정상마우스에 비해 트리글리세라이드 및 ALT 수치는 증 가하였으나, 알부민 수치는 변화가 없었다 (도 2D). 이로부터, TM4SF5 단백질을 과발현하는 형질전환 마우스의 간 조직이 손상되었음을 알 수 있었다. 실시예 2. H4SF5 단백질을 과발현하는 형질전환 마우스에서의 신호 전달 기전 변화 확인
2-1. TM4SF5 단백질을 과발현하는 형질전환 마우스에서의 지방간과 관련 된 유전자의 발현 변화 확인
실시예 1—1에서 제조된 형질전환 마우스의 간 조직에서 지방간과 관련된 유전자의 발현 변화를 다음과 같은 방법으로 확인하였다.
먼저, 수득된 간 조직에 QiazoHQiagen, 미국)을 첨가하여 세포를 파쇄하 고. 여기에 클로로포름을 넣어 12,000 xg 및 4°C '의 조건하에서 15분 동안 원심분 리하였다. 원심분리 후 수득된 상청액에 이소프로판올을 첨가하여 RNA를 침강시 킨 후, 침강된 NA를 70% 에탄올을 이용하여 세척하였다. 이를 7,500 xg 및 4°C
53 의 조건하에서 5분 동안 원심분리하여 RNA 펠렛을 수득하고, 10분 동안 상온에서 건조시켰다. 건조된 펠렛에 30 , 의 DEPC-증류수를 첨가하여 RNA를 수득하였다. 수득된 RNA는 역전사 키트 (Toyobo, 일본)를 사용하여 제조사의 프로토콜 에 따라 gDNA를 제거하고 cDNA를 수득하였다. 수득된 cDNA에 2x 에바그린 마스터 믹스 (Labopass, 대한민국), 하기 표 2에 기재된 0.4 μΜ의 정방향 및 역방향 프 라이머를 각각 첨가하여 실시간 PCR을 수행하였다. PCR 결과로부터 유전자 각각 의 발현량은 Pfaffl의 변형된 델타 -델타 Ct 방법을 이용하여 수득하였다.
【표 2]
Figure imgf000056_0001
그 결과, 도 3A에 나타난 바와 같이, TM4SF5 단백질을 과발현하는 형질전 환 마우스의 간 조직에서 지방간과 관련된 유전자인 Srebp 1, Srebp 2, Cd36, Fabpl, Fasn, Acc α , Acc 3, 및 Ldlr의 발현이 증가하였다 (도 3A). '
54 2-2. TM4SF5 단백질을 과발현하는 형질전환 마우스에서의 지방간과 관련 된 단백질의 발현 변화 확인
실시예 1-1에서 제조된 형질전환 마우스의 간 조직에서 지방간과 관련된 단백질의 발현 변화를 웨스턴 블롯 방법으로 확인하였다.
구체적으로 수득된 간 조직에 용해 완층액 [50 niM Tris-HCKpH 7.4), 1% NP40. 0.25% 소듬 디옥시콜레이트, 150 niM NaCl. 1 niM EDTA] , SDS (sodium dodecyl sulfate), Na304V 및 프로테아제 억제제 칵테일 (GenDepot )을 첨가하여 4°C 에서 15분 동안 방치하여 조직을 용해시켰다. 상기 용해물을 13.000 rpm 및 4°C 의 조건하에서 30분 동안 원심분리하여 상청액을 수득하였다. 상청액 내 존재하 는 단백질은 BCA 시약 (Thermo Scient i f ics)을 이용하여 정량하고. 여기에 4x ¾ 플 완층액 [4 ιι '의 100% 글리세를, 2.4 iiie의 Tris-HCKpH 6.8), 0.8 g의 SDS, 4 nig의 브름화페놀 블루. 0.4 ιιιί'의 β-머갑토에탄을 및 3.1 iii,의 Η20를 첨가하고, 최종 부피가 10 가 되도록 맞춤]을 첨가하고. 100t에서 5분 동안 끓였다. 이 를 이용하여 SDS-PAGE를 수행하고, 단백질을 니트로셀를로오스 막 (Whatman)에 이 동시켰다. 상기 막을 5% 탈지 우유를 포함하는 용액에 넣어 1시간 동안 전처리하 고, 1차 항체로서 라미닌 (lamininKAbcaiii, 영국), ACCKCell Signalling. 미국), SREBP1 전구체 (precursor. Santa cruz, 미국), 성숙한 SREBP1 (Santa cruz, 미 국), TP( Santa cruz, 미국), PPARa (Santa cruz. 미국), pY706STAT3(Mi 11 ipore.
55 미국), STAT3( Santa cruz, 미국), α -튜블린 (Sigma, 미국) 및 TM4SF5 (J Clin Invest. 2008 Apr :118(4) :1354-66) 단백질에 대한 항체를 첨가한 뒤 , 이를 4°C에 서 15시간 동안 반웅시켰다. 이후, 2차 항체를 반응시키고, ECL 용액 (Pierce, 미 국)을 사용하여 액스레이 필름에 현상한 결과를 도 3B에 나타내었다.
도 3B에 나타난 바와 같이 , TM4SF5 단백질을 과발현하는 형질전환 마우스 의 간 조직에서 지방간과 관련된 단백질인 SREBP1 및 ACCl(ACCa) 단백질의 발현 이 유의적으로 증가하였으나, STAT3 단백질에 대한 인산화는 억제되었다 (도 3B).
2-3. TM4SF5 단백질을 과발현하는 형질전환 마우스에서 STAT3 단백질에 대한 인산화 억제 확인
실시예 2-2에서 확인된 , TM4SF5 단백질을 과발현하는 형질전환 마우스에 서 STAT3 단백질에 대한 인산화가 억제되는 것을 조직 염색 방법을 이용하여 확 인하였다.
수득된 간 조직을 60°C의 오븐에 20분 정도 방치하여 파라핀을 제거하였 다 파라핀을 제거한 간 조직을 자일렌 용액에 5분씩 담그고. 이를 3회 반복하였 다. 다음으로, 상기 간 조직을 에탄올 100%. 90%, 80%, 70% 및 증류수에 순차적 으로 3분씩 넣었다 꺼낸 뒤 , 이를 수듯물에 10분동안 넣어두었다. 이를 lOmM Citric acid buf fer(pH6.0) 안에 조직을 넣고 호일로 덮어 Autoclave하였다. Autoclave가 끝난 후, 조직을 충분히 식힌 다음 PBS에 10분씩 2번 반웅 시키고
56 메탄을을 이용하여 3%의 과산화수소를 만들어 15분동안 quenching 단계를 거쳤다. 이를 다시 PBS에 넣어 5분씩 3번 반웅시켰다. 그 다음 Horse나 goat serum을 PBS 에 5%로 만들어 blocking과정을 4°C에서 하루 반응하였다. 그 다음날 PBS로 5분 씩 3번 반웅시킨 후, biot in-conjugated IgG Rabbit or mouse를 1차반웅때 사용 했던 serum을 이용해 1시간동안 반웅시켰다. 이를 다시 PBS를 이용하여 세척하고, Avidin-biot in— peroxidase complex를 미리 만들어 30분동안 반응시켰다. 그리고 PBS로 5분씩 3번 세척하고 DAB을 이용하여 조직을 염색하였다. 이 때 , 사용하는 항체에 따라서 반웅하는 시간이 다르기 때문에 대조군과 비교하여 시점을 정하였 다. DAB 염색이 다 된 조직은 증류수에 넣고 Hematoxylin에 5분이상 반웅시켰다. 그 후에는 수듯물에 세척하고, 에탄올 70%, 80%, 90%, 100%및 자일렌 용액에 순 차적으로 3분씩 넣었다 꺼낸 뒤 슬라이드에 놓고 마운팅하였다.
도 3C에 나타난 바와 같이 , 대조군에 비해 TM4SF5 단백질을 과발현하는 형질전환 마우스의 간 조직에서 SREBP1의 발현이 증가하고 STAT3 단백질에 대한 인산화가 억제되었다 (도 3C). 실시예 3. T14SF5단백질이 과발현된 간세포에서의 신호 전달 기전 변화 확인
3-1. TM4SF5 단백질이 과발현된 간세포에서 지방 축적 확인
57 TM4SF5 단백질이 과발현된 간세포를 이용하여 상기와 같은 결과를 재확인 하였다.
먼저 . TM4SF5 단백질이 과발현된 형질전환 마우스 대신 C57BL/6 정상 마 우스를 사용한 것을 제외하고는, 실시예 1-4에 기재된 바와 동일한 조건 및 방법 으로 간세포를 수득하였다. 수득한 간세포에 실시예 1- 1에서 제조된 TM4SF5 유전 자를 포함하는 컨스트릭트를 형질전환시켰다. TM4SF5를 발현하는 컨스트럭트가 형질전환된 세포를 이용하여 실시예 1—4에 기재된 바와 동일한 조건 및 방법으로 오일 레드 0 염색을 수행하였다. 이때. 양성 대조군으로서 정상 마우스로부터 수 득한 간세포에 지방산 ( FFA )을 처리한 것을 사용하였다. 염색된 세포를 현미경으 로 관찰한 결과 사진을 도 4A에 나타내었다.
도 4A에 나타난 바와 같이 , 마우스로부터 분리한 간세포에 TM4SF5 단백질 을 과발현시킴으로써 지방이 축적되는 것을 확인하였다 (도 4A ) .
3-2 . TM4SF5 단백질이 과발현된 세포에서 지방관련 유전자의 발현 변화 확인
실시예 3- 1에서 제조된 TM4SF5 단백질을 발현하는 간세포를 이용하여 지 방관련 유전자의 발현 변화를 확인하였다. 이때. 세포는 T 4SF5 단백질을 과발현 하는 간세포 혹은 TM4SF5를 발현하지 않는 세포에 자유지방산을 처리하거나. TM4SF5 단백질을 발현하는 간세포, 지방간과 관련된 사이토카인인 I L-6를 처리한
58 정상 간세포 및 TM4SF5 단백질을 과발현하는 간세포에 IL-6를 처리한 세포를 사 용하여 비교하였다. 실험은 하기 표 3에 기재된 프라이머를 사용한 것을 제외하 고는, 실시예 2-1과 동일한 조건 및 방법으로 수행되었다.
【표 3】
Figure imgf000061_0001
그 결과, 도 4B 및 4C에 나타난 바와 같이, TM4SF5 단백질을 과발현하는 간세포 및 IL-6를 처리한 정상 간세포 모두에서 지방과 관련된 Srebpl, Srebp2, Fasn, CD36, Fabpl, Vldlr, 및 Ldlr 유전자의 발현이 증가하였다 (도 4B 및 4C). 도 4B에서 cont+FFA는 Control 세포에 free fatty acid (250 yM steric acid + 250 μΜ palmitic acid)를 처리한 것이다. 나아가 Tm4sf5 유전자가 heterozygote 로 제거된 녹아웃마우스 (Tm4sf5-/+)의 경우에 정상마우스와 달리, 지방생합성 및 운송축적에 관련된 ApoBlOO, Ldlr, Srebp2, Ppar γ , 및 Leptin유전자가 낮게
59 유지되었다 (도 4D )
3-3 . TM4SF5 단백질이 과발현된 세포에서 STAT3 단백질에 대한 인산화 억 제 확인
TM4SF5 단백질이 과발현된 세포에서 지방간과 관련된 단백질의 발현 변화 를 웨스턴 블롯 방법으로 확인하였다. 실험은 1차 항체로서 라미닌, SREBP1 전구 체 , 성숙한 SREBP1 , PPAR γ , p '705STAT3 , STAT3 , β -액틴 및 F l ag에 대한 항체를 사용한 것을 제외하고는. 실시예 2-2와 동일한 조건 및 방법으로 수행되었다. 그 결과, 도 5A에 나타난 바와 같이 , TM4SF5 단백질이 과발현된 세포는 정상 간세포에 FFA를 처리한 경우와 비슷하게 SREBP1 단백질의 발현이 증가한 반 면 , STAT3 단백질의 인산화는 감소하였다 (도 5A ) .
이와 같은 SREBP1 단백질의 발현 증가와 STAT3 단백질의 인산화 감소가 경¾적 관계를 갖는지 확인하기 위해. 정상 간세포에 STAT3 단백질을 과발현시키 고 지방산을 처리한 세포를 사용하여 상기와 동일한 방법으로 웨스턴 블롯을 수 행하였다. 그 결과, 도 5B에 나타난 바와 같이 , STAT3 단백질이 과발현되는 경우 에는 지방산 처리에 의한 SREBP1 단백질의 발현 증가가 억제되었다 (도 5B ) . 한편 , 정상 간세포에 SREBP1 단백질을 과발현시킨 뒤 . STAT3 단백질의 인 산화를 상기와 같은 방법으로 확인하였다. 그 결과. 도 5C에 나타난 바와 같이 , 증가된 SREBP1 단백질의 발현량에 의해 STAT3 단백질의 인산화는 현저히 감소하
60 였다 (도 5C ) .
따라서 . 상기로부터 SREBP 1 단백질의 발현량과 STAT3 단백질의 인산화는 ᄋ ᄂ!■ ᄂ- -1 s 丁 >-', a s 厂 人 人 1 " " · 실시예 4. B14SF5 단백질의 발현이 억제된 지방세포에서의 신호 전달 기 전 변화 확인
4-1 . TM4SF5 단백질의 발현이 억제된 지방세포에서 지방 생성 억제 확인 한편. 지방세포에서 TM4SF5 단백질의 발현을 억제하는 경우, 지방 생성이 억제되는지 여부를 확인하기 위해 오일 레드 0 염색을 수행하였다.
먼저, 마우스 3T3-L1 지방 전구세포를 10% NBCS( Gi bco , 16010159 ) 및 1% 페니실린 /스트랩토마이신을 포함하는 DMEM 배양 배지에 배양하여 준비하였다. 상 기 준비된 세포를 웰 당 lxlO5개가 되도록 6웰 플레이트에 분주하였다. 분주 4일 후, 지방 전구세포가 웰에 가득차면 48시간을 더 배양하고, 1 μ Μ의 덱사메타손, 0.5 ιιιΜ의 I BMX ( 3- 1 sobu t y 1 - 1-nie t hy 1 xan t h i ne ) 및 10 / g/iii('의 인슐린 (Si gma , 미국) 을 포함하는 지방세포 분화 배지 ( 10% FBS를 포함하는 MDI 배지)로 배지를 교체하 였다. 이를 2일 동안 배양한 뒤 10% FBS 및 10 //g/iii ('의 인슐린을 포함하는 DMEM 으로 배지를 교체하였다. 상기 배지로 교체하고, 10일 동안 배양한 뒤, 10% FBS 및 1% 페니실린 /스트랩토마이신을 포함하는 DMEM 배양 배지를 사용하여 배양함으
61 로써 , 분화된 지방세포를 수득하였다. Adipocyte에 1 ipofectamine 3000을 이용하 여 TM4SF5 shRNA ( shTM4SF5 , 5' -CCTGGAATGTGACGCTCTTCTCGCTGCTG- 3' , 서열번호 35)를 t ransfect i on하였다.
그 결과, 도 6A에 나타난 바와 같이, 지방세포에서 TM4SF5 유전자의 발현 을 억제하면 지방의 생성이 억제되었다 (도 6A) .
4-2. TM4SF5 단백질의 발현이 억제된 지방세포에서 지방관련 유전자의 발 현 변화 확인
지방세포에서 TM4SF5 유전자의 발현이 억제되면 지방관련 유전자의 발현 이 변화하는지 여부를 다음과 같은 방법으로 확인하였다. 구체적으로, 실험은 실 시예 4-1에서 수득한 분화된 지방세포에 TM4SF5에 대한 shRNA를 처리한 뒤, 하기 표 4에 기재된 프라이머를 사용한 것을 제외하고는, 실시예 2-1과 동일한 조건 및 방법으로 수행되었다.
【표 4]
Figure imgf000064_0001
62 Fasn— R GAAGCTGGGGGTCCATTGTG 서열번호 45
Ppary_F CTGGCCTCCCTGATGAATAAAG 서열번호 46
Ppary_R AGGCTCCATAAAGTCACCAAAG 서열번호 47
그 결과, 도 6B에 타난 바와 같이, 지방세포에서 TM4SF5 유전자의 발현 을 억제하면 지방과 관련된 Ppary, CD36, Fasn, Srebpl, 및 Fabpl 유전자의 발 현이 억제되었다 (도 6B).
4-3. TM4SF5 단백질이 발현이 증가된 지방세포가 분화되는 과정에서 지방 관련 유전자의 발현 변화 확인
마우스 3T3-L1 preadipocytes를 10% NBCS (Gibco, 16010159) 및 1% penicillin/streptomycin을 포함하는 DMEM 배양 배지에 배양하였다. 4일째 preadipocytes가 배양용기에 100%로 가득차면 추가적으로 48시간 더 배양한 후, 1 y M Dexaniethasone, 0.5 mM IBMX( (3-isobutyl-l-methylxanthine) , 10 μ g/ml 인슬린 (Sigma, USA) 및 10% FBS를 포함하는 지방세포 분화 배지 (MDI 배지, 제조 사 및 카탈로그 넘버)를 2 일간 처리하였다. 그 후, 배지를 10% FBS 및 인슐린 (10 /m£)으로 보충 된 DMEM으로 2 일 동안 교체해주었다. 10일째 10% NBCS 및 1% penicillin/strept에 lycin을 포함하는 DMEM 배양 배지로 배양하여 지방세포를 분화시켰다. _
이때, 지방이 축적하게 되는 과정 중에 TM4SF5 유전자의 발현과 더불어 지방관련 유전자의 발현이 변화하는지 여부를 SREBP1 전구체, 성숙한 SREBP1,
63 PPAR Y, PY705STAT3, STAT3 , β -액틴 ( Ce 1 1 Signal ing Techno logy, 미국),
ERK(Ce l 1 Signal ing Technology, 미국) , p-ERK(Cel 1 Signal ing Technology, 미 국), Akt (Cel l Signal ing Technology, 미국), TM4SF5에 대한 1차 항체를 사용하 여 실시예 2-2와 조건 및 방법으로 실험을 수행하여 확인하였다.
그 결과, 도 6C에 나타난 바와 같이, TM4SF5 단백질이 발현이 증가된 지 방세포가 분화되어 감에 따라서 지방과 관련된 단백질 (SREBP1)의 발현이 점차 증 가하였고, 반대로 STAT3 단백질의 인산화는 점차 감소하였다 (도 6C) . 실시예 5. TM4SF5단백질을 과발현하는 형질전환마우스에서 SREBP1 단백 질의 발현 증가 및 STAT3 단백질 인산화 억제 기전 확인
5-1. TM4SF5 단백질을 과발현하는 형질전환 마우스에서 SREBP1 단백질의 발현 증가 기전 확인
상기 실시예에서 확인된 TM4SF5 단백질의 과발현에 의한 SREBP1 단백질의 발현 증가가, SREBP1 단백질의 발현을 조절하는 인자인 SIRT 유전자들의 발현 변 화에 어떠한 영향을 미치는지 확인하였다. 실험은 하기 표 5에 기재된 프라이머 를 사용한 것을 제외하고는, 실시예 2-1과 동일한 조건 및 방법으로 수행되었다.
【표 5]
Figure imgf000066_0001
64 Sirtl_R TGTGAAGTTACTGCAGGAGTGTAAA 서열번호 49
Sirt2_F TTCCATCGCGCTTCTTCTCC 서열번호 50
Sirt2_R CCAGGCCACGTCCCTGTAAG 서열번호 51
Sirt3_F ACCTCCTGGGGTGGACACAA 서열번호 52
Sirt3_R GGCCCCAAGGGTAGACATCC 서열번호 53
Sirt4_F AGCTTTCAGGTCCCGTGCTG 서열번호 54
Sirt4_R TCAGGCAAGCCAAATCGTCA 서열번호 55
Sirt5_F TCTACCCGGCTGCCATGTTT 서열번호 56
Sirt5_R TGAGGAGCAAGGGCTTCAGG 서열번호 57
Sirt6_F GGGACCTGATGCTCGCTGAT 서열번호 58
Sirt6_R CAGAGGTGGCAGGGCTTTGT 서열번호 59
Sirt7_F TGCCAGGCACTTGGTTGTCT 서열번호 60
Sirt7_R TAGGCTCCGCTTCGCTTAGG 서열번호 61
그 결과, 도 7A에 나타난 바와 같이, TM4SF5 단백질올 과발현하는 형질전 환 마우스의 간조직에서 SIRTl , SIRT5 및 SIRT6 유전자는 발현이 감소한 반면, SIRT2 , SIRT4 및 SIRT7 유전자는 발현이 증가하였다 (도 7A) .
5-2. TM4SF5 단백질을 과발현하는 형질전환 마우스에서 STAT3 단백질의 인산화 억제 기전 확인
상기 실시예에서 확인된 TM4SF5 단백질의 과발현에 의한 STAT3 단백질의 인산화 억제가 STAT3 단백질을 억제하는 인자인 SOCS유전자들의 발현 변화에 어 떠한 영향을 미치는지 확인하였다. 실험은 하기 표 6에 기재된 프라이머를 사용 한 것을 제외하고는, 실시예 2-1과 동일한 조건 및 방법으로 수행되었다.
【표 6】
Figure imgf000067_0001
65 SOCSl— R GTTGAGCGTCAAGACCCAGT 서열번호 63
SOCS2— F TCCAGATGTGCAAGGATAAACG 서열번호 64
SOCS2_R AGGTACAGGTGAACAGTCCCATT 서열번호 65
SC0S3— F TGCAGGAGAGCGGATTCTA 서열번호 66
SCOS3_R AGCTGTCGCGGATAAGAAAG 서열번호 67
SCOS5_F GAGGGAGGAAGCCGTAATGAG 서열번호 68
SC0S5— R CGGCACAGTTTTGGTTCCG 서열번호 69
그 결과, 도 7C에 나타난 바와 같이, TM4SF5 단백질을 과발현하는 형질전 환 마우스의 간조직에서 S0CS1 및 S0CS3 유전자의 발현이 증가하였다 (도 7C) .
5-3. TM4SF5 단백질을 과발현하는 형질전환 마우스에서 SREBP1 단백질의 발현 증가 및 STAT3 단백질 인산화 억제 기전 확인
TM4SF5 단백질의 과발현에 의한 SREBP1 단백질의 발현 증가 및 STAT3 단 백질의 인산화 억제가 이들과 관련된 SIRT 및 S0CS 단백질의 발현 변화에 어떠한 영향을 미치는지 확인하였다. 실험은, 1차 항체로서 SCOSKCe U Signal ing , 미 국), S0CS3( Sant a cruz , 미국), SIRTK Sant a cruz , 미국) 및 β -튜블린을 사용한 것을 제외하고는, 실시예 2-2와 동일한 조건 및 방법으로 수행되었다.
그 결과, 도 7Β에 나타난 바와 같이, TM4SF5 단백질을 과발현하는 형질전 환 마우스의 간조직에서 S0CS1 및 S0CS3 단백질의 발현은 증가한 반면 , SIRT1 단 백질의 발현은 감소하였다 (도 7Β) .
또한, TM4SF5 단백질을 발현하는 컨스트럭트가 형질전환된 정상 간세포인
AML12 세포를 배양한 배양 배지를 배양 4일, 8일 및 12일에 수득하여, 수득된 배
66 양 배지를 이용하여 3T3-L1 세포를 배양하였다. 상기 배양된 3T3-L1 세포에서
S0CS3 단백질의 발현 변화를 상기와 같은 방법으로 웨스턴 블롯을 통해 확인하였 다- 그 결과, 도 7D에 나타난 바와 같이, 지방전구세포를 배양한 배양 배지를 얻어 TM4SF5 단백질을 발현하는 간상피세포에게 처리하여 배양한 후 S0CS3 단백 질의 발현 수준이 증가하였다 (도 7D) .
실시예 6. 1M4SF5 단백질이 과발현된 간세포에서 SREBP1 단백질의 발현 증가 및 S AT3단백질 인산화 억제 기전 확인
정상 마우스로부터 분리한 간세포에 TM4SF5 단백질을 과발현시켰을 때, SREBP1 단백질의 발현 증가 및 STAT3 단백질의 인산화 억제가 이들과 관련된
SIRT 및 S0CS 단백질의 발현 변화에 어떠한 영향을 미치는지 확인하였다.
먼저, 3—1에 기재된 바와 동일한 조건 및 방법으로 TM4SF5 단백질이 과발 현된 간세포를 제작하였다. 제작된 간세포를 이용하여 상기 표 3에 기재된 프라 이머를 사용한 것을 제외하고는, 실시예 2—1과 동일한 조건 및 방법으로 S0CS1 및 S0CS3 유전자의 발현 변화를 확인하였다. 그 결과, 도 8A에 나타난 바와 같이 , 과발현된 TM4SF5 단백질에 의해 S0CS1 및 S0CS3 유전자의 발현이 증가하였고, 이 는 지방산을 첨가한 경우와 유사하였다 (도 8A) .
또한, 상기 간세포에서 S0CS1 및 S0CS3 단백질의 발현 변화를 웨스턴 블
67 롯으로 확인한 결과ᅳ 도 8B에 나타난 바와 같이. 대조군에 비해 14SF5 단백질이 과발현된 간세포에서 S0CS1 및 S0CS3 단백질의 발현이 증가하였다 (도 8B).
나아가. 상기 간세포에서 S0CS1 및 S0CS3 단백질의 발현 변화를 면역 염 색으로 확인한 결과. 도 8C에 나타난 바와 같이 , 대조군에 비해 TM4SF5 단백질이 과발현된 간세포에서 SOCS 1 및 S0CS3 단백질의 발현이 증가하였다 (도 8C ) .
한편. 정상 마우스로부터 분리한 간세포에 SREBP1 단백질이 과발현된 간 세포를 제작하고. 제작된 간세포를 이용하여 S0CS1 및 S0CS3 단백질의 발현 변화 를 웨스턴 블롯으로 확인하였다. 그 결과, 도 8D에 나타난 바와 같이 , 대조군에 비해 SREBP1 단백질이 과발현된 간세포에서 S0CS1 및 S0CS3 단백질의 발현이 증 가하였다 (도 8D).
한편, 52주령 정상 마우스로부터 분리한 primary 간세포에 실시예 4-1과 동일한 조건 및 방법으로 S0CS3 (NM_174466) sh NA(shS0CS3 , sense 5' CAACAUCUCUGUCGGAAGAUU- 3' 서열번호 111: ant i sense 5' UCUUCCGACAGAGAUGUUGUU- 3' 서열번호 112: )를 transfect ion하여 S0CS3 유 전자의 발현이 억제된 간세포를 제작하고, 제작된 간세포를 이용하여 SREBP1. S0CS3 단백질의 발현 및 STAT3 인산화 변화를 웨스턴 블롯으로 확인하였다.
그 결과, 도 8E에 나타난 바와 같이 , 대조군에 비해 S0CS3 유전자의 발현 이 억제된 간세포에서 SREBP1 단백질의 발현이 감소하였다 (도 SE).
68 실시예 7. T14SF5유전자가녹아웃 (knock-out , K0)된 마우스의 제조
7-1. TM4SF5 유전자 K0 마우스의 제조
먼저 , C57BL/6.마우스를 이용하여 , 5개의 exon으로 이루어진 Tm4sf5 마우 스 유전자 (GenBank access i on number : 匪_029360.3)의 exon 3을 제거한
cas9/RGEN K0 마우스를 제작하였다 (마크로젠, 서을) . 이때, 하기 표 7에 기재된 RGEN 위치를 이용하여 TM4SF5의 유전자 포함된 DNA 522 bp가 결실된 마우스를 수 득하였다. 또한, 하기 표 7에 기재된 마우스 TM4SF5 프라이머를 이용하여, 상기 수득된 마우스로부터 TM4SF5 유전자가 결실된 마우스를 제조하였다.
【표 7】
Figure imgf000071_0001
T7E1 분석을 통해 wi kltype (정상형)과 돌연변이 PCR산물 사이의 이형 2 중가닥 형성을 관찰함으로써 돌연변이 마우스를 선별하였다.
추가적으로, C57BL/6 마우스를 이용하여, Tm4sf5 마우스 유전자 (GenBank access i on number: NM— 029360.3)의 exon 1을 제거한 cas9/RGEN K0마우스를 제작
69 하였다. 이때, 하기 표 8에 기재된 RGEN 위치를 이용하여 TM4SF5의 유전자 포함 된 DNA 29 bp가 결실된 마우스를 수득하였다. 또한, 하기 표 8에 기재된 마우스 TM4SF5 프라이머를 이용하여 , 상기 수득된 마우스로부터 TM4SF5 유전자가 결실된 Tm4sf5-Exon 1-K0 마우스를 제조하였다. 그리고, 도 9를 제외한 다른 실시예에서 는 Tm4sf5-Exon 1-K0 마우스를 Tm4sf5—K0 마우스로 이용하였다.
【표 8】
Figure imgf000072_0001
T7E1 분석을 통해 정상형 (wi l dtype)과 돌연변이 PCR산물 사이의 이형 2 중가닥 형성을 관찰함으로써 돌연변이 마우스를 선별하였다.
7-2. TM4SF5 유전자 K0마우스에서 STAT3 단백질의 인산화를 조절하는 인 자의 발현 변화 확인
실시예 그 1에서 제조된 TM4SF5 유전자 K0 마우스에서 STAT3 단백질의 인 산화를 조절하는 S0CS1 및 S0CS3 유전자의 발현 변화를 확인하였다. 상기 제조된 마우스로부터 수득된 간세포를 이용하여 상기 표 3에 기재된 프라이머를 사용한 것을 제외하고는, 실시예 2-1과 동일한 조건 및 방법으로 S0CS1 및 S0CS3 유전자
70 의 발현 변화를 확인하였다. 그 결과, 도 12A에 나타난 바와 같이 , TM4SF5 유전 자의 K0에 의해 S0CS1 및 S0CS3 유전자의 발현이 억제되었다 (도 12A ) .
또한, 이와 같은 S0CS1 및 S0CS3 유전자의 발현 억제가 단백질에서도 동 일하게 나타나는지 확인하기 위해 웨스턴 블롯을 수행하였다. 실험은 상기 제조 된 마우스로부터 수득된 간세포를 이용하고, 1차 항체로서 SOCSl , S0CS3 및 β - 튜블린을 사용한 것을 제외하고는, 실시예 2-2와 동일한 조건 및 방법으로 수행 되었다. 그 결과, 도 12B에 나타난 바와 같이 , TM4SF5의 유전자 0 마우스의 세 포에서 S0CS1 및 S0CS3 단백질의 발현도 억제되었다 (도 12B) . 실시예 8. 고지방 식이를 섭취한 T14SF5유전자 Κ0마우스에서의 지방축 적 억제 확인
8-1 . 고지방 식이를 섭취한 TM4SF5 유전자 1(0 마우스에서의 지방 축적 억 제 확인
TM4SF5 유전자 Κ0 마우스에 고지방 식이를 섭취시키고, 간에서의 지방축 적 여부를 Η&Ε 염색을 통해 확인하였다.
먼저, 실시예 7- 1에서 제조된 TM4SF5 유전자 Κ0 마우스에 사료로서 60% kca l 고지방 (Har l an , 미국)을 10주 동안 섭취시켰다. 식이요법을 수행하는 10주 동안 매주 체중 변화를 측정하였다. 10주 후. 상기 마우스로부터 간조직올 수득
71 한 것을 제외하고는, 상기 1-3에 기재된 바와 동일한 조건 및 방법으로 H&E 염색 을 수행하였다.
그 결과, 도 10A , 10B , 및 12C에 나타난 바와 같이, 고지방 식이를 섭취 하였음에도 불구하고, 정상 마우스에 비해 TM4SF5 유전자 K0 마우스에서 지방 축 적이 억제되었다 (도 10A , 10B , 및 12C) .
8-2. 고지방식이를 섭취한 TM4SF5 유전자 K0마우스에서의 지방관련 유전 자 및 단백질의 발현 변화 확인
고지방식이를 섭취한 TM4SF5 유전자 K0 마우스로부터 간조직을 수득하고, 상기 간조직에서 지방과 관련된 유전자 및 단백질의 발현변화를 확인하였다. 실험은, 상기 제조된 마우스로부터 수득된 간세포를 이용하여 하기 표 9 에 기재된 프라이머를 사용한 것을 제외하고는, 실시예 2-1과 동일한 조건 및 방 법으로 유전자의 발현 변화를 확인하였다.
【표 9]
Figure imgf000074_0001
72 β— actin_R AGGAAGAGGATGCGGCAGTG 서열번호 85 한편, 웨스턴 블롯은 1차 항체로서 SREBP1 전구체, 성숙 SREBP1, CD36( Santa cruz, 미국) 및 α-튜블린 (Cell Signaling Thechnology, 미국)에 대 한 항체를 사용한 것을 제외하고는, 실시예 2-2와 동일한 조건 및 방법으로 수행 하였다.
그 결과, 도 11 및 12D에 나타난 바와 같이 , 정상 대조군과 비교하여 TM4SF5유전자의 K0에 의해 지방과 관련된 Srebpl, Srebplc, Srebp2, Ldlr, ApoBlOO, CD36, Fasn, 및 Ppary , 유전자 및 단백질의 발현증가가 억제되었다 (도 11 및 12D).
8-3. 고지방 식이를 섭취한 TM4SF5유전자 K0마우스에서의 간조직 내 지 방수준 변화 확인
고지방 식이를 섭취한 TM4SF5유전자 K0마우스로부터 간조직 내의 지방 측정을 위해서 RNAlater에 고정된 조직을 ~10 mg크기로 조작을 내어
cholesterol (Abeam, ab65390) , free fatty acid (Abeam, ab65341) 및
Triglyceride (Cell biolabs, STA-396)를 측정하였다.
그 결과, 도 IOC 및 10D에 나타난 바와 같이, 정상마우스는 고지방 식이 의 섭취에 따라 간조직 내 콜레스테롤 및 FFA의 수준이 높았으나, TM4SF5유전자
1(0마우스는 고지방 식이 섭취에도 불구하고 간조직 내 콜레스테롤 및 FFA의 수
73 준이 높지 않음을 확인하였다 (도 10C 및 10D) 실시예 10. 114SF5 및 APC유전자의 상호작용 확인
10-1. TM4SF5 유전자 K0마우스와 APCmim/+마우스를 교배하여 수득된 자손 의 특징 확인
실시예 7-1에서 제조된 TM4SF5 유전자 K0 마우스를 대장 질환이 발생하기 쉽도록 돌연변이화된 APCmim/+마우스 [중앙동물실험 (주) , 서울, 대한민국]와 교배 하여 자손의 표현형을 확인하였다.
먼저, 수득된 자손의 간 조직을 이용하여, 하기 표 10에 기재된 프라이머 를 사용한 것을 제외하고는, 실시예 2-1과 동일한 조건 및 방법으로 TM4SF5 및 APC유전자의 발현을 확인하였다.
【표 10]
Figure imgf000076_0001
또한, 상기 수득된 자손을 희생시켜 각 기관을 관찰한 결과를 도 13B에
74 나타내었다. 도 13B에 나타난 바와 같이 . 일반적으로 APC+/_마우스에서 관찰되는 특징인 비장종대 및 비정상적인 창자에 추가로 비장이 비대해지고 간조직의 동양 혈관이 벌어져 있는 문맥압항진증 (portal hyper tens ion)의 증상을 나타냈다 (도 13B).
10-2. TM4SF5 유전자 KQ 마우스와 APCn'im/+ 마우스를 교배하여 수득된 자손 의 지방 및 콜라겐 발현 확인
상기 수득된 자손의 간조직을 이용해 H&E 및 메이슨의 트리크름 (Masson's Tri chrome) 염낵을 수행하였다. 이때. H&E 염색은 상기 실험예 1-3에 기재된 바 와 같이 수행되었다.
한편, 메이슨의 트리크름 염색을 위해 파라핀에 고정된 간 조직을 6C C의 오븐에 20분 정도 방치하여 파라핀을 제거하였다. 파라핀이 제거된 조직을 가열 된 보우인 's 용액 (bouin's solution)에 넣고 1시간 동안 반웅시켰다. 반웅이 끝 난 뒤, 간 조직을 수듯물로 세척하고. 헤마토자일린 용액에 넣어 10분 동안 반웅 시켰다. 이를 다시 수듯물로 세척하고, 비브리히 스칼렛ᅳ산 푹신 (biebrich scarlet-acid fushsin) 용액에 넣어 5분 동안 반응시켰다. 반웅이 끝난 간 조직 을 증류수에 넣은 뒤, 인텅스텐산 /인몰리브덴산 (phosphotungstic
acid/phosphomolybdic acid) 용액에 넣어 15분 동안 반웅시켰다. 이후, 상기 간 조직을 아닐린 블루 (anil in blue) 용액에 10분 및 1% 아세트산에 1분 동안 각각
75 넣어 반응시킨 뒤, 조직을 탈수시켰다. 탈수된 조직을 자일렌에 넣었다 쩌낸 뒤 . 슬라이드에 놓고 마운팅하였다. 두 염색 방법으로 염색된 세포를 현미경을 이용 하여 관찰한 결과 사진을 도 13D에 나타내었다.
도 13D에 나타난 바와 같이 , TM4SF5 유전자 0 마우스와 APCmim/+마우스를 교배하여 수득된 자손의 간조직에서 고혈압 증상 (portal hyper tens ion)을 보이는 위치 주위에 세포의 배열이 비정상적으로 완만하였고, 콜라겐의 발현이 증가하였 다 (도 13으).
10-3. TM4SF5 유전자 KQ 마우스와 APCmim/+마우스를 교배하여 수득된 자손 의 간세포에서 TM4SF5의 발현 확인
실시예 10-1에서 수득된 자손에서 TM4SF5, β-카테닌 및 HIFla 단백질의 발현 변화를 확인하기 위해 면역 염색을 수행하였다. 실험은, 1차 항체로서
TM4SF5, β-카테닌 및 HIFla 단백질에 대한 항체를 사용한 것을 제외하고는, 실 시예 2-3과 동일한 조건 및 방법으로 수행되었다.
그 결과, 도 13C에 나타난 바와 같이 , TM4SF5 유전자 K0 마우스와 APCmim/+ 마우스를 교배하여 수득된 자손의 간세포에서 TM4SF5, β-카테닌 및 HIFla 단백 질의 발현이 증가하였고 혈관의 확장이 확인되었다 (도 13C). 따라서 간조직의 혈 관확장 증세인 portal hypertension은 H4SF5의 발현과 유관하다는 것이 본 실시 예을 통해 확인되었고, 이러한 portal hypertension은 간섬유화 및 간경화와 연
76 결되는 것으로 알려져 있다 (Methods Mol Biol . 2017;1627:91-116).
10-4. TM4SF5 유전자 K0 마우스와 APCmim/+마우스를 교배하여 수득된 자손 의 간세포에서 지방관련 신호전달 기전 확인
TM4SF5 유전자 0 마우스와 APCmim/+마우스를 교배하여 수득된 자손의 간 세포에서 지방관련 신호전달 기전을 웨스턴 블롯 방법으로 확인하였다. 실험은, 실시예 10-1에서 수득된 자손의 간세포를 사용하고, 1차 항체로서 라미닌, 피브 로넥틴, ρΥΐ42 β-카테닌. β一카테닌, pY705 STAT3, STAT3, pS9-GSK3 β , GSK3 및 14SF5 단백질에 대한 항체를 사용한 것을 제외하고는, 실시예 2-3과 동일한 조건 및 방법으로 수행되었다.
그 결과, 도 13E에 나타난 바와 같이, TM4SF5 유전자 K0 마우스와 APCmim/+ 마우스를 교배하여 수득된 자손의 간세포에서 라미닌 및 피브로넥틴 단백질의 발 현과 GSK3|3의 인산화가 증가하였다 (도 13E).
따라서 , 상기로부터 TM4SF5 단백질의 발현이 간의 혈과 및 문맥에 장애를 발생시키고, 섬유화와 관련된 세포외 기질 등의 발현을 촉진시킴으로써 간에서 섬유화 증상을 유발할 수 있음을 확인하였다. 실시예 11. H4SF5단백질에 의한 세포 외부 아르기닌 운반 확인
TM4SF5 단백질의 과발현에 의해 지방간의 특징이 나타나는 것을 확인하고,
77 면역침강 실험을 수행하여 TM4SF5 단백질과 niTOR 및 아르기닌 수송체인 SLC7A1 또는 SLC38A9 단백질과의 결합여부를 확인하였다.
먼저 , HEK293T 세포 (KCLB, 대한민국)를 10% FBS 및 항생제가 포함된 DMEM 배양 배지를 사용하여 37 °C 및 5% C02 조건하에서 배양하여 준비하였다. 준비된 세포를 100 uiui 플레이트에 분주하여 60% 밀도가 되도록 배양하고,
Polyethyleniniine(PEI)를 이용하여 TM4SF5 단백질에 STE P 태그가 표지된 컨스트 릭트 및 HA 태그가 표지된 SLC7A1 또는 SLC38A9 단백질을 발현하는 컨스트럭트 를 형질감염시켰다. 형질감염 후 2일 동안 배양된 세포를 PBS로 1회 세힉하고 amino acid 또는 Arginine이 결핍된 배양액에 50분간 37 °C 5% C02에서 배양한다. 배양 후 PBS로 2회 세척하고, 500 의 용해 완충액을 첨가하여 4t'에서 15분 동 안 반응시켰다. 세포 용해물을 4°C 및 12,000 xg의 조건하에서 15분 동안 원심분 리하고 상청액을 취하였다. BCA 시약 (Thermo Scientifics, 미국)을 이용하여 상 기 상청액에 포함된 단백질을 정량하고. 여기에 스트렙타비딘이 코팅된 비드를 단백질양에 비례하도록 첨가하였다. 상기 흔합물을 4°C에서 4시간 동안 회전하며 반응시킨 뒤 , 4t' 및 7,000 xg의 조건으로 5분 동안 원심분리하였다. 원심분리 후. 수득된 펠렛에 용해 완충액을 첨가하여 가볍게 섞어준 뒤 , 이를 다시 4°C 및 7,000 xg의 조건으로 5분 동안 원심분리하고 펠렛을 취하였다. 이와 같은 세척 과정을 용해 완층액을 이용하여 2회, PBS를 이용하여 2회 반복한 뒤 , 세척된 펠 렛에 2x 샘플 완충액을 첨가하고. 5분 동안 끓여주어 ¾플을 준비하였다. 준비된
78 샘플을 이용하고, 1차 항체로서 HA(Covanvce, 미국) 및 스트랩타비딘 -HRP( IBA, 미국)를 사용한 것을 제외하고는 실시예 2— 3과 동일한 조건 및 방법으로 웨스턴 블롯을 수행하였다.
그 결과, 도 14에 나타난 바와 같이 , TM4SF5 단백질이 niTOR와 SLC7A1 단 백질 또는 SLC38A9과 결합하였고, 상기 결합은 세포를 배양하는 배지 내에 아 르기닌이 결핍된 상황에서 더욱 강하게 나타났고 (도 14A, 14B, 및 14C), TM4SF5 단백질이 발현하는 경우에는 발현하지 않는 경우에 대비하여, 세포에 아미노산을 없앴다가 (depletion) 다시 처리공급함 ( replaet km)에 따라 S6K, 4EBP1 , 및 ULK1 의 인산화가 증가함을 확인하였다 (도 14D 및 14E). 실시예 12. TM4SF5 단백질과 아르기닌 수송 기전의 관련성 확인
12-1. TM4SF5 유전자 K0 마우스에서 아르기닌 분해효소 확인
T 4SF5 유전자 K0 마우스를 6시간 동안 굶긴 뒤, 간에 존재하는 아르기닌 분해효소의 함량을 아르기나아제 l(arginasel) 유전자의 발현을 측정함으로써 확 인하였다.
구체적으로, 실시예 7-1에서 제조된 TM4SF5 유전자 1(0 마우스의 식이를 6 시간 동안 중단하고 상술한 바와 같이 회생시켜 간 조직을 수득하였다. 수득된 간 조직을 이용하고, 아르기나아제 유전자에 대해 공지된 프라이머를 사용한 것
79 을 제외하고는 실시예 2—1과 동일한 조건 및 방법으로 실시간 PCR을 수행하였다. 도 15A에 나타난 바와 같이 TM4SF5 유전자 K0 마우스에서 아르기닌의 분 해효소인 아르기나아제 1 유전자의 발현이 16시간 식이억제 군 (흰색바)에서 유의 적으로 감소하였다 (도 15A, 검은색바 =16시간 식이억제 후 4시간 재섭취).
12-2. TM4SF5 단백질 및 아르기닌의 결합 확인
TM4SF5 단백질이 아르기닌의 수송에 직접적인 영향을 주는지 확인하기 위 해 다음과 같은 실험을 수행하였다.
먼저, HEK293FT 세포 (Thermo, 미국)를 10% FBS 및 항생제가 포함된 DMEM 배양 배지를 사용하여 37°C 및 5% C02 조건하에서 배양하여 준비하였다. 준비된 세포를 150 UIUI 플레이트에 분주하여 60% 밀도가 되도록 배양하고, PEI를 이용하 여 실시예 11에서 제조된 TM4SF5, MetaP2, Castrol, TM4SF1, TM4SF4, 및 TM4SF5 단백질을 발현하는 컨스트럭트로 형질감염시켰다. 형질감염 2일 후, 실시예 11에 기재된 바와 동일한 조건 및 방법으로 스트랩타비딘이 코팅된 비드를 이용하여 원하는 단백질을 침강시켰다. 상기 침강물에 10 μΜ의 [3Η]-아르기닌(½ - 311 radiolabeled chemicals, 미국)을 첨가하고. 이를 4°C에서 1시간 동안 반웅시켰 다. 이때, 대조군으로서 동량의 비드에 10 ηιΜ의 L-아르기닌을 첨가한 씸플을 사 용하였다. 반응이 끝난 후, 상기 비드를 용해 완충액을 이용하여 3회 세척하고, 2 의 신틸레이션 칵테일 (scint Π lation cocktail, Ultima gold, Perk in elmer ,
80 미국)을 첨가하였다. 이를 볼텍싱.하고 리퀴드 신틸레이션 카운터 (liquid scintillation counter , Tr i-Carb, Perk in elmer , 미국)를 이용하여 분석하였다. 그 결과. 도 15B와 15C에 나타난 바와 같이 , TM4SF5 단백질과 세포질에 존재하는 아르기닌 센서로 알려진 Castorl 단백질이 아르기닌과 직접 결합하였다 (도 15B 및 15C ).
12-3. TM4SF5 단백질 및 아르기닌의 농도 의존적 결합 확인
실시예 12-2에서 TM4SF5 단백질이 아르기닌과 결합하는 것을 확인한 바, 상기 결합이 농도 의존적인지 여부를 확인하는 실험을 수행하였다. 실험은
TM4SF5 단백질이 형질전환된 HE 293FT 세포를 사용하고 . 0, 0.01, 0.05. 0.1 및 0.5 ιιιΜ의 L-아르기닌을 첨가한 것을 제외하고는, 실시예 12-2와 동일한 조건 및 방법으로 수행하였다.
그 결과, 도 15D와 15E에 나타난 바와 같이 . 14SF5 단백질이 첨가된 아 르기닌의 농도 의존적으로 아르기닌에 결합하였다 (도 15D 및 15E). 실시예 13. H4SF5단백질에서 아르기닌과의 결합위치 확인
상기로부터 TM4SF5 단백질이 아르기닌과 직접적으로 결합하는 것을 확인 함으로써 , TM4SF5 단백질의 어느 잔기가 아르기닌과의 결합에 중요한 작용을 하 는지 확인하기 위해 다음과 같은 실험을 수행하였다.
81 먼저 , TM4SF5 단백질을 구성하는 아미노산 서열 (서열번호 1)에서 N-말단 으로부터 31에서 42번째 아미노산 잔기를 포함하는 short extracel lul ar loop(SEL) 조각 돌연변이를 제조, N-말단으로부터 113에서 157번째 아미노산 잔 기를 포함하는 long extracellular loop (LED 조각 돌연변이를 제조, 또는 N-말 단으로부터 124 내지 129 및 153 내지 157번째 아미노산 잔기를 각각 치환하여 TM4SF5 단백질의 돌연변이를 제조하였다. 그 결과. TM4SF5 단백질의 wild type(WT, full length)외에 SEL, LEL, W124A, G125A, Y126S, H127A, F128S, E129A, P153A, W154A, N155Q, V156A 또는 T157A 돌연변이를 수득하였다. 상기 수 득된 돌연변이 단백질을 발현하는 컨스트럭트를 사용한 것을 제외하고. 실시예 12— 2와 동일한 조건 및 방법으로 TM4SF5 단백질과 아르기닌의 결합을 확인하였다 그 결과, 도 15F에 나타난 바와 같이, TM4SF5 단백질의 짧은 세포외루프 (SEL) 돌연변이는 아르기닌과 결합하지 못하였다 (도 15F). 따라서, 상기로부터 TM4SF5 단백질의 LEL 아미노산 잔기가 아르기닌과 결합함을 알 수 있었다.
도 15G에 나타난 바와 같이 ,ᅳ TM4SF5 단백질의 세포외 루프 (extracel lular loop)에 존재하는 124 내지 129번째 아미노산 잔기가 치환된 돌연변이가 아르기 닌과 결합하지 못하였다 (도 15G). 따라서 , 상기로부터 TM4SF5 단백질의 N-말단으 로부터 124 내지 129번째 아미노산 잔기가 아르기닌과 결합함을 알 수 있었다. 한편 , 도 15G에 나타난 바와 같이 , 상기 부위는 양이온 -π 상호작용을 형 성하는 것으로 알려진 부위로, 대부분의 동물 TMSF5 단백질에서 보존된 서열이
82 다 (도 15G) 실시예 14. H4SF5유전자 K0마우스에서 고아르기닌 식이 섭취에 의한 체중 변화 확인
14-1. TM4SF5 유전자 K0 마우스에서 고아르기닌 식이 섭취에 의한 체중 변화 확인
TM4SF5 유전자 1(0 마우스에서 고아르기닌 식이 (High Arg Diet) 섭취에 의 한 체중변화를 다음과 같은 방법으로 확인하였다.
구체적으로, 실시예 7-1에서 제조된 TM4SF5 유전자 K0 마우스에 사료로서 마우스 체중 1 kg당 40 g의 L-아르기닌 (L-arginine)을 10주 동안 섭취시켰다. 식 이요법을 수행하는 10주 동안 매주 체중 변화를 측정하여 그 결과를 도 17A에 나 타내었다.
도 17A에 나타난 바와 같이, 고아르기닌 식이를 섭취한 정상 마우스는 정 삭 식이를 섭취한 마우스에 비해 체중이 약 25% 증가한 반면. TM4SF5 유전자 K0 마우스는 체중이 약 7% 증가하였다 (도 17A). 한편, 도 17B에 나타난 바와 같이 , 고아르기닌 식이를 시작한 시작점에 대비하여 마우스 개체 각각의 체중 증가를 확인한 결과. TM4SF5 유전자 K0 마우스에서는 체중 증가가 유의적으로 감소되었 다 (도 17B).
83 14- 2. TM4SF5 유전자 Q 마우스에서 고아르기닌 식이 섭취에 의한 지방 축적 확인
실시예 13-1에서 고아르기닌 식이를 섭취한 TM4SF5 유전자 K0 마우스로부 터 간조직을 적출하여 상기 서술한 방법을 이용하여 H&E 염색을 수행하였다. 그 결과, 도 17C에 나타난 바와 같이, 고아르기닌 식이를 섭취한 정상 마 우스는 지방간이 유도된 반면, TM4SF5 유전자 1(0 마우스의 간조직에서는 상대적 으로 지방 축적이 억제되었다 (도 17C ) . 실시예 15. 114SF5 단백질과 글루코스 수송체와의 관계 확인
15- 1 . TM4SF5 단백질에 의한 S61 (의 인산화 여부 확인
질량분석법을 사용하여 TM4SF5 단백질과 결합하는 단백질을 분석하고. GLUTKSLC2A1 ) 단백질을 선택하였다. GLUT1 단백질은 글루코스 수송체로서 인슬 린에 의해 세포막으로 이동하여 글루코스를 세포 안쪽으로 공급하여 에너지를 생 산하는데 관여한다. 이에 . TM4SF5 단백질을 발현하는 컨스트릭트가 형질전환된 세포를 이용하여 S6Ki nase의 인산화 여부를 다음과 같이 확인하였다.
먼저, HEK293FT 세포 (Thermo , 미국)를 10% FBS 및 항생제가 포함된 DMEM 배양 배지를 사용하여 37 t 및 5% C02 조건하에서 배양하여 준비하였다. 준비된
84 세포를 이용하여 포도당 결핍 후 공급을 통해, 이와 같은 스트레스하에서 세포의 생존여부를 확인함으로써 세포의 생존 반응성을 확인하였다.
그 결과, 도 18A에 나타난 바와 같이. TM4SF5 단백질이 발현된 세포주에 서 S6K의 인산화가 증가되었다 (도 18A).
15-2. TM4SF5 단백질의 발현 억제에 따른 해당작용 스트레스 측정
TM4SF5 단백질의 발현을 억제한 세포에서 해당작용 스트레스를 XF 분석기 (Sea Horse)를 사용하여 측정하였다. TM4SF5 발현 억제 세포주 제작을 위해
HEK293FT 세포주에 TMSF5를 타겟하는 sh NA 서열 (shTM4SF5 #2: 5'一
accauguguacgggaaaaugugc-3 ' , 서열번호 95; shTM4SF5 #4, 5' - ccaucucagCLiLigcaaguc-3' , 서열번호 96)을 삽입한 pLKO .1 ( acldgene ) lent i-vi ral plasmid, psPAX2 와 pDM2.G 컨스트릭트를 PEI를 이용하여 전달 감염시켰다. 5시 간후 배양액을 갈아주고 24시간 동안 배양시켜 shTM4SF5 lenti-virus를 얻었다. 이를 Hep3B 세포에 4ug/ml polybrene과 함께 24시간 동안 감염시킨 후 puromycin 으로 48시간동안 selection 하였다.
구체적으로, Hep3B 세포를 XFp 세포 배양 플레이트 (Sea Horse bioscience, 미국)에 웰당 5x103개가 되도록 분주하였다. 분주된 세포를 37°C 및 5% C02 조건 하에서 16시간 동안 배양하고, Sea Horse XF 기본 배지 (Sea Horse bioscience, 미국)로 교체하였다. 배지를 교체한 세포를 C02가 공급되지 않는 37'5C 배양기에
85 서 1시간 동안 배양하였다. 배양된 세포를 포함하는 XFp 세포 배양 플레이트를 37'C에서 수화 및 보정된 센서 카트리지 (Sea Horse bioscience, 미국)에 결합시 키고, XFp 분석기를 사용하여 분석하였다. 약물의 주입구에는 A: 100 ηΜ 글루코 스, B: 50 LiM 올리고마이신. 및 C: 500 ιιιΜ 2-데옥시—D—글루코스를 로딩하였다. 그 결과, 도 18B에 나타난 바와 같이 , TM4SF5 유전자의 발현을 억제하면 글루코스에 의한 반웅성이 떨어지는 것을 확인하였다 (도 18B).
15-3. TM4SF5 단백질의 과발현에 의한 해당작용에 관련된 유전자의 발현 변화 확인
TM4SF5 단백질이 과발현된 세포에서 해당작용과 관련된 유전자의 발현이 어떻게 변화하는지 확인하기 위해 다음과 같은 실험을 수행하였다.
먼저 . SNU449 간암 세포주에 TM4SF5 단백질을 발현하는 컨스트럭트를 형 질전환시켰다. 상기 세포에 액화질소를 첨가하여 파쇄시키고. RNAeasy 키트
(Qiagen, 미국)를 이용하여 제조사의 프로토콜에 따라 RNA를 추출하였다. 추출된 NA에 DNAse를 첨가하여 DNA를 제거하고, 통상적인 방법으로 cDNA를 합성하였다. 합성된 cDNA에 어댑터 (adaptor)를 부착시키고, PCR로 증폭하여 200 내지 400 bp 크기를 갖는 PCR 산물을 선별하였다. 선별된 cDNA의 서열을 HiSeci 4000 서열분석 기 (Illuniina. 미국)를 이용하여 분석하였다. 서열분석 결과는 전처리과정을 통해 인공산물 (artifact)을 제거하고, HISTA2 프로그램을 사용하여 게놈에 맵핑하였다
86 맵핑된 데이터는 StringTie를 이용하여 전사물 (transcript) 어 ¾블리를 통해 발 현량을 얻었다.
그 결과. 도 18C에 나타난 바와 같이, TM4SF5 단백질의 과발현으로 인해 세포내에 존재하는 해당작용 관여 유전자들의 발현이 대체적으로 증가하였다 (도 18C). . 실시예 16. H4SF5유전자 K0마우스에서의 고탄수화물 식이 또는 고수크 로즈 식이 섭취에 의한 영향 확인
16-1. TM4SF5 유전자 K0 마우스에서 고탄수화물 식이 또는 고수크로즈 (자 당. sucrose) 식이 섭취에 의한 체중 증가 억제 확인
실시예 8-1과 동일한 조건 및 방법으로 TM4SF5 유전자 1(0 마우스에 고탄 수화물 식이 (70% kcal 고탄수화물 ) 혹은 고수크로즈 식이 (자당, sucrose, AIN- 93G diet; sucrose의 함량이 3.15%인 chow diet에 대비하여 100 g/kg로 10%높게 함유됨)를 섭취시키고, 체중 변화를 확인한 결과를 각각 도 16A 및 19A에 나타내 었다.
도 16A, 16B, 및 19A에 나타난 바와 같이, 고탄수화물 식이의 경우 정상 마우스는 정상식이에 대비하여 체중이 크게 증가하였으나, TM4SF5 유전자 K0 마 우스는 유의적으로 체중이 증가하지 않았다 (도 1(3A, 16B). 한편 , 고수크로즈 식
87 이를 섭취한 경우에는 정상마우스는 체중 증가 속도가 높았지만 Tm4sf5 유전자 K0 마우스는 체중증가 속도가 미약하였다 (도 19A).
16-2. TM4SF5 유전자 K0 마우스에서 고탄수화물 식이 또는 또는 고수크로 즈 식이 섭취에 의한 포도당 저항성 변화 확인
실시예 8-1과 동일한 조건 및 방법으로 고탄수화물 또는 고수크로즈 (자당, sucrose) 식이를 섭취한 TM4SF5 유전자 K0 마우스의 포도당 저항성을 다음과 같 은 방법으로 측정하였다.
구체적으로. 3주 및 10주간의 고탄수화물 또는 고수크로즈 (자당, sucrose) 식이를 각각 섭취한 마우스를 16시간 동안 굶기고, 꼬리에서 혈액을 채취하였다. 채취된 혈액 내 혈당을 혈당기 (One touch ultra. Johnsons and Johnsons , 미국) 를 이용하여 측정하였다. 혈당 측정 후. 상기 마우스에 2 g/kg의 포도당을 복강 으로 주사하고, 주사 30분, 60분, 90분 및 120분 후에 각각 꼬리에서 혈액을 채 취하여 혈당을 측정하였다.
그 결과, 도 16C와 19B에 나타난 바와 같이, 정상 마우스와 비교하여 TM4SF5 유전자 K0 마우스는 10주 동안의 고탄수화물 식이 혹은 고수크로즈 (자당. sucrose) 식이의 섭취로 인한 포도당 저항성이 감소되었다 (도 16C 및 도 19B).
16-8. TM4SF5 유전자 K0 마우스에서 고탄수화물 혹은 고수크로즈 (자당
88 sucrose) 식이 섭취에 의한 인슐린 저항성어 1 대한 영향 확인
실시예 8-1과 동일한 조건 및 방법으로 고탄수화물 또는 고수크로즈 (자당, sucrose) 식이를 섭취한 TM4SF5 유전자 K0 마우스의 인슐린 저항성을 다음과 같 은 방법으로 측정하였다.
구체적으로. 10주간의 고탄수화물 또는 고수크로즈 (자당, sucrose) 식이 를 각각 섭취한 마우스를 6시간 동안 굶기고, 꼬리에서 혈액을 채취하였다. 채취 된 혈액 내 혈당을 혈당기 (One touch ultra, Johnsons and Johnsons, 미국)를 이 용하여 측정하였다. 혈당 측정 후, 상기 마우스에 0.5 U/kg의 인슐린을 복강으로 주사하고, 주사 30분, 60분, 90분 및 120분 후에 각각 꼬리에서 혈액을 채취하여 혈당을 측정하였다.
그 결과, 도 16D와 19B에 나타난 바와 같이. 포도당 저항성과 달리, 인슐 린 저항성은 TM4SF5 단백질의 존재 여부와 관련이 없었다 (도 16D). 하지만, 10주 동안의 고수크로즈 식이의 경우, Tm4sf5 유전자 K0 마우스는 인슐린 저항성이 낮 아져 호전되었다 (도 19B).
16-4. TM4SF5 유전자 K0 마우스에서 고탄수화물 또는 고수크로즈 (자당, sucrose) 식이 섭취에 의한 혈액 내 AST. ALT, Triglyceride 및 콜레스테를 수준 에 대한 영향 확인
실시예 8-1과 동일한 조건 및 방법으로 고탄수화물 또는 고수크로즈 (자당,
89 sucrose) 식이를 섶취한 TM4SF5 유전자 K0 마우스의 혈액 내 AST, ALT, 및 콜레 스테를 수준을 Fuji Dri-Chem 3500i를 이용하여 측정하였다.
그 결과, 도 16E와 19C에 나타난 바와 같이 , 고탄수화물 식이를 섭취한 정상마우스는 혈액중 ALT, AST, Total cholesterol , 및 Triglyceride의 수준이 증가하였으나, TM4SF5 유전자 K0 마우스에서는 그 증가가 미약하였다 (도 16E). 하지만, 고수크로즈 (자당. sucrose) 식이의 경우, 정상마우스는 혈액중 ALT, AST 수준이 증가하였으나, TM4SF5 유전자 0 마우스에서는 그 증가가 미약 하였으나, Total cholesterol , 및 Triglyceride의 수준은 통계적 유의성 없이 변 화가 없었다 (도 19C).
16-5. TM4SF5 유전자 K0 마우스에서 고탄수화물 또는 고수크로즈 (자당, sucrose) 식이 섭취에 의한 지방 축적 확인
실시예 16-1에서 고탄수화물 또는 고수크로즈 (자당, sucrose) 식이를 섭 취한 TM4SF5 유전자 1(0 마우스로부터 간조직을 적출하여 상기 서술한 방법을 이 용하여 H&E 염색을 수행하였다.
그 결과, 도 19D에 나타난 바와 같이, 고탄수화물 또는 고수크로즈 (자당, sucrose) 식이를 섭취한 정상 마우스는 지방간이 유도된 반면, TM4SF5 유전자 1(0 마우스의 간조직에서는 상대적으로 지방 축적이 억제되었다 (도 19D).
90 16-6. TM4SF5 유전자 KO 마우스에서 고탄수화물 또는 고수크로즈 식이 섭 취에 의한 모노아실- (monoacyl-). 다이아실 -((Uacyl-) , 및 트라이아실一 (triacyl-) 글라이세롤 (glycerol) 합성 축적 확인 실시예 16-1에서 고탄수화물 또는 고수크로즈 (자당, sucrose) 식이를 섭 취한 TM4SF5 유전자 KO 마우스로부터 간조직을 적출하여, lysophilization하고 막자사발을 이용하여 분쇄한 후. 간조직 10 mg 당 0.3 ml의 메탄을과 0.1% butylated hydroxy toluene 용액으로 지질을 추출하였다. 0.1% butylated hydroxytoluene 를 포함하는 methyl-tert-butyl ether를 추출액에 첨가한 후, 상온에서 1시간동안 shaking 하였다. 0.25 ml의 H20로 회석한 후, 상온에서 10 분간 vertex한 후, 14,000 g로 40(:에서 15분간 원심분리하였다. 상층액과 하층 액을 별개로 분주 확보한 후 dyringl 과정을 거친 후 0.16 ml에 40 μΐ CHCl3:MeOH (1:9)를 처리하여 Lipids analysis using LC- MS/MS (8040, Shimadzu, 일본)로 측정하였다. 그 결과, 도 19E에 나타난 바와 같이. 고수크로즈 (자당, sucrose) 식이를 섭취한 정상 마우스에 대비하여, TM4SF5 유전자 K0 마우스의 간조직에서는 상대 적으로 모노아실- (monoacyl-), 다이아실 -((liacy卜), 및 트라이아실 -(triacy卜) 글라이세를 (glycerol)의 합성이 낮았다 (도 19E).
실시예 17. T14SF5단백질의 과발현에 의한 간경화 증상 확인
91 실시예 1-1과 동일한 조건 및 방법으로 TM4SF5 단백질이 과발현된 마우스 를 제작하고. 이를 78주 동안 사육하였다. 사육된 마우스를 상술한 바와 같이 희 생시켜 간조직을 수득하고, 이를 H&E 및 메이슨의 트리크름 염색을 통해 간조직 의 표현형을 확인하였다. 그 결과, 도 20A에 나타난 바와 같이 . 간조직의 섬유화 가 생성된 간경화의 표현형을 나타내었다 (도 20A). 마우스의 주령이 78주 (1년 6 개월)되어 노령이기 때문에, 정상쥐의 경우에도 지방간의 증세가 미약하게 보였 으나, TM4SF5가 과발현된 동물의 겨웅에는 좀 더 심각한 지방간 증세와 더블어 골수외조혈 (extraniedullary heniatopoiesis) 증상이 확인되었다 (도 20B).
또한, 상기 간조직을 이용하여 상술한 바와 같이 지방과 관련된 단백질들 의 발현 변화를 웨스턴 블롯으로 확인한 결과를 도 20C에 나타내었다.
도 20C에 나타난 바와 같이, 지방간의 표현형을 나타낸 52주령의 마우스 와 달리 , 78주령의 경우 TM4SF5 단백질의 과발현에 의해 STAT3의 인산화가 증가 하고, 간경화의 주요 인자인 세포외 기질 (extracellular matrix, ECM)이 증가하 였다. 한편, SREBP1 단백질의 발현은 억제되고. SIRT1 단백질의 발현은 증가됨으 로써 간조직 내에서의 지방 합성 및 축적이 감소되었다 (도 20C).
나아가, 상기 간조직을 이용하여 상술한 바와 같이 면역 염색을 수행한 결과를 도 21A에 나타내었다. 도 21A에 나타난 바와 같이 , TM4SF5의 과발현에 의 해 S0CS1 및 S0CS3 단백질의 발현이 억제되고, STAT3의 인산화가 증가되었으며 , α-SMA, 콜라겐 1 및 라미닌과 같은 ECM의 발현이 증가되었다. 이때, 콜라겐 1과
92 α -SMA는 유사한 발현 패턴을 나타낸 반면. 라미닌 및 라미닌 γ 2는 발현 세포 및 발현 패턴이 상이하였다 (도 21A ) .
한편, 상기 간조직을 이용하여 상술한 바와 같이 지방대사. 간경화 및 간 염과 관련된 유전자의 발현 변화를 확인하였다. 그 결과, 도 21B 및 21C에 나타 난 바와 같이 , 지방대사와 관련된 유전자의 발현은 14SF5 단백질의 과발현에 영 향을 받지 않았으나, 간경화 및 간염과 관련된 유전자의 발현은 증가하였다 (도 21B 및 21C ) .
따라서 . 상기로부터 TM4SF5 단백질을 과발현하는 형질전환 마우스에서 지 방간이 발생하다가 일정 시간이 경과하면 지방간이 간경화나 간염으로 발전하고, 그에 따라 STAT3 단백질의 인산화나 ECM 수준을 증가시키는 것을 확인하였다. 실시예 18. 간질환모델 마우스에서의 T14SF5 단백질 발현 변화 확인
TM4SF5 단백질이 과발현된 마우스에서 생성된 지방간이 시간이 경과함에 따라 간경화 및 간염 증상을 나타내는 것을 확인하였다. 일반적으로 사염화탄소 를 4주 동안 투여한 마우스는 간섬유증을 16주 동안 투여한 마우스는 간경변증의 증상올 나타내는 것이 보고되어 있다. 이에, 약물로 간경화를 유도시킨 모델 마 우스에서 TM4SF5 단백질의 발현 변화를 확인하였다.
먼저, 4주령의 BALB/C 마우스 (오리엔트 바이오. 대한민국)에 1 nig/kg의 양으로 사염화탄소 ( CC 14 )를 1 , 4 또는 16주 동안 일주일에 1회 복강 내 주사하여 .
93 간질환이 유도된 모델 마우스를 제조하였다 . 제조된 모델 마우스를 이용하여 상 술한 바와 같이 H&E 및 메이슨의 트리크름 염색올 수행한 결과를 도 22A에 나타 내었다.
도 22A에 나타난 바와 같이 . CC14를 4주 또는 16주 동안 투여한 마우스의 간조직에서 혈관을 중심으로 세포들이 죽어있고, 그 주변으로 면역반웅이 일어나 면서 정상세포와 비교하여 형태가 변형된 세포가 관찰되었다. 또한, 세포 사이에 콜라겐이 축적되면서 혈관과 혈관 사이에 길이 생성되었다 (도 22A).
또한, 상기 모델 마우스의 간조직을 이용하여 상술한 바와 같이 단백질 및 mRNA의 발현 수준을 확인한 결과를 도 23에 나타내었다. 도 23A에 나타난 바 와 같이 , 모델 마우스의 간조직에서 TM4SF5 단백질의 발현, STAT3 단백질의 인산 화 및 ECM이 증가하였다 (도 23A). 뿐만 아니라, CC14를 4주 또는 16주 처리한 동 물의 간경화가 일어난 조직에서 처리하지 않은 대조군에 대비하여 elastin, 라미 닌 α2, α3, α5. γ2, γ3 chain의 mRNA가 높아지는 것을 확인하였다 (도 23B) 나아가, 상기 모델 마우스의 간조직을 이용하여 상술한 바와 같이 면역 염색을 수행한 결과를 도 24에 나타내었다. 도 24에 나타난 바와 같이 , 모델 마 우스의 간조직에서 TM4SF5 단백질의 발현이 증가함에 따라, STAT3의 인산화가 증 가하였고, a— SMA, 콜라겐 I, 콜라겐 IV, 라미닌 및 라미닌 γ2 단백질의 발현이 증가하였다 (도 24).
한편, 실시예 7-1에서 제조한 TM4SF5 유전자 Κ0 마우스에 상술한 바와 같
94 이 CC14를 투여한 뒤, 간조직을 수득하여 메이슨의 트리크롬 염색을 수행한 결과 를 도 22C에 나타내었다. 그 결과, 대조군에 비해 TM4SF5 유전자 K0 마우스에서 콜라겐의 축적이 감소하였다 (도 22C). 실시예 19. 간질환모델 마우스에서의 라미닌 단백질 발현 조절 기전확인 실시예 18에서 약물 투여로 제조된 간질환 모델 마우스의 간조직을 이용 하여 라미닌 단백질의 발현 조¾ 기전을 다음과 같은 방법으로 확인하였다. 먼제 상기 분리된 간조직으로부터 상술한 바와 같이 간세포를 수득하였 다. 수득된 간세포에서 TM4SF5 및 STAT3 단백질의 발현을 shTM4SF5 또는
silencing STAT3 [On-Tar et plus SMART pool s iRNA( Thermo )]¾ trans feet ion 시 키어 억제시키고, 그에 따라 라미닌의 발현 변화를 상술한 바와 같이 웨스턴 블 롯으로 확인하였다.
그 결과. 도 25에 나타난 바와 같이 , TM4SF5 및 STAT3 단백질의 발현이 억제됨으로써 , 라미닌 단백질의 발현도 억제되었다. 한편 , STAT3 단백질의 발현 을 억제하였을 때는 TM4SF5 단백질의 발현 변화에는 별다른 영향을 미치지 않았 다 (도 25).
또한, 상기 분리된 간조직에 IL-6를 처리하여 상술한 바와 같이 웨스턴 블롯을 수행함으로써 증가된 STAT3 인산화 및 라미닌 단백질의 발현이 IL-6에 의 존적인지 확인하였다. 그 결과, 도 26A에 나타난 바와 같이 IL-6에 의해 STAT3
95 단백질의 인산화 및 콜라겐 1의 발현이 증가하였으나. 라미닌 단백질의 수준은 변 화가 없었다 (도 26A). 따라서 , 상기로부터 라미닌 및 라미닌 γ 2는 TM4SF5 단백질 에 의존적으로 발현이 증가함을 알 수 있었다.
또한, 상기와 같은 신호전달 기전에서 라미닌의 위치를 확인하기 위해. 상기 분리된 간조직에 라미닌을 처리하여 상술한 바와 같이 웨스턴 블롯을 수행 하였다. 그 결과, 도 26B에 나타난 바와 같이, 라미닌에 의해 STAT3 단백질의 발 현 수준은 변화하지 않았다 (도 26B). 따라서 , 상기로부터 TM4SF5 단백질이 STAT3 단백질의 인산화를 통해 라미닌의 발현을 조절함을 알 수 있었다.
또한, 상기 분리된 간조직에 c-Si'c 단백질의 저해제인 PP2 X
Laboratories , 미국) 또는 대조약물 (control compound)인 PP3(LC Laboratories, 미국)를 첨가하여. 그에 따른 단백질의 발현 변화를 상술한 바와 같이 웨스턴 블 롯으로 확인하였다. 그 결과, 도 26C에 나타난 바와 같이 . PP2에 의해 STAT3 단 백질의 인산화 및 라미닌 단백질의 발현이 억제되었다 (도 26C).
나아가. HepG2 (한국세포주 은행, 서을) 간암 세포를 이용하여 , TM4SF5 단백질의 발현을 억제하였을 때, STAT3 단백질의 인산화 및 라미닌 단백질의 발 현 변화를 상술한 바와 같이 웨스턴 블롯으로 확인하였다. 그 결과, 도 26D에 나 타난 바와 같이 , TM4SF5 단백질의 발현이 억제되면 STAT3 단백질의 인산화 및 라 미닌의 발현이 억제되었다 (도 26D).
96 실시예 20. STAT3 단백질의 인산화에 의한 라미닌 단백질의 조절 기전 확 인
상기로부터 라미닌 단백질의 발현 변화를 조정하는 것으로 확인된 STAT3 단백질의 인산화가 라미닌의 프로모터를 통해 이의 발현을 조절하는지를 루시퍼 라제 분석 방법으로 확인하였다.
먼저, LAMC2 프로모터의 -1871 내지 +388( 1 kb) 및 —592 내지 +388(2.3 kb)에 해당하는 부위와 C0L1A1 프로모터의 -2865 내지 +85( 0.9 kb) , -2047 내지 +89(2. 1 kb) 및 —845 내지 +89(2.9 kb)에 해당하는 부위를 하기 표 11에 기재된 프라이머를 사용하여 PCR로 증폭하였다.
【표 111
Figure imgf000099_0001
증폭된 PCR산물을 pGL3 백터 (Promega , Cat# . E1751 , 미국)에 삽입하여 컨 스트럭트를 제조하였다 (도 27k) . 한편, AML12 세포를 48-웰 플레이트에 배양하고 리포펙타민 3000을 사용하여 상기 제조된 컨스트럭트와 TM4SF5 또는 STAT3 단백
97 질을 각각 발현하는 컨스트럭트를 각각 형질감염시켰다. 24시간 후, 루시퍼라제 리포터 어세이 키트 (Pi-에 iega. 미국)를 사용하여 제조서 "의 프로토콜에 따라 루시 퍼라제 활성을 측정하였다.
생쥐 간상피세포 [murine hepatocytes, AML12, (도 27B 및 27C)] 또는 인 간 간성상세포 [human hepatic stellate cells, LX2, (도 27B 및 27C)]에 발현하 는 TM4SF5 또는 STAT3 단백질에 의해 라미닌 γ2 (Lamc2, 도 27B) 또는 콜라겐 I Al (Collal, 도 27C)의 프로모터 활성을 나타내는 루시퍼라제 활성이 증가하였다. 실시예 21. B14SF5단백질의 발현 증가에 의해 발현되는 ECM의 종류 확인 일반적으로 간 성상세포에 의해 활성화되는 콜라겐의 축적으로 질병이 악 화됨이 알려져 있다. 또한, 상기 실험에 의해 콜라겐 I 및 라미닌 γ2의 루시퍼 라제 활성 정도가 다른 것으로 보아 세포 종류에 따라 다른 종류의 ECM이 발현될 것이라고 예상되어 다음과 같은 실험을 수행하였다.
먼저, 간경화 조직을 이용하여 상기 서술한 바와 같이 형광염색을 수행하 였고, 그 결과, TM4SF5 단백질의 발현이 증가함으로써 . 라미닌 단백질도 손상된 간조직 주변에 발현된 것을 확인하였다 (도 28Α).
또한, 상기 네포들이 어떤 종류의 세포인지 더욱 명확하게 확인하기 위해 서 간세포 마커인 알부민. 간성상세포 마커인 α-SMA를 콜라겐 I 및 라미닌과 같 이 상술한 바와 동일한 방법으로 염색하였다. 그 결과. 도 28B 및 28C에 나타난
98 바와 같이ᅳ 콜라겐 I은 α-SMA와 같이 염낵되었고, 라미닌은 처음엔 a-SMA 및 알부민과 같이 염색되다가. 간경화가 악화되어 간경변증이되면 알부민에만 염색 되었다 (도 28B 및 28C). 이로부터 라미닌은 콜라겐과는 상이한 패턴으로 간 성상 세포보다는 간세포에서 더 많이 발현되고. 간경화에 영향을 주는 것을 확인하였 다.
한편. HepG2 세포에서 실시예 4-1과 같은 방법으로 TM4SF5 단백질의 발현 을 억제시킨 후 상기와 동일한 방법으로 단백질의 발현 변화를 확인하였다. 그 결과, 도 28D 및 도 28E에 나타난 바와 같이 , TM4SF5의 발현을 낮춘 세포에서는 간성상세포를 배양하였을 때 얻게되는 배양액 (conditioned medium)를 처리하거나 HepG2 세포와 간성상세포와 공동배양을 transwell chamber (Corning, 미국, 위쪽 의 chamber에는 간성상세포 배양하고 아래 chamber에는 간상피세포 배양)에서 하 더라도 콜라겐의 발현 양은 올라가지만 라미닌의 발현 양은 올라가지 않는 것을 확인함으로써 간상피세포에서는 TM4SF5와 관련하여 STAT3의 인산화를 통해 라미 닌이 조절된다는 것을 알 수 있다 (도 28D 및 도 28E). 실시예 22. 라미닌 및 콜라겐 유전자의 억제에 의한 간경화 완화 효과 확 인
상기 실험을 통해 STAT3 단백질에 의해 라미닌 단백질의 발현이 조절되는 것을 확인하였다. 먼저. 마우스의 꼬리 정맥으로 라미닌 Y2(LAMC2) 또는 콜라겐
99 KC0L1A1) 유전자에 대한 siRNA를 주사한 뒤. CC14를 투여하였다. 상기 마우스로 부터 간조직을 수득하고, 이를 H&E 염색으로 염색한 결과, CCl 에 의한 간손상이 억제되었다 (도 29A). 또한, TM4SF5, 라미닌 γ2 (LAMC2) 또는 콜라겐 I αΐ ( COL 1 A 1 ) 단백질의 발현과 STAT3의 인산화가 감소하였고 (도 29B ) . TM4SF5. laminin γ2 (LAMC2) 또는 collagen I al (COLIAI), a-SMA, 및 TGFf31의 niRNA (도 29C) 발현 수준이 감소함을 확인하였다. 실시예 23. 간암동물모델에서 TM4SF5 단백질에 의한 라미닌의 조절 확인 지방간, 간경화, 지방간염 및 간경변증을 거쳐 유발된 간암 모델에서도 상기와 같은 신호전달이 적용되는지를 하기와 같은 방법으로 확인하였다.
구체적으로, TM4SF5 단백질이 과발현된 52주령 FVB/N 동물모델을 1년 동 안 사육한 뒤 , 이를 희생시켜 간조직을 적출하였다. 적출된 간조직에서 TM4SF5 단백질이 과발현되고, 간조직에 nodule이 생긴 것올 확인하였다 (도 30A). 상기 간조직에서 간암 마커인 CD34, AFP, AFU, 인산화된 STAT3, 라미닌, 라미닌 γ2 및 콜라겐 I등의 발현이 증가하였다 (도 30Β 및 30Ε). 한편. 상기 간조직을 이용 하여 mRNA의 발현 수준을 확인한 결과, 지방간과 관련된 유전자의 발현은 증가하 지 않았다 (도 30C). 한편 , 상기 간조직으로부터 간암 마커인 CD34, HIFla , i67 및 cyclinD 유전자의 발현이 HIFl-a의 발현과 함께 증가한 것을 확인하였다 (도 30D). 또한, 혈액 샘플을 분석하였을 경우, AST. ALT, LDL, 및 triglyceride의
100 수준이 증가함을 확인하였다 (도 30E) 실시예 24. 간섬유화 및 간암의 동물모델에서 T14SF5 단백질 및 관련 단 백질의 발현 변화 확인
유전자 변형 마우스를 이용하여 간질환의 심화과정을 다음과 같이 확인하 였다. 구체적으로. 상기 유전자 변형 마우스에 diethylnitrosamine(DEN) 약물을 주입함으로써 간암을 유도하였다. 상기 마우스로부터 간조직을 적출하여 H&E 염 색을 수행한 결과 간암이 유발된 것을 확인하였고 (도 31A), TM4SF5 단백질의 발 현이 증가하면서 STAT3 단백질의 인산화 및 라미닌의 발현이 증가하였다 (도 31B) 또한. 상기 수득된 간조직을 이용하여 면역염색을 수행함으로써 , TM4SF5, 인산화된 STAT3 , 라미닌 (laminins), 라미닌 γ 2(laminin γ 2) 및 콜라겐
K collagen I) 단백질의 발현이 증가한 것을 확인하였다 (도 31C). 실시예 25. 간암 환자의 암조직에서 T 4SF5 단백질의 발현 변화 확인 간암환자로부터 암 조직 및 암 주변조직을 수득하여 상술한 바와 같은 방 법으로 인산화된 STAT3. 라미닌 및 콜라겐 I의 발현변화를 확인하였다. 이때, 암 주변조직은 암으로 발병되기 전 단계로서 간염, 성유화 및 간경화의 병리학적 증 상이 나타날 것으로 예상되었다. 그 결과, 도 32에 나타난 바와 같이 , 암 조직 및 암 주변조직에서 TM4SF5, 인산화된 STAT3, 라미닌 및 콜라겐 I의 발현이 증가
101 하였다 (도 32)
102

Claims

【청구범위】
【청구항 1】
1) 간질환 의심 환자로부터 분리된 시료에서 TM4SF5( transmembrane 4 L6 family member 5) 단백질의 발현 수준이 정상 대조군에 비해 증가된 시료를 선별 하는 단계 ;
2) 상기 단계 1)에서 선별된 시료에서 SREBPKsterol regulatory element -binding transcription factor 1)의 mRNA또는 단백질의 발현 수준 및 STAT3( signal transducer and activator of transcription 3) 단백질, c—
Src(cel hilar sarcoma) 단백질, FA ( focal adhesion kinase) 단백질, mTOR, S6 , ULK(UNC-51-1 ike kinase 1), 4EBPl(Eukaryot ic translation initiation factor 4E— binding protein) 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이 상 단백질의 인산화 수준을 측정하는 단계; 및
3) 상기 단계 2)의 SREBPl의 mRNA또는 단백질의 발현 수준 및 STAT3 단 백질, C— Src단백질, FAK, mTOR, S6 , ULK, 4EBP1 및 Akt 단백질로 이루어진 그룹 에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 정상 대조군 시료의 SREBPl의 mRNA 또는 단백질의 발현 수준 및 STAT3 단백질, c-Src단백질, FAK, mTOR, S6 , ULK, 4EBP1 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준과 비교하는 단계를 포함하는 간질환의 진단을 위한 정보 제공 방법.
103 【청구항 2】
제 1항에 있어서, 상기 간질환이 비만, 대사장애, 포도당저항성, 인슬린저 항성, 체중증가, 지방간, 간섬유화증, 간염, 간경화증, 또는 간암인, 간질환의 진단을 위한 정보 제공 방법.
【청구항 3】
거 U항에 있어서, 상기 SREBP1의 mRNA또는 단백질의 발현 수준이 정상 대 조군에 비해 증가하고, STAT3 단백질, c-Src단백질, FAK 단백질, mTOR 단백질, S6 단백질, ULK 단백질, 4EBP1 단백질 및 Akt 단백질로 이루어진 그룹에서 선택 되는어느 하나 이상 단백질의 인산화 수준이 정상 대조군에 비해 감소하거나, 상기 SREBP1의 mRNA 또는 단백질의 발현 수준이 정상 대조군에 비해 증가 하고, 모노아실 -(monoacyl -) , 다이아실 -(di acyl -), 또는 트라이아실— ( t r i acyl-) 글라이세롤 (glycerol )의 수준이 정상 대조군에 비해 감소하는 경우 지방간으로 판단하는, 간질환의 진단을 위한 정보 제공 방법.
【청구항 4]
제 1항에 있어서, 상기 SREBP1의 mRNA또는 단백질의 발현 수준이 정상 대 조군에 비해 감소하고, STAT3 단백질, c-Src단백질, FAK , mTOR , S6K, ULK , 4EBP1
104 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준이 정상 대조군에 비해 증가하면 간섬유화증, 간염, 간경화증, 또는 간암으 로 판단하는, 간질환의 진단을 위한 정보 제공 방법 .
【청구항 5】
제 1항에 있어서, SIRTKNAD-dependent deacetylase sirtuin-1), SIRT5, SIRT6, SREBP2, SREBPlc, CD36, FABPK fatty acid-binding protein 1),
FASN( fatty Acid Synthase) , LDLR( low density lipoprotein receptor) ,
VLDLR(very Low Density Lipoprotein Receptor) , PPAR γ (peroxisome
prol i ferator-act ivated receptors γ ) , TIMPKThe t issue inhibitor of metal loproteinase-1) , TGFP 1 (Trans forming growth factor beta 1),
TNF a (tumor necrosis factor a), viment in, MCP1 [monocyte chemotact ic protein 1 (CCL2)] , laminin a2, laminin α 3, laminin a 5, laminin γ 2, laminin y 3, S0CS1 (suppressor of cytokine signaling 1), S0CS3 ,
ApoB100(Apol ipoprotein B) , PPAR a , Leptin, Acc(Acetyl-CoA carboxylase) α , Acc , F4/80 antigen, 콜라겐 I, 콜라겐 I형 al 체인 (collagen type I alpha 1 chain), AFP(Alpha-fetoprotein) , FUCA(AFU, alphaᅳ L-fucosidase 1), CD34, HIF1 a (Hypoxia— inducible factor), Ki-67, 및 Cyclin Dl으로 구성된 군으로부터 선택되는 어느 하나 이상의 mRNA또는 단백질의 발현을 측정하는 단계를 추가로
105 포함하는, 간질환의 진단을 위한 정보 제공 방법.
【청구항 6]
제 5항에 있어서, 상기 SIRT1, SIRT5, SIRT6, laminin α5, laminin γ2 또는 laminin y 3의 mRNAs 또는 단백질의 발현 수준이 정상 대조군에 비해 감소 하고 SREBP2 , SREBPlc , CD36, FABP1, FASN, LDLR, VLDLR, PPARy , TIMP1, TGFP1, TNFa , vimentin, MCPl, SOCSl, S0CS3, ApoBlOO, PPAR a , Leptin, Acc a 또는 AccP 의 mRNA혹은 단백질의 발현 수준이 정상 대조군에 비해 증가하고, STAT3단백질, c-Src단백질., FAK단백질, mTOR단백질, S6K단백질, ULK단백질, 4EBP1 단백질 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백 질의 인산화 수준이 정상 대조군에 비해 감소하면 지방간으로 판단하는, 간질환 의 진단을 위한 정보 제공 방법.
【청구항 7】
제 5항에 있어서, 상기 SREBP2, SREBPlc, CD36, FABP1, FASN, LDLR, VLDLR 또는 PPARy의 mRNA또는 단백질의 발현 수준이 정상 대조군에 비해 감소하고, SIRT1, SIRT5, SIRT6, TGFP 1, TNFa, vimentin, laminin, laminin γ 2, collagen I SOCSl, S0CS3, F4/80 antigen, 콜라겐 I, 콜라겐 I형 al 체인 (collagen type I alpha 1 chain) , AFP(Alpha-fetoprotein) , FUCA(AFU, alpha—L—
106 fucosidase 1), CD34, HIFl a (Hypoxia-inducible factor) , Ki-67, 또는 Cyclin Dl의 mRNA 또는 단백질의 발현 수준이 증가하고, STAT3 단백질, c-Src단백질, FA 단백질, mTOR 단백질, S6K 단백질, ULK 단백질, 4EBP1 단백질 및 Akt 단백질 로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준이 정상 대 조군에 비해 증가하면 간섬유화증, 간염, 간경화증, 또는 간암으로 판단하는, 간 질환의 진단을 위한 정보 제공 방법 .
【청구항 8】
제 7항에 있어서, 상기 간염, 간섬유화증, 간경화증, 또는 간암이 간상피 세포 (hepatocytes)에서 laminin α 2, laminin α3, laminin α 5, laminin γ 2, laminin γ3 chain을 포함하는 라미닌 ( laminins) 또는 elastin을 포함하는 세포 외 기질 (extracellular matrix, ECM)의 양이 증가하는, 간질환의 진단을 위한 정 보 제공 방법 .
【청구항 9】
제 8항에 있어서, 상기 ECM이 a-SMA( a -smooth muscle actin), 콜라겐, 라미닌 및 laminin γ 2로 구성된 군으로부터 선택되는 어느 하나 이상을 간상피 세포 (hepatocytes) 또는 간성상세포 (hepatic stellate eel Is)에서 각각의 발현 수준의 측정을 포함하는, 간질환의 진단을 위한 정보 제공 방법 .
107
【청구항 10]
게 1항 또는 게 5항에 있어서, SREBPl, SREBP2 또는 SREBPlc의 mRNA 혹은 단백질의 발현 수준이 SIRTKNAD-dependent deacetylase sirtuin-1), SIRT2, SIRT4, SIRT5, SIRT6 및 SIRT7로 구성된 군으로부터 선택되는 어느 하나 이상의 단백질에 의해 조절되는, 간질환의 진단을 위한 정보 제공 방법.
【청구항 111
제 1항에 있어서, TM4SF5가 과발현되거나 발현 억제된 세포 혹은 동물모델 에서 STAT3 단백질의 인산화 수준이 SOCSKsuppressor of cytokine signaling 1) 및 S0CS3로 구성된 군으로부터 선택되는 어느 하나 이상의 단백질에 의해 조절되 고 elastin, 콜라겐 (col lagen) I, 라미닌 (laminin) α2, 라미닌 (laminin) α3, 라미닌 (laminin) α5, 라미닌 (laminin) γ2 또는 라미닌 (laminin) γ 3의 전사 활 성 및 발현을 조절하는, 간질환의 진단을 위한 정보 제공 방법.
【청구항 12】
거 U항에 있어서, 상기 TM4SF5 단백질의 발현 증가에 따라지방간 및 간염 이 발병함에 따라서 혈장 내에서 트리글리세라이드 (triglyceride, TG), 자유 지방 산 (free fatty acid, FFA), 콜레스테를 (cholesterol), 알라닌 아미노트랜스퍼라제
108 (alanine aminotransferase, ALT), 아스파르산 아미노트랜스퍼라제 (aspartate aminotransferase, AST), LDL(Low— density lipoprotein), 글루코스 (glucose), 및 인슐린 (insLilin)으로 구성된 군으로부터 선택되는 어느 하나 이상의 양이 증가되 는 것인, 간질환의 진단을 위한 정보 제공 방법.
【청구항 13】
거 U항에 있어서, 상기 TM4SF5 단백질의 발현 증가에 따라 간섬유화가 발 병함에 따라서 조직에서 간세포의 손상, 세포 배열 패턴 무질서화, 또는 콜라겐 I 또는 라미닌 합성 축적 증가가 나타나는 것인, 간질환의 진단을 위한 정보 제 공 방법ᅳ
【청구항 14】
제 1항에 있어서, 상기 TM4SF5 단백질의 발현 증가에 따라 환자에서 체중 의 증가, 체중 /간무게의 증가, 고탄수화물 식이, 고지방 식이, 저지방 /고탄수화 물 식이, 고아르기닌, 및 고수크로즈 ( sucrose) 식이에 따른 체중 증가, 인슐린 저항성 증가, 글루코즈 저항성 증가, 지방간 및 지방간염의 증가, 또는 콜라겐 및 라미닌 등의 세포외기질 합성 증가가 나타나는 것인, 간질환의 진단을 위한 정보 제공 방법 .
109
【청구항 15]
1) TM4SF5 및 SREBP1 단백질을 발현하는 세포에 피검물질을 처리하는 단 계;
2) 상기 단계 1)의 세포에서 SREBP1 단백질의 mRNA또는 단백질의 발현 수준 및 STAT3 단백질, C— Src단백질, FAK, mTOR, S6K, ULK, 4EBP1 및 Akt 단백질 로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 측정하 는 단계 ; 및
3) 상기 단계 2)에서 피검물질을 처리하지 않은 대조군에 비해 SREBP1 mRNA또는 단백질의 발현 수준을 억제하고, STAT3 단백질, c-Src단백질, FAK, mTOR, S6K, ULK, 4EBP1 및 Akt 단백질로 이루어진 그룹에서 선택되는 어느 하나 이상 단백질의 인산화 수준을 증가시키거나, 피검물질을 처리하지 않은 대조군에 비해 SREBP1 mRNA또는 단백질의 발현 수준을 억제하고, 모노아실 -(monoacyl-), 다이아실 -(di acyl-) , 또는 트라이아실 -(tr i acyl-) 글라이세롤 (glycerol )의 합성 을 감소시키는 피검물질을 선별하는 단계를 포함하는 지방간 치료 후보물질의 스 크리닝 방법.
【청구항 16】
제 15항에 있어서, SIRT NAD— dependent deacetylase si rtuin-1) , SIRT5 , SIRT6 , SREBP2 , SREBPlc , CD36 , FABPK fat ty ac id-binding protein 1),
110 FASN( fatty Acid Synthase) , LDLR( low density lipoprotein receptor) , VLDLR(very Low Density Lipoprotein Receptor) , PPAR γ (peroxisome
prol i f erator-act ivated receptors γ ) , TIMPKThe tissue inhibitor of metal loproteinase-1) , TGFP 1( Trans forming growth factor beta 1),
TNF a (tumor necrosis factor a), viment in, MCP1 [monocyte chemotact ic protein 1 (CCL2)] , laminin a 5, laminin γ 2, laminin γ 3, S0CS1 (suppressor of cytokine signaling 1) S0CS3 , ApoB100(Apol ipoprotein B) , PPAR a , Leptin, Acc(Acetyl-CoA carboxylase) a , AccP , F4/80 antigen, 콜라겐 I, 콜라겐 I형 α 1 체인 (collagen type I alpha 1 chain), AFP(Alpha-fetoprotein) , FUCA(AFU, alpha-L-fucosidase 1), CD34, HIF1 a (Hypoxia- inducible factor) , Kiᅳ 67, 및 Cyclin D으로 구성된 군으로부터 선택되는 어느 하나 이상의 mRNA또는 단백질의 발현을 측정하는 단계를 추가로 포함하는, 지방간 치료 후보물질의 스크리닝 방 법.
【청구항 17】
1) TM4SF5 단백질을 발현하는 세포 또는 동물모델에 피검물질을 처리하는 단계;
2) 상기 단계 1)의 세포 또는 동물모델에서 TM4SF5 단백질과 mTOR 단백질, SLC7A1 단백질 및 아르기닌으로 구성된 군으로부터 선택되는 어느 하나 이상과의
111 결합을 측정하는 단계 ;
3) 상기 단계 1)의 세포 또는 동물모델에서 mTOR 단백질, S6K 단백질, UNC-51-like kinase 1(UL 1) 단백질, 또는 4EBP1 단백질의 인산화를측정하는 단계 ;
4) 상기 단계 1)의 세포 또는 동물모델에서 모노아실 -(monoacyl-) , 다이 아실 -(di acyl-) , 또는 트라이아실 -(tr i acyl-) 글라이세를 (glycerol )의 수준을 측정하는 단계 ;
5) 상기 단계 1)의 세포 또는 동물모델에서 체중 증가, 포도당 저항성, 인술린 저항성 및 해당과정의 반응성으로 구성된 군으로부터 어느 하나 이상을 측정하는 단계 ; 및
6) 상기 단계 1)의 세포 또는 동물모델에서 해당과정 관련된 유전자들의 발현 정도를 측정하는 단계 ; 및
7) 상기 단계 2)에서 TM4SF5 단백질과 niTOR 단백질, SLC7A1 단백질 및 아 르기닌으로 구성된 군으로부터 선택되는 어느 하나 이상과의 결합을 억제하고, 단계 3) mTOR 단백질, S6K 단백질, UNC-51-like kinase 1(UL 1) 단백질, 또는 4EBP1 단백질의 인산화를 억제하며, 단계 4)에서 모노아실— (monoacyl-) , 다이아실- (di acyl-) , 및 트라이아실 -(tr i acyl-) 글라이세롤 (glycerol )의 수준을 감소시키 고, 단계 5)에서 체중 증가, 포도당 저항성, 인슐린 저항성 또는 해당과정의 반 응성을 감소시키는 피검물질을 선별하는 단계를 포함하는 항비만, 지방간, 또는 간암 치료 후보물질의 스크리닝 방법.
112
【청구항 18】
TM4SF5 유전자가 녹아웃 (knock-out , K0)된 마우스를 APCmim/+(adenc)matous polypos i s col imin/+)의 유전형을 갖는 마우스와 교배하는 단계를 포함하는 문맥 압항진증 (portal hypertension) 동물 모델 제조 방법 .
【청구항 19】
제 18항의 방법으로 제조된 문맥압항진증 동물 모델.
113
PCT/KR2018/012860 2017-10-26 2018-10-26 Tm4sf5 단백질의 발현 변화를 이용한 간질환의 진단방법 및 간질환 치료제 스크리닝 방법 Ceased WO2019083333A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/758,016 US20210190799A1 (en) 2017-10-26 2018-10-26 Method for diagnosing liver diseases and method for screening therapeutic agent for liver diseases using changes in expression of tm4sf5 protein

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20170140514 2017-10-26
KR10-2017-0140514 2017-10-26

Publications (1)

Publication Number Publication Date
WO2019083333A1 true WO2019083333A1 (ko) 2019-05-02

Family

ID=66247975

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/012860 Ceased WO2019083333A1 (ko) 2017-10-26 2018-10-26 Tm4sf5 단백질의 발현 변화를 이용한 간질환의 진단방법 및 간질환 치료제 스크리닝 방법

Country Status (3)

Country Link
US (1) US20210190799A1 (ko)
KR (3) KR102112760B1 (ko)
WO (1) WO2019083333A1 (ko)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
RU2770735C1 (ru) * 2021-10-14 2022-04-21 Федеральное государственное бюджетное образовательное учреждение высшего образования "Рязанский государственный медицинский университет имени академика И.П. Павлова" Министерства здравоохранения Российской Федерации Способ моделирования портальной гипертензии у свиньи
KR20220057286A (ko) * 2020-10-29 2022-05-09 한국과학기술연구원 Fak 활성 억제제를 스크리닝하기 위한 조성물, 키트 및 방법

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102573556B1 (ko) * 2020-08-20 2023-09-01 한국생명공학연구원 Srebp2의 발현 수준을 측정하는 제제를 포함하는 감염성 질환 진단용 조성물
KR102643622B1 (ko) 2020-11-06 2024-03-05 서울대학교산학협력단 Tsahc 또는 이의 약학적으로 허용가능한 염을 유효성분으로 포함하는 면역억제제
KR102258451B1 (ko) 2020-11-17 2021-05-31 주식회사 하이센스바이오 지방간질환의 예방 또는 치료용 조성물
KR102682305B1 (ko) * 2021-01-19 2024-07-09 서울대학교산학협력단 간혈관폐쇄회로 시스템을 이용한 간 유래 엑소좀 추출방법 및 간 유래 엑소좀을 유효성분으로 함유하는 당뇨 관련 질환 치료용 약학적 조성물
EP4349358A4 (en) * 2021-06-03 2025-05-28 Medpacto, Inc. TM4SF19 INHIBITOR AND ITS USES
JP7816768B2 (ja) * 2021-07-26 2026-02-18 国立大学法人山口大学 肝癌モデル動物又は肝硬変モデル動物の作製方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120022504A (ko) * 2010-07-30 2012-03-12 서울대학교산학협력단 간 질환의 진단, 치료 및 예방용 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100934706B1 (ko) 2006-12-07 2009-12-31 재단법인서울대학교산학협력재단 Tm4sf5의 기능을 저해하는 항암물질의 스크리닝 방법및 칼콘계 화합물을 함유하는 항암조성물

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120022504A (ko) * 2010-07-30 2012-03-12 서울대학교산학협력단 간 질환의 진단, 치료 및 예방용 조성물

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BAI, T. ET AL.: "Betulin Alleviated Ethanol-induced Alcoholic Liver Injury via SIRT1/AMPK Signaling Pathway", PHARMACOLOGICAL RESEARCH, vol. 105, 15 January 2016 (2016-01-15), pages 1 - 12, XP029435951, DOI: doi:10.1016/j.phrs.2015.12.022 *
HORIGUCHI, N. ET AL.: "Cell Type-dependent Pro-and Anti-inflammatory Role of Signal Transducer and Activator of Transcription 3 in Alcoholic Liver Injury", GASTROENTEROLOGY, vol. 134, 2008, pages 1148 - 1158, XP022584848, DOI: doi:10.1053/j.gastro.2008.01.016 *
IKENAGA, N. ET AL.: "A New Mdr2-/- Mouse Model of Sclerosing Cholangitis with Rapid Fibrosis Progression, Early-onset Portal Hypertension, and Liver Cancer", THE AMERICAN JOURNAL OF PATHOLOGY, vol. 185, no. 2, February 2015 (2015-02-01), pages 325 - 334, XP055597167 *
RYU, J. ET AL.: "Cross Talk between the TM4SF5/Focal Adhesion Kinase and the Interleukin-6/STAT3 Pathway s Promotes Immune Escape of Human Liver Cancer Cells", MOLECULAR AND CELLULAR BIOLOGY, vol. 34, no. 16, August 2014 (2014-08-01), pages 2946 - 2960, XP055597165 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220057286A (ko) * 2020-10-29 2022-05-09 한국과학기술연구원 Fak 활성 억제제를 스크리닝하기 위한 조성물, 키트 및 방법
KR102408538B1 (ko) 2020-10-29 2022-06-15 한국과학기술연구원 Fak 활성 억제제를 스크리닝하기 위한 조성물, 키트 및 방법
RU2770735C1 (ru) * 2021-10-14 2022-04-21 Федеральное государственное бюджетное образовательное учреждение высшего образования "Рязанский государственный медицинский университет имени академика И.П. Павлова" Министерства здравоохранения Российской Федерации Способ моделирования портальной гипертензии у свиньи

Also Published As

Publication number Publication date
KR102112760B1 (ko) 2020-05-19
KR20200045454A (ko) 2020-05-04
KR20190046705A (ko) 2019-05-07
KR20200043954A (ko) 2020-04-28
KR102212707B1 (ko) 2021-02-08
US20210190799A1 (en) 2021-06-24
KR102212697B1 (ko) 2021-02-08

Similar Documents

Publication Publication Date Title
WO2019083333A1 (ko) Tm4sf5 단백질의 발현 변화를 이용한 간질환의 진단방법 및 간질환 치료제 스크리닝 방법
Lin et al. CB1 cannabinoid receptor antagonist attenuates left ventricular hypertrophy and Akt-mediated cardiac fibrosis in experimental uremia
Zhang et al. Transforming growth factor β1 (TGF-β1)-stimulated integrin-linked kinase (ILK) regulates migration and epithelial-mesenchymal transition (EMT) of human lens epithelial cells via nuclear factor κB (NF-κB)
Zhang et al. Effect of icariside II and metformin on penile erectile function, glucose metabolism, reaction oxygen species, superoxide dismutase, and mitochondrial autophagy in type 2 diabetic rats with erectile dysfunction
Chen et al. LncRNA LINK‐A remodels tissue inflammatory microenvironments to promote obesity
Zhong et al. LNK deficiency decreases obesity-induced insulin resistance by regulating GLUT4 through the PI3K-Akt-AS160 pathway in adipose tissue
CN102921007B (zh) 防治胰岛素抵抗和糖尿病的方法和试剂
Li et al. HMGB1 regulates autophagy of placental trophoblast through ERK signaling pathway
KR101910770B1 (ko) Dscr1-4 를 이용한 제2형 당뇨병 치료제의 스크리닝 방법, 및 제2형 당뇨병 진단 또는 예후 예측용 조성물
Wu et al. Pentamethylquercetin attenuates angiotensin II-induced abdominal aortic aneurysm formation by blocking nuclear translocation of C/EBPβ at Lys253
Miao et al. ErbB3 binding protein 1 (EBP1) participates in the regulation of intestinal inflammation via mediating Akt signaling pathway
US20150018383A1 (en) Biomarkers of renal disorders
TWI359271B (en) Pharmaceutical composition for insulin resistance
Tang et al. Role of far upstream element binding protein 1 in colonic epithelial disruption during dextran sulphate sodium-induced murine colitis
Qi et al. Contributing role and molecular basis of Vitamin D/Vitamin D receptor deficiency in hyperhomocysteinemia-induced cardiac hypertrophy
Zhang et al. Macrophage Nogo-B drives liver fibrosis
KR102176937B1 (ko) 바이페린 억제제를 유효성분으로 포함하는 대사질환의 예방 또는 치료용 조성물
CN108159419B (zh) 诱导irf8表达的物质在制备治疗肝癌的药物中的应用
Wang et al. SREBP1 Is a Down‐Stream Target of CLOCK Mediating Natural Development of MAFLD Induced by HFD
Liu et al. Effect of sleeve gastrectomy on glycometabolism via forkhead box O1 (FoxO1)/lipocalin-2 (LCN2) pathway
CN114908158B (zh) Cdk1在晚期胃肠间质瘤的诊断和治疗中的应用
Xu et al. Downregulation of Brf1 Induces Liver Failure and Inhibits Hepatocellular Carcinoma Progression by Promoting Apoptosis
Al Sereidi DISTRIBUTION OF ERM PROTEINS IN THE STOMACH MUCOSA OF NORMAL AND DIABETIC RATS
Adnani The Role of Neuropeptide Y and NPY5R in Ewing Sarcoma Metastasis
Suga et al. Sodium-glucose cotransporter-specific substrate αMG stimulates endogenous glucagon secretion and ameliorates obesity-associated metabolic disorders in mice

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18869587

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18869587

Country of ref document: EP

Kind code of ref document: A1