WO2019081383A1

WO2019081383A1 - Eukaryotic initiation factor 4 recruiting aptamers for enhancing translation

Info

Publication number: WO2019081383A1
Application number: PCT/EP2018/078794
Authority: WO
Inventors: Steve Pascolo
Original assignee: Universität Zürich
Priority date: 2017-10-25
Filing date: 2018-10-19
Publication date: 2019-05-02

Abstract

The present invention relates to ribonucleic acids containing an open reading frame (ORF) and one or more aptamer sequence(s) specific for a component of eukaryotic initiation factor 4 F (elF4F) complex, which aptamer sequence binds to elF4F complex but does not inhibit translation. The invention further relates to DNA molecules such as vectors coding for the RNA. It also relates to vectors containing an elF4F complex aptamer sequence ready for insertion of a recombinant gene. Furthermore, the invention relates to methods for expression of recombinant genes employing said RNA or DNA molecules.

Description

Eukaryotic initiation factor 4 recruiting aptamers for enhancing translation

The present invention relates to ribonucleic acids containing an open reading frame (ORF) and one or more aptamer sequence(s) specific for a component of eukaryotic initiation factor 4 F (elF4F) complex, which aptamer sequence binds to elF4F complex but does not inhibit translation. The invention further relates to DNA molecules such as vectors coding for the RNA. It also relates to vectors containing an elF4F complex aptamer sequence ready for insertion of a recombinant gene. Furthermore, the invention relates to methods for expression of recombinant genes employing said RNA or DNA molecules. Expressing recombinant genes in vivo can be used for vaccination and gene therapy. Although, plasmid DNA and recombinant viruses have been mostly used initially, in vitro transcribed messenger RNA (ivt mRNA) has emerged as a further alternative in the 90s and became a broadly accepted method attracting increasing interest in the last ten years (Sahin et al. (2014) Nature reviews Drug discovery 13 (10):759-780). Since the implementation of the first Good Manufactoring Practice (GMP) mRNA production plant, several human clinical studies have been published demonstrating safety, versatility and efficacy of directly injected ivt mRNA (e.g. Weide et al. (2009) J Immunother 32 (5):498-507). Key features of mRNA-based therapies are (i) the intrinsic translability of the ivt mRNA (level of protein expression), (ii) its

immunogenicity (triggering or not of innate immune receptors) and its formulation (site of delivery and expression). Concerning the first aspect, the optimization of the cap structure, untranslated regions (UTRs), open reading frame and poly A-tail have been reported (Sahin et al. (2014), supra; Holtkamp et al. (2006) Blood 108

(13):4009-4017). They turn ivt mRNA into a vector with high expression of the encoded protein. One limiting factor in translating mRNA is the eukaryotic initiation factor 4 E (elF4E) which recognizes the 5' cap structure of the mRNA. It recruits the scaffolding elF4G protein which in turn recruits all other components of the initiation complex forming the elF4F complex that moves on the mRNA down to the ATG start codon. Aptamers that bind elF4G have been identified with the goal to block translation in tumor cells Miyakawa et al. (2006) RNA 12 (10):1825-1834). Of the eight identified aptamers, Miyakawa et al. demonstrated that three inhibited indeed translation.

The technical problem underlying the present invention is to provide new means for improving translation of recombinant genes.

The solution to the above technical problem is provided by the embodiments of the present invention as defined in the claims and further characterized in the description and appending figures.

In particular, the present invention provides nucleic acid, preferably, a ribonucleic acid (RNA) molecule comprising an ORF coding sequence and at least one translation non-blocking elF4F aptamer sequence. According to the invention a "translation non-blocking elF4F aptamer sequence is a ribonucleotide sequence specifically binding to a component of the elF4F complex characterized in that the sequence specifically binding to the complex does not interfere with, i.e. reduce translation. The RNA of the invention may comprise more than one translation non- blocking elF4F aptamer sequence, e.g. 2, 3 or more of them. The elF4F aptamer sequences, if more than one is present, may be the same or different. They may be included into the RNA in a head-to-tail, head-to-head or tail-to-tail fashion (whereby the "head" denotes the 5' end of a respective aptamer sequence as described herein, and the "tail" denotes the 3' end). Preferred embodiments of elF4F aptamer sequences for use in the invention are translation non-blocking aptamers specific for elF4A, elF4E and/or elF4G. Particularly preferred aptamers are translation non- blocking aptamers specific for elF4G.

It is to be understood that the inventive nucleic acids can take the form of RNA and DNA. According to the present invention, the terms "nucleic acid" and

"polynucleotide" are used interchangeably and refer to DNA, RNA or species containing one or more nucleotide analogues. Preferred nucleic acids or

polynucleotides according to the present invention are RNAs, particularly preferred mRNAs. Preferably, the RNA is an mRNA having a 5' cap structure, more preferably a 7- methyl guanosine group bound to the 5' end of the mRNA (also referred to as 7- methyl guanosine cap, typically abbreviated as m⁷G). The 7-methylguanosine group of the 5' cap structure can be further modified, including methylation of the 2' hydroxy groups of the first two ribose moieties at the 5' end of the mRNA. The so-called cap-1 structure has a methylated 2'-hydroxy group on the first ribose. The so-called cap-2 structure includes a methylated 2'-hydroxy groups on the first two ribose sugars at the 5' end of the mRNA In other embodiments the mRNA may be may be capped with NAD+, NADH or 3'-dephospho Coenzyme A. In another embodiment, the mRNA of the invention has a cap independent structure at the 5' end such as the 143 nt 5'- leader RNA sequence from tobacco etch virus (TEV).

In order to achieve particularly strong expression of the mRNA according to the invention, the elF4G aptamer sequence is located in the 5' untranslated region (5' UTR) of the mRNA.

In one embodiment, the elF4F aptamer sequence, in particular an elF4G aptamer for use in the present invention comprises the sequence motif 5'-UGUCG-3'. Particularly preferred elF4G aptamer sequences of this type comprise or consist of the following sequences (in 5' to 3' direction):

ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAAGUGUCG (SEQ ID NO: 1)

UCCGCGGCGCCAUCUCAUGUUUAGUUGUCCUAUGUCGAGC (SEQ ID NO: 2) According to the most preferred embodiment of the invention, the elF4G aptamer sequence comprises or consists of, respectively, the sequence according to SEQ ID NO: 1 .

In an alternative embodiment, the elF4G aptamer sequence of the invention comprises or consists of the following sequence (shown in 5' to 3' direction):

UCCGUAGAAACGCGUUAAGGUGAAAGUUUGAGGGCUCCUCA (SEQ ID NO: 3)

The RNA of the present invention may also contain one or more modified nucleotide analogues, in particular based upon stability and immunostimulating considerations. The chemical modification of the nucleotide analogue in comparison to the natural occurring nucleotide may be at the ribose, phosphate and/or base moiety. With respect to molecules having an increased stability, especially with respect to RNA degrading enzymes, modifications at the backbone, i. e. the ribose and/or phosphate moieties, are especially preferred.

Preferred examples of ribose-modified ribonucleotides are analogues wherein the 2'- OH group is replaced by a group selected from H, OR, R, halo, SH, SR, NH₂, NHR, NR₂, or CN with R being C1 -C6 alkyl, alkenyl or alkynyl and halo being F, CI, Br or I. It is clear for the person skilled in the art that the term "modified ribonucleotide" also includes 2'-deoxyderivatives, such as 2'-O-methyl derivatives, which may at several instances also be termed "deoxynucleotides". As mentioned before, the at least one modified ribonucleotide may be selected from analogues having a chemical modification at the base moiety. Examples of such analogues include, but are not limited to, 5-aminoallyl-uridine, 6-aza-uridine, 8-aza- adenosine, 5-bromo-uridine, 7-deaza-adenine, 7-deaza-guanine, N⁶-methyl-adenine, 5-methyl-cytidine, pseudo-uridine, 1 -methyl-pseudo-uridine and 4-thio-uridine.

Examples of backbone-modified ribonucleotides wherein the phosphoester group between adjacent ribonucleotides is modified are phosphothioate groups.

The invention also provides DNA molecules coding for a RNA as described herein. According to a preferred embodiment, the DNA of the invention takes the form a vector for transmitting the information for production of RNAs of the invention into cells or in cell-free systems for transcription of the vector yielding RNA, in particular, mRNA molecules of the invention. In general, the present invention provides a method for producing the RNA as defined herein comprising the step of transcribing the DNA of the invention in vitro. Corresponding cell-free in vitro transcription kits are known to the skilled person and commercially available from various manufacturers such as those mentioned in the below Example. Many types of vectors are known to the skilled person, and examples include viruses, plasmids and cosmids. A further embodiment of the invention is a vector containing the following sequence elements:

Prom-elF4F-translation start-Term

wherein the above abbreviations denote the following:

Prom promotor

elF4F sequence coding for elF4F aptamer sequence as defined

herein

translation start translation start codon

Term termination site Thus, the invention includes vectors prepared for inclusion of a recombinant gene such that transcription of an mRNA according to the invention is attained, once the vector is introduced into a suitable cell or a suitable cell-free in vitro transcription system. The vector may comprise a sequence comprising more than one elF4F aptamer sequence such as 2, 3 or more, which may be in head-to-head, head-to-tail or tail-to-tail orientation.

With respect to elements of vectors according to the invention, it is to be understood that these elements can be present in both the vector of the invention without having an inserted recombinant gene and the vectors of the invention containing a

recombinant gene.

Promoters useful in the present invention include, but are not limited to, promoters of prokaryotic, viral, mammalian, or insect cell origin or a combination thereof. Likewise, terminators useful in a nucleic acid according to the invention include, but are not limited to, terminators of prokaryotic, viral, mammalian, insect cell origin or a combination thereof.

Preferred prokaryotic promoters are Lac, T7, T3, SP6, arabinose and trc promoters. Further promoters useful in the context of the present invention are viral promoters such as baculoviral promoters. Further promoters useful in the context of the present invention are the promoter sequences CMV, SV40, UbC, EF-1 a, RSVLTR, MT, T DS47, Ac5, PGAL and PADH- Examples of terminator sequences useful in the context of the present invention are T7, SV40, HSVtk or BGH.

Vectors according to the invention may further contain one or more typical multiple cloning cites (MCS), preferably after the elF4F aptamer sequence, most preferred the elF4G aptamer sequence of the invention. The restriction enzymes sites contained in the MCS can easily be chosen by the skilled person and examples of such sites together with their recognition sequences can be taken from the latest product catalogue of New England Biolabs, Ipswich, MA, USA. Vectors of the invention for transmission in prokaryotic host cells comprise, preferably besides the above-exemplified marker genes (one or more thereof), an origin of replication (ori). Examples are BR322, ColE1 , and conditional origins of replication such as OriV and R6Ky. In further preferred embodiments of the present invention, the vectors as described herein additionally contain one or more resistance markers for selecting against otherwise toxic substances. Preferred examples of resistance markers useful in the context of the present invention include, but are not limited to, antibiotics such as ampicillin, chloramphenicol, gentamycin, spectinomycin, and kanamycin resistance markers.

The nucleic acid of the present invention may also contain one or more ribosome binding site(s) (RBS) For increasing the stability and effectiveness of translation of the inventive RNA, the sequences of the invention can be further modified such as disclosed in Sahin et al (2014), supra, and Holtkamp et al. (2006), the contents of which are herewith included into the present description by reference. Such measures include optimised codon usage in the ORF, optimized polyA tails and inclusion of untranslated globin UTR(s) in the untranslated region between the 5' end and the ORF or between the ORF and the polyA tail.

The nucleic acids of the present invention are useful in genetic vaccination, wherein a suitable nucleic acid molecule of the invention, which codes for an antigen, is introduced into an organism or into a cell. The introduction of the nucleic acid may be carried out in vitro by electroporation followed by adoptive transfer or in vivo by direct injection by needle-dependent or needle-less devices. The nucleic acid molecule in this context of the invention may be a DNA or an mRNA.

Further object of the invention is a host cell containing the RNA or DNA. The invention also relates to a cell-free transcription extract containing the DNA of the invention from which the inventive RNA will be transcribed in vitro. The host cell of the invention can be selected from a wide range and include prokaryotic cells, in particular bacteria, for propagating DNA molecules, in particular vectors such as plasmids and viruses. Other host cells of the invention include eukaryotic cells transfected with a RNA, preferably an mRNA, of the invention or a DNA encoding said RNA. One embodiment is a dendritic cell into which an in vitro transcribed RNA (ivt RNA), preferably encoding an antigen such as a tumor antigen or an antigen of a pathogen, e.g. of a virus, has been transfected. A further embodiment is a T cell into which an in vitro transcribed RNA (ivt RNA), preferably encoding a receptor such as a T cell Receptor has been transfected. For introduction of the nucleic acids of the invention, for example the RNA, particularly preferred an mRNA according to the invention, these molecules may be admixed or in complex with, respectively, agents increasing the stability and/or facilitating the introduction of the RNA into the targeted cell. Typical examples are liposomal compositions containing the RNA of the invention. Other useful agents in this regard are polycations such as protamine. The use of nanoparticles and RNA for introducing the RNA into host cells is disclosed in WO 2009/144230 A1 . The invention therefore also relates to a pharmaceutical composition containing the RNA or DNA molecule as defined above in combination with a pharmaceutically acceptable carrier, vehicle and/or diluent. Further objects of the invention are methods expressing the recombinant gene encoded by the ORF sequence present in the RNA of the invention in vitro. One method is the transfection of the RNA, particularly, the mRNA of the invention into a host cell. Another option is the introduction of a DNA encoding the RNA of the invention into a host cell and culturing the cell under conditions allowing the expression of the recombinant gene.

Pharmaceutical compositions of the invention can be injected systematically (intra- venous or sub-cutaneous) as well as locally at the site of DNA or mRNA delivery, thereby providing an immune environment (induction of cytokines and maturation of APCs) profitable to the induction of an immune response against an antigen encoded by the ORF of the inventive nucleic acid. The RNA, DNA and pharmaceutical compositions of the present invention are useful as genetic vaccines, i.e. they are especially suited for expressing the recombinant gene in vivo. The genetic vaccines according to the invention are suitable for the treatment of cancers. A tumor-specific antigen (TSA) or a nucleic acid which codes for such an antigen as well as part(s) of tumor antigens or nucleic acids which code for such part(s) may be used in this context. Specific examples of tumor antigens which can be used according to the invention include 707-AP, AFP, ART-4, BAGE, .beta.-catenin/m, Bcr-abl, CAMEL, CAP-1 , CASP-8, CDC27/m, CDK4/m, CEA, CT, Cyp-B, DAM, ELF2M, ETV6-AML1 , G250, GAGE, GnT-V, Gp100, HAGE, HER- 2/neu, HLA-A*0201 -R170I, HPV-E7, HSP70-2M, HAST-2, hTERT (or hTRT), iCE, KIAA0205, LAGE, LDLR/FUT, MAGE, MART-1 /Melan-A, MC1 R, myosin/m, MUC1 , MUM-1 , -2, -3, NA88-A, NY-ESO-1 , p190 minor bcr-abl, Pml/RAR.alpha., PRAME, PSA, PSM, RAGE, RU 1 or RU2, SAGE, SART-1 or SART-3, TEL/AML1 , TPI/m, TRP-1 , TRP-2, TRP-2/INT2 and WT1 . The nucleic acids according to the invention may be furthermore employed against infectious diseases.

The nucleic acids, in particular the RNA, according to the invention may be used combination with chloroquine, a pharmaceutical compound that increases cross presentation and thus the induction of antigen-specific effector T-cells.

The pharmaceutical composition of the invention comprises, in addition to the inventive nuclei acid, in particular an mRNA, and other optional therapeutic or immunogenic agents, a pharmaceutically acceptable carrier and/or a

pharmaceutically acceptable vehicle and/or pharmaceutically acceptable diluent. Appropriate routes for suitable formulation and preparation of the immunostimulating agent according to the invention and the vaccine are disclosed in Remington: "The Science and Practice of Pharmacy," 20th Edn., A.R. Gennaro, Editor, Mack

Publishing Co., Easton, PA (2003). Possible carrier substances for parenteral administration are e.g. sterile water, Ringer, Ringer lactate, sterile sodium chloride solution, polyalkylene glycols, hydrogenated naphthalenes and, in particular, biocompatible lactide polymers, lactide/glycolide copolymers or

polyoxyethylene/polyoxy- propylene copolymers. Immunostimulating agents and vaccines according to the invention can comprise filler substances or substances such as lactose, mannitol, substances for covalent linking of polymers, such as e.g. of polyethylene glycol, on to antigenic haptens, peptides or polypeptides according to the invention, complexing with metal ions or inclusion of materials in or on particular preparations of polymer compounds, such as e.g. polylactate, polyglycolic acid, hydrogel or to liposomes, microemulsions, micelles, unilamellar or multilamellar vesicles, erythrocyte fragments or spheroblasts. The particular embodiments of the immunostimulating agent and the vaccine are chosen according to the physical properties, for example in respect of solubility, stability, bioavailability or

degradability. Controlled or constant release of the active drug (-like) components according to the invention in the vaccine or in the immunostimulating agent includes formulations based on lipophilic depots (e.g. fatty acids, waxes or oils). In the context of the present invention, coatings of immunostimulating substances and vaccine substances or vaccine compositions (all of them according to the invention) comprising such substances, namely coatings with polymers, are also disclosed (e.g. polyoxamers or polyoxamines). Immunostimulating or vaccine substances or compositions according to the invention can furthermore have protective coatings, e.g. protease inhibitors or permeability intensifiers. Preferred carriers are typically aqueous carrier materials, water for injection (WFI) or water buffered with phosphate, citrate, HEPES or acetate, or Ringer or Ringer Lactate etc. being used, and the pH is typically adjusted to 5.0 to 8.0, preferably 6.5 to 7.5. The carrier or the vehicle will additionally preferably comprise salt constituents, e.g. sodium chloride, potassium chloride or other components which render the solution e.g. isotonic. Furthermore, the carrier or the vehicle can contain, in addition to the abovementioned constituents, additional components, such as human serum albumin (HSA), polysorbate 80, sugars or amino acids.

The mode and method of administration and the dosage of the immunostimulating agent according to the invention and of the vaccine according to the invention depend on the nature of the disease to be treated, where appropriate the stage thereof, the antigen (in the case of the vaccine) and also the body weight, the age and the sex of the patient.

The pharmaceutical composition of the present invention may preferably be administered to the patient parenterally, e.g. intravenously, intraarterially,

subcutaneously, intradermally, intra-lymp node or intramuscularly. It is also possible to administer the immunostimulating agent or the vaccine topically or orally. A further injection possibility is into a tumor tissue or tumor cavity (after the tumor is removed by surgery, e.g. in the case of brain tumors).

The Figures show:

Fig. 1 : Effect of elF4G-binding aptamers of the invention on ACGU ivt mRNA's

efficacy. Enzymatically capped (A) or ARCA capped (B) mRNAs comprising a 5' elF4G-binding aptamer sequence Apt 14 (SEQ ID NO: 3); Apt 17 (SEQ ID

NO: 1 ), Apt 19 (SEQ ID NO 2) or not (No UTR) were transfected in HEK cells (A, B, C, D, E, F) or CT26 cells (part of C) using Lipofectamine 2000 (A, B, C, E) or MessengerMax (D, F). Twenty four hours after transfection, luciferase activity was recorded (A to E, the results show the mean and standard deviation of triplicates). At that time, fluorescence was measured using FACS (F), with representative results presented: the filled histogram represents untransfected cells, the gray line represents cells transfected with an mRNA without an aptamer of the invention in its 5' UTR, and the black line represents cells transfected with an mRNA with the aptamer 17 sequence of the invention in its 5' UTR.

Fig. 2: Effect of elF4G-binding aptamers on ACG ivt mRNA's efficacy. Enzymatically Capped mRNA in which U residues were replaced by 1 -methyl-pseudoUridine residues and in which the 5' UTR contained (Apt 17; SEQ ID NO: 1 ) or not (No Apt) the conformational sequence 17 binding to elF4G were transfected using MessengerMax in HEK cells (A), immature human dendritic cells (B) or mature human dendritic cells (C). Twenty four hours after transfection, luciferase activity was recorded. The results show the mean and deviation of triplicates.

The present invention is further illustrated by the following non-limiting example.

EXAMPLE Materials and methods

Production of ivt mRNA

Plasmids containing a wild type luciferase-coding gene or an optimized (having a 5' UTR of human a-globin, a codon optimized open reading frame and a double 3' UTR from human β-globin, synthetic gene purchased from BlueHeron) luciferase-coding gene were used as matrix for PCR amplification using upstream primers that contained a T7 promoter followed by an aptamer sequence and then by a sequence complementary to the 5' end of the targeted gene (control was without aptamer sequence). Similarly, a synthetic codon optimized gene coding ZsGreen (having a 5' UTR of human a-globin, a codon optimized open reading frame and a double 3' UTR from human β-globin, synthetic gene purchased from BlueHeron) was amplified by PCR. Primers sequences and corresponding mRNA products are depicted below. The PCR products were analysed on agarose gel and purified using the PCR cleanup kit from Qiagen according to the manufacturer's instruction. Messenger RNA was produced either using HiScribe™ T7 ARCA mRNA Kit (with tailing) (NEB Biolabs) to obtain ARCA-capped poly-adenylated mRNA or using Genscripts' Capping and poly-adenylation kits on mRNA produced using a T7 RNA polymerase (NEB Biolabs) reaction containing all 4 canonical nucleotides or a A, C, G, 1 -methyl- pseudouridine mixture (triphosphate nucleotides from Trilink). The capped-poly- adenylated mRNA were precipitated using LiCI and after a wash with 75% ethanol, resuspended in pure water before being quantified by nanodrop and analysed by agarose gel electrophoresis.

PCR primers to generate DNA templates for in vitro transcription

Underlined: T7 promoter

Bold: Complementary to target gene

Wild type Luciferase

Forward primers

No UTR: TAA TAC GAC TCA CTA TAG GG CCG CAT CTA GAG GGC C (SEQ ID NO: 4)

Apt 17:TAA TAC GAC TCA CTA TAG GG ACTC ACT ATT TGT TTT CGC GCC CAG TTG CAA AAA GTG TCG CCG CAT CTA GAG GGC C (SEQ ID NO: 5) Apt 14: TAA TAC GAC TCA CTA TAG GGT CCG TAG AAA CGC GTT AAG GTG AAA GTT TGA GGG CTC CTC ACC GCA TCT AGA GGG CC (SEQ ID NO: 6) Apt 19: TAA TAC GAC TCA CTA TAG GGT CCG CGG CGC CAT CTC ATG TTT AGT TGT CCT ATG TCG AGC CCG CAT CTA GAG GGC C (SEQ ID NO: 7

Reverse primer:

AGC AAG AAA GCG AGC TCT GAA TAA GTT ACA TTT TA (SEQ ID NO: 8)

Optimised Luciferase

Forward primers

No UTR-Opt: TAA TAC GAC TCA CTA TAG GG ATT CTT CTG GTC CCC AC

(SEQ ID NO: 9)

Apt 17-Qpt:TAA TAC GAC TCA CTA TAG GG ACTC ACT ATT TGT TTT CGC GCC CAG TTG CAA AAA GTG TCG ATT CTT CTG GTC CCC AC (SEQ ID NO: 10) Reverse primer

TGT AAT CCA GAG GTT GAT TG (SEQ ID NO: 1 1 )

Cells and transfection

Human embryonic kidney (HEK) cells and CT26 mouse colon carcinoma cells were maintained in RPMI medium (Thermo Fisher Scientific) containing 10% fetal calf serum (FCS) and 0.2% antimicrobial reagent Normocin (Invivogen). Human dendritic cells were produced from adherent monocytes harvested from peripheral

mononuclear blood cells (PBMCs) after 45 minutes of adhesion to plastic and cultured for 6 days in the presence of GM-CSF (800 U/ml) and IL4 (500 U/ml) from PeproTech (with medium replacement at day 3). They were eventually matured by 24 hours culture in the presence of Protamine-RNA nanoparticles at 5 μg ml (Tusup & Pascolo Methods Mol Biol. 2017;1499:155-163.). Transfections were performed with 200 000 cells per well in 100 microliters of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding either 200 ng of mRNA in 12 microliters of Opti-MEM (Thermo Fisher Scientific) and 200 ng of Lipofectamine 2000 (Thermo Fisher Scientific) in 12 microliters of Opti-MEM to each well or 200 ng of mRNA in 5 microliters of Opti-MEM and 400 ng of MessengerMax (Thermo Fisher Scientific) in 5 microliters of Opti-MEM to each well. Luciferase activity was recorded one day after transfection by adding 25 microliters of Bright-Glo (Promega) and measuring activity using GloMax equipment (Promega). ZsGreen signal was recorded by acquiring cells using Flow activated cell cytometry (FACS) (Canto, BD Biosciences) and analyzing the results using FlowJo.

Results

Miyakawa et al, supra, reported the sequences of eight aptamers capable to bind elF4G.. Five of them: (aptamer numbers 2, 14, 17, 18, and 19) did not inhibit translation. Aptamers numbers 14 (SEQ ID NO: 3), 17 (SEQ ID NO: 1 ) and 19 (SEQ ID NO: 2) being 41 bases or less were tested. Oligonucleotides having a T7 promoter sequence followed by the respective aptamer sequence and by a 20 bases sequence recognizing the wild type luciferase sequence at its start codon (see above for the primer sequences have been used to generate DNA templates for in vitro transcription). Uncapped and enzymatically capped and ARCA capped mRNA were produced from those PCR matrixes. The mRNAs were transfected into human HEK cells using Lipofectamine 2000 and luciferase activity was recorded. Uncapped mRNAs even when having aptamer sequences at their 5' were not translated (data not shown). However, a detectable luciferase activity was found when those mRNA were enzymatically (Figure 1 A) or co-transcriptionally (Figure 1 B) capped.

Remarkably, the aptamer 17 sequence (SEQ ID NO: 1 ) gave consistently a several fold increase in Luciferase activity when compared to mRNA not having a 5' aptamer. The same results were obtained when mRNAs were transfected in a mouse tumor cell line (CT26 cells, Figure 1 C) or when other transfection reagents than

Lipofectamine 2000 were used (for example MessengerMax which is a liposome optimised for mRNA transfection, Figure 1 D). Addition of the aptamer 17 sequence (SEQ ID NO: 1 ) to different mRNAs such as codon optimized luciferase (Figure 1 E) or ZsGreen (Figure 1 F) having globin stabilization untranslated 5' and 3' sequences enhanced the expression of the reporter proteins strongly. Thus, the aptamer sequences according to the invention, in particular SEQ ID NO: 1 sequence, is/are an optimization element that work alone or in addition to other mRNA-optimising sequences such as stabilizing UTRs. For gene therapy approaches, the mRNA must be deficient in triggering RNA sensors such as Toll-like receptors. This objective can be achieved by substituting modified nucleotides for canonical nucleotides, most notably by replacing canonical uridine with 1 -methyl-pseudouridine. As shown in Figure 2, the aptamer 17 sequence (SEQ ID NO: 1 ) increased luciferase expression produced by mRNA molecules containing 1 -methyl-pseudouridine instead of uridine, regardless of whether mRNAs are transfected into tumor cells (HEK, cells, Figure 2A) or untransformed human cells (immature dendritic cells, Figure 2B, or mature dendritic cells, Figure 2C).

In conclusion, the addition of a translation non-blocking elF4G-binding aptamer to the 5' UTR of ivt mRNA can be used as a universal method to increase the quantity of protein produced from recombinant mRNA. The numerous ongoing pre-clinical and clinical studies that involve evaluating the efficacy of mRNA-based therapies should take advantage of the method reported here to increase the functionality of ivt mRNA and thereby achieve a higher therapeutic index with the same dose of mRNA or the same therapeutic index with a lower dose of ivt mRNA.

Claims

1 . An RNA molecule comprising a sequence containing an open reading frame coding sequence and at least one translation non-blocking aptamer sequence specific for at least one component of elF4F complex.

2. The RNA molecule of claim 1 wherein the elF4F aptamer is a translation non- blocking elF4G aptamer.

3. The RNA of claim 1 or 2 wherein the RNA is an mRNA having a 5' cap structure.

4. The RNA of claim 3 wherein the aptamer sequence is present in the 5' UTR thereof.

5. The RNA according to anyone of the preceding claims wherein the aptamer sequence comprises the sequence 5'-UGUCG-3'.

6. The RNA of claim 5 wherein the aptamer sequence is selected from the group consisting of (in 5' to 3' direction):

ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAAGUGUCG (SEQ ID NO: 1) UCCGCGGCGCCAUCUCAUGUUUAGUUGUCCUAUGUCGAGC (SEQ ID NO: 2)

7. The RNA according to any one of claims 1 to 4 wherein the aptamer sequence is (in 5' to 3' direction):

UCCGUAGAAACGCGUUAAGGUGAAAGUUUGAGGGCUCCUCA (SEQ ID NO: 3)

8. A DNA molecule coding for the RNA according to any one of the preceding claims.

9. The DNA molecule of claim 8 being a vector, preferably a virus, plasmid or cosmid.

10. A vector comprising the following sequence elements

Prom-elF4F-translation start-Term

wherein the above abbreviations denote the following:

Prom promotor

elF4F sequence coding for the translation non-blocking

aptamer sequence specific for at least one component of elF4F complex as defined in any one of claims 1 to 7 translation start translation start codon

Term termination site

1 1 .The vector of claim 10 comprising more than one elF4F aptamer sequence.

12. A method for expressing a recombinant gene in vitro comprising the step of transfecting the RNA according to any one of claims 1 to 7 into a cell wherein the recombinant gene is encoded by the ORF coding sequence.

13. A method for expressing a recombinant gene in vitro comprising the steps of

(i) introducing the DNA of claim 8 or 9 into a cell; and

(ii) culturing the cell under conditions allowing the expression of the

recombinant gene;

wherein said DNA encodes the ORF coding sequence of the recombinant gene.

14. The RNA according to any one of claims 1 to 7 or the DNA of claim 8 or 9 for use in the expression of a therapeutic gene in vivo.

15. A host cell containing the RNA according to any one of claims 1 to 7, the DNA of claim 8 or 9 or the vector of claim 10 or 1 1 .

16. A pharmaceutical composition comprising the RNA according to any one of claims 1 to 7 or the DNA of claim 8 or 9 in combination with at least one pharmaceutically acceptable carrier, vehicle and/or diluent.

17. A method for the production of the RNA according to any one of claims 1 to 7 comprising the step of in vitro transcribing the DNA of claim 8 or 9.