CN117965488A - Cancer mRNA vaccine - Google Patents

Cancer mRNA vaccine Download PDF

Info

Publication number
CN117965488A
CN117965488A CN202211322077.1A CN202211322077A CN117965488A CN 117965488 A CN117965488 A CN 117965488A CN 202211322077 A CN202211322077 A CN 202211322077A CN 117965488 A CN117965488 A CN 117965488A
Authority
CN
China
Prior art keywords
polypeptide
seq
sequence
kras
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202211322077.1A
Other languages
Chinese (zh)
Inventor
周骥
沈海法
李航文
蔡毅骅
王学丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Siwei Shanghai Biotechnology Co ltd
Original Assignee
Siwei Shanghai Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Siwei Shanghai Biotechnology Co ltd filed Critical Siwei Shanghai Biotechnology Co ltd
Priority to CN202211322077.1A priority Critical patent/CN117965488A/en
Publication of CN117965488A publication Critical patent/CN117965488A/en
Pending legal-status Critical Current

Links

Landscapes

  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The invention relates to the field of biological medicine, in particular to polypeptide and mRNA vaccine for preventing or treating cancer. In particular, the invention provides KRAS peptide concatemers, polynucleotides (particularly mRNA), compositions and vaccine formulations for use in the prevention or treatment of cancer.

Description

Cancer mRNA vaccine
Technical Field
The invention relates to the field of biological medicine, in particular to an mRNA vaccine for preventing or treating cancers.
Background
KRAS belongs to the RAS series in the GTPase protein family, and G12 series mutations thereof are common in tumors, and are one of the hot targets for development of related small molecule inhibitors, tumor vaccines, and T Cell Receptor (TCR) chimeric T cell technologies. The research at present finds that KRAS gene mutation is closely related to occurrence and development of human malignant tumors, recurrence thereof and the like, and is one of the most common mutant genes in cancers, and accounts for 27% of lung adenocarcinoma patients, 49% of colorectal cancer patients and 93% of pancreatic duct adenocarcinoma, wherein most of KRAS gene mutation is in mutant forms such as G12D, G12V, G12C, G R, the non-small cell lung cancer is mainly G12C mutation, most colorectal cancers are G12D, G12V mutation, and pancreatic cancer is commonly G12D, G V, G R mutation.
Because KRAS protein molecules are small, the surface is relatively smooth, and it is difficult to find a "pocket" for small molecule drug binding; and KRAS has extremely strong affinity for nucleotide GTP, so that conventional drugs are difficult to compete with GTP, and are difficult to bind to KRAS protein and inhibit the activity of KRAS protein, so that KRAS has long been difficult to target. However, in recent years, small molecule inhibitors against KRAS-G12C have been broken through, and the advancing small molecule inhibitors against KRAS-G12C are approved for market. But it only shows a better clinical response in non-small cell lung cancer populations with predominantly G12C mutations, whereas in colorectal and pancreatic cancers with fewer G12C mutations, the clinical response is poor. For other mutations, there is also a lack of clinically effective drugs. There is an urgent need in the art for treatment of KRAS mutant multi-target sites.
At present, research on KRAS multi-target tumor vaccines is continuously carried out in the aspect of tumor vaccines. KRAS multi-target mRNA tumor vaccine mRNA-5671/V941 developed in cooperation with Moderna in moesadong was already in the clinical phase 1 study stage, but its preclinical study required co-adjuvant administration. There remains a need in the art for efficient KRAS multi-target mRNA tumor vaccines.
Disclosure of Invention
In one aspect, the invention provides a polypeptide comprising a concatemer of 2 or more mutant peptides, wherein each of the mutant peptides independently comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in a KRAS polypeptide, HRAS polypeptide, or NRAS polypeptide.
In one embodiment, the HRAS polypeptide comprises the amino acid sequence of SEQ ID No. 86 and the mutant peptide comprises a HRAS mutation selected from G12V, Q61L, Q R and Q61H compared to SEQ ID No. 86.
In one embodiment, the NRAS polypeptide comprises the amino acid sequence of SEQ ID NO. 87 and the mutant peptide comprises an NRAS mutation selected from the group consisting of G12D, G13D, Q K and Q61R as compared to SEQ ID NO. 87.
In one embodiment, the KRAS polypeptide comprises the amino acid sequence of SEQ ID No. 1 and the mutant peptide comprises a KRAS mutation selected from G12D, G12V, G12S, G12R, G12C, G12A, G12F, G D and Q61H compared to SEQ ID No. 1.
In one embodiment, the mutant peptide comprises a first KRAS peptide, a second KRAS peptide, a third KRAS peptide, and a fourth KRAS peptide; wherein each KRAS peptide comprises at least 27 consecutive amino acids from the N-terminus of SEQ ID No. 1 and comprises a mutation selected from G12D, G12V, G12S, G12R, G12C, G12A, G F and G13D; or at least 27 consecutive amino acids from position 48 of SEQ ID NO. 1, and the KRAS peptide comprises a mutation of Q61H.
In yet another aspect, the invention also provides a polypeptide comprising a quadruplex of a first KRAS peptide, a second KRAS peptide, a third KRAS peptide and a fourth KRAS peptide, wherein each KRAS peptide comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in SEQ ID No.1 and each comprises a mutation selected from the group consisting of G12D, G12V, G12S, G12R, G12C, G12A, G12F, G D and Q61H compared to SEQ ID No. 1.
In one embodiment, each KRAS peptide comprises at least 27 consecutive amino acids from the N-terminus of SEQ ID No. 1 and comprises a mutation selected from G12D, G12V, G12S, G12R, G12C, G12A, G F and G13D; or at least 27 consecutive amino acids from position 48 of SEQ ID NO. 1, and the KRAS peptide comprises a mutation of Q61H.
In one embodiment, the four KRAS peptides comprise G12D, G12V, G R and G12C, G12D, G12V, G F and G12C, or G12D, G12V, Q H and G12C, respectively.
In one embodiment, the four KRAS peptides are the same length, preferably 27 amino acids each.
In one embodiment, the polypeptide comprises the amino acid sequence of SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4.
In one embodiment, the polypeptide further comprises a signal peptide sequence at the N-terminus and a transmembrane-intracellular segment domain sequence of MHC-I at the C-terminus.
In one embodiment, the signal peptide sequence comprises the amino acid sequence of SEQ ID NO. 15; and/or the transmembrane-intracellular domain sequence of MHC-I comprises the amino acid sequence of SEQ ID No. 16.
In one embodiment, the polypeptide further comprises one or more linkers, preferably GS linkers.
In one embodiment, the polypeptide comprises the amino acid sequence of SEQ ID NO. 17, SEQ ID NO. 18 or SEQ ID NO. 19.
In another aspect, the invention also provides a polynucleotide encoding a polypeptide of the invention.
In one embodiment, the polynucleotide comprises the nucleotide sequence of one of SEQ ID NOS.23, 24, 25 and 26 or a nucleotide sequence having at least 80% identity to one of SEQ ID NOS.23, 24, 25 and 26.
In one embodiment, the polynucleotide comprises the nucleotide sequence of one of SEQ ID NOS.32, 33, 34 and 35 or a nucleotide sequence having at least 80% identity to one of SEQ ID NOS.32, 33, 34 and 35.
In another aspect, the invention also provides a polynucleotide comprising a polynucleotide sequence encoding a polypeptide of the invention, and further comprising a polynucleotide sequence encoding a second polypeptide.
In one embodiment, the second polypeptide is a cytokine, preferably human interferon alpha 1 or a human FMS-related tyrosine kinase 3 ligand.
In one embodiment, the second polypeptide comprises the amino acid sequence of SEQ ID NO. 13 or SEQ ID NO. 14.
In one embodiment, the polynucleotide comprises the nucleotide sequence of SEQ ID NO. 36 or 37 or a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID NO. 36 or 37.
In one embodiment, the polynucleotide of the invention is DNA or RNA, preferably mRNA.
In one embodiment, the RNA further comprises a 5' -UTR; preferably, the 5' -UTR comprises the nucleotide sequence of SEQ ID NO. 61.
In one embodiment, the RNA further comprises a 3' -UTR; preferably, the 3' -UTR comprises the nucleotide sequence of SEQ ID NO. 62.
In one embodiment, the RNA further comprises a poly (a) sequence; preferably, the poly (a) sequence comprises 75 adenosine nucleotides.
In one embodiment, the polynucleotide comprises the nucleotide sequence of one of SEQ ID NOs 42, 43, 44, 45, 51, 52, 53, 54, 55, 56, 63, 64, 65, 66, 72, 73, 74, 75, 76 and 77.
In yet another aspect, the invention also provides a composition comprising a polypeptide of the invention.
In yet another aspect, the invention also provides a composition comprising a polynucleotide of the invention.
In one embodiment, the composition comprises a lipid encapsulating the polynucleotide.
In one embodiment, the composition comprises a lipid nanoparticle or a lipid-multimeric complex.
In one embodiment, the lipid encapsulating the polynucleotide comprises a cationic lipid, a non-cationic lipid, and a polyethylene glycol modified lipid; optionally, the composition further comprises a cationic polymer, wherein the cationic polymer associates with the polynucleotide as a complex, and is co-encapsulated in a lipid to form a lipopolysaccharide complex.
In yet another aspect, the invention also provides a vaccine formulation comprising a polypeptide of the invention or a composition of the invention comprising a polypeptide of the invention.
In yet another aspect, the invention also provides a vaccine formulation comprising a polynucleotide of the invention or a composition of the invention comprising a polynucleotide of the invention.
In one embodiment, the lipid encapsulating the polynucleotide comprises 10-70 mole% T5, 10-70 mole% 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 10-70 mole% cholesterol, and 0.05-20 mole% 1, 2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG) 2000; preferably, the lipids are T5, DOPE, cholesterol and (DMG-PEG) 2000 in a molar ratio of 40:15:43.5:1.5.
In a further aspect, the invention also provides the use of a polypeptide of the invention, a polynucleotide of the invention, a composition of the invention or a vaccine formulation of the invention in the manufacture of a medicament for the prevention or treatment of cancer in a subject in need thereof.
In yet another aspect, the present invention also provides a method of preventing or treating cancer in a subject in need thereof, the method comprising:
Administering to a subject in need thereof a polypeptide of the invention, a polynucleotide of the invention, a composition of the invention or a vaccine formulation of the invention.
In a further aspect, the invention also provides a polypeptide of the invention, a polynucleotide of the invention, a composition of the invention or a vaccine formulation of the invention for use in preventing or treating cancer in a subject in need thereof.
Drawings
FIG. 1 shows the results of in vitro mRNA expression assays for G12D 25mer, G12D 27mer, 25 mer-concatemers and 27 mer-concatemers.
FIG. 2 shows ELISPot detection results for 25 mers and Moderna 4-MUT.
FIGS. 3A-3D show mRNA in vitro expression detection results for 25 mer-concatemers, 27mer-concatemer opt, 27 mer-concatemers 12F and 4-MUT. FIG. 3A shows in vitro expression of mRNA from 25 mer-concatemers, 27mer-concatemer opt and 4-MUT detected with RAS G12D specific antibodies. FIG. 3B is in vitro expression of mRNA of 25 mer-concatemers, 27 mer-concatemers and 27mer-concatemer opt detected with RAS G12V specific antibodies. FIG. 3C shows in vitro expression of mRNA from 27mer-concatemer opt and 27mer-concatemer 12F detected with RAS G12D specific antibodies. FIG. 3D shows in vitro expression of mRNA from 27mer-concatemer opt and 27mer-concatemer 12F detected with RAS G12V specific antibodies.
FIG. 4 shows ELISPot detection results of 25mer-con, 27mer-con and Moderna 4-MUT.
FIGS. 5A and 5B show ELISPot detection results of 27mer-con opt under different immunization programs.
FIGS. 6A and 6B show the results of in vitro mRNA expression assays for 27mer-concatemer opt, 27mer-concatemer QH, 27mer-concatemer IRES hIFN α1 and 27mer-concatemer IRES hFlt 3L. FIG. 6A shows in vitro expression of mRNA of 27mer-concatemer opt, 27mer-concatemer QH, 27mer-concatemer IRES hIFN α1 and 27mer-concatemer IRES hFlt L detected with RAS G12D specific antibodies. FIG. 6B shows the in vitro expression of mRNA of 27mer-concatemer opt, 27mer-concatemer QH, 27mer-concatemer IRES hIFN α1 and 27mer-concatemer IRES hFlt L detected with RAS G12V specific antibodies.
Detailed description of the preferred embodiments
General definitions and terms
All patents, patent applications, scientific publications, manufacturer's instructions and guidelines, and the like, cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the disclosure is not entitled to antedate such disclosure.
Unless otherwise defined, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology related terms as used herein are terms that are widely used in the corresponding field (see, e.g., ,Molecular Cloning:ALaboratory Manual,2nd Edition,J.Sambrook et al.eds.,Cold Spring Harbor Laboratory Press,Cold Spring Harbor 1989)., while, for a better understanding of the present invention, definitions and explanations of related terms are provided below.
As used herein, the terms "comprises," "comprising," "includes," "including," "having" and "containing" are open-ended, meaning the inclusion of the stated elements, steps or components, but not the exclusion of other non-recited elements, steps or components. The expression "consisting of … …" does not include any elements, steps or components not specified. The expression "consisting essentially of … …" means that the scope is limited to the specified elements, steps, or components, plus any optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of … …" and "consisting of … …" are encompassed within the meaning of the expression "comprising".
As used herein, the singular forms "a," "an," or "the" include plural referents unless the context clearly dictates otherwise. The term "one or more" or "at least one" encompasses 1, 2, 3, 4,5, 6, 7, 8, 9 or more.
Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. Unless specifically indicated to the contrary, the numerical values or ranges set forth herein are modified by "about" to mean the enumerated or claimed values or ranges are + -20%, + -10%, + -5%, or + -3%.
All methods described herein can be performed in any suitable order unless otherwise indicated.
As used herein, the term "polypeptide" refers to a polymer comprising two or more amino acids covalently linked by peptide bonds. A "protein" may comprise one or more polypeptides, wherein the polypeptides interact with each other by covalent or non-covalent means. Unless otherwise indicated, "polypeptide" and "protein" may be used interchangeably.
As used herein, a "mutant peptide" of a reference polypeptide refers to a polypeptide that differs from the reference polypeptide by at least one amino acid modification. The reference polypeptide may be naturally occurring or may be a modified form of the wild-type polypeptide. In this context, "polypeptide variants" and "mutant peptides" have the same meaning. Mutant peptides may be, for example, mutants, post-translational modification variants, isoforms, species variants, species homologs, and the like. Mutant peptides may be prepared by recombinant DNA techniques, for example, by modification of known amino acid sequences by altering the coding sequence. Mutant peptides may also be prepared by chemical synthesis or enzymatic methods.
As used herein, the term "wild-type" means that the sequence is naturally occurring and not artificially modified, including naturally occurring mutants.
As used herein, the term "% identity" with respect to sequences refers to the percentage of nucleotides or amino acids that are identical in the optimal alignment between the sequences to be compared. The difference between the two sequences may be distributed over a local area (section) or the entire length of the sequences to be compared. The identity between two sequences is typically determined after optimal alignment of the segments or "comparison windows". The optimal alignment may be performed manually or by means of algorithms known in the art, including but not limited to the local homology algorithms described by SMITH AND WATERMAN,1981,ADS APP.MATH.2,482 and NEDDLEMAN AND Wunsch,1970, j.mol. Biol.48,443, the similarity search method described by Pearson AND LIPMAN,1988,Proc.Natl Acad.Sci.USA 88,2444, or using a computer program, such as GAP, BESTFIT, FASTA, BLAST P, BLAST N and tfast a in Wisconsin Genetics Software Package, genetics Computer Group,575Science Drive,Madison,Wis. For example, the percent identity of two sequences may be determined using the BLASTN or BLASTP algorithm commonly available at the National Center for Biotechnology Information (NCBI) website.
The% identity is obtained by determining the number of identical positions corresponding to the sequences to be compared, dividing this number by the number of positions compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100. In some embodiments, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% of the regions give a degree of identity. In some embodiments, the degree of identity is given to the entire length of the reference sequence. Alignment for determining sequence identity can be performed using tools known in the art, preferably using optimal sequence alignment, e.g., using Align, using standard settings, preferably EMBOSS:: needle, matrix: blosum62, gap Open 10.0, gap extension 0.5.
Herein, "nucleotide" includes deoxyribonucleotides and ribonucleotides and derivatives thereof. As used herein, a "ribonucleotide" is a constituent material of ribonucleic acid (RNA) and consists of one molecule of base, one molecule of pentose, and one molecule of phosphate, which refers to a nucleotide having a hydroxyl group at the 2' -position of the β -D-ribofuranose (β -D-ribofuranosyl) group. The "deoxyribonucleotide" is a constituent substance of deoxyribonucleic acid (DNA), and also comprises one molecule of base, one molecule of pentose and one molecule of phosphoric acid, and refers to a nucleotide in which the hydroxyl group at the 2' -position of the beta-D-ribofuranose (beta-D-ribofuranosyl) group is replaced by hydrogen, and is a main chemical component of a chromosome. "nucleotide" is generally referred to by the single letter representing the base therein: "A (a)" means adenine-containing deoxyadenylate or adenylate, "C (C)" means cytosine-containing deoxycytidylate or cytidylate, "G (G)" means guanine-containing deoxyguanylate or guanylate, "U (U)" means uracil-containing uridylate, "T (T)" means thymine-containing deoxythymidylate.
As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA). "Polynucleotide sequence", "nucleic acid sequence" and "nucleotide sequence" are used interchangeably to refer to the ordering of nucleotides in a polynucleotide. It will be appreciated by those skilled in the art that the coding strand (sense strand) of DNA can be considered to have the same nucleotide sequence as the RNA it encodes, with deoxythymidylate in the sequence of the coding strand of DNA corresponding to uridylate in the sequence of the RNA it encodes.
As used herein, the term "expression" includes transcription and/or translation of a nucleotide sequence. Thus, expression may involve the production of transcripts and/or polypeptides. The term "transcription" relates to the process of transcribing the genetic code in a DNA sequence into RNA (transcript). The term "in vitro transcription" refers to the synthesis of RNA, in particular mRNA, in vitro in a cell-free system (e.g. in a suitable cell extract) (see, e.g. Pardi N.,Muramatsu H.,Weissman D.,KarikóK.(2013).In:Rabinovich P.(eds)Synthetic Messenger RNA and Cell Metabolism Modulation.Methods in Molecular Biology(Methods and Protocols),vol 969.Humana Press,Totowa,NJ.). vectors which may be used for the production of transcripts are also referred to as "transcription vectors", which contain the regulatory sequences required for transcription.
As used herein, "encoding" refers to the inherent properties of a particular nucleotide sequence in a polynucleotide, such as a gene, cDNA or mRNA, that can be used as a template to synthesize polymers and macromolecules in other biological processes, provided that there is a defined nucleotide sequence or a defined amino acid sequence. Thus, a gene encodes a protein, meaning that mRNA of the gene is transcribed and translated to produce the protein in a cell or other biological system.
As used herein, the term "host cell" refers to a cell that is used to receive, hold, replicate, express a polynucleotide or vector. In some embodiments, the host cell may be a cell in which a polypeptide of the invention is expressed.
As used herein, "antigen" refers to a molecule that upon entry into the body can elicit an immune response that is acquired by the body and that can be directed to the production of antibodies, or to specific immunogenically active cells, or both. It will be appreciated by those skilled in the art that any macromolecule, including almost all proteins or peptide fragments, may act as an antigen. Still further, the antigen may be from recombinant or genomic DNA or RNA. It will be appreciated by those skilled in the art that any of the DNA or RNA herein, the nucleotide sequence or portions thereof, may encode a protein capable of eliciting an acquired immunity in the body. Still further, it will be understood by those skilled in the art that an antigen need not solely encode the full length nucleotide sequence of only one gene. It will be apparent that the invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences form different mixtures to induce the onset of a response. Still further, it will be appreciated by those skilled in the art that the antigen need not be encoded entirely by one gene. Obviously, the antigen may be synthetically produced or may be derived from a biological sample. Biological samples include, but are not limited to, tissue samples, tumor samples, cells, or biological fluids.
As used herein, "antibody" refers to a protein that has a protective effect by the body as a result of stimulation by an antigen. It is an immunoglobulin produced by B lymphocytes. The monomer of the antibody is a Y-shaped molecule and consists of 4 polypeptide chains. The chain comprises two identical heavy chains and two identical light chains, which are connected together by disulfide bonds. Each heavy chain is 50kDa, each light chain is 25kDa, and disulfide bonds exist between the light and heavy chains. It is unique in high affinity and specificity for binding partners.
As used herein, "vaccine" refers to a composition comprising an active ingredient (e.g., a polypeptide or polynucleotide of the invention) that is capable of eliciting an immune response in an vaccinated subject upon vaccination. As used herein, "mRNA cancer vaccine" provides a unique therapeutic alternative to peptide-based vaccines or DNA vaccines. When an mRNA cancer vaccine is delivered to a cell, the mRNA will be processed within the cell into a polypeptide, which is further processed into an immunosensitive fragment capable of stimulating an immune response against the tumor. The cancer vaccines described herein include at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one cancer antigenic polypeptide or immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response to cancer).
Internal ribose access site
The polynucleotide may contain an Internal Ribosome Entry Site (IRES). IRES may serve as the sole ribosome binding site, or may serve as one of a plurality of mRNA ribosome binding sites, which allow translation initiation to occur in regions within the mRNA other than the translation initiation site. Polynucleotides containing more than one functional ribosome binding site can encode several peptides or polypeptides that are independently translated by a ribosome (e.g., polycistronic mRNA). When provided with an IRES, a second translatable region is additionally optionally provided. Examples of IRES sequences that may be used according to the present disclosure include, but are not limited to, those from picornaviruses (e.g., FMDV), insect viruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (EMCV), foot and Mouth Disease Viruses (FMDV), hepatitis C Viruses (HCV), swine fever viruses (CSFV), murine Leukemia Viruses (MLV), simian Immunodeficiency Viruses (SIV), cricket paralysis viruses (CrPV), or coxsackie viruses B3 (CVB 3).
In some embodiments, the IRES sequence in the nucleotide sequence of the invention is from an encephalomyocarditis virus (EMCV) or coxsackievirus B3 (CVB 3). In some embodiments, the IRES sequence in the nucleotide sequence of the invention comprises the nucleotide sequence set forth in SEQ ID NO. 88 or SEQ ID NO. 90.
Signal peptide sequence and transmembrane-intracellular domain sequence of MHC-I
As used herein, the term "signal peptide (SIGNAL PEPTIDE, SP) sequence" refers to a signal peptide fragment of MHC-I that aids in the distribution of an antigen of interest to cellular vesicle structures. As used herein, the term "transmembrane-intracellular segment domain (MHC CLASS I TRAFFICKING domain, MITD) sequence of MHC-I" refers to the amino acid sequence of the transmembrane and cytoplasmic domains of MHC-I. It has been reported that the addition of SP sequences to the N-terminus of antigen and MITD sequences to the C-terminus helps to improve presentation of MHC class I and class II epitopes in human and mouse Dendritic Cells (DCs), enhancing antigen presentation efficiency (see, e.g. Kreiter S,et al.,Increased antigen presentation efficiency by coupling antigens to MHC class Itrafficking signals.J Immunol.2008Jan 1;180(1):309-18.).
As used herein, an "epitope (also referred to as an antigenic determinant)" is a portion of an antigen that is recognized by the immune system (particularly by antibodies, B cells or T cells) in a suitable context. Epitopes include B cell epitopes and T cell epitopes. B cell epitopes are peptide sequences necessary for recognition by B cells producing specific antibodies. B cell epitopes refer to specific regions of an antigen that are recognized by an antibody. The portion of the antibody that binds to this epitope is referred to as the paratope. Epitopes can be conformational epitopes or linear epitopes based on structure and interaction with paratopes. A linear or continuous epitope is defined by the primary amino acid sequence of a particular region of a protein. The sequences that interact with the antibody are located successively next to each other on the protein, and the epitope can be generally mimicked by a single peptide. Conformational epitopes are epitopes defined by the conformational structure of the native protein. These epitopes can be contiguous or discontinuous, i.e., the components of the epitope can be located on different parts of the protein that are in proximity to each other in the folded native protein structure.
The term "domain" or "region" relates to a specific part of an amino acid sequence, which may preferably be linked to a specific function or structure. The polypeptides of MHC-II molecules have two domains, α1, α2 and β1, β2, respectively a transmembrane region and a cytoplasmic region. The alpha chain of an MHC-I molecule has three domains, α1, α2 and α3, a transmembrane region and a cytoplasmic region. The term "transmembrane region" relates to a portion of a protein which substantially occupies the portion present in the cell membrane and is preferably used to anchor the protein in the membrane.
The term "Major Histocompatibility Complex (MHC)" relates to the gene complex that occurs in all vertebrates. MHC proteins or molecules play a role in the signaling between lymphocytes and antigen presenting cells in a normal immune response. Human MHC, also known as HLA, a human leukocyte antigen, is located on chromosome 6, including MHC-I and MHC-II.
The term "MHC-I" or "MHC class I" refers to a major histocompatibility complex class I protein or gene. Within the human MHC-I region are HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, CD1a, CD1b and CD1c sub-regions. MHC class I proteins are present on almost all cell surfaces, including most tumor cells. MHC-I proteins are loaded with antigens that are typically derived from endogenous proteins or pathogens present within the cell and then presented to Cytotoxic T Lymphocytes (CTLs). T cell receptors are capable of recognizing and binding peptides complexed with MHC class I molecules. Each cytotoxic T lymphocyte expresses a unique T cell receptor, capable of binding to a specific MHC/peptide complex. MHC class I molecules mediate primarily the presentation of endogenous antigens.
The alpha chain of MHC-I is a glycoprotein with a molecular weight of about 44 kDa. It can be divided into three functional areas: an outer region, a transmembrane region, and a cytoplasmic region. The outer region is divided into three domains, α1, α2 and α3. The transmembrane region spans the lipid bilayer of the plasma membrane. It consists of 23 generally hydrophobic amino acid residues arranged in an alpha helix. The cytoplasmic region, the portion facing the cytoplasm and attached to the transmembrane region, is typically 32 amino acid residues in length and is capable of interacting with elements of the cytoskeleton.
The term "MHC-II" or "MHC class II" refers to a major histocompatibility complex class II protein or gene. MHC class II proteins are mainly expressed on antigen presenting cells such as B cells, monocytes, macrophages and dendritic cells. MHC class II molecules mediate primarily the presentation of exogenous antigens, which present exogenous antigen polypeptide molecules to Th cells (helper T cells).
The exact number of amino acids in different MHC molecule domains or regions depends on the differences between mammalian species and the genetic class within the species. The skilled artisan will appreciate that function may also be maintained if a complete amino acid sequence is used that is not the domain or region of choice.
The term "MHC/peptide complex" relates to a non-covalent complex of a binding domain of an MHC class I or MHC class II molecule and an MHC class I or MHC class II binding peptide.
RAS family
RAS family proteins are a class of small molecule GTP-binding proteins with GTP hydrolase activity, which are located on the cytoplasmic side of the cell membrane, in an activated state when bound to GTP, and in a non-activated state when bound to GDP. RAS proteins are the expression products of the oncogene RAS, which is involved in the growth, differentiation and development and progression of tumors in cells. The currently known RAS family shares three genes: kirsten rat sarcoma virus oncogene homolog (KRAS), neuroblastoma RAS virus (V-RAS) oncogene homolog (NRAS), and Harvey rat sarcoma virus oncogene Homolog (HRAS). KRAS, HRAS and NRAS are located on chromosomes 12, 11 and 1, respectively, and all are involved in intracellular signaling. The human KRAS amino acid sequence (UniProtKB P01116) is shown in SEQ ID NO. 1. The amino acid sequence of human HRAS (UniProtKB P01112) is shown in SEQ ID NO. 86. The human NRAS amino acid sequence (UniProtKB P01111) is shown in SEQ ID NO. 87.
Mutations in the RAS protein are closely related to tumorigenesis, and among different types of tumors, the RAS mutation type is also different. KRAS mutations are most common in human tumors.
RAS family proteins are structurally similar, and the KRAS mutation sites described herein are also present in neuroblast RAS virus (V-RAS) oncogene homologs (NRAS) and Harvey rat sarcoma virus oncogene Homologs (HRAS).
In some embodiments, the HRAS mutation is a mutation at amino acid position 12, 13 or 61.
In some embodiments, the HRAS mutation comprises G12V, Q61L, Q R or Q61H.
In some embodiments, the NRAS mutation is a mutation at amino acid position 12, 13 or 61.
In some embodiments, the NRAS mutation comprises G12D, G, D, Q K or Q61R.
KRAS
Oncogenes, when activated, may inhibit programmed cell death and/or cause abnormal cell proliferation. Such oncogene activation may lead to cancer. The KRAS gene (Ki-RAS 2 Kirsten rat sarcoma virus oncogene homolog) is an oncogene encoding a small gtpase transduction protein, which belongs to the RAS gene family (KRAS, NRAS, HRAS), located on the short arm of chromosome 12. KRAS transmits external signals to the nucleus and helps regulate cell division. Activating mutations in the KRAS gene impair the ability of the KRAS protein to switch between an active state and an inactive state. KRAS activation results in cell transformation and increases resistance to chemotherapy and biological therapies targeting epidermal growth factor receptors (Jancik,Sylwia et al.,Clinical Relevance of KRAS in Human Cancers,Journal of Biomedicine and Biotechnology,, volume 2010, article ID 150960 (2010)). KRAS mutations are common in many cancers, with G12 being the most common site for KRAS mutation.
In one embodiment, the KRAS mutation is a mutation at amino acid position 12.
In one embodiment, the KRAS mutation comprises G12D, G12V, G12S, G12R, G12C, G a or G12F.
In one embodiment, the KRAS mutation is a mutation at amino acid position 13.
In one embodiment, the KRAS mutation comprises G13D.
In one embodiment, the KRAS mutation is a mutation at amino acid position 61.
In one embodiment, the KRAS mutation comprises Q61H.
In one embodiment, the KRAS mutation comprises a mutation at amino acid position 12 or a mutation at amino acid position 13.
In one embodiment, the KRAS mutation comprises G12D, G12V, G12S, G R, G12C, G12A, G F or G13D.
In one embodiment, the KRAS mutation comprises a mutation at amino acid position 12 or a mutation at amino acid position 61.
In one embodiment, the KRAS mutation comprises G12D, G12V, G12S, G R, G12C, G12A, G F or Q61H.
In one embodiment, the KRAS mutation comprises a mutation at amino acid position 13 or a mutation at amino acid position 61.
In one embodiment, the KRAS mutation comprises G13D or Q61H.
In one embodiment, the KRAS mutation comprises a mutation at amino acid position 12, 13 or 61.
In one embodiment, the KRAS mutation comprises G12D, G12V, G12S, G R, G12C, G12A, G12F, G D or Q61H.
Polypeptides
In a general aspect, the present invention provides a polypeptide comprising a concatemer of 2 or more mutant peptides, wherein each of the mutant peptides independently comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in a KRAS polypeptide, HRAS polypeptide, or NRAS polypeptide.
In one embodiment, the polypeptide comprises a concatemer of 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutant peptides, wherein each of the mutant peptides independently comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in a KRAS polypeptide, HRAS polypeptide, or NRAS polypeptide.
As used herein, the term "KRAS mutant peptide" or "mutated KRAS peptide" refers to a polypeptide or peptide portion comprising a KRAS mutation.
As used herein, "concatemer" refers to polypeptides made up of 2,3, 4,5,6, 7, 8, 9, 10 or more polypeptides joined together, wherein each polypeptide may or may not contain a linker between the polypeptides.
In some embodiments, the mutant peptides each comprise 27, 28, 29, 30, 31,32, 33, 34, 35, 36, 37, 38, 39, 40, 50, 60, 70, 80, 90, 100, or more amino acids.
In one embodiment, the HRAS polypeptide comprises the amino acid sequence of SEQ ID No. 86 and the mutant peptide comprises a HRAS mutation selected from G12V, Q61L, Q R and Q61H compared to SEQ ID No. 86.
In one embodiment, the NRAS polypeptide comprises the amino acid sequence of SEQ ID NO. 87 and the mutant peptide comprises an NRAS mutation selected from the group consisting of G12D, G13D, Q K and Q61R as compared to SEQ ID NO. 87.
In one embodiment, the KRAS polypeptide comprises the amino acid sequence of SEQ ID No. 1 and the mutant peptide comprises a KRAS mutation selected from G12D, G12V, G12S, G12R, G12C, G12A, G12F, G D and Q61H compared to SEQ ID No. 1.
In one embodiment, the mutant peptide may comprise a mutation corresponding to both amino acid position 12 and amino acid position 13 in a KRAS polypeptide, HRAS polypeptide or NRAS polypeptide. For example, a KRAS mutant peptide, which may comprise a KRAS mutation (combination) selected from the group consisting of: G12D and G13D, G12V and G13D, G S and G13D, G R and G13D, G C and G13D, G12A and G13D, G F and G13D.
In one embodiment, the mutant peptide may comprise a mutation corresponding to both amino acid position 13 and amino acid position 61 in a KRAS polypeptide, HRAS polypeptide or NRAS polypeptide. For example, KRAS mutant peptides, which may comprise KRAS mutations of G13D and Q61H as compared to SEQ ID NO. 1.
In one embodiment, the mutant peptide may comprise a mutation corresponding to both amino acid position 12 and amino acid position 61 in a KRAS polypeptide, HRAS polypeptide or NRAS polypeptide. For example, a KRAS mutant peptide, which may comprise a KRAS mutation (combination) selected from the group consisting of: G12D and Q61H, G V and Q61H, G S and Q61H, G R and Q61H, G C and Q61H, G a and Q61H, G F and Q61H.
In one embodiment, the mutant peptide may comprise a mutation at amino acid position 12, a mutation at amino acid position 13, and a mutation at amino acid position 61 corresponding to a KRAS polypeptide, HRAS polypeptide, or NRAS polypeptide. For example, a KRAS mutant peptide, which may comprise a KRAS mutation (combination) selected from the group consisting of: G12D, G D and Q61H, G12V, G D and Q61H, G12S, G D and Q61H, G12R, G D and Q61H, G12C, G D and Q61H, G12A, G D and Q61H, G12F, G D and Q61H.
In one embodiment, the mutant peptide comprises a first KRAS peptide, a second KRAS peptide, a third KRAS peptide, and a fourth KRAS peptide; wherein each KRAS peptide comprises at least 27 consecutive amino acids from the N-terminus of SEQ ID No. 1 and comprises a mutation selected from G12D, G12V, G12S, G12R, G12C, G12A, G F and G13D; or at least 27 consecutive amino acids from position 48 of SEQ ID NO. 1, and the KRAS peptide comprises a mutation of Q61H.
In one embodiment, the concatemer comprises 2,3, 4, 5, 6, 7, 8, 9 or 10 mutant peptides, wherein each of the mutant peptides comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in a KRAS polypeptide, the mutant peptides comprising the same or different mutations.
In one embodiment, the concatemer comprises 2,3, 4, 5, 6, 7, 8, 9, or 10 mutant peptides, wherein each of the mutant peptides comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in a HRAS polypeptide, the mutant peptides comprising the same or different mutations.
In one embodiment, the concatemer comprises 2,3, 4, 5, 6, 7, 8, 9, or 10 mutant peptides, wherein each of the mutant peptides comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in an NRAS polypeptide, the mutant peptides comprising the same or different mutations.
In one embodiment, the concatemer comprises 2,3, 4, 5, 6, 7, 8, 9, or 10 mutant peptides, wherein each of the mutant peptides independently comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in a KRAS polypeptide or NRAS polypeptide, the mutant peptides comprising the same or different mutations.
In one embodiment, the concatemer comprises 2,3, 4, 5, 6, 7, 8, 9, or 10 mutant peptides, wherein each of the mutant peptides independently comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in a KRAS polypeptide or HRAS polypeptide, the mutant peptides comprising the same or different mutations.
In one embodiment, the concatemer comprises 2,3, 4, 5, 6, 7, 8, 9, or 10 mutant peptides, wherein each of the mutant peptides independently comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in an HRAS polypeptide or an NRAS polypeptide, the mutant peptides comprising the same or different mutations.
In one embodiment, the concatemer comprises 2,3, 4, 5, 6, 7, 8, 9, or 10 mutant peptides, wherein each of the mutant peptides independently comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in a KARS polypeptide, HRAS polypeptide, or NRAS polypeptide, the mutant peptides comprising the same or different mutations.
In one embodiment, the concatemer is a quadruplet.
The invention also provides a polypeptide comprising a quadruplet of a first KRAS peptide, a second KRAS peptide, a third KRAS peptide and a fourth KRAS peptide, wherein each KRAS peptide comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in SEQ ID No. 1 and each comprises a mutation selected from G12D, G12V, G12S, G12R, G12C, G12A, G12F, G D and Q61H compared to SEQ ID No. 1.
As used herein, "tetrad" refers to a polypeptide made up of four polypeptides joined together, wherein each polypeptide may or may not contain a linker between the polypeptides.
In one embodiment, each KRAS peptide comprises at least 27 consecutive amino acids from the N-terminus of SEQ ID No. 1 and comprises a mutation selected from G12D, G12V, G12S, G12R, G12C, G12A, G F and G13D; or at least 27 consecutive amino acids from position 48 of SEQ ID NO. 1, and the KRAS peptide comprises a mutation of Q61H.
The linker may comprise an amino acid sequence of any length, in particular an amino acid sequence of 1 to 50, preferably 1 to 30, for example 1 to 10 amino acid residues. Exemplary linkers may include, but are not limited to, poly glycine (G), poly alanine (a), poly serine (S), or combinations thereof, such as GGAS, GGGS, GGGSG or (G4S) n, where n is an integer from 1 to 30, preferably from 1 to 10. The joint may also be a hinge region or a functional equivalent thereof. Other suitable linkers may be organic compounds or polymers generally suitable for use in pharmaceutical proteins, including but not limited to polyethylene glycol.
As used herein, "G12 mutation" refers to a mutation of the glycine at amino acid 12 starting from the N-terminus of the human KRAS amino acid sequence SEQ ID NO. 1.
As used herein, "G13 mutation" refers to a mutation of the amino acid glycine at position 13 starting from the N-terminus of the human KRAS amino acid sequence SEQ ID NO. 1.
As used herein, "Q61 mutation" refers to a mutation of the 61 st amino acid glutamine starting from the N-terminus of the human KRAS amino acid sequence SEQ ID NO. 1.
In one embodiment, each of the four KRAS peptides comprises a different mutation selected from G12D, G12V, G12S, G12R, G12C, G12A, G12F, G D and Q61H.
In one embodiment, each of the four KRAS peptides comprises
G12D, G12V, G R and G12C;
G12D, G12V, G F and G12C; or alternatively
G12D, G12V, Q H and G12C.
In one embodiment, the four KRAS peptides are the same length.
In a preferred embodiment, the four KRAS peptides are each 27 amino acids.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising G12D, G, V, G R and G12C, respectively, each of which is 27 amino acids.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising G12D, G, V, G R and G12C from the N-terminus to the C-terminus, respectively, each of the four KRAS peptides being 27 amino acids, the polypeptide comprising the amino acid sequence of SEQ ID No. 2.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising G12D, G, V, G F and G12C, respectively, each of which is 27 amino acids.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising G12D, G, V, G F and G12C from the N-terminus to the C-terminus, respectively, each of the four KRAS peptides being 27 amino acids, the polypeptide comprising the amino acid sequence of SEQ ID No. 3.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising G12D, G, V, Q H and G12C, respectively, each of which is 27 amino acids.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising G12D, G, V, Q H and G12C from the N-terminus to the C-terminus, respectively, each of the four KRAS peptides being 27 amino acids, the polypeptide comprising the amino acid sequence of SEQ ID No. 4.
In one embodiment, the polypeptide of the invention further comprises an SP sequence at the N-terminus and a MITD sequence at the C-terminus.
In one embodiment, the SP sequence comprises the amino acid sequence of SEQ ID NO. 15; MITD comprises the amino acid sequence of SEQ ID NO. 16.
In one embodiment, the polypeptide of the invention further comprises one or more linkers, preferably GS linkers.
In one embodiment, the linker comprises the amino acid sequence of SEQ ID NO. 84 or SEQ ID NO. 85.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides, an SP sequence and a MITD sequence.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides, SP sequences, MITD sequences and linkers.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising mutations in G12D, G12V, G R and G12C, respectively, SP sequence, MITD sequence, and linker.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising mutations in G12D, G12V, G R and G12C, each of which is 27 amino acids, SP sequence, MITD sequence, and linker.
In one embodiment, the polypeptide of the invention comprises from N-terminus to C-terminus an SP sequence, a linker, four KRAS polypeptides comprising mutations in G12D, G12V, G R and G12C, respectively, a linker and MITD sequences.
In one embodiment, the polypeptide of the invention comprises from N-terminus to C-terminus an SP sequence, a linker, four KRAS polypeptides comprising mutations in G12D, G12V, G R and G12C, respectively, and MITD sequences, each of which is 27 amino acids.
In one embodiment, the polypeptide of the invention comprises the amino acid sequence of SEQ ID NO. 2, the amino acid sequence of SEQ ID NO. 15, the amino acid sequence of SEQ ID NO. 16 and a GS linker.
In one embodiment, the polypeptide of the invention comprises the amino acid sequence of SEQ ID NO. 2, the amino acid sequence of SEQ ID NO. 15, the amino acid sequence of SEQ ID NO. 16, the amino acid sequence of SEQ ID NO. 84 and the amino acid sequence of SEQ ID NO. 85.
In one embodiment, the polypeptide of the invention comprises from the N-terminus to the C-terminus the amino acid sequence of SEQ ID NO. 15, the amino acid sequence of SEQ ID NO. 84, the amino acid sequence of SEQ ID NO. 2, the amino acid sequence of SEQ ID NO. 85 and the amino acid sequence of SEQ ID NO. 16.
In one embodiment, the polypeptide comprises the amino acid sequence of SEQ ID NO. 17.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising mutations in G12D, G12V, G F and G12C, respectively, SP sequence, MITD sequence, and linker.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising mutations in G12D, G12V, G F and G12C, each of which is 27 amino acids, SP sequence, MITD sequence, and linker.
In one embodiment, the polypeptide of the invention comprises from N-terminus to C-terminus an SP sequence, a linker, four KRAS polypeptides comprising mutations in G12D, G12V, G F and G12C, respectively, a linker and MITD sequences.
In one embodiment, the polypeptide of the invention comprises from N-terminus to C-terminus an SP sequence, a linker, four KRAS polypeptides comprising mutations in G12D, G12V, G F and G12C, respectively, and MITD sequences, each of which is 27 amino acids.
In one embodiment, the polypeptide of the invention comprises the amino acid sequence of SEQ ID NO. 3, the amino acid sequence of SEQ ID NO. 15, the amino acid sequence of SEQ ID NO. 16 and a GS linker.
In one embodiment, the polypeptide of the invention comprises the amino acid sequence of SEQ ID NO. 3, the amino acid sequence of SEQ ID NO. 15, the amino acid sequence of SEQ ID NO. 16, the amino acid sequence of SEQ ID NO. 84 and the amino acid sequence of SEQ ID NO. 85.
In one embodiment, the polypeptide of the invention comprises from the N-terminus to the C-terminus the amino acid sequence of SEQ ID NO. 15, the amino acid sequence of SEQ ID NO. 84, the amino acid sequence of SEQ ID NO. 3, the amino acid sequence of SEQ ID NO. 85 and the amino acid sequence of SEQ ID NO. 16.
In one embodiment, the polypeptide comprises the amino acid sequence of SEQ ID NO. 18.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising mutations in G12D, G12V, Q H and G12C, respectively, SP sequence, MITD sequence, and linker.
In one embodiment, the polypeptide of the invention comprises four KRAS peptides comprising mutations in G12D, G12V, Q H and G12C, each of which is 27 amino acids, SP sequence, MITD sequence, and linker.
In one embodiment, the polypeptide of the invention comprises from N-terminus to C-terminus an SP sequence, a linker, four KRAS polypeptides comprising mutations in G12D, G12V, Q H and G12C, respectively, a linker and MITD sequences.
In one embodiment, the polypeptide of the invention comprises from N-terminus to C-terminus an SP sequence, a linker, four KRAS polypeptides comprising mutations in G12D, G12V, Q H and G12C, respectively, and MITD sequences, each of which is 27 amino acids.
In one embodiment, the polypeptide of the invention comprises the amino acid sequence of SEQ ID NO. 4, the amino acid sequence of SEQ ID NO. 15, the amino acid sequence of SEQ ID NO. 16 and a GS linker.
In one embodiment, the polypeptide of the invention comprises the amino acid sequence of SEQ ID NO. 4, the amino acid sequence of SEQ ID NO. 15, the amino acid sequence of SEQ ID NO. 16, the amino acid sequence of SEQ ID NO. 84 and the amino acid sequence of SEQ ID NO. 85.
In one embodiment, the polypeptide of the invention comprises from the N-terminus to the C-terminus the amino acid sequence of SEQ ID NO. 15, the amino acid sequence of SEQ ID NO. 84, the amino acid sequence of SEQ ID NO. 4, the amino acid sequence of SEQ ID NO. 85 and the amino acid sequence of SEQ ID NO. 16.
In one embodiment, the polypeptide comprises the amino acid sequence of SEQ ID NO. 19.
Second polypeptide
In one embodiment, the coding sequence of the invention further comprises a nucleotide sequence encoding a second polypeptide.
The second polypeptide may be any polypeptide of interest. In one embodiment, the second polypeptide is a polypeptide other than KRAS. The second polypeptide may comprise a cytokine to assist the KRAS mutant peptide quadruplet in promoting stronger immunity. As used herein, the term "cytokine" refers to a small molecule polypeptide secreted primarily by immune cells that is capable of modulating cellular function.
As used herein, "interferon alpha 1 (ifnα1)" is a cytokine produced by immune cells of the body and belongs to the type I IFN family. Interferon alpha 1 is an early effector of the innate immune response, which can also modulate subsequent adaptive immunity by promoting Th 1-type responses. As used herein, the "FMS-related tyrosine kinase 3 ligand (Flt 3L)" is a cytokine that promotes differentiation or expansion of a variety of hematopoietic cell lineages including monocytes, immature dendritic cells and early B cell lineage cells. FMS-related tyrosine kinase 3 ligands and other cytokines synergistically promote bone marrow differentiation and mobilization of hematopoietic stem cells, induce NK cell development, and induce terminal B cell maturation.
In one embodiment, the second polypeptide is a cytokine.
In a preferred embodiment, the cytokine is a human interferon alpha 1 or a human FMS-related tyrosine kinase 3 ligand.
In a preferred embodiment, the second polypeptide comprises the amino acid sequence of SEQ ID NO. 13 or SEQ ID NO. 14.
Polynucleotide
In another aspect, the invention provides polynucleotides encoding the polypeptides described herein or the polypeptides described herein and a second polypeptide. The polynucleotide may be single-stranded or double-stranded. Polynucleotides include, but are not limited to DNA, cDNA, RNA (e.g., mRNA), recombinantly produced, and chemically synthesized polynucleotides. The polynucleotide may be contained in a vector. Polynucleotides of the invention may include naturally occurring, synthetic, and modified nucleotides. In some embodiments, the polynucleotides of the invention are used to express a polypeptide described herein or a polypeptide described herein and a second polypeptide in a cell to provide a polypeptide antigen or a polypeptide antigen and a second polypeptide. In some embodiments, the polypeptide antigen or polypeptide antigen and the second polypeptide may induce an immune response against a KRAS mutation in a suitable subject.
A polynucleotide may comprise one or more segments (nucleotide fragments) (e.g., 1,2,3, 4, 5, 6, 7, 8, or more segments). Polynucleotides may comprise segments encoding polypeptides of interest (e.g., polypeptides and polypeptide antigens described herein). In particular embodiments, the polynucleotide may comprise coding sequences for the polypeptide of interest as well as regulatory sequences (including but not limited to transcriptional and translational regulatory sequences). In one embodiment, the regulatory sequence comprises one or more of the following: promoter sequence, 5 'untranslated region (5' UTR) sequence, 3 'untranslated region (3' UTR) sequence, and poly (A) sequence.
Coding sequence
As used herein, "coding sequence" refers to a nucleotide sequence in a polynucleotide that can be used as a template for synthesis of a polypeptide having a defined nucleotide sequence (e.g., tRNA and mRNA) or a defined amino acid sequence in a biological process. The coding sequence may be a DNA sequence or an RNA sequence. If an mRNA corresponding to a DNA sequence (including the same coding strand as the mRNA sequence and the template strand complementary thereto) is translated into a polypeptide in a biological process, the DNA sequence or mRNA sequence may be considered to encode the polypeptide.
As used herein, "codon" refers to three consecutive nucleotide sequences (also known as triplet codes) in a polynucleotide that encode a particular amino acid. Synonymous codons (codons encoding the same amino acid) are used differently in different species, termed "codon bias". It is generally believed that for a given species, coding sequences using codons that are favored by it can have higher translational efficiency and accuracy in the expression system of that species. Thus, a polynucleotide may be "codon optimized," i.e., codons in the polynucleotide are altered to reflect codons favored by the host cell, preferably without altering the amino acid sequence it encodes. One of skill in the art will appreciate that due to the degeneracy of the codons, a polynucleotide of the invention may comprise a coding sequence which differs from (e.g., has about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to) a coding sequence described herein but encodes the same amino acid sequence. In a particular embodiment, the RNA of the invention comprises codons optimized for the host (e.g., subject, in particular human) cell such that the polypeptide of the invention or the second polypeptide is optimally expressed in the host (e.g., subject, in particular human).
In one embodiment, the polynucleotides of the invention comprise a coding sequence for a polypeptide antigen as described herein. In one embodiment, the polynucleotide of the invention comprises a coding sequence for a polypeptide antigen as described herein and a coding sequence for a second polypeptide. In one embodiment, the polynucleotides of the invention comprise a nucleotide sequence complementary to the coding sequences described herein. In some embodiments, a polynucleotide of the invention comprises a coding sequence for a polypeptide as described herein. In some embodiments, a polynucleotide of the invention comprises a coding sequence for a second polypeptide as described herein. In some embodiments, a polynucleotide of the invention comprises a coding sequence for a polypeptide as described herein and a coding sequence for a second polypeptide. In one embodiment, the coding sequence comprises an initiation codon at its 5 'end and a termination codon at its 3' end. In one embodiment, the coding sequence comprises an Open Reading Frame (ORF) as described herein.
In one embodiment, the coding sequence of the invention encodes any of the polypeptide antigens described above.
In one embodiment, the coding sequence of the invention encodes a polypeptide antigen comprising:
(1) The amino acid sequence of SEQ ID NO. 2; (2) An amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 2; (3) an immunogenic fragment of the amino acid sequence of SEQ ID NO. 2; (4) An immunogenic fragment of an amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 2; (5) the amino acid sequence of SEQ ID NO. 3; (6) An amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 3; (7) an immunogenic fragment of the amino acid sequence of SEQ ID NO. 3; (8) An immunogenic fragment of an amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 3; (9) the amino acid sequence of SEQ ID NO. 4; (10) An amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 4; (11) An immunogenic fragment of the amino acid sequence of SEQ ID NO. 4; (12) An immunogenic fragment of an amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 4.
In one embodiment, the coding sequence of the invention encodes a polypeptide antigen further comprising an SP sequence (SEQ ID NO: 15) and MITD sequence (SEQ ID NO: 16), wherein the polypeptide antigen comprises:
(1) The amino acid sequence of SEQ ID NO. 17; (2) An amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 17; (3) An immunogenic fragment of the amino acid sequence of SEQ ID NO. 17; (4) An immunogenic fragment of an amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 17; (5) the amino acid sequence of SEQ ID NO. 18; (6) An amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 18; (7) An immunogenic fragment of the amino acid sequence of SEQ ID NO. 18; (8) An immunogenic fragment of an amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 18; (9) the amino acid sequence of SEQ ID NO. 19; (10) An amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 19; (11) An immunogenic fragment of the amino acid sequence of SEQ ID NO. 19; (12) An immunogenic fragment of an amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 19.
In one embodiment, the coding sequence of the invention encodes a polypeptide comprising the amino acid sequence of a polypeptide antigen as described above.
In one embodiment, the coding sequence of the invention further encodes a second polypeptide comprising:
(1) The amino acid sequence of SEQ ID NO. 13; (2) An amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 13; (3) the amino acid sequence of SEQ ID NO. 14; (4) An amino acid sequence having at least 94%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence in SEQ ID NO. 14.
In one embodiment, the coding sequence of the invention encodes a polypeptide and a second polypeptide comprising the amino acid sequences of the polypeptide and the second polypeptide, respectively, as described above.
In one embodiment, the coding sequence described herein comprises a nucleotide sequence encoding a polypeptide comprising: (1) 23, 24, 25, 26, 32, 33, 34 and 35; (2) A nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence of one of SEQ ID NOs 23, 24, 25, 26, 32, 33, 34 and 35; (3) The nucleotide sequence of one of SEQ ID NOs 63, 64, 65, 66, 72, 73, 74 and 75; or (4) a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence of one of SEQ ID NOs 63, 64, 65, 66, 72, 73, 74 and 75.
In one embodiment, the coding sequence described herein comprises a nucleotide sequence encoding a second polypeptide comprising: (1) the nucleotide sequence of SEQ ID NO. 27 or SEQ ID NO. 28; (2) A nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence of SEQ ID NO. 27 or SEQ ID NO. 28; (3) the nucleotide sequence of SEQ ID NO. 67 or SEQ ID NO. 68; or (4) a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence of SEQ ID NO. 67 or SEQ ID NO. 68.
In one embodiment, the coding sequences described herein further comprise an Internal Ribosome Entry Site (IRES) sequence which allows the polypeptide of the invention and the second polypeptide to be independently translated by a ribosome (e.g., polycistronic mRNA).
Preferably, the Internal Ribosome Entry Site (IRES) sequence comprises an IRES sequence from:
Picornaviruses (e.g., FMDV), insect viruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (EMCV), foot and Mouth Disease Viruses (FMDV), hepatitis C Viruses (HCV), swine fever viruses (CSFV), murine Leukemia Viruses (MLV), simian Immunodeficiency Viruses (SIV), cricket paralysis viruses (CrPV), or coxsackie viruses B3 (CVB 3).
In one embodiment, the Internal Ribosome Entry Site (IRES) sequence is located between the nucleotide sequence of the polypeptide of the present invention and the nucleotide sequence of the second polypeptide of the present invention.
In one embodiment, the Internal Ribosome Entry Site (IRES) sequence comprises the nucleotide sequence of SEQ ID NO 88, 89, 90 or 91.
In one embodiment, the coding sequence described herein comprises a nucleotide sequence encoding a polypeptide of the invention and a nucleotide sequence encoding a second polypeptide comprising: (1) the nucleotide sequence of SEQ ID NO. 36 or SEQ ID NO. 37; (2) A nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence of SEQ ID NO. 36 or SEQ ID NO. 37; (3) the nucleotide sequence of SEQ ID NO. 76 or SEQ ID NO. 77; or (4) a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to the nucleotide sequence of SEQ ID NO. 76 or SEQ ID NO. 77.
RNA
In some embodiments, the polynucleotides of the invention are RNA. As used herein, the definition of "RNA" encompasses single-stranded, double-stranded, linear, and circular RNAs. The RNA of the invention may be RNA produced by chemical synthesis, recombination and in vitro transcription. In one embodiment, the RNA of the invention is used to express a polypeptide of the invention in a host cell. In one embodiment, the RNA of the invention is used to express a second polypeptide of the invention in a host cell. In one embodiment, the RNA of the invention is used to express the polypeptide of the invention and the second polypeptide in a host cell.
In one embodiment, the RNA of the invention is single stranded RNA. In one embodiment, the RNA of the invention is in vitro transcribed RNA (IVT-RNA). IVT-RNA can be obtained by in vitro transcription with a DNA template by RNA polymerase (e.g., as described herein).
In some embodiments, the RNA of the invention is messenger RNA (mRNA). In general, an mRNA can comprise a 5'-UTR sequence, a coding sequence for a polypeptide (e.g., a polypeptide of the invention or a second polypeptide), a 3' -UTR sequence, and optionally a poly (a) sequence. mRNA can be produced, for example, by in vitro transcription or chemical synthesis. In one embodiment, the mRNA of the invention is obtained by in vitro transcription by RNA polymerase (e.g., T7 RNA polymerase) using a DNA template. In one embodiment, the mRNA of the invention comprises (1) a 5'-UTR, (2) a coding sequence, (3) a 3' -UTR, and (4) optionally, a poly (A) sequence. The 5'-UTR, coding sequence, 3' -UTR and poly (A) sequences are as described herein. In one embodiment, the mRNA of the present invention is a nucleoside modified mRNA. In one embodiment, the mRNA of the present invention comprises an optional 5' cap.
In some embodiments, the RNA of the invention comprises a coding sequence for a polypeptide antigen as described herein. In some embodiments, the RNA of the invention comprises a coding sequence for a second polypeptide as described herein. In some embodiments, the RNA of the invention comprises a coding sequence for a polypeptide antigen as described herein and a coding sequence for a second polypeptide. In some embodiments, the RNA of the invention comprises a coding sequence for a polypeptide as described herein. In some embodiments, the RNA of the invention comprises a coding sequence for a second polypeptide as described herein. In some embodiments, the RNA of the invention comprises a coding sequence for a polypeptide as described herein and a coding sequence for a second polypeptide.
In some embodiments, the RNAs of the invention further comprise structural elements that help to improve stability and/or translation efficiency of the RNAs, including, but not limited to, 5' caps, 5' -UTRs, 3' -UTRs, and poly (a) sequences.
As used herein, the term "untranslated region (UTR)" generally refers to a region in RNA (e.g., mRNA) that is not translated into an amino acid sequence (non-coding region), or a corresponding region in DNA. In general, the UTR located 5' to (upstream of) the open reading frame (start codon) may be referred to as the 5' -UTR of the 5' untranslated region; UTRs located 3 'to (downstream of) the open reading frame (stop codon) may be referred to as 3' -UTRs. In the presence of a 5 'cap, the 5' -UTR is located downstream of the 5 'cap, e.g., immediately adjacent to the 5' cap. In particular embodiments, an optimized "Kozak sequence" may be included in the 5' -UTR, e.g., adjacent to the start codon, to increase translation efficiency. In the presence of a poly (A) sequence, the 3' -UTR is located upstream of the poly (A) sequence, e.g., immediately adjacent to the poly (A) sequence.
In some embodiments, the RNA of the invention comprises a 5' -UTR. In a preferred embodiment, the 5' -UTR comprises the nucleotide sequence of SEQ ID NO. 61. In some embodiments, the RNA of the invention comprises a 3' -UTR. In a preferred embodiment, the 3' -UTR comprises the nucleotide sequence of SEQ ID NO. 62. In some embodiments, the RNA of the invention comprises a 5'-UTR and a 3' -UTR. In a specific embodiment, the 5'-UTR comprises the nucleotide sequence of SEQ ID NO. 61 and the 3' -UTR comprises the nucleotide sequence of SEQ ID NO. 62.
As used herein, the term "poly (a) sequence" or "poly (a) tail" refers to a nucleotide sequence comprising continuous or discontinuous adenylates. The poly (A) sequence is typically located at the 3' end of the RNA, e.g., 3' end (downstream) of the 3' -UTR. In some embodiments, the poly (a) sequence does not comprise nucleotides other than adenylate at its 3' end. Poly (A) sequences can be transcribed from the coding sequence of a DNA template by a DNA-dependent RNA polymerase during the preparation of IVT-RNA or can be linked to the free 3' end of IVT-RNA, e.g., the 3' end of the 3' -UTR, by a DNA-independent RNA polymerase (Poly (A) polymerase).
In some embodiments, the RNA of the invention comprises a poly (a) sequence. In one embodiment, the poly (A) sequence comprises contiguous adenylates. In one embodiment, the poly (a) sequence can comprise at least 20, 30, 40, 50, 60, 70, 75, 80, 85, 95, or 100 and up to 120, 150, 180, 200, 300 adenylates. In one embodiment, the contiguous adenylate sequence in the poly (a) sequence is interrupted by a sequence comprising U, C or G nucleotides. Preferably, the poly (a) sequence comprises 75 adenylates.
The poly (a) sequence may comprise at least 20, 30, 40, 50, 60, 70, 75, 80, 85, 95, or 100 and up to 120, 150, 180, 200, 300 nucleotides. In one embodiment, the poly (a) sequence comprises at least 50 nucleotides. In one embodiment, the poly (a) sequence comprises at least 80 nucleotides. In one embodiment, the poly (a) sequence comprises at least 100 nucleotides. In some embodiments, the poly (a) sequence comprises about 70, 80, 90, 100, 120, or 150 nucleotides. In a specific embodiment, the poly (A) sequence comprises 75 nucleotides.
As used herein, the term "5 'cap" generally refers to an N7-methylguanosine structure (also known as "m7G cap", "m7 Gppp-") attached to the 5' end of an mRNA by a 5 'to 5' triphosphate bond. The 5' cap may be co-transcribed into the RNA in vitro transcription (e.g., using an anti-reverse cap analogue "ARCA") or may be post-transcriptionally linked to the RNA using a capping enzyme.
In one embodiment, the RNA of the invention comprises the nucleotide sequence of any one of SEQ ID NOs 23, 24, 25, 26, 32, 33, 34, 35, 36 and 37. In one embodiment, the RNA of the invention comprises the nucleotide sequence of any one of SEQ ID NOs 42, 43, 44, 45, 51, 52, 53, 54, 55 and 56.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 23 or 42.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 24 or 43.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 25 or 44.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 26 or 45.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 32 or 51.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 33 or 52.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO 34 or 53.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 35 or 54.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 36 or 55.
In one embodiment, the RNA of the invention comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO. 37 or 56.
Modified nucleotides
In some embodiments, the nucleotides in the RNAs (e.g., mrnas) of the invention can be naturally occurring nucleotides (e.g., naturally occurring ribonucleotides) and modified nucleotides. The modified nucleotide may be, for example, a nucleotide that is not present in the naturally occurring RNA, such as a nonstandard nucleotide or a deoxynucleotide. Modification of the nucleotide may occur on the nucleoside, for example on the ribose moiety and/or nucleobase moiety. The modified nucleotides may be incorporated during transcription (e.g., in vitro transcription) or may be added during RNA chemical synthesis.
In one embodiment, the RNA is modified by including one or more modified nucleosides. In one embodiment, the RNA is modified by replacing one or more uracils with a modified uridine. In one embodiment, the modified uridine comprises 1-methyl pseudouracil, 5-methyl-uracil, or a combination thereof.
Examples of modified uridine may include, but are not limited to: 1-methyluridine, 1-methyl-pseudouridine, 3-methyl-uridine, 3-methyl-pseudouridine, 2-methoxy-uridine, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurine methyl-uridine, 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uridine, 1-taurine methyl-4-thio-pseudouridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5, 6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 3- (3-amino-3-carboxypropyl) uridine, 5- (isocyanatomethyl) uridine, 5- (2-thio) -methyl-1-deaza-uridine, 2 '-methyl-2' -thio-amino-2 '-methyl-2' -thio-2 '-O-methyl-2' -thio-uridine, 2 '-O-methyl-2' -O-thio-uridine, O-methyl-2 '-O-thio-2' -O-methyl-uridine, 5-methoxycarbonylmethyl-2 ' -O-methyl-uridine, 5-carbamoylmethyl-2 ' -O-methyl-uridine, 5-carboxymethylaminomethyl-2 ' -O-methyl-uridine, 3,2' -O-dimethyl-uridine, 5- (isopentenylaminomethyl) -2' -O-methyl-uridine, 1-thio-uridine, 5- (2-methoxycarbonylvinyl) uridine and 5- [3- (1-E-propenyl amino) uridine.
In one embodiment, the RNA (e.g., mRNA) of the present invention is modified by inclusion of one or more modified nucleobases. In one embodiment, the modified nucleobase comprises a modified cytosine, a modified uracil, or a combination thereof. In one embodiment, the modified uracil is independently selected from pseudouracil, 1-methyl-pseudouracil, 5-methyl-uracil, or a combination thereof. In one embodiment, the modified cytosine is independently selected from 5-methylcytosine, 5-hydroxymethylcytosine, or a combination thereof. In one embodiment, the proportion of modified nucleobases in the RNA of the invention is from 10% to 100%, i.e.the RNA of the invention can be modified by replacing 10% to 100% of the nucleobases with modified nucleobases.
In some embodiments, the RNA (e.g., mRNA) of the invention is modified by replacing one or more uracils with a modified uracil. In one embodiment, the modified uracil comprises 1-methyl pseudouracil, 5-methyl-uracil, or a combination thereof. In one embodiment, the modified uracil comprises pseudouracil. In one embodiment, the modified uracil comprises 5-methyl-uracil. In one embodiment, the modified uracil comprises 1-methyl-pseudouracil.
In one embodiment, the RNA is modified by replacing at least one uracil with a modified uracil. In one embodiment, the RNA is modified by replacing all uracils with modified uracils. In one embodiment, the proportion of modified uracil in the RNA is 10% -100%, e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%. In one embodiment, the proportion of modified uracil in the RNA is 20% to 100%. In one embodiment, 20% to 100% of uracil in the RNA is replaced with 1-methyl pseudouracil. In a preferred embodiment, 100% of uracil in the RNA is replaced with 1-methyl pseudouracil.
1-Methyl-pseudouridine has the following structure:
In a specific embodiment, the mRNA of the present invention comprises the nucleotide sequence of any of SEQ ID NOs 42, 43, 44, 45, 51, 52, 53, 54, 55 and 56, and wherein 100% of the uracil is replaced by 1-methyl pseudouracil.
DNA
In some embodiments, the polynucleotides of the invention are DNA. Such DNA may be, for example, a DNA template for in vitro transcription of the RNA of the invention or a DNA vaccine for expression of the polypeptide antigen and/or the second polypeptide antigen in a host cell. The DNA may be double-stranded, single-stranded, linear and circular.
The DNA template may be provided in a suitable transcription vector. In general, a DNA template may be a double-stranded complex comprising a nucleotide sequence (coding strand) identical to a coding sequence described herein and a nucleotide sequence (template strand) complementary to a coding sequence described herein. As known to those skilled in the art, a DNA template may comprise a promoter, a 5'-UTR, a coding sequence, a 3' -UTR, and optionally a poly (a) sequence. Promoters may be available to suitable RNA polymerases (particularly DNA-dependent RNA polymerases) known to those skilled in the art, including but not limited to promoters of SP6, T3 and T7 RNA polymerases. In some embodiments, the 5'-UTR, coding sequence, 3' -UTR, and poly (a) sequences in the DNA templates are or are complementary to the corresponding sequences contained in the RNAs described herein. Polynucleotides as DNA vaccines may be provided in plasmid vectors (e.g., circular plasmid vectors).
In some embodiments, the DNA of the invention comprises a coding sequence for a polypeptide antigen as described herein. In some embodiments, the DNA of the invention comprises a coding sequence for a second polypeptide as described herein. In some embodiments, the DNA of the invention comprises the coding sequences for the polypeptide antigen and the second polypeptide as described herein. In some embodiments, the DNA of the invention comprises a coding sequence for a polypeptide as described herein. In some embodiments, the DNA of the invention comprises a coding sequence for a second polypeptide as described herein. In some embodiments, the DNA of the invention comprises the coding sequences for the polypeptide and the second polypeptide as described herein. In some embodiments, the DNA of the invention comprises, from the 5 'end to the 3' end, (1) a T7 promoter, (2) a 5'-UTR, (3) a coding sequence, (4) a 3' -UTR, and (5) an optionally present poly (a) sequence as described herein. In some embodiments, the DNA of the present invention comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs 63, 64, 65, 66, 72, 73, 74, 75, 76 and 77.
Composition and method for producing the same
The present invention provides a composition comprising a polypeptide of the present invention.
The invention also provides a composition comprising a polynucleotide (particularly RNA) of the invention.
In one embodiment, the compositions of the invention are used to provide prophylactic or therapeutic immunity in a subject against a cancer associated with a KRAS mutation.
In some embodiments, the compositions of the invention comprise a polynucleotide of the invention. In some embodiments, the compositions of the invention comprise a DNA of the invention. In some embodiments, the compositions of the invention comprise an RNA of the invention. In one embodiment, the RNA is in vitro transcribed RNA. In one embodiment, the RNA is mRNA.
In some embodiments, the compositions of the invention comprise a polynucleotide (particularly RNA, e.g., mRNA) as described herein and a lipid encapsulating the polynucleotide.
As used herein, the term "lipid" refers to an organic compound comprising a hydrophobic moiety and optionally also a hydrophilic moiety. Lipids are generally poorly soluble in water but soluble in many organic solvents. Generally, amphiphilic lipids comprising a hydrophobic portion and a hydrophilic portion may be organized in an aqueous environment as a lipid bilayer structure, for example in the form of vesicles. Lipids may include, but are not limited to: fatty acids, glycerides, phospholipids, sphingolipids, glycolipids, and steroids and cholesterol esters, and the like.
Particularly preferred nucleic acid compositions can be, for example, lipid Nanoparticles (LNPs) and lipid multimeric complexes (LPPs) as described herein. Methods of preparing such compositions can be found, for example, in Kaczmarek, j.c.et al, 2017,Genome Medicine 9,60 or as described herein. In some embodiments, the compositions of the invention comprise Lipid Nanoparticles (LNPs) or lipid multimeric complexes (LPPs). In some embodiments, the compositions of the invention are Lipid Nanoparticles (LNPs) or lipid multimeric complexes (LPPs) comprising the RNAs of the invention.
In some embodiments, the lipid encapsulating the polynucleotide comprises a cationic lipid and a non-cationic lipid. In a preferred embodiment, the cationic lipid is an ionizable cationic lipid.
In one embodiment, the cationic lipid comprises DOTMA、DOTAP、DDAB、DOSPA、DODAC、DODAP、DC-Chol、DMRIE、DMOBA、DLinDMA、DLenDMA、CLinDMA、DMORIE、DLDMA、DMDMA、DOGS、N4- cholesteryl-spermine, DLin-KC2-DMA, DLin-MC3-DMA, or a combination thereof.
In a preferred embodiment, the cationic lipid comprises T5, which has the following structure:
In one embodiment, the non-cationic lipid comprises a phospholipid as described herein. In one embodiment, the non-cationic lipid comprises a steroid as described herein. In one embodiment, the non-cationic lipid comprises a phospholipid and a steroid as described herein. In one embodiment, the phospholipid comprises DSPC, DPPC, DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE and DSPE or a combination thereof. In one embodiment, the steroid is cholesterol. In one embodiment, the non-cationic lipid comprises DOPE. In one embodiment, the non-cationic lipid comprises DSPC. In one embodiment, the non-cationic lipid comprises cholesterol. In one embodiment, the non-cationic lipid comprises DOPE and cholesterol. In one embodiment, the non-cationic lipid comprises DSPC and cholesterol.
In one embodiment, the cationic lipid comprises T5 and the non-cationic lipid comprises DOPE and cholesterol. In one embodiment, the cationic lipid comprises T5 and the non-cationic lipid comprises DSPC and cholesterol.
In some embodiments, the polynucleotide-encapsulating lipid further comprises a polyethylene glycol-modified lipid. In one embodiment, the polyethylene glycol modified lipid comprises DMG-PEG (e.g., DMG-PEG 2000), DOGPEG, and DSPE-PEG, or a combination thereof. In one embodiment, the polyethylene glycol modified lipid comprises DSPE-PEG. In one embodiment, the polyethylene glycol modified lipid comprises DMG-PEG (e.g., DMG-PEG 2000).
In some embodiments, the compositions of the invention further comprise a cationic polymer associated with the polynucleotide as a complex, co-encapsulated in the lipid.
In one embodiment, the cationic polymer comprises poly-L-lysine, protamine, polyethylenimine (PEI), or a combination thereof. In one embodiment, the cationic polymer is protamine. In one embodiment, the cationic polymer is a polyethyleneimine.
In one embodiment, the amount of lipid in the composition is calculated as mole percent (mole%) based on the total moles of lipid in the composition.
In one embodiment, the amount of cationic lipid in the composition is from about 10 to about 70 mole%. In some embodiments, the amount of cationic lipid in the composition is from about 20 to about 60 mole%, from about 30 to about 50 mole%, from about 35 to about 45 mole%, from about 38 to about 45 mole%, from about 40 to about 50 mole%, or from about 45 to about 50 mole%.
In one embodiment, the amount of phospholipid in the composition is from about 10 to about 70 mole%. In one embodiment, the amount of phospholipid in the composition is from about 20 to about 60 mole%, from about 30 to about 50 mole%, from about 10 to about 30 mole%, from about 10 to about 20 mole%, or from about 10 to about 15 mole%.
In one embodiment, the amount of cholesterol in the composition is from about 10 to about 70 mole%. In one embodiment, the amount of cholesterol in the composition is from about 20 to about 60 mole%, from about 30 to about 50 mole%, from about 35 to about 40 mole%, from about 35 to about 45 mole%, from about 40 to about 45 mole%, or from about 45 to about 50 mole%.
In one embodiment, the amount of polyethylene glycol modified lipid in the composition is from about 0.05 to about 20 mole%. In one embodiment, the amount of polyethylene glycol modified lipid in the composition is from about 0.5 to about 15 mole%, from about 1 to about 10 mole%, from about 5 to about 15 mole%, from about 1 to about 5 mole%, from about 1.5 to about 3 mole%, or from about 2 to 5 mole%.
In some embodiments, the RNA (particularly mRNA) of the invention is formulated as Lipid Nanoparticles (LNP). As used herein, "lipid nanoparticle" or "LNP" refers to particles formed from lipids in which nucleic acids (e.g., mRNA) are encapsulated.
In one embodiment, the LNP comprises an RNA of the invention and an RNA-encapsulating lipid, wherein the RNA-encapsulating lipid comprises a cationic lipid, a phospholipid, cholesterol, and a polyethylene glycol modified lipid. In one embodiment, the cationic lipid is T5. In one embodiment, the phospholipid is DSPC. In one embodiment, the polyethylene glycol modified lipid is DMG-PEG 2000. In one embodiment, the cationic lipid is T5, the phospholipid is DSPC, and the polyethylene glycol modified lipid is DMG-PEG 2000.
In one embodiment, the RNA-encapsulating lipid comprises 50 mole% T5, 10 mole% DSPC, 38.5 mole% cholesterol, and 1.5 mole% DMG-PEG 2000.
In some embodiments, the RNAs (particularly mrnas) of the invention are formulated as lipid multimeric complexes (lipopolyplex, LPP). As used herein, "lipid multimeric complex" or "LPP" refers to a core-shell structure comprising a nucleic acid core encapsulated by a lipid outer shell, the nucleic acid core comprising a nucleic acid (e.g., mRNA) associated with a polymer.
In one embodiment, the LPP comprises an RNA of the invention, associated with a cationic polymer as a complex; and a lipid encapsulating the complex, wherein the lipid encapsulating the complex comprises a cationic lipid, a non-cationic lipid, and a polyethylene glycol modified lipid. In one embodiment, the non-cationic lipid comprises a phospholipid and a steroid. In one embodiment, the non-cationic lipid comprises a phospholipid selected from 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoyl phosphatidylcholine (DSPC), or a combination thereof, and cholesterol. In one embodiment, the cationic polymer comprises protamine. In one embodiment, the polyethylene glycol modified lipid comprises DMG-PEG 2000.
In one embodiment, the cationic lipid comprises T5, which has the structure:
The non-cationic lipid comprises a phospholipid selected from 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), distearoyl phosphatidylcholine (DSPC), or a combination thereof, and cholesterol;
the polyethylene glycol modified lipid comprises 1, 2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol 2000 (DMG-PEG 2000);
The cationic polymer comprises protamine.
In one embodiment, the cationic polymer is protamine, the cationic lipid is T5, the phospholipid is DOPE, and the polyethylene glycol modified lipid is DMG-PEG 2000.
In one embodiment, the lipid of the encapsulation complex comprises 40 mole% T5, 15 mole% DOPE, 43.5 mole% cholesterol, and 1.5 mole% DMG-PEG 2000.
The invention also provides a vaccine formulation (also referred to as a "vaccine agent") comprising a polypeptide of the invention.
The invention also provides a vaccine formulation comprising a polynucleotide as described herein.
In some embodiments, the vaccine formulations of the present invention (also referred to as "vaccine agents") comprise the compositions described herein, wherein the lipid comprises 10-70 mole% T5, 10-70 mole% DOPE, 10-70 mole% cholesterol, and 0.05-20 mole% DMG-PEG 2000,
Wherein the polynucleotide encodes a polypeptide, a second polypeptide, or both a polypeptide and a second polypeptide described herein.
In one embodiment, the polynucleotide comprises the nucleotide sequence of any one of SEQ ID NOs 23, 24, 25, 26, 32, 33, 34, 35, 36, 37, 42, 43, 44, 45, 51, 52, 53, 54, 55, 56, 63, 64, 65, 66, 72, 73, 74, 75, 76 and 77.
In one embodiment, the vaccine formulation comprises a polynucleotide encoding a polypeptide, a second polypeptide, or both as described herein, and a lipid encapsulating the polynucleotide, the lipid comprising 10 to 70 mole% T5, 10 to 70 mole% 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 10 to 70 mole% cholesterol, and 0.05 to 20 mole% 1, 2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG) 2000,
In one embodiment, the polynucleotide comprises the nucleotide sequence of any one of SEQ ID NOs 23, 24, 25, 26, 32, 33, 34, 35, 36, 37, 42, 43, 44, 45, 51, 52, 53, 54, 55, 56, 63, 64, 65, 66, 72, 73, 74, 75, 76 and 77. Optionally, the vaccine formulation further comprises a cationic polymer, wherein the cationic polymer associates with the polynucleotide as a complex, and is co-encapsulated in a lipid to form a lipid-multimeric complex.
Cationic lipids
Cationic lipids are lipids that can carry a net positive charge at a given pH. Lipids with a net positive charge can associate with nucleic acids through electrostatic interactions.
Examples of cationic lipids include, but are not limited to, 1,2-di-O-octadecenyl-3-trimethylammonium propane (1, 2-di-O-octadecenyl-3-trimethylammonium-propane, DOTMA), 1,2-dioleoyl-3-trimethylammonium propane (1, 2-dioleoyl-3-trimethylammonium-propane, DOTAP), didecyl dimethylammonium bromide (Didecyldimethylammonium bromide, DDAB), 2, 3-dioleyloxy-N- [2 (sperminecarboxamide) ethyl ] -N, N-dimethyl-l-propylamine trifluoroacetate (2,3-dioleoyloxy-N-[2(spermine carboxamide)ethyl]-N,N-dimethyl-l-propanamium trifluoroacetate,DOSPA)、 dioctadecyl dimethylammonium chloride (dioctadecyldimethyl ammonium chloride, DODAC), 1,2-dioleoyl-3-dimethylammonium-propane (1, 2-dioleoyl-3-dimethylammonium-propane, DODAP), 3- (N ', N ' -dimethylaminoethane) -carbamoyl) cholesterol (3- (N ', N ' -carbamoyl) ol), 2, 3-dioleyloxy-N- [2 (spermidine carboxamide) ethyl ] -N, N-dimethyl-l-propylamine trifluoroacetate (2,3-dioleoyloxy-N-[2(spermine carboxamide)ethyl]-N,N-dimethyl-l-propanamium trifluoroacetate,DOSPA)、 bis-dioleyl dimethylammonium chloride (dioctadecyldimethyl ammonium chloride, DODAP), 1,2-dioleoyl-3-dimethylammonium-propane (1, 2-dioleoyl-3-dimethylammonium-propane (DODAP), 3- (N ', N ' -dimethylaminoethane) -cholesterol (3- (N ' -carbamoyl), DC-2-dioleyl-2-dimethyl-35-methyl-35-2-amine (DC-2, 3-2-dioleyl-2-dimethyl-2-N-trimethyl-propane), n-dimethylaminopropane (1, 2-dilinoleyloxy-N, N-dimethylaminopropane, DLinDMA), 1, 2-dioleenyloxy-N, N-dimethylaminopropane (1, 2-dilinolenyloxy-N, N-dimethylaminopropane, DLenDMA), 3-dimethylamino-2- (cholest-5-en-3-beta-oxybutan-4-yloxy) -1- (cis, cis-9, 12-octadecadienyloxy) propane (3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-oc-tadecadienoxy)propane,CLinDMA)、N-(2- -aminoethyl) -N, N-dimethyl-2,3-bis (tetradecyloxy) propane-1-aminium bromide (N- (2-aminoethyl) -N, N-dimethyl-2,3-bis (tetradecyloxy) propan-1-aminium bromide, DMORIE), N-dimethyl-2,3-bis (dodecyloxy) propan-1-amine (N, N-dimethyl-2,3-bis (dodecyloxy) propan-1-amine, DLDMA), N-dimethyl-2,3-bis (tetradecyloxy) propan-1-amine (N, N-dimethyl-2,3-bis (tetradecyloxy) propan-1-amine, DMDMA), dioctadecyl amidoglycyl spermine (dioctadecylamidoglycyl spermine, DOGS), N4-cholesteryl-spermine (N4-cholesteryl-spermine), N-cholesterol, 2, 2-diiodo-4- (2-dimethylaminoethyl) - [1,3] -dioxolane (2, 2-dilinoleyl-4- (2-dimethylaminoethyl) - [1,3] -dioxolane, DLin-KC 2-DMA), triacontanyl-6,9,28,31-tetralin-19-yl-4- (dimethylamino) butanoate (heptatriaconta-6,9,28,31-tetraen-19-yl-4- (dimethyllamino) butanoate, DLin-MC 3-DMA), heptadec-9-yl-8- ((2-hydroxyethyl) (6-oxo-6- ((decyloxy) hexyl) amino) octanoate) (heptadecan-9-yl 8- ((2-hydroxyethyl) (6-oxo-6- (undecyloxy) hexyl) amino) octanoate) ((4-hydroxybutyl) azadialkyl) bis (hexane-6, 1-diyl) bis (2-hexyl decanoate) ((4-hydroxybutyl) azanediyl) bis (hexane-6, 1-diyl) bis (hexyldecanoate).
In some embodiments, the cationic lipid is preferably an ionizable cationic lipid. The ionizable cationic lipid carries a net positive charge at, for example, an acidic pH, and is neutral at a higher pH (e.g., physiological pH). Examples of ionizable cationic lipids include, but are not limited to: dioctadecyl amidoglycyl spermine (dioctadecylamidoglycyl spermine, DOGS), N4-cholesteryl-spermine (N4-cholesteryl-spermine), 2-dioleyl-4- (2-dimethylaminoethyl) - [1,3] -dioxolane (2, 2-dilinoleyl-4- (2-dimethylaminoethyl) - [1,3] -diolide, DLin-KC 2-DMA), triacontanyl-6,9,28,31-tetralin-19-yl-4- (dimethylamino) butyrate (heptatriaconta-6,9,28,31-tetraen-19-yl-4- (dimethyllamino) butanoate, DLin-MC 3-DMA), heptadec-9-yl-8- ((2-hydroxyethyl) (6-oxo-6- ((decyloxy) hexyl) amino) octanoate) (heptadecan-9-yl 8- ((2-hydroxyethyl) (6-oxo-6- (hexyl) amino) octanoate, ((4-hydroxybutyl) azepine-19-yl-4- (dimethylamino) butyrate) bis (1-864-dihexyl) bis (24-864-2-bis (864-2-8654).
In a preferred embodiment, the cationic lipid comprises T5, which has the following structure:
Non-cationic lipids
Herein, "non-cationic lipids" refers to lipids that do not carry a net positive charge at a specified pH, such as anionic lipids and neutral lipids. The term "neutral lipid" refers to a lipid that exists in an uncharged, neutral or zwitterionic form at physiological pH. Neutral lipids may include, but are not limited to, phospholipids and steroids.
Examples of phospholipids include, but are not limited to: 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine, DOPE), 1-palmitoyl-2-oleoyl phosphatidylethanolamine (1-palmitoyl-2-oleoylphosphatidylethanolamine, POPE), distearoyl phosphatidylcholine (distearoylphosphatidylcholine, DSPC), distearoyl-phosphatidylethanolamine (distearoyl-phosphotidylinothiolamine, DSPE), dioleoyl phosphatidylcholine (dioleoylphosphatidylcholine, DOPC), dimyristoyl phosphatidylcholine (dimyristoylphosphatidylcholine, DMPC), dipalmitoyl phosphatidylcholine (dipalmitoylphosphatidylcholine, DPPC), ditetraenoyl phosphatidylcholine (diarachidoylphosphatidylcholine, DAPC), didodecyl phosphatidylcholine (dibehenoylphosphatidylcholine, DBPC), ditridecyl phosphatidylcholine (ditricosanoylphosphatidylcholine, DTPC), ditetradecyl phosphatidylcholine (dilignoceroylphatidylcholine, DLPC), palmitoyl-phosphatidylethanolamine (palmitoyloleoyl-phosphatidylcholine, POPC), ditolyphosphatidylethanolamine (dButyl-93-phosphotidyline, DPPE), and ditolyphosphatidylethanolamine (dipalmitoyl-phosphotidyline, DPPE).
Examples of steroids include, but are not limited to, for example, cholesterol, cholestanol, cholestanone, cholestenone, cholestyl-2 '-hydroxyethyl ether, cholestyl-4' -hydroxybutyl ether, tocopherol, and derivatives thereof.
Polyethylene glycol modified lipids
As used herein, the term "polyethylene glycol modified lipid" refers to a molecule comprising a polyethylene glycol moiety and a lipid moiety. Examples of polyethylene glycol modified lipids include, but are not limited to: 1, 2-dimyristoyl-rac-glycerol-3-methoxypolyethylene glycol (1, 2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol, DMG-PEG), 1,2-dioleoyl-rac-glycerol, methoxy-polyethylene glycol (1, 2-Dioleoyl-rac-glycerol, methoxypolyethylene Glycol, DOGPEG)) and 1, 2-distearoyl-sn-glycerol-3-phosphoethanolamine-poly (ethylene glycol) (1, 2-Distearoyl-sn-glycero-3-phosphoethanolamine-Poly (ethylene glycol), DSPE-PEG).
In one embodiment, the polyethylene glycol modified lipid is DMG-PEG, such as DMG-PEG 2000. In one embodiment, the DMG-PEG 2000 has the following structure:
Wherein n has an average value of 44.
Cationic polymers
As used herein, the term "cationic polymer" refers to any ionic polymer capable of carrying a net positive charge at a specified pH to electrostatically bind nucleic acids. Examples of cationic polymers include, but are not limited to: poly-L-lysine, protamine and Polyethylenimine (PEI). The polyethyleneimine may be a linear or branched polyethyleneimine.
The term "protamine" refers to arginine-rich low molecular weight basic proteins that are present in sperm cells of various animals (particularly fish) and bind to DNA in place of histones. In a preferred embodiment, the cationic polymer is protamine (e.g., protamine sulfate).
Preventing or treating cancer
The present invention provides polypeptides, polynucleotides (particularly RNA), compositions or vaccine formulations of the invention for use in the prevention or treatment of cancer in a subject in need thereof.
The present invention provides the use of a polypeptide, polynucleotide (particularly RNA), composition or vaccine formulation of the invention in the manufacture of a medicament for the prevention or treatment of cancer in a subject in need thereof.
The present invention provides a method of preventing or treating cancer in a subject in need thereof, the method comprising administering to a subject in need thereof a prophylactically or therapeutically effective amount of a polypeptide, polynucleotide (particularly RNA), composition or vaccine formulation of the invention. In one embodiment, the method comprises administering a prophylactically or therapeutically effective amount of a composition comprising a polypeptide of the invention. In one embodiment, the method comprises administering a prophylactically or therapeutically effective amount of a composition comprising an mRNA of the present invention, particularly a composition comprising LNP or LPP as described herein.
As used herein, "cancer" refers to cancers associated with KRAS mutations, wherein the cancer is selected from pancreatic cancer, peritoneal cancer, colorectal cancer, small intestine cancer, biliary tract cancer, lung cancer, endometrial cancer, ovarian cancer, genital tract cancer, gastrointestinal cancer, cervical cancer, gastric cancer, urinary tract cancer, colon cancer, rectal cancer, and hematopoietic and lymphoid tissue cancers.
The term "prophylactically or therapeutically effective amount" refers to an amount sufficient to prevent or inhibit the occurrence of a disease or symptom and/or to slow, alleviate, delay the progression or severity of a disease or symptom. A prophylactically or therapeutically effective amount is affected by factors including, but not limited to: the rate and severity of the disease or condition, the age, sex, weight and physiological condition of the subject, the duration of the treatment, and the particular route of administration. A prophylactically or therapeutically effective amount may be administered in one or more doses. A prophylactically or therapeutically effective amount may be achieved by continuous or intermittent administration.
In some embodiments, a prophylactically or therapeutically effective amount is provided in one or more administrations. In some embodiments, a prophylactically or therapeutically effective amount is provided in two administrations. In some embodiments, a prophylactically or therapeutically effective amount is provided in three administrations. In some embodiments, a prophylactically or therapeutically effective amount is provided in four administrations. In some embodiments, a prophylactically or therapeutically effective amount is provided in five administrations. Preferably, in some embodiments, a prophylactically or therapeutically effective amount is provided in two administrations. More preferably, in some embodiments, the prophylactically or therapeutically effective amount is provided in four administrations.
In some embodiments, the polypeptide, polynucleotide, composition or vaccine formulation of the invention may be administered to a subject by any method known to those of skill in the art, such as parenterally, orally, transmucosally, transdermally, intramuscularly, intravenously, intradermally, subcutaneously or intraperitoneally. Preferably, the composition or vaccine formulation of the invention is administered by intramuscular injection.
As used herein, the term "subject" describes an organism, e.g., a mammal, to which prophylactic or therapeutic immunity using a polynucleotide or composition of the invention may be provided. Preferably, the subject is a rodent or a human.
Advantageous effects
The polypeptides, polynucleotides, compositions, vaccine formulations and methods of the invention may exhibit excellent effects, such as, but not limited to: (1) high expression level; (2) Good prevention or treatment effect can be achieved without adjuvant administration; can also be used with adjuvant; (3) Has higher specific CD8 + T cell immunity level; (4) improving antigen presentation and T cell specific responses; and/or (5) the LPP preparation enhances mRNA stability and immune response effect, and can flexibly develop preparation formulas; has excellent dendritic cell (DC cell) targeting.
Examples
The invention is further described by reference to the following examples. It should be understood that these embodiments are by way of example only and are not limiting of the invention. The following materials and instruments are commercially available or prepared according to methods well known in the art. The following experiments were performed according to the manufacturer's instructions or according to methods and procedures well known in the art.
Example 1 preparation of mRNA
Design and Synthesis of DNA templates
The 25 amino acid length G12D KRAS mutant peptide haplotype (SEQ ID NO: 20), the 27 amino acid length G12D KRAS mutant peptide haplotype (SEQ ID NO: 21), the four KRAS mutant peptide quadruplex (SEQ ID NO: 22) each 25 amino acids in length, the four KRAS mutant peptide quadruplex (SEQ ID NO: 27 amino acids in length) and the DNA Open Reading Frame (ORF) sequence encoding KRAS mutant peptide quadruplex (SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO: 19) each comprising a Signal Peptide (SP) sequence (SEQ ID NO: 15) and a GS linker (SEQ ID NO: 84) at the N-terminus and a transmembrane-intracellular domain (MITD) sequence (amino acid sequence of SEQ ID NO: 16) of the GS linker (SEQ ID NO: 85) and MHC-I at the C-terminus was designed. The nucleotide sequences of the nucleic acids encoding KRAS mutant peptide monomers (G12D 25mer, G12D 27 mer), the nucleic acids encoding KRAS mutant peptide quadruplets (25 mer-concatemers, 27 mer-concatemers opt, 27 mer-concatemers 12F, 27 mer-concatemers QH) and the nucleic acids encoding KRAS mutant peptides and cytokines (27 mer-concatemer IRES hIFN α1, 27mer-concatemer IRES hFlt L) are shown in Table 1. Wherein the nucleotide sequence of the 27mer-concatemer opt is the sequence after the nucleotide sequence optimization of the 27 mer-concatemer. Meanwhile, the Moderna ORF encoding the KRAS mutant peptide quadruplet was used as a reference (see 4-MUT in Table 1).
T7 promoter sequence (TAATACGACTCACTATA), 5'-UTR sequence (SEQ ID NO: 82), 3' -UTR sequence (SEQ ID NO: 83) and poly (A) sequence (75 adenosine nucleotides) were also designed. The Kozak sequence "GCCACC" is contained in the 5' -UTR sequence (SEQ ID NO: 82).
Then, the T7 promoter sequence, the 5'-UTR sequence, the DNA ORF, the 3' -UTR sequence and the poly (A) sequence were ligated in this order, and total gene synthesis (Scoring Jin Weizhi Biotechnology Co., ltd.) was performed using pUC57 as a vector to obtain a plasmid DNA template.
The PCR amplification was performed using a pair of tailing PCR primers (upstream primer: 5 'TTGGACCCTCCGTACAGAGCTAATAACG3'; and downstream poly (T) long primer ：5'TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTTCCTACTCAGGCTTTATTCAAAGACCA3') and a high fidelity DNA polymerase-based PCR amplification kit (Bao Ri doctor materials technology (Beijing) Co., ltd.) to obtain a DNA template.
1.2. In vitro transcription of mRNA from DNA templates
Using the purified PCR product (Takara purification kit) prepared in example 1.1 as a template, a co-transcription capping reaction was performed by T7 RNA polymerase, and RNA was transcribed in vitro, thereby producing Cap1 mRNA. In vitro transcription 1-methyl-pseudouridine triphosphate was used instead of Uridine Triphosphate (UTP), and therefore the modification ratio of 1-methyl-pseudouracil in vitro transcribed Cap1 mRNA was 100%. After transcription, the DNA template was digested with dnaseli (sameil technologies limited) to reduce the risk of residual DNA template.
MRNA was purified using DynabeadsMyone (Semer Feishul technologies Co., ltd.). Purified mRNA was dissolved in 1mM sodium citrate buffer (pH 6.5+/-0.1), sterile filtered, and cryopreserved at-80℃until use. The nucleotide sequences obtained are shown in Table 1.
TABLE 1 nucleic acids G12D 25mer、G12D 27mer、25mer-concatemer、27mer-concatemer、27mer-concatemer opt、27mer-concatemer 12F、27mer-concatemer QH、27mer-concatemer
IRES hIFNalpha 1, 27mer-concatemer IRES hFlt L and 4-MUT sequences
EXAMPLE 2 preparation of mRNA vaccine formulations
2.1. Experimental materials
Cationic lipid T5 is a s microbial synthesis; helper phospholipids (DOPE) were purchased from CordenPharma; cholesterol was purchased from Sigma-Aldrich; mPEG2000-DMG (i.e., DMG-PEG 2000) was purchased at Avanti Polar Lipids, inc; PBS was purchased from Invitrogen; protamine sulfate was purchased from Beijing Lian pharmaceutical Co.
Preparation of lipid multimeric complexes (LPP) of mRNA
Preparation of an aqueous mRNA solution: each mRNA prepared in example 1.2 was diluted to 0.2mg/mL of mRNA solution with 10mM citric acid-sodium citrate buffer (pH 4.0).
Preparation of lipid solution: cationic lipid (T5): DOPE: cholesterol: DMG-PEG 2000 was dissolved in absolute ethanol at a molar ratio of 40:15:43.5:1.5 to prepare a lipid solution of 10 mg/mL.
Preparing a protamine sulfate solution: the protamine sulfate is dissolved in water without the nucleotidase to prepare the protamine sulfate solution with the working concentration of 0.25 mg/mL.
Preparation of core nanoparticle (core nanoparticle) solution: using microfluidic technology (micana (Shanghai) technologies, inc.: inano D), a solution of protamine sulfate was mixed with a solution of mRNA under the following conditions to obtain a solution of nuclear nanoparticles formed from protamine and mRNA: volume = 4.0mL; flow ratio=5 (mRNA): 1 (protamine solution), total flow = 12mL/min, front waste (START WASTE) =0.35 mL, rear waste (end waste) =0.1 mL, room temperature.
Preparation of LPP: the core nanoparticle solution was secondarily mixed with the lipid solution under the following conditions: volume=4.0 mL, flow rate ratio=1 (lipid solution): 3 (core nanoparticle solution), total flow rate=12 mL/min, front waste=0.35 mL, rear waste=0.1 mL, room temperature, diluted with PBS to obtain LPP solution.
Centrifugal ultrafiltration: the LPP solution was centrifuged by ultrafiltration to remove ethanol (rotation speed 3000rpm, centrifugation time 60min, temperature 4 ℃ C.), and LPP preparations containing mRNAs of G12D 25mer、G12D 27mer、25mer-concatemer、27mer-concatemer、27mer-concatemer opt、27mer-concatemer 12F、27mer-concatemer QH、27mer-concatemer IRES hIFNα1、27mer-concatemer IRES hFlt3L and 4-MUT, respectively, hereinafter referred to as 25mer、27mer、25mer-con、27mer-con、27mer-con opt、27mer-con 12F、27mer-conQH、27mer-con IRES hIFNα1、27mer-con IRES hFlt3L and Moderna 4-MUT, respectively, were obtained.
Example 3 comparison of mRNA in vitro expression of G12D 25mer, G12D 27mer, 25mer-concatemer and 27mer-concatemer
HEK 293 cells (human embryonic kidney epithelial cells) were cultured in Dulbecco's modified Eagle's medium (DMEM, GIBCO, 10566-016) supplemented with 10% FBS (Hyclone, 35-081-CV) and 1% penicillin-streptomycin (GIBCO, 15140-122) at 37℃under 5% CO 2.
The expression of the mRNA of the G12D25mer, G12D 27mer, 25mer-concatemer, 27mer-concatemer prepared in example 1.2 was detected in HEK293 cells. Briefly, corresponding mRNA stocks were transfected into HEK293 cells using transfection reagent Lipofectamine MessengerMax (Invitrogen, LMRNA 015), wherein G12D25mer and G12D 27mer mRNA stocks containing 0.6 μg mRNA were transfected into HEK293 cells and 25mer-concatemer and 27mer-concatemer mRNA stocks containing 2.4 μg mRNA were transfected into HEK293 cells taking into account the differences in single and four tandem molecular weights. And a control (control) was set to which only an equal amount Lipofectamine MessengerMax of treated cells was added. The transfected cells were placed in a cell incubator and cultured for an additional 24h at 37℃with 5% CO 2. Cell extracts were collected, the supernatant was concentrated 10-fold simultaneously by acetone precipitation, and mRNA expression was detected by Western blotting (Western Blot) using RAS G12D-specific antibodies (CST, # 14429).
As a result, as shown in FIG. 1, the HEK293 cells transfected with G12D 25mer, G12D 27mer, 25mer-concatemer and 27mer-concatemer all had the expression of proteins containing KRAS G12D mutant epitopes, indicating that these mRNAs were correctly translated into specific antigen proteins containing KRAS G12D mutant epitopes in the cells. In addition, G12D 25mer and G12D 27mer were expressed more, while the expression of 27 mer-concatemers was significantly higher than 25 mer-concatemers, indicating higher expression efficiencies of the mRNA of 27 mer-concatemers.
Example 4 immunization of 25mer and Moderna4-MUT in mice
4.1 Laboratory mice
Female, 6 week old A1101 transgenic mice were used in this example. A1101 transgenic mice (Taconic Biosciences, 9660-F) were bred and cared for in Shanghai model biological center Co.Ltd. Animal studies were strictly performed according to the recommendations in Shanghai laboratory animal feeding administration and use guidelines.
4.2 Experimental procedures and results
This example uses LPP formulations prepared as in example 2.2 to immunize a1101 transgenic mice and assess their level of activation of specific CD8 + T cell immunity in the mice.
Mice were randomly divided into 5 groups (n=2), wherein the 2 groups were immunized with 25mer and Moderna4-MUT LPP formulations prepared as in example 2.2 (single dose 20 μg/mouse), 1 group each mice was administered 50 μg g G D polypeptide (gold rayleigh synthesis) in combination with 30 μg polyinosine (polyIC, invivogen, vac-pic) adjuvant as positive control, and the other 2 groups were administered 30 μg polyIC and Phosphate Buffered Saline (PBS) as negative control, respectively. Each group was administered by intramuscular injection 1 time per week for 2 consecutive weeks. Mice were euthanized 7 days after the last immunization and spleen cells were collected for activation-specific CD8 + T cell detection in the mice. The specific detection method comprises the following steps:
ELISA spot (ELISPot) assay
The mouse IFN-. Gamma.ELISpot assay was performed using the IFN-. Gamma. ELISpotPLUS kit (Mabtech, 3321-4 APT-10) according to the manufacturer's instructions. Briefly, plates were blocked in RPMI 1640 medium (supplemented with 10% fbs) and incubated for 30min. Spleen cells were plated at 3×10 5 cells/well and stimulated in vitro with 10 μg/ml KRAS G12D 25mer polypeptide, SLP (MTEYKLVVVGADGVGKSALTIQLIQ, gold synthesis), KRAS wild type 25mer polypeptide, wt-25 (MTEYKLVVVGAGGVGKSALTIQLIQ, gold synthesis) or RPMI 1640 medium alone (negative control), incubated at 37 ℃ for 20 hours with 5% co 2. After that, with biotinylated IFN-. Gamma. -detection antibody and streptavidin-alkaline phosphatase (ALP), BCIP/NBT-plus (5-bromo-4-chloro-3-indole-phosphate/nitro blue tetrazolium-plus) substrate was added for color development and counted with an ELISPOT reader (ImmunoSpot S6 Core Analyzer (CTL)).
As shown in FIG. 2, the specific immunity of the 25mer group was limited compared with the positive control group, which is the G12D polypeptide combined polyIC adjuvant, and no obvious color development was observed in the 25mer group, whether SLP in vitro stimulation or wt-25 in vitro stimulation. The Moderna-MUT group can activate specific CD8 + T immunity more effectively under LPP system, and has obvious color development under SLP in vitro stimulation, and has weaker color development degree under wt-25 in vitro stimulation. This result is consistent with Moderna in vivo immunization results (see, e.g., US10881730B 2).
Example 525 comparison of mRNA in vitro expression of mer-concatemers, 27mer-concatemer opt and 4-MUT
HEK 293 cells (human embryonic kidney epithelial cells) were cultured in Dulbecco's modified Eagle's medium (DMEM, GIBCO, 10566-016) supplemented with 10% FBS (Hyclone, 35-081-CV) and 1% penicillin-streptomycin (GIBCO, 15140-122) at 37℃under 5% CO 2.
MRNA expression of 25 mer-concatemers, 27mer-concatemer opt and 4-MUT prepared as in example 1.2 was detected in HEK293 cells. Briefly, corresponding mRNA stocks were transfected into HEK293 cells using transfection reagent Lipofectamine MessengerMax (Invitrogen), wherein HEK293 was transfected with 25 mer-concatemers, 27mer-concatemer opt, and 4-MUT mRNA stocks containing 1.0. Mu.g and 2.5. Mu.g mRNA, respectively. And a control (control) was set to which only an equal amount Lipofectamine MessengerMax of treated cells was added. The transfected cells were placed in a cell incubator and cultured for an additional 24h at 37℃with 5% CO 2. Cell extracts were collected and mRNA expression was detected by Western Blot (Western Blot) using RAS G12D specific antibodies (CST, # 14429) and RAS G12V specific antibodies (CST, # 14412).
Results as shown in fig. 3A and 3B, 25 mer-concatemers, 27mer-concatemer opt and 4-MUT transfected HEK293 cells all had expression of proteins containing KRAS G12D mutant epitopes and proteins containing KRAS G12V mutant epitopes, indicating that these mrnas were correctly translated in cells into specific antigen proteins containing KRAS G12D mutant epitopes and KRAS G12V mutant epitopes. In addition, the expression of 27 mer-concatemers and 27mer-concatemer opt was significantly higher than that of 25 mer-concatemers and 4-MUT, demonstrating that the mRNA encoding the 27mer KRAS mutant peptide quadruplet of the present invention was more efficient in expression than the mRNA encoding the 25mer KRAS mutant peptide quadruplet.
Example 6 in vitro expression of mRNA from 27mer-concatemer 12F
The polynucleotides of the above examples encode KRAS mutant peptide quads comprising mutations G12D, G12V, G R and G12C, respectively (the 4-MUT of Moderna company comprises G12D, G12V, G13D and G12C mutations). This example is the detection of in vitro expression of a polynucleotide encoding a KRAS mutant peptide tetrad comprising G12D, G, V, G F and G12C mutations.
HEK 293 cells (human embryonic kidney epithelial cells) were cultured in Dulbecco's modified Eagle's medium (DMEM, GIBCO, 10566-016) supplemented with 10% FBS (Hyclone, 35-081-CV) and 1% penicillin-streptomycin (GIBCO, 15140-122) at 37℃under 5% CO 2.
MRNA expression of 27mer-concatemer opt and 27mer-concatemer12F prepared as in example 1.2 was detected in HEK293 cells. Briefly, corresponding mRNA stocks were transfected into HEK293 cells using transfection reagent Lipofectamine MessengerMax (Invitrogen), wherein 27mer-concatemer opt and 27mer-concatemer12F mRNA stocks containing 0.4. Mu.g, 1.0. Mu.g and 2.5. Mu.g mRNA were taken, respectively, to transfect the cells. And a control (control) was set to which only an equal amount Lipofectamine MessengerMax of treated cells was added. The transfected cells were placed in a cell incubator and cultured for an additional 24h at 37℃with 5% CO 2. Cell extracts were collected and the expression of mRNA of 27mer-concatemer opt and 27mer-concatemer12F was detected by Western Blot using RAS G12D specific antibody (CST, # 14429) and RAS G12V specific antibody (CST, # 14412).
Results as shown in figures 3C and 3D, both the 27mer-concatemer opt and the 27mer-concatemer 12F transfected HEK293 cells had expression of both the protein containing the KRAS G12D mutant epitope and the protein containing the KRAS G12V mutant epitope, indicating that these mrnas were correctly translated in the cells into specific antigen proteins containing the KRAS G12D mutant epitope and containing the KRAS G12V mutant epitope. In addition, 27mer-concatemer 12F, while encoding a quadruplet comprising the G12D, G12V, G F and G12C mutations, has similar expression efficiency as 27mer-concatemer opt encoding a quadruplet comprising the G12D, G12V, G R and G12C mutations.
Example 7 immune Effect of 27mer-con, 25mer-con and Moderna-MUT in C57BL6n mice
7.1 Laboratory mice
Female, 6-week-old C57BL6n mice (Shanghai Ling Biotechnology Co., ltd.) were used in this example. C57BL6n mice were kept and cared for at the south-seafloor model biosciences limited. Animal studies were strictly performed according to the recommendations in Shanghai laboratory animal feeding administration and use guidelines.
7.2 Experimental procedures and results
This example uses LPP formulations of 25mer-con, 27mer-con and Moderna-MUT prepared as in example 2.2 to immunize C57BL6n mice, which were evaluated for the level of activation of specific CD8 + T cell immunity in the mice.
Mice were randomly assigned to 4 groups (n=2), 3 of which were immunized with 25mer-con, 27mer-con and Moderna 4-MUT formulations prepared as in example 2.2 (single dose 10 μg/mouse), respectively, and 1 group was administered with Phosphate Buffered Saline (PBS) as a negative control. Each group was administered by intramuscular injection 2 times a week for two consecutive weeks. Mice were euthanized 7 days after the last immunization and spleen cells were collected for activation-specific CD8 + T cell detection in the mice. The specific detection method comprises the following steps:
ELISA spot (ELISPot) assay
The mouse IFN-. Gamma.ELISpot assay was performed using the IFN-. Gamma. ELISpotPLUS kit (Mabtech, 3321-4 APT-10) according to the manufacturer's instructions. Briefly, plates were blocked in RPMI 1640 medium (supplemented with 10% fbs) and incubated for 30 min. Spleen cells were plated at 3×10 5 cells/well and stimulated in vitro with 10 μg/mL KRAS G12D 25mer polypeptide, SLP (gold synthesis), positive stimulation 500ng/mL pma+10 μg/mL Ionomycin (daceae 2030421), PC or RPMI 1640 medium alone (negative control), incubated at 37 ℃ for 20 hours with 5% co 2. After that, with biotinylated IFN-. Gamma. -detection antibody and streptavidin-alkaline phosphatase (ALP), BCIP/NBT-plus (5-bromo-4-chloro-3-indole-phosphate/nitro blue tetrazolium-plus) substrate was added for color development and counted with an ELISPOT reader (ImmunoSpot S6 Core Analyzer (CTL)).
The results of the experiment are shown in FIG. 4, where only the 27mer-con group was significantly colored by SLP in vitro stimulation. The 27mer-con immune effect is superior to Moderna-MUT and 25mer-con, and the specific CD8 + T immune can be effectively activated.
EXAMPLE 8 immunization effect of 27mer-con opt in BalB/C mice under different immunization programs
8.1 Laboratory mice
Female, 6 week old BalB/C mice (Shanghai Ling Biotech Co., ltd.) were used in this example. BalB/C mice were kept and cared for in Shanghai south mode biological center Co.Ltd. Animal studies were strictly performed according to the recommendations in Shanghai laboratory animal feeding administration and use guidelines.
8.2 Experimental procedures and results
This example uses 27mer, 27mer-con opt LPP formulations prepared as example 2.2 to immunize mice with different immunization programs to assess their level of activation of specific CD8 + T cell immunity in mice.
Mice were randomly divided into 5 groups (control group n=2, remaining groups n=5), with 4 groups being administered 27mer-con opt LPP formulation (single doses of 3, 10 and 30 μg/mouse, respectively) and 27mer LPP formulation (single dose of 20 μg/mouse), 1 time per week for 3 weeks; also, as a negative control group, 1 group was administered Phosphate Buffered Saline (PBS). Mice were euthanized 7 days after the last immunization and spleen cells were collected for activation-specific CD8 + T cell detection in the mice. The specific detection method is as described in example 7.2.
The experimental results are shown in fig. 5A and 5B, which have the most Spot Forming Cells (SFC) under SLP stimulation when 27mer-con opt LPP formulation was administered and a single dose of 30 μg/mouse, 1 time per week, for 3 consecutive weeks, compared to other immunization procedures. This shows that the 27mer-con opt LPP preparation can obtain optimal immune effect and activate specific CD8 + T cell immunity to the maximum extent.
Example 9 in vitro expression of mRNA of 27mer-concatemerQH, 27mer-concatemer IRES hIFN. Alpha.1 and 27mer-concatemer IRES hFlt3L
In this example, the in vitro expression of the polynucleotides 27mer-concatemer QH encoding KRAS mutant peptide quadruplets comprising the G12D, G12V, Q H and G12C mutations and the polynucleotides 27mer-concatemer IRES hIFN alpha 1 and 27mer-concatemer IRES hFlt L encoding the polypeptide and the second polypeptide cytokine were examined.
HEK 293 cells (human embryonic kidney epithelial cells) were cultured in Dulbecco's modified Eagle's medium (DMEM, GIBCO, 10566-016) supplemented with 10% FBS (Hyclone, 35-081-CV) and 1% penicillin-streptomycin (GIBCO, 15140-122) at 37℃under 5% CO 2.
Expression of mRNA of 27mer-concatemer opt, 27mer-concatemer QH, 27mer-concatemer IRES hIFN α1 and 27mer-concatemer IRES hFlt L prepared as in example 1.2 was detected in HEK293 cells. Briefly, corresponding mRNA stocks were transfected into HEK293 cells using transfection reagent Lipofectamine MessengerMax (Invitrogen), wherein 27mer-concatemer opt, 27mer-concatemer QH, 27mer-concatemer IRES hIFN. Alpha.1 and 27mer-concatemer IRES hFlt3L mRNA stocks containing 1.0. Mu.g and 2.5. Mu.g mRNA were taken, respectively, to transfect the cells. And a control (control) was set to which only an equal amount Lipofectamine MessengerMax of treated cells was added. The transfected cells were placed in a cell incubator and cultured for an additional 24h at 37℃with 5% CO 2. Cell extracts were collected and mRNA expression was detected by Western Blot (Western Blot) using RAS G12D specific antibodies (CST, # 14429) and RAS G12V specific antibodies (CST, # 14412).
The results are shown in FIGS. 6A and 6B, and the cells transfected with 27mer-concatemer opt, 27mer-concatemer QH, 27mer-concatemer IRES hIFN α1 and 27mer-concatemer IRES hFlt L mRNA stocks, as well as the cells transfected with the remaining mRNA stocks, all had the expression of the protein containing the KRAS G12D mutant epitope and the protein containing the KRAS G12V mutant epitope, indicating that each mRNA was correctly translated into a specific antigen protein containing the KRAS G12D mutant epitope and the KRAS G12V mutant epitope in the cells.
And, it was also observed that the mRNA expression of 27mer-concatemer QH was significantly higher in vitro than 27mer-concatemer opt, indicating that the mRNA expression efficiency of 27mer-concatemer QH was further improved compared to 27mer-concatemer opt. The above results demonstrate that when the polynucleotide encodes a 27mer quadruplex, the different design optimized sequences (27 mer-concatemers, 27mer-concatemer opt, 27mer-concatemer 12F, 27mer-concatemer QH) all have the same or better efficient expression.
Furthermore, the expression efficiency of both 27mer-concatemer IRES hIFN α1 and 27mer-concatemer IRES hFlt3L mRNA was slightly lower than that of 27mer-concatemer opt, which should be due to the effect of the introduced cytokine on expression, and the sequence lengths of 27mer-concatemer IRES hIFN α1 and 27mer-concatemer IRES hFlt L were about 3 times longer than that of 27mer-concatemer opt.
While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>

Claims (41)

1. A polypeptide comprising a concatemer of 2 or more mutant peptides, wherein the mutant peptides each independently comprise an amino acid sequence corresponding to at least 27 consecutive amino acids in a KRAS polypeptide, HRAS polypeptide or NRAS polypeptide.
2. The polypeptide of claim 1, wherein the HRAS polypeptide comprises the amino acid sequence of SEQ ID No. 86 and the mutant peptide comprises a HRAS mutation selected from G12V, Q61L, Q R and Q61H compared to SEQ ID No. 86.
3. The polypeptide of claim 1 or 2, wherein the NRAS polypeptide comprises the amino acid sequence of SEQ ID No. 87 and the mutant peptide comprises an NRAS mutation selected from the group consisting of G12D, G D, Q K and Q61R compared to SEQ ID No. 87.
4. The polypeptide of any one of claims 1-3, wherein the KRAS polypeptide comprises the amino acid sequence of SEQ ID No. 1 and the mutant peptide comprises a KRAS mutation selected from G12D, G12V, G S, G12R, G12C, G12A, G12F, G D and Q61H compared to SEQ ID No. 1.
5. The polypeptide of claim 4, wherein the mutant peptide comprises a first KRAS peptide, a second KRAS peptide, a third KRAS peptide, and a fourth KRAS peptide; wherein each KRAS peptide comprises at least 27 consecutive amino acids from the N-terminus of SEQ ID No. 1 and comprises a mutation selected from G12D, G12V, G12S, G12R, G12C, G12A, G F and G13D; or at least 27 consecutive amino acids from position 48 of SEQ ID NO. 1, and the KRAS peptide comprises a mutation of Q61H.
6. A polypeptide comprising a quadruplet of a first KRAS peptide, a second KRAS peptide, a third KRAS peptide and a fourth KRAS peptide, wherein each KRAS peptide comprises an amino acid sequence corresponding to at least 27 consecutive amino acids in SEQ ID No.1 and each comprises a mutation selected from G12D, G12V, G12S, G R, G12C, G12A, G12F, G D and Q61H compared to SEQ ID No. 1.
7. The polypeptide of claim 6, wherein each KRAS peptide comprises at least 27 consecutive amino acids from the N-terminus of SEQ ID No. 1 and comprises a mutation selected from the group consisting of G12D, G12V, G12S, G R, G12C, G12A, G F and G13D; or at least 27 consecutive amino acids from position 48 of SEQ ID NO. 1, and the KRAS peptide comprises a mutation of Q61H.
8. The polypeptide of claim 6 or 7, wherein each of the four KRAS peptides comprises a different mutation selected from G12D, G12V, G12S, G R, G12C, G12A, G12F, G D and Q61H.
9. The polypeptide of claim 8, wherein the four KRAS peptides each comprise
G12D, G12V, G R and G12C,
G12D, G12V, G F and G12C, or
G12D, G12V, Q H and G12C.
10. The polypeptide of any one of claims 6-9, wherein the four KRAS peptides are identical in length, preferably all 27 amino acids.
11. The polypeptide of claim 6, comprising the amino acid sequence of SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4.
12. The polypeptide of any one of claims 6-11, further comprising a signal peptide sequence at the N-terminus and further comprising a transmembrane-intracellular domain sequence of MHC-I at the C-terminus.
13. The polypeptide of claim 12, wherein the signal peptide sequence comprises the amino acid sequence of SEQ ID No. 15; and/or wherein the transmembrane-intracellular domain sequence of MHC-I comprises the amino acid sequence of SEQ ID No. 16.
14. The polypeptide of any one of claims 6-13, further comprising one or more linkers, preferably GS linkers.
15. The polypeptide of claim 14, wherein the linker comprises the amino acid sequence of SEQ ID No. 84 or SEQ ID No. 85.
16. The polypeptide of any one of claims 12-15, comprising the amino acid sequence of SEQ ID No. 17, SEQ ID No. 18 or SEQ ID No. 19.
17. A polynucleotide encoding the polypeptide of any one of claims 1-16.
18. The polynucleotide of claim 17 comprising the nucleotide sequence of one of SEQ ID NOs 23, 24, 25 and 26 or a nucleotide sequence having at least 80% identity to one of SEQ ID NOs 23, 24, 25 and 26.
19. The polynucleotide of claim 17 comprising the nucleotide sequence of one of SEQ ID NOs 32, 33, 34 and 35 or a nucleotide sequence having at least 80% identity to one of SEQ ID NOs 32, 33, 34 and 35.
20. A polynucleotide comprising a polynucleotide sequence encoding the polypeptide of any one of claims 1-16, and further comprising a nucleotide sequence encoding a second polypeptide.
21. The polynucleotide of claim 20, wherein the second polypeptide is a cytokine, preferably human interferon alpha 1 or a human FMS-related tyrosine kinase 3 ligand.
22. The polynucleotide of claim 21, wherein said second polypeptide comprises the amino acid sequence of SEQ ID No. 13 or SEQ ID No. 14.
23. The polynucleotide of any one of claims 20-22, further comprising an Internal Ribosome Entry Site (IRES) sequence;
Preferably, the Internal Ribosome Entry Site (IRES) sequence comprises an IRES sequence from:
Picornaviruses (e.g., FMDV), insect viruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (EMCV), foot and Mouth Disease Viruses (FMDV), hepatitis C Viruses (HCV), swine fever viruses (CSFV), murine Leukemia Viruses (MLV), simian Immunodeficiency Viruses (SIV), cricket paralysis viruses (CrPV), or coxsackie viruses B3 (CVB 3).
24. The polynucleotide of claim 23, wherein the Internal Ribosome Entry Site (IRES) sequence comprises the nucleotide sequence of SEQ id No. 88 or 90.
25. The polynucleotide of claim 20, comprising the nucleotide sequence of SEQ ID No. 36 or 37 or a nucleotide sequence having at least 80% identity to the nucleotide sequence of SEQ ID No. 36 or 37.
26. The polynucleotide of any one of claims 17-25, which is DNA or RNA, preferably mRNA.
27. The polynucleotide of claim 26, wherein
The RNA further comprises a 5' -UTR; preferably, the 5' -UTR comprises the nucleotide sequence of SEQ ID NO. 61; and/or
The RNA further comprises a 3' -UTR; preferably, the 3' -UTR comprises the nucleotide sequence of SEQ ID NO. 62.
28. The polynucleotide of claim 26 or 27, wherein the RNA further comprises a poly (a) sequence; preferably, the poly (a) sequence comprises 75 adenosine nucleotides.
29. The polynucleotide of claim 26 comprising the nucleotide sequence of one of SEQ ID NOs 42, 43, 44, 45, 51, 52, 53, 54, 55, 56, 63, 64, 65, 66, 72, 73, 74, 75, 76 and 77.
30. A composition comprising the polypeptide of any one of claims 1-16.
31. A composition comprising the polynucleotide of any one of claims 17-29.
32. The composition of claim 31, comprising a lipid encapsulating the polynucleotide.
33. The composition of claim 31 or 32, comprising a lipid nanoparticle or a lipid-multimeric complex.
34. The composition of claim 32 or 33, wherein the lipid encapsulating the polynucleotide comprises a cationic lipid, a non-cationic lipid, and a polyethylene glycol modified lipid; optionally, the composition further comprises a cationic polymer, wherein the cationic polymer associates with the polynucleotide as a complex, and is co-encapsulated in a lipid to form a lipopolysaccharide complex.
35. A vaccine formulation comprising the polypeptide of any one of claims 1-16 or the composition of claim 30.
36. A vaccine formulation comprising the polynucleotide of any one of claims 17-29, or the composition of any one of claims 31-34.
37. The vaccine formulation of claim 36, wherein the lipid encapsulating the polynucleotide comprises 10-70 mole% T5, 10-70 mole% 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 10-70 mole% cholesterol, and 0.05-20 mole% 1, 2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG) 2000; preferably, the lipids are T5, DOPE, cholesterol and (DMG-PEG) 2000 in a molar ratio of 40:15:43.5:1.5,
38. Use of the polypeptide of any one of claims 1-16, the polynucleotide of any one of claims 17-29, the composition of any one of claims 30-34, the vaccine formulation of any one of claims 35-37 in the manufacture of a medicament for preventing or treating cancer in a subject in need thereof.
39. A method of preventing or treating cancer in a subject in need thereof, the method comprising:
Administering to a subject in need thereof the polypeptide of any one of claims 1-16, the polynucleotide of any one of claims 17-29, the composition of any one of claims 30-34, the vaccine formulation of any one of claims 35-37.
40. The polypeptide of any one of claims 1-16, the polynucleotide of any one of claims 17-29, the composition of any one of claims 30-34, the vaccine formulation of any one of claims 35-37 for use in preventing or treating cancer in a subject in need thereof.
41. The use of claim 38, the method of claim 39, or the polypeptide, polynucleotide, composition or vaccine formulation of claim 40, wherein said cancer comprises a cancer associated with a KRAS mutation selected from pancreatic cancer, peritoneal cancer, colorectal cancer, small intestine cancer, biliary tract cancer, lung cancer, endometrial cancer, ovarian cancer, genital tract cancer, gastrointestinal cancer, cervical cancer, gastric cancer, urinary tract cancer, colon cancer, rectal cancer, hematopoietic and lymphoid tissue cancer.
CN202211322077.1A 2022-10-26 2022-10-26 Cancer mRNA vaccine Pending CN117965488A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202211322077.1A CN117965488A (en) 2022-10-26 2022-10-26 Cancer mRNA vaccine

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202211322077.1A CN117965488A (en) 2022-10-26 2022-10-26 Cancer mRNA vaccine

Publications (1)

Publication Number Publication Date
CN117965488A true CN117965488A (en) 2024-05-03

Family

ID=90854443

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202211322077.1A Pending CN117965488A (en) 2022-10-26 2022-10-26 Cancer mRNA vaccine

Country Status (1)

Country Link
CN (1) CN117965488A (en)

Similar Documents

Publication Publication Date Title
CN112384205B (en) Messenger RNA vaccine and use thereof
US20220236253A1 (en) Expanded t cell assay
RU2769316C2 (en) Polynucleotides coding interleukin-12 (il12), and applications thereof
CN113453707A (en) RNA for malaria vaccine
JP2024012523A (en) Novel artificial nucleic acid molecules
JP2023522246A (en) RNA constructs and uses thereof
KR20190110612A (en) Immunomodulatory Therapeutic MRNA Compositions Encoding Activating Oncogene Mutant Peptides
JP2022519557A (en) Method for preparing lipid nanoparticles
CN111328287A (en) Novel nucleic acid molecules
CN105517566A (en) Composition and vaccine for treating prostate cancer
US20230257738A1 (en) Modified messenger rna comprising functional rna elements
US20220257631A1 (en) Therapeutic rna for ovarian cancer
US20230114808A1 (en) Therapeutic rna for prostate cancer
EP3987027A1 (en) Endonuclease-resistant messenger rna and uses thereof
WO2017030956A1 (en) Method of inducing a t-cell response to phosphopeptides using nucleic acids encoding phosphopeptide mimetics
WO2023019309A1 (en) Vaccine compositions
CN117965488A (en) Cancer mRNA vaccine
RU2774677C2 (en) Rna for cancer therapy
WO2024075022A2 (en) Rna constructs and uses thereof
WO2023061930A1 (en) Therapeutic rna for lung cancer

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication