WO2019079718A1 - COMPOSITIONS AND METHODS FOR TREATING AGE-RELATED MACULAR DEGENERATION - Google Patents

COMPOSITIONS AND METHODS FOR TREATING AGE-RELATED MACULAR DEGENERATION Download PDF

Info

Publication number
WO2019079718A1
WO2019079718A1 PCT/US2018/056709 US2018056709W WO2019079718A1 WO 2019079718 A1 WO2019079718 A1 WO 2019079718A1 US 2018056709 W US2018056709 W US 2018056709W WO 2019079718 A1 WO2019079718 A1 WO 2019079718A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
promoter
cfh
aav
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/056709
Other languages
English (en)
French (fr)
Inventor
James Mclaughlin
Adarsha KOIRALA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Disc Medicine Inc
Original Assignee
Gemini Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gemini Therapeutics Inc filed Critical Gemini Therapeutics Inc
Priority to EP18869436.8A priority Critical patent/EP3697920A4/en
Priority to CN201880078342.1A priority patent/CN111788311A/zh
Priority to CA3079553A priority patent/CA3079553A1/en
Priority to US16/757,268 priority patent/US20210188927A1/en
Priority to JP2020542710A priority patent/JP2021500922A/ja
Priority to AU2018351491A priority patent/AU2018351491A1/en
Publication of WO2019079718A1 publication Critical patent/WO2019079718A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/472Complement proteins, e.g. anaphylatoxin, C3a, C5a
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14145Special targeting system for viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/22Vectors comprising a coding region that has been codon optimised for expression in a respective host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00Nucleic acids vectors
    • C12N2800/60Vectors containing traps for, e.g. exons, promoters
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/007Vectors comprising a special translation-regulating system cell or tissue specific

Definitions

  • Age-related macular degeneration is a medical condition and is the leading cause of legal blindness in Western societies. AMD typically affects older adults and results in a loss of central vision due to degenerative and neovascular changes to the macula, a pigmented region at the center of the retina which is responsible for visual acuity.
  • AMD typically affects older adults and results in a loss of central vision due to degenerative and neovascular changes to the macula, a pigmented region at the center of the retina which is responsible for visual acuity.
  • AMD is identified by the focal hyperpigmentation of the retinal pigment epithelium (RPE) and accumulation of drusen deposits. The size and number of drusen deposits typically correlates with AMD severity.
  • RPE retinal pigment epithelium
  • AMD occurs in up to 8% of individuals over the age of 60, and the prevalence of AMD continues to increase with age.
  • the U.S. is anticipated to have nearly 22 million cases of AMD by the year 2050, while global cases of AMD are expected to be nearly 288 million by the year 2040.
  • the disclosure provides for an adeno-associated viral (AAV) vector encoding a Complement Factor H (CFH) or human Factor H Like 1 (FHLl) protein or biologically active fragment thereof, wherein the vector comprises a nucleotide sequence that is at least 80% identical to the nucleotide sequence of SEQ ID NO: 1-3 or 5, or a fragment thereof. In some embodiments, the nucleotide sequence is at least 90% identical to the nucleotide sequence of SEQ ID NO: 1-3 or 5, or codon-optimized variant and/or a fragment thereof.
  • AAV adeno-associated viral
  • the nucleotide sequence is at least 95% identical to the nucleotide sequence of SEQ ID NO: 1-3 or 5, or codon-optimized variant and/or a fragment thereof. In some embodiments, the nucleotide sequence is the sequence of SEQ ID NO: 1-3 or 5, or codon-optimized variant and/or a fragment thereof. In some embodiments, the vector encodes a CFH protein or biologically active fragment thereof comprising at least four CCP domains. In some embodiments, the vector encodes a CFH protein or biologically active fragment thereof comprising at least five CCP domains. In some embodiments, the vector encodes a CFH protein or biologically active fragment thereof comprising at least six CCP domains.
  • the vector encodes a CFH protein or biologically active fragment thereof comprising at least seven CCP domains. In some embodiments, the vector encodes a CFH protein or biologically active fragment thereof comprising at least three CCP domains. In some embodiments, the vector encodes a CFH protein or biologically active fragment thereof comprising the H402 polymorphism. In some embodiments, the vector encodes a CFH protein or biologically active fragment thereof comprising the V62 polymorphism. In some embodiments, the CFH protein or biologically active fragment thereof comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the amino acid sequence of SEQ ID NO: 4 is the C-terminal sequence of the CFH protein.
  • the CFH protein or biologically active fragment thereof is capable of diffusing across the Bruch's membrane. In some embodiments, the CFH protein or biologically active fragment thereof is capable of binding C3b. In some embodiments, the CFH protein or biologically active fragment thereof is capable of facilitating the breakdown of C3b.
  • the vector comprises a promoter that is less than 1000 nucleotides in length. In some embodiments, the vector comprises a promoter that is less than 500 nucleotides in length. In some embodiments, the vector comprises a promoter that is less than 400 nucleotides in length. In some embodiments, the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 6, or a fragment thereof.
  • the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 8, or a fragment thereof. In some embodiments, the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 12, or a fragment thereof. In some embodiments, the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 14, or a fragment thereof. In some embodiments, the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 16, or a fragment thereof. In some embodiments, the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 18, or a fragment thereof.
  • the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 20, or a fragment thereof. In some embodiments, the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 31, or a fragment thereof. In some embodiments, the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 32, or a fragment thereof. In some embodiments, the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 6, or a biologically active fragment thereof.
  • the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 8, or a biologically active fragment thereof. In some embodiments, the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 12, or a biologically active fragment thereof.
  • the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 14, or a biologically active fragment thereof. In some embodiments, the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 16, or a biologically active fragment thereof.
  • the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 18, or a biologically active fragment thereof. In some embodiments, the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 20, or a biologically active fragment thereof.
  • the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 31, or a biologically active fragment thereof. In some embodiments, the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 32, or a biologically active fragment thereof.
  • the promoter comprises a promoter having a nucleotide sequence that is at least 65%, 70%, 75%, 80%, 85%, 90%, 92%, 93%, 95%, 98%, or 99% identical to the nucleotide sequence of SEQ ID NO: 32, or a biologically active fragment thereof.
  • the promoter comprises an additional viral intron.
  • the additional viral intron comprises the nucleotide sequence of SEQ ID NO: 10, or a fragment thereof.
  • the vector is an AAV2 vector.
  • the vector comprises a CMV promoter.
  • the vector comprises a Kozak sequence.
  • the vector comprises one or more ITR sequence flanking the vector portion encoding CFH.
  • the vector comprises a
  • the vector comprises a selective marker.
  • the selective marker is an antibiotic -resistance gene.
  • the antibiotic-resistance gene is an ampicillin-resistance gene.
  • the disclosure provides a composition comprising any of the vectors disclosed herein and a pharmaceutically acceptable carrier.
  • the disclosure provides for a method of treating a subject having a disorder associated with undesired activity of the alternative complement pathway, comprising the step of administering to the subject any of the vectors disclosed herein or any of the compositions disclosed herein.
  • the disclosure the provides for amethod of treating a subject having age-related macular degeneration (AMD), comprising the step of administering to the subject any of the vectors disclosed herein or any of the compositions disclosed herein.
  • the the vector or composition is administered intravitreally.
  • the subject is not administered a protease or a polynucleotide encoding a protease.
  • the subject is not administered a furin protease or a polynucleotide encoding a furin protease.
  • the subject is a human.
  • the human is at least 40 years of age.
  • the human is at least 50 years of age.
  • the human is at least 65 years of age.
  • the vector or composition is administered locally. In some
  • the vector or composition is administered systemically.
  • the vector or composition comprises a promoter that is associated with strong expression in the liver.
  • the promoter comprises a nucleotide sequence that is at least 90%, 95% or 100% identical to the nucleotide sequence of any one of SEQ ID NOs: 16, 18, or 20.
  • the vector or composition comprises a promoter that is associated with strong expression in the eye.
  • the promoter comprises a nucleotide sequence that is at least 90%, 95%, or 100% identical to the nucleotide sequence of any one of SEQ ID NOs: 6 or 32.
  • the subject has a loss-of-function mutation in the subject's CFI gene.
  • the subject has one or more CFI mutations selected from the group consisting of: Gl 19R, L131R, V152M, G162D, R187Y, R187T, T203I, A240G, A258T, G287R, A300T, R317W, R339Q, V412M, and P553S.
  • the subject has a loss-of-function mutation in the subject's CFH gene.
  • the subject has one or more CFH mutations selected from the group consisting of: R2T, L3V, R53C, R53H, S58A, G69E, D90G, R175Q, S 193L, I216T, I221V, R303W, H402Y, Q408X, P503A, G650V, R1078S, and R1210C.
  • the subject has atypical hemolytic uremic syndrome (aHUS).
  • the subject is suffering from a renal disease or complication.
  • any of the vectors disclosed herein or any of the compositions disclosed herein is capable of inducing at least 20%, 50%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 700%, 900%, 1000%, 1100%, 1500%, or 2000% higher expression of CFH or FHL in a target cell (e.g., an RPE or liver cell) as compared to the endogenous expression of CFH or FHL in the target cell.
  • a target cell e.g., an RPE or liver cell
  • compositions disclosed herein results in at least 20%, 50%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 700%, 900%, 1000%, 1 100%, 1500%, or 2000% higher levels of CFH or FHL activity in the target cell as compared to endogenous levels of CFH or FHL activity in the target cell.
  • any of the vectors disclosed herein or any of the compositions disclosed herein induces CFH expression in a target cell of the eye.
  • any of the vectors or compositions disclosed herein induces CFH expression in a target cell of the retina or macula.
  • target cell of the retina is selected from the group of layers consisting of: inner limiting membrane, nerve fiber, ganglion cell layer (GCL), inner plexiform layer, inner nuclear layer, outer plexiform layer, outer nuclear layer, external limiting membrane, rods and cones, and retinal pigment epithelium (RPE).
  • the target cell is in the choroid plexus.
  • the target cell is in the macula.
  • any of the vectors or compositions disclosed herein induces CFH expression in a cell of the GCL and/or RPE.
  • the vector or composition is administered to the retina at a dose in the range of 1 x 10 10 vg/eye to 1 x 10 13 vg/eye. In some embodiments, the vector or composition is administered to the retina at a dose of about 1.4 x 10 12 vg/eye.
  • the promoter comprises a promoter having the nucleotide sequence of SEQ ID NO: 36, or a fragment thereof.
  • Figure 1 shows a vector map of a full vector genome construct for expression of CFH.
  • ITR corresponds to inverted terminal repeats
  • CRALBP promoter corresponds to the cellular retinaldehyde-binding protein promoter
  • CFH corresponds to the gene encoding Complement Factor H
  • polyA corresponds to the polyadenylation sequence
  • Amp R corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 1 is SEQ ID NO: 7.
  • Figure 2 shows a vector map of a full vector genome construct for expression of CFH.
  • ITR inverted terminal repeats
  • EFla promoter corresponds to the elongation factor- 1 alpha promoter
  • CCH corresponds to the gene encoding Complement Factor H
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 2 is SEQ ID NO: 9.
  • Figure 3 shows a vector map of a full vector genome construct for expression of CFH.
  • ITR corresponds to inverted terminal repeats
  • EFla.SV40i corresponds to the elongation factor- 1 alpha promoter including the simian virus 40 intron
  • CFH corresponds to the gene encoding Complement Factor H
  • polyA corresponds to the polyadenylation sequence
  • AmicillinR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 3 is SEQ ID NO: 11.
  • Figure 4 shows a vector map of a full vector genome construct for expression of CFH.
  • ITR corresponds to inverted terminal repeats
  • HSP70 promoter corresponds to the heat shock protein 70 promoter
  • CFH corresponds to the gene encoding Complement Factor H;
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 4 is SEQ ID NO: 13.
  • Figure 5 shows a vector map of a full vector genome construct for expression of CFH.
  • ITR corresponds to inverted terminal repeats
  • sCBA promoter corresponds to the chicken ⁇ actin promoter
  • CFH corresponds to the gene encoding Complement Factor H
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • This vector also included the SV40i intron.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 5 is SEQ ID NO: 15.
  • Figure 6 shows a vector map of a full vector genome construct for expression of CFH.
  • ITR corresponds to inverted terminal repeats
  • AAT1 corresponds to the alpha-1 antitrypsin 1 promoter
  • CFH corresponds to the gene encoding Complement Factor H
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 6 is SEQ ID NO: 17.
  • Figure 7 shows a vector map of a full vector genome construct for expression of CFH.
  • ITR corresponds to inverted terminal repeats
  • ALB corresponds to a synthetic promoter based on the human albumin promoter
  • CFH corresponds to the gene encoding Complement Factor H
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 7 is SEQ ID NO: 19.
  • Figure 8 shows a vector map of a full vector genome construct for expression of CFH.
  • ITR corresponds to inverted terminal repeats
  • PCK1 corresponds to the phosphoenolpyruvate carboxykinase 1 promoter
  • CFH corresponds to the gene encoding Complement Factor H
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 8 is SEQ ID NO: 21.
  • Figure 9 shows a vector map of a full vector genome construct for expression of FHL- 1.
  • ITR inverted terminal repeats
  • EFla corresponds to the elongation factor- 1 alpha promoter
  • FHL-1 corresponds to the gene encoding Factor-H-Like Protein 1
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 9 is SEQ ID NO: 22.
  • Figure 10 shows a vector map of a full vector genome construct for expression of FHL-1.
  • ITR corresponds to inverted terminal repeats
  • ALB corresponds to a synthetic promoter based on the human albumin promoter
  • FHL-1 corresponds to the gene encoding Factor-H- Like Protein 1
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 10 is SEQ ID NO: 23.
  • Figure 11 shows a vector map of a full vector genome construct for expression of FHL-1.
  • ITR inverted terminal repeats
  • AAT1 corresponds to the alpha-1 antitrypsin 1 promoter
  • FHL-1 corresponds to the gene encoding Factor-H-Like Protein 1
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 11 is SEQ ID NO: 24.
  • Figure 12 shows a vector map of a full vector genome construct for expression of FHL-1.
  • ITR corresponds to inverted terminal repeats
  • EFla.SV40i corresponds to the elongation factor- 1 alpha promoter including the simian virus 40 intron
  • FHL-1 corresponds to the gene encoding Factor-H-Like Protein 1
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 12 is SEQ ID NO: 25.
  • Figure 13 shows a vector map of a full vector genome construct for expression of FHL- 1.
  • ITR inverted terminal repeats
  • CAG corresponds to a synthetic promoter that includes the cytomegalovirus (CMV) early enhancer element, the promoter/first exon/first intron of chicken beta-actin gene, and the splice acceptor of the rabbit beta-globin gene
  • FHL-1 corresponds to the gene encoding Factor-H-Like Protein 1
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 13 is SEQ ID NO: 26.
  • Figure 14 shows a vector map of a full vector genome construct for expression of FHL-1.
  • ITR corresponds to inverted terminal repeats
  • CRALBP corresponds to the cellular retinaldehy de-binding protein promoter
  • FHL-1 corresponds to the gene encoding Factor- H-Like Protein 1
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • the nucleotide sequence corresponding to the vector illustrated in Figure 14 is SEQ ID NO: 27.
  • Figure 15 shows a vector map of a full vector genome construct for expression of FHL-1.
  • ITR corresponds to inverted terminal repeats
  • hRPE65 corresponds to the retinal pigment epithelial 65 promoter
  • FHL-1 corresponds to the gene encoding Factor-H-Like Protein 1
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • Figure 16 shows a vector map of a full vector genome construct for expression of FHL-1.
  • ITR corresponds to inverted terminal repeats
  • HSP70 corresponds to the heat shock protein 70 promoter
  • FHL-1 corresponds to the gene encoding Factor-H-Like Protein 1
  • polyA corresponds to the polyadenylation sequence
  • AmpR corresponds to the ampicillin resistance cassette.
  • 16 is SEQ ID NO: 29.
  • Figure 17 shows a vector map of a full vector genome construct for expression of FHL-1.
  • ITR corresponds to inverted terminal repeats;
  • PCK1 corresponds to the
  • nucleotide sequence corresponding to the vector illustrated in Figure 17 is SEQ ID NO: 30.
  • Figure 18 shows a Western Blot from an experiment in which the levels of CFH (or the loading control GAPDH) were detected in HEK cells transfected with various CFH or control plasmids.
  • Figure 19 shows a bar graph comparing the levels of CFH protein levels from the Western analysis of Figure 18 relative to GAPDH protein levels.
  • Figure 20 shows a Western Blot from an experiment in which the levels of CFH or GFP (or the loading control GAPDH) were detected in HEK cells transfected with various CFH or control AAV vectors.
  • the disclosure provides compositions and methods for treating, preventing, or inhibiting diseases of the eye.
  • the disclosure provides recombinant adeno-associated virus (rAAV) vectors comprising a complement system gene (such as, but not limited to genes encoding complement factor H (CFH) or factor-H-like protein 1 (FHL1)).
  • rAAV adeno-associated virus
  • the disclosure provides methods of treating, preventing, or inhibiting diseases of the eye by intraocularly (e.g. , intravitreally) administering an effective amount of an rAAV vector of the disclosure to deliver and drive the expression of a complement factor gene.
  • a wide variety of diseases of the eye may be treated or prevented using the viral vectors and methods provided herein.
  • Diseases of the eye that may be treated or prevented using the vectors and methods of the disclosure include but are not limited to, glaucoma, macular degeneration (e.g., age-related macular degeneration), diabetic retinopathies, inherited retinal degeneration such as retinitis pigmentosa, retinal detachment or injury and retinopathies (such as retinopathies that are inherited, induced by surgery, trauma, an underlying aetiology such as severe anemia, SLE, hypertension, blood dyscrasias, systemic infections, or underlying carotid disease, a toxic compound or agent, or photically).
  • macular degeneration e.g., age-related macular degeneration
  • diabetic retinopathies e.g., diabetic retinopathies
  • inherited retinal degeneration such as retinitis pigmentosa
  • retinal detachment or injury retinopathies
  • retinopathies such as retinopathies
  • the present disclosure encompasses not only the entire group listed as a whole, but each member of the group individually and all possible subgroups of the main group, but also the main group absent one or more of the group members.
  • the present disclosure also envisages the explicit exclusion of one or more of any of the group members in the embodimented disclosure.
  • Exemplary methods and materials are described herein, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. The materials, methods, and examples are illustrative only and not intended to be limiting.
  • nucleotide refers to chains of nucleotides of any length, and include DNA and RNA.
  • the nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a chain by DNA or RNA polymerase.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs.
  • modification to the nucleotide structure may be imparted before or after assembly of the chain.
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • a polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.
  • modifications include, for example, "caps", substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoamidates, carbamates, etc.) and with charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), those containing pendant moieties, such as, for example, proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as un
  • any of the hydroxyl groups ordinarily present in the sugars may be replaced, for example, by phosphonate groups, phosphate groups, protected by standard protecting groups, or activated to prepare additional linkages to additional nucleotides, or may be conjugated to solid supports.
  • the 5 ' and 3 ' terminal OH can be phosphorylated or substituted with amines or organic capping group moieties of from 1 to 20 carbon atoms.
  • Other hydroxyls may also be derivatized to standard protecting groups.
  • Polynucleotides can also contain analogous forms of ribose or deoxyribose sugars that are generally known in the art, including, for example, 2'-0-methyl-, 2'-0-allyl, 2'-fluoro- or 2'- azido-ribose, carbocyclic sugar analogs, alpha- or beta-anomeric sugars, epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, sedoheptuloses, acyclic analogs and abasic nucleoside analogs such as methyl riboside.
  • One or more phosphodiester linkages may be replaced by alternative linking groups. These alternative linking groups include, but are not limited to, embodiments wherein phosphate is replaced by
  • each R or R' is independently H or substituted or unsubstituted alkyl (1-20 C) optionally containing an ether (-0-) linkage, aryl, alkenyl, cycloalkyl, cycloalkenyl or araldyl. Not all linkages in a polynucleotide need be identical. The preceding description applies to all polynucleotides referred to herein, including RNA and DNA.
  • polypeptide oligopeptide
  • peptide protein
  • the terms “polypeptide”, “oligopeptide”, “peptide” and “protein” are used interchangeably herein to refer to chains of amino acids of any length.
  • the chain may be linear or branched, it may comprise modified amino acids, and/or may be interrupted by non-amino acids.
  • the terms also encompass an amino acid chain that has been modified naturally or by
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids, etc.
  • the polypeptides can occur as single chains or associated chains.
  • homologous when modified with an adverb such as “highly,” may refer to sequence similarity and may or may not relate to a common evolutionary origin.
  • sequence similarity in all its grammatical forms, refers to the degree of identity or correspondence between nucleic acid or amino acid sequences that may or may not share a common evolutionary origin.
  • Percent (%) sequence identity or “percent (%) identical to” with respect to a reference polypeptide (or nucleotide) sequence is defined as the percentage of amino acid residues (or nucleic acids) in a candidate sequence that are identical with the amino acid residues (or nucleic acids) in the reference polypeptide (nucleotide) sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • a "host cell” includes an individual cell or cell culture that can be or has been a recipient for vector(s) for incorporation of polynucleotide inserts.
  • the term host cell may refer to the packaging cell line in which the rAAV is produced from the plasmid.
  • the term "host cell” may refer to the target cell in which expression of the transgene is desired.
  • a "vector” refers to a recombinant plasmid or virus that comprises a nucleic acid to be delivered into a host cell, either in vitro or in vivo.
  • a "recombinant viral vector” refers to a recombinant polynucleotide vector comprising one or more heterologous sequences (i.e. a nucleic acid sequence not of viral origin).
  • the recombinant nucleic acid is flanked by at least one inverted terminal repeat sequence (ITR).
  • ITR inverted terminal repeat sequence
  • the recombinant nucleic acid is flanked by two ITRs.
  • a “recombinant AAV vector (rAAV vector)” refers to a polynucleotide vector based on an adeno-associated virus comprising one or more heterologous sequences (i.e., nucleic acid sequence not of AAV origin) that are flanked by at least one AAV inverted terminal repeat sequence (ITR).
  • rAAV vectors can be replicated and packaged into infectious viral particles when present in a host cell that has been infected with a suitable helper virus (or that is expressing suitable helper functions) and that is expressing AAV rep and cap gene products (i.e. AAV Rep and Cap proteins).
  • a rAAV vector When a rAAV vector is incorporated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid used for cloning or transfection), then the rAAV vector may be referred to as a "pro-vector" which can be
  • An rAAV vector can be in any of a number of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated within liposomes, and encapsidated in a viral particle, e.g., an AAV particle.
  • An rAAV vector can be packaged into an AAV virus capsid to generate a "recombinant adeno-associated viral particle (rAAV particle)".
  • An "rAAV virus” or “rAAV viral particle” refers to a viral particle composed of at least one AAV capsid protein and an encapsidated rAAV vector genome.
  • transgene refers to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and optionally, translated and/or expressed under appropriate conditions. In aspects, it confers a desired property to a cell into which it was introduced, or otherwise leads to a desired therapeutic or diagnostic outcome. In another aspect, it may be transcribed into a molecule that mediates RNA interference, such as miRNA, siRNA, or shRNA.
  • vector genome may refer to one or more polynucleotides comprising a set of the polynucleotide sequences of a vector, e.g., a viral vector.
  • a vector genome may be encapsidated in a viral particle.
  • a vector genome may comprise single-stranded DNA, double- stranded DNA, or single- stranded RNA, or double- stranded RNA.
  • a vector genome may include endogenous sequences associated with a particular viral vector and/or any heterologous sequences inserted into a particular viral vector through recombinant techniques.
  • a recombinant AAV vector genome may include at least one ITR sequence flanking a promoter, a stuffer, a sequence of interest (e.g., an RNAi), and a polyadenylation sequence.
  • a complete vector genome may include a complete set of the polynucleotide sequences of a vector.
  • the nucleic acid titer of a viral vector may be measured in terms of vg/mL. Methods suitable for measuring this titer are known in the art (e.g., quantitative PCR).
  • ITR inverted terminal repeat
  • AAV inverted terminal repeat (ITR) sequence is an approximately 145 -nucleotide sequence that is present at both termini of the native single- stranded AAV genome.
  • the outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, leading to heterogeneity between different AAV genomes and between the two ends of a single AAV genome.
  • helper virus for AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by a host cell. A number of such helper viruses are known in the art.
  • expression control sequence means a nucleic acid sequence that directs transcription of a nucleic acid.
  • An expression control sequence can be a promoter, such as a constitutive promoter, or an enhancer.
  • the expression control sequence is operably linked to the nucleic acid sequence to be transcribed.
  • isolated molecule is a molecule that by virtue of its origin or source of derivation (1) is not associated with one or more naturally associated components that accompany it in its native state, (2) is substantially free of one or more other molecules from the same species (3) is expressed by a cell from a different species, or (4) does not occur in nature.
  • purify refers to the removal, whether completely or partially, of at least one impurity from a mixture containing the polypeptide and one or more impurities, which thereby improves the level of purity of the polypeptide in the composition (i.e., by decreasing the amount (ppm) of impurity(ies) in the composition).
  • substantially pure refers to material which is at least 50% pure (i.e., free from contaminants), more preferably, at least 90% pure, more preferably, at least 95% pure, yet more preferably, at least 98% pure, and most preferably, at least 99% pure.
  • patient refers to either a human or a non-human animal.
  • mammals such as humans, non- human primates, laboratory animals, livestock animals (including bovines, porcines, camels, etc.), companion animals (e.g., canines, felines, other domesticated animals, etc.) and rodents (e.g., mice and rats).
  • the subject is a human that is at least 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95 years of age.
  • the subject has, or is at risk of developing a disease of the eye.
  • a disease of the eye includes, without limitation, retinitis pigmentosa, rod-cone dystrophy, Leber's congenital amaurosis, Usher's syndrome, Bardet-Biedl Syndrome, Best disease, retinoschisis, Stargardt disease (autosomal dominant or autosomal recessive), untreated retinal detachment, pattern dystrophy, cone-rod dystrophy, achromatopsia, ocular albinism, enhanced S cone syndrome, diabetic retinopathy, age-related macular degeneration, retinopathy of prematurity, sickle cell retinopathy, Congenital Stationary Night Blindness, glaucoma, or retinal vein occlusion.
  • the subject has, or is at risk of developing glaucoma, Leber's hereditary optic neuropathy, lysosomal storage disorder, or peroxisomal disorder.
  • the subject is in need of optogenetic therapy.
  • the subject has shown clinical signs of a disease of the eye.
  • the subject has, or is at risk of developing a renal disease or complication.
  • the renal disease or complication is associated with AMD or aHUS.
  • the subject has, or is at risk of developing AMD or aHUS.
  • Clinical signs of a disease of the eye include, but are not limited to, decreased peripheral vision, decreased central (reading) vision, decreased night vision, loss of color perception, reduction in visual acuity, decreased photoreceptor function, and pigmentary changes.
  • the subject shows degeneration of the outer nuclear layer (ONL).
  • the subject has been diagnosed with a disease of the eye.
  • the subject has not yet shown clinical signs of a disease of the eye.
  • the terms “prevent”, “preventing” and “prevention” refer to the prevention of the recurrence or onset of, or a reduction in one or more symptoms of a disease or condition (e.g., a disease of the eye) in a subject as result of the administration of a therapy (e.g., a prophylactic or therapeutic agent).
  • a therapy e.g., a prophylactic or therapeutic agent
  • prevent refers to the inhibition or a reduction in the development or onset of a disease or condition (e.g., a disease of the eye), or the prevention of the recurrence, onset, or development of one or more symptoms of a disease or condition (e.g., a disease of the eye), in a subject resulting from the administration of a therapy (e.g., a prophylactic or therapeutic agent), or the administration of a combination of therapies (e.g., a combination of prophylactic or therapeutic agents).
  • a therapy e.g., a prophylactic or therapeutic agent
  • a combination of therapies e.g., a combination of prophylactic or therapeutic agents
  • Treating" a condition or patient refers to taking steps to obtain beneficial or desired results, including clinical results.
  • treatment refers to the reduction or amelioration of the progression, severity, and/or duration of an infection (e.g., a disease of the eye or symptoms associated therewith), or the amelioration of one or more symptoms resulting from the administration of one or more therapies (including, but not limited to, the administration of one or more prophylactic or therapeutic agents).
  • administering or "administration of a substance, a compound or an agent to a subject can be carried out using one of a variety of methods known to those skilled in the art.
  • a compound or an agent can be administered intravitreally or subretinally.
  • the compound or agent is administered intravitreally.
  • administration may be local.
  • administration may be systemic.
  • Administering can also be performed, for example, once, a plurality of times, and/or over one or more extended periods.
  • the administration includes both direct administration, including self-administration, and indirect administration, including the act of prescribing a drug.
  • ocular cells refers to any cell in, or associated with the function of, the eye.
  • the term may refer to any one or more of photoreceptor cells, including rod, cone and photosensitive ganglion cells, retinal pigment epithelium (RPE) cells, glial cells, Muller cells, bipolar cells, horizontal cells, amacrine cells.
  • RPE retinal pigment epithelium
  • the ocular cells are bipolar cells.
  • the ocular cells are horizontal cells.
  • the ocular cells are ganglion cells.
  • the cells are RPE cells.
  • rAAV vectors comprising a complement system gene (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5), a splice variant (e.g. FHL1), or a fragment thereof, under the control of a suitable promoter to direct the expression of the complement system gene, splice variant, or fragment thereof in the eye.
  • the disclosure further provides a therapeutic composition comprising an rAAV vector comprising a complement system gene, a splice variant, or a fragment thereof (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5) under the control of a suitable promoter.
  • rAAV vectors may be used to deliver the desired complement system gene to the eye and to direct its expression. More than 30 naturally occurring serotypes of AAV from humans and non- human primates are known. Many natural variants of the AAV capsid exist, and an rAAV vector of the disclosure may be designed based on an AAV with properties specifically suited for ocular cells.
  • the complement system gene is a splice variant (e.g. FHL1, which is a truncated splice variant of CFH).
  • an rAAV vector is comprised of, in order, a 5' adeno-associated virus inverted terminal repeat, a transgene or gene of interest encoding a complement system polypeptide (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5) or a biologically active fragment thereof operably linked to a sequence which regulates its expression in a target cell, and a 3' adeno-associated virus inverted terminal repeat.
  • the rAAV vector may preferably have a polyadenylation sequence.
  • rAAV vectors should have one copy of the AAV ITR at each end of the transgene or gene of interest, in order to allow replication, packaging, and efficient integration into cell chromosomes.
  • the transgene sequence encoding a complement system polypeptide e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5
  • a biologically active fragment thereof will be of about 2 to 5 kb in length (or alternatively, the transgene may additionally contain a "stuffer” or "filler" sequence to bring the total size of the nucleic acid sequence between the two ITRs to between 2 and 5 kb).
  • the transgene encoding a complement system polypeptide (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5) or a biologically active fragment thereof may be composed of the same heterologous sequence several times (e.g., two nucleic acid molecules of a complement system gene separated by a ribosomal readthrough stop codon, or alternatively, by an Internal Ribosome Entry Site or "IRES"), or several different heterologous sequences (e.g., different complement system members such as FHL1, separated by a ribosomal readthrough stop codon or an IRES).
  • CFH complement system polypeptide
  • FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5 a biologically active fragment thereof
  • a biologically active fragment thereof may be composed of the same heterologous sequence several times (e.g., two nucleic acid molecules of a complement system gene separated by a ribosomal readthrough stop codon, or alternatively, by an
  • Recombinant AAV vectors of the present disclosure may be generated from a variety of adeno-associated viruses.
  • ITRs from any AAV serotype are expected to have similar structures and functions with regard to replication, integration, excision and transcriptional mechanisms.
  • AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12.
  • the rAAV vector is generated from serotype AAV1, AAV2, AAV4, AAV5, or AAV8. These serotypes are known to target photoreceptor cells or the retinal pigment epithelium.
  • the rAAV vector is generated from serotype AAV2.
  • the AAV serotypes include AAVrh8, AAVrh8R or AAVrhlO. It will also be understood that the rAAV vectors may be chimeras of two or more serotypes selected from serotypes AAV l through AAV12. The tropism of the vector may be altered by packaging the recombinant genome of one serotype into capsids derived from another AAV serotype.
  • the ITRs of the rAAV virus may be based on the ITRs of any one of AAV 1-12 and may be combined with an AAV capsid selected from any one of AAV1-12, AAV-DJ, AAV-DJ8, AAV-DJ9 or other modified serotypes. In certain embodiments, any AAV capsid serotype may be used with the vectors of the disclosure.
  • AAV serotypes include AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1, AAV 12, AAV-DJ, AAV-DJ8, AAV-DJ9, AAVrh8, AAVrh8R or AAVrhlO.
  • the AAV capsid serotype is AAV2.
  • Desirable AAV fragments for assembly into vectors may include the cap proteins, including the vp l , vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells. Such fragments maybe used, alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences.
  • artificial AAV serotypes include, without limitation, AAV with a non-naturally occurring capsid protein.
  • Such an artificial capsid may be generated by any suitable technique using a selected AAV sequence (e.g., a fragment of a vpl capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source.
  • An artificial AAV serotype may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a "humanized" AAV capsid.
  • the AAV is AAV2/5.
  • the AAV is AAV2/8.
  • the sequences encoding each of the essential rep proteins may be supplied by different AAV sources (e.g., AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8).
  • the rep78/68 sequences may be from AAV2
  • the rep52/40 sequences may be from AAV8.
  • the vectors of the disclosure contain, at a minimum, sequences encoding a selected AAV serotype capsid, e.g., an AAV2 capsid or a fragment thereof. In another embodiment, the vectors of the disclosure contain, at a minimum, sequences encoding a selected AAV serotype rep protein, e.g., AAV2 rep protein, or a fragment thereof.
  • such vectors may contain both AAV cap and rep proteins.
  • the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., all AAV2 origin.
  • the vectors may comprise rep sequences from an AAV serotype which differs from that which is providing the cap sequences.
  • the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In some embodiments, these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as AAV2/8 described in US Patent No.
  • AAV serotypes include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV 12, AAV-DJ, AAV-DJ8, AAV-DJ9, AAVrh8, AAVrh8R or AAVrhlO.
  • the cap is derived from AAV2.
  • any of the vectors disclosed herein includes a spacer, i.e., a DNA sequence interposed between the promoter and the rep gene ATG start site.
  • the spacer may be a random sequence of nucleotides, or alternatively, it may encode a gene product, such as a marker gene.
  • the spacer may contain genes which typically incorporate start/stop and polyA sites.
  • the spacer may be a non-coding DNA sequence from a prokaryote or eukaryote, a repetitive non- coding sequence, a coding sequence without transcriptional controls or a coding sequence with transcriptional controls.
  • the spacer is a phage ladder sequences or a yeast ladder sequence. In some embodiments, the spacer is of a size sufficient to reduce expression of the rep78 and rep68 gene products, leaving the rep52, rep40 and cap gene products expressed at normal levels. In some embodiments, the length of the spacer may therefore range from about 10 bp to about 10.0 kbp, preferably in the range of about 100 bp to about 8.0 kbp. In some embodiments, the spacer is less than 2 kbp in length.
  • the capsid is modified to improve therapy.
  • the capsid may be modified using conventional molecular biology techniques.
  • the capsid is modified for minimized immunogenicity, better stability and particle lifetime, efficient degradation, and/or accurate delivery of the transgene encoding the complement system polypeptide (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5) or biologically active fragment thereof to the nucleus.
  • the modification or mutation is an amino acid deletion, insertion, substitution, or any combination thereof in a capsid protein.
  • a modified polypeptide may comprise 1, 2, 3, 4, 5, up to 10, or more amino acid substitutions and/or deletions and/or insertions.
  • a “deletion” may comprise the deletion of individual amino acids, deletion of small groups of amino acids such as 2, 3, 4 or 5 amino acids, or deletion of larger amino acid regions, such as the deletion of specific amino acid domains or other features.
  • An “insertion” may comprise the insertion of individual amino acids, insertion of small groups of amino acids such as 2, 3, 4 or 5 amino acids, or insertion of larger amino acid regions, such as the insertion of specific amino acid domains or other features.
  • substitution comprises replacing a wild type amino acid with another (e.g., a non-wild type amino acid).
  • the another (e.g., non-wild type) or inserted amino acid is Ala (A), His (H), Lys (K), Phe (F), Met (M), Thr (T), Gin (Q), Asp (D), or Glu (E).
  • the another (e.g., non-wild type) or inserted amino acid is A.
  • the another (e.g., non-wild type) amino acid is Arg (R), Asn (N), Cys (C), Gly (G), lie (I), Leu (L), Pro (P), Ser (S), Trp (W), Tyr (Y), or Val (V).
  • non-polar Norleucine, Met, Ala, Val, Leu, He
  • polar without charge Cys, Ser, Thr, Asn, Gin
  • acidic negatively charged
  • Asp, Glu acidic
  • basic positively charged
  • Lys, Arg residues that influence chain orientation
  • Gly, Pro residues that influence chain orientation
  • aromatic Trp, Tyr, Phe, His
  • Conventional amino acids include L or D stereochemistry.
  • the another (e.g., non-wild type) amino acid is a member of a different group (e.g., an aromatic amino acid is substituted for a non-polar amino acid).
  • Substantial modifications in the biological properties of the polypeptide are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a ⁇ -sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
  • Naturally occurring residues are divided into groups based on common side-chain properties: (1) Non-polar: Norleucine, Met, Ala, Val, Leu, Ile;(2) Polar without charge: Cys, Ser, Thr, Asn, Gln;(3) Acidic (negatively charged): Asp, Glu;(4) Basic
  • the another (e.g., non-wild type) amino acid is a member of a different group (e.g., a hydrophobic amino acid for a hydrophilic amino acid, a charged amino acid for a neutral amino acid, an acidic amino acid for a basic amino acid, etc.).
  • the another (e.g., non-wild type) amino acid is a member of the same group (e.g., another basic amino acid, another acidic amino acid, another neutral amino acid, another charged amino acid, another hydrophilic amino acid, another hydrophobic amino acid, another polar amino acid, another aromatic amino acid or another aliphatic amino acid).
  • the another (e.g., non-wild type) amino acid is an unconventional amino acid. Unconventional amino acids are non-naturally occurring amino acids.
  • an unconventional amino acid examples include, but are not limited to, aminoadipic acid, beta-alanine, beta-aminopropionic acid, aminobutyric acid, piperidinic acid, aminocaprioic acid, aminoheptanoic acid, aminoisobutyric acid, aminopimelic acid, citrulline, diaminobutyric acid, desmosine, diaminopimelic acid, diaminopropionic acid, N- ethylglycine, N-ethylaspargine, hyroxylysine, allo-hydroxylysine, hydroxyproline, isodesmosine, allo-isoleucine, N-methylglycine, sarcosine, N-methylisoleucine, N- methylvaline, norvaline, norleucine, orithine, 4-hydroxyproline, ⁇ -carboxyglutamate, ⁇ - ⁇ , ⁇ , ⁇ -trimethyllysine, ⁇ - ⁇ -acetyllysine, O
  • one or more amino acid substitutions are introduced into one or more of VP1, VP2 and VP3.
  • a modified capsid protein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 conservative or non-conservative substitutions relative to the wild-type polypeptide.
  • the modified capsid polypeptide of the disclosure comprises modified sequences, wherein such modifications can include both conservative and non-conservative substitutions, deletions, and/or additions, and typically include peptides that share at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the corresponding wild- type capsid protein.
  • the recombinant AAV vector, rep sequences, cap sequences, and helper functions required for producing the rAAV of the disclosure may be delivered to the packaging host cell using any appropriate genetic element (vector).
  • a single nucleic acid encoding all three capsid proteins e.g., VP1, VP2 and VP3 is delivered into the packaging host cell in a single vector.
  • nucleic acids encoding the capsid proteins are delivered into the packaging host cell by two vectors; a first vector comprising a first nucleic acid encoding two capsid proteins (e.g., VP1 and VP2) and a second vector comprising a second nucleic acid encoding a single capsid protein (e.g., VP3).
  • three vectors, each comprising a nucleic acid encoding a different capsid protein are delivered to the packaging host cell.
  • the selected genetic element may be delivered by any suitable method, including those described herein. The methods used to construct any embodiment of this disclosure are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques.
  • recombinant AAVs may be produced using the triple transfection method (described in detail in U.S. Pat. No. 6,001,650).
  • the recombinant AAVs are produced by transfecting a host cell with an recombinant AAV vector (comprising a transgene) to be packaged into AAV particles, an AAV helper function vector, and an accessory function vector.
  • An AAV helper function vector encodes the "AAV helper function" sequences (e.g., rep and cap), which function in trans for productive AAV replication and encapsidation.
  • the AAV helper function vector supports efficient AAV vector production without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes).
  • vectors suitable for use with the present disclosure may be pHLP19, described in U.S. Pat. No. 6,001,650 and pRep6cap6 vector, described in U.S. Pat. No. 6, 156,303, the entirety of both incorporated by reference herein.
  • the accessory function vector encodes nucleotide sequences for non-AAV derived viral and/or cellular functions upon which AAV is dependent for replication (e.g., "accessory functions").
  • the accessory functions include those functions required for AAV replication, including, without limitation, those moieties involved in activation of AAV gene transcription, stage specific AAV mRNA splicing, AAV DNA replication, synthesis of cap expression products, and AAV capsid assembly.
  • Viral-based accessory functions can be derived from any of the known helper viruses such as adenovirus, herpesvirus (other than herpes simplex virus type-1), and vaccinia virus.
  • Cells may also be transfected with a vector (e.g., helper vector) which provides helper functions to the AAV.
  • the vector providing helper functions may provide adenovirus functions, including, e.g., Ela, Elb, E2a, E40RF6.
  • sequences of adenovirus gene providing these functions may be obtained from any known adenovirus serotype, such as serotypes 2, 3, 4, 7, 12 and 40, and further including any of the presently identified human types known in the art.
  • the methods involve transfecting the cell with a vector expressing one or more genes necessary for AAV replication, AAV gene transcription, and/or AAV packaging.
  • An rAAV vector of the disclosure is generated by introducing a nucleic acid sequence encoding an AAV capsid protein, or fragment thereof; a functional rep gene or a fragment thereof; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a transgene encoding a complement system polypeptide (e.g. CFH, FHLl, FHRl, FHR2, FHR3, FHR4, or FHR5) or a biologically active fragment thereof; and sufficient helper functions to permit packaging of the minigene into the AAV capsid, into a host cell.
  • the components required for packaging an AAV minigene into an AAV capsid may be provided to the host cell in trans.
  • any one or more of the required components may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.
  • a stable host cell will contain the required component(s) under the control of an inducible promoter.
  • the required component(s) may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein, in the discussion below of regulator elements suitable for use with the transgene, i.e., a nucleic acid encoding a complement system polypeptide (e.g.
  • a selected stable host cell may contain selected components under the control of a constitutive promoter and other selected components under the control of one or more inducible promoters.
  • a stable host cell may be generated which is derived from 293 cells (which contain El helper functions under the control of a constitutive promoter), but which contains the rep and/or cap proteins under the control of inducible promoters. Still other stable host cells may be generated by one of skill in the art.
  • the minigene, rep sequences, cap sequences, and helper functions required for producing the rAAV of the disclosure may be delivered to the packaging host cell in the form of any genetic element which transfers the sequences.
  • the selected genetic element may be delivered by any suitable method known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation on the present disclosure. See, e.g., K. Fisher et al, 1993 J. Virol, 70:520-532 and US Patent 5,478,745, among others. These publications are incorporated by reference herein.
  • the AAV ITRs, and other selected AAV components described herein may be readily selected from among any AAV serotype, including, without limitation, AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV10, AAVl 1, AAV 12, AAV-DJ, AAV-DJ8, AAV-DJ9, AAVrh8, AAVrh8R or AAVrhlO or other known and unknown AAV serotypes.
  • These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype.
  • Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA).
  • the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
  • the minigene is composed of, at a minimum, a transgene encoding a complement system polypeptide (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5) or a biologically active fragment thereof, as described above, and its regulatory sequences, and 5' and 3' AAV inverted terminal repeats (ITRs).
  • the ITRs of AAV serotype 2 are used. However, ITRs from other suitable serotypes may be selected.
  • the minigene is packaged into a capsid protein and delivered to a selected host cell.
  • regulatory sequences are operably linked to the transgene encoding a complement system polypeptide (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5) or a biologically active fragment thereof.
  • the regulatory sequences may include conventional control elements which are operably linked to the complement system gene, splice variant, or a fragment thereof in a manner which permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus produced by the disclosure.
  • "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
  • Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • RNA processing signals such as splicing and polyadenylation (poly A) signals
  • sequences that stabilize cytoplasmic mRNA sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • poly A polyadenylation
  • sequences that enhance translation efficiency i.e., Kozak consensus sequence
  • sequences that enhance protein stability i.e., Kozak consensus sequence
  • the regulatory sequences useful in the constructs of the present disclosure may also contain an intron, desirably located between the promoter/enhancer sequence and the gene.
  • the intron sequence is derived from SV-40, and is a 100 bp mini -intron splice donor/splice acceptor referred to as SD-SA.
  • Another suitable sequence includes the woodchuck hepatitis virus post-transcriptional element. (See, e.g., L. Wang and I. Verma, 1999 Proc. Natl. Acad. Sci., USA, 96:3906-3910).
  • PolyA signals may be derived from many suitable species, including, without limitation SV-40, human and bovine.
  • IRES internal ribosome entry site
  • An IRES sequence may be used to produce more than one polypeptide from a single gene transcript (for example, to produce more than one complement system polypeptides).
  • An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell.
  • An exemplary IRES is the poliovirus internal ribosome entry sequence, which supports transgene expression in photoreceptors, RPE and ganglion cells.
  • the IRES is located 3' to the transgene in the rAAV vector.
  • expression of the transgene encoding a complement system polypeptide is driven by a separate promoter (e.g., a viral promoter).
  • a separate promoter e.g., a viral promoter.
  • any promoters suitable for use in AAV vectors may be used with the vectors of the disclosure.
  • the selection of the transgene promoter to be employed in the rAAV may be made from among a wide number of constitutive or inducible promoters that can express the selected transgene in the desired ocular cell. Examples of suitable promoters are described below.
  • Other regulatory sequences useful in the disclosure include enhancer sequences.
  • Enhancer sequences useful in the disclosure include the 1RBP enhancer (Nicoud 2007, cited above), immediate early cytomegalovirus enhancer, one derived from an immunoglobulin gene or SV40 enhancer, the cis-acting element identified in the mouse proximal promoter, etc. Selection of these and other common vector and regulatory elements are well-known and many such sequences are available. See, e.g., Sambrook et al, and references cited therein at, for example, pages 3.18-3.26 and 16, 17-16.27 and Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989).
  • the rAAV vector may also contain additional sequences, for example from an adenovirus, which assist in effecting a desired function for the vector.
  • additional sequences include, for example, those which assist in packaging the rAAV vector in adenovirus-associated virus particles.
  • the rAAV vector may also contain a reporter sequence for co-expression, such as but not limited to lacZ, GFP, CFP, YFP, RFP, mCherry, tdTomato, etc.
  • the rAAV vector may comprise a selectable marker.
  • the selectable marker is an antibiotic-resistance gene.
  • the antibiotic-resistance gene is an ampicillin-resistance gene.
  • the ampicillin-resistance gene is beta-lactamase.
  • the rAAV particle is an ssAAV.
  • the rAAV particle is a self-complementary AAV (sc-AAV) (See, US 2012/0141422 which is incorporated herein by reference).
  • Self-complementary vectors package an inverted repeat genome that can fold into dsDNA without the requirement for DNA synthesis or base-pairing between multiple vector genomes. Because scAAV have no need to convert the single- stranded DNA (ssDNA) genome into double -stranded DNA (dsDNA) prior to expression, they are more efficient vectors. However, the trade-off for this efficiency is the loss of half the coding capacity of the vector, ScAAV are useful for small protein-coding genes (up to -55 kd) and any currently available RNA-based therapy.
  • the single-stranded nature of the AAV genome may impact the expression of rAAV vectors more than any other biological feature. Rather than rely on potentially variable cellular mechanisms to provide a complementary-strand for rAAV vectors, it has now been found that this problem may be circumvented by packaging both strands as a single DNA molecule. In the studies described herein, an increased efficiency of transduction from duplexed vectors over conventional rAAV was observed in He La cells (5-140 fold). More importantly, unlike conventional single-stranded AAV vectors, inhibitors of DNA replication did not affect transduction from the duplexed vectors of the invention.
  • the inventive duplexed parvovirus vectors displayed a more rapid onset and a higher level of transgene expression than did rAAV vectors in mouse hepatocytes in vivo. All of these biological attributes support the generation and characterization of a new class of parvovirus vectors (delivering duplex DNA) that significantly contribute to the ongoing development of parvovirus-based gene delivery systems.
  • the present invention provides a parvovirus particle comprising a parvovirus capsid (e.g., an AAV capsid) and a vector genome encoding a heterologous nucleotide sequence, where the vector genome is self-complementary, i. e., the vector genome is a dimeric inverted repeat.
  • a parvovirus capsid e.g., an AAV capsid
  • a vector genome encoding a heterologous nucleotide sequence
  • the vector genome is self-complementary, i. e., the vector genome is a dimeric inverted repeat.
  • the vector genome is preferably approximately the size of the wild-type parvovirus genome (e.g., the AAV genome) corresponding to the parvovirus capsid into which it will be packaged and comprises an appropriate packaging signal.
  • the present invention further provides the vector genome described above and templates that encode the same. rAAV vectors useful in the methods of the disclosure are further described in PCT publication No. WO2015168666 and PCT publication no. WO201401 1210, the contents of which are incorporated by reference herein.
  • any of the vectors disclosed herein is capable of inducing at least 20%, 50%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 700%, 900%, 1000%, 1100%, 1500%, or 2000% higher expression of CFH or FHL in a target cell (e.g. , an RPE or liver cell) as compared to the endogenous expression of CFH or FHL in the target cell.
  • a target cell e.g. , an RPE or liver cell
  • expression of any of the vectors disclosed herein in a target cell e.g.
  • an RPE or liver cell results in at least 20%, 50%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 700%, 900%, 1000%, 1100%, 1500%, or 2000% higher levels of CFH or FHL activity in the target cell as compared to endogenous levels of CFH or FHL activity in the target cell.
  • Complement system genes e.g. CFH, FHL- 1, FHRI, FHR2, FHR3, FHR4, or FHR5
  • splice variants e.g. FHL1
  • FHL1 splice variants
  • fragments thereof are provided as transgenes in the recombinant AAV (rAAV) vectors of the disclosure.
  • the transgene is a nucleic acid sequence, heterologous to the vector sequences flanking the transgene, which encodes a polypeptide, protein, or other product, of interest.
  • the nucleic acid coding sequence is operatively linked to regulatory components in a manner which permits transgene transcription, translation, and/or expression in a target cell (e.g. an ocular cell).
  • the heterologous nucleic acid sequence can be derived from any organism.
  • the transgene is derived from a human.
  • the transgene encodes a mature form of a complement protein.
  • the transgene encodes a polypeptide comprising an amino acid sequence that is at least 80%,, 85%, 90%, 92%, 95%, or 97% identical to the amino acid sequence of SEQ ID NO: 33, or a biologically active fragment thereof.
  • the transgene encodes a polypeptide comprising an amino acid sequence that is at least 80%,, 85%, 90%, 92%, 95%, or 97% identical to the amino acid sequence of SEQ ID NO: 34, or a biologically active fragment thereof.
  • the rAAV vector may comprise one or more transgenes.
  • the transgene comprises more than one complement system gene, splice variant, or fragments derived from more than one complement system gene. This may be accomplished using a single vector carrying two or more heterologous sequences, or using two or more rAAV vectors each carrying one or more heterologous sequences.
  • the rAAV vector may also encode additional proteins, peptides, RNA, enzymes, or catalytic R As.
  • Desirable RNA molecules include shRNA, tRNA, dsRNA, ribosomal RNA, catalytic RNAs, and antisense RNAs.
  • a useful RNA sequence is a sequence which extinguishes expression of a targeted nucleic acid sequence in the treated subject.
  • the additional proteins, peptides, RNA, enzymes, or catalytic RNAs and the complement factor may be encoded by a single vector carrying two or more heterologous sequences, or using two or more rAAV vectors each carrying one or more heterologous sequences.
  • the disclosure provides a recombinant adeno-associated viral (rAAV) vector encoding a human Complement Factor H or Factor H Like 1 (FHL1) protein or biologically active fragment thereof.
  • the vector comprises a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 94%, 95%, 97%, 99% or 100% identical to any of the sequences disclosed herein encoding a CFH or CFHL protein, or biologically active fragments thereof.
  • the vector comprises a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 94%, 95%, 97%, 99% or 100% identical to any of SEQ ID Nos: 1-3 or 5, or biologically active fragments thereof. In some embodiments, the vector comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 97%, 99% or 100% identical to SEQ ID NO: 1, or biologically active fragments thereof.
  • the vector comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 97%, 99% or 100% identical to SEQ ID NO: 2, or biologically active fragments thereof. In some embodiments, the vector comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 97%, 99% or 100% identical to SEQ ID NO: 3, or biologically active fragments thereof.
  • the vector comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 92%, 94%, 95%, 97%, 99% or 100% identical to SEQ ID NO: 5, or biologically active fragments thereof.
  • the vector comprises a nucleotide sequence that is at least 80% identical to the nucleotide sequence of SEQ ID NO: 1-3 or 5, or a fragment thereof.
  • the nucleotide sequence is at least 90% identical to the nucleotide sequence of SEQ ID NO: 1-3 or 5, or a fragment thereof.
  • the nucleotide sequence is at least 95% identical to the nucleotide sequence of SEQ ID NO: 1-3 or 5, or a fragment thereof. In certain embodiments, the nucleotide sequence is the sequence of SEQ ID NO: 1-3 or 5, or a fragment thereof.
  • the vector encodes a CFH or an FHLl protein or biologically active fragment thereof comprising at least four CCP domains. In certain embodiments, the vector encodes CFH or an FHLl protein or biologically active fragment thereof comprising at least five CCP domains. In certain embodiments, the vector encodes a CFH or an FHLl protein or biologically active fragment thereof comprising at least six CCP domains.
  • the vector encodes a CFH or an FHLl protein or biologically active fragment thereof comprising at least seven CCP domains. In certain embodiments, the vector encodes an FHLl protein or biologically active fragment thereof comprising at least three CCP domains. In certain embodiments, the vector encodes a CFH or FHLl protein or biologically active fragment thereof that comprises at least CCPs 1-2 of CFH. In certain embodiments, the vector encodes a biologically active fragment of CFH that comprises at least CCPs 1-4 of CFH. In certain embodiments, the vector encodes a CFH or FHLl protein or biologically active fragment thereof that comprises at least CCPs 19-20 of CFH. Schmidt C O, Herbert A P, Kavanagh D, Gandy C, Fenton C J, Blaum B S, Lyon M, Uhrin D, Barlow P N. J
  • the vector encodes a CFH or an FHLl protein or biologically active fragment thereof comprising the H402 polymorphism. In certain embodiments, the vector encodes a CFH or an FHLl protein or biologically active fragment thereof comprising the V62 polymorphism. In certain embodiments, the CFH or FHLl protein or biologically active fragment thereof comprises the amino acid sequence of SEQ ID NO: 4. In certain embodiments, the amino acid sequence of SEQ ID NO: 4 is the C- terminal sequence of the CFH or FHLl protein. In certain embodiments, the CFH or FHLl protein or biologically active fragment thereof is capable of diffusing across the Bruch's membrane. In certain embodiments, the CFH or FHLl protein or biologically active fragment thereof is capable of binding C3b. In certain embodiments, the CFH or FHLl protein or biologically active fragment thereof is capable of facilitating the breakdown of C3b.
  • the vector comprises a nucleotide sequence that is at least 80%, 85%, 90%, 92%, 94%, 95%, 97%, 99% or 100% identical to any of SEQ ID Nos: 7, 9, 11, 13, 15, 17, 19, or 21-30, or biologically active fragments thereof.
  • Exemplary sequences of transgenes are set forth in SEQ ID Nos: 1-3 or 5.
  • a transgene of the disclosure comprises the nucleic acid sequence set forth in SEQ ID NO: 1.
  • a transgene of the disclosure comprises the nucleic acid sequence set forth in SEQ ID NO: 2.
  • a transgene of the disclosure comprises the nucleic acid sequence set forth in SEQ ID NO: 3.
  • a transgene of the disclosure comprises the nucleic acid sequence set forth in SEQ ID NO: 5.
  • a transgene of the disclosure comprises a variant of these sequences, wherein such variants can include can include missense mutations, nonsense mutations, duplications, deletions, and/or additions, and typically include polynucleotides that share at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 87%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the specific nucleic acid sequences set forth in SEQ ID NOs: 1-3 or 5.
  • nucleic acid sequences complementary to the nucleic acids, and variants of the nucleic acids are also within the scope of this disclosure.
  • nucleic acid sequences of the disclosure can be isolated, recombinant, and/or fused with a heterologous nucleotide sequence.
  • any of the nucleotides disclosed herein e.g., SEQ ID Nos: 1-3 or 5
  • is codon-optimized e.g., codon-optimized for human expression
  • a transgene encodes a complement system polypeptide with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, or 15 amino acid substitutions, deletions, and/or additions relative to the wild-type polypeptide. In some embodiments, a transgene encodes a complement system polypeptide with 1, 2, 3, 4, or 5 amino acid deletions relative to the wild-type polypeptide. In some embodiments, a transgene encodes a polypeptide with 1, 2, 3, 4, or 5 amino acid substitutions relative to the wild-type polypeptide. In some embodiments, a transgene encodes a polypeptide with 1, 2, 3, 4, or 5 amino acid insertions relative to the wild-type polypeptide.
  • Polynucleotides complementary to any of the polynucleotide sequences disclosed herein are also encompassed by the present disclosure.
  • Polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be DNA (genomic or synthetic), cDNA, or RNA molecules.
  • RNA molecules include mRNA molecules. Additional coding or non-coding sequences may, but need not, be present within a polynucleotide of the present disclosure, and a polynucleotide may, but need not, be linked to other molecules and/or support materials.
  • Two polynucleotide or polypeptide sequences are said to be “identical” if the sequence of nucleotides or amino acids in the two sequences is the same when aligned for maximum correspondence as described below. Comparisons between two sequences are typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity.
  • a “comparison window” as used herein refers to a segment of at least about 20 contiguous positions, usually 30 to about 75, or 40 to about 50, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Optimal alignment of sequences for comparison may be conducted using the MegAlign ® program in the Lasergene ® suite of bioinformatics software (DNASTAR ® , Inc., Madison, WI), using default parameters.
  • This program embodies several alignment schemes described in the following references: Dayhoff, M.O., 1978, A model of evolutionary change in proteins - Matrices for detecting distant relationships. In Dayhoff, M.O. (ed.) Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, Washington DC Vol. 5, Suppl. 3, pp. 345-358; Hein J., 1990, Unified Approach to Alignment and Phylogenes pp. 626-645 Methods in Enzymology vol.
  • the "percentage of sequence identity” is determined by comparing two optimally aligned sequences over a window of comparison of at least 20 positions, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less, usually 5 to 15 percent, or 10 to 12 percent, as compared to the reference sequences (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • additions or deletions i.e., gaps
  • the percentage is calculated by determining the number of positions at which the identical nucleic acid bases or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the reference sequence (i.e., the window size) and multiplying the results by 100 to yield the percentage of sequence identity.
  • the transgenes or variants may also, or alternatively, be substantially homologous to a native gene, or a portion or complement thereof. Such polynucleotide variants are capable of hybridizing under moderately stringent conditions to a naturally occurring DNA sequence encoding a complement factor (or a complementary sequence). Suitable
  • “moderately stringent conditions” include prewashing in a solution of 5 X SSC, 0.5% SDS, l.O mM EDTA (pH 8.0); hybridizing at 50°C-65°C, 5 X SSC, overnight; followed by washing twice at 65°C for 20 minutes with each of 2X, 0.5X and 0.2X SSC containing 0.1 % SDS.
  • highly stringent conditions or “high stringency conditions” are those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1% SDS, and 10% dextran sulfate
  • nucleotide sequences that encode a polypeptide as described herein. Some of these polynucleotides bear minimal homology to the nucleotide sequence of any native gene. Nonetheless, polynucleotides that vary due to differences in codon usage are specifically contemplated by the present disclosure. Further, alleles of the genes comprising the polynucleotide sequences provided herein are within the scope of the present disclosure. Alleles are endogenous genes that are altered as a result of one or more mutations, such as deletions, additions and/or substitutions of nucleotides.
  • the resulting mRNA and protein may, but need not, have an altered structure or function. Alleles may be identified using standard techniques (such as hybridization, amplification and/or database sequence comparison).
  • the nucleic acids/polynucleotides of this disclosure can be obtained using chemical synthesis, recombinant methods, or PCR. Methods of chemical polynucleotide synthesis are well known in the art and need not be described in detail herein. One of skill in the art can use the sequences provided herein and a commercial DNA synthesizer to produce a desired DNA sequence.
  • nucleic acids of the disclosure also include nucleotide sequences that hybridize under highly stringent conditions to the nucleotide sequences set forth in SEQ ID NOs: 1, 2, 3 and 5, or sequences complementary thereto.
  • appropriate stringency conditions which promote DNA hybridization can be varied. For example, one could perform the hybridization at 6.0 x sodium chloride/sodium citrate (SSC) at about 45 °C, followed by a wash of 2.0 x SSC at 50 °C.
  • the salt concentration in the wash step can be selected from a low stringency of about 2.0 x SSC at 50 °C to a high stringency of about 0.2 x SSC at 50 °C.
  • the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22 °C, to high stringency conditions at about 65 °C. Both temperature and salt may be varied, or temperature or salt concentration may be held constant while the other variable is changed.
  • the disclosure provides nucleic acids which hybridize under low stringency conditions of 6 x SSC at room temperature followed by a wash at 2 x SSC at room temperature.
  • Isolated nucleic acids which differ due to degeneracy in the genetic code are also within the scope of the disclosure.
  • a number of amino acids are designated by more than one triplet. Codons that specify the same amino acid, or synonyms (for example, CAU and CAC are synonyms for histidine) may result in "silent" mutations which do not affect the amino acid sequence of the protein.
  • CAU and CAC are synonyms for histidine
  • these variations in one or more nucleotides (up to about 3-5% of the nucleotides) of the nucleic acids encoding a particular protein may exist among members of a given species due to natural allelic variation. Any and all such nucleotide variations and resulting amino acid polymorphisms are within the scope of this disclosure.
  • the present disclosure further provides oligonucleotides that hybridize to a polynucleotide having the nucleotide sequence set forth in SEQ ID NOs: 1, 2, 3 and 5 , or to a polynucleotide molecule having a nucleotide sequence which is the complement of a sequence listed above.
  • oligonucleotides are at least about 10 nucleotides in length, and preferably from about 15 to about 30 nucleotides in length, and hybridize to one of the aforementioned
  • polynucleotide molecules under highly stringent conditions, i.e., washing in 6> SSC/0.5% sodium pyrophosphate at about 37° C for about 14-base oligos, at about 48° C for about 17- base oligos, at about 55° C for about 20-base oligos, and at about 60° C for about 23-base oligos.
  • the oligonucleotides are complementary to a portion of one of the aforementioned polynucleotide molecules. These oligonucleotides are useful for a variety of purposes including encoding or acting as antisense molecules useful in gene regulation, or as primers in amplification of complement system-encoding polynucleotide molecules.
  • the transgenes useful herein include reporter sequences, which upon expression produce a detectable signal.
  • reporter sequences include, without limitation, DNA sequences encoding ⁇ -lactamase, ⁇ -galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), red fluorescent protein (RFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2, CD4, CD8, the influenza hemagglutinin protein, and others well known in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc.
  • coding sequences when associated with regulatory elements which drive their expression, provide signals detectable by conventional means, including enzymatic, radiographic, colorimetric, fluorescence or other spectrographic assays, fluorescent activating cell sorting assays and immunological assays, including enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA) and immunohistochemistry.
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • immunohistochemistry immunohistochemistry.
  • the marker sequence is the LacZ gene
  • the presence of the vector carrying the signal is detected by assays for beta-galactosidase activity.
  • the transgene is green fluorescent protein or luciferase
  • the vector carrying the signal may be measured visually by color or light production in a luminometer.
  • the complement system gene or fragment thereof may be used to correct or ameliorate gene deficiencies, which may include deficiencies in which normal complement system genes are expressed at less than normal levels or deficiencies in which the functional complement system gene product is not expressed.
  • the transgene sequence encodes a single complement system protein or biologically active fragment thereof.
  • the disclosure further includes using multiple transgenes, e.g., transgenes encoding two or more complement system polypeptides or biologically active fragments thereof. In certain situations, a different transgene may be used to encode different complement proteins or biologically active fragments thereof (e .g.
  • CFH FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5
  • different complement proteins e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5
  • a single transgene includes the DNA encoding each of the complement proteins (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5) or biologically active fragments thereof, with the DNA for each protein or functional fragment thereof separated by an internal ribozyme entry site (IRES).
  • IRS internal ribozyme entry site
  • the DNA may be separated by sequences encoding a 2A peptide, which self-cleaves in a post-translational event. See, e.g., MX. Donnelly, et al, J. Gen.
  • the regulatory sequences include conventional control elements which are operably linked to the transgene encoding a complement system polypeptide (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5) or biologically active fragment thereof in a manner which permits its transcription, translation and/or expression in a cell transfected with the vector or infected with the virus produced as described herein.
  • a complement system polypeptide e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5
  • "operably linked" sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
  • Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • efficient RNA processing signals such as splicing and polyadenylation (poly A) signals
  • sequences that stabilize cytoplasmic mRNA sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
  • a great number of expression control sequences, including promoters, are known in the art and may be utilized.
  • the regulatory sequences useful in the constructs provided herein may also contain an intron, desirably located between the promoter/enhancer sequence and the gene.
  • One desirable intron sequence is derived from SV-40, and is a 100 bp mini -intron splice donor/splice acceptor referred to as SD-SA.
  • the intron comprises the nucleotide sequence of SEQ ID NO: 10, or a codon-optimized or fragment thereof.
  • Another suitable sequence includes the woodchuck hepatitis virus post-transcriptional element. (See, e.g., L. Wang and I. Verma, 1999 Proc. Natl. Acad. Sci., USA, 96:3906-3910).
  • PolyA signals may be derived from many suitable species, including, without limitation SV-40, human and bovine.
  • IRES internal ribosome entry site
  • An IRES sequence may be used to produce more than one polypeptide from a single gene transcript.
  • An IRES (or other suitable sequence) is used to produce a protein that contains more than one polypeptide chain or to express two different proteins from or within the same cell.
  • An exemplary IRES is the poliovirus internal ribosome entry sequence, which supports transgene expression in photoreceptors, RPE and ganglion cells.
  • the IRES is located 3' to the transgene in the rAAV vector.
  • the AAV comprises a promoter (or a functional fragment of a promoter).
  • the selection of the promoter to be employed in the rAAV may be made from among a wide number of promoters that can express the selected transgene in the desired target cell.
  • the target cell is an ocular cell.
  • the target cell is a neuronal cell (i.e. , the vector targets neuronal cells).
  • the target cell is a non-neuronal cell (i.e. , the vector does not target neuronal cells).
  • the target cell is a glial cell, Muller cell, and/or retinal pigment epithelial (RPE) cell.
  • the promoter may be derived from any species, including human. In one embodiment, the promoter is "cell specific".
  • cell-specific means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular cell or ocular cell type.
  • the promoter is specific for expression of the transgene in photoreceptor cells.
  • the promoter is specific for expression in the rods and/or cones.
  • the promoter is specific for expression of the transgene in RPE cells.
  • the promoter is specific for expression of the transgene in ganglion cells.
  • the promoter is specific for expression of the transgene in Muller cells.
  • the promoter is specific for expression of the transgene in bipolar cells.
  • the promoter is specific for expression of the transgene in ON-bipolar cells.
  • the promoter is metabotropic glutamate receptor 6 (mGluR6) promoter (see, Vardi et al, mGluR6 Transcripts in Non-neuronal Tissues, J Histochem Cytochem. 201 1 December; 59(12): 1076-1086, which is incorporated herein by reference).
  • the promoter is an enhancer-linked mGluR6 promoter.
  • the promoter is specific for expression of the transgene in OFF -bipolar cells.
  • the promoter is specific for expression of the transgene in horizontal cells.
  • the promoter is specific for expression of the transgene in amacrine cells. In another embodiment, the transgene is expressed in any of the above noted ocular cells. In another embodiment, the promoter is the human G-protein-coupled receptor protein kinase 1 (GRKl) promoter (Genbank Accession number AY327580), In another
  • the promoter is the human interphotoreceptor retinoid-binding protein proximal (IRBP) promoter.
  • IRBP human interphotoreceptor retinoid-binding protein proximal
  • the promoter is of a small size, e.g., under 1000 bp, due to the size limitations of the AAV vector. In some embodiments, the promoter is less than 1000, 900, 800, 700, 600, 500, 400 or 300 bp in size. In particular embodiments, the promoter is under 400 bp. In some embodiments, the promoter is a promoter selected from the CRALBP (RLBP), EFla, HSP70, AAT1, ALB, PCK1, CAG, RPE65, MECP, or sCBA promoter.
  • the promoter comprises a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity of any one of SEQ ID NOs: 6, 8, 12, 14, 16, 18, 20, 31, 32, or 36 or codon-optimized and/or fragment thereof. In some embodiments, the promoter comprises the nucleotide sequence of any one of SEQ ID NOs: 6, 8, 12, 14, 16, 18, 20, 31, 32, or 36 or codon-optimized and/or fragment thereof. In some embodiments, the promoter is associated with strong expression in the eye.
  • the promoter is a CRALBP or RPE65 promoter (e.g., a promoter having the nucleotide sequence of SEQ ID NO: 6 or 32). In some embodiments, the promoter is associated with strong expression in the liver. In some embodiments, the promoter is an AAT1, ALB or PCK1 promoter (e.g. , a promoter having the nucleotide sequence of SEQ ID NO: 16, 18, or 20. In some
  • the promoter is less than 1000, 900, 800, 700, 600, 500, 400 or 300 bp in size.
  • the promoter is a promoter selected from the CRALBP, EF la, HSP70 or sCBA promoter.
  • the promoter comprises the nucleotide sequence of any one of SEQ ID NOs: 6, 8, 12, 14, 16, 18, 20, 31, 32, or 36 or codon-optimized and/or fragments thereof.
  • any of the promoters disclosed herein is coupled with a viral intron (e.g. , an SV40i intron).
  • the promoter is the native promoter for the gene to be expressed.
  • Useful promoters include, without limitation, the rod opsin promoter, the red-green opsin promoter, the blue opsin promoter, the cGMP- -phosphodiesterase promoter, the mouse opsin promoter (Beltran et al 2010 cited above), the rhodopsin promoter (Mussolino et al, Gene Ther, July 2011, 18(7):637-45); the alpha-subunit of cone transducin (Morrissey et al, BMC Dev, Biol, Jan 201 1, 1 1 :3); beta phosphodiesterase (PDE) promoter; the retinitis pigmentosa (RP 1) promoter (Nicoud et al, J.
  • the promoter is of a small size, under 1000 bp, due to the size limitations of the AAV vector. In another embodiment, the promoter is under 400 bp.
  • any promoters suitable for use in AAV vectors may be used with the vectors of the disclosure.
  • suitable promoters include constitutive promoters such as a CMV promoter (optionally with the CMV enhancer), RSV promoter (optionally with the RSV enhancer), SV40 promoter, MoMLV promoter, CB promoter, the dihydrofolate reductase promoter, the chicken ⁇ -actin (CBA) promoter, CBA/CAG promoter, and the immediate early CMV enhancer coupled with the CBA promoter, or a EF la promoter, etc.
  • a cell- or tissue-specific promoter is utilized (e.g., a rod, cone, or ganglia derived promoter).
  • the promoter is small enough to be compatible with the disclosed constructs, e.g., the CB promoter.
  • the promoter is a constitutive promoter.
  • the promoter is cell-specific.
  • the term "cell- specific" means that the particular promoter selected for the recombinant vector can direct expression of the selected transgene in a particular ocular cell type.
  • the promoter is specific for expression of the transgene in photoreceptor cells.
  • the promoter is specific for expression in the rods and cones.
  • the promoter is specific for expression in the rods.
  • the promoter is specific for expression in the cones.
  • the promoter is specific for expression of the transgene in RPE cells.
  • the transgene is expressed in any of the above noted ocular cells.
  • transcription factor promoters including, without limitation, promoters for the neural retina leucine zipper (Nrl), photoreceptor-specific nuclear receptor Nr2e3, and basic -leucine zipper (bZIP).
  • Nrl neural retina leucine zipper
  • bZIP basic -leucine zipper
  • the promoter is of a small size, under 1000 bp, due to the size limitations of the AAV vector. In another embodiment, the promoter is under 400 bp.
  • Enhancer sequences useful herein include the IRBP enhancer (Nicoud 2007, cited above), immediate early cytomegalovirus enhancer, one derived from an immunoglobulin gene or SV40 enhancer, the cis-acting element identified in the mouse proximal promoter, etc.
  • rAAV vectors Numerous methods are known in the art for production of rAAV vectors, including transfection, stable cell line production, and infectious hybrid virus production systems which include adenovirus- AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al, (1997). Virology 71(11):8780-8789) and baculovirus-AAV hybrids.
  • rAAV production cultures for the production of rAAV virus particles all require; 1) suitable host cells, including, for example, human-derived cell lines such as HeLa, A549, or 293 cells, or insect-derived cell lines such as SF-9, in the case of baculovirus production systems; 2) suitable helper virus function, provided by wild-type or mutant adenovirus (such as temperature sensitive adenovirus), herpes virus, baculovirus, or a plasmid construct providing helper functions; 3) AAV rep and cap genes and gene products; 4) a transgene (such as a transgene encoding a complement system polypeptide (e.g.
  • CFH FHLl, FHRl, FHR2, FHR3, FHR4, or FHR5) or a biologically active fragment thereof) flanked by at least one AAV ITR sequence; and 5) suitable media and media components to support rAAV production.
  • suitable media known in the art may be used for the production of rAAV vectors. These media include, without limitation, media produced by Hyclone Laboratories and JRH including Modified Eagle Medium (MEM), Dulbecco's Modified Eagle Medium (DMEM), custom formulations such as those described in U.S. Patent No. 6,566,118, and Sf-900 II SFM media as described in U.S. Patent No. 6,723,551, each of which is incorporated herein by reference in its entirety, particularly with respect to custom media formulations for use in production of recombinant AAV vectors.
  • MEM Modified Eagle Medium
  • DMEM Dulbecco's Modified Eagle Medium
  • custom formulations such as those described in U.S. Patent No. 6,566,
  • the rAAV particles can be produced using methods known in the art. See, e.g., U.S. Pat. Nos. 6,566,118; 6,989,264; and 6,995,006.
  • host cells for producing rAAV particles include mammalian cells, insect cells, plant cells, microorganisms and yeast.
  • Host cells can also be packaging cells in which the AAV rep and cap genes are stably maintained in the host cell or producer cells in which the AAV vector genome is stably maintained.
  • Exemplary packaging and producer cells are derived from 293, A549 or HeLa cells.
  • AAV vectors are purified and formulated using standard techniques known in the art.
  • Recombinant AAV particles are generated by transfecting producer cells with a plasmid (cis- plasmid) containing a rAAV genome comprising a transgene flanked by the 145 nucleotide- long AAV ITRs and a separate construct expressing the AAV rep and CAP genes in trans.
  • adenovirus helper factors such as E1A, E1B, E2A, E40RF6 and VA RNAs, etc. may be provided by either adenovirus infection or by transfecting a third plasmid providing adenovirus helper genes into the producer cells.
  • Producer cells may be HEK293 cells.
  • Packaging cell lines suitable for producing adeno-associated viral vectors may be readily accomplished given readily available techniques (see e.g., U.S. Pat. No. 5,872,005).
  • the helper factors provided will vary depending on the producer cells used and whether the producer cells already carry some of these helper factors.
  • rAAV particles may be produced by a triple transfection method, such as the exemplary triple transfection method provided infra.
  • a triple transfection method such as the exemplary triple transfection method provided infra.
  • a plasmid containing a rep gene and a capsid gene, along with a helper adenoviral plasmid may be transfected (e.g., using the calcium phosphate method) into a cell line (e.g., HEK-293 cells), and virus may be collected and optionally purified.
  • rAAV particles may be produced by a producer cell line method, such as the exemplary producer cell line method provided infra (see also (referenced in Martin et al., (2013) Human Gene Therapy Methods 24:253-269).
  • a cell line e.g., a HeLa cell line
  • a cell line may be stably transfected with a plasmid containing a rep gene, a capsid gene, and a promoter-transgene sequence.
  • Cell lines may be screened to select a lead clone for rAAV production, which may then be expanded to a production bioreactor and infected with an adenovirus (e.g., a wild-type adenovirus) as helper to initiate rAAV production.
  • adenovirus e.g., a wild-type adenovirus
  • Virus may subsequently be harvested, adenovirus may be inactivated (e.g., by heat) and/or removed, and the rAAV particles may be purified.
  • a method for producing any rAAV particle as disclosed herein comprising (a) culturing a host cell under a condition that rAAV particles are produced, wherein the host cell comprises (i) one or more AAV package genes, wherein each said AAV packaging gene encodes an AAV replication and/or encapsidation protein; (ii) a rAAV pro- vector comprising a nucleic acid encoding a therapeutic polypeptide and/or nucleic acid as described herein flanked by at least one AAV ITR, and (iii) an AAV helper function; and (b) recovering the rAAV particles produced by the host cell.
  • said at least one AAV ITR is selected from the group consisting of AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV1 1, AAV 12, AAV2R471A, AAV DJ, a goat AAV, bovine AAV, or mouse AAV or the like.
  • the encapsidation protein is an AAV2 encapsidation protein.
  • Suitable rAAV production culture media of the present disclosure may be supplemented with serum or serum-derived recombinant proteins at a level of 0.5 -20 (v/v or w/v).
  • rAAV vectors may be produced in serum- free conditions which may also be referred to as media with no animal-derived products.
  • commercial or custom media designed to support production of rAAV vectors may also be supplemented with one or more cell culture components know in the art, including without limitation glucose, vitamins, amino acids, and or growth factors, in order to increase the titer of rAAV in production cultures.
  • rAAV production cultures can be grown under a variety of conditions (over a wide temperature range, for varying lengths of time, and the like) suitable to the particular host cell being utilized.
  • rAAV production cultures include attachment- dependent cultures which can be cultured in suitable attachment-dependent vessels such as, for example, roller bottles, hollow fiber filters, microcarriers, and packed-bed or fluidized- bed bioreactors.
  • rAAV vector production cultures may also include suspension-adapted host cells such as He La, 293, and SF-9 cells which can be cultured in a variety of ways including, for example, spinner flasks, stirred tank bioreactors, and disposable systems such as the Wave bag system.
  • rAAV vector particles of the disclosure may be harvested from rAAV production cultures by lysis of the host cells of the production culture or by harvest of the spent media from the production culture, provided the cells are cultured under conditions known in the art to cause release of rAAV particles into the media from intact cells, as described more fully in U.S. Patent No. 6,566,118).
  • Suitable methods of lysing cells include for example multiple freeze/thaw cycles, sonication, microfluidization, and treatment with chemicals, such as detergents and/or proteases.
  • the rAAV particles are purified.
  • purified includes a preparation of rAAV particles devoid of at least some of the other components that may also be present where the rAAV particles naturally occur or are initially prepared from.
  • isolated rAAV particles may be prepared using a purification technique to enrich it from a source mixture, such as a culture lysate or production culture supernatant.
  • Enrichment can be measured in a variety of ways, such as, for example, by the proportion of DNase -resistant particles (DRPs) or genome copies (gc) present in a solution, or by infectivity, or it can be measured in relation to a second, potentially interfering substance present in the source mixture, such as contaminants, including production culture contaminants or in-process contaminants, including helper virus, media components, and the like.
  • DNase -resistant particles DNase -resistant particles
  • gc genome copies
  • the rAAV production culture harvest is clarified to remove host cell debris.
  • the production culture harvest is clarified by filtration through a series of depth filters including, for example, a grade DOHC Millipore Millistak+ HC Pod Filter, a grade A1HC Millipore Millistak+ HC Pod Filter, and a 0.2 ⁇ Filter Opticap XL 10 Millipore Express SHC Hydrophilic Membrane filter. Clarification can also be achieved by a variety of other standard techniques known in the art, such as, centrifugation or filtration through any cellulose acetate filter of 0.2 ⁇ or greater pore size known in the art.
  • the rAAV production culture harvest is further treated with
  • Benzonase ® to digest any high molecular weight DNA present in the production culture.
  • the Benzonase ® digestion is performed under standard conditions known in the art including, for example, a final concentration of 1-2.5 units/ml of Benzonase ® at a temperature ranging from ambient to 37°C for a period of 30 minutes to several hours.
  • rAAV particles may be isolated or purified using one or more of the following purification steps: equilibrium centrifugation; flow-through anionic exchange filtration; tangential flow filtration (TFF) for concentrating the rAAV particles; rAAV capture by apatite
  • the method comprises all the steps in the order as described below. Methods to purify rAAV particles are found, for example, in Xiao et al., (1998) Journal of Virology 72:2224-2232; US Patent Numbers 6,989,264 and 8,137,948; and WO 2010/148143.
  • compositions comprising an rAAV particle comprising a transgene encoding a complement system polypeptide (e.g. CFH, FHLl, FHRl, FHR2, FHR3, FHR4, or FHR5) or a biologically active fragment thereof and/or therapeutic nucleic acid, and a pharmaceutically acceptable carrier.
  • a complement system polypeptide e.g. CFH, FHLl, FHRl, FHR2, FHR3, FHR4, or FHR5
  • the pharmaceutical compositions may be suitable for any mode of administration described herein; for example, by intravitreal administration.
  • the composition comprises a polypeptide (or a nucleic acid encoding a polypeptide) that processes (e.g. , cleaves) the complement system polypeptide encoded by the transgene in the rAAV.
  • the composition does not comprise a polypeptide (or a nucleic acid encoding a polypeptide) that processes (e.g., cleaves) the complement system polypeptide encoded by the transgene in the rAAV.
  • Gene therapy protocols for retinal diseases, such as LCA, retinitis pigmentosa, and age- related macular degeneration require the localized delivery of the vector to the cells in the retina.
  • the cells that will be the treatment target in these diseases are either the photoreceptor cells in the retina or the cells of the RPE underlying the neurosensory retina. Delivering gene therapy vectors to these cells requires injection into the subretinal space between the retina and the RPE.
  • the disclosure provides methods to deliver rAAV gene therapy vectors encoding a complement system polypeptide (e.g. CFH, FHLl, FHRl, FHR2, FHR3, FHR4, or FHR5) or a biologically active fragment thereof to cells of the retina.
  • a complement system polypeptide e.g. CFH, FHLl, FHRl, FHR2, FHR3, FHR4, or FHR5
  • the pharmaceutical compositions comprising a rAAV described herein and a pharmaceutically acceptable carrier is suitable for administration to a human subject.
  • Such carriers are well known in the art (see, e.g., Remington's Pharmaceutical Sciences, 15th Edition, pp. 1035-1038 and 1570-1580).
  • the pharmaceutical compositions comprising a rAAV described herein and a pharmaceutically acceptable carrier is suitable for ocular injection.
  • the pharmaceutical composition is suitable for intravitreal injection.
  • the pharmaceutical composition is suitable for subretinal delivery.
  • Such pharmaceutically acceptable carriers can be sterile liquids, such as water and oil, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, and the like.
  • Saline solutions and aqueous dextrose, polyethylene glycol (PEG) and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • the pharmaceutical composition may further comprise additional ingredients, for example preservatives, buffers, tonicity agents, antioxidants and stabilizers, nonionic wetting or clarifying agents, viscosity-increasing agents, and the like.
  • the pharmaceutical compositions described herein can be packaged in single unit dosages or in multidosage forms.
  • the compositions are generally formulated as sterile and substantially isotonic solution.
  • the recombinant AAV containing the desired transgene encoding a complement system polypeptide e.g. CFH, FHLl, FHRl, FHR2, FHR3, FHR4, or FHR5
  • a biologically active fragment thereof and constitutive or tissue or cell-specific promoter for use in the target ocular cells as detailed above is formulated into a pharmaceutical composition intended for subretinal or intravitreal injection.
  • the compositions disclosed herein targets cells of any one or more regions of the macula including, for example, the umbo, the foveolar, the foveal avascular zone, the fovea, the parafovea, or the perifovea.
  • Such formulation involves the use of a pharmaceutically and/or physiologically acceptable vehicle or carrier, particularly one suitable for administration to the eye, e.g., by subretinal injection, such as buffered saline or other buffers, e.g., HEPES, to maintain pH at appropriate physiological levels, and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, carriers, adjuvants, diluents, etc.
  • the carrier will typically be a liquid.
  • physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free, phosphate buffered saline. A variety of such known carriers are provided in US Patent Publication No. 7,629,322, incorporated herein by reference.
  • the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is balanced salt solution. In one embodiment, the carrier includes tween. If the virus is to be stored long-term, it may be frozen in the presence of glycerol or Tween20. In another embodiment, the pharmaceutically acceptable carrier comprises a surfactant, such as perfluorooctane (Perfluoron liquid).
  • a surfactant such as perfluorooctane (Perfluoron liquid).
  • the pharmaceutical composition described above is administered to the subject by subretinal injection.
  • the pharmaceutical composition is administered by intravitreal injection.
  • Other forms of administration that may be useful in the methods described herein include, but are not limited to, direct delivery to a desired organ (e.g., the eye), oral, inhalation, intranasal, intratracheal, intravenous, intramuscular, subcutaneous, intradermal, and other parental routes of administration. Routes of administration may be combined, if desired.
  • the pharmaceutical compositions of the disclosure are administered after administration of an initial loading dose of the complement system protein.
  • any of the vectors/pharmaceutical compositions disclosed herein are administered to a patient such that they target glial cells, Muller cells, and/or retinal pigment epithelial cells.
  • the route of administration does not specifically target neurons.
  • the route of administration is chosen such that it reduces the risk of retinal detachment in the patient (e.g. , intravitreal rather than subretinal
  • intravitreal administration is chosen if the vector/composition is to be administered to an elderly adult (e.g., at least 60 years of age).
  • any of the vectors/pharmaceutical compositions disclosed herein are administered to a subject intravitreally.
  • Procedures for intravitreal injection are known in the art (see, e.g., Peyman, G.A., et al. (2009) Retina 29(7): 875-912 and Fagan, X.J. and Al- Qureshi, S. (2013) Clin. Experiment. Ophthalmol. 41(5):500-7).
  • a subject for intravitreal injection may be prepared for the procedure by pupillary dilation, sterilization of the eye, and administration of anesthetic.
  • Any suitable mydriatic agent known in the art may be used for pupillary dilation. Adequate pupillary dilation may be confirmed before treatment.
  • Sterilization may be achieved by applying a sterilizing eye treatment, e.g., an iodide -containing solution such as Povidone-Iodine (BETADINE®).
  • BETADINE® Povidone-Iodine
  • a similar solution may also be used to clean the eyelid, eyelashes, and any other nearby tissues ⁇ e.g., skin).
  • Any suitable anesthetic may be used, such as lidocaine or proparacaine, at any suitable concentration.
  • Anesthetic may be administered by any method known in the art, including without limitation topical drops, gels or jellies, and subconjuctival application of anesthetic.
  • a sterilized eyelid speculum may be used to clear the eyelashes from the area.
  • the site of the injection may be marked with a syringe.
  • the site of the injection may be chosen based on the lens of the patient. For example, the injection site may be 3-3.5 mm from the limus in pseudophakic or aphakic patients, and 3.5-4 mm from the limbus in phakic patients.
  • the patient may look in a direction opposite the injection site.
  • the needle may be inserted perpendicular to the sclera and pointed to the center of the eye.
  • the needle may be inserted such that the tip ends in the vitreous, rather than the subretinal space. Any suitable volume known in the art for injection may be used.
  • the eye may be treated with a sterilizing agent such as an antiobiotic. The eye may also be rinsed to remove excess sterilizing agent.
  • ophthalmoscopy may include electroretinography (ERG) (particularly the b-wave measurement), perimetry, topographical mapping of the layers of the retina and measurement of the thickness of its layers by means of confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), topographical mapping of cone density via adaptive optics (AO), functional eye exam, etc.
  • EMG electroretinography
  • OCT optical coherence tomography
  • AO adaptive optics
  • one or more injections are performed in the same eye in order to target different areas of retained bipolar cells.
  • the volume and viral titer of each injection is determined individually, as further described below, and may be the same or different from other injections performed in the same, or contralateral, eye.
  • a single, larger volume injection is made in order to treat the entire eye.
  • the volume and concentration of the rAAV composition is selected so that only a specific region of ocular cells is impacted.
  • the volume and/or concentration of the rAAV composition is a greater amount, in order reach larger portions of the eye, including non-damaged ocular cells.
  • the composition may be delivered in a volume of from about 0.1 ⁇ ⁇ ⁇ about 1 mL, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method.
  • the volume is about 50 ⁇ .
  • the volume is about 70 ⁇ .
  • the volume is about 100 ⁇ .
  • the volume is about 125 ⁇ .
  • the volume is about 150 ⁇ .
  • the volume is about 175 ⁇ .
  • the volume is about 200 ⁇ ⁇ .
  • the volume is about 250 ⁇ ⁇ .
  • the volume is about 300 ⁇ .
  • the volume is about 450 ⁇ . In another embodiment, the volume is about 500 ⁇ . In another embodiment, the volume is about 600 ⁇ . In another embodiment, the volume is about 750 ⁇ . In another embodiment, the volume is about 850 ⁇ . In another embodiment, the volume is about 1000 ⁇ .
  • An effective concentration of a recombinant adeno-associated virus carrying a nucleic acid sequence encoding the desired transgene under the control of the cell-specific promoter sequence desirably ranges from about 10 7 and 10 13 vector genomes per milliliter (vg/mL) (also called genome copies/mL (GC/mL)). The rAAV infectious units are measured as described in S.K. McLaughlin et al, 1988 J. Virol., 62: 1963, which is incorporated herein by reference.
  • the concentration in the retina is from about 1.5 x 10 9 vg/mL to about 1.5 x 10 12 vg/mL, and more preferably from about 1.5 x 10 9 vg/mL to about 1.5 x 10 11 vg/mL.
  • the effective concentration is about 2.5 xlO 10 vg to about 1.4xlO n .
  • the effective concentration is about 1.4 x 10 8 vg/mL.
  • the effective concentration is about 3.5 x 10 10 vg/mL.
  • the effective concentration is about 5.6 x 10 11 vg/mL.
  • the effective concentration is about 5.3 x 10 12 vg/mL.
  • the effective concentration is about 1.5 x 10 12 vg/mL. In another embodiment, the effective concentration is about 1.5 x 10 13 vg/mL. In one embodiment, the effective dosage (total genome copies delivered) is from about 10 7 to 10 13 vector genomes. It is desirable that the lowest effective concentration of virus be utilized in order to reduce the risk of undesirable effects, such as toxicity, retinal dysplasia and detachment. Still other dosages and administration volumes in these ranges may be selected by the attending physician, taking into account the physical state of the subject, preferably human, being treated, the age of the subject, the particular ocular disorder and the degree to which the disorder, if progressive, has developed. For extra-ocular delivery, the dosage will be increased according to the scale-up from the retina. Intravenous delivery, for example may require doses on the order of 1.5 X 10 13 vg/kg.
  • compositions useful in the methods of the disclosure are further described in PCT publication No. WO2015168666 and PCT publication no. WO201401 1210, the contents of which are incorporated by reference herein.
  • Described herein are various methods of preventing, treating, arresting progression of or ameliorating the ocular disorders and retinal changes associated therewith.
  • the methods include administering to a mammalian subject in need thereof, an effective amount of a composition comprising a recombinant adeno-associated virus (AAV) described above, carrying a transgene encoding a complement system polypeptide (e.g. CFH, FHL1, FHR1, FHR2, FHR3, FHR4, or FHR5) or a biologically active fragment thereof under the control of regulatory sequences which express the product of the gene in the subject's ocular cells, and a pharmaceutically acceptable carrier.
  • AAV recombinant adeno-associated virus
  • Gene therapy protocols for retinal diseases require the localized delivery of the vector to the cells in the retina.
  • the cells that will be the treatment target in these diseases are either the photoreceptor cells in the retina or the cells of the RPE underlying the neurosensory retina. Delivering gene therapy vectors to these cells requires injection into the subretinal space between the retina and the RPE.
  • the disclosure provides methods to deliver rAAV gene therapy vectors comprising a complement system gene or a fragment thereof to cells of the retina.
  • the disclosure provides a method of treating a subject having age-related macular degeneration (AMD), comprising the step of administering to the subject any of the vectors of the disclosure.
  • the vectors are administered at a dose between 2.5 xlO 10 vg and 1.4xlO n vg/ per eye in about 50 ⁇ to about 100 ⁇ .
  • the vectors are administered at a dose between 1.0 xlO 11 vg and 1.5x10 13 vg/ per eye in about 50 ⁇ to about 100 ⁇ .
  • the vectors are administered at a dose between 1.0 xlO 11 vg and 1.5xl0 12 vg/ per eye in about 50 ⁇ to about 100 ⁇ .
  • the vectors are administered at a dose of about 1.4x10 12 vg/ per eye in about 50 ⁇ to about 100 ⁇ . In certain embodiments, the vectors are administered at a dose of 1.4xl0 12 vg/ per eye in about 50 ⁇ to about 100 ⁇ .
  • the pharmaceutical compositions of the disclosure comprise a pharmaceutically acceptable carrier. In certain embodiments, the pharmaceutical compositions of the disclosure comprise PBS. In certain embodiments, the pharmaceutical compositions of the disclosure comprise pluronic. In certain embodiments, the pharmaceutical compositions of the disclosure comprise PBS, NaCl and pluronic. In certain embodiments, the vectors are administered by intravitreal injection in a solution of PBS with additional NaCl and pluronic.
  • any of the vectors of the present disclosure used according to the methods disclosed herein is capable of inducing at least 5%, 10%, 20%, 50%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 700%, 900%, 1000%, 1 100%, 1500%, or 2000% higher expression of CFH and/or FHLl in a target cell disclosed herein (e.g., an RPE or liver cell) as compared to the endogenous expression of CFH and/or FHLl in the target cell.
  • a target cell disclosed herein e.g., an RPE or liver cell
  • expression of any of the vectors disclosed herein in a target cell disclosed herein results in at least 5%, 10%, 20%, 50%, 100%, 150%, 200%, 250%, 300%, 400%, 500%, 700%, 900%, 1000%, 1 100%, 1500%, or 2000% higher levels of CFH and/or FHLl activity in the target cell as compared to endogenous levels of CFH and/or FHLl activity in the target cell.
  • any of the vectors disclosed herein is administered to cell(s) or tissue(s) in a test subject.
  • the cell(s) or tissue(s) in the test subject express less CFH and/or FHLl, or less functional CFH and/or FHLl, than expressed in the same cell type or tissue type in a reference control subject or population of reference control subjects.
  • the reference control subject is of the same age and/or sex as the test subject.
  • the reference control subject is a healthy subject, e.g. , the subject does not have a disease or disorder of the eye. In some embodiments, the reference control subject does not have a disease or disorder of the eye associated with activation of the complement cascade.
  • the reference control subject does not have macular degeneration.
  • the eye and/or a specific cell type of the eye (e.g., cells in the foveal region) in the test subject express at least 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or 1% less CFH and/or FHLl or functional CFH and/or FHLl as compared to the levels in the reference control subject or population of reference control subjects.
  • a the eye or a specific cell type of the eye (e.g., cells in the foveal region) in the test subject express CFH and/or FHLl protein having any of the CFH and/or FHLl mutations disclosed herein.
  • the eye or a specific cell type of the eye (e.g., cells in the foveal region) in the reference control subject do not express a CFH and/or FHLl protein having any of the CFH and/or FHLl mutations disclosed herein.
  • expression of any of the vectors disclosed herein in the cell(s) or tissue(s) of the test subject results in an increase in levels of CFH and/or FHLl protein or functional CFH and/or FHLl protein.
  • expression of any of the vectors disclosed herein in the cell(s) or tissue(s) of the test subject results in an increase in levels of CFH and/or FHLl protein or functional CFH and/or FHLl protein such that the increased levels are within 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or 1% of, or are the same as, the levels of CFH and/or FHLl protein or functional CFH and/or FHLl protein expressed by the same cell type or tissue type in the reference control subject or population of reference control subjects.
  • expression of any of the vectors disclosed herein in the cell(s) or tissue(s) of the test subject results in an increase in levels of CFH and/or FHLl protein or functional CFH and/or FHLl protein, but the increased levels of CFH and/or FHLl protein or functional CFH and/or FHLl protein do not exceed the levels of CFH and/or FHLl protein or functional CFH and/or FHLl protein expressed by the same cell type or tissue type in the reference control subject or population of reference control subjects.
  • expression of any of the vectors disclosed herein in the cell(s) or tissue(s) of the test subject results in an increase in levels of CFH and/or FHLl protein or functional CFH and/or FHLl protein, but the increased levels of CFH and/or FHLl protein or functional CFH and/or FHLl protein exceed the levels of CFH and/or FHLl protein or functional CFH and/or FHLl protein by no more than 1%, 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% of the levels expressed by the same cell type or tissue type in the reference control subject or population of reference control subjects.
  • any of the treatment and/or prophylactic methods disclosed herein are applied to a subject.
  • the subject is a mammal.
  • the subject is a human.
  • the human is an adult.
  • the human is an elderly adult.
  • the human is at least 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95 years of age.
  • the human is at least 60 or 65 years of age.
  • any of the treatment and/or prophylactic methods disclosed herein is for use in treatment of a patient having one or more mutations that causes amacular degeneration (AMD) or that increases the likelihood that a patient develops AMD.
  • AMD amacular degeneration
  • any of the treatment and/or prophylactic methods disclosed herein is for use in treatment of a patient having one or more mutations that causes atypical hemolytic uremic syndrome (aHUS) or that increases the likelihood that a patient develops aHUS.
  • the one or more mutations are in the patient's CFI gene.
  • the one or more mutations are in the patient's CFH gene. In some embodiments, the one or more mutations are in both the patient's CFH and CFI genes. In some embodiments, the subject has a loss-of-function mutation in the subject's CFH gene. In some embodiments, the subject has a loss-of-function mutation in the subject's CFI gene.
  • any of the treatment and/or prophylactic methods disclosed herein is for use in treatment of a patient having one or more mutations in the patient's CFI gene.
  • the patient has a mutation in one or more of the FIMAC, CD5, LI, Ll- Ca binding, Ll-disulfid bond, L2, L2-Ca binding, serine protease, or serine protease active site domains.
  • the patient has one or more mutations in the disulphide bond sites in the CFI protein.
  • the mutation is one or more of the mutations selected from the group consisting of: E548Q, V412M, A43 IT, A43 IS, K441R, P553S, A240G, A258T, G119R, G261D, R202I, T300A, T203I, V152M, R317W, G287R, E554V, I340T, G162D, P50A, Y206N, D310E, H418L, p.(Tyr41 IStop), p.(Argl87Stop), R474Q, Y459S, R187Q, R339Q, G263V, p.(Arg339Stop), D477H, p.(Ile357Met), P64L, E109A, G125R, N177I, F198L, S221Y, D224N, C229R, V230M, G248E, G280D, A356P, V20I,
  • the mutation is any one of the mutations selected from the group consisting of: Gl 19R, L13 lR, V152M, G162D, R187Y, R187T, T203I, A240G, A258T, G287R, A300T, R317W, R339Q, V412M, and P553S.
  • any of the CFI mutant amino acid positions described herein correspond to the wildtype amino acid CFI sequence of SEQ ID NO: 35.
  • any of the treatment and/or prophylactic methods disclosed herein is for use in treatment of a patient having one or more mutations in the patient's CFH gene.
  • the patient has a mutation in one or more of the pre-SCRl or any of the SCR1-SCR20 domains.
  • the patient has a mutation in one or more of the transition regions between SCRs.
  • the mutation is one or more of the mutations selected from the group consisting of: H402Y, G69E, D194N, W314C, A806T, Q950H, p.Ilel84fsX, p.Lys204fsX, c.
  • the mutation is one or more of the mutations selected from the group consisting of: R2T, L3V, R53C, R53H, S58A, G69E, D90G, R175Q, S 193L, I216T, I221V, R303W, H402Y, Q408X, P503A, G650V, R1078S, and R1210C.
  • any of the CFH mutant amino acid positions described herein correspond to the wildtype amino acid CFH sequence of SEQ ID NO: 33.
  • any of the vectors disclosed herein are for use in treating a renal disease or complication.
  • the renal disease or complication is associated with AMD in the patient.
  • the renal disease or complication is associated with aHUS in the patient.
  • the vector administered for treating a renal disease or complication comprises a promoter that is associated with strong expression in the liver.
  • the promoter is an AAT1, PCK1, or ALB 1 promoter (e.g. , a promoter comprising the nucleotide sequence of any one of SEQ ID Nos: 16, 18 or 20).
  • the retinal diseases described above are associated with various retinal changes. These may include a loss of photoreceptor structure or function; thinning or thickening of the outer nuclear layer (ONL); thinning or thickening of the outer plexiform layer (OPL);
  • a method of preventing, arresting progression of or ameliorating any of the retinal changes associated with these retinal diseases is provided. As a result, the subject's vision is improved, or vision loss is arrested and/or ameliorated.
  • Vision loss associated with an ocular disorder refers to any decrease in peripheral vision, central (reading) vision, night vision, day vision, loss of color perception, loss of contrast sensitivity, or reduction in visual acuity.
  • a method of targeting one or more type(s) of ocular cells for gene augmentation therapy in a subject in need thereof is provided.
  • a method of targeting one or more type of ocular cells for gene suppression therapy in a subject in need thereof is provided.
  • a method of targeting one or more type of ocular cells for gene knockdown/augmentation therapy in a subject in need thereof is provided.
  • a method of targeting one or more type of ocular cells for gene correction therapy in a subject in need thereof is provided.
  • a method of targeting one or more type of ocular cells for neurotropic factor gene therapy in a subject in need thereof is provided.
  • the targeted cell may be an ocular cell.
  • the targeted cell is a glial cell.
  • the targeted cell is an RPE cell.
  • the targeted cell is a photoreceptor.
  • the photoreceptor is a cone cell.
  • the targeted cell is a Muller cell.
  • the targeted cell is a bipolar cell.
  • the targeted cell is a horizontal cell.
  • the targeted cell is an amacrine cell.
  • the targeted cell is a ganglion cell.
  • the gene may be expressed and delivered to an intracellular organelle, such as a
  • photoreceptor function loss means a decrease in photoreceptor function as compared to a normal, non-diseased eye or the same eye at an earlier time point.
  • increase photoreceptor function means to improve the function of the
  • photoreceptors or increase the number or percentage of functional photoreceptors as compared to a diseased eye (having the same ocular disease), the same eye at an earlier time point, a non-treated portion of the same eye, or the contralateral eye of the same patient.
  • Photoreceptor function may be assessed using the functional studies described above and in the examples below, e.g., ERG or perimetry, which are conventional in the art.
  • the treatment may be used to prevent the occurrence of retinal damage or to rescue eyes having mild or advanced disease.
  • the term "rescue” means to prevent progression of the disease to total blindness, prevent spread of damage to uninjured ocular cells, improve damage in injured ocular cells, or to provide enhanced vision.
  • the composition is administered before the disease becomes symptomatic or prior to photoreceptor loss.
  • symptomatic is meant onset of any of the various retinal changes described above or vision loss.
  • the composition is administered after disease becomes symptomatic.
  • the composition is administered after initiation of photoreceptor loss.
  • the composition is administered after outer nuclear layer (ONL) degeneration begins.
  • ONL outer nuclear layer
  • the composition is administered while bipolar cell circuitry to ganglion cells and optic nerve remains intact.
  • the composition is administered after initiation of photoreceptor loss.
  • the composition is administered when less than 90% of the photoreceptors are functioning or remaining, as compared to a non-diseased eye.
  • the composition is administered when less than 80% of the photoreceptors are functioning or remaining.
  • the composition is administered when less than 70% of the photoreceptors are functioning or remaining.
  • the composition is administered when less than 60% of the photoreceptors are functioning or remaining.
  • the composition is administered when less than 50% of the photoreceptors are functioning or remaining.
  • the composition is administered when less than 40% of the photoreceptors are functioning or remaining.
  • the composition is administered when less than 30% of the
  • composition is administered when less than 20% of the photoreceptors are functioning or remaining. In another embodiment, the composition is administered when less than 10% of the
  • the composition is administered only to one or more regions of the eye. In another embodiment, the composition is administered to the entire eye. In another embodiment, the method includes performing functional and imaging studies to determine the efficacy of the treatment. These studies include ERG and in vivo retinal imaging, as described in the examples below. In addition visual field studies, perimetry and microperimetry, pupillometry, mobility testing, visual acuity, contrast sensitivity, color vision testing may be performed. In yet another embodiment, any of the above described methods is performed in combination with another, or secondary, therapy. The therapy may be any now known, or as yet unknown, therapy which helps prevent, arrest or ameliorate any of the described retinal changes and/or vision loss.
  • the secondary therapy is encapsulated cell therapy (such as that delivering Ciliary Neurotrophic Factor (CNTF)). See, Sieving, P.A. et al, 2006. Proc Natl Acad Sci USA, 103( 10):3896-3901, which is hereby incorporated by reference.
  • the secondary therapy is a neurotrophic factor therapy (such as pigment epithelium -derived factor, PEDF; ciliary neurotrophic factor 3; rod-derived cone viability factor (RdCVF) or glial -derived neurotrophic factor).
  • the secondary therapy is anti-apoptosis therapy (such as that delivering X-linked inhibitor of apoptosis, XIAP).
  • the secondary therapy is rod derived cone viability factor 2.
  • the secondary therapy can be administered before, concurrent with, or after administration of the rAAV described above.
  • any of the vectors or compositions disclosed herein is administered to a subject in combination with any of the other vectors or compositions disclosed herein.
  • any of the vectors or compositions disclosed herein is administered to a subject in combination with another therapeutic agent or therapeutic procedure.
  • the additional therapeutic agent is an anti-VEGF therapeutic agent (e.g. , such as an anti-VEGF antibody or fragment thereof such as ranibizumab, bevacizumab or aflibercept), a vitamin or mineral (e.g. , vitamin C, vitamin E, lutein, zeaxanthin, zinc or copper), omega-3 fatty acids, and/or VisudyneTM.
  • the other therapeutic procedure is a diet having reduced omega-6 fatty acids, laser surgery, laser photocoagulation, submacular surgery, retinal translocation, and/or photodynamic therapy.
  • any of the vectors disclosed herein is administered to a subject in combination with an additional agent needed for processing and/or improving the function of the protein encoded by the vector/composition.
  • the vector comprises a CFH gene
  • the vector may be administered to a patient in combination with an antibody (or a vector encoding that antibody) that potentiates the activity of the expressed CFH protein. Examples of such antibodies are found in WO2016/028150, which is incorporated herein in its entirety.
  • the vector is administered in combination with an additional polypeptide (or a vector encoding that additional polypeptide), wherein the additional polypeptide is capable of processing the protein encoded by the vector, e.g. , processing an encoded precursor protein into its mature form.
  • the processing protein is a protease (e.g. , a furin protease).
  • any of the vectors disclosed herein is assembled into a pharmaceutical or diagnostic or research kit to facilitate their use in therapeutic, diagnostic or research applications.
  • a kit may include one or more containers housing any of the vectors disclosed herein and instructions for use.
  • the kit may be designed to facilitate use of the methods described herein by researchers and can take many forms.
  • Each of the compositions of the kit may be provided in liquid form (e.g., in solution), or in solid form, (e.g., a dry powder).
  • some of the compositions may be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species (for example, water or a cell culture medium), which may or may not be provided with the kit.
  • a suitable solvent or other species for example, water or a cell culture medium
  • Instructions also can include any oral or electronic instructions provided in any manner such that a user will clearly recognize that the instructions are to be associated with the kit, for example, audiovisual (e.g., videotape, DVD, etc.), Internet, and/or web-based communications, etc.
  • the written instructions may be in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which instructions can also reflects approval by the agency of manufacture, use or sale for animal administration.
  • AAV2 vectors were designed comprising either codon-optimized or non-codon-optimized CFH and/or CFHL sequences in combination with a variety of different promoters and, in some cases, SV40 introns.
  • Figures 1-6 show vector maps of the different vectors generated. A table is provided below outlining the gene included in the cassette, the promoter included, the Figure laying out the construct map, and the sequence associated with the vector.
  • AAV.CFH and AAV.FHLl vectors to transduce cells and regulate complement activity:
  • the CFH vectors indicated above each will be first tested in vitro in HEK293 and ARPE19 cells via transfection and evaluated for expression of the human CFH and FHLl protein in both cell pellets and in the supernatant. Techniques like Western blot will be used for protein detection and quantification. Quantitative Real time PCR will be used for determining mRNA expression levels. Regulation of complement activity will be tested in a cell culture model of blue light irradiation of A2E-laden retinal pigment epithelial cells as described in van der Burght et al, Acta Ophthalmol, 2013. Briefly, ARPE-19 cell line is grown to confluence and cultured in standard media plus or minus lOuM A2E for 4 weeks.
  • RPE are irradiated with blue light. Media is replaced with PBS plus calcium, magnesium and 5.5mM glucose and cells are irradiated with blue light (430 +/- 30nm) for 0, 5 or 10 minutes. RPE cells are incubated with appropriately-complement depleted human serum +/- and transfected with the AAV. CFH and AAV.FHL1 vectors. Immunoreactivity of RPE with cell surface markers, CD46, CD55 and CD59 and C3 and MAC deposition will be assessed by fluorescent microscopy or western blot. Levels of iC3b will be measured by Western Blot.
  • the AAV. CFH and AAV. FHLl vectors will be tested in mouse models of light-induced retinal degeneration and laser induced choroidal neovascularization via intravitreal injections. Amount of protein produced and its biodistribution in the retina will be tested via Western blot and immunohistochemistry.
  • CFH and FHLl proteins produced and secreted by the RPE. Amount of secreted CFH and FHLl protein will be measured in the retina and the choroid compared to uninjected or sham injected cohorts. Increased levels of CFH and FHLl in the retina and choroid is expected to provide therapeutic benefits in the AMD population with rare mutations that lead to the loss or decreased amount of these protein.
  • Plasmids capable of expressing CFH or GFP under the control of one of several specific promoters were transfected into HEK- 293T cells. Cells were transfected using 1 mg/L plasmid DNA. Cells were transfected with PEI at a 1 : 1 DNA:PEI ratio. Cells were cultured for 120hr and sampled for analysis. Cells were lysed and supernatants were harvested and run on reducing PAGE gel and transferred to membranes for Western blot.
  • Primary antibody for detection of CFH is Quidel goat antiserum to human CFH at 1: 1000 at 4°C with rotation O/N.
  • FIG. 18 depicts the results from the Western blot analysis. Robust CFH expression was observed in cell samples transfected with the CFH plasmid under the control of the EFla.SV40i; EFla; or CRALBP promoters, while lower expression was observed in the samples transfected with the CFH plasmid under the control of the AAT1 promoter. No CFH was detected in the negative control samples. The data from the Western Blot was quantified by densitometry and the ratio between the level of CFH expression and the level of GAPDH expression for each sample was calculated (Figure 19).
  • HEK-293 cells were transduced for three days with various CFH-AAV2 constructs and supernatant samples were harvested and run on a reducing PAGE gel with various controls such as recombinant CFH, recombinant GFP, untrasfected cell lysate, or cells transfected with recombinant GFP rather than CFH.
  • Quidel goat anti-human CFH (A312) was utilized to detect CFH and the blot was incubated at a 1 : 1,000 dilution overnight and after washing with rabbit Anti-Goat HRP Secondary (Jackson Immunore search) at 1 :5000 dilution for 1 hour at room temperature with rotation.
  • mice were intravitreally injected with AAV2-CFH vectors under the control of the EFla.SV40i or EFla promoters. Eyes were collected 21 days after injection and immunohistochemistry was performed for detection of CFH protein. Eyes were embedded and section and put on slides by standard methods. Slides were washed for 3 x 5 minutes in IX PBS. Sections were blocked with blocking buffer (5% BSA, 10% Donkey serum, 0.5% Triton X-100) at room temperature for 1 hour in dark humidity chamber. Samples were stained with CFH antibody (Novus cat. AF4779-SP) at a concentration of 1 :20 overnight at 4°C in dark humidity chamber. Antibody solution was prepared in blocking buffer.
  • blocking buffer 5% BSA, 10% Donkey serum, 0.5% Triton X-100
  • Example 5 Treatment of Patients with AMD with AAV Vectors This study will evaluate the efficacy of the vectors of Example 1 for treating patients with AMD. Patients with AMD will be treated with any of the CFH AAV2 vectors, or a control. The vectors will be administered at varying doses between 2.5 xlO 8 vg to 1.4xlO n vg/ per eye in about 100 ⁇ . The vectors will be administered by intravitreal injection in a solution of PBS with additional NaCl and pluronic. Patients will be monitored for improvements in AMD symptoms.
  • SEQ ID NO: 1 Codon Optimized Human Factor H Like 1 (FHL1)
  • SEQ ID NO: 3 Non-Codon Optimized Human Factor H Like 1 (FHL1)
  • SEQ ID NO: 8 EFla Promoter ACGCGTTAACTAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGG
  • SEQ ID NO: 9 Representative CFH AAV vector (EFla promoter)
  • SEQ ID NO: 11 Representative CFH AAV vector (with EFla promoter and SV40i intron) CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCG GGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAG AGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCACGCGTTAACTAGT GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGAGGGGTCGGCA ATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCG
  • SEQ ID NO: 13 Representative CFH AAV Vector (with HSP70 Promoter)
  • SEQ ID NO: 15 Representative CFH AAV Vector (with sCBA Promoter and SV40i Intron) CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCG GGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAG AGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCACGCGTTAACTAGT CCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCTCCCCACCCCCAATTTTGT
  • SEQ ID NO: 18 ALB Promoter GTTAACACGCGTTAACTAGTCAGTTCCAGATGGTAAATATACACAAGGGATTTAG
  • SEQ ID NO: 21 Representative CFH AAV Vector (with PCKlPromoter)
  • SEQ ID NO: 22 Representative FHL AAV Vector (with EFla Promoter)
  • SEQ ID NO: 23 Representative FHL AAV Vector (with ALB Promoter)
  • SEQ ID NO: 24 Representative FHL AAV Vector (with AAT1 Promoter) CCTGCAGGCAGCTGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAG CCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGC GCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGCA GTTCCAGATGGTAAATATACACAAGGGATTTAGTCAAACAATTTTTTGGC AAGAATATTATGAATTTTGTAATCGGTTGGCAGCCAATGAAATACAAAGA TGAGTCTAGTTAATAATCTACAATTATTGGTTAAAGACCGGTCTCGAAGG CCTGCAGGCGGCCGCCGCCACCATGAATGAGACTTCTAGCAAAGATTATT TGCCTTATGTTATGGGCTATTTGTGTAGCAGAAGATTGCAATGAACTTCC TCCAAGAAGAAATACAGAAATTCTGACAGGTTCCTGGTCTGACCAAACAT ATCCAGAAGGCACCCAGGCT
  • SEQ ID NO: 25 Representative FHL AAV Vector (with EFla.SV40i Promoter) CCTGCAGGCAGCTGCGCGCTCGCTCACTGAGGCCGCCCGGGCAAAG CCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGC GCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGAC GCGTTAACTAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTG GGGGGAGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGT AAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTG GGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGC TTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAAAAAGAACTGCTCCTCAGT GGATGTTGCCTTTACTTCTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAAAAAAAAAAAAAAAA
  • SEQ ID NO: 26 Representative FHL AAV Vector (with CAG Promoter)
  • GAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACT CAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTT CGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAAT TTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAAT CTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCG CTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAA GCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATC
  • SEQ ID NO: 28 Representative FHL AAV Vector (with hRPE65 Promoter) CCTGCAGGCAGCTGCGCGCTCGCTCACTGAGGCCGCCCGGGCAAAG CCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGC GCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCCGTA TATTTATTGAAGTTTAATATTGTGTTTGTGATACAGAAGTATTTGCTTTA ATTCTAAATAAAAATTTTATGCTTTTATTGCTGGTTTAAGAAGATTTGGA TTATCCTTGTACTTTGAGGAGAAGTTTCTTATTTGAAATATTTTGGAAAC AGGTCTTTTAATGTGGAAAGATAGATATTAATCTCCTCTTCTATTACTCT CCAAGATCCAACAAAAGTGATTATACCCCCCAAAATATGATGGTAGTATC TTATGGAAAC AGGTCTTTTAATGTGGAAAGATAGATATTAATCTCCTCTTCTATTACTCT CCAAGA
  • SEQ ID NO: 29 Representative FHL AAV Vector (with HSP70 Promoter)
  • SEQ ID NO: 30 Representative FHL AAV Vector (with PCK1 Promoter)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
PCT/US2018/056709 2017-10-20 2018-10-19 COMPOSITIONS AND METHODS FOR TREATING AGE-RELATED MACULAR DEGENERATION Ceased WO2019079718A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
EP18869436.8A EP3697920A4 (en) 2017-10-20 2018-10-19 COMPOSITIONS AND METHODS FOR THE TREATMENT OF AGE-RELATED MACULAR DEGENERATION
CN201880078342.1A CN111788311A (zh) 2017-10-20 2018-10-19 用于治疗年龄相关性黄斑变性的组合物和方法
CA3079553A CA3079553A1 (en) 2017-10-20 2018-10-19 Compositions and methods for treating age-related macular degeneration
US16/757,268 US20210188927A1 (en) 2017-10-20 2018-10-19 Compositions and methods for treating age-related macular degeneration
JP2020542710A JP2021500922A (ja) 2017-10-20 2018-10-19 加齢黄斑変性を処置するための組成物および方法
AU2018351491A AU2018351491A1 (en) 2017-10-20 2018-10-19 Compositions and methods for treating age-related macular degeneration

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762574814P 2017-10-20 2017-10-20
US62/574,814 2017-10-20

Publications (1)

Publication Number Publication Date
WO2019079718A1 true WO2019079718A1 (en) 2019-04-25

Family

ID=66174265

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/056709 Ceased WO2019079718A1 (en) 2017-10-20 2018-10-19 COMPOSITIONS AND METHODS FOR TREATING AGE-RELATED MACULAR DEGENERATION

Country Status (7)

Country Link
US (1) US20210188927A1 (https=)
EP (1) EP3697920A4 (https=)
JP (1) JP2021500922A (https=)
CN (1) CN111788311A (https=)
AU (1) AU2018351491A1 (https=)
CA (1) CA3079553A1 (https=)
WO (1) WO2019079718A1 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020086735A1 (en) * 2018-10-23 2020-04-30 Gemini Therapeutics Inc. Compositions and methods for treating age-related macular degeneration and other diseases
WO2021081395A1 (en) * 2019-10-23 2021-04-29 Gemini Therapeutics Inc. Methods for treating patients having cfh mutations with recombinant cfh proteins
WO2021081203A1 (en) * 2019-10-22 2021-04-29 Applied Genetic Technologies Corporation Adeno-associated virus (aav)vectors for the treatment of age-related macular degeneration and other ocular diseases and disorders
US20210338838A1 (en) * 2018-07-20 2021-11-04 University Of Utah Research Foundation Gene therapy for macular degeneration
WO2022079453A1 (en) * 2020-10-16 2022-04-21 Gyroscope Therapeutics Limited Nucleic acid encoding an anti-vegf entity and a negative complement regulator and uses thereof for the treatment of age-related macular degeneration
WO2022094340A1 (en) * 2020-10-30 2022-05-05 Gemini Therapeutics Sub, Inc. Methods for treating inflammatory ocular diseases with complement factor h
US12116606B2 (en) 2020-06-14 2024-10-15 Vertex Pharmaceuticals Incorporated Complement factor I-related compositions and methods
AU2023274191B2 (en) * 2018-12-21 2025-10-30 Gyroscope Therapeutics Limited Codon-Optimised Complement Factor I

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB202003618D0 (en) 2020-03-12 2020-04-29 Univ Bristol Gene Therapy
CN115786308B (zh) * 2022-11-24 2024-05-31 江苏海洋大学 一种提高右旋糖酐酶热稳定性的方法及突变体

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006088950A2 (en) * 2005-02-14 2006-08-24 University Of Iowa Research Foundation Methods and reagents for treatment and diagnosis of age-related macular degeneration
WO2017053732A2 (en) * 2015-09-24 2017-03-30 The Trustees Of The University Of Pennsylvania Composition and method for treating complement-mediated disease
WO2017072515A1 (en) * 2015-10-28 2017-05-04 Syncona Management Llp Gene therapy

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005333845A (ja) * 2004-05-25 2005-12-08 Tokyoto Igaku Kenkyu Kiko ミトコンドリア局在型DsRed2及びECFP発現ベクター

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006088950A2 (en) * 2005-02-14 2006-08-24 University Of Iowa Research Foundation Methods and reagents for treatment and diagnosis of age-related macular degeneration
WO2017053732A2 (en) * 2015-09-24 2017-03-30 The Trustees Of The University Of Pennsylvania Composition and method for treating complement-mediated disease
WO2017072515A1 (en) * 2015-10-28 2017-05-04 Syncona Management Llp Gene therapy

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CASHMAN, S.M. ET AL.: "Adenovirus-mediated delivery of Factor H attenuates complement C3 induced pathology in the murine retina: a potential gene therapy for age-related macular degeneration", THE JOURNAL OF GENE MEDICINE, vol. 17, 2015, pages 229 - 243, XP055336604, Retrieved from the Internet <URL:https://doi.org/10.1002/jgm.2865> DOI: doi:10.1002/jgm.2865 *
SCHMIDT, C.Q. ET AL.: "A new map of glycosaminoglycan and C3b binding sites on factor H.", JOURNAL OF IMMUNOLOGY, vol. 181, 2008, pages 2610 - 2619, XP002704048, DOI: doi:10.4049/jimmunol.181.4.2610 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210338838A1 (en) * 2018-07-20 2021-11-04 University Of Utah Research Foundation Gene therapy for macular degeneration
WO2020086735A1 (en) * 2018-10-23 2020-04-30 Gemini Therapeutics Inc. Compositions and methods for treating age-related macular degeneration and other diseases
AU2023274191B2 (en) * 2018-12-21 2025-10-30 Gyroscope Therapeutics Limited Codon-Optimised Complement Factor I
US12570707B2 (en) 2018-12-21 2026-03-10 Novartis Pharmaceuticals Uk Limited Codon-optimised complement factor I
WO2021081203A1 (en) * 2019-10-22 2021-04-29 Applied Genetic Technologies Corporation Adeno-associated virus (aav)vectors for the treatment of age-related macular degeneration and other ocular diseases and disorders
EP4048321A4 (en) * 2019-10-22 2023-11-22 Applied Genetic Technologies Corporation ADENO-ASSOCIATED VIRUS (AAV) VECTORS FOR THE TREATMENT OF AGE-RELATED MACULAR DEGENERATION AND OTHER EYE DISEASES AND DISORDERS
WO2021081395A1 (en) * 2019-10-23 2021-04-29 Gemini Therapeutics Inc. Methods for treating patients having cfh mutations with recombinant cfh proteins
US20220395557A1 (en) * 2019-10-23 2022-12-15 Gemini Therapeutics Sub, Inc. Methods for treating patients having cfh mutations with recombinant cfh proteins
US12116606B2 (en) 2020-06-14 2024-10-15 Vertex Pharmaceuticals Incorporated Complement factor I-related compositions and methods
WO2022079453A1 (en) * 2020-10-16 2022-04-21 Gyroscope Therapeutics Limited Nucleic acid encoding an anti-vegf entity and a negative complement regulator and uses thereof for the treatment of age-related macular degeneration
WO2022094340A1 (en) * 2020-10-30 2022-05-05 Gemini Therapeutics Sub, Inc. Methods for treating inflammatory ocular diseases with complement factor h

Also Published As

Publication number Publication date
AU2018351491A1 (en) 2020-05-07
EP3697920A1 (en) 2020-08-26
US20210188927A1 (en) 2021-06-24
CA3079553A1 (en) 2019-04-25
EP3697920A4 (en) 2022-03-02
JP2021500922A (ja) 2021-01-14
CN111788311A (zh) 2020-10-16

Similar Documents

Publication Publication Date Title
US20210188927A1 (en) Compositions and methods for treating age-related macular degeneration
US20210371480A1 (en) Compositions and methods for treating age-related macular degeneration and other diseases
EP2844302B1 (en) Viral vectors for the treatment of retinal dystrophy
EP3113787B1 (en) Improved raav vectors and methods for transduction of photoreceptors and rpe cells
US20210154325A1 (en) Promoters, expression cassettes, vectors, kits, and methods for the treatment of achromatopsia and other diseases
AU2012204266B2 (en) Promoters, expression cassettes, vectors, kits, and methods for the treatment of achromatopsia and other diseases
KR20200086292A (ko) 바이러스 벡터를 제조하기 위한 수단 및 방법 및 그의 용도
WO2023240236A1 (en) Compositions and methods for the treatment of spinal muscular atrophy related disorders
US20230265455A1 (en) Improved aav-mediated x-linked retinoschisis therapies
CN113474461A (zh) 治疗bietti晶体营养不良的组合物和方法
US20220396807A1 (en) Methods for treating patients having cfh mutations with cfh-encoding vectors
US20200270614A1 (en) RNAi-BASED THERAPEUTICS FOR TARGETING HTRA1 AND METHODS OF USE
AU2020212026B2 (en) Highly efficient transduction and lateral spread in the retina by a novel AAV virus enhanced by rational design
US20220088222A1 (en) Compositions and methods for the treatment of degenerative ocular diseases
HK40036018A (en) Compositions and methods for treating age-related macular degeneration
EP4704917A1 (en) Dual aav vectors for treating stargardt disease
TW202542310A (zh) 靶向tau的人工微rna
NZ713958B2 (en) Promoters, expression cassettes, vectors, kits, and methods for the treatment of achromatopsia and other diseases
NZ753155B2 (en) Promoters, expression cassettes, vectors, kits, and methods for the treatment of achromatopsia and other diseases

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18869436

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3079553

Country of ref document: CA

Ref document number: 2020542710

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018351491

Country of ref document: AU

Date of ref document: 20181019

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018869436

Country of ref document: EP

Effective date: 20200520