WO2019066378A1 - Factor viii 또는 factor ix 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도 - Google Patents

Factor viii 또는 factor ix 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도 Download PDF

Info

Publication number
WO2019066378A1
WO2019066378A1 PCT/KR2018/011118 KR2018011118W WO2019066378A1 WO 2019066378 A1 WO2019066378 A1 WO 2019066378A1 KR 2018011118 W KR2018011118 W KR 2018011118W WO 2019066378 A1 WO2019066378 A1 WO 2019066378A1
Authority
WO
WIPO (PCT)
Prior art keywords
factor
rabbit
transgenic
rabbits
sgrna
Prior art date
Application number
PCT/KR2018/011118
Other languages
English (en)
French (fr)
Inventor
김소라
정명은
김민정
조승현
황성호
곽희천
이수민
남현자
Original Assignee
주식회사 녹십자
재단법인 목암생명과학연구소
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2018341437A priority Critical patent/AU2018341437B2/en
Priority to MX2020005732A priority patent/MX2020005732A/es
Priority to JP2020518017A priority patent/JP7091450B2/ja
Priority to US16/651,200 priority patent/US20210161111A1/en
Priority to EA202090635A priority patent/EA202090635A1/ru
Priority to CN201880068875.1A priority patent/CN111492060A/zh
Application filed by 주식회사 녹십자, 재단법인 목암생명과학연구소 filed Critical 주식회사 녹십자
Priority to KR1020207008487A priority patent/KR102268072B1/ko
Priority to BR112020006311-8A priority patent/BR112020006311A2/pt
Priority to EP18862737.6A priority patent/EP3690053A4/en
Priority to CA3077160A priority patent/CA3077160A1/en
Publication of WO2019066378A1 publication Critical patent/WO2019066378A1/ko
Priority to AU2021250834A priority patent/AU2021250834A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1025—Acyltransferases (2.3)
    • C12N9/104—Aminoacyltransferases (2.3.2)
    • C12N9/1044—Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • C12N9/644—Coagulation factor IXa (3.4.21.22)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2207/00—Modified animals
    • A01K2207/15—Humanized animals
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A01K2217/052—Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/15—Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/20—Animal model comprising regulated expression system
    • A01K2217/203—Animal model comprising inducible/conditional expression system, e.g. hormones, tet
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/107—Rabbit
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Definitions

  • the present invention relates to a rabbit knocked out of Factor VIII or Factor IX gene, a method for producing the rabbit, and a use thereof, and more specifically, a transgenic rabbit knockout of Factor VIII or Factor IX with CRISPR / Cas9 system, Lt; / RTI >
  • Blood clotting is a complex and major process that occurs in response to vascular injury. This consists of the formation of a thrombus that stops bleeding and begins to restore the damaged vessel; The site of injury is covered by fibrin and platelets, including thrombus. The process starts almost immediately after the damage.
  • the blood coagulation process involves two types of components, a cellular component called platelets and a protein component called coagulation factor. Platelets immediately form plugs at the site of injury, which is referred to as primary hemostasis. Secondary hemostasis occurs at the same time and proteins in plasma called coagulation factors or coagulation factors react through a complex cascade process to form fibrin strands that enhance the platelet plug.
  • the coagulation cascade of secondary hemostasis is divided into two pathways: endogenous pathway, also called contact activation pathway, and extrinsic pathway, also called tissue factor pathway. Not only are a number of coagulation factors involved, but cofactors and regulators are involved to keep the process accurate.
  • protein C is an essential factor in the main mechanism of coagulation control, referred to as the " anticoagulation pathway. &Quot;
  • the active form of protein C (activating protein C) is serine protease, which, when associated with other cofactors (protein S), degrades two factors of the clot cascade essential for the production of large amounts of thrombin, namely Factor Va and Factor VIIIa do. The destruction of these factors negatively regulates the amount of thrombin formed, which leads to an anticoagulant effect.
  • proteins are known to have multifunctional expression biological activities such as antithrombotic activity, anti-inflammatory activity, anti-apoptotic activity and pro-fibrinolytic activity
  • FIX Factor IX
  • FXa active cofactor Factor VIIIa
  • Factor X is another essential factor of the clotting cascade.
  • the activated form of FX (FXa) is the only serine protease that is capable of activating prothrombin with thrombin in conjunction with its cofactor (coagulation factor Va factor).
  • Factor X which has long been considered as a passive vasodilator, has been shown to directly participate in a wide variety of cell types through activation of its two major receptors, protease-activated receptor-1 (PAR-1) and PAR- ≪ / RTI > According to recent findings, it has been suggested that PAR-2 plays an important role in Factor X factors as an important mediator of coordination between coagulation and disease progression and fibrotic diseases such as fibrosis, tissue remodeling and cancer (Borensztajn et al., Am J Pathol. 2008; 172: 309-20).
  • hemophilia A when lack of Factor VIII factor
  • hemophilia B when lack of Factor IX.
  • Hemophilia A is the most common hereditary coagulopathy worldwide, with the exception of von Willebrand disease, accounting for 80-85% of all hemophilia, with a frequency of 1 per 5,000-10,000 survivors Reported.
  • Hemophilia B is less common and is estimated to be about 1/5 of hemophilia A.
  • Factor VIII and Factor IX The activity of Factor VIII and Factor IX is about 50-150% in normal subjects, and the activity of hemophilia A and B is decreased in blood test.
  • Factor VIII or Factor IX activity is less than 1%
  • moderate factor activity 1-5%
  • mild factor activity 5-30%
  • sub-normal factor activity 30- 50%
  • the symptoms differ according to the moderate degree.
  • the moderate distribution of hemophilia A is 70%, 15%, 15%, and 50%, 30% and 20%, respectively, in patients with severe, moderate or mild disease.
  • the frequency of bleeding is generally known as once a week for severe patients, once a month for moderate patients, and once a year for mild patients. Joints and muscles are the most common sites of bleeding. Particularly, joint bleeding is evident between 15 and 25 years of age, and in case of repeated bleeding, it will suffer from the formation of joints due to hemophilic arthropathy for an average of 50 years.
  • hemophilia A patients The incidence of antibody production in hemophilia A patients is about 30%, and about 3% in hemophilia B patients (Kessler CM, Hematology Am Soc Hematol Educ. Program 2005: 429-35).
  • Antibodies to hemophilia therapy are most commonly encountered within 50 days of drug exposure, and are classified as antibody-producing when they are more than 0.6 Bethesda Unit (BU), and are classified as high antibody-producing when they are above 5 BU (Kasper CK et al.
  • BU Bethesda Unit
  • the CRISPR / Cas system which is an immune system for microorganisms to respond to viruses, can selectively cut the target sequence by introducing CRISPR / Cas system into cells of different kinds in 2012, (Jinek et al., Science, 337 (6096), and the like are known to be capable of editing genomes for various cells up to the present time ): 816-821, 2012).
  • the CRISPR / Cas9 system of the CRISPR / Cas system generates a double-strand break (DSB) on the target DNA by Cas9 and sgRNA constituting the CRISPR / Cas9 system
  • This process induces normal DNA repair processes by non-homologous end joining (NHEJ) or homology-directed repair (HDR), and normalization by mutation or gene replacement Because it is possible, it can be used to induce genome editing.
  • NHEJ non-homologous end joining
  • the non-homologous end joining (NHEJ) mechanism is a simple joining after refinement of the DSB produced by the action of the CRISPR / Cas system. In this process, framehift mutation is introduced, Homologue-directed repair (HDR) may occur when there is a genomic fragment of homologous to the cleaved site, and this mechanism may lead to normalization or deletion by gene replacement .
  • Such a CRISPR / Cas system is very advantageous for the production of transgenic animals because it can eliminate the precise location of the target gene.
  • FVIII / FIX has been knocked out by application of the CRISPR / Cas system in NSG mice (Nod / Scid-Il2 ⁇ - / - (Ching-Tzu Yen, et al., Thrombosis Journal, Vol. 14: 22, 2016).
  • Rabbits are more promising animal models for biomedical research because they show more similarities with humans in physiology and anatomy than mice and require lower maintenance and shorter gestation periods than pigs and monkeys.
  • the CRISPR / Cas system There is no known hemophilia rabbit model.
  • the present inventors have made intensive efforts to produce knockout rabbits of Factor 8 and / or Factor 9, and as a result have found that they contain an sgRNA capable of complementarily binding to the exon region of Factor 8 and /
  • the present inventors completed the present invention upon confirming that knockout rabbits can be prepared by using Factor 8 and / or Factor 9 when rabbits are prepared using the CRISPR / Cas system.
  • Another object of the present invention is to provide a transgenic rabbit knocked out with Factor 8 and / or Factor 9 produced using the CRISPR / Cas9 system and a method for producing the same.
  • Another object of the present invention is to provide a use such as the use of transgenic rabbits knocked out of Factor 8 and / or Factor 9 as a model for hemophilia research.
  • the present invention provides an sgRNA comprising a targeting domain that binds complementarily to a part of the exon region of factor VIII (FVIII) or factor 9 (Factor IX, FIX).
  • the present invention also relates to a polynucleotide encoding said sgRNA, a vector inserted with said polynucleotide, a CRISPR / Cas9 system comprising said vector, and an eighth factor and / or a ninth factor produced using said CRISPR / Cas9 system Lt; / RTI > transgenic rabbit transgenic rabbits.
  • step (A) transcribing the CRISPR / Cas9 system to produce sgRNA and Cas9 mRNA; (b) introducing and culturing the mRNA prepared in the step (a) into an embryo; And (c) transplanting the embryo obtained in step (b) into a surrogate mother and delivering the embryo to a surrogate mother.
  • the present invention also provides cells, tissues and by-products isolated from transgenic rabbits knocked out of Factor 8 or 9.
  • FIG. 1 (A) is a schematic diagram showing the position of an eighth factor gene targeted by an sgRNA produced for producing a transgenic rabbit according to an embodiment of the present invention
  • Fig. 3 is a schematic diagram showing the position of a factor 9 gene targeted by the sgRNA produced for producing the transgenic rabbit.
  • Fig. 2 (A) shows the sequence of the amplicon used in the NGS-based sequencing analysis for detecting the knockout of the factor VIII in the transgenic rabbit produced in the present invention
  • Fig. 2 (B) The sequence of the amplicon used in NGS-based sequencing analysis to detect knockout of Factor 9 in rabbits.
  • FIG. 3 (A) is a result of confirming that 4 bp of the factor VIII gene has been deleted in the 8th factor knockout rabbit second individual produced in the present invention, and (B) shows the result of the 8th factor knockout rabbit And a deletion mutation of the factor VIII gene in the third individual.
  • FIG. 4 (A) is a result of confirming the deletion mutation of the factor-9 gene in the ninth round knockout rabbit No. 6 produced in the present invention
  • (B) (C) shows the result of confirming the deletion mutation of the factor 9 gene in the eighth animal of the ninth knockout rabbit produced in the present invention.
  • FIG. 5 (A) is a result of confirming the deletion mutation of the factor 9 gene in the ninth genotype knockout rabbit 9 produced in the present invention
  • FIG. 5 (B) In which the deletion mutation of the factor 9 gene was confirmed.
  • FIG. 6 (A) is a result of confirming the deletion mutation of the factor 9 gene in the ninth knockout rabbit No. 12 produced in the present invention
  • (B) (C) shows the result of confirming the deletion mutation of the factor 9 gene in the ninth article of knockout rabbit No. 9 produced in the present invention.
  • FIG. 7 is a graph showing the results of APTT analysis of transgenic rabbits knocked out with the eighth factor or ninth factor, wherein four normal rabbits, two rabbits knocked out of the eighth factor, This experiment was repeated twice or three times with seven plasma samples.
  • (B) is a graph showing the results of TGA analysis performed twice or three times with 9 normal rabbits, 3 rabbits knocked out of factor 8, and 8 rabbits rabbits knocked out. The results are shown as means ⁇ s.e.m. Statistical significance was confirmed by two-tailed, unpaired t-test, ** means p ⁇ 0.01 and *** means p ⁇ 0.001.
  • Figure 8 shows a reproduction family diagram for F1 generation and F2 generation.
  • FIG. 9 shows the result of confirming the gene Indel mutation of the offspring female obtained by crossing the male of the second factor knockout rabbit of the present invention with the normal female.
  • FIG. 10 shows the result of confirming the genetic deletion mutation of the progeny females obtained by crossing the male of the ninth knockout rabbit of the present invention with the normal female.
  • FIG. 11 shows the result of confirming the gene Indel mutation of the F2 male obtained by crossing the female F1 (X'X) of the eighth knockout rabbit produced in the present invention with the normal male.
  • FIG. 12 shows the result of confirming the gene Indel mutation in the F2 male obtained by crossing the female F1 (X'X) of the ninth knockout rabbit produced in the present invention with the normal male.
  • FIG. 13 is a schematic diagram for manufacturing a rabbit toenail hemorrhage model.
  • nucleic acid and polynucleotide of the present invention refer to deoxyribonucleotides or ribonucleotide polymers in linear or cyclic stereochemistry and in single- or double-stranded form. For purposes of the present invention, these terms are not to be construed as limiting on the length of the polymer. These terms may encompass nucleotides that are modified in base, sugar and / or phosphate moieties (e.g., phosphorothioate backbone) as well as known analogs of natural nucleotides. In general, analogs of particular nucleotides have the same base-mating specificity; That is, an analogue of A will base pair with T.
  • nucleotides refers to deoxyribonucleotides or ribonucleotides.
  • the nucleotides may be standard nucleotides (i.e., adenosine, guanosine, cytidine, thymidine, and uridine) or nucleotide analogs.
  • a nucleotide analogue refers to a nucleotide having a modified purine or pyrimidine base or a modified ribose moiety.
  • the nucleotide analog may be a naturally occurring nucleotide (e. G., Inosine) or a naturally occurring nucleotide.
  • nucleotide analogs also include dideoxynucleotides, 2'-O-methyl nucleotides, locked nucleic acids (LNA), peptide nucleic acids (PNA), and morpholino.
  • " sgRNA " of the present invention refers to a first region that is complementary to a target region in an inducible RNA (guide RNA) that induces Cas protein to a target region in a CRISPR / Cas system.
  • guide RNA inducible RNA
  • the inducible RNA interacts with the Cas protein to direct the Cas protein to a specific target site, and the 5 'end of the induced RNA at this site forms a base pair with a specific protospaser sequence within the chromosome sequence.
  • Each inducible RNA contains three regions: a first region at the 5 'end complementary to the target site in the chromosomal sequence, a second internal region forming a stem loop structure, and a third 3' domain.
  • the first region of each inducible RNA is different so that each derived RNA will direct the fusion protein to a specific target site.
  • the second and third regions of each inducible RNA can be identical in all derived RNAs.
  • the first region of the inducible RNA is complementary to the sequence at the target site (ie, the proto-spacer sequence) within the chromosome sequence so that the first region of the derived RNA can base-pair with the target site.
  • the first region of the induced RNA may comprise from about 10 nucleotides to about 25 nucleotides.
  • the first region of the inducible RNA and the region of base overlap between the target sites in the chromosomal sequence are about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 25, or more than 25 nucleotides.
  • the first region of the derived RNA is about 19, 20, or 21 nucleotides in length.
  • the induced RNA also includes a second region that forms a secondary structure.
  • the secondary structure comprises a stem (or hairpin) and a loop.
  • the length of the loop and stem can vary.
  • the loop can vary in length from about 3 to about 10 nucleotides in length
  • the stem can vary in length from about 6 to about 20 base pairs in length.
  • the stem may comprise one or more protrusions of 1 to about 10 nucleotides.
  • the overall length of the second region may vary from about 16 to about 60 nucleotides in length.
  • the loop is about 4 nucleotides in length
  • the stem contains about 12 base pairs.
  • the derived RNA also contains a third region at the 3 'end that remains essentially a single strand.
  • the third region does not have complementarity to any chromosomal sequence within the cell of interest and has no complement to the rest of the induced RNA.
  • the length of the third region may vary. Generally, the third region is more than about four nucleotides in length. For example, the length of the third region may vary from about 5 to about 60 nucleotides in length.
  • the combined length of the second and third regions of the induced RNA can range from about 30 to about 120 nucleotides in length. In one aspect, the combined length of the second and third regions of the induced RNA varies from about 70 to about 100 nucleotides in length.
  • a CRISPR / Cas system was used to confirm whether rabbits knocked out with Factor 8 and / or Factor 9 can be produced.
  • an sgRNA comprising a targeting domain that binds complementarily to a part of the exon region of Factor VIII (FVIII) or Factor IX (FIX)
  • the CRISPR / Cas system was transcribed, injected into rabbit embryos, cultured and transplanted into surrogate mothers, and rabbits were produced.
  • deletion mutants in the exon region of Factor 8 or 9 of the prepared rabbit Fig. 3 to Fig. 7).
  • the invention relates to an sgRNA comprising a targeting domain that binds complementarily to a portion of the exon region of Factor VIII, FVIII, or Factor IX, FIX.
  • the exon region of the factor VIII gene may be an exon region represented by the nucleotide sequence of SEQ ID NO: 1, but is not limited thereto.
  • the exon region of the ninth factor gene may be an exon region represented by the nucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
  • the present invention also relates to a polynucleotide encoding said sgRNA.
  • the polynucleotide may be characterized by being represented by any one of the nucleotide sequences of SEQ ID NOS: 3 to 6, but is not limited thereto.
  • the polynucleotide encoding the sgRNA is generally operably linked to at least one transcription control sequence for expression of the sgRNA in the cell or embryo of interest.
  • the DNA encoding the sgRNA may be operably linked to a promoter sequence recognized by RNA polymerase III (Pol III).
  • Pol III RNA polymerase III
  • suitable Pol III promoters include, but are not limited to, the mammalian U6, U3, H1, and 7SL RNA promoters.
  • the present invention also relates to a vector into which said polynucleotide is inserted.
  • the DNA molecule encoding the sgRNA may be linear or circular.
  • the DNA sequence encoding the sgRNA may be part of a vector.
  • Suitable vectors include plasmid vectors, phagemids, cosmids, artificial chromosomes, transposons, and viral vectors.
  • the DNA encoding Cas protein is present in the plasmid vector.
  • Unlimited examples of suitable plasmid vectors include pUC, pBR322, pET, pBluescript, and variants thereof.
  • the vector may include additional expression control sequences (e.g., enhancer sequences, Kozak sequences, polyadenylation sequences, transcription termination sequences, etc.), selectable marker sequences (such as antibiotic resistance genes), origin of replication,
  • each may be a portion of a separate molecule (e.g., a vector containing the fusion protein coding sequence and a second vector containing the sgRNA coding sequence) Or both may be a portion of the same molecule (e.g., a vector containing coding (and regulatory) sequences for both the fusion protein and the derived RNA).
  • the present invention also relates to a CRISPR / Cas system comprising said vector.
  • the CRISPR / Cas system may be a Type I, Type II, or Type III system.
  • suitable CRISPR / Cas proteins include but are not limited to Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, CasF, CasG, CasH, (Or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Cs5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Cs
  • the CRISPR / Cas protein comprises at least one RNA recognition and / or RNA binding domain.
  • the RNA recognition and / or RNA binding domain interacts with the induced RNA.
  • the CRISPR / Cas protein may also contain a nucleotide sequence encoding a nucleotide sequence encoding a nucleotide sequence encoding a nucleotide sequence encoding a nucleotide sequence (eg, a nucleolytic enzyme or RNA degradase domain), a DNA binding domain, a helicase domain, an RNA degrading enzyme domain, Other domains may be included.
  • the CRISPR / Cas-like protein may be a wild-type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild-type or modified CRISPR / Cas protein.
  • a CRISPR / Cas-like protein may be modified to increase nucleic acid binding affinity and / or specificity, to alter enzymatic activity and / or to alter other properties of the protein.
  • the nuclease (i.e., DNA degrading enzyme, RNA degrading enzyme) domain of a CRISPR / Cas-like protein may be modified, deleted, or inactivated.
  • the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the function of the fusion protein.
  • the CRISPR / Cas-like protein may also be truncated or modified to optimize the activity of the operative domain of the fusion protein.
  • the CRISPR / Cas-like protein can be derived from a wild-type Cas9 protein or fragment thereof.
  • the CRISPR / Cas-like protein can be derived from a modified Cas9 protein.
  • the amino acid sequence of a Cas9 protein can be modified to alter one or more properties of the protein (e.g., nuclease activity, affinity, stability, etc.).
  • the domain of the Cas9 protein not involved in RNA-induced cleavage can be removed from the protein, and thus the modified Cas9 protein is smaller than the wild-type Cas9 protein
  • a Cas9 protein contains at least two nuclease (i. E., DNA degrading) domains.
  • the Cas9 protein may comprise a RuvC-like nuclease domain and an HNH-like nuclease domain.
  • the RuvC and HNH domains work together to cleave a single strand to produce a double strand break in DNA (Jinek et al., Science, 337: 816-821).
  • a Cas9-derived protein can be modified to contain only one functional nuclease domain (either RuvC-like or HNH-like nuclease domain).
  • a Cas9-derived protein can be modified so that one of the nuclease domains is deleted or mutated and thus is no longer functioning (i. E., Lacking nuclease activity).
  • the Cas9-derived protein can introduce a gap into the double-stranded nucleic acid (such a protein is termed a " cleavage enzyme "), I never do that.
  • alanine (D10A) conversion in aspartate in the RuvC-like domain converts the Cas9-derived protein into a cleavage enzyme.
  • alanine (H840A or H839A) conversion at histidine in the HNH domain converts the Cas9-derived protein into a cleavage enzyme.
  • Each nuclease domain can be modified using well-known methods, for example, site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis, as well as other methods known in the art.
  • the DNA encoding the Cas protein may be operably linked to at least one promoter control sequence.
  • DNA coding sequences can be operably linked to promoter control sequences for expression in eukaryotic cells or animals of interest.
  • the promoter control sequence may be structural, regulated, or tissue specific.
  • Suitable structural promoter control sequences include the cytomegalovirus immediate early promoter (CMV), the ape virus (SV40) promoter, the adenovirus major late promoter, the Rous sarcoma virus (RSV) promoter, the mouse mammary tumor virus (MMTV) promoter, phosphoglycerin But are not limited to, an acid kinase (PGK) promoter, an extender (ED1) -alpha promoter, an ubiquitin promoter, an actin promoter, a tubulin promoter, an immunoglobulin promoter, fragments thereof, or any combination of the foregoing .
  • CMV cytomegalovirus immediate early promoter
  • SV40 ape virus
  • RSV Rous sarcoma virus
  • MMTV mouse mammary tumor virus
  • Suitable regulated promoter control sequences include, without limitation, those regulated by heat shock, metals, steroids, antibiotics, or alcohols.
  • tissue-specific promoters include but are not limited to B29 promoter, CD14 promoter, CD43 promoter, CD45 promoter, CD68 promoter, desmin promoter, elastase-1 promoter, endoglin promoter, fibroblast promoter, Flt-1 promoter, GFAP Promoter, the GPIIb promoter, the ICAM-2 promoter, the INF-? Promoter, the Mb promoter, the NphsI promoter, the OG-2 promoter, the SP-B promoter, the SYN1 promoter and the WASP promoter.
  • the promoter sequence may be wild-type or may be modified for more efficient or effective expression.
  • the encoding DNA can be operably linked to a CMV promoter for structural expression in mammalian cells.
  • the sequence encoding the Cas protein may be operably linked to a promoter sequence recognized by a phage RNA polymerase for in vitro mRNA synthesis.
  • the in vitro transcribed RNA can be purified and used in a known manner.
  • the promoter sequence may be a T7, T3, or SP6 promoter sequence or a variation of a T7, T3, or SP6 promoter sequence.
  • the DNA encoding Cas protein is operably linked to the T7 promoter for in vitro mRNA synthesis using T7 RNA polymerase.
  • the sequence encoding the Cas protein may be operably linked to a promoter sequence for in vitro expression of the Cas protein in bacterial or eukaryotic cells.
  • the expressed protein can be purified and used in a known manner.
  • Suitable bacterial promoters include, without limitation, the T7 promoter, the lac operon promoter, the trp promoter, mutations thereof, and combinations thereof.
  • An exemplary bacterial promoter is tac, a hybrid of the trp and lac promoters.
  • Unlimited examples of suitable eukaryotic promoters are listed above.
  • the DNA encoding the Cas protein may also be linked to a polyadenylation signal (e.g., an SV40 polyA signal, bovine growth hormone (BGH) polyA signal, etc.) and / or at least one transcription termination sequence.
  • a polyadenylation signal e.g., an SV40 polyA signal, bovine growth hormone (BGH) polyA signal, etc.
  • the DNA encoding the Cas protein may be present in the vector.
  • Suitable vectors include plasmid vectors, phagemids, cosmids, artificial chromosomes, transposons, and viral vectors (e.g., lentiviral vectors, adeno-associated viral vectors, etc.).
  • the DNA encoding the Cas protein is present in the plasmid vector.
  • Unlimited examples of suitable plasmid vectors include pUC, pBR322, pET, pBluescript, and variants thereof.
  • Such vectors may include additional expression control sequences (e.g., enhancer sequences, Kozak sequences, polyadenylation sequences, transcription termination sequences, etc.), selectable marker sequences (such as antibiotic resistance genes), replication origin,
  • additional expression control sequences e.g., enhancer sequences, Kozak sequences, polyadenylation sequences, transcription termination sequences, etc.
  • selectable marker sequences such as antibiotic resistance genes
  • the Cas protein along with the inducible RNA, is directed to the target site in the chromosomal sequence, where the Cas protein introduces double strand breaks into the chromosomal sequence.
  • the target site has no sequence restriction, except that it follows a common sequence immediately downstream (downstream) of the sequence.
  • This common sequence is also known as a prototype spacer adjacent motif (PAM).
  • PAM include, but are not limited to, NGG, NGGNG, and NNAGAAW (where N is defined as any nucleotide and W is defined as A or T).
  • the first region (at the 5 'end) of the induced RNA is complementary to the proto-spacer of the target sequence.
  • the first region of the induced RNA is about 19 to 21 nucleotides in length.
  • the sequence of the target site within the chromosomal sequence is 5'-N19-21-NGG-3 '.
  • PAM is shown in italics.
  • the target site can be a coding region of a gene, an intron of a gene, a regulatory region of a gene, or a noncoding region between genes.
  • the gene may be a protein coding gene or an RNA coding gene.
  • the gene may be any gene of interest, and preferably it may be the eighth factor or the ninth factor.
  • the transgenic rabbit in the present invention, the transgenic rabbit
  • step (c) transplanting the embryo obtained in the step (b) into a surrogate mother and delivering the surrogate egg to the surrogate mother.
  • the transgenic rabbit may be produced by a method further comprising the step of confirming whether or not the transformant is transformed after delivery.
  • the present invention relates to a transgenic rabbit that is produced by a method comprising crossing the transgenic rabbit to produce an offspring-transformed rabbit.
  • the term " offspring " means all of the transgenic rabbits that can survive by crossing with the transgenic rabbit. More specifically, the transgenic rabbits are used as transgenic rabbits or transgenic rabbits, But it is not limited to the F1 generation produced by crossing the F1 rabbit, the F2 generation produced by crossing the F1 rabbit and the normal rabbit of F1 generation, and the subsequent generations.
  • the crossing may be characterized by crossing with the transgenic rabbit or the normal rabbit.
  • the transgenic rabbits or offspring transgenic rabbits may be characterized in that the factor 8 or 9 is knocked out to show a haemophilia phenotype.
  • the present invention also relates to cells, tissues and by-products isolated from the transgenic rabbits or offspring transgenic rabbits.
  • the by-product refers to all substances derived from the transgenic rabbit, but is preferably selected from the group consisting of blood, serum, urine, feces, saliva, organs, and skin. But is not limited thereto.
  • step (c) transplanting the embryo obtained in step (b) into a surrogate mother and delivering the embryo, wherein the rabbit is a method for producing a transgenic rabbit knocked out by Factor 8 or 9.
  • the present invention also relates to a method for producing offspring transgenic rabbits comprising the step of producing transgenic rabbits by crossing the transgenic rabbits produced by the above method.
  • the crossing may be characterized by crossing with the transgenic rabbit or the normal rabbit
  • the present invention also relates to transgenic rabbits expressing the desired hemophilia A phenotype by crossing the rabbit knocked out with Factor 8 and a method for producing the same.
  • the present invention also relates to transgenic rabbits, wherein said Factor 9 crosses the rabbit knocked out and displays as many hemophilia B phenotypes as desired, and a process for their preparation.
  • the present invention also relates to a transgenic rabbit capable of studying the immune response following human factor VIII or factor 9 injection by crossing a rabbit knocked out with Factor 8 or a rabbit knocked out with Factor 9 and a method for producing the same will be.
  • Example 1 sgRNA design and CRISPR / Cas9 vector construction and in vitro transcription
  • the sgRNA represented by the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 was designed using the sequence shown in SEQ ID NO: 1 in the exon 1 region (Fig. 1).
  • SEQ ID NO: 3 sgRNA 1 (+ Strand)
  • SEQ ID NO: 4 sgRNA 2 (- Strand)
  • the sgRNA represented by the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6 was designed using the sequence shown in SEQ ID NO: 2 in the region of exon 2.
  • SEQ ID NO: 5 sgRNA 1 (+ Strand)
  • SEQ ID NO: 6 sgRNA 2 (+ Strand)
  • oligonucleotide suitable for the sgRNA sequence designed in Example 1-1 was designed and cloned into the pUC57-T7 vector (Addgene ID 51306), and the completed sgRNA and the T7 promoter located in front of it were amplified by PCR with the primers of SEQ ID NOS: 7 and 8 Lt; / RTI >
  • the PCR amplification product was produced using T7 RNA polymerase (MAXIscript T7 Kit, Ambion) and then purified (miRNeasy Mini Kit, Qiagen).
  • Cas9 expression vector was linearized and then produced in the form of capped mRNA using mMessage mMachine SP6 Kit (Ambion) and purified using RNeasy Mini Kit (Qiagen).
  • the Cas9 / FVIII sgRNA or Cas9 / FIX sgRNA obtained in Example 1 were respectively introduced into rabbit embryos by a known method (Sci. Rep. 2016; 6: 222024).
  • the rabbit embryos obtained were cultured in embryo culture medium (9.5g TCM-119, 0.05g NaHCO3 (Sigma, S4019), 0.75g Hepes (Sigma H3784), 0.05g penicillin, 0.06g (25 ng / ⁇ l), Cas9 mRNA (100 ng / ⁇ l) or FIX sgRNA (25 ng / ⁇ l) and Cas9 mRNA (100 ng / ⁇ l) ng / ⁇ l) was injected into the cytoplasm of embryo and then cultured in a culture medium at 38.5 ° C for 30 to 60 minutes under 5% carbon dioxide, and then transplanted into a surrogate mother.
  • embryo culture medium 9.5g TCM-119, 0.05g NaHCO3 (Sigma, S4019), 0.75g Hepes (Sigma H3784), 0.05g penicillin, 0.06g (25 ng / ⁇ l), Cas9 mRNA (100 ng / ⁇ l) or FI
  • Amplicons shown in FIG. 2 (a) were amplified using the primers of SEQ ID NOs: 9 and 10, followed by secondary tertiary PCR to attach adapters and tags, followed by MiSeq (Illumina, MiSeq Reagent Kit V) , And the results were analyzed using Cas-Analyzer (Bioinformatics, 2017 Jan 15; 333 (2): 286-288).
  • the amplicon shown in FIG. 2 (b) was amplified using the primers of SEQ ID NOS: 11 and 12, and the adapter and tag were attached through the second-order tertiary PCR, followed by MiSeq (Illumina, MiSeq Reagent Kit V) , And the results were analyzed using Cas-Analyzer (Bioinformatics, 2017 Jan 15; 333 (2): 286-288).
  • the F9-R2 primer of SEQ ID NO: 13 was used for primary amplification.
  • the waveform of the APTT clot was observed in real time using the Start 4Hemostasis Analyzer (Stago Inc., USA). 50 ⁇ l of APTT reagent (Dade® Actin FSL, Siemens Medical Solutions Inc., USA) and 50 ⁇ l of plasma from transgenic rabbits were mixed in a cuvette and incubated at 37 ° C for 3 min. (final concentration: 25 mM) of calcium chloride (CaCl 2 ) was injected into the cuvette, and the time of occurrence of the clot was measured.
  • APTT reagent Dade® Actin FSL, Siemens Medical Solutions Inc., USA
  • Thrombin production was measured by analyzing Fluoroskan Ascent (Thermo Scientific) fluorescent plate reader with Thrombinoscope BV software. That is, 80 ⁇ l of transfected rabbit plasma was mixed with 2 ⁇ l of PPP-reagent LOW containing tissue factor and phospholipid and cultured in an Immulon microtiter 2HB-High Binding 96-well plate (Thermo Nunc) at 37 ° C. Control wells were mixed with 80 ⁇ l of rabbit plasma and 20 ⁇ l of Thrombin Calibrator reagent. Before starting the reaction, the thrombin substrate with fluorescence and Flu-Ca reagent, which had been preheated, were injected and mixed well. The reaction was started by injecting 20 ⁇ l of Flu-Ca reagent. The amount of thrombin produced was analyzed by Thrombinoscope Analysis Version 3.0.
  • transgenic rabbits in which the FVIII or FIX gene has been deleted represent a haemophilia phenotype.
  • the haemophilia rabbits prepared in Example 2 were called P (or F0), and F1 and F2 corresponding to their progeny were obtained as follows.
  • P or F0
  • F1 and F2 corresponding to their progeny were obtained as follows.
  • the individuals were propagated as described in FIG. That is, since hemophilia corresponds to a hemorrhagic genetic disease present on the X chromosome, the factor VIII knockout and factor VIII knockout transformant rabbits (P, X'Y) prepared in Example 2 were transplanted into normal rabbit female (XX) to produce offspring.
  • Transgenic rabbits (F1) were obtained from the first crossing to identify the recipient (X'X) and crossed with the normal male (XY) to obtain a transgenic rabbit male F2 , X'Y).
  • F2 male mice obtained by crossing F1 male mice (X'X), which are F1 generations, with normal male mice (XY) weighing at least 2 kg and sampled from Sumacococcus and 10-12 weeks old, Genetic analysis was performed in the same manner. As shown in Table 5 and FIG. 11, it was confirmed that the indel pattern was detected in the FVIII gene of the # 1-4 and # 5-1 individuals.
  • hemophilia rabbits of Example 7 which weigh more than 2 kg and 12 weeks or more, diazepam 0.4 mg / kg and pentobarbital were added to normal rabbits weighing more than 2 kg and sampled at 10-12 weeks of age sodium 25 mg / kg was injected through the auricular vein and anesthetized.
  • One of the paws of the anesthetized rabbit was removed with a hair clipper, and a 2 mm proximal portion from the quick distal end of the middle toe claw was marked with a lubricant pen using a digimatic caliper and cut using a wire cutter (Fig. 13).
  • the blood was collected in a 50 mL conical tube containing sterile physiological saline maintained at 37 ° C, and the blood was collected for 60 minutes. After centrifugation at 1500 xg for 5 minutes, the supernatant was removed, The blood was completely hemolyzed using a vortex after placing 3 mL of distilled water in the tube up to 20 mL.
  • Example 8-1 the amount of hemoglobin in the blood was quantitatively determined using a hemoglobin assay kit (Sigma and Aldrich, MAK115-1KT, # BF03A26V) using a hemolyzed sample to measure blood loss.
  • concentration of hemoglobin was confirmed to be 1,014 nM (Range: 502-1503)
  • the hemoglobin concentration of the knockout rabbit of the eighth factor was 45,787 nM
  • the hemoglobin concentration of the ninth knockout rabbit of the ninth factor was 4,620 nM 14).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Environmental Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 Factor VIII 또는 Factor IX 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도에 관한 것으로, 보다 구체적으로는 CRISPR/Cas9 시스템으로 Factor VIII 또는 Factor IX을 녹아웃 시킨 형질전환 토끼, 이의 제조방법 및 그 용도에 관한 것이다. 본 발명에 따른 제 8인자 및/또는 제 9인자가 녹아웃된 형질전환 토끼는 혈우병 발생에 중요한 기능을 수행하는 단백질인 제 8인자 및/또는 제 9인자의 기능이 억제되어 있기 때문에, 혈우병 치료제의 개발에 유용하다.

Description

FACTOR VIII 또는 FACTOR IX 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도
본 발명은 Factor VIII 또는 Factor IX 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도에 관한 것으로, 보다 구체적으로는 CRISPR/Cas9 시스템으로 Factor VIII 또는 Factor IX을 녹아웃 시킨 형질전환 토끼, 이의 제조방법 및 그 용도에 관한 것이다.
혈액응고는 혈관 손상에 대응하여 발생하는 복합적이고 주요한 과정이다. 이는 출혈을 멈추고 손상된 혈관의 회복을 시작하는 혈전의 형성으로 이루어지며; 손상 부위는 혈전을 포함하는 피브린 및 혈소판에 의해 커버된다. 상기 과정은 손상 이후에 거의 즉시 시작된다.
혈액응고 과정에는 두 개 유형의 성분, 즉 혈소판으로 지칭되는 세포 성분과 응고 인자로 지칭되는 단백질 성분이 관여된다. 혈소판은 손상된 부위에서 즉시 플러그 (plug)를 형성하며 이는 일차적 지혈이라고 지칭된다. 이차적 지혈은 동시에 발생하며 응고 인자 또는 응혈 인자라고 지칭되는 혈장 내 단백질이 복잡한 캐스케이드 과정을 거쳐 반응하여, 혈소판 플러그를 강화시키는 피브린 스트랜드를 형성한다.
이차적 지혈의 응고 캐스케이드는 2개의 경로, 즉 접촉 활성화 경로라고도 불리우는 내인성 경로 및 조직 인자경로라고도 불리우는 외인성 경로로 나뉘어진다. 다수의 응고 인자들이 관여될 뿐만 아니라, 보조인자와 조절인자가 과정을 정확하게 유지하기 위해 관여된다.
예를 들어, 단백질 C는 "항응고 경로"라고 지칭되는 응고 조절의 주요 메카니즘의 필수적인 인자이다. 단백질 C의 활성 형태 (활성화 단백질 C)는 세린 프로테아제이며, 이는 다른 보조인자 (단백질 S)와 연관될 때 트롬빈의 대량 생성에 필수적인 응혈 캐스케이드의 2개의 인자, 즉 제 Va인자 및 제 VIIIa인자를 분해한다. 상기 인자들의 파괴는 형성되는 트롬빈의 양을 음성적으로 조절하며, 이는 항응고 효과를 가져온다. 상기 단백질은 특히 항혈전 활성, 항-염증 활성, 항-아폽토틱 활성 및 프로-피브린 용해 활성 등의 다면발현적인 생물학적 활성을 갖는 것으로 알려져 있다
제 IX인자 (하기에서는 FIX라고 언급함)는 혈액응고의 필수적인 세린 프로테아제 중 하나이다. 상기 단백질의 결핍은 혈우병 B라고 불리우는 출혈 장애를 야기한다. 혈액응고 동안, 활성화된 FIX (FIXa)는 이의 활성화된 보조 인자인 제 VIIIa인자 (하기에서는 FVIIIa라고 언급함)와 결부되며, 이는 특이적 기질 제 X인자 (하기에서는 FX라고 언급함)를 이의 활성화 유도체인 활성화된 제X인자 (하기에서는 FXa라고 언급함)로 전환시킨다.
제 X인자는 응혈 캐스케이드의 또 다른 필수적인 인자이다. FX의 활성화된 형태 (FXa)는 그의 보조인자 (응혈 제 Va인자)와 결부되어 프로트롬빈을 트롬빈으로 활성화시킬 수 있는 유일한 세린 프로테아제이다. 또한, 수동적인 방관성분으로서 오래 고려되어온 제 X인자는 이의 2개의 주요 수용체, 즉 프로테아제-활성화 수용체-1 (PAR-1) 및 PAR-2의 활성화를 통해 매우 다양한 세포 유형들에 대해 직접적인 참가성분으로서 나타난다. 최근의 발견에 따르면, PAR-2는 응고와 질환의 진행 사이의 접점을 조정하는 중요한 매개체로서 제 X인자에 대한 포인트와 섬유증식성 질환, 예컨대 섬유증, 조직 재형성 및 암에서 중요한 역할을 한다는 점이 제안되었다(Borensztajn et al., Am J Pathol. 2008;172:309-20).
우리 몸에서 지혈을 담당하는 여러 가지 혈액 응고인자들 중 제 VIII인자가 부족하면 혈우병 A, 제 IX인자가 부족하면 혈우병 B라 명칭하고 있다. 혈우병 A는 폰빌레브란트병 (von Willebrand disease)을 제외하면 전 세계적으로 가장 흔한 유전성 혈액 응고 질환으로서, 전체 혈우병의 80-85% 정도를 차지하며 그 발생빈도는 생존 남아 5,000-10,000명당 1명으로 보고된다. 혈우병 B는 더 드물게 발병하여 혈우병 A의 약 1/5 정도로 추산된다.
정상인에서 제 VIII인자 및 제 IX인자의 활성도는 50-150% 정도이며, 혈우병 A와 B는 혈액 검사에서 그 활성도가 감소되어 있다. 응고인자의 활성도에 따라 다시 중증(제 VIII 인자 또는 제 IX인자 활성도 1% 이하), 중등증 (인자 활성도 1-5%), 경증 (인자 활성도 5-30%), 아정상 (인자 활성도 30-50%)으로 분류하며 중등도에 따라 그 증상이 다르다. 예를 들어 중증 혈우병 A 환자의 경우에는 특별한 외상없이도 자연 출혈이 언제든지 일어날 수 있어 치료약 (제 VIII 인자 농축물)이 개발되기 전에는 뇌출혈 등으로 인하여 평균 연령이 25세 정도밖에 되지 않았다. 중등도 분포는 혈우병 A는 중증, 중등증, 경증 환자의 빈도가 각각 70%, 15%, 15% 정도, 혈우병 B는 각각 50%, 30%, 20% 정도이다. 출혈의 빈도는 일반적으로 중증 환자의 경우 주 1회, 중등증 환자의 경우 월 1회, 경증 환자의 경우 연 1회 정도로 알려져 있으며, 출혈 부위는 관절과 근육이 가장 흔하다. 특히 관절 출혈은 15-25세 사이에 뚜렷해지며, 출혈이 반복될 경우에는 평균 50년 정도 혈우병성 관절병증 (hemophilic arthropathy)으로 인한 관절의 구축으로 고통받게 된다.
혈우병의 약물치료에서 항체생성 (inhibitor development) 반응을 예측하는 것은 매우 중요하다. 혈우병 A 환자에서의 항체생성 반응 빈도는 약 30%이고, 혈우병B 환자에서는 약 3%이다 (Kessler CM, Hematology Am Soc Hematol Educ Program. 2005:429-35). 혈우병 치료제에 대한 항체는 약제 노출 후 50일 이내에 가장 많이 발생하고 통상적으로 0.6 Bethesda Unit (BU) 이상일 때 항체생성군으로 분류되며, 5 BU 이상일 때에는 고항체생성군으로 분류된다 (Kasper CK et al., Thromb Diath Haemorrh. 1975;34(2):612; Verbruggen B et al., Thromb Haemost. 1995;73(2):247-51; Viel KR et al., N Engl J Med. 2009;360(16):1618-27; Kemton CL et al., Blood. 2009;113(1):11-7). 항체생성 반응이 있는 환자의 치료는 매우 어려우며, 특히 잦은 출혈로 인한 관절 합병증이 빈번하게 발생한다 (Park YS, J Korean Med Assoc 2009; 52(12):1201-6). 대체 요법으로는 활성화 프로트롬빈 복합체, 제 VII인자 재조합 제제와 같은 우회인자 투여가 있으나, 항체생성 반응군에서는 면역관용요법을 통해 항체를 제거하는 것이 더 바람직할 수 있다 (Kemton CL et al., Blood. 2009;113(1):11-7; Park YS, J Korean Med Assoc 2009; 52(12):1201-6). 면역관용요법의 성공률은 30-80%로 다양하며, 면역관용요법 시행 후 환자는 다시 지속적인 제 VIII인자 또는 제 IX인자 제제 사용이 가능하다 (Park YS, J Korean Med Assoc 2009; 52(12):1201-6).
혈우병 치료제 항체생성 반응의 주요 예측 인자 또는 원인에 대하여 여러 연구가 진행된 바 있다. 그 중 유전적 예측 인자로는 F8 유전자의 결함이 가장 큰 원인으로 알려져 있으며 (Schwaab R et al., Thromb Haemost. 1995 74(6):1402-6; Oldenburg J et al., Thromb Haemost. 1997, 77(2):238-42), MHC II, TNF-α, IL-10, CTLA-4 등의 유전자에 위치한 SNP (single nucleotide polymorphism) 변이들 또한 유의미한 통계적 연관성을 나타내는 것으로 사료되나, 아직 밝혀지지 않은 유전적 예측 인자가 다수 존재할 것으로 예상된다 (Hay CR et al., Thromb Haemost. 1997 77(2):234-7; Oldenburg J et al., Thromb Haemost. 1997;77(2):238-42; Astermark J et al., Blood. 2006a, 107(8):3167-72; Astermark J et al., Blood. 2006b, 108(12):3739-45; Astermark J et al., J Thromb Haemost. 2007, 5(2):263-5).
한편, 미생물이 바이러스에 대응하기 위한 면역체계인 CRISPR/Cas 시스템은 2012년 이종의 세포에 CRISPR/Cas 시스템을 도입하여 타겟 염기서열을 선택적으로 절단할 수 있고, 이를 이용하여 미생물부터 인간 세포에 이르기까지의 다양한 세포에 대한 게놈을 편집할 수 있다는 것이 알려지게 되어, 유전자 편집기술로서, 생물 개량에 있어서 보다 효율적이고 편리하게 활용될 수 있을 것으로 기대되고 있다(Jinek et al., Science, 337(6096): 816-821, 2012).
유전자 편집기술에 있어서, CRISPR/Cas 시스템 중 CRISPR/Cas9 시스템은 이를 구성하는 Cas9 및 sgRNA에 의하여 타겟 DNA 상에 이중가닥절단 (double-strand break, DSB)을 생성시키고, 세포는 이를 손상부위로 인식하여 비상동적 말단접합 (non-homologous end joining, NHEJ) 또는 상동성 기반수복 (homology-directed repair, HDR)에 의한 통상적인 DNA repair 과정을 유도하게 되며, 이 과정에서 변이 또는 유전자 교체에 의한 정상화가 가능하기 때문에, 이를 활용하여 게놈 편집을 유도할 수 있다. 비상동적 말단접합 (non-homologous end joining, NHEJ) 기전은 CRISPR/Cas 시스템의 작용으로 생성된 DSB를 다듬은 후, 단순 접합시키는데, 그 과정에서 틀이동 돌연변이 (frameshift mutation)가 도입되어 손쉽게 유전자 결실을 유도할 수 있으며, 반면 절단된 부위와 상동성의 유전자 단편이 존재하는 경우에는 상동성 기반수복 (homology-directed repair, HDR) 기전이 일어날 수 있으며, 이 기전을 통해서는 유전자 치환에 의한 정상화 또는 결실을 유도할 수 있다.
이러한 CRISPR/Cas 시스템은 표적 유전자의 정확한 위치를 결실할 수 있기 때문에, 형질전환 동물의 제조에 있어 매우 유리하다. 혈우병 연구를 위해 CRISPR/Cas 시스템에 기반한 형질전환 동물을 제조하기 위한 노력이 계속되고 있으며, 최근에는 NSG 마우스 (Nod/Scid-Il2γ-/-)에서 CRISPR/Cas 시스템을 적용하여 FVIII/FIX가 녹아웃된 마우스가 보고된바 있다 (Ching-Tzu Yen, et al., Thrombosis Journal, Vol.14:22, 2016). 토끼는 마우스보다 생리학과 해부학적 측면에서 인간과 더 많은 유사점을 보이고, 돼지와 원숭이에 비해 저렴한 유지비와 짧은 임신 기간을 필요로 하기 때문에 생물의학 연구를 위한 유망한 동물 모델이나, 아직까지 CRISPR/Cas 시스템을 이용한 혈우병 토끼 모델은 알려진 바가 없는 실정이다.
이러한 배경하에 본 발명자들은 제 8인자 및/또는 제 9인자가 녹아웃된 토끼를 제조하기 위하여 예의 노력한 결과, 제 8인자 및/또는 제 9인자의 엑손영역에 상보적으로 결합할 수 있는 sgRNA를 포함하는 CRISPR/Cas 시스템을 이용하여 토끼를 제작할 경우, 제 8인자 및/또는 제 9인자가 녹아웃된 토끼를 제조할 수 있음을 확인하고, 본 발명을 완성하였다.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.
발명의 요약
본 발명의 목적은 제 8인자 (Factor VIII, FVIII) 또는 제 9인자 (Factor IX, FIX)의 각각 1번 엑손과 2번 엑손 영역에 상보적으로 결합하는 타겟팅 도메인을 포함하는 sgRNA, 이를 포함하는 벡터 및 상기 벡터를 포함하는 CRISPR/Cas9 시스템에 대한 것이다.
본 발명의 다른 목적은 상기 CRISPR/Cas9 시스템을 이용하여 제조된 제 8인자 및/또는 제 9인자가 녹아웃된 형질전환 토끼 및 이의 제조방법을 제공하는 것이다.
본 발명의 또 다른 목적은 제 8인자 및/또는 제 9인자가 녹아웃된 형질전환 토끼를 혈우병 연구의 모델로 활용하는 등의 용도를 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 제 8인자 (Factor VIII, FVIII) 또는 제 9인자 (Factor IX, FIX)의 엑손 영역 일부에 상보적으로 결합하는 타겟팅 도메인을 포함하는 sgRNA를 제공한다.
본 발명은 또한, 상기 sgRNA를 암호화하는 폴리뉴클레오타이드, 상기 폴리뉴클레오타이드가 삽입된 벡터, 상기 벡터를 포함하는 CRISPR/Cas9 시스템 및 상기 CRISPR/Cas9 시스템을 이용하여 제조된 제 8인자 및/또는 제 9인자가 녹아웃된 형질전환 토끼 형질전환 토끼를 제공한다.
본 발명은 또한, (a) 상기 CRISPR/Cas9 시스템을 전사 (transcription)하여, sgRNA 및 Cas9 mRNA를 제조하는 단계; (b) 수정란에 상기 (a) 단계에서 제조한 mRNA를 도입하고 배양하는 단계; 및 (c) 상기 (b) 단계에서 수득한 수정란을 대리모에 이식하여 분만시키는 단계를 포함하는 제 8인자 또는 제 9인자가 녹아웃된 형질전환 토끼의 제조방법을 제공한다.
본 발명은 또한, 제 8인자 또는 제 9인자가 녹아웃된 형질전환 토끼로부터 분리한 세포, 조직 및 부산물을 제공한다.
도 1의 (A)는 본 발명의 일 실시예에 따른 형질전환 토끼를 제작하기 위해 제조하는 sgRNA가 타겟팅하는 제 8인자 유전자의 위치를 나타내는 모식도이며, (B)는 본 발명의 일 실시예에 따른 형질전환 토끼를 제작하기 위해 제조하는 sgRNA가 타겟팅하는 제 9인자 유전자의 위치를 나타내는 모식도이다.
도 2는 (A)는 본 발명에서 제조한 형질전한 토끼에서 제 8인자의 녹아웃을 검출하기 위한 NGS 기반 시퀀싱 분석에 사용되는 앰플리콘의 서열을 나타낸 것이며, (B)는 본 발명에서 제조한 형질전한 토끼에서 제 9인자의 녹아웃을 검출하기 위한 NGS 기반 시퀀싱 분석에 사용되는 앰플리콘의 서열을 나타낸 것이다.
도 3의 (A)는 본 발명에서 제조한 제 8인자 녹아웃 토끼 제 2개체에서 제 8인자 유전자의 4 bp가 결실된 것을 확인한 결과이며, (B)는 본 발명에서 제조한 제 8인자 녹아웃 토끼 제 3개체에서 제 8인자 유전자의 결실 돌연변이를 확인한 결과이다.
도 4의 (A)는 본 발명에서 제조한 제 9인자 녹아웃 토끼 제 6개체에서 제 9인자 유전자의 결실 돌연변이를 확인한 결과이고, (B)는 본 발명에서 제조한 제 9인자 녹아웃 토끼 제 7개체에서 제 9인자 유전자의 결실 돌연변이를 확인한 결과이며, (C)는 본 발명에서 제조한 제 9인자 녹아웃 토끼 제 8개체에서 제 9인자 유전자의 결실 돌연변이를 확인한 결과이다.
도 5의 (A)는 본 발명에서 제조한 제 9인자 녹아웃 토끼 제 9개체에서 제 9인자 유전자의 결실 돌연변이를 확인한 결과이며, (B)는 본 발명에서 제조한 제 9인자 녹아웃 토끼 제 11개체에서 제 9인자 유전자의 결실 돌연변이를 확인한 결과이다.
도 6의 (A)는 본 발명에서 제조한 제 9인자 녹아웃 토끼 제 12개체에서 제 9인자 유전자의 결실 돌연변이를 확인한 결과이고, (B)는 본 발명에서 제조한 제 9인자 녹아웃 토끼 제 13개체에서 제 9인자 유전자의 결실 돌연변이를 확인한 결과이며, (C)는 본 발명에서 제조한 제 9인자 녹아웃 토끼 제 5개체에서 제 9인자 유전자의 결실 돌연변이를 확인한 결과이다.
도 7의 (A)는 제 8인자 또는 제 9인자가 녹아웃된 형질전환 토끼의 APTT 분석 결과를 측정한 그래프이며, 정상 토끼 4마리, 제 8인자가 녹아웃된 토끼 2마리 및 제 9인자가 녹아웃된 토끼 7마리의 혈장으로 두 번 혹은 세 번 반복 수행한 실험을 나타낸다. (B)는 정상 토끼 9마리, 제 8인자가 녹아웃된 토끼 3마리 및 제 9인자가 녹아웃된 토끼 8마리의 혈장으로 두 번 혹은 세 번 반복 수행한 TGA 분석 결과를 나타낸 그래프이다. 상기 결과는 mean ± s.e.m 나타내는 것이고, 통계적 유의성은 two-tailed, unpaired t-test로 확인하였으며, **은 p<0.01을 의미하고, ***은 p<0.001을 의미한다.
도 8은 F1세대 및 F2세대 생산을 위한 번식 가계도를 나타낸 것이다.
도 9는 본 발명에서 제조한 제 8인자 녹아웃 토끼 제2개체인 수컷을 정상 암컷과 교배시켜 얻은 자손 암컷의 유전자 Indel 돌연변이를 확인한 결과이다.
도 10은 본 발명에서 제조한 제 9인자 녹아웃 토끼 제6개체인 수컷을 정상 암컷과 교배시켜 얻은 자손 암컷의 유전자 결실 돌연변이를 확인한 결과이다.
도 11은 본 발명에서 제조한 제 8인자 녹아웃 토끼의 F1 세대인 암컷(X’X)을 정상 수컷과 교배시켜 얻은 F2 수컷의 유전자 Indel 돌연변이를 확인한 결과이다.
도 12는 본 발명에서 제조한 제 9인자 녹아웃 토끼의 F1 세대인 보인자 암컷(X’X)을 정상 수컷과 교배시켜 얻은 F2 수컷의 유전자 Indel 돌연변이를 확인한 결과이다.
도 13은 토끼 발톱출혈모델을 제조하기 위한 모식도이다.
도 14는 용혈된 샘플에서 혈액내 헤모글로빈 양을 측정한 결과이다.
발명의 상세한 설명 및 바람직한 구현예
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명의 용어 "핵산"과 "폴리뉴클레오타이드"는 선형 또는 환상 입체형태에서, 그리고 단일- 또는 이중 가닥 형태에서 데옥시리보뉴클레오타이드 또는 리보뉴클레오타이드 중합체를 지칭한다. 본 발명의 목적으로, 이들 용어는 중합체의 길이에 대하여 한정하는 것으로 해석되지 않는다. 이들 용어는 자연 뉴클레오타이드의 공지된 유사체뿐만 아니라 염기, 당 및/또는 인산염 모이어티 (가령, 포스포로티오에이트 중추)에서 변형되는 뉴클레오타이드를 포괄할 수 있다. 일반적으로, 특정 뉴클레오타이드의 유사체는 동일한 염기-짝짓기 특이성을 갖는다; 즉, A의 유사체는 T와 염기쌍을 이룰 것이다.
본 발명의 용어 "뉴클레오타이드"는 데옥시리보뉴클레오타이드 또는 리보뉴클레오타이드를 지칭한다. 뉴클레오타이드는 표준 뉴클레오타이드 (즉, 아데노신, 구아노신, 시티딘, 티미딘, 그리고 우리딘) 또는 뉴클레오타이드 유사체일 수 있다. 뉴클레오타이드 유사체는 변형된 퓨린 또는 피리미딘 염기 또는 변형된 리보오스 모이어티를 갖는 뉴클레오타이드를 지칭한다. 뉴클레오타이드 유사체는 자연적으로 발생하는 뉴클레오타이드 (가령, 이노신) 또는 비자연적으로 발생하는 뉴클레오타이드일 수 있다. 뉴클레오타이드의 당 또는 염기 모이어티 상에서 변형의 무제한적 실례는 아세틸 기, 아미노 기, 카르복실 기, 카르복시메틸 기, 히드록실 기, 메틸 기, 포스포릴 기, 그리고 티올 기의 부가 (또는 제거)뿐만 아니라 염기의 탄소와 질소 원자의 다른 원자 (가령, 7-데아자 퓨린)로 치환을 포함한다. 뉴클레오타이드 유사체는 또한, 디데옥시 뉴클레오타이드, 2'-O-메틸 뉴클레오타이드, 잠금된 핵산 (LNA), 펩타이드 핵산 (PNA), 및 모르폴리노를 포함한다.
본 발명의 용어 “sgRNA”는 CRISPR/Cas 시스템에서 Cas 단백질을 표적 지역으로 유도하는 유도 RNA(guide RNA)에서, 표적 지역과 상보적으로 결합하는 첫 번째 영역을 의미한다.
본 발명에서 유도 RNA는 Cas 단백질과 상호작용하여 Cas 단백질을 특정한 표적 부위로 향하게 하고, 상기 부위에서 유도 RNA의 5' 단부는 염색체 서열 내에 특정한 프로토스페이서 서열과 염기쌍을 이룬다.
각 유도 RNA는 3 가지 영역을 포함한다: 염색체 서열 내에 표적 부위에 상보적인 5' 단부에서 첫 번째 영역, 줄기 루프 구조를 형성하는 두 번째 내부 영역, 그리고 본질적으로 단일 가닥으로 남아있는 세 번째 3' 영역. 각 유도 RNA의 첫 번째 영역은 각 유도 RNA가 융합 단백질을 특정한 표적 부위로 유도하도록 상이하다. 각 유도 RNA의 두 번째와 세 번째 영역은 모든 유도 RNA에서 동일할 수 있다.
유도 RNA의 첫 번째 영역은 유도 RNA의 첫 번째 영역이 표적 부위와 염기쌍을 이룰 수 있도록, 염색체 서열 내에 표적 부위에서 서열 (즉, 프로토스페이서 서열)에 상보적이다. 다양한 구체예에서, 유도 RNA의 첫 번째 영역은 약 10개 뉴클레오타이드 내지 약 25개 보다 많은 뉴클레오타이드를 포함할 수 있다. 가령, 유도 RNA의 첫 번째 영역 및 염색체 서열 내에 표적 부위 사이에 염기 대합의 영역은 길이에서 약 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25개, 또는 25개 보다 많은 뉴클레오타이드 일 수 있다. 예시적인 구체예에서, 유도 RNA의 첫 번째 영역은 길이에서 약 19, 20, 또는 21개 뉴클레오타이드이다.
유도 RNA는 또한, 이차 구조를 형성하는 두 번째 영역을 포함한다. 일부 구체예에서, 이차 구조는 줄기 (또는 헤어핀) 및 루프를 포함한다. 루프와 줄기의 길이는 변할 수 있다. 가령, 루프는 길이에서 약 3 내지 약 10개 뉴클레오타이드 범위에서 변할 수 있고, 그리고 줄기는 길이에서 약 6 내지 약 20개 염기쌍 범위에서 변할 수 있다. 줄기는 1 내지 약 10개 뉴클레오타이드의 하나 또는 그 이상의 돌출을 포함할 수 있다. 따라서, 두 번째 영역의 전반적인 길이는 길이에서 약 16 내지 약 60개 뉴클레오타이드 범위에서 변할 수 있다. 예시적인 구체예에서, 루프는 길이에서 약 4개 뉴클레오타이드이고, 그리고 줄기는 약 12개 염기쌍을 포함한다.
유도 RNA는 또한, 본질적으로 단일 가닥으로 남아있는 3' 단부에서 세 번째 영역을 포함한다. 따라서, 세 번째 영역은 관심되는 세포 내에 임의의 염색체 서열에 대한 상보성을 갖지 않고, 그리고 유도 RNA의 나머지 부분에 상보성을 갖지 않는다. 세 번째 영역의 길이는 변할 수 있다. 일반적으로, 세 번째 영역은 길이에서 약 4개 보다 많은 뉴클레오타이드이다. 가령, 세 번째 영역의 길이는 길이에서 약 5 내지 약 60개 뉴클레오타이드 범위에서 변할 수 있다.
유도 RNA의 두 번째와 세 번째 영역 (또한, 보편적인 또는 골격 영역으로 불린다)의 합동된 길이는 길이에서 약 30 내지 약 120개 뉴클레오타이드 범위에서 변할 수 있다. 한 양상에서, 유도 RNA의 두 번째와 세 번째 영역의 합동된 길이는 길이에서 약 70 내지 약 100개 뉴클레오타이드 범위에서 변한다.
본 발명에서는 CRISPR/Cas 시스템을 이용하여 제 8인자 및/또는 제 9인자가 녹아웃된 토끼를 제조할 수 있는지 확인하고자 하였다.
즉, 본 발명의 일 실시예에서는 제 8인자 (Factor VIII, FVIII) 또는 제 9인자(Factor IX, FIX)의 엑손 영역 일부에 상보적으로 결합하는 타겟팅 도메인을 포함하는 sgRNA를 제조하고 이를 포함하는 CRISPR/Cas 시스템을 전사 (transcription)하여, 토끼 수정란에 주입한 다음, 배양하여 대리모에 이식한 후, 토끼를 생산한 결과, 제조된 토끼의 제 8인자 또는 제 9인자의 엑손 영역에서 결실 돌연변이가 발생하는 것을 확인하였다 (도 3 내지 도 7).
따라서, 본 발명은 일 관점에서, 제 8인자 (Factor VIII, FVIII) 또는 제 9인자(Factor IX, FIX)의 엑손 영역 일부에 상보적으로 결합하는 타겟팅 도메인을 포함하는 sgRNA에 관한 것이다.
본 발명에 있어서, 상기 제 8인자 유전자의 엑손 영역은 서열번호 1의 염기서열로 표시되는 엑손 영역인 것으로 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 제 9인자 유전자의 엑손 영역은 서열번호 2의 염기서열로 표시되는 엑손 영역인 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명은 또한, 상기 sgRNA를 암호화하는 폴리뉴클레오타이드에 관한 것이다.
본 발명에 있어서, 상기 폴리뉴클레오타이드는 서열번호 3 내지 6 중 어느 하나의 염기서열로 표시되는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서, 상기 sgRNA를 암호화하는 폴리뉴클레오타이드는 일반적으로, 관심되는 세포 또는 배아에서 sgRNA의 발현을 위해 최소한 하나의 전사 제어 서열에 작동 가능하게 연결된다. 가령, sgRNA를 인코딩하는 DNA는 RNA 중합효소 III (Pol III)에 의해 인식되는 프로모터 서열에 작동 가능하게 연결될 수 있다. 적합한 Pol III 프로모터의 실례에는 포유류 U6, U3, H1, 그리고 7SL RNA 프로모터가 포함되지만 이들에 한정되지 않는다.
본 발명은 또한, 상기 폴리뉴클레오타이드가 삽입된 벡터에 관한 것이다.
sgRNA를 인코딩하는 DNA 분자는 선형 또는 환상일 수 있다. 일부 구체예에서, sgRNA를 인코딩하는 DNA 서열은 벡터의 부분일 수 있다. 적합한 벡터는 플라스미드 벡터, 파지미드, 코스미드, 인공/꼬마염색체, 트랜스포손, 그리고 바이러스 벡터를 포함한다. 예시적인 구체예에서, Cas 단백질을 인코딩하는 DNA는 플라스미드 벡터 내에 존재한다. 적합한 플라스미드 벡터의 무제한적 실례는 pUC, pBR322, pET, pBluescript, 그리고 이들의 변이체를 포함한다. 벡터는 추가 발현 제어 서열 (가령, 인핸서 서열, Kozak 서열, 폴리아데닐화 서열, 전사 종결 서열 등), 선별가능 마커 서열 (가령, 항생제 내성 유전자), 복제 기점, 기타 등등을 포함할 수 있다.
Cas 단백질과 sgRNA 둘 모두 DNA 분자로서 세포 내로 도입되는 구체예에서, 각각은 별개의 분자의 부분 (가령, 융합 단백질 코딩 서열을 내포하는 하나의 벡터 및 sgRNA 코딩 서열을 내포하는 두 번째 벡터)일 수 있거나 또는 둘 모두 동일한 분자의 부분 (가령, 융합 단백질과 유도 RNA 둘 모두에 대한 코딩 (및 조절) 서열을 내포하는 하나의 벡터)일 수 있다.
본 발명은 또한 상기 벡터를 포함하는 CRISPR/Cas 시스템에 관한 것이다.
본 발명에 있어서, 상기 CRISPR/Cas 시스템은 타입 I, 타입 II, 또는 타입 III 시스템일 수 있다. 적합한 CRISPR/Cas 단백질의 무제한적 실례는 Cas3, Cas4, Cas5, Cas5e (또는 CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (또는 CasA), Cse2 (또는 CasB), Cse3 (또는 CasE), Cse4 (또는 CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, 및 Cu1966을 포함한다.
본 발명에 있어서, 상기 Cas9 단백질로부터 유래된다. Cas9 단백질은 스트렙토콕쿠스 피오게네스 (Streptococcus pyogenes), 스트렙토콕쿠스 써모필루스 (Streptococcus thermophilus), 스트렙토콕쿠스 (Streptococcus) 종, 노카르디오프시스 라스손빌레이 (Nocardiopsis dassonvillei), 스트렙토미세스 프리스티네스피랄리스 (Streptomyces pristinaespiralis), 스트렙토미세스 비리도크로모게네스 (Streptomyces viridochromogenes), 스트렙토미세스 비리도크로모게네스 (Streptomyces viridochromogenes), 스트렙토스포랑기움 로세움 (Streptosporangium roseum), 스트렙토스포랑기움 로세움 (Streptosporangium roseum), 알리사이클로바실루스 아시도칼다리우스 (Alicyclobacillus acidocaldarius), 바실루스 슈도마이코이데스 (Bacillus pseudomycoides), 바실루스 셀레니티레두센스 (Bacillus selenitireducens), 엑시구오박테리움 시비리쿰(Exiguobacterium sibiricum), 락토바실루스 델브루키 (Lactobacillus delbrueckii), 락토바실루스 살리바리우스 (Lactobacillus salivarius), 미크로스킬라 마리나 (Microscilla marina), 버크홀데리알레스 박테리움 (Burkholderiales bacterium), 폴라로모나스 나프탈레니보란스 (Polaromonas naphthalenivorans), 폴라로모나스 (Polaromonas) 종, 크로코스파에라 왓소니 (Crocosphaera watsonii), 시아노테세 (Cyanothece) 종, 마이크로시스티스 아에루기노사 (Microcystis aeruginosa), 시네코콕쿠스 (Synechococcus) 종, 아세토할로비움 아라바티쿰 (Acetohalobium arabaticum), 암모니펙스 데겐씨 (Ammonifex degensii), 칼디셀룰로시럽토 베시(Caldicellulosiruptor bescii), 칸디다투스 데술포루디스 (Candidatus Desulforudis), 클로스트리듐 보툴리눔 (Clostridium botulinum), 클로스트리듐 디피실레 (Clostridium difficile), 피네골디아 마그나 (Finegoldia magna), 나트라나이로비우스 써모필루스 (Natranaerobius thermophilus), 펠로토마쿨룸 써모프로피오니쿰(Pelotomaculum thermopropionicum), 아시치오바실루스 칼두스 (Acidithiobacillus caldus), 아시치오바실루스 페록시단스 (Acidithiobacillus ferrooxidans), 알로크로마티움 비노숨 (Allochromatium vinosum), 마리노박터(Marinobacter) 종, 니트로소콕쿠스 할로필루스 (Nitrosococcus halophilus), 니트로소콕쿠스 왓소니 (Nitrosococcus watsoni), 슈도알테로모나스 할로플랭크티스 (Pseudoalteromonas haloplanktis), 크테도노박터 라세미페르 (Ktedonobacter racemifer), 메타노할로비움 에베스티가툼 (Methanohalobium evestigatum), 아나베나 바리아빌리스 (Anabaena variabilis), 노둘라리아 스푸미게나 (Nodularia spumigena), 노스톡 (Nostoc) 종, 아르트로스피라 맥시마 (Arthrospira maxima), 아르트로스피라 플라텐시스 (Arthrospira platensis), 아트로스피라 (Arthrospira) 종, 링비아 (Lyngbya) 종, 미크로콜레우스 크토노플라스테스 (Microcoleus chthonoplastes), 오실라토리아 (Oscillatoria) 종, 페트로토가 모빌리스 (Petrotoga mobilis), 써모시포 아프리카누스 (Thermosipho africanus), 또는 아카리오클로리스 마리나 (Acaryochloris marina)로부터 유래될 수 있다.
일반적으로, CRISPR/Cas 단백질은 최소한 하나의 RNA 인식 및/또는 RNA 결합 도메인을 포함한다. RNA 인식 및/또는 RNA 결합 도메인은 유도 RNA와 상호작용한다. CRISPR/Cas 단백질은 또한, 뉴클레아제 도메인 (즉, DNA분해효소 또는 RNA분해효소 도메인), DNA 결합 도메인, 헬리카아제 도메인, RNA분해효소 도메인, 단백질-단백질 상호작용 도메인, 이합체화 도메인뿐만 아니라 다른 도메인을 포함할 수 있다. CRISPR/Cas-유사 단백질은 야생형 CRISPR/Cas 단백질, 변형된 CRISPR/Cas 단백질, 또는 야생형 또는 변형된 CRISPR/Cas 단백질의 단편일 수 있다. CRISPR/Cas- 유사 단백질은 핵산 결합 친화성 및/또는 특이성을 증가시키고, 효소적 활성을 변경 및/또는 단백질의 다른 성질을 변화시키기 위해 변형될 수 있다. 가령, CRISPR/Cas-유사 단백질의 뉴클레아제 (즉, DNA분해효소, RNA분해효소) 도메인은 변형되거나, 결실되거나, 또는 불활성화될 수 있다. 대안으로, CRISPR/Cas-유사 단백질은 융합 단백질의 기능에 필수적이지 않은 도메인을 제거하기 위해 절두될 수 있다. CRISPR/Cas-유사 단백질은 또한, 융합 단백질의 작동체 도메인의 활성을 최적화하기 위해 절두되거나 또는 변형될 수 있다.
일부 구체예에서, CRISPR/Cas-유사 단백질은 야생형 Cas9 단백질 또는 이의 단편으로부터 유래될 수 있다. 다른 구체예에서, CRISPR/Cas-유사 단백질은 변형된 Cas9 단백질로부터 유래될 수 있다. 가령, Cas9 단백질의 아미노산 서열은 단백질의 하나 또는 그 이상의 성질 (가령, 뉴클레아제 활성, 친화성, 안정성 등)을 변경하기 위해 변형될 수 있다. 대안으로, RNA-유도된 개열에 관련되지 않는 Cas9 단백질의 도메인이 단백질로부터 제거될 수 있고, 따라서 변형된 Cas9 단백질은 야생형 Cas9 단백질보다 작다
일반적으로, Cas9 단백질은 최소한 2개의 뉴클레아제 (즉, DNA 분해효소) 도메인을 포함한다. 가령, Cas9 단백질은 RuvC-유사 뉴클레아제 도메인 및 HNH-유사 뉴클레아제 도메인을 포함할 수 있다. RuvC와 HNH 도메인은 단일 가닥을 절단하여 DNA에서 이중 가닥 절단을 만들기 위해 함께 작동한다 (Jinek et al., Science, 337: 816-821). 일부 구체예에서, Cas9-유래된 단백질은 단지 한 가지 기능적 뉴클레아제 도메인 (RuvC-유사 또는 HNH-유사 뉴클레아제 도메인 중에서 어느 한쪽)만을 내포하도록 변형될 수 있다. 가령, Cas9-유래된 단백질은 뉴클레아제 도메인 중에서 한 가지가 결실되거나 또는 돌연변이되고, 따라서 이것이 더 이상 기능하지 않도록 (즉, 뉴클레아제 활성이 부재하도록) 변형될 수 있다. 뉴클레아제 도메인 중에서 한 가지가 비활성인 일부 구체예에서, Cas9-유래된 단백질은 이중 가닥 핵산 내로 틈을 도입할 수 있지만 (이런 단백질은 "틈내기효소"로 명명된다), 이중 가닥 DNA를 개열하지 않는다. 가령, RuvC-유사 도메인에서 아스파르트산염에서 알라닌 (D10A) 전환은 Cas9-유래된 단백질을 틈내기효소로 전환한다. 유사하게, HNH 도메인에서 히스티딘에서 알라닌 (H840A 또는 H839A) 전환은 Cas9-유래된 단백질을 틈내기효소로 전환한다. 각 뉴클레아제 도메인은 널리 공지된 방법, 예를 들면, 부위-지향된 돌연변이유발, PCR-매개된 돌연변이 유발, 그리고 전체 유전자 합성뿐만 아니라 당분야에서 공지된 다른 방법을 이용하여 변형될 수 있다.
본 발명에 있어서, 상기 Cas 단백질을 인코딩하는 DNA는 최소한 하나의 프로모터 제어 서열에 작동 가능하게 연결될 수 있다. 일부 반복에서, DNA 코딩 서열은 관심되는 진핵 세포 또는 동물에서 발현을 위해 프로모터 제어 서열에 작동 가능하게 연결될 수 있다. 프로모터 제어 서열은 구조성, 조절된, 또는 조직 특이적일 수 있다. 적합한 구조성 프로모터 제어 서열에는 시토메갈로바이러스 극초기 프로모터 (CMV), 유인원 바이러스(SV40) 프로모터, 아데노바이러스 주요 후기 프로모터, 라우스 육종 바이러스 (RSV) 프로모터, 생쥐 유방 종양 바이러스 (MMTV) 프로모터, 포스포글리세린산 키나아제 (PGK) 프로모터, 연장 인자 (ED1)-알파 프로모터, 유비퀴틴 프로모터, 액틴 프로모터, 튜불린 프로모터, 면역글로불린 프로모터, 이들의 단편, 또는 전술한 것들의 임의의 조합이 포함되지만 이들에 한정되지 않는다. 적합한 조절된 프로모터 제어 서열의 실례는 제한 없이, 열 쇼크, 금속, 스테로이드, 항생제, 또는 알코올에 의해 조절된 것들을 포함한다. 조직 특이적 프로모터의 무제한적 실례는 B29 프로모터, CD14 프로모터, CD43 프로모터, CD45 프로모터, CD68 프로모터, 데스민 프로모터, 엘라스타아제-1 프로모터, 엔도글린 프로모터, 섬유결합소 프로모터, Flt-1 프로모터, GFAP 프로모터, GPIIb 프로모터, ICAM-2 프로모터, INF-β 프로모터, Mb 프로모터, NphsI 프로모터, OG-2 프로모터, SP-B 프로모터, SYN1 프로모터, 그리고 WASP 프로모터를 포함한다. 프로모터 서열은 야생형이거나 또는 더욱 효율적인 또는 유효한 발현을 위해 변형될 수 있다. 한 예시적인 구체예에서, 인코딩 DNA는 포유류 세포에서 구조성 발현을 위해 CMV 프로모터에 작동 가능하게 연결될 수 있다.
본 발명에 있어서, 상기 Cas 단백질을 인코딩하는 서열은 시험관내 mRNA 합성을 위한 파지 RNA 중합효소에 의해 인식되는 프로모터 서열에 작동 가능하게 연결될 수 있다. 이런 구체예에서, 시험관내 전사된 RNA는 공지된 방법으로 정제하여 사용할 수 있다. 가령, 프로모터 서열은 T7, T3, 또는 SP6 프로모터 서열 또는 T7, T3, 또는 SP6 프로모터 서열의 변이일 수 있다. 예시적인 구체예에서, Cas 단백질을 인코딩하는 DNA는 T7 RNA 중합효소를 이용한 시험관내 mRNA 합성을 위해 T7 프로모터에 작동 가능하게 연결된다.
대안적 구체예에서, Cas 단백질을 인코딩하는 서열은 세균 또는 진핵 세포에서 Cas 단백질의 시험관내 발현을 위해 프로모터 서열에 작동 가능하게 연결될 수 있다. 이런 구체예에서, 발현된 단백질은 공지된 방법으로 정제하여 사용할 수 있다. 적합한 세균 프로모터는 제한 없이, T7 프로모터, lac 오페론 프로모터, trp 프로모터, 이들의 변이, 그리고 이들의 조합을 포함한다. 예시적인 세균 프로모터는 trp와 lac 프로모터의 하이브리드인 tac이다. 적합한 진핵 프로모터의 무제한적 실례는 상기에서 열거된다. 추가의 양상에서, Cas 단백질을 인코딩하는 DNA는 또한, 폴리아데닐화 신호 (가령, SV40 polyA 신호, 소 성장 호르몬 (BGH) polyA 신호 등) 및/또는 최소한 하나의 전사 종결 서열에 연결될 수 있다.
다양한 구체예에서, Cas 단백질을 인코딩하는 DNA는 벡터 내에 존재할 수 있다. 적합한 벡터는 플라스미드 벡터, 파지미드, 코스미드, 인공/꼬마염색체, 트랜스포손, 그리고 바이러스 벡터(가령, 렌티바이러스 벡터, 아데노 연관된 바이러스 벡터 등)를 포함한다. 한 구체예에서, Cas 단백질을 인코딩하는 DNA는 플라스미드 벡터 내에 존재한다. 적합한 플라스미드 벡터의 무제한적 실례는 pUC, pBR322, pET, pBluescript, 그리고 이들의 변이체를 포함한다. 상기 벡터는 추가 발현 제어 서열 (가령, 인핸서 서열, Kozak 서열, 폴리아데닐화 서열, 전사 종결 서열 등), 선별가능 마커 서열 (가령, 항생제 내성 유전자), 복제 기점, 기타 등등을 포함할 수 있다. 추가 정보는 "Current Protocols in Molecular Biology" Ausubel et al., John Wiley & Sons, New York, 2003 또는 "Molecular Cloning: A Laboratory Manual" Sambrook & Russell, Cold Spring Harbor Press, Cold Spring Harbor, NY, 3rd edition, 2001를 참고하면 된다.
유도 RNA와 함께 Cas 단백질은 염색체 서열 내에서 표적 부위에 지향되고, 여기서 Cas 단백질은 염색체 서열 내에 이중 가닥 절단을 도입한다. 표적 부위는 상기 서열 바로 뒤에 (하류) 공통 서열이 뒤따른다는 점을 제외하고, 서열 제한을 갖지 않는다. 이러한 공통 서열은 또한, 프로토스페이서 인접한 모티프 (PAM)로서 알려져 있다. PAM의 실례에는 NGG, NGGNG, 그리고 NNAGAAW (여기서 N은 임의의 뉴클레오타이드로서 규정되고, 그리고 W는 A 또는 T로서 규정된다)가 포함되지만 이들에 한정되지 않는다. 상기에서 상술된 바와 같이, 유도 RNA의 첫 번째 영역 (5' 단부에서)은 표적 서열의 프로토스페이서에 상보적이다.
전형적으로, 유도 RNA의 첫 번째 영역은 길이에서 약 19 내지 21개 뉴클레오타이드이다. 따라서, 일정한 양상에서, 염색체 서열 내에 표적 부위의 서열은 5'-N19-21-NGG-3'이다. PAM은 이탤릭체로 표시된다. 표적 부위는 유전자의 코딩 영역, 유전자의 인트론, 유전자의 제어 영역, 유전자 사이에 비코딩 영역 등에 있을수 있다. 유전자는 단백질 코딩 유전자 또는 RNA 코딩 유전자일 수 있다. 유전자는 관심되는 임의의 유전자일수 있고, 바람직하게는 제 8인자 또는 제 9인자일 수 있다.
본 발명은 다른 관점에서 제 8인자 (Factor VIII, FVIII) 또는 제 9인자 (Factor IX, FIX)의 엑손 영역 일부에 상보적으로 결합하는 타겟팅 도메인을 포함하는 sgRNA를 암호화하는 폴리뉴클레오타이드가 삽입된 벡터를 포함하는 CRISPR/Cas9 시스템을 이용하여 제조된 형질전환 토끼에 관한 것이다.
본 발명에 있어서, 상기 형질전환 토끼는
(a) 상기 본 발명에 따른 CRIPSR/Cas9 시스템을 전사 (transcription)하여, sgRNA 및 Cas9 mRNA를 제조하는 단계;
(b) 수정란에 상기 (a) 단계에서 제조한 mRNA를 도입하고 배양하는 단계; 및
(c) 상기 (b) 단계에서 수득한 수정란을 대리모에 이식하여 분만시키는 단계;를 포함하는 방법으로 제조되는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 형질전환 토끼는 분만 이후 형질전환 여부를 확인하는 단계를 추가로 포함하는 방법으로 제조되는 것을 특징으로 할 수 있다.
본 발명은 또 다른 관점에서, 상기 형질전환 토끼를 교배하여 자손 형질전환 토끼를 생산하는 단계를 포함하는 방법으로 제조되는 것을 특징으로 하는 자손 형질전환 토끼에 관한 것이다.
본 발명에서, 상기 “자손”은 상기 형질전환 토끼와 교배하여 생존가능한 모든 새끼 형질전환 토끼를 의미하며, 보다 구체적으로는 상기 형질전환 토끼를 부모로 형질전환 토끼끼리 또는 상기 형질전환 토끼와 정상 토끼를 교배하여 생산한 F1 세대, F1 세대의 보인자 토끼와 정상 토끼를 교배하여 생산한 F2세대 및 그 이후 세대를 의미하나 이에 한정되는 것은 아니다.
본 발명에 있어서, 상기 교배는 상기 형질전환 토끼 또는 정상토끼와 교배하는 것을 특징으로 할 수 있다.
본 발명에 있어서, 상기 형질전환 토끼 또는 자손 형질전환 토끼는 제 8인자 또는 제 9인자가 녹아웃 되어 혈우병 표현형을 나타내는 것을 특징으로 할 수 있다.
본 발명은 또한, 상기 형질전환 토끼 또는 자손 형질전환 토끼로부터 분리한 세포, 조직 및 부산물에 관한 것이다.
본 발명에 있어서, 상기 부산물은 상기 형질전환 토끼로부터 유래한 물질 모든 것을 의미하나 바람직하게는 혈액, 혈청, 소변, 대변, 침, 장기 및 피부로 이루어진 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.
한 측면에서, 본 발명은
(a) 상기 본 발명에 따른 CRIPSR/Cas9 시스템을 전사 (transcription)하여, sgRNA 및 Cas9 mRNA를 제조하는 단계;
(b) 수정란에 상기 (a) 단계에서 제조한 mRNA를 도입하고 배양하는 단계; 및
(c) 상기 (b) 단계에서 수득한 수정란을 대리모에 이식하여 분만시키는 단계를 포함하는 토끼는 제 8인자 또는 제 9인자가 녹아웃된 형질전환 토끼의 제조방법에 대한 것이다.
본 발명은 또한, 상기 제조방법으로 제조된 형질전환 토끼를교배하여 자손 형질전환 토끼를 생산하는 단계를 포함하는 자손 형질전환 토끼의 제조방법에 관한 것이다.
본 발명에 있어서, 상기 교배는 상기 형질전환 토끼 또는 정상토끼와 교배하는 것을 특징으로 할 수 있다
본 발명은 또한, 제 8인자가 녹아웃된 토끼를 교배하여 원하는 만큼의 혈우병 A 표현형을 나타내는 형질전환 토끼 및 이의 제조방법에 관한 것이다.
본 발명은 또한, 제 9인자가 녹아웃된 토끼를 교배하여 원하는 만큼의 혈우병 B 표현형을 나타내는 형질전환 토끼 및 이의 제조방법에 관한 것이다.
본 발명은 또한, 제 8인자가 녹아웃된 토끼 혹은 제 9인자가 녹아웃된 토끼를 교배하여 인간 제 8인자 혹은 제 9인자 주입에 따른 면역반응을 연구할 수 있는 형질전환 토끼 및 이의 제조방법에 관한 것이다.
본 발명의 제 8인자 및 제 9인자가 녹아웃된 토끼는 자신의 제 8인자 및 제 9인자의 활성이 없기 때문에 인간 제 8인자 및 제 9인자 주입에 따른 면역반응 연구 및 혈우병 치료제 개발 연구에 유용하다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1. sgRNA 설계 및 CRISPR/Cas9 벡터 구축 및 전사(in vitro transcription)
1-1. sgRNA 설계
제 8인자의 경우, 엑손 1번 영역에서 하기 서열번호 1로 표시되는 서열을 이용하여 서열번호 3 및 서열번호 4의 염기서열로 표시되는 sgRNA를 설계하였다 (도 1).
서열번호 1:
ATGCAAATAGAGCTCTCCACCTGTTTCTTTGTGTGTATTTTACAATTGAGCTTTAGTGCCACCAGAAGATACTACCTGGGTGCAGTGAACTGTCCTGGGACTATATGCACAGTGAC CTGCTCAGTGA
서열번호 3: sgRNA 1 (+ Strand)
5’- GCCACCAGAAGATACTACCTGGG -3’
서열번호 4: sgRNA 2 (- Strand)
5’- GTCACTGTGCATATAGTCCCAGG -3’
제 9인자의 경우, 엑손 2번 영역에서 하기 서열번호 2로 표시되는 서열을 이용하여 서열번호 5 및 서열번호 6의 염기서열로 표시되는 sgRNA를 설계하였다.
서열번호 2:
TTTTTCTTGATCATGAAAATGCCACCAAAATTCTGAATCGGGCAAAGAGGTACAATTCAGGTAAACTGGAAGAGTTTGTTTCAGGGAACCTTGAGAGAGAATGTATAGAAGAAAGGTGTAGTTTTGAAGAAGCTCGAGAAGTTTTTGAAAACACTGAAAAAACT
서열번호 5: sgRNA 1 (+ Strand)
5’- ATGCCACCAAAATTCTGAATCGG -3’
서열번호 6: sgRNA 2 (+ Strand)
5’ CGGGCAAAGAGGTACAATTCAGG -3’
1-2. sgRNA 및 Cas9 mRNA 전사
실시예 1-1에서 설계한 sgRNA 서열에 맞는 올리고뉴클레오타이드를 디자인하여 pUC57-T7 벡터 (Addgene ID 51306)에 클로닝한 다음, 완성된 sgRNA 및 그 앞에 위치한 T7 프로모터를 서열번호 7 및 8의 프라이머로 PCR을 통해 증폭하였다.
상기 PCR 증폭산물을 T7 RNA polymerase를 이용하여 생산 (MAXIscript T7 Kit, Ambion) 한 다음, 정제하였다 (miRNeasy Mini Kit, Qiagen).
서열번호 7: T7-F
5’- GAAATTAATACGACTCACTAT -3’
서열번호 8: T7-R
5’- AAAAAAAGCACCGACTCGGTGCCAC -3’
Cas9 mRNA의 경우, Cas9 발현 벡터를 linearize 한 다음, mMessage mMachine SP6 Kit (Ambion)을 이용하여 Capped mRNA 형태로 생산한 다음, RNeasy Mini Kit (Qiagen)을 이용하여 정제하였다.
실시예 2. 수정란에 전사된 Cas9/sgRNA 주입
공지된 방법 (Sci Rep. 2016; 6:222024)으로 토끼 수정란에 실시예 1에서 수득한 Cas9/FVIII sgRNA 또는 Cas9/FIX sgRNA를 각각 도입하였다.
대략적으로는 수정 후 18-20시간이 지난 후 획득한 토끼 수정란을 수정란 배양 배지 (9.5g TCM-119, 0.05g NaHCO3 (Sigma, S4019), 0.75g Hepes (Sigma H3784), 0.05g penicillin, 0.06g streptomycin, 1.755g NaCl, 3.0g BSA 및 1L Milli Q 증류수)로 옮긴 다음, FVIII sgRNA(25 ng/μl)과 Cas9 mRNA(100 ng/μl) 또는 FIX sgRNA(25 ng/μl)과 Cas9 mRNA(100 ng/μl)를 embryo의 cytoplasm에 주입한 다음, 배양 배지에서 38.5 ℃에서 30-60 분간 5 % 이산화탄소 조건에서 배양한 다음, 대리모에 이식하여 분만시켰다.
실시예 3. 형질전환 토끼 유전형 분석
3-1. 제 8인자 녹아웃 토끼의 유전형 분석
도 2의 (a)에 표시된 앰플리콘을 서열번호 9 및 10의 프라이머를 이용하여 증폭한 다음, 2차 3차 PCR을 통해 어댑터 및 tag을 부착한 후, MiSeq (Illumina, MiSeq Reagent Kit V)을 이용하여 deep sequencing을 수행한 다음, 그 결과를 Cas-Analyzer (Bioinformatics, 2017 Jan 15; 333(2): 286-288)를 이용하여 분석하였다.
서열번호 9: F8-F
5’- gagccatgcaaatagagctc -3‘
서열번호 10: F8-R
5’- atctttctccagccagagtc -3’
그 결과, 표 1 및 도 3에 개시된 바와 같이 제2개체 및 제3개체의 FVIII 유전자에서 indel이 검출되는 것을 확인할 수 있었다.
Figure PCTKR2018011118-appb-T000001
즉, 제2개체에서는 4 bp의 핵산이 결실된 돌연변이가 검출되어, premature stop codon 및 nonsense-mediated decay를 야기하여 유전자 발현을 저해하는 것을 확인하였으며, 제3개체에서는 3 bp와 12 bp의 핵산이 결실된 돌연변이를 검출하였다 (도 3).
3-2. 제 9인자 녹아웃 토끼의 유전형 분석
도 2의 (b)에 표시된 앰플리콘을 서열번호 11 및 12의 프라이머를 이용하여 증폭한 다음, 2차 3차 PCR을 통해 어댑터 및 tag을 부착한 후, MiSeq (Illumina, MiSeq Reagent Kit V)을 이용하여 deep sequencing을 수행한 다음, 그 결과를 Cas-Analyzer (Bioinformatics, 2017 Jan 15; 333(2): 286-288)를 이용하여 분석하였다. 제5개체의 경우, 서열번호 13의 F9-R2 프라이머를 이용하여 1차 증폭하였다.
서열번호 11: F9-F
5’- ttggctttgggattagttgg -3’
서열번호 12: F9-R
5’- tcaaaaacttctcgagcttc -3’
서열번호 13: F9-R2
5‘- tctctgtctgtaactctacc -3’
그 결과, 표 2 및 도 4 내지 도 6에 개시된 바와 같이 제 5개체, 제 6개체, 제 7개체, 제 8개체, 제 9개체, 제 11개체, 제 12개체 및 제 13개체의 FIX 유전자에서 indel이 검출되는 것을 확인할 수 있었다.
Figure PCTKR2018011118-appb-T000002
실시예 4. 형질전환 토끼의 혈우병 표현형 확인
4-1. APTT (Activated Partial Thromboplastin Time) 분석
APTT 분석을 수행하기 위하여, Start 4Hemostasis Analyzer (Stago Inc., USA)를 이용하여 실시간으로 APTT 클롯 (clot)의 웨이브 폼을 관찰하였다. 즉, 50 μl의 APTT reagent (Dade® Actin FSL, Siemens Medical Solutions Inc., USA) 용액과 형질전환 토끼로부터 채취한 50 μl의 혈장을 큐벳에서 섞은 다음, 37 °C에서 3 분간 배양한 다음, 50 μl의 염화칼슘 (CaCl2) 수용액 (최종 농도: 25mM)을 큐벳에 주입한 다음, 클롯 이 생기는 시간을 측정하였다.
그 결과, 도 7의 A에 개시된 바와 같이, FVIII가 녹아웃된 토끼의 경우, 클롯 형성 시간이 19.4±1.1 초이며, FIX가 녹아웃된 토끼의 경우, 그 시간이 18.9±2.5 초 인 것으로 모두 혈우병 환자에 해당하는 시간인 것을 확인할 수 있었다.
4-2. 트롬빈 생산 분석 (Thrombin Generation Assay, TGA)
트롬빈 생산은 Fluoroskan Ascent (Thermo Scientific) 형광 플레이트 리더를 Thrombinoscope BV software 로 분석하여 측정하였다. 즉, 형질전환 토끼의 혈장 80μl와 tissue factor 및 포스포리피드를 함유한 2 μl의 PPP-reagent LOW를 섞어서 37℃의 Immulon microtiter 2HB-High Binding 96 웰 플레이트 (Thermo Nunc)에서 배양하였다. 컨트롤 웰에는 80 μl의 토끼 혈장과 20 μl의 Thrombin Calibrator reagent를 섞어서 배양하였으며, 반응을 시작하기 전에 형광을 가진 트롬빈 기질과 미리 데워둔 Flu-Ca reagent를 주입하고 잘 섞어 주었다. 20 μl의 Flu-Ca reagent를 주입하여 반응을 시작하였으며, 생산되는 트롬빈의 양은 Thrombinoscope Analysis Version 3.0으로 분석하였다.
그 결과, 도 7의 B에 개시된 바와 같이 대조군에서는 36.9±1.8 nM의 트롬빈이 생산되는 반면 FVIII가 녹아웃된 형질전환 토끼에서는 0.1±0.1 nM이 생산되며, FIX가 녹아웃된 형질전환 토끼에서는 0 nM의 트롬빈이 생산되는 것을 확인하였다.
따라서 FVIII 혹은 FIX의 유전자가 제거된 형질전환 토끼는 혈우병 표현형을 나타내는 것을 확인할 수 있다.
실시예 5. F1세대 및 F2세대 생산을 위한 번식 가계도
실시예 2에서 제조한 혈우병 토끼를 P (또는 F0)라고 하고, 이의 자손에 해당하는 F1과 F2를 얻기 위해 다음과 같이 진행하였다. 제 8인자 녹아웃 혹은 제 9인자를 녹아웃시킨 형질전환 토끼의 자손을 얻기 위해서는 도 8에 개시된 바와 같이 개체를 번식시켰다. 즉, 혈우병은 혈우병 유전자가 X 염색체 상에 존재하는 반성 유전병에 해당하기 때문에, 실시예 2에서 제조한 제 8인자 녹아웃 및 제 9인자 녹아웃 형질 전환 토끼 부체(P, X’Y)를 정상토끼 암컷(XX)과 교차시켜 자손을 생성하였다. 첫번째 교차로부터 얻어진 자손 암컷(F1)의 유전자 분석을 하여 보인자(X’X)를 확인한 후 정상 수컷(XY)과 교차시켜 제8인자 녹아웃 및 제 9인자 녹아웃을 시킨 형질 전환 토끼의 수컷(F2, X’Y)을 제조하였다.
실시예 6. F1세대의 형질전환 토끼 유전형 분석
6-1. 제 8인자 녹아웃 토끼 보인자의 유전형 분석
표 1의 4 bp의 핵산이 결실된 돌연변이가 검출되었던 #2 개체인 수컷 토끼(X’Y)를 샘타코에서 구입한 몸무게 2kg이상과 10-12주령인 정상 암컷(XX)과 교배시켜 자손을 얻어 이를 실시예 3-1과 같은 방법으로 유전자 분석을 진행하여 F1세대인 암컷 보인자(X’X)를 확인하였다. 표 3 및 도 9에 개시된 바와 같이 제1개체와 제 5개체의 FVIII 유전자에서 indel 패턴이 검출되는 것을 확인할 수 있었다.
Figure PCTKR2018011118-appb-T000003
6-2. 제 9인자 녹아웃 토끼 보인자의 유전형 분석
표 2 중 6 bp의 핵산이 결실된 돌연변이가 검출된 #6 개체인 수컷(X’Y)을 정상 암컷(XX)과 교배시켜 자손(F1)을 얻고 실시예 3-2와 같은 방법으로 유전자 분석을 진행하여 암컷 보인자(X’X)를 확인하였다. 표 4 및 도 10에 개시된 바와 같이 #4 개체의 FIX 유전자에서 indel 패턴이 검출되는 것을 확인할 수 있으며 형태는 -6bp deletion과 1bp insertion이다.
Figure PCTKR2018011118-appb-T000004
실시예 7. F2세대의 형질전환 토끼 유전형 분석
7-1. 제 8인자 녹아웃 토끼의 유전형 분석
F1세대인 보인자 암컷(X’X)을 샘타코에서 구입한 몸무게 2kg이상과 10-12주령인 정상 수컷(XY)과 교배시켜 얻은 F2 수컷(X’Y)에 대해 실시예 3-1과 같은 방법으로 유전자 분석을 실시하였다. 표 5 및 도 11에 개시된 바와 같이 #1-4 개체와 #5-1 개체의 FVIII 유전자에서 indel 패턴이 검출되는 것을 확인할 수 있었다.
Figure PCTKR2018011118-appb-T000005
7-2. 제 9인자 녹아웃 토끼의 유전형 분석
F1세대인 보인자 암컷(X’X)을 정상 수컷(XY)과 교배시켜 얻은 F2 수컷(X’Y)에 대해실시예 3-2와 같은 방법으로 유전자 분석을 실시하였다. 표 6 및 도 12에 개시된 바와 같이 #4-1 개체의 FIX 유전자에서 indel 패턴이 검출되는 것을 확인할 수 있으며 형태는 6bp, 7bp, 27bp deletion형태이나, 7bp, 27bp deletion은 그 비율이 각각 0.023%, 0.001%로 서열분석 에러인 것으로 판단되어 그 형태는 6bp 핵산 결실 변이인 것으로 확인하였다.
Figure PCTKR2018011118-appb-T000006
실시예 8. F2세대로 얻어진 형질전환 토끼의 표현형 확인
8-1. 발톱 출혈 모델
토끼에서의 발톱출혈모델을 유도하기 위해 몸무게 2kg이상과 12주령 이상이 된 실시예 7의 혈우병 토끼와 샘타코에서 구입한 몸무게 2kg이상과 10-12주령인 정상토끼에 Diazepam 0.4 mg/kg과 pentobarbital sodium 25 mg/kg을 이개(耳介)정맥을 통해 주사하여 마취시켰다. 마취된 토끼의 한 쪽 앞발을 hair clipper로 제모하고, digimatic caliper를 이용하여 가운데 발가락 발톱의 quick 원위부 끝으로부터 2 mm 근위부를 유성펜을 이용하여 표시한 후 wire cutter를 이용하여 절단하였다(도 13). 발톱을 절단한 즉시 37˚C로 유지시킨 멸균생리식염수가 담긴 50 mL conical tube에 넣어 60 분 동안 혈액을 모은 다음, 1500 x g에서 5분간 원심 분리하여 상층액을 제거한 후, 10mL pipet을 이용하여 conical tube에 3차 증류수를 20mL까지 넣은 후 vortex를 이용하여 혈액을 완전히 용혈시켰다.
8-2. 헤모글로빈 분석 (Hemoglobin assay: HB) 분석
실시예 8-1에서 용혈된 샘플을 이용하여 hemoglobin assay kit (Sigma and Aldrich, MAK115-1KT,# BF03A26V)의 방법으로 혈액내의 헤모글로빈의 양을 정량하여 blood loss를 측정하였다. 정상 토끼의 경우 헤모글로빈의 농도가 1,014 nM(Range: 502-1503)인 것을 확인하였고, 제8인자 녹아웃 토끼의 헤모글로빈의 농도가 45,787nM, 제9인자 녹아웃 토끼의 hemoglobin의 농도가 4,620nM 확인하였다(도 14).
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
본 발명에 따른 제 8인자 및/또는 제 9인자가 녹아웃된 형질전환 토끼는 혈우병 발생에 중요한 기능을 수행하는 단백질인 제 8인자 및/또는 제 9인자의 기능이 억제되어 있기 때문에, 혈우병 치료제의 개발에 이용하거나 혈우병 연구에 유용하다.
전자파일 첨부하였음.

Claims (18)

  1. 제 8인자 (Factor VIII, FVIII) 또는 제 9인자 (Factor IX, FIX)의 엑손 영역에 상보적으로 결합하는 타겟팅 도메인을 포함하는 sgRNA.
  2. 제1항에 있어서, 상기 제 8인자 유전자의 엑손 영역은 서열번호 1의 염기서열로 표시되는 엑손 영역인 것을 특징으로 하는 sgRNA.
  3. 제1항에 있어서, 상기 제 9인자 유전자의 엑손 영역은 서열번호 2의 염기서열로 표시되는 엑손 영역인 것을 특징으로 하는 sgRNA.
  4. 제1항 내지 제3항 중 어느 한 항의 sgRNA를 암호화하는 폴리뉴클레오타이드.
  5. 제4항에 있어서, 상기 폴리뉴클레오타이드는 서열번호 3내지 6중 어느 하나의 염기서열로 표시되는 것을 특징으로 하는 폴리뉴클레오타이드.
  6. 제4항의 폴리뉴클레오타이드가 삽입된 벡터.
  7. 제6항의 벡터를 포함하는 CRISPR/Cas9 시스템.
  8. 제7항의 CRISPR/Cas9 시스템을 이용하여 제조된 형질전환 토끼
  9. 제8항에 있어서, 상기 형질전환 토끼는
    (a) 제 7항의 CRISPR/Cas9 시스템을 전사 (transcirption)하여, sgRNA 및 Cas9 mRNA를 제조하는 단계;
    (b) 수정란에 상기 (a) 단계에서 제조한 mRNA를 도입하고 배양하는 단계; 및
    (c) 상기 (b) 단계에서 수득한 수정란을 대리모에 이식하여 분만시키는 단계를 포함하는 방법으로 제조되는 것을 특징으로 하는 형질전환 토끼.
  10. 제9항에 있어서, 상기 형질전환 토끼는 분만 이후 형질전환 여부를 확인하는 단계를 추가로 포함하는 방법으로 제조되는 것을 특징으로 하는 형질전환 토끼.
  11. 제9항에 따른 형질전환 토끼를 교배하여 자손 형질전환 토끼를 생산하는 단계를 포함하는 방법으로 제조되는 것을 특징으로 하는 자손 형질전환 토끼.
  12. 제11항에 있어서, 상기 형질전환 토끼의 교배는 제9항에 따른 형질전환 토끼 또는 정상 토끼와 교배하는 것을 특징으로 하는, 자손 형질전환 토끼.
  13. 제8항 내지 제12항 중 어느 한 항에 있어서, 상기 형질전환 토끼 또는 자손형질전환 토끼는 제 8인자 또는 제 9인자가 녹아웃되어 혈우병 표현형을 나타내는 것을 특징으로 하는 형질전환 토끼.
  14. 제8항의 형질전환 토끼 또는 제11항의 자손 형질전환 토끼로부터 분리한 세포, 조직 및 부산물.
  15. 제14항에 있어서, 상기 부산물은 혈액, 혈청, 소변, 대변, 침, 장기 및 피부로 이루어진 군에서 선택되는 것을 특징으로 하는 부산물.
  16. 다음 단계를 포함하는 형질전환 토끼의 제조방법.
    (a) 제7항의 CRISPR/Cas9 시스템을 전사 (transcirption)하여, sgRNA 및 Cas9 mRNA를 제조하는 단계;
    (b) 수정란에 상기 (a) 단계에서 제조한 mRNA를 도입하고 배양하는 단계; 및
    (c) 상기 (b) 단계에서 수득한 수정란을 대리모에 이식하여 분만시키는 단계.
  17. 제16항의 방법으로 제조된 형질전환 토끼를 교배하여 자손 형질전환 토끼를 생산하는 단계를 포함하는 자손 형질전환 토끼의 제조방법.
  18. 제17항에 있어서, 상기 형질전환 토끼의 교배는 제16항의 방법으로 제조된 형질전환 토끼 또는 정상 토끼와 교배하는 것을 특징으로 하는, 자손 형질전환 토끼의 제조방법.
PCT/KR2018/011118 2017-09-28 2018-09-20 Factor viii 또는 factor ix 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도 WO2019066378A1 (ko)

Priority Applications (11)

Application Number Priority Date Filing Date Title
MX2020005732A MX2020005732A (es) 2017-09-28 2018-09-20 Conejo de inactivacion de genes del factor viii o factor ix, metodo para preparar el mismo y utilizarlo.
JP2020518017A JP7091450B2 (ja) 2017-09-28 2018-09-20 Ｆａｃｔｏｒ ＶＩＩＩ又はＦａｃｔｏｒ ＩＸ遺伝子がノックアウトされたウサギ、その製造方法及びその用途
US16/651,200 US20210161111A1 (en) 2017-09-28 2018-09-20 Factor viii or factor ix gene knockout rabbit, method for preparing same and use thereof
EA202090635A EA202090635A1 (ru) 2017-09-28 2018-09-20 Кролики с нокаутом гена фактора viii или фактора ix, способы их получения и их применение
CN201880068875.1A CN111492060A (zh) 2017-09-28 2018-09-20 因子viii或因子ix基因敲除兔、其制备方法及其用途
AU2018341437A AU2018341437B2 (en) 2017-09-28 2018-09-20 Factor VIII or factor IX gene knockout rabbit, method for preparing same and use thereof
KR1020207008487A KR102268072B1 (ko) 2017-09-28 2018-09-20 Factor VIII 또는 Factor IX 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도
BR112020006311-8A BR112020006311A2 (pt) 2017-09-28 2018-09-20 Método para preparar um coelho knockout de gene de fator viii ou fator ix e uso do mesmo
EP18862737.6A EP3690053A4 (en) 2017-09-28 2018-09-20 RABBIT WITH FACTOR VIII OR FACTOR IX GENE KNOCKOUT, METHOD OF ITS MANUFACTURING AND USES
CA3077160A CA3077160A1 (en) 2017-09-28 2018-09-20 Factor viii or factor ix gene knockout rabbit, method for preparing same and use thereof
AU2021250834A AU2021250834A1 (en) 2017-09-28 2021-10-11 Factor VIII or factor IX gene knockout rabbit, method for preparing same and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2017-0126068 2017-09-28
KR20170126068 2017-09-28

Publications (1)

Publication Number Publication Date
WO2019066378A1 true WO2019066378A1 (ko) 2019-04-04

Family

ID=65901732

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/011118 WO2019066378A1 (ko) 2017-09-28 2018-09-20 Factor viii 또는 factor ix 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도

Country Status (11)

Country Link
US (1) US20210161111A1 (ko)
EP (1) EP3690053A4 (ko)
JP (2) JP7091450B2 (ko)
KR (1) KR102268072B1 (ko)
CN (1) CN111492060A (ko)
AU (2) AU2018341437B2 (ko)
BR (1) BR112020006311A2 (ko)
CA (1) CA3077160A1 (ko)
EA (1) EA202090635A1 (ko)
MX (1) MX2020005732A (ko)
WO (1) WO2019066378A1 (ko)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021083073A1 (zh) * 2019-10-31 2021-05-06 华东师范大学 一种基于肝细胞Alb基因的疾病治疗的产品
WO2022147759A1 (en) * 2021-01-08 2022-07-14 Susheng Biotech (Hainan) Co., Ltd. Grna molecule targeting intron i or intron ii of hbb gene, synthetic method thereof, and method to correct types of hbb gene mutations
CN115943928B (zh) * 2022-12-28 2023-09-26 广州医药研究总院有限公司 可遗传的甲型血友病模型犬的建立方法

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017131237A1 (ja) * 2016-01-30 2017-08-03 株式会社ボナック 人工単一ガイドｒｎａ及びその用途

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6851319B2 (ja) * 2015-04-27 2021-03-31 ザ・トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア ヒト疾患のＣＲＩＳＰＲ／Ｃａｓ９媒介性の修正のためのデュアルＡＡＶベクター系
BR112018008971A2 (pt) * 2015-11-06 2018-11-27 Crispr Therapeutics Ag materiais e métodos para tratamento de doença de armazenamento de glicogênio tipo 1a
WO2017112895A1 (en) * 2015-12-23 2017-06-29 Haplomics, Inc. F8 gene repair
CN105567735A (zh) * 2016-01-05 2016-05-11 华东师范大学 一种凝血因子基因突变的定点修复载体系统及方法
US20190112353A1 (en) * 2016-02-18 2019-04-18 Crispr Therapeutics Ag Materials and methods for treatment of severe combined immunodeficiency (scid) or omenn syndrome

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017131237A1 (ja) * 2016-01-30 2017-08-03 株式会社ボナック 人工単一ガイドｒｎａ及びその用途

Non-Patent Citations (24)

* Cited by examiner, † Cited by third party
Title
ASTERMARK J ET AL., BLOOD, vol. 108, no. 12, 2006, pages 3739 - 45
ASTERMARK J ET AL., J THROMB. HAEMOST., vol. 5, no. 2, 2007, pages 263 - 5
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 2003, JOHN WILEY SONS
BIOINFORMATICS, vol. 333, no. 2, 15 January 2017 (2017-01-15), pages 286 - 288
BORENSZTAJN ET AL., AM J PATHOL., vol. 172, 2008, pages 309 - 20
CHING-TZU YEN ET AL., THROMBOSIS JOURNAL, vol. 14, 2016, pages 22
DATABASE Nucleotide 26 June 2016 (2016-06-26), ANONYMOUS: "Oryctolagus cuniculus coagulation factor VIII (F8), mRNA", XP055586665, retrieved from NCBI Database accession no. NM_001171271.1 *
DATABASE NUCLEOTIDE 27 May 2017 (2017-05-27), SARKAR G. ET AL.: "Oryctolagus cuniculus coagulation factor IX (F9), mRNA", XP055586670, retrieved from NCBI Database accession no. NM_001195725.1 *
JINEK ET AL., SCIENCE, vol. 337, no. 6096, 2012, pages 816 - 821
JINEK ET AL., SCIENCE, vol. 337, pages 816 - 821
KASPER CK ET AL., THROMB. DIATH. HAEMORRH., vol. 34, no. 2, 1975, pages 612
KEMTON CL ET AL., BLOOD, vol. 113, no. 1, 2009, pages 11 - 7
KESSLER CM, HEMATOLOGY. AM. SOC. HEMATOL. EDUC. PROGRAM., 2005, pages 429 - 35
OLDENBURG J ET AL., THROMB. HAEMOST., vol. 77, no. 2, 1997, pages 234 - 42
PARK YS, J KOREAN MED ASSOC, vol. 52, no. 12, 2009, pages 1201 - 6
PARK YS, J. KOREAN MED. ASSOC., vol. 52, no. 12, 2009, pages 1201 - 6
PRYKHOZHIJ, S. V. ET AL.: "CRISPR Multitargeter: A Web Tool to Find Common and Unique CRISPR Single Guide RNA Targets in a Set of Similar Sequences", PLOS ONE, vol. 10, no. 3, 5 March 2015 (2015-03-05), pages 1 - 18, XP055551212, DOI: doi:10.1371/journal.pone.0119372 *
SAMBROOKRUSSELL: "Molecular Cloning: A Laboratory Manual", 2001, COLD SPRING HARBOR PRESS
SCI REP., vol. 6, 2016, pages 222024
See also references of EP3690053A4
VERBRUGGEN B ET AL., THROMB. HAEMOST., vol. 74, no. 6, 1995, pages 1402 - 51
VIEL KR ET AL., N. ENGL. J. MED., vol. 360, no. 16, 2009, pages 1618 - 27
YEN, C.-T. ET AL.: "Current Animal Models of Hemophilia: the State of the Art", THROMBOSIS JOURNAL, vol. 14, no. suppl.1- 22, 4 October 2016 (2016-10-04), pages 101 - 106, XP055586662 *
YUAN, L. ET AL.: "CRISPR/Cas9-mdiated GJA8 Knockout in Rabbits Recapitulates Human Congenital Cataracts", SCIENTIFIC REPORTS, vol. 6, no. 22024, 25 February 2016 (2016-02-25), pages 1 - 9, XP055586680 *

Also Published As

Publication number Publication date
EP3690053A4 (en) 2021-10-06
JP2020536522A (ja) 2020-12-17
JP2022000055A (ja) 2022-01-04
CN111492060A (zh) 2020-08-04
BR112020006311A2 (pt) 2021-01-12
MX2020005732A (es) 2021-01-15
JP7091450B2 (ja) 2022-06-27
AU2021250834A1 (en) 2021-11-04
CA3077160A1 (en) 2019-04-04
JP7199492B2 (ja) 2023-01-05
KR102268072B1 (ko) 2021-06-23
AU2018341437B2 (en) 2022-04-21
EA202090635A1 (ru) 2020-07-30
EP3690053A1 (en) 2020-08-05
AU2018341437A1 (en) 2020-05-07
US20210161111A1 (en) 2021-06-03
KR20200038538A (ko) 2020-04-13

Similar Documents

Publication Publication Date Title
US12065667B2 (en) Modified Cpf1 MRNA, modified guide RNA, and uses thereof
Lyu et al. Targeted genome engineering in human induced pluripotent stem cells from patients with hemophilia B using the CRISPR-Cas9 system
US20200123542A1 (en) Rna compositions for genome editing
Zhang et al. Disruption of the sheep BMPR-IB gene by CRISPR/Cas9 in in vitro-produced embryos
WO2016021972A1 (en) Immune-compatible cells created by nuclease-mediated editing of genes encoding hla
EP3074515B1 (en) Somatic haploid human cell line
WO2019147014A1 (ko) 연장된 단일 가이드 rna 및 그 용도
Schlissel et al. Double-strand signal sequence breaks in V (D) J recombination are blunt, 5'-phosphorylated, RAG-dependent, and cell cycle regulated.
KR20200121782A (ko) 아데노신 염기 편집제의 용도
EP3536796A1 (en) Gene knockout method
WO2019066378A1 (ko) Factor viii 또는 factor ix 유전자가 녹아웃된 토끼, 이의 제조방법 및 그 용도
JP6751402B2 (ja) 宿主細胞タンパク質の改変方法
Bacman et al. Manipulation of mitochondrial genes and mtDNA heteroplasmy
WO2019020007A1 (zh) 通过诱导剪接位点碱基突变或多聚嘧啶区碱基置换调控rna剪接的方法
WO2018039783A1 (en) Selection systems and methods for genome editing
WO2023008933A1 (ko) 혈액 적합성을 갖는 중간엽 줄기세포, 이의 제조방법 및 용도
US20240175056A1 (en) Prime editing-based simultaneous genomic deletion and insertion
WO2022065689A1 (ko) 편집 효율이 향상된 프라임 편집 기반 유전자 교정용 조성물 및 이의 용도
Xu et al. Introduction of the FecGF mutation in GDF9 gene via CRISPR/Cas9 system with single-stranded oligodeoxynucleotide
EP3666898A1 (en) Gene knockout method
Wang et al. Decreasing predictable DNA off-target effects and narrowing editing windows of adenine base editors by fusing human Rad18 protein variant
EP3792347A1 (en) Method for producing homozygous cells
WO2023008887A1 (ko) 염기 편집기 및 이의 용도
Sun et al. Organoid Easytag: an efficient workflow for gene targeting in human organoids
WO2024063273A1 (en) Novel adenine deaminase variants and a method for base editing using the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18862737

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 20207008487

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 3077160

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2020518017

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2018862737

Country of ref document: EP

Effective date: 20200428

ENP Entry into the national phase

Ref document number: 2018341437

Country of ref document: AU

Date of ref document: 20180920

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112020006311

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112020006311

Country of ref document: BR

Free format text: SOLICITA-SE EFETUAR, EM ATE 60 (SESSENTA) DIAS, O PAGAMENTO DA GRU SOB O CODIGO 260 PARA A REGULARIZACAO DO PEDIDO CONFORME A RESOLUCAO NO189/2017 UMA VEZ QUE A PETICAO NO 870200061605 APRESENTA DOCUMENTOS REFERENTES A DOIS SERVICOS DIVERSOS (APRESENTACAO DE PROCURACAO E TRADUCAO DOS DOCUMENTOS APRESENTADOS NO DEPOSITO) TENDO SIDO PAGO SOMENTE UMA RETRIBUICAO. DEVERA SER PAGA MAIS 1 (UMA) GRU SOB O CODIGO 260 ALEM DA GRU 207, REFERENTE A RESPOSTA DE EXIGENCIA.

ENP Entry into the national phase

Ref document number: 112020006311

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20200327