WO2019066161A1 - 세포질 이식을 이용한 복제배아의 재프로그래밍 효율 향상 방법 - Google Patents

세포질 이식을 이용한 복제배아의 재프로그래밍 효율 향상 방법 Download PDF

Info

Publication number
WO2019066161A1
WO2019066161A1 PCT/KR2018/001691 KR2018001691W WO2019066161A1 WO 2019066161 A1 WO2019066161 A1 WO 2019066161A1 KR 2018001691 W KR2018001691 W KR 2018001691W WO 2019066161 A1 WO2019066161 A1 WO 2019066161A1
Authority
WO
WIPO (PCT)
Prior art keywords
cytoplasm
oocyte
oocytes
somatic cells
cloned
Prior art date
Application number
PCT/KR2018/001691
Other languages
English (en)
French (fr)
Inventor
공일근
쉬렌강
Original Assignee
(주)더킹콩
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)더킹콩 filed Critical (주)더킹콩
Publication of WO2019066161A1 publication Critical patent/WO2019066161A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
    • C12N15/877—Techniques for producing new mammalian cloned embryos
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0273—Cloned vertebrates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies

Definitions

  • the present invention relates to a method for increasing somatic cell replication efficiency in a mammal, and more particularly, to a method for providing a high quality embryo by improving the reprogramming efficiency of a cloned embryo using a cytoplasmic transplantation technique.
  • embryonic aggregation can be a good means of improving both the development rate of blastocysts and the quality of cloned embryos [Tang P-c, West JD. The effects of embryo stage and cell number on the composition of mouse aggregation chimaeras. Zygote. 2000; 8 (03): 235-43; Misica-Turner PM, Oback FC, Eichenlaub M, Wells DN, Oback B. Aggregating embryonic but not somatic nuclear transfer embryos increases cloning efficiency in cattle. Biol Reprod. 2007; 76 (2): 268-78).
  • the present inventors investigated a method for increasing somatic cell replication efficiency in mammals, and in order to replicate somatic cells, the cytoplasm removed with nucleus and polar body was removed from the somatic cells of other oocytes, so that the reprogramming efficiency of somatic cells became very high, And the present invention has been completed.
  • an object of the present invention is to provide a method for enhancing the reprogramming efficiency of a cloned embryo by injecting a cytoplasm together with somatic cells to be replicated in an enucleated oocyte.
  • the present invention provides a method for improving the reprogramming efficiency of a cloned embryo, which comprises injecting somatic cells and cytoplasm to be replicated in enucleated oocytes in which the cytoplasm is lost.
  • the inventors of the present invention found that transplantation of cytoplasmic transplants into enucleated oocytes was performed by using terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL), quantitative reverse transcription PCR and immunocytochemistry techniques, The effect of embryo development on embryo development and quality of small embryos was confirmed.
  • TUNEL terminal deoxynucleotidyl transferase dUTP nick-end labeling
  • immunocytochemistry techniques The effect of embryo development on embryo development and quality of small embryos was confirmed.
  • the present inventors have developed a novel technology called cytoplasm injection cloning technology (CICT). This technique is a technique for transplanting the cytoplasm of another oocyte into the oocyte that has lost the cytoplasm during the enucleation, thereby regenerating the lost cytoplasm of the enucleated oocyte.
  • CICT cytoplasm injection cloning technology
  • the method of improving the reprogramming efficiency of the cloned embryo of the present invention may include injecting the cytoplasm of somatic cells and other oocytes to be cloned into the enucleated oocytes in which the cytoplasm is lost.
  • the amount of cytoplasm of the injected other oocyte is approximately equal to the amount of cytoplasm lost in the enucleated oocyte. In other words, it can be injected with the original amount of cytoplasm present in the recipient oocyte.
  • the amount of cytoplasm lost in the enucleated oocyte may be about 10-50% by volume of the total cytoplasm, but is not limited thereto.
  • the method of enhancing the reprogramming efficiency of the cloned embryo comprises: incubating the cytoplasm of the somatic cells and other oocytes which are to be replicated in the enucleated oocyte with about 20 to 30% 30% by volume of the solution.
  • the enucleated oocyte that has lost the cytoplasm used in the method for improving the reprogramming efficiency of the cloned embryo is prepared by inhaling the enucleated oocyte and the surrounding cytoplasm to enucleation .
  • the step of injecting somatic cells and cytoplasm to be replicated comprises the steps of injecting a single round donor into the perivitelline space of the enucleated oocyte using a manipulation pipette somatic cells) and the cytoplasm of the donor oocyte.
  • the method for enhancing the reprogramming efficiency of the cloned embryo may further include fusing the somatic cells and cytoplasm-impregnated oocytes through an SV mediated method.
  • a method for improving the reprogramming efficiency of the cloned embryo comprises the steps of: (a) extracting somatic cells to be cloned from an individual having somatic cells to be cloned; (b) preparing enucleated oocytes with 20 to 30% by volume of the cytoplasm and nuclei from in vitro maturated oocytes; (c) extracting 20 to 30% by volume cytoplasm from the donor oocyte; (d) injecting cytoplasm extracted from donor oocytes with somatic cells extracted from the somatic cells to be replicated into the enucleated oocytes of step (b); And (e) fusing the somatic cells and cytoplasm-impregnated oocytes.
  • the cloned embryo may be a cloned embryo of a mammal other than a human.
  • the mammals other than humans may include pigs, cows, sheep, mice, dogs and the like, preferably, but not limited to, bees.
  • the proportion of embryos in which dividing is performed and the blastocysts are formed is compared with that of the somatic cell nuclear transfer (SCNT) group [the donor somatic cells in the perivitelline space of the enucleated oocyte (61.5 ⁇ 1.3% vs. CICT group) of the present invention (group injected with cytoplasm of donor oocytes together with somatic cells into enucleated oocyte) 39.7 ⁇ 2.1% and 28.9 ⁇ 0.8% vs. 20.2 ⁇ 1.3%) (P ⁇ 0.05).
  • SCNT somatic cell nuclear transfer
  • CICT showed increased mitochondrial activity, and mRNA levels of DNA methyl transferase 1 and DNA methyl transferase 3a were much lower (P ⁇ 0.05) in the CICT group than in the SCNT group. DNA methyl transferase 3b mRNA levels were lower in the CICT group than in the SCNT group, but there was no significant difference (P> 0.05).
  • the invention provides a method of increasing somatic cell replication efficiency in a mammal using a method of enhancing the reprogramming efficiency of said cloned embryo.
  • a method of increasing the somatic cell replication efficiency of a mammal comprising: (a) extracting somatic cells to be replicated from a mammal; (b) preparing enucleated oocytes with 20 to 30% by volume of the cytoplasm and nuclei from in vitro maturated oocytes; (c) extracting 20 to 30% by volume cytoplasm from the donor oocyte; (d) injecting somatic cells extracted from the mammal and a cytoplasm extracted from a donor oocyte into the enucleated oocyte of step (b); (e) fusing the somatic cells and cytoplasm-impregnated oocytes; And (f) culturing the fused oocyte.
  • the step (f) comprises culturing the fused oocyte in ionomycin for 1 to 10 minutes, treating DMAP (6-dimethylaminopurine) for 3 to 5 hours And activating.
  • the mammal may be a mammal other than a human, and the mammal other than the human may include pigs, cows, sheep, mice, dogs and the like, But is not limited thereto.
  • the present invention provides a cloned somatic cell animal produced by the above method.
  • a desired gene can be inserted or deleted to be efficiently used for producing transgenic cloned animals. That is, it can be effectively used for the production of disease model animals and transgenic clones producing the physiologically active substances, and is also capable of restoring by replication of somatic cells of endangered species.
  • FIG. 1 is a diagram schematically showing a method for increasing somatic cell replication efficiency of the present invention.
  • Figure 2 shows the results of TUNEL analysis of 8 day blastocysts in IVF, SCNT and CICT groups.
  • FIG. 3 shows the result of confirming the fluorescence intensity of mitochondria staining in the blastocyst of 8 days.
  • FIG. 4 shows the results of confirming the relative mRNA expression level of the DNMT gene in the blastocyst determined by RT-qPCR.
  • the present invention provides a method for producing a somatic cell clone of a mammal other than a human, comprising injecting 20 to 30% by volume of a cytoplasm of somatic cells and other oocytes having a characteristic of replicating in an enucleated oocyte at 20 to 30% And to a method for increasing the efficiency.
  • step (b) 20 to 30% by volume of the cytoplasm may be extracted from the oocytes other than the oocytes used in step (a), and then injected together with the somatic cells.
  • the activation of the oocyte fused in step (b) can be performed by incubating the cells in ionomycin for 1 to 10 minutes and treating DMAP (6-dimethylaminopurine) for 3 to 5 hours in fused oocytes .
  • Nuclear transplantation' is a genetic engineering technique that allows an enucleated oocyte to artificially bind other cells or nuclei to have the same traits.
  • Nuclear transfer embryos' refers to oocytes into which nuclear donor cells are introduced or fused.
  • 'Cloning' is a genetic manipulation technique for creating a new individual having the same gene set as that of an individual.
  • the present invention provides a gene manipulation technique in which a cell, an embryo cell, a fetal cell, and / or an adult cell is substantially the same nucleus DNA sequence.
  • Nuclear donor cells refers to nuclei of cells or cells that deliver nuclei to recipient oocytes, which are nuclear receptors.
  • recipient oocyte refers to an oocyte whose original nucleus has been removed through the enucleation process and the nucleus is transferred from the nuclear donor cell.
  • &quot oocyte " preferably refers to a mature oocyte that has reached the middle stage of the second meiosis.
  • 'enucleated oocyte' refers to the removal of the oocyte nucleus.
  • lipid membrane can be a plasma membrane or a nuclear membrane of a cell. Fusion can occur by applying electrical stimulation when the nuclear donor cell and the recipient oocyte are adjacent to each other or when the nuclear donor cell is located in the perivitelline space of the recipient oocyte.
  • Nuclear reprogramming' is a process in which nuclei of the donor cell line are incubated for a certain period of time after fusing the recipient oocyte and the donor cell during the nuclear transfer process, thereby inducing the normal development of the nuclear oocyte (cloned embryo) Process.
  • 'Activation' refers to stimulation of cells to divide before, during, and after nuclear transfer.
  • the present invention refers to stimulation in advance of the nuclear transfer step.
  • Mammal means a mammal other than a human, and most preferably a pig, a cow, a sheep, a mouse, a dog, but is not limited thereto.
  • somatic cell cloned animals In order to produce somatic cell cloned animals, it is necessary to remove the nucleus of the oocyte and inject somatic cells to be cloned and induce reprogramming by fusing to induce de-differentiation into 1-cell stage.
  • the reprogramming of injected somatic cells is insufficient due to insufficient cytoplasm of 20 to 30% by volume removed in the enucleation, resulting in a very low production efficiency of cloned animals.
  • the present invention uses a method of increasing the efficiency of reprogramming somatic cells by re-injecting 20 to 30% by volume of another enucleated cytoplasm.
  • the embryo fusion rate was significantly higher than that of the SCNT group (see Table 2), and the quality of the blastocyst was also excellent (see Table 3).
  • DNA methyl transferase 1 (DNMT1), DNA methyl transferase 3a (DNMT3a), the level of expression of the gene in the analysis of RT-qPCR to quantify the mRNA expression level of the DNA methyl transferase 3b (DNMT3b) is Housekeeping gene was normalized to the level of (housekeeping gene), GAPDH, mRNA expression levels of the gene was confirmed to significantly lower than SCNT group from the CICT group prepared by the method of the present invention (see Fig. 4).
  • the cloned embryos produced using the method of the present invention were similar to those of the in vitro fertilized embryos and were significantly higher than those of the embryo-derived somatic cells.
  • the donor somatic cells were derived from the skin tissue of Hanwoo livestock. Briefly, skin tissue was washed three times with Dulbecco's phosphate buffered saline (D-PBS, Invitrogen, Carlsbad, Calif., USA) and chopped to 1 mm 2 with 0.25% (v / v) Trypsin- EDTA solution (Gibco BRL , Life Technologies, Grand Island, NY, USA) at 37 < 0 > C for 1 hour.
  • D-PBS Dulbecco's phosphate buffered saline
  • v / v Trypsin- EDTA solution
  • the cells were then incubated with 15% (v / v) fetal bovine serum (FBS, Gibco), 1% (v / v) L- glutamine, 1% (Becton Dickinson, Franklin Lakes, NJ, USA) in a donor cell culture medium supplemented with penicillin-streptomycin (Dulbecco's modified Eagles medium (DMEM, Gibco), centrifuged at 1,000 rpm for 2 minutes, USA). Divided cells were continuously cultured for 10-14 days in humidified air containing 5% CO 2 at 37 ° C in donor cell culture medium.
  • FBS fetal bovine serum
  • DMEM Dulbecco's modified Eagles medium
  • passage # 3 The cells of passage # 3 were frozen in DMEM supplemented with 10% (v / v) FBS and 10% (v / v) dimethyl sulfoxide and stored in liquid nitrogen. Cells were thawed and cultured until passage # 4-8 and used for cloning.
  • COCs Cumulus-oocyte complexes
  • COCs with three or more layers of homogeneously granulated cytoplasm and compressed cumulus cells were selected, and TL-HEPES [114 mM sodium chloride, 3.2 mM potassium chloride, 2 mM sodium bicarbonate, 0.34 mM sodium biphosphate, The cells were washed with 10 mM sodium lactate, 0.5 mM magnesium chloride, 2 mM calcium chloride, 10 mM HEPES, 1 L / mL phenol red, and 1% (v / v) P / ) supplemented with 10% (v / v) FBS, 1 ⁇ g / mL estradiol-17 ⁇ , 10 ⁇ g / mL follicle-stimulating hormone, 0.6 mM cysteine, and 0.2 mM Na-pyruvate) and 600 ⁇ L IVM medium (Thermo Fisher Scientific, Waltham, MA, USA) and incubated for 22-24 hours in humidified air containing 5% CO 2 at 3
  • the semen was thawed for 1 minute in a 37 ° C water bath.
  • the sperm was washed and centrifuged at 1,800 x rpm for 5 minutes at room temperature and pelleted with D-PBS.
  • the pellet was resuspended in vitro fertilization (IVF) medium [6 mg / mL bovine serum albumin (BSA) containing 20 / / mL heparin and cultured in a humidified environment containing 5% CO 2 at 38.5 ⁇ for 15 minutes ), 22 [mu] g / mL sodium pyruvate, 100 IU / mL penicillin and 0.1 mg / mL streptomycin).
  • IVF vitro fertilization
  • sperm suspension was diluted in IVF medium (final density 1-2 x 10 6 sperm / mL).
  • Mature COCs were transferred to a 4-well dish containing sperm in 600 ⁇ L of IVF medium and cultured for 18-20 hours in a humidified environment containing 5% CO 2 at 38.5 ° C.
  • erythrocytes were removed from COCs by repeated pipetting to 0.1% (v / v) bovine testis hyaluronidase produced in TL-HEPES. Dehydrated oocytes with a first polar body were selected for enucleation.
  • enucleation was achieved by inhaling the first polar body and a small amount of peripheral cytoplasm in a small droplet of TCM-199 medium supplemented with 7.5 / / mL cytochalasin B (CB) and 0.3% BSA . Approximately 30% by volume of total enucleated oocytes were used as a source of cytoplasm. The remaining oocytes were used as recipient oocytes. The nuclear donor somatic cells were immersed in a solution of Sendai virus (SV, Cosmo Bio, Tokyo, Japan) for 1 minute.
  • Sendai virus SV, Cosmo Bio, Tokyo, Japan
  • a single round donor somatic cell ( ⁇ 20 ⁇ m) was injected (SCNT group) into the perivitelline space of each enucleated oocyte using an operation pipette (SCNT group), or a donor oocyte (CICT group) to recover the cytoplasm of the recipient oocyte ( Figure 1).
  • the reconstructed oocyte was fused via SV mediated method (Song YH, Pinkernell K, Alt E. Stem cell-induced cardiac regeneration: Fusion / mitochondrial exchange and / or transdifferentiation Cell Cycle 2011; 10 (14): 2281-6) And then cultured in modified SOF-BE1 (synthetic oviduct fluid-bovine embryo 1) supplemented with 5 ⁇ g / mL CB for 2 hours. Successfully reconstructed oocytes were incubated for 5 min in 5 ⁇ M ionomycin and activated in 2 mM 6-dimethylaminopurine for 4 h in a humidified environment containing 5% CO 2 at 38.5 ° C.
  • SOF-BE1 synthetic oviduct fluid-bovine embryo 1
  • TUNEL terminal deoxynucleotidyl transferase dUTP nick-end labeling
  • the immobilized embryos were washed with PVP-PBS (0.3% (w / v) polyvinylpyrrolidine) and incubated for 30 min at room temperature with permeabilized solution [0.5% (v / v) Triton X- 100 and 0.1% (w / v) sodium citrate].
  • the embryos were washed twice with PVP - PBS and incubated with fluorescein - conjugated deoxyuridine triphosphate and terminal deoxynucleotide transferase in the dark for 1 hour.
  • the embryos stained with TUNEL were washed with PVP-PBS and then incubated for 10 minutes in PVP-PBS containing 10 ⁇ g / mL Hoechst 33342, washed twice with PVP-PBS to remove excess Hoechst 33342 I put it on a glass slide.
  • TUNEL - positive cells appeared bright red and showed apoptosis.
  • TUNEL analysis was performed three times and 15 blastocysts per group were analyzed.
  • Mitochondrial activity was assayed using a commercial kit (MitoTracker Green FM; Invitrogen) according to the manufacturer's instructions.
  • the fixed 8-day blastocysts were washed three times with D-PBS and incubated with MitoTracker ® Green FM at 125 nm for 30 minutes at 37 ° C.
  • the blastocysts were then rinsed twice with D-PBS and labeled with Hoechst 33342 for 10 min at room temperature in the dark. After staining, the blastocysts were placed on glass slides and examined under a confocal laser scanning Olympus Fluoview FV1000 microscope. The excitation wavelength was 594 nm and the emission was read at 608 nm.
  • Mitochondrial fluorescence was quantified by subtracting the background density from each image using the ImageJ (National Institutes of Health, Bethesda, MD, USA, https://imagej.nih.gov/ij) and then standardizing. Twenty blastocytes per group were examined and the experiment was repeated three times.
  • RNA concentration and purity were measured using a NANO DROP 2000c instrument (Thermo Fisher Scientific, Wilmington, DE, USA). RNA samples were stored at -80 ° C prior to use. The mRNA was reverse transcribed with the first complementary DNA (cDNA) according to the manufacturer's instructions using the iScript TM cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA). Finally, cDNA was stored at -80 ° C until used for RT-qPCR analysis.
  • cDNA first complementary DNA
  • RT-qPCR assays were performed in a reaction volume of 10 ⁇ L containing 0.2 mM each of the small specific primers, 1 x iQ SYBR Green Supermix kit (iQ SYBR Green Supermix kit, Bio-Rad Laboratories, Inc.) and 3 ⁇ L of diluted cDNA was performed using a CFX98 real-time system (Bio 1 x iQ SYBR Green Supermix (iQ SYBR Green Supermix kit, Bio-Rad Laboratories, Inc.).
  • PCR involves a 44 cycle denaturation step (95 ° C for 3 minutes) at 95 ° C for 15 seconds, 57 ° C for 20 seconds and 72 ° C for 30 seconds and a final extension step at 72 ° C for 5 minutes.
  • Amplification was carried out using progressive denaturation and the fluorescence was continuously measured while increasing the temperature from 65 ° C to 95 ° C at a rate of 0.2 ° C per second. Quantitative analysis was performed using the ⁇ C (t) method. For all profiled genes, the internal coefficient of variation was calculated using an equation of standard deviation / mean value ⁇ 100.
  • DNMT1 F AGGGAGACGTGGAGATGCTGR: CATGGAGCGCTTGAAGGAG AY244709
  • DNMT3a F AGACATGTGGGTTGAACCCGR: GGCTCCCACAAGAGATGCAG AY271298
  • DNMT3b F CAGGATGGGAAGGAGTTTGGAR: CACCAAACCACTGGACCCAC AY244710 151
  • GAPDH F CCCAGAATATCATCCCTGCTR: CTGCTTCACCACCTTCTTGA NM_001034034 185
  • the present inventors examined the effects of cytoplasmic migration on the cutting and embryo developmental performance at the 8th day after transplantation of the transformed embryo transferred to the second day and compared these ratios with the ratio of in vitro fertilized embryos.
  • the fusion rate was significantly higher in the CICT group injected with about 30% by volume of the cytoplasm of the other oocytes by the method of the present invention than the SCNT group using the conventional method (82.0 ⁇ 0.3% vs. 68.3 ⁇ 1.5%; see Table 2).
  • the number of divisions was significantly higher than in the SCNT group (61.5 ⁇ 1.3% vs. 39.7 ⁇ 2.1%) and lower than that of the IVF group (75.4 ⁇ 1.3% 2).
  • the percentage of embryos developed with embryo blastocysts was significantly higher in the CICT group than in the SCNT group (28.9 ⁇ 0.8% vs. 20.2 ⁇ 1.3%), but there was no significant difference between the CICT and IVF groups (see Table 2).
  • the total number of cells per blastocyst was significantly higher in the CICT group than in the SCNT group (176.2 ⁇ 6.5 vs. 119.3 ⁇ 7.7) (P ⁇ 0.05) and similar to the IVF group (184.0 ⁇ 8.7) And Fig. 2).
  • the number of apoptotic cells in the CICT group per blastocyst was lower than in the SCNT group (3.5 ⁇ 1.1 vs. 4.1 ⁇ 0.8).
  • these differences were not significant (see Table 3).
  • the present inventors investigated the effect of cytoplasmic migration on mitochondrial fluorescence intensity using MitoTracker ® Green FM.
  • RT-qPCR was performed to quantify the mRNA expression level of the DNA methyl transferase 1 (DNMT1), DNA methyl transferase 3a (DNMT3a), DNA methyl transferase 3b (DNMT3b).
  • the expression level of the gene was normalized to that of the housekeeping gene GAPDH .
  • mRNA level of DNMT1 and DNMT3a could see significantly lower in SCNT CICT group than in the group.
  • the mRNA expression level of DNMT3b was lower in the CICT group than in the SCNT group (see FIG. 4).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Animal Husbandry (AREA)
  • Plant Pathology (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Reproductive Health (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 포유동물의 체세포 복제 효율을 증가시키는 방법에 관한 것으로, 보다 구체적으로 세포질 이식 기술을 이용하여 복제배아의 재프로그래밍 효율을 향상시킴으로써 양질의 배아를 제공하는 방법에 관한 것이다. 본 발명에 따른 방법을 사용 시 복제하고자 하는 체세포의 genome editing에 의하여 원하는 유전자를 삽입 또는 제거하여 형질전환복제동물을 생산하는데 매우 효율적으로 활용될 수 있다.

Description

세포질 이식을 이용한 복제배아의 재프로그래밍 효율 향상 방법
본 발명은 포유동물의 체세포 복제 효율을 증가시키는 방법에 관한 것으로, 보다 구체적으로 세포질 이식 기술을 이용하여 복제배아의 재프로그래밍 효율을 향상시킴으로써 양질의 배아를 제공하는 방법에 관한 것이다.
1997년 복제된 양 돌리와 같이, 미성숙된 난자를 대상으로 유선상피세포 또는 태아 섬유아세포 등 분화가 이루어진 세포의 핵을 치환하는 체세포 복제기술이 개발되어, 우수한 형질을 갖는 가축, 인공장기 생산용, 질환모델 동물 및 희귀 또는 멸종상태의 동물 등을 대상으로 무한히 복제할 수 있게 되었다[Wilmut et al., Nature, 385, 810 (1997)]. 이러한 예로는, 태아 섬유아세포, 난구세포, 협막세포의 핵을 치환하여 소를 복제하는 방법이 보고되어 있고[Cibelli et al., Science , 280 , 1256 (1998); Kato et al., ibid, 282, 2095 (1988); Wells et al., Biol. Reprod., 60, 996 (1999)], 생쥐의 경우 난구세포를 이용하여 복제하는 방법이 보고된 바 있다[Wakayama et al., Nature , 394, 369 (1998)].
그러나, 이들 방법들은 여전히 체세포 핵치환 복제수정란의 체외발달율이 저조하여 실제 복제에 성공할 확률이 매우 낮은 실정이었으며, 돼지의 경우에는 핵치환된 복제수정란의 배반포기까지의 체외 발달율이 5% 미만으로 매우 저조할 뿐만 아니라, 세포수가 적으며, 이들 복제수정란의 계속적인 발달이 이루어지지 못하는 등, 아직까지도 복제에 성공하지 못하는 실정이다[Du et al., Theriogenology , 282 , 2095 (1999); Tao et al., Cloning, 1, 55 (1999)].
핵이 제거된 난모세포(enucleated oocyte)에 고도로 분화된 체세포 핵을 주입함으로써 재생된 배아를 생산할 수 있다. 이러한 체세포 핵이식(somatic cell nuclear transfer; SCNT)을 통하여 20종 이상의 포유동물을 성공적으로 복제하기는 하였으나 이 기술은 완전하지 못하다[Wilmut I, Beaujean N, De Sousa P, Dinnyes A, King T, Paterson L, et al. Somatic cell nuclear transfer. Nature. 2002; 419(6907):583-7.; Young LE. Scientific hazards of human reproductive cloning s. Human Fertility. 2003; 6(2):59-63; Solter D. Mammalian cloning: advances and limitations. Nature Reviews Genetics. 2000; 1(3):199-207 등 참조]. SCNT의 낮은 효율은 주입된 체세포의 불완전한 재프로그래밍(reprogramming)과 후성적(epigenetic) 결함 때문인 것으로 보이며, 따라서 성공적인 복제는 분화된 체세포의 전분화능(totipotent)을 가진 배아-유사 상태로의 재프로그래밍에 의존적이다[Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, et al. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A. 2001; 98(24):13734-8; Tian XC. Reprogramming of epigenetic inheritance by somatic cell nuclear transfer. Reproductive biomedicine online. 2004; 8(5):501-8; Latham KE. Early and delayed aspects of nuclear reprogramming during cloning. Biology of the Cell. 2005; 97(2):119-32]. 공여되는 체세포(somatic donor cells)의 재프로그래밍은 대체로 완전하며, 이러한 세포들을 이용한 SCNT는 건강한 복제 동물을 생산할 수 있으나, 많은 증거들은 체세포 유전체의 임의의 유전자좌에서의 불완전하거나 비정상적인 재프로그래밍이 배아 발달에 치명적일 수 있는 유전자의 비정상적 발현에 기여하며 이로 인해 복제동물의 이상을 야기한다는 사실을 뒷받침한다[Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, et al. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci U S A. 2001; 98(24):13734-8; Tian XC. Reprogramming of epigenetic inheritance by somatic cell nuclear transfer. Reproductive biomedicine online. 2004; 8(5):501-8; Latham KE. Early and delayed aspects of nuclear reprogramming during cloning. Biology of the Cell. 2005; 97(2):119-32]. 체세포 유전체에서 메틸화 수준을 감소시키거나, 히스톤 탈아세틸효소(deacetylase) 활성을 억제함으로써 염색체 접근성을 증가시킴으로써 체세포 핵의 재프로그래밍을 증가시키려는 노력이 이루어져 왔다[Enright B, Kubota C, Yang X, Tian X. Epigenetic characteristics and development of embryos cloned from donor cells treated by trichostatin A or 5-aza-2-deoxycytidine. Biol Reprod. 2003; 69(3):896-901]. 복제된 배아의 발달 능력은 이러한 유전자들의 조절이상의 수준과 역의 상관관계가 있다. 공여 세포들의 후성적 상태에 더하여, 수여자인 난모세포의 질 역시 재프로그래밍 효율에 영향을 미칠 수 있다.
복제의 효율을 증가시키기 위해서는, 양질의 배아가 제공되어야 한다. 일부 연구결과에 따르면 배아 응집은 배반포 발달율과 복제된 배아의 질을 모두 향상시키는 훌륭한 수단이 될 수 있다[Tang P-c, West JD. The effects of embryo stage and cell number on the composition of mouse aggregation chimaeras. Zygote. 2000; 8(03):235-43; Misica-Turner PM, Oback FC, Eichenlaub M, Wells DN, Oback B. Aggregating embryonic but not somatic nuclear transfer embryos increases cloning efficiency in cattle. Biol Reprod. 2007; 76(2):268-78]. 응집된 소 복제 배아는, 발달율이 향상되지는 않더라도, 단일의, 응집되지 않은 복제 배아에 비해 총 세포수를 더 많이 가진다[Boiani M, Eckardt S, Leu N, Schler HR, McLaughlin K. Pluripotency deficit in clones overcome by cloneclone aggregation: epigenetic complementation? The EMBO Journal. 2003; 22(19):5304-12. doi: 10.1093/emboj/cdg507. PubMed PMID: PMC204490].
본 발명자들은 포유동물의 체세포 복제 효율을 증대시키기 위한 방법을 연구하던 중 체세포복제를 위해 핵과 극체와 함께 제거된 세포질을 다른 난자의 체세포에서 빼서 주입 시 체세포의 재프로그래밍 효율이 매우 높아져 복제 효율을 증가시킬 수 있음을 확인하고, 본 발명을 완성하였다.
*선행기술문헌
한국공개특허 제10-2008-0018759호
한국공개특허 제10-2009-7019691호.
따라서 본 발명의 목적은 탈핵된 난모세포(oocyte)에 복제하고자 하는 체세포와 함께 세포질을 주입하여 복제배아의 재프로그래밍 효율을 향상시키는 방법을 제공하는 것이다.
본 발명의 다른 목적은 상기 복제배아의 재프로그래밍 효율을 향상시키는 방법을 이용하여 포유동물의 체세포 복제 효율을 증가시키는 방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 세포질이 소실된 탈핵된 난모세포에 복제하고자 하는 체세포 및 세포질을 주입하는 단계를 포함하는, 복제배아의 재프로그래밍 효율을 향상시키는 방법을 제공한다.
본 발명자들은 TUNEL (terminal deoxynucleotidyl transferase dUTP nick-end labeling), 정량적 역전사 PCR(quantitative reverse transcription PCR) 및 면역세포화학(immunocytochemistry) 기술 등을 이용하여, 탈핵된 난모세포로의 세포질 이식이 복제된 착상 전 소 배아의 배아 발달능력과 질에 미치는 영향을 확인하였다. 이를 위해 본 발명자들은 새로운 기술인 세포질 주입 클로닝 기술(cytoplasm injection cloning technology, CICT)을 개발하였다. 이 기술은 탈핵 과정에서 세포질이 소실된 난모세포에 다른 난모세포의 세포질을 이식하는 기술로, 이를 통해 탈핵된 난모세포의 소실된 세포질을 재생시킬 수 있다.
따라서 상기 본 발명의 복제배아의 재프로그래밍 효율을 향상시키는 방법은 세포질이 소실된 탈핵된 난모세포에 복제하고자 하는 체세포 및 다른 난모세포의 세포질을 주입하는 단계를 포함하는 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 주입되는 다른 난모세포의 세포질의 양은 탈핵된 난모세포에서 소실된 세포질의 양과 거의 동일하다. 즉, 수여자 난모세포에 존재하던 본래의 세포질 양만큼 주입될 수 있다.
본 발명의 일실시예에 있어서, 상기 탈핵된 난모세포에서 소실된 세포질의 양은 전체 세포질의 약 10 ~ 50 부피%일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일실시예에 있어서, 상기 복제배아의 재프로그래밍 효율을 향상시키는 방법은, 세포질의 약 20 ~ 30 부피%가 소실된 탈핵된 난모세포에 복제하고자 하는 체세포 및 다른 난모세포의 세포질 20 ~ 30 부피%를 주입하는 단계를 포함하는 것일 수 있다.
본 발명의 일실시예에 있어서, 상기 복제배아의 재프로그래밍 효율을 향상시키는 방법에 사용되는 세포질이 소실된 탈핵된 난모세포는 난모세포의 제일 극체 및 그 주위 세포질을 흡입하여 탈핵시키는 방법으로 준비될 수 있다.
본 발명의 일실시예에 있어서, 상기 복제하고자 하는 체세포 및 세포질을 주입하는 단계는, 조작 피펫(manipulation pipette)을 이용하여 상기 탈핵된 난모세포의 난황 주위공간에 단일 원형 공여자 체세포(a single round donor somatic cell) 및 공여자 난모세포의 세포질을 함께 주입하는 단계를 포함한다.
본 발명의 일실시예에 있어서, 상기 복제배아의 재프로그래밍 효율을 향상시키는 방법은 상기 체세포 및 세포질이 주입된 난모세포를 SV 매개 방법을 통해 융합시키는 단계를 추가로 포함할 수 있다.
본 발명의 일실시예에 있어서, 상기 복제배아의 재프로그래밍 효율을 향상시키는 방법은 (a) 복제하고자 하는 체세포를 가진 개체로부터 복제하고자 하는 체세포를 추출하는 단계; (b) 체외성숙시킨 난모세포로부터 세포질의 20~30 부피%와 핵이 제거된 탈핵된 난모세포를 준비하는 단계; (c) 공여자 난모세포로부터 20~30 부피%의 세포질을 추출하는 단계; (d) 상기 복제하고자 하는 체세포를 가진 개체로부터 추출된 체세포와 공여자 난모세포로부터 추출한 세포질을 상기 (b) 단계의 탈핵된 난모세포에 주입하는 단계; 및 (e) 상기 체세포 및 세포질이 주입된 난모세포를 융합시키는 단계를 포함할 수 있다.
본 발명의 일실시예에 있어서, 상기 복제배아는 인간을 제외한 포유동물의 복제배아일 수 있다. 상기 인간을 제외한 포유동물에는 돼지, 소, 양, 마우스, 개 등이 포함될 수 있고, 바람직하게 소일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일실시예에 따르면, 분할이 이루어지고 배반포를 형성한 배아의 비율은 대조군인 SCNT (somatic cell nuclear transfer) 그룹[탈핵된 난모세포의 난황주위공간(perivitelline space)에 공여자 체세포(donor somatic cell)만을 주입한 그룹]에서보다 본 발명의 CICT (cytoplasm injection cloning technology) 그룹[탈핵된 난모세포에 체세포와 함께 공여자 난모세포의 세포질을 주입한 그룹]에서 훨씬 더 높았다(각각 61.5 ± 1.3% vs. 39.7 ± 2.1% 및 28.9 ± 0.8% vs. 20.2 ± 1.3%)(P < 0.05). 또한, 8일 배반포(Day 8 blastocyst) 당 총 세포수는 SCNT 그룹에서보다 CICT 그룹에서 훨씬 더 많았다(176.2 ± 6.5 vs. 119.3 ± 7.7, P < 0.05). 또한, CICT는 미토콘드리아 활성을 증가시키는 것으로 나타났고, mRNA 수준은 DNA methyl transferase1 및 DNA methyl transferase 3a의 mRNA 수준은 SCNT 그룹에 비해 CICT 그룹에서 훨씬 더 낮았다(P<0.05). DNA methyl transferase 3b의 mRNA 수준은 SCNT 그룹에 비해 CICT 그룹에서 더 낮았으나 유의적인 차이는 없었다(P>0.05). 이러한 결과를 종합하면, CICT는 복제된 소 배아의 체외 발달능력과 질을 향상시킨다는 것을 알 수 있다.
따라서, 다른 양태로서 본 발명은 상기 복제배아의 재프로그래밍 효율을 향상시키는 방법을 이용한 포유동물의 체세포 복제 효율을 증가시키는 방법을 제공한다.
본 발명의 일실시예에 있어서, 상기 포유동물의 체세포 복제 효율을 증가시키는 방법은 (a) 포유동물로부터 복제하고자 하는 체세포를 추출하는 단계; (b) 체외성숙시킨 난모세포로부터 세포질의 20~30 부피%와 핵이 제거된 탈핵된 난모세포를 준비하는 단계; (c) 공여자 난모세포로부터 20~30 부피%의 세포질을 추출하는 단계; (d) 상기 포유동물로부터 추출된 체세포와 공여자 난모세포로부터 추출한 세포질을 상기 (b) 단계의 탈핵된 난모세포에 주입하는 단계; (e) 상기 체세포 및 세포질이 주입된 난모세포를 융합시키는 단계; 및 (f) 상기 융합된 난모세포를 배양하는 단계를 포함할 수 있다.
본 발명의 일실시예에 있어서, 상기 (f)단계는 융합된 난모세포를 이오노마이신(ionomycin)에서 1 ~ 10분 동안 배양하고, DMAP (6-dimethyl aminopurine)를 3 ~ 5시간 동안 처리하여 활성화시키는 단계를 포함할 수 있다.
본 발명의 일실시예에 있어서, 상기 포유동물은 인간을 제외한 포유동물일 수 있고, 상기 인간을 제외한 포유동물에는 돼지, 소, 양, 마우스, 개 등이 포함될 수 있고, 바람직하게 소일 수 있으나, 이에 제한되는 것은 아니다.
나아가 본 발명은 상기 방법에 따라 제조된 체세포 복제동물을 제공한다.
본 발명에 따른 방법을 사용 시 복제하고자 하는 체세포의 genome editing에 의하여 원하는 유전자를 삽입 또는 제거하여 형질전환복제동물을 생산하는데 매우 효율적으로 활용될 수 있다. 즉, 질환모델동물, 생리활성물질을 생산하는 형질전환 복제 동물의 생산에 유용하게 사용될 수 있으며, 또한 멸종위기종의 체세포복제에 의한 복원을 가능하게 할 수 있는 효과가 있다.
도 1은 본 발명의 체세포 복제 효율을 증가시키는 방법을 개략적으로 나타낸 그림이다.
도 2는 IVF, SCNT 및 CICT 그룹에서 8 일 배반포의 TUNEL 분석 결과를 나타낸 것이다.
도 3은 8 일 배반 포자에서 미토콘드리아 염색의 형광 강도를 확인한 결과이다.
도 4는 RT-qPCR에 의해 결정된 배반포에서 DNMT 유전자의 상대적 mRNA 발현 정도를 확인한 결과이다.
본 발명은 일 구체예로서 20 ~ 30 부피%가 탈핵된 난자에 복제하고자 하는 특징이 있는 체세포 및 다른 난자의 세포질 20 ~ 30 부피%를 주입하는 단계를 포함하는, 인간을 제외한 포유동물의 체세포 복제 효율을 증가시키는 방법에 관한 것이다.
또한, 본 발명은 다른 구체예로서 (a) 성숙한 난자의 세포질을 20 ~ 30 부피% 제거하여 탈핵시키는 단계; 및 (b) 탈핵된 난자에 복제하고자 하는 특징이 있는 체세포를 이식하고 세포융합유도시켜 체세포 핵치환 복제수정란을 재구성하는 단계; 를 포함하는 인간을 제외한 포유동물의 체세포 복제 효율을 증가시키는 방법에 관한 것이다.
상기 (b)단계에서 체세포를 이식 시 (a)단계에서 사용된 난자 이외의 다른 난자에서 세포질 20 ~ 30 부피%를 뽑아 함께 주입하는 단계를 더 포함시킬 수 있다.
또한, 상기 (b)단계에서 융합된 난자의 활성화는 이오노마이신(ionomycin)에서 1 ~ 10분 동안 인큐베이션하고, DMAP (6-dimethyl aminopurine)를 3 ~ 5시간 동안 융합된 난자에 처리할 수 있다.
이하 본 발명을 실시예에 의하여 더욱 상세하게 설명한다. 이들 실시예는 단지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
본 발명에서 사용되는 용어에 대한 정의는 이하와 같다.
'핵 이식'은 탈핵된 난자에 다른 세포 또는 핵을 인공적으로 결합시켜 동일한 형질을 갖도록 하는 유전자 조작기술을 말한다.
'핵 이식란'은 핵 공여 세포가 도입 또는 융합된 난자를 말한다.
'복제'는 한 개체와 동일한 유전자 세트를 가진 새로운 개체를 만드는 유전자 조작기술로서 특히 본 발명에서는 세포, 배아 세포, 태아 유래 세포 및/또는 성체 유래 세포가 다른 세포의 핵 DNA 서열과 실질적으로 동일한 핵 DNA 서열을 갖는 것을 말한다.
'핵 공여 세포'는 핵 수용체인 수핵 난자로 핵을 전달하는 세포 또는 세포의 핵을 말한다.
'수핵 난자'는 탈핵 과정을 통해 본래의 핵이 제거되고 핵 공여 세포로부터 핵을 전달받는 난자를 말한다.
'난자'는 바람직하게는 제2차 감수분열 중기까지 도달한 성숙난자를 말한다.
'탈핵 난자'는 난자의 핵이 제거된 것을 말한다.
'융합'은 핵 공여 세포와 수핵 난자의 지질막 부분의 결합을 의미한다. 예를들어, 지질막은 세포의 플라스마 막 또는 핵막이 될 수 있다. 융합은 핵 공여 세포와 수핵 난자가 서로 인접하게 위치해 있는 경우 또는 핵 공여 세포가 수핵 난자의 위란강(perivitelline space) 내에 위치해 있는 경우에 전기적 자극을 가함으로써 일어날 수 있다.
'핵 재프로그래밍(nuclear reprogramming)'은 핵 이식 과정 중 수핵 난자와 공여 세포를 융합한 후 공여 세포주의 핵이 재구성 되도록 일정 시간을 항온 배양하는 것으로, 핵 이식란(복제수정란)의 정상적인 발생을 유도하는 과정을 말한다.
'활성화'는 핵 전이 단계 전, 핵 전이 단계 동안 및 핵 전이 단계 후에 세포가 분열하도록 자극을 주는 것을 말한다. 바람직하게는, 본 발명에서는 핵 전이 단계 이전에 미리 자극을 주는 것을 말한다.
포유동물은 인간을 제외한 포유동물을 의미하며, 가장 바람직하게는 돼지, 소, 양, 마우스, 개일 수 있으나, 이에 제한되지는 않는다.
체세포복제동물을 생산하기 위해서는 난자의 핵을 제거하고 복제하고자 하는 체세포를 주입하고 융합하여 재프로그래밍을 유도하여 1-cell stage로 역분화를 유도하는 과정을 반드시 거치게 된다. 그러나 탈핵과정에서 제거된 20~30 부피%의 세포질이 부족하여 주입한 체세포의 재프로그래밍이 불충분하여 복제동물의 생산효율이 매우 낮다는 단점이 있었다.
본 발명에서는 이를 극복하기 위해서 또 다른 탈핵된 세포질을 20~30 부피%를 재주입하여 체세포의 재프로그래밍의 효율을 높이는 방법을 사용하였으며, 본 발명의 방법으로 제조된 CICT 군에서 기존의 방법을 사용한 SCNT 군보다 배아의 융합률이 월등히 높았으며(표 2 참조), 배반포의 질도 우수함을 확인할 수 있었다(표 3 참조).
또한, 본 발명의 방법으로 제조된 CICT 군에서 기존의 방법을 사용한 SCNT 군보다 미토콘드리아 염색의 형광강도가 월등히 높았다(도 3 참조).
나아가 DNA 메틸 전이 효소 1 (DNMT1), DNA 메틸 전이 효소 3a (DNMT3a), DNA 메틸 전이 효소 3b (DNMT3b)의 mRNA 발현 수준을 정량화하기 위해 RT-qPCR 분석한 결과에서도 상기 유전자의 발현 수준은 하우스 키핑 유전자(housekeeping gene) GAPDH의 수준으로 정상화되었으며, 상기 유전자의 mRNA 발현 정도는 본 발명의 방법으로 제조된 CICT 군에서 SCNT 군보다 유의적으로 낮음을 확인할 수 있었다(도 4 참조).
따라서, 본 발명의 방법을 사용하여 생산된 복제수정란은 체외수정란과 유사하였으며, 기존의 체세포복제 유래 수정란보다 유의적으로 높게 나타났다.
또한 이들 수정란의 발달율도 높고 세포사멸 할구의 수도 낮을 뿐만 아니라 세포질에 존재하는 미토콘드리아의 활성도도 체외수정란과 유사하였다. 이러한 결과에서 탈핵과정에 손실된 세포질의 재복원(20~30 부피%)은 복제수정란의 복제효율을 높이는데 매우 효과적임을 알 수 있다.
<실시예 1>
실험 재료 및 방법
1. 윤리규정
모든 방법 및 실험 절차는 경상대학교의 실험 동물 보호 및 사용 가이드 라인 (승인 번호 GAR-110502-X0017)에 따라 수행되었다.
2. 화학물질
달리 명시하지 않는 한 모든 화학 물질 및 시약은 Sigma-Aldrich (St. Louis, MO, USA)에서 입수하였다.
3. 기증자 세포(donor cell)의 준비
기증자 체세포는 한우 가축의 피부 조직에서 유래되었다. 간략히 설명하자면, 피부 조직을 Dulbecco 인산염 완충 식염수 (D-PBS, Invitrogen, Carlsbad, CA, USA)로 3 번 세척하고, 1 mm2로 잘게 잘라 0.25% (v / v) Trypsin-EDTA 용액 (Gibco BRL, Life Technologies, Grand Island, NY, USA)에서 37 ℃의 온도로 1 시간 동안 배양 하였다. 그 후, 세포를 15% (v/v) 소 태아 혈청 (FBS, Gibco), 1% (v/v) L-glutamine, 1% (v/v) 비필수 아미노산 및 1% (v/v) 페니실린 - 스트렙토 마이신으로 보충된 donor cell culture medium [Dulbeccos modified Eagles medium (DMEM, Gibco)로 3번 세척하였으며, 1,000 rpm에서 2 분간 원심 분리한 다음, 100 mm 플라스틱 접시 (Becton Dickinson, Franklin Lakes, NJ, USA)에 분주하였다. 분주된 세포는 5% CO2를 함유한 습기가 있는 공기, 37℃의 donor cell culture 배지에서 10-14 일 동안 연속 배양 하였다. passage #3의 세포를 10% (v / v) FBS 및 10% (v / v) 디메틸 술폭시드가 보충된 DMEM에서 동결시키고 액체 질소에서 저장 하였다. 세포를 해동하고, passage #4-8까지 배양한 다음 복제에 사용하였다.
4. 난모세포 수집 및 체외 성숙(IVM)
한우의 난소는 지방 도살장에서 얻은 후 35℃의 멸균 식염수에 보관하여 2 시간 이내에 실험실로 옮겼다. Cumulus-oocyte complexes (COCs)는 진공 펌프에 부착된 18 게이지 바늘을 사용하여 직경 2 ~ 8 mm의 모낭으로부터 흡인되었다.
균등하게 과립화된 세포질 및 압축된 난구세포(cumulus cell)의 3 개 이상의 층을 갖는 COCs를 선별하고 TL-HEPES [114 mM sodium chloride, 3.2 mM potassium chloride, 2 mM sodium bicarbonate, 0.34 mM sodium biphosphate, 10 mM sodium lactate, 0.5 mM magnesium chloride, 2 mM calcium chloride, 10 mM HEPES, 1 L/mL phenol red, and 1% (v/v) P/S]에서 세척한 다음 IVM 배지[TCM-199 (Gibco) supplemented with 10% (v/v) FBS, 1 ㎍/mL estradiol-17β, 10 ㎍/mL follicle-stimulating hormone, 0.6 mM cysteine, and 0.2 mM Na-pyruvate]에 넣고, 600 μL의 IVM 배지를 포함하는 4-웰 디시(Thermo Fisher Scientific, Waltham, MA, USA)로 옮긴 다음, 38.5℃에서 5% CO2를 함유한 가습 공기 중에서 22-24 시간 동안 배양하였다.
5. 체외수정
정액을 37℃의 수조에서 1 분 동안 해동시켰다. 정자를 세척하고 실온에서 1,800 x rpm으로 5 분간 원심 분리하여 D-PBS로 펠렛화하였다. 펠릿을 20 ㎍/mL 헤파린을 함유하고 있고, 38.5℃에서 15분 동안 5% CO2를 함유한 가습 환경에서 배양된 체외수정(in vitro fertilization; IVF) 배지[6 mg/mL 소 혈청 알부민 (BSA), 22 ㎍/mL 소듐 피루베이트(sodium pyruvate), 100 IU/mL 페니실린 및 0.1 mg/mL 스트렙토마이신]에서 조심스럽게 재부유시켰다.
정자 현탁액을 IVF 배지 (최종 밀도 1-2 × 106 sperm/mL)로 희석시켰다. 성숙한 COCs는 600 μL의 IVF 배지에 정자가 들어있는 4-well dish에 옮겨졌고, 38.5℃에서 5% CO2를 함유한 가습 환경에서 18-20시간 동안 배양되었다.
6. 핵 이식
IVM 배지에서 22-24시간 배양한 후, 적혈구를 TL-HEPES에서 제조한 0.1% (v/v) 소 고환 히알루로니다아제에 반복적인 피펫팅을 가하여 COCs로부터 제거하였다. 제1 극체(first polar body)를 가진 탈수된 난모세포를 핵 제거 (enucleation)를 위해 선별하였다.
이에 대해 간단히 설명하면, 7.5 ㎍/mL 사이토카라신 B (cytochalasin B; CB) 및 0.3% BSA가 보충된 TCM-199 배지의 작은 방울(droplet)에서 제일 극체 및 소량의 주위 세포질을 흡입함으로써 탈핵을 하였다. 총 탈핵된 난모세포의 약 30 부피%가 세포질의 원천으로 사용되었다. 남은 난모세포는 수핵난자로 사용되었다. 핵 공여 체세포를 센다이 바이러스 (SV, Cosmo Bio, Tokyo, Japan) 용액에 1분 동안 담갔다.
그 후, 조작 피펫을 이용하여 각각의 탈핵된 난모세포의 위란강(perivitelline space)에 단일 원형 공여자 체세포(a single round donor somatic cell; <20 ㎛)를 주입하거나(SCNT 그룹), 또는 공여자 난모세포에서 세포질의 약 30 부피%를 체세포와 함께 주입하여(CICT 그룹) 탈핵된 수여자 난모세포(recipient oocyte)의 세포질을 회복시켰다(도 1 참조).
재구성된 난모세포를 SV 매개 방법(Song Y-H, Pinkernell K, Alt E. Stem cell induced cardiac regeneration: Fusion/mitochondrial exchange and/or transdifferentiation? Cell Cycle. 2011; 10(14):2281-6)을 통해 융합시킨 다음 5 ㎍/mL CB가 보충된 변형된 SOF-BE1(synthetic oviduct fluid-bovine embryo 1) 배지에서 2시간 동안 배양 하였다. 성공적으로 재건된 난모세포는 5 μM 이오노마이신(ionomycin)에서 5 분 동안 인큐베이션하고, 2 mM 6-dimethylaminopurine에서 38.5℃에서 5% CO2를 함유한 가습 환경에서 4시간동안 배양하여 활성화시켰다.
7. 체외배양
20시간 동안 배양된 정자 및 / 또는 재구성된 난모세포의 활성화 후, 추정 된 접합체 / 활성화된 배아를 광범위하게 세척하고 38.5℃에서 5% CO2를 함유한 가습한 환경에서 미네랄 오일로 덮인 SOF-BE1 배지 (20 embryos per droplet) 80 μL의 액적(droplet)에서 배양하였다.
배양 배지의 절반을 2일마다 보충하였다. 재구성된 배아와 체외 수정된 배아의 절단은 융합 후 2일째 및 IVF(체외수정) 후 3일째에 확인 하였다(day 0 = day of IVF or fusion). 배양 8 일 후 입체 현미경으로 배반포 발달 정도를 관찰하였다. 8일 배반포를 TL-HEPES에서 3번 세척하고 고정액[4% (v/v) paraformaldehyde prepared in 1 M phosphate-buffered saline (PBS)]으로 옮겨 4℃에서 보관하여 세포자멸사 및 총 세포를 분석하였다. 유전자 발현 분석을 위해 8일 배반 포자를 1.5 mL Eppendorf tube에 옮기고 액체 질소로 급속 동결시킨 다음 -80℃에서 보관하였다.
8. TUNEL(Terminal deoxynucleotidyl transferase dUTP nick-end labeling) 분석
8일 배반포에서 총 세포 및 사멸 세포의 수는 TUNEL(Terminal deoxynucleotidyl transferase dUTP nick-end labeling)으로 분석하였다. TUNEL은 제조업자의 프로토콜에 따라 In Situ Cell Death Detection Kit (Fluorescein, Roche Diagnostics Corp., Indianapolis, IN, USA)를 사용하여 수행하였다.
이에 대해 간단히 말하면, 고정된 배아를 PVP-PBS[1 M PBS supplemented with 0.3% (w/v) polyvinylpyrrolidine]로 세척한 후, 실온에서 30 분 동안 투과성 용액[0.5% (v/v) Triton X-100 and 0.1% (w/v) sodium citrate]으로 배양 하였다.
투과(permeabilization) 후, 배아를 PVP - PBS로 두 번 씻고, 1시간 동안 어둠 속에서 fluorescein-conjugated deoxyuridine triphosphate 및 terminal deoxynucleotide transferase로 배양하였다.
TUNEL로 염색된 배아는 PVP-PBS로 세척한 다음, 10분 동안 10 ㎍/mL의 Hoechst 33342를 포함하는 PVP-PBS에 배양하였으며, 과도한 Hoechst 33342를 제거하기 위해 PVP-PBS로 두 번 세척한 다음 유리슬라이드에 올렸다.
배반포 당 세포 수는 수은 램프가 장착된 epifluorescence 현미경 (Olympus IX71, Tokyo, Japan)을 사용하여 카운팅하였다. TUNEL 양성 세포는 밝은 적색으로 나타나 세포 사멸의 발생을 나타내었다. 본 발명을 위하여 TUNEL 분석을 3 회 수행 하였으며, 한 개의 그룹 당 15 개의 배반포를 분석 하였다.
9. 미토콘드리아 활동의 평가
미토콘드리아 활성을 상업적 키트 (MitoTracker Green FM; Invitrogen)를 사용하여 제조자의 지시에 따라 분석하였다.
이에 대해 간단히 설명하면, 고정된 8 일 배반포를 D-PBS로 3 번 세척한 후 125 nm의 MitoTracker® Green FM로 37℃에서 30분 동안 배양하였다. 그런 다음, 배반포를 D-PBS로 2번 헹구고 Hoechst 33342로 실온의 어두운 곳에서 10분 동안 표지하였다. 염색 후 배반포를 유리 슬라이드 위에 놓고 공 초점 레이저 스캐닝 Olympus Fluoview FV1000 현미경 하에서 검사 하였다. 여기 파장은 594 nm이고, 방출은 608 nm에서 판독되었다. Mitochondrial 형광은 ImageJ (National Institutes of Health, Bethesda, MD, USA, https://imagej.nih.gov/ij)를 사용하여 각 이미지에서 배경 밀도를 뺀 다음 표준화 후 정량화시켰다. 그룹 당 20 개의 배반포를 검사하였으며, 실험은 3회 반복하였다.
10. mRNA 추출 및 cDNA 역전사
제작자의 지침에 따라 Arcturus PicoPure RNA Isolation Kit (Life Technologies, Inc., Foster City, CA, USA)를 사용하여 복제된 포배 (IVF, SCNT 및 CICT)의 각 그룹에서 총 RNA를 추출하였다.
NANO DROP 2000c 기기 (Thermo Fisher Scientific, Wilmington, DE, USA)를 사용하여 RNA의 농도 및 순도를 측정하였다. RNA 샘플은 사용 전 -80℃에서 보관하였다. iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA)를 제조사의 지침에 따라 mRNA를 1차 상보형 DNA (cDNA)로 역전사시켰다. 마지막으로 cDNA를 RT-qPCR 분석에 사용하기 전까지 -80℃에서 보관하였다.
11. RT-qPCR 분석
유전자 특이적 프라이머는 Primer3Plus 소프트웨어 (http://primer3plus.com/cgi-bin/dev/primer3plus.cgi)를 사용하여 디자인되었으며 표 1에 기재하였다.
RT-qPCR 분석은 0.2 mM의 각 소 특이성 프라이머, 1 x iQ SYBR Green Supermix(iQ SYBR Green Supermix kit, Bio-Rad Laboratories, Inc.) 및 3 μL의 희석된 cDNA를 포함하는 반응 부피가 10 μL 인 CFX98 실시간 시스템(Bio 1 x iQ SYBR Green Supermix (iQ SYBR Green Supermix 키트, Bio-Rad Laboratories, Inc.)을 사용하여 수행하였다.
모든 cDNA 샘플을 GAPDH (glyceraldehyde-3-phosphate dehydrogenase) 특이 적 프라이머를 사용하여 분석하여 본 발명의 내부 통제 유전자의 발현 변화를 검출 하였다. 상대적인 GAPDH 발현이 샘플 간에 유의하게 다르지 않다는 것을 확인한 후, 모든 전사물을 독립적인 분석에서 정량화하였다. PCR은 95℃에서 15 초간, 57℃에서 20초간 및 72℃에서 30초간의 44 사이클의 변성 단계 (95℃에서 3 분간) 및 72℃에서 5 분간의 최종 신장 단계를 포함한다.
증폭은 점진적 변성을 사용하여 용융 곡선 분석을 한 후, 온도를 초당 0.2℃의 속도로 65℃에서 95℃로 증가시키면서 형광을 연속적으로 측정하였다. 정량 분석은 ΔΔC (t) 방법을 사용하여 수행하였다. 프로파일된 모든 유전자에 대해, 표준 편차 / 평균치 × 100의 식을 사용하여 내부의 변동계수를 계산했다.
RT-qPCR 프라이머 서열
Gene Primer sequence Accession number Product size (bp)
DNMT1 F: AGGGAGACGTGGAGATGCTGR: CATGGAGCGCTTGAAGGAG AY244709 194
DNMT3a F: AGACATGTGGGTTGAACCCGR: GGCTCCCACAAGAGATGCAG AY271298 188
DNMT3b F: CAGGATGGGAAGGAGTTTGGAR: CACCAAACCACTGGACCCAC AY244710 151
GAPDH F: CCCAGAATATCATCCCTGCTR: CTGCTTCACCACCTTCTTGA NM_001034034 185
Abbreviations: F, forward; R, reverse.
12. 통계 분석
데이터는 평균의 평균 ± 표준 오차 (SEM)로 나타내었고 SPSS 18.0 (SPSS Inc., Chicago, IL, USA)을 사용하여 one-way ANOVA로 분석하였다. Duncan의 다중 범위 테스트를 사용하여 그룹을 비교하였다. P < 0.05는 유의한 것으로 간주한다.
<실시예 2>
본 발명의 방법으로 제조된 소 복제수정란의 배아 발달능 정도 확인
본 발명자들은 세포질 이동이 2 일째에 복제된 착상 전 이식 소 배아의 절단 및 8 일째 배아 발달능에 미치는 영향을 조사하고 이들 비율을 체외 수정된 배아의 비율과 비교하였다.
그 결과, 융합률(fusion rate)은 본 발명의 방법으로 다른 난자의 세포질을 약 30 부피% 정도 주입한 CICT 군에서 기존의 방법을 사용한 SCNT 군보다 유의하게 높음을 알 수 있었다(82.0 ± 0.3% vs. 68.3 ± 1.5%; 표 2 참조). 또한, CICT 군에서 분열을 일으킨 배아의 비율은 SCNT 군보다 유의적으로 높았으나(61.5 ± 1.3% vs. 39.7 ± 2.1%), IVF 군(75.4 ± 1.3%)보다는 낮은 수준임을 확인할 수 있었다(표 2 참조).
배아 포배기로 발달한 배아의 비율은 CICT 군에서 SCNT 군보다 유의하게 높았으나(28.9 ± 0.8% vs. 20.2 ± 1.3%), CICT와 IVF 군간에 유의한 차이는 없었다(표 2 참조).
Group No. of cultured zygotes No. of cloned oocytes No. (%) of fused embryos* No. (%) ≥≥ 8/16 cell embryos** No. (%) of blastocysts***
IVF 258 - - 194 (75.4 ± 1.3)a 80 (31.2 ± 1.2)a
SCNT - 558 381 (68.3 ± 1.5)a 148 (39.7 ± 2.1)b 74 (20.2 ± 1.3)b
CICT - 296 243 (82.0 ± 0.3)b 149 (61.5 ± 1.3)c 70 (28.9 ± 0.8)a
*Fusion rates were calculated based on the number of injected oocytes.
**Cleavage rates were calculated based on the number of fused embryos.
***Blastocyst development rates were calculated based on the number of fused
a-cValues with different superscripts in the same column are significantly different (P < 0.05).
<실시예 3>
본 발명의 방법으로 제조된 소 복제수정란의 소 배반포 질 확인
본 발명의 방법을 사용한 CICT가 배반포의 질을 향상 시켰는지 여부를 조사하기 위해, 8일된 배반포의 총 세포 및 아폽토시스 세포의 수를 세었다.
그 결과, CICT 군에서 배반포 당 총 세포 수는 SCNT 군 (176.2 ± 6.5 vs. 119.3 ± 7.7) 보다 현저히 높았고(P < 0.05), IVF 군(184.0 ± 8.7)과 유사함을 확인할 수 있었다(표 3 및 도 2 참조). 대조적으로 배반포 당 CICT 군의 세포 사멸 세포의 수는 SCNT 군보다 낮았다(3.5 ± 1.1 vs. 4.1 ± 0.8). 그러나 이러한 차이는 유의하지 않았다(표 3 참조).
Group No. of blastocysts No. of total cellsper blastocyst No. of apoptotic cells per blastocyst
IVF 15 184.0 ± 8.7a 4.4 ± 0.5a
SCNT 15 119.3 ± 7.7b 4.1 ± 0.8a
CICT 15 176.2 ± 6.5a 3.5 ± 1.1a
a-cValues with different superscript in the same columns are significantly different (P < 0.05).
<실시예 4>
본 발명의 방법으로 제조된 소 복제수정란의 미토콘드리아 활성 분석
본 발명자들은 MitoTracker® Green FM을 이용하여 세포질 이동이 미토콘드리아 형광 강도에 미치는 영향을 조사하였다.
그 결과, 미토콘드리아 염색의 형광 강도는 CICT 군에서 SCNT 군(22.3 ± 6.5 vs. 15.2 ± 3.8 arbitrary units) 보다 유의하게 높음을 알 수 있었다. 그러나 CICT와 IVF 군(22.3 ± 6.5 vs. 20.5 ± 7.7 arbitrary units) 사이에 유의한 차이는 없음을 확인할 수 있었다(도 3 참조).
<실시예 5>
본 발명의 방법으로 제조된 소 복제수정란의 RT-qPCR 분석 결과
RT-qPCR은 DNA 메틸 전이 효소 1 (DNMT1), DNA 메틸 전이 효소 3a (DNMT3a), DNA 메틸 전이 효소 3b (DNMT3b)의 mRNA 발현 수준을 정량화하기 위해 수행하였다.
확인 결과, 상기 유전자의 발현 수준은 하우스 키핑 유전자(housekeeping gene) GAPDH의 수준으로 정상화되었다. 또한, DNMT1과 DNMT3a의 mRNA 정도는 CICT 군에서 SCNT 군보다 유의하게 낮음을 알 수 있었다. 그러나 CICT와 IVF 군간에 유의한 차이는 없었으며, DNMT3b의 mRNA 발현 정도는 CICT 군에서 SCNT 군보다 낮았다(도 4 참조). 그러나 세 군간에 유의한 차이는 없었다.
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 특허청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.

Claims (7)

  1. 세포질이 소실된 탈핵된 난모세포에 복제하고자 하는 체세포 및 세포질을 주입하는 단계를 포함하는, 복제배아의 재프로그래밍 효율을 향상시키는 방법.
  2. 제1항에 있어서,
    상기 세포질이 소실된 탈핵된 난모세포는 세포질의 20~30 부피%가 소실된 난모세포이며, 상기 세포질을 주입하는 단계는 다른 난모세포에서 20~30 부피%의 세포질을 추출하여 주입하는 것을 특징으로 하는 방법.
  3. 제1항에 있어서,
    상기 체세포 및 세포질을 주입하는 단계는 조작 피펫(manipulation pipette)을 이용하여 상기 탈핵된 난모세포의 난황 주위공간에 체세포 및 세포질을 함께 주입하는 것을 특징으로 하는 방법.
  4. 제1항에 있어서,
    상기 체세포 및 세포질이 주입된 난모세포를 SV 매개 방법을 통해 융합시키는 단계를 추가로 포함하는 것을 특징으로 하는 방법.
  5. 제1항에 있어서,
    (a) 복제하고자 하는 체세포를 가진 개체로부터 복제하고자 하는 체세포를 추출하는 단계;
    (b) 체외성숙시킨 난모세포로부터 세포질의 20~30 부피%와 핵이 제거된 탈핵된 난모세포를 준비하는 단계;
    (c) 공여자 난모세포로부터 20~30 부피%의 세포질을 추출하는 단계;
    (d) 상기 복제하고자 하는 체세포를 가진 개체로부터 추출된 체세포와 공여자 난모세포로부터 추출한 세포질을 상기 (b) 단계의 탈핵된 난모세포에 주입하는 단계; 및
    (e) 상기 체세포 및 세포질이 주입된 난모세포를 융합시키는 단계를 포함하는 방법.
  6. 제1항 내지 제5항 중 어느 한 항의 방법을 이용한 포유동물의 체세포 복제 효율을 증가시키는 방법.
  7. 제6항에 있어서,
    (a) 포유동물로부터 복제하고자 하는 체세포를 추출하는 단계;
    (b) 체외성숙시킨 난모세포로부터 세포질의 20~30 부피%와 핵이 제거된 탈핵된 난모세포를 준비하는 단계;
    (c) 공여자 난모세포로부터 20~30 부피%의 세포질을 추출하는 단계;
    (d) 상기 포유동물로부터 추출된 체세포와 공여자 난모세포로부터 추출한 세포질을 상기 (b) 단계의 탈핵된 난모세포에 주입하는 단계;
    (e) 상기 체세포 및 세포질이 주입된 난모세포를 융합시키는 단계; 및
    (f) 상기 융합된 난모세포를 배양하는 단계를 포함하는 것을 특징으로 하는 방법.
PCT/KR2018/001691 2017-09-28 2018-02-08 세포질 이식을 이용한 복제배아의 재프로그래밍 효율 향상 방법 WO2019066161A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020170126290A KR101985924B1 (ko) 2017-09-28 2017-09-28 세포질 이식을 이용한 복제배아의 재프로그래밍 효율 향상 방법
KR10-2017-0126290 2017-09-28

Publications (1)

Publication Number Publication Date
WO2019066161A1 true WO2019066161A1 (ko) 2019-04-04

Family

ID=65903021

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2018/001691 WO2019066161A1 (ko) 2017-09-28 2018-02-08 세포질 이식을 이용한 복제배아의 재프로그래밍 효율 향상 방법

Country Status (2)

Country Link
KR (1) KR101985924B1 (ko)
WO (1) WO2019066161A1 (ko)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080222745A1 (en) * 2007-03-07 2008-09-11 Utah State University Colcemid-Treatment of Oocytes to enhance Nuclear Transfer Cloning

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080018759A (ko) 2006-08-25 2008-02-28 엘지이노텍 주식회사 윈칩형 ｒｆ집적모듈

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080222745A1 (en) * 2007-03-07 2008-09-11 Utah State University Colcemid-Treatment of Oocytes to enhance Nuclear Transfer Cloning

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
HUA, SONG: "Effects of the removal of cytoplasm on the development of early cloned bovine embryos", ANIMAL REPRODUCTION SCIENCE, vol. 126, 2011, pages 37 - 44, XP028240030, DOI: doi:10.1016/j.anireprosci.2011.05.002 *
MA, LIBING: "Somatic cell reprogrammed by oocyte: process and barricade", ANIMAL CELLS AND SYSTEMS, vol. 18, no. 3, 4 May 2014 (2014-05-04), pages 161 - 171, XP055586712 *
SONG, BONG-SEOK: "Inactivated sendai-virus-mediated fusion improves early development of cloned bovine embryos by avoiding endoplasmic-reticulum- stress-associated apoptosis", REPRODUCTION, FERTILITY AND DEVELOPMENT, vol. 23, 2011, pages 826 - 836 *
WEN , DUANCHENG: "Histone variant H3.3 is an essential maternal factor for oocyte reprogramming", PNAS, vol. 111, no. 20, 20 May 2014 (2014-05-20), pages 7325 - 7330, XP055240348, DOI: doi:10.1073/pnas.1406389111 *
XU, LIANGUANG, IMPROVEMENT OF REPROGRAMMING EFFICIENCY OF BOVINE CLONED EMBRYOS BY CYTOPLASM RESTORATION OF ENUCLEATED OOCYTE, August 2017 (2017-08-01), pages 1 - 37 *

Also Published As

Publication number Publication date
KR101985924B1 (ko) 2019-06-04
KR20190036865A (ko) 2019-04-05

Similar Documents

Publication Publication Date Title
Edwards et al. Oocyte polarity and cell determination in early mammalian embryos.
US8551705B2 (en) Use of haploid genomes for genetic diagnosis, modification and multiplication
Eakin et al. Tetraploid development in the mouse
Cervera et al. Trichostatin A affects histone acetylation and gene expression in porcine somatic cell nucleus transfer embryos
Liu et al. Cross-species single-cell transcriptomic analysis reveals pre-gastrulation developmental differences among pigs, monkeys, and humans
US20090133137A1 (en) Method of cloning animals
US6194635B1 (en) Embryonic germ cells, method for making same, and using the cells to produce a chimeric porcine
US20050273870A1 (en) Preparation and selection of donor cells for nuclear transplantation
Galli et al. Introduction to cloning by nuclear transplantation
US6545199B1 (en) Embryonic germ cells, method for making same, and using the cells to produce a chimeric porcine
KR20200145804A (ko) 멜라토닌을 포함하는, 배아 발달용 조성물 및 이를 이용하여 배아 발달의 효율을 향상시키는 방법
Yatsenko et al. The power of mouse genetics to study spermatogenesis
EP0774510A1 (en) Ungulate eg cell
WO2006041910A2 (en) Stem cells derived from uniparental embryos and methods of use thereof
KR102204413B1 (ko) Rad51 활성화제를 포함하는, 배아 발달용 조성물 및 이를 이용하여 배아 발달률을 향상시키는 방법
Yang et al. Improving in vitro development of cloned bovine embryos with hybrid (Holstein–Chinese Yellow) recipient oocytes recovered by ovum pick up
Hao et al. Developmental competence of porcine parthenogenetic embryos relative to embryonic chromosomal abnormalities
WO2019066161A1 (ko) 세포질 이식을 이용한 복제배아의 재프로그래밍 효율 향상 방법
Sha et al. Fates of donor and recipient mitochondrial DNA during generation of interspecies SCNT-derived human ES-like cells
US20220025323A1 (en) Methods for generating, evaluating, gene editing and cloning pluripotent stem cells comprising a lethal haplotype
Kerkis et al. Actual achievements on germ cells and gametes derived from pluripotent stem cells
Saadeldin et al. Blastocysts derivation from somatic cell fusion with premature oocytes (prematuration somatic cell fusion)
Ernst et al. Development of an efficient method to produce uniformly haploid parthenogenones
WO2002019811A2 (en) Generation of transgenic animals using nuclear transfer and oocytes at the germinal vesicle stage
Randall Optimized vitrification, cell cycle compatibility and volume of cytoplasts for bovine embryonic cloning

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18860364

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18860364

Country of ref document: EP

Kind code of ref document: A1

32PN Ep: public notification in the ep bulletin as address of the adressee cannot be established

Free format text: NOTING OF LOSS OF RIGHTS PURSUANT TO RULE 112(1) EPC (EPO FORM 1205A DATED 02/02/2021)

122 Ep: pct application non-entry in european phase

Ref document number: 18860364

Country of ref document: EP

Kind code of ref document: A1