WO2019064312A1

WO2019064312A1 - Tetravalent dengue vaccine and processes thereof

Info

Publication number: WO2019064312A1
Application number: PCT/IN2018/050352
Authority: WO
Inventors: Ravi Kant RAJPOOT; Rahul Shukla; Upasana Arora; Navin Khanna
Original assignee: International Centre For Genetic Engineering And Biotechnology
Priority date: 2017-09-29
Filing date: 2018-06-01
Publication date: 2019-04-04

Abstract

A recombinant dengue virus Envelope (E) protein based tetravalent mosaic virus- like particle vaccine comprising E proteins of the DENV -1, -2, -3 and -4 serotypes co-expressed in a single P. pastoris clone that co-assemble to form VLPs. A method for producing a recombinant tetravalent virus-like particle (VLP) vaccine against DENV -1, -2, -3 and -4 serotypes, the method comprising: preparing a plasmid harbouring a tandem assembly of independent expression cassettes of DENV-1, -2, -3 and -4 E genes; electroporating the plasmid into yeast cells pre-treated with lithium acetate- DTT solution.

Description

TETRAVALENT DENGUE VACCINE AND PROCESSES THEREOF

Field of the Invention

The embodiments herein relate to a multivalent vaccine against dengue virus, and more particularly, to a tetravalent vaccine providing simultaneous protection against all the four dengue virus serotypes i.e. DENV-1, DENV-2, DENV-3 and DENV-4 and also relates to process to make such vaccines.

Background of the Invention

Dengue is a mosquito borne viral disease, which is highly endemic in the entire tropical region. It can be caused by any of the four Dengue virus serotypes (DENV-1, DENV-2, DENV-3 and DENV-4) belonging to Flavivirus genus of Flaviviridae family. Dengue viruses are transmitted to humans by mosquitoes (mainly by Aedes aegypti). Dengue disease can either be asymptomatic or exhibit clinical symptoms of varying severities.

As mentioned above, dengue is caused by any of the four antigenically distinct serotypes of Dengue virus (DENV-1, -2, -3 and -4) belonging to Flavivirade family. Dengue virus is a plus stranded RNA virus having a genome of about l lkb encoding for three structural proteins [Capsid protein (C), Precursor membrane/membrane protein (prM/M) and Envelop protein (E)] and seven nonstructural proteins (NS 1, 2A, 2B, 3, 4A, 4B and 5). E is the most immunodominant of all the proteins and is exposed on the virus surface consisting of three distinct structural domains. Domain I is an eight- stranded β barrel central domain. Domain II contains a dimerization region and a highly conserved fusion loop. Domain III consists of an immunoglobulin-like fold and is the proposed receptor binding domain. The E protein via domain III binds to cellular receptors, and mediates fusion between viral envelope and cellular membrane during viral entry via fusion loop of domain II. The development of affordable tetravalent vaccine against dengue, capable of neutralizing all four serotypes with equivalent efficiency, has been long desired. Currently, there are a few vaccine candidates under clinical trials such as Sanofi's live attenuated virus candidate, ChimeriVax™. However, live-attenuated viruses have often been associated with concerns of viral inteference, and disease enhancement. A recent report has attributed the low efficacy of ChimeriVax™ against DENV-2 to cross-reactive antibodies generated by the vaccine candidate. WO2003101397 discloses a tetravalent dengue vaccine composition of ChimeriVax, which is a physical mixture of four chimeric flaviviruses. Each of these four chimeric flaviviruses contain the capsid and non- structural proteins of Yellow Fever virus and the pre-membrane and envelope proteins of corresponding DENV-1, DENV-2, DENV-3 or DENV-4.

One of the strategies to overcome the limitations of the current live-attenuated virus based vaccine candidates is to develop virus-like particles (VLPs) based vaccine candidates. WO2014064707 discloses virus like particles comprising recombinant envelop (E) protein of Dengue virus, expressed in Pichia pastoris. It further provides gene constructs capable of expressing a polypeptide that elicit type-specific immune response in a host against dengue virus. In this vaccine strategy, the DENV Envelope (E) protein based vaccine candidates (DENV-1 E, DENV-2 E, DENV-3 E and DENV-4 E), expressed separately in corresponding eukaryotic host Pichia pastoris, assemble into VLPs and elicit potent neutralizing antibodies against the respective DENV serotype in animal models such as mice. WO2014064707 merely reports purified VLPs, expressed in eukaryotic host Pichia pastoris. It doesn't disclose a viable strategy to make a tetravalent VLP- based vaccine candidate.

SUMMARY OF THE INVENTION

In an aspect, a recombinant virus-like particle vaccine comprising envelope, E, proteins of all four DENV serotypes (DENV -1, -2, -3 and -4) co-assembled into one is provided. In another aspect, a method for producing an E protein based recombinant tetravalent virus-like particle (VLP) vaccine against DENV-1, -2, -3 and -4 serotype, is provided. The method includes preparing a plasmid harbouring all four DENV-1, -2, -3 and -4 envelope (E) independent expression cassettes; electroporating said plasmid into yeast cells pre-treated with lithium acetate- DTT solution. The method further includes suspending yeast cells pre-treated with lithium acetate- DTT solution in sorbitol. The plasmid is linearlized before electroporation by a pulser. In an embodiment, the plasmid harbouring only two of the four DENV-1, -2, -3 and -4 envelope (E) expression cassettes, with one plasmid harbouring DENV-1 and -2, envelope (E) expression cassettes and the second plasmid harbouring DENV-3 and -4 envelope (E) expression cassettes respectively were constructed. In yet another aspect, a forward and reverse primer for DENV-1 E envelope gene having SEQ ID NO 1 and SEQ ID NO 2 is provided.

In still another aspect, a forward and reverse primer for DENV-2 E envelope gene having SEQ ID NO 3 and SEQ ID NO 4 is provided.

In still another aspect, a forward and reverse primer for DENV-3 E envelope gene having SEQ ID NO 5 and SEQ ID NO 6 is provided.

In still another aspect, a forward and reverse primer for DENV-4 E envelope gene having SEQ ID NO 7 and SEQ ID NO 8 is provided.

BRIEF DESCRIPTION OF DRAWINGS

Other objects, features, and advantages of the invention will be apparent from the following description when read with reference to the accompanying drawings. In the drawings, wherein like reference numerals denote corresponding parts throughout the several views: Figure 1 illustrates a schematic representation of developing tetravalent DENV- E VLP based dengue vaccine candidate by mixing Bivalent VLP 1,2 (purified from corresponding clone transformed with pl+2 and co-expressing DENV-1 and 2 E VLPs) and Bivalent VLP 3,4 (purified from corresponding clone transformed with p3+4 and co-expressing DENV-3 and 4 E VLPs) according to an embodiment herein; and

Figure 2 illustrates a schematic representation of developing tetravalent DENV- E VLP based dengue vaccine candidate using tetravalent E VLP clone (co- expressing DENV-1, 2, 3 and 4 E VLPs) according to an embodiment herein;

Figure 3A-3C illustrates (A) plasmid map (pl+2) for expression of bivalent VLP 1,2 harbouring tandem assembly of DENV-1 and 2 E expression cassettes; (B) plasmid map (p3+4) for expression of bivalent VLP 3,4 harbouring tandem assembly of DENV-3 and 4 E expression cassettes, and (C) plasmid map (pTV) for expression of tetravalent E VLP harbouring tandem assembly of DENV -1, -2, -3, and -4 E expression cassettes, according to an embodiment herein;

Figure 4A-4C illustrates a schematic representation of the restriction map highlighting the position of digestion and expected digestion pattern of pl+2 (A), p3+4 (B) and pTV (C) with the indicated restriction enzyme, according to an embodiment herein;

Figure 5A-5B represents confirmation of bivalent VLP 1,2 (5 A) and bivalent VLP 3, 4 (5B) clones for the presence of DENV-1 E and -2 E, and DENV-3 E and -4 E respectively, by colony PCR. It illustrates a schematic representation showing primer binding location; FP & RP denotes forward and reverse primers of the corresponding genes for pl+2 (FP1, FP2, RP1 and RP2), and p3+4 (FP3, FP4, RP3, RP4). Agarose gel electrophoretic image is shown for both the colony PCR confirming the integrity of the two bivalent clones, according to an embodiment here; Figure 6 illustrates screening of tetravalent E VLP clones harbouring all the four DENV- E expression cassettes, according to an embodiment herein; Figure 7 is a table depicting confirmation of co-expression of all the four DENV- E proteins by Tetravalent E VLP clones C-l, C-6 and C-8 through ELISA with the four serotype-specific mAbs, according to an embodiment herein;

Figure 8A-8C illustrates real time analysis (with Ct values) of mRNA expression levels of the transformed expression cassettes in Bivalent VLP 1,2 (A), Bivalent VLP 3,4 (B) and tetravalent E VLP (C) clones using serotype specific primers, according to an embodiment herein;

Figure 9 illustrates examination of the purified and dialyzed Bivalent VLP 1,2 (A), Bivalent VLP 3,4 (B), and tetravalent E VLPs (C) under dynamic light scattering (DLS), according to an embodiment herein;

Figure 10 illustrates a table depicting evaluation of purified Bivalent VLP 1,2, Bivalent VLP 3,4 and Tetravalent E VLPs for display of critical epitopes through ELISA with conformational serotype-specific mAbs; and

Figure 11 illustrates DENV-1, DENV-2, DENV-3 and DENV-4 neutralization titers (FNT₅₀ values) of sera elicited against mixture of four monovalent DENV- E VLPs (named as Physical mix VLP 1-4), mixture of Bivalent 1,2 and 3,4 E VLPs (named as Bivalent E VLP mix), and Tetravalent E VLPs.

DETAILED DESCRIPTION OF THE PRESENT EMBODIMENT

As used throughout this application, the word "may" is used in a permissive sense (i.e., meaning having the potential to), rather than the mandatory sense (i.e., meaning must). Similarly, the words "include", "including", and "includes" mean including but not limited to.

The phrases "at least one", "one or more", and "and/or" are open-ended expressions that are both conjunctive and disjunctive in operation. For example, each of the expressions "at least one of A, B and C", "at least one of A, B, or C", "one or more of A, B, and C", "one or more of A, B, or C" and "A, B, and/or C" means A alone, B alone, C alone, A and B together, A and C together, B and C together, or A, B and C together.

The term "a" or "an" entity refers to one or more of that entity. As such, the terms "a" (or "an"), "one or more" and "at least one" can be used interchangeably herein. It is also to be noted that the terms "comprising", "including", and "having" can be used interchangeably.

VLPs refer to virus-like particles that resemble viruses [in the instant embodiment, they resemble all serotypes of dengue virus], but are non-infectious because they contain no viral genetic material. The expression of viral structural proteins, such as Envelope or Capsid, may result in the self-assembly of virus like particles (VLPs). pi, p2, p3 and p4 refers to the plasmid harbouring DENV-1, -2, -3, and -4 E expression cassettes respectively. In an embodiment, the clones are Pichia clones. pl+2 refers to the plasmid harbouring both DENV-1 and -2 E expression cassettes.

p3+4 refers to the plasmid harbouring both DENV-3 and - 4 E expression cassettes.

pTV refers to the plasmid harbouring tandem assembly of all DENV-1, -2, -3, and -4 E expression cassettes. The embodiment herein disclose a recombinant virus like particle comprising Envelope (E) proteins of the DENV -1, -2, -3 and -4 serotypes. The embodiment herein further provides a method for the expression of the four envelope (E) genes of each of the four serotypes of dengue virus. The method includes cloning a plasmid harbouring tandem assembly of four E genes expression cassettes corresponding to DENV- 1,-2, -3 and -4, and transforming yeast cells with the said plasmid. In an embodiment, two bivalent plasmids, one harbouring tandem assembly of DENV-1 and DENV-2 E genes expression cassettes, and the other harbouring tandem assembly of DENV-3 and -4 E genes expression cassettes was explored to obtain an overall tetravalent composition.

Further disclosed is a method of transformation of a yeast cell with bivalent or tetravalent plasmid to obtain a virus-like particle correspondingly composed of having two or four DENV- E proteins encoded by the E genes, thus providing a VLP vaccine capable of neutralising corresponding two or four infectious DENV serotypes.

As mentioned, there is need to develop processes to make tetravalent dengue vaccines capable of protecting against four DENVs i.e. DENV-1, -2, -3, and -4 with high efficacy. In order to achieve this, virus-like-particle (VLP) based subunit vaccine is disclosed according to an embodiment herein. A DENV- E VLP based tetravalent vaccine candidate against all four serotypes of dengue virus is disclosed herein. The tetravalent vaccine candidate, according to an embodiment herein, may be obtained by either of the following two methods or process:

Developing two bivalent P. pastoris clones Bivalent VLP 1,2 (obtained after transformation of pl+2) and Bivalent VLP 3,4 (obtained after transformation of p3+4) co-expressing DENV-1 and -2 Es, and DENV-3 and -4 Es, respectively, and preparing a physical mixture of Bivalent VLP 1,2 and Bivalent VLP 3,4 VLPs (Bivalent VLP Mix) as depicted in Figure 1. The mosaic bivalent VLPs are purified and mixed to make a tetravalent vaccine composition.

2. Developing a mosaic tetravalent (obtained after transformation of pTV) clone co-expressing all the four DENV-1, -2, -3 and -4 Es as depicted in Figure 2. With the integration of pTV in P. pastoris host genome, each of the four DENV- Es are co-expressed and tetravalent VLPs are purified and used as a tetravalent vaccine after being adsorbed on alum adjuvant.

In an embodiment, the pl+2, p3+4, and pTV plasmids are integrated in the genome of a yeast cell. In a preferred embodiment, the pl+2, p3+4, and pTV plasmids are integrated in the genome of Pichia pastoris.

In an embodiment, any two DENV E VLPs/proteins can be assembled on a single plasmid for developing bivalent clones. In a preferred embodiment, DENV-1 E is co-expressed with DENV-2 E, while DENV-3 is co-expressed with DENV-4 E to develop bivalent clones.

In an embodiment, an expression vector or plasmid suitable for expression in a yeast cell, and more particularly, in P. pastoris is selected. In a preferred embodiment, pA0815 expression vector, is used. pA0815 is a Pichia expression vector having a Bgl II site upstream of the 5' AOX1 gene and a unique BamH I site downstream of the Ύ AOX1 transcription termination (TT) signal. The following four steps are required to generate multiple copies of a gene of interest in pA0815:

1. The gene is cloned into the unique EcoR I site to obtain a plasmid construct.

2. The plasmid construct is digested with Bam HI and Bgl II to release the expression cassette containing the AOX1 promoter, gene of interest, and Ύ AOX1 TT.

3. Concatemers of same expression cassette or the different expression cassettes (independent expression cassettes of DENV- IE, -2E, -3E, and -4E may be generated by ligation in vitro with Bam HI linearized pA0815 harbouring the expression cassettes of interest.

4. The pA0815 harbouring tandem assembly of multiple expression cassettes is transformed into P. pastoris.

In a preferred embodiment, the P. pastoris cells are suspended in autoclaved 200 ml lithium acetate-DTT solution and incubated. In an embodiment, the P. pastoris cells are in the form of a cell pellet. Thereafter, the cells are collected by centrifugation, which are re-suspended in sorbitol, and centrifuged again to collect cells, which are re-suspended in sorbitol. In an embodiment, ice cold sorbitol is used. The ice-cold re-suspended cells are mixed with plasmid DNA pTV) and transformation is achieved by pulsing the cells followed by incubation.

In an embodiment, serotype-specific forward primers (FP) and reverse

(RP) were developed. The primers are reproduced in the table below:

Oligo Lengt Produ

S.No Sequence

Name h ct size

SEQ DEN

5 ' GGAT ACT AACTTTGTCTGTAGAAGAAC A ID V-1E 34

TTCGTT3'

NO 1 FP1

452

SEQ DEN

5'GCAAGTCCTGTCTATTCCAGGTTTCTTG ID V-1E 38

ACTTGTTGAA3 '

NO 2 RP1

SEQ DEN

5 'AATC AAGATT ACTCC AC AGTCTTCC ATT ID V-2E 40

ACCGAAGCAGAG3 '

NO 3 FP2

562

SEQ DEN

5 'AAGAACGTGTCTCTTCTCC AAGTCC ATA ID V-2E 34

ATTTCG3'

NO 4 RP2 SEQ DEN

5 ' GATCTT AGCCTT ATTTCTTGCCC ACTATA ID V-3E 31

TC3'

NO 5 FP3

474

SEQ DEN

ID V-3E 5'TTCGATGGACTCCAAGCATTGA3 ' 22

NO 6 RP3

SEQ DEN ID V-4E 5 ' GGTCGATTCCGGTGACGGAAACC AT A3 ' 26

NO 7 FP4

373

SEQ DEN

5 ' TCTGAACC AGTGC AAAGT AAGAGCGGA ID V-4E 35

ATTTCCAA3'

NO 8 RP4

SEQ ID NO 1 and SEQ ID NO 2 are the sequences for DENV-1E FP1 and RP1 respectively.

SEQ ID NO 3 and SEQ ID NO 4 are the sequences for DENV-2E FP2 and RP2 respectively.

SEQ ID NO 5 and SEQ ID NO 6 are the sequences for DENV-3E FP3 and RP3 respectively.

SEQ ID NO 7 and SEQ ID NO 8 are the sequences for DENV-4E FP4 and RP4 respectively.

EXAMPLES

EXAMPLE 1: Generation of recombinant plasmid pl+2 carrying DENV-1 and -2 E expression cassettes in tandem

Recombinant plasmids pi and p2 carrying DENV-1 E (GenBank accession number JX292264) and DENV-2 E (GenBank accession number: JX292265) genes, respectively, at Eco RI in pA0815 were prepared. DENV-2 E expression cassette was excised from p2 by double digestion with Bam HI and Bgl II and ligated into Bam HI linearized pi to result in the formation of pi +2 as shown in Figure 3 A, in which Symbols P and T represent 5' AOX1 promoter and transcription terminator sequences, respectively.

EXAMPLE 2: Generation of recombinant plasmid p3+4 carrying DENV-3 and -4 E expression cassettes in tandem

Recombinant plasmids p3 and p4 carrying DENV-3 E (GenBank accession no. JX292266) and DENV-4 E (GenBank accession no. JX292267) genes, respectively, at Eco RI in pA0815 were prepared. DENV-4 E expression cassette was excised from p4 by double digestion with Bam HI and Bgl II and ligated into Bam HI linearized p3 to result in the formation of p3+4 as shown in Figure 3B.

EXAMPLE 3: Generation of recombinant tetravalent plasmid pTV carrying DENV-1, -2, -3 and -4 E expression cassettes in tandem p3+4 was digested with Bam HI and Bgl II to excise out the fragment of interest carrying DENV-3 and -4 E expression cassettes in tandem. The excised fragment was ligated into Bam HI linearized pi +2 to result in the formation of pTV as shown in Figure 3C.

EXAMPLE 4: Restriction digestion analysis of pi +2

The integrity of pl+2 was confirmed by restriction digestion analysis with multiple restriction enzymes, as shown in Figure 4A, which shows restriction digestion of pl+2 with Pst I (A), and Bgl II- Bam HI (B). In the restriction map, in the left of Figure 4A, the position of digestion and expected digestion product is highlighted (in bp) for each digestion scheme. On the right of Figure 4A, the agarose gel image of the respective digested products (lane A and B) is shown. DNA ladder is loaded in lane M; their sizes (in bp) are also indicated on the left of lane M. EXAMPLE 5: Restriction digestion analysis of p3+4 The integrity of p3+4 was confirmed by restriction digestion analysis with multiple restriction enzymes, as shown in Figure 4B, which shows restriction digestion of p3+4 with with (A) Bgl II and Bam HI, and (B) Hind III. In the restriction map, in the left of Figure 4B, the position of digestion and expected digestion product is highlighted (in bp) for each digestion scheme. On the right of Figure 4B, the agarose gel image of the respective digested products (lane A and B) is shown. DNA ladder is loaded in lane M; their sizes (in bp) are also indicated on the left of lane M.

EXAMPLE 6: Restriction digestion analysis of pTV

The integrity of pTV was confirmed by restriction digestion analysis with multiple restriction enzymes, as shown in Figure 4C, which shows restriction digestion of pTV with (A) Bgl II and Bam HI, (B) Afl II, and (C) Pst I and Sna BI. In the restriction map, in the left of Figure 4C, the position of digestion and expected digestion product is highlighted (in bp) for each digestion scheme. On the right of Figure 4C, the agarose gel image of the respective digested products (lane A and B) is shown. DNA ladder is loaded in lane M; their sizes (in bp) are also indicated on the left of lane M.

EXAMPLE 7: Designing of serotype-specific primers

Primers were designed to all the four-dengue serotype envelopes by aligning the sequences of all the envelopes to identify the regions of low similarity. The serotype specificity of the designed primers was checked via PCR.

EXAMPLE 7: Integration of pl+2, p3+4 and pTV in Pichia pastoris: Each of the generated pl+2, p3+4 and pTV plasmid was digested with Bgl II and electroporated in Pichia pastoris strain GS 115, to generate clones Bivalent VLP 1,2, Bivalent VLP 3,4 and tetravalent E VLP, respectively. To obtain tetravalent E VLP clone, the concentration of final DNA to be electroporated was 100-200 ng/ul. 5 ml of YPD medium was inoculated with a fresh colony of GS 115 P. pastoris cells, grown overnight at 28° C and 250 rpm. Cells were sub-cultured into fresh 250 ml YPD medium in a baffled shake flask next day and incubated under similar conditions. Cells were harvested in their log phase (OD600 at 1.3-1.5) by centrifugation at 2500 rpm for 5 minutes at 4°C. Cell pellet was resuspended in autoclaved 200 ml lithium acetate- DTT solution and incubated the cells for 30 min at room temperature while gently shaking at 100 rpm. The cells were then collected by centrifugation at 2500 rpm for 5 minutes at 4°C. The cells were resuspended in 37.5 ml of ice-cold 1M sorbitol (this step was performed on ice). The cells were collected by centrifugation at 2500 rpm for 5 minutes at 4°C, and the final cell pellet was resuspended in 1.88 ml ice cold 1 M sorbitol. 80 ul of competent cells were premixed with 100 ng of linearlized plasmid DNA prepared in a pre-chilled 2 mm electroporation cuvette and incubated on ice for 5 min. The cells were pulsed using Gene Pulser according to parameters set for yeast (at 2000 V, 25 μΡ, and 200 Ω). Immediately after pulsing the cells, 1ml of 1M ice cold sorbitol was added to the cells and incubated for 2 hours at 28° C, and cells were plated. EXAMPLE 8. Screening of Bivalent VLP 1,2 clones for presence of DENV-1 and -2 E expression cassettes integrated into the genome

The transformed Pichia clones were spotted in parallel on methanol and dextrose containing plates. Transformed clones being Mut were expected to be slow growing on methanol plates as compared to dextrose. One of the clones exhibiting differential growth was selected and confirmed for the presence of DENV-1 E and -2 E expression cassettes by colony PCR with serotype-specific primers as in Figure 5A, which shows primer binding location and the agarose gel image of PCR products with Bivalent VLP 1,2 Pichia clone genome using serotype 1 (lane 2) and serotype 2 (lane 3) specific primers; lane 1 denotes only pA0815 vector transformed Pichia clone as a negative control with a mixture of both the sets of primers, while M indicates DNA markers; their sizes (in kb) are shown on the left of panels. FP1 is primer with SEQ ID NO 1, and FP2 is primer with by SEQ ID NO 3, whereas RP1 and RP2 are the primers with SEQ ID NO 2 and SEQ ID NO 4 respectively.

EXAMPLE 9: Screening of Bivalent VLP 3,4 clones for presence of DENV-3 and -4 E expression cassettes integrated into the genome

The transformed Pichia clones were spotted in parallel on methanol and dextrose containing plates. Transformed clones being Mut were expected to be slow growing on methanol plates as compared to dextrose. One of the clones exhibiting differential growth was selected and confirmed for the presence of DENV-3 E and -4 E expression cassettes by colony PCR with serotype-specific primers as shown in Figure 5B, which also shows the agarose gel image of PCR with Bivalent VLP 3,4 Pichia genome using serotype 1 (FP1/RP1), serotype 2 (FP2/RP2), serotype 3 (FP3/RP3) and serotype 4 (FP4/RP4) specific primers, with schematic representation on the left. The forward primers used here were the primers with SEQ ID NO 1, 3, 5 and 7 for DENV-1, DENV-2, DENV-3 and -4 E, while reverse primers were the primers with SEQ ID NO 2, 4, 6 and 8 for DENV-1, DENV-2, DENV-3 and -4 E, respectively. PCR products for Bivalent VLP 3,4 Pichia genome could only be obtained with serotype 3 (FP3/RP3) and serotype 4 (FP4/RP4) specific primers; serotype 1 (FP1/RP1) and serotype 2 (FP2/RP2) specific primers failed to produce any PCR product due to the absence of DENV- 1 E and DENV-2 E expression cassettes in Bivalent VLP 3,4 Pichia genome.

EXAMPLE 10: Screening of tetravalent E VLP clones for expression of all the four Es The transformed Pichia clones were spotted in parallel on methanol and dextrose containing plates. Transformed clones being Mut were expected to be slow growing on methanol plates as compared to dextrose. Multiple clones exhibiting differential growth were screened for the presence of the four E expression cassettes integrated into the genome through colony PCR with serotype 4-specific primers (Figure 6-A). Three clones CI, C6 and C8 were found to possess the DENV-4 E expression cassette. Thus, these three clones were further evaluated to additionally detect the presence of DENV-1, -2 and -3 E expression cassettes as shown in Figure 6-B. It was observed that all the three clones possessed all the four DENV- E expression cassettes integrated into their genome. The forward primers used here were the primers with SEQ ID NO 1, 3, 5 and 7 for DENV-1, DENV-2, DENV-3 and -4 E, while reverse primers were the primers with SEQ ID NO 2, 4, 6 and 8 for DENV-1, DENV-2, DENV-3 and -4 E, respectively. The three PCR positive clones were induced with methanol and expression of the four corresponding proteins was analyzed through ELISA with four DENV serotype- specific mAbs [10]- E29, 3H5, El, and E42 specific for DENV-1, -2, -3 and -4, respectively, as shown in Figure 7. The monovalent proteins DENV-1, -2, -3 and - 4 Es served as control in this ELISA. On this basis, clone C6 was selected for further evaluations.

EXAMPLE 11: Expression of the co-expressed proteins in Bivalent VLP 1,2, Bivalent VLP 3,4 and Tetravalent E VLP P. pastoris clones is relative to each other Selected Bivalent VLP 1,2, Bivalent VLP 3,4 and Tetravalent E VLP clones were characterized for relative expression of the co-expressed proteins by real-time PCR using serotype specific primers as depicted in Figure 8A, 8B and 8C respectively. RNA was purified from 48 hr induced clones and cDNAs were prepared using respective serotype specific reverse primers, separately. The relative level of the cDNAs, reflecting the relative levels of all the corresponding mRNAs, was monitored through real-time PCR study. It was observed that mRNA production level of all the co -expressed genes was comparative (as indicated by the Ct values), in the bivalent and tetravalent clones (Fig. 8A-8C)

EXAMPLE 12: Purification and characterization of Bivalent VLP 1,2, Bivalent VLP 3,4 and Tetravalent E VLPs:

Large-scale methanol induced biomass of the selected clone was prepared where cells were induced with 1.5% methanol every 24 hours for 72 hours. Like DENV- 1, -2, -3 and -4 E, Bivalent VLP 1,2, Bivalent VLP 3,4 and Tetravalent E VLPs were solely associated with the cell pellet on lysing the cells with PBS. Hence, Bivalent VLP 1,2, Bivalent VLP 3,4 and Tetravalent E VLPs were purified according to the optimized protocol and standard techniques. The purified and dialyzed proteins were examined under dynamic light scattering (DLS) and Bivalent 1,2 (A), Bivalent 3,4 (B) and Tetravalent E (C) were found to assemble into -40 nm sized VLPs as shown in Figure 9, in which X and Y axes represent the size (diameter in nm) of the particles and % volume of particles, respectively. The cumulative % volume of the peak in each panel was more than 95%.

EXAMPLE 13: Purified VLPs display critical neutralizing epitopes

Purified Bivalent VLP 1,2, Bivalent VLP 3,4 and Tetravalent E VLPs were evaluated for display of critical epitopes through ELISA with conformational serotype- specific mAbs. It was observed that DENV-1 specific mAbs (Figure 10) recognized only Bivalent VLP 1,2 and Tetravalent VLP and the corresponding monovalent protein DENV-1 E. Similarly, DENV-2, DENV-3 and DENV-4 specific mAbs recognized only Bivalent VLP 1,2 and Tetravalent E VLPs, Bivalent VLP 3,4 and Tetravalent E VLPs, and Bivalent VLP 3,4 and Tetravalent E VLPs, respectively apart from them recognizing the corresponding monovalent DENV- Es. EXAMPLE 14: Evaluation of immunogenicity of the three tetravalent strategies

Four groups of six BALB/c mice were immunized with Tetravalent E VLPs, mixture of Bivalent VLP 1,2 and Bivalent VLP 3,4 (Bivalent E VLP Mix), mixture of monovalent E VLPs (Physical Mix VLP 1-4), and PBS adsorbed on alhydrogel. All the VLPs were adsorbed on alhydrogel in following combination:

· Tetravalent E VLP: 80μg of Tetravalent VLP on 500μg of alhydrogel per

ΙΟΟμΙ οί ΡΒε

• Bivalent E VLP mix: (40μg of Bivalent VLP 1,2 on 250μg of alhydrogel) + (40μg of Bivalent VLP 3,4 on 250μg of alhydrogel) per ΙΟΟμΙ PBS

• Physical Mix VLP 1-4: (20μg of DENV-1 E on 125 μg of alhydrogel) + (20μg of DENV-2 E on 125μg of alhydrogel) + (20μg of DENV-3 E on

125μg of alhydrogel) + (20μg of DENV-4 E on 125μg of alhydrogel) per ΙΟΟμΙ PBS

MPLA was supplemented to the formulation @ 5μg per ΙΟΟμΙ formulation. BALB/c mice were immunized on days 0, 30 and 90 with ΙΟΟμΙ injection volume given intra-muscular. Sera were collected on day 105 and evaluated for the presence of DENV neutralizing antibodies by FACS -based neutralization test [FNT; 9-11, unpublished data]. It revealed that the tetravalent strategy of tetravalent expression (tetravalent E VLP) is comparable in immunogenicity as the other two tetravalent strategies (Fig. 11) since all the three strategies resulted in generation of a balanced neutralizing immune response against all the four DENV serotypes. Figure 11 shows FNT₅₀ value of the three tetravalent sera- Physical Mix VLP 1-4, Bivalent E VLP mix and Tetravalent E VLP antisera. These sera were serially diluted two-fold and pre-incubated separately with DENV-1, DENV-2, DENV-3, and DENV-4. The antibody- virus complexes were allowed to infect Vero cells and neutralizing antibody titers (FNT₅₀) were determined using FACS. PBS alhydrogel immunized antisera was used as negative control, which were analyzed in similar manner and showed FNT₅₀ titer of <20 against each of the four DENV serotypes. The Y-axis represents FNT₅₀ titers and X-axis represents the sera analyzed. FNT₅₀ titer is defined as the sera dilution that resulted in 50% neutralization of the virus.

Claims

CLAIMS:

A recombinant tetravalent mosaic virus-like particle vaccine comprising envelope (E) proteins of the DENV -1, -2, -3 and -4 serotypes of dengue virus.

A method for producing a recombinant tetravalent E protein based viruslike particle (VLP) vaccine against DENV -1, -2, -3 and -4 serotypes, said method comprising: preparing a plasmid harbouring a tandem assembly of independent expression cassettes of DENV-1, -2, -3 and -4 envelope (E) genes; electroporating said plasmid into yeast cells pre-treated with lithium acetate- DTT solution.

The method according to claim 2, further comprising suspending yeast cells pre-treated with lithium acetate- DTT solution in sorbitol; and linearlising said plasmid before electroporation by a pulser

The method according to claim 2, wherein said plasmid expresses only two of the four DENV- 1,-2, -3 and -4 envelope (E) genes.

5. The method according to claim 2, wherein said plasmid, expressing DENV- IE, -2E, -3E and -4E envelope gene.

6. A forward and reverse primer for DENV -IE envelope gene having SEQ ID NO 1 and SEQ ID NO 2.

7. A forward and reverse primer for DENV -2E envelope gene having SEQ ID NO 3 and SEQ ID NO 4.

8. A forward and reverse primer for DENV -3E envelope gene having SEQ ID NO 5 and SEQ ID NO 6.

9. A forward and reverse primer for DENV -4E envelope gene having SEQ ID NO 7 and SEQ ID NO 8.

10. A recombinant bivalent mosaic virus-like particle vaccine comprising two of the envelope (E) proteins of the DENV -1, -2, -3 and -4 serotypes of dengue virus.