WO2019054396A1 - Agent for inhibiting number of bacteria of genus fusobacterium and/or bacteria of genus sutterella - Google Patents

Abstract

[Problem] To provide an agent for inhibiting the number of bacteria of the genus Fusobacterium and/or bacteria of the genus Sutterella, the agent being capable of effectively inhibiting the number of bacteria of the genus Fusobacterium and bacteria of the genus Sutterella and capable of contributing to the prevention and treatment of diseases such as acute hemorrhagic diarrhea. [Solution] An agent for inhibiting the number of bacteria of the genus Fusobacterium and/or bacteria of the genus Sutterella having 1-kestose as an active ingredient. The present invention can obtain an agent for inhibiting the number of bacteria of the genus Fusobacterium and/or bacteria of the genus Sutterella that can effectively inhibit the number of bacteria of the genus Fusobacterium and bacteria of the genus Sutterella, is highly safe, and can be compounded easily with various foods and pharmaceuticals or taken conveniently on a daily basis.

Description

Inhibitors for the number of Fusobacterium bacteria and / or Stellara bacteria

The present invention is an agent for suppressing the number of Fusobacterium bacteria and / or bacteria of the genus Stelerus, which comprises 1-kestose as an active ingredient, a food composition for suppressing the number of bacteria, a feed for animals for suppressing the number of bacteria and a method for suppressing the number of bacteria The present invention relates to a method of preventing or treating hemorrhagic diarrhea and use of 1-kestose for producing a medicament for preventing or treating acute hemorrhagic diarrhea.

Fusobacterium (Fusobacterium) is an anaerobic gram-negative bacillus and has been reported to inhabit the digestive organs of animals such as human intestine and oral cavity. Sterella bacteria (Sutterella) are also anaerobic or microaerophilic gram-negative short bacilli and are a component species of the intestinal flora of animals such as humans.

Recent studies have suggested that Fusobacterium bacteria and Stellara bacteria are associated with various diseases and health conditions, for example, prominent in feces of dogs suffering from acute hemorrhagic diarrhea (Acute hemorrhagic diarrihea; AHD). The increase is suggested to be involved in such diseases (Non-patent Document 1; Table 3 and FIG. 3 etc.).

AHD in dogs is characterized by symptoms such as bloody vomiting and diarrhea, and is a digestive disease that can be concentrated and become serious. In the treatment of AHD, in addition to infusion for the purpose of body fluid adjustment and nutritional support, antibiotics have been administered for the purpose of suspicion of Clostridial infection and for the prevention of sepsis (non-patented). Literature 2). However, antibiotics are controversial in the therapeutic efficacy of AHD, and there is a risk that the intestinal bacterial flora is destroyed or resistant bacteria are generated (Non-patent Document 3).

Therefore, the present inventors have made it a task to suppress the number of Fusobacterium bacteria and bacteria of Stellara bacteria without causing the above-mentioned risks associated with the use of antibiotics. Another object of the present invention is to contribute to the prevention and treatment of diseases such as AHD by suppressing the number of such bacteria. That is, the present invention provides a substance and method capable of effectively suppressing the number of Fusobacterium bacteria and Sterella bacteria, and a substance and method which can contribute to the prevention and treatment of diseases such as AHD. With the goal.

As a result of earnest studies, the present inventors have found that 1-kestose significantly suppresses the number of Fusobacterium bacteria and / or Stellara bacteria in the body. Then, based on this knowledge, the following each invention was completed.

(1) The agent for suppressing the number of Fusobacterium bacteria and / or Stelerus bacteria according to the present invention comprises 1-kestose as an active ingredient.

(2) The agent for suppressing the number of bacteria according to the present invention can be suitably used to suppress the number of Fusobacterium bacteria and / or bacteria of Stella bacteria in dogs.

(3) The bacteria count inhibitor according to the present invention can be suitably used for the prevention or treatment of acute hemorrhagic diarrhea.

(4) The food composition for suppressing the number of Fusobacterium bacteria and / or Stelerus bacteria according to the present invention contains 1-kestose as an active ingredient.

(5) The animal feed for reducing the number of Fusobacterium bacteria and / or Stelerus bacteria according to the present invention contains 1-kestose as an active ingredient.

(6) The method for suppressing the number of Fusobacterium bacteria and / or Stelerus bacteria according to the present invention is a Fusobacterium bacteria and / or Stellara bacteria in the human or animal body by allowing the human or animal to take in 1-kestose. It has the process of suppressing the number of bacteria.

(7) The method for preventing or treating AHD according to the present invention is a method for preventing or treating AHD, by causing a human or animal suffering from or capable of suffering from AHD to ingest 1-kestose into the body of the human or animal. Suppressing the number of Fusobacterium bacteria and / or Stelerus bacteria in

(8) The use of 1-kestose according to the present invention is the use of 1-kestose for producing a medicament for preventing or treating AHD.

According to the present invention, it is possible to effectively suppress the number of at least one of Fusobacterium bacteria and / or Stellara bacteria in human or animal organisms. In addition, the suppression of the number of bacteria can contribute to the prevention and treatment of diseases such as AHD.

In addition, 1-kestose is a kind of oligosaccharide which is contained in vegetables and grains such as onion, garlic, barley, rye, etc., and it is a substance with eating experience since ancient times, mutagenicity test, acute The safety is extremely high as toxicity is not observed in any of the toxicity test, subchronic toxicity test and chronic toxicity test (Food and Development, Vol. 49, No. 12, p. 9, 2014). Furthermore, 1-kestose is highly soluble in water and has a good sweet taste similar to sugar, so it can be taken on a daily basis as it is or as a seasoning such as a sweetener etc. It can be easily incorporated into pharmaceuticals, animal feeds and the like.

Therefore, according to the present invention, Fusobacterium bacteria and Stellara spp. Can be conveniently and effectively taken without any risk (the destruction of the intestinal bacterial flora and the development of resistant bacteria) caused by the use of the above-mentioned antibiotics. The number of at least one of the bacteria can be suppressed.

It is a line graph which shows the 16S rDNA copy number of the whole eubacteria in feces from three months after a test start (one month after the completion of 1-kestose intake). It is a line graph which shows the 16S rDNA copy number of the Fusobacterium genus bacteria in feces from three months after a test start to 1 month (one month after the completion of 1-kestose intake). It is a line graph which shows the 16S rDNA copy number of the Sterella bacteria in feces from three months after a test start to 1 month (one month after the completion of 1-kestose intake).

Hereinafter, the present invention will be described in detail.

In the present invention, the term "Fusobacterium" refers to a bacterium belonging to the genus Fusobacterium. As the bacteria belonging to the genus Fusobacterium, for example, Fusobacterium mortiferum, Fusobacterium necrophorum, Fusobacterium gondinoformans, Fusobacterium russii, Fusobacterium perfoetens, Fusobacterium simum, Fusobacterium simiae, Fusobacterium nuclearium,

In the present invention, "Sterella bacteria" refers to bacteria belonging to the genus Stellara. Examples of bacteria belonging to the genus Stellara include Sutterella wadsworthensis, Sutterella parvirubra, Sutterella stercoricanis and the like.

1-kestose is a trisaccharide oligosaccharide consisting of one molecule of glucose and two molecules of fructose. 1-kestose can be produced by using sucrose as a substrate and performing an enzyme reaction with an enzyme as disclosed in JP-A-58-201980. Specifically, first, β-fructofuranosidase is added to a sucrose solution, and the mixture is allowed to stand at 37 ° C. to 50 ° C. for about 20 hours to perform an enzyme reaction to obtain a 1-kestose-containing reaction solution. By subjecting this 1-kestose-containing reaction solution to a chromatographic separation method as disclosed in JP-A-2000-232878, 1-kestose and other sugars (glucose, fructose, sucrose, tetrasaccharide or more) can be obtained. The oligosaccharide is separated and purified to obtain a high purity 1-kestose solution. Subsequently, the high purity 1-kestose solution is concentrated and then crystallized by a crystallization method as disclosed in Japanese Examined Patent Publication No. 6-70075 to obtain 1-kestose as crystals.

Further, since 1-kestose is contained in commercially available fructooligosaccharides, it may be used as it is or after separation and purification of 1-kestose from fructooligosaccharides by the method described above. That is, as the 1-kestose of the present invention, a 1-kestose-containing composition such as an oligosaccharide containing 1-kestose may be used. When the 1-kestose-containing composition is used, the purity of 1-kestose is preferably 80% or more, more preferably 85% or more, and still more preferably 90% or more. In the present invention, the "purity" of 1-kestose refers to the mass% of 1-kestose when the total mass of sugar is 100.

1-kestose is used by being ingested by humans or animals. As an intake amount (dosage amount) of 1-kestose, for example, 0.04 g / kg body weight or more per day can be mentioned. The amount of intake concerned may be divided into several times and ingested not only once a day.

As a method of feeding 1-kestose to humans and animals, any method may be used as long as it reaches the intestine which is a habitat of Fusobacterium bacteria and Stelerus bacteria. As such a method, specifically, there can be mentioned a method of orally ingesting 1-kestose into a human or an animal as it is, or in the form of food or drink, medicine, or animal feed. In addition, the method of administering 1-kestose directly from the anus or via a inserted tube, 1-kestose is added to the enteral nutrient, and this is inserted into the digestive tract such as stomach or small intestine, etc. And the method of administering by enteral nutrition etc. can be mentioned.

As mentioned above, the numbers of Fusobacterium bacteria and Stellara bacteria have been reported to be significantly increased in feces of dogs suffering from acute hemorrhagic diarrhea (AHD) compared to healthy dogs. It is suggested that it is involved in such diseases (see Non-patent Document 1; Table 3 and FIG. 3 etc.).

Therefore, AHD can be prevented or treated by allowing humans or animals to ingest 1-kestose to suppress the number of at least one of Fusobacterium bacteria and / or Stellara bacteria in the body or intestine. In addition, 1-kestose can be used to manufacture a pharmaceutical for the prevention or treatment of AHD.

In the present invention, "suppressing the number of bacteria" refers to suppressing an increase in the number of bacteria in any cell, tissue or organ of a living body.

For example, since the number of bacteria of the bacteria in the intestine is considered to be correlated with the number of bacteria of the bacteria in feces, the number of bacteria of the bacteria in the intestine can be obtained by measuring the number of bacteria of the bacteria in feces. Can be checked whether or not Specifically, for example, as shown in Example 1 (5) described later, 16S rDNA is subjected to real-time PCR using primers specific to the bacteria, using feces before and after intake of 1-kestose as a sample. Count the number of copies. Primers specific to the bacteria can be designed based on the known base sequences of the bacteria. For example, specific primers can be designed based on the 16S rDNA sequences shown in SEQ ID NO: 1-4 for Fusobacterium bacteria and in SEQ ID NO: 5 for Stellaella bacteria. Also, conveniently, real-time PCR can be performed using a commercially available kit for quantifying the bacteria.

Since there is a correlation between the 16S rDNA copy number of the bacteria and the number of bacteria of the bacteria, the 16S rDNA copy number can be used as an indicator of the number of bacteria. Therefore, as a result of measuring the 16S rDNA copy number of Fusobacterium or Sterella bacteria, if the 16S rDNA copy number in feces after intake of 1-kestose is smaller than before intake, intake of 1-kestose suppresses the number of bacteria. It can be determined that In addition, the number of bacteria in feces before and after 1-kestose intake is about those who are in the condition that the number of Fusobacterium bacteria and bacteria of Sterella bacteria increase with the passage of time, such as those suffering from acute hemorrhagic diarrhea (AHD). If the degree of increase is small, even if it is the same degree (constant) or increased, it can be judged that the number of bacteria is suppressed by the intake of 1-kestose.

Examples of the form of the microbe number inhibitor of the present invention and the preventive or therapeutic drug for AHD include forms consisting only of 1-kestose which is an active ingredient, as well as forms of pharmaceuticals, food additives, supplements and the like. When it is in the form of pharmaceuticals, food additives, supplements, its dosage form is, for example, powder, tablet, sugar coating, capsule, granule, dry syrup, liquid, syrup, drop, drink, etc. Or a liquid dosage form can be mentioned.

The pharmaceutical preparations, food additives and supplements of each of the above dosage forms can be produced by methods known to those skilled in the art. For example, in the case of powder, 800 g of 1-kestose and 200 g of lactose are mixed well, and then 300 mL of 90% ethanol is added to wet it. Subsequently, the wet powder is granulated and then air-dried at 60 ° C. for 16 hours, and then sized to obtain 1000 g of a powder of appropriate fineness (800 mg / 1 g of 1-kestose content). In the case of tablets, 300 g of 1-kestose, 380 g of powdered reduced starch syrup, 180 g of rice starch and 100 g of dextrin are thoroughly mixed, and then 300 mL of 90 (v / v)% ethanol is added to obtain a wet powder. The wet powder is extruded and granulated and then air-dried at 60 ° C. for 16 hours to obtain granules. The granules are sized using an 850 μm sieve, and 50 g of sucrose fatty acid ester is added to and mixed with 470 g of the granules. By using this in a rotary tableting machine (6B-2, manufactured by Kikusui Seisakusho Co., Ltd.), it is possible to obtain 5,000 tablets (containing 1-kestose content 60 mg / 1 tablet) having a diameter of 8 mm and a weight of 200 mg. In addition, tablets can also be produced by the method described in Example 1 (1) described later.

Further, the food composition for controlling the number of bacteria according to the present invention may be in the form of ordinary food such as confectionery, beverages, processed foods, health foods, infant foods, etc. besides those consisting of only 1-kestose which is an active ingredient. Can be mentioned. When it is in the form of food or drink, it can be manufactured by adding an active ingredient in a normal manufacturing process. Since the sweetness of 1-kestose is 30, and its taste, physical properties, and processability are close to those of sucrose, some or all of the sugar is replaced with 1-kestose, etc. It can be handled in the same manner as sugar to produce various foods and beverages.

The form of animal feed for suppressing number of bacteria of the present invention is also composed of only 1-kestose which is an active ingredient, dairy cattle feed, feed for beef cattle, livestock feed such as pig feed, poultry feed, etc., dog feed The form of normal animal feed, such as pet feed (pet food) such as cat feed, can be mentioned. When it is in the form of a normal animal feed, it can be produced by adding an active ingredient in the production process.

Hereinafter, the present invention will be described based on each example. The technical scope of the present invention is not limited to the features shown by these embodiments.

<Example 1> Changes in the number of Fusobacterium spp. And Sterella spp. By 1-kestose intake (1) Preparation of a tablet mainly composed of 1-kestose 1-kestose (purity 98% by mass or more; product food science) 800 g and stearin 8 g of magnesium acid is thoroughly mixed and then used in a continuous tableting machine (RT-S-9, Kikusui Seisakusho Ltd.) for tableting to give 2000 tablets (1-kestose content: 396 mg / 1) with a diameter of 8 mm and a weight of 400 mg. Got a lock).

(2) Breeding of beagle dogs fed orally with 1-kestose and collection of feces With the test period being 3 months, 5 beagle dogs were given 2 g of the tablet of Example 1 (1) per day The animals were bred for 2 months while taking 1-kestose intake (1980 mg). Thereafter, for follow-up observation, the animals were reared for 1 month without taking a tablet. At the beginning of the test, and one month, two months, and three months after the start of the test (at the end of the test), rectal stool was collected using a stool collection spoon type kit and stored frozen at -80.degree.

(3) Extraction of total DNA Total DNA was extracted from feces of Example 1 (2) according to the method described in <Shunsuke Takahashi et al., PLosONE, Vol. 9, No. 8, e105592, August 2014>. . Specifically, first, 100 mg of feces melted on ice is suspended in an aqueous solution containing 4 M guanidine thiocyanate, 100 mM Tris HCl (pH 9.0) and 40 mM EDTA, and zirconia is added using FastPrep FP 100 A (MP Biomedicals). Triturate with beads to obtain a suspension. DNA was extracted from this suspension using Magtration System 12 GC (Precision System Science) and GC series MagDEA DNA 200 (Precision System Science). The concentration of DNA was measured using a spectrophotometer ND-1000 (NanDrop Technologies), adjusted to 10 ng / μL, and used as total fecal DNA.

(4) Comprehensive Analysis of Microorganism-Derived DNA in Feces A comprehensive analysis of the types and abundances of bacteria and archaea contained in the feces of Example 1 (2) was performed. Specifically, according to the method described in <Shunsuke Takahashi et al., PLosONE, Vol. 9, No. 8, e105592, August 2014>, using the universal primer, feces-derived total of Example 1 (3) After amplification of 16S rDNA derived from bacteria contained in DNA, its nucleotide sequence was decoded by the next-generation sequencer MiSeq (Illumina). From the obtained nucleotide sequence data, after excluding those with low data quality and those derived from a chimeric sequence, sequences with high homology are grouped as one group, and this is classified into one bacterial species (or one genus) Treated as. The sequence with the highest frequency of appearance in the group was taken as a representative sequence, and the homology analysis with the sequence database was performed to identify the bacterial species. The abundance ratio was calculated as a percentage of the number of leads in each group to the total number of leads. The chimera sequence check is <Robert C. Edgar et al., BIOIN FORMATICS, Vol. 27, No. 16, pp. 2194-2200, June 2011>, and the homology analysis is <Chika Kasai et al., BMC Gastroenterology, 15 In the volume, article 100, August 2015>.

As a result of this comprehensive analysis, the abundance ratio of Fusobacterium and Stellara, and Fusobacterium mortiferum, Fusobacterium varium, Fusobacterium perfoetens, Fusobacterium necrogenes and Sutterella stercoricanis was found to be remarkable. The representative sequences (partial sequences of 16S rDNA) of each bacterial species are shown in SEQ ID NOs: 1 to 5, respectively. Further, the abundance ratio of each bacterial species (genus) is shown in Table 1. In Table 1, the value of the abundance ratio indicates the median value of five beagle dogs.

As shown in Table 1, the abundance ratio of the 16S rDNA of Fusobacterium bacteria was 7.18 at the start of the test, while 1.53 after 1 month after the start of the test and 1.98 after 2 months. One month after the end of 44, 1-kestose intake (3 months later) was 2.41. In addition, the abundance ratio of 16S rDNA of Fusobacterium mortiferum was 5.97 at the beginning of the test, whereas it was 1.64 after 1 month, 1.55 after 2 months, 1.85 after 3 months Met. In addition, the abundance ratio of 16S rDNA of Fusobacterium varium was 0.55 at the start of the test, whereas it was 0.09 after 1 month, 0.07 after 2 months and 0.23 after 3 months Met. In addition, the abundance ratio of 16S rDNA of Fusobacterium perfoetens was 0.46 at the beginning of the test, whereas it was 0.03 after 1 month, 0.06 after 2 months and 0.08 after 3 months Met. In addition, the abundance ratio of 16S rDNA of Fusobacterium necrogenes was 0.13 at the beginning of the test, whereas it was 0.02 after 1 month, 0.04 after 2 months, 0.01 after 3 months Met.

As described above, the abundance ratio of 16S rDNA of Fusobacterium bacteria starts the test at any time point one month after the start of the test, two months after and one month after the end of the intake of 1-kestose (three months later) It was noticeably small compared to the time. From this result, it was revealed that intake of 1-kestose reduces the abundance ratio of 16S rDNA of Fusobacterium bacteria in feces.

In addition, the abundance ratio of 16S rDNA of Sterella bacteria was 0.22 at the beginning of the test, but 0.10 after 1 month, 0.09 after 2 months, and the end of 1-kestose intake One month after (3 months after) it was 0.02. In addition, the abundance ratio of 16S rDNA of Sutterella stercoricanis was 0.31 at the start of the test, while it was 0.11 after 1 and 2 months and 0.02 after 3 months.

As described above, the abundance ratio of 16S rDNA of Sterella bacteria starts the test at any time point one month after the start of the test, two months after and one month after the end of the intake of 1-kestose (three months later) It was noticeably small compared to the time. From this result, it was revealed that intake of 1-kestose reduces the abundance ratio of 16S rDNA of Sterella bacteria in feces.

Therefore, it was decided to carry out a quantitative analysis on the number of bacteria of Fusobacterium spp.

(5) Quantitative Analysis of the Number of Bacteria by Real-Time PCR The number of Fusobacterium bacteria and bacteria of the genus Stellara in feces of the present Example 1 (2) was quantified by real-time PCR. Specifically, Fusobacterium Detection Kit (Cat. No. RO-0005) (Techno Surga Lab), real-time PCR reagent “SYBR Premix Ex Taq II Real-time PCR was performed using T1i RNase H Plus) (Takara) and real-time PCR equipment "Rotor-Gene Q" (QIAGEN) according to the attached instructions to quantify the 16S rDNA copy number of Fusobacterium bacteria per gram of feces did.

Also, real-time PCR was performed in the same manner using Sutterella Detection Kit (Techno Surga Lab) in place of Fusobacterium Detection Kit to quantify the 16S rDNA copy number of Sterella bacteria per gram of feces. Furthermore, real-time PCR is performed in the same manner using a universal primer (forward primer; CCTACGGGAGGCAGCAG (SEQ ID NO: 6), reverse primer: ATTACCGCGGCTGCTGG (SEQ ID NO: 7)) to quantify 16S rDNA copy number of total eubacteria contained in 1 g of feces. did.

In addition, the calibration curve for quantifying Fusobacterium genus bacteria and Sterella genus bacteria was produced based on the result of having performed real-time PCR on the same conditions using the standard sample contained in the said kit. On the other hand, the calibration curve for quantifying whole eubacteria is E. coli. The results of real-time PCR using plasmid DNA incorporating 16S rDNA sequence (SEQ ID NO: 8) of E. coli JCM1649T as a standard sample, forward primer; AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 9) and reverse primer; GGTTACCTTGTTACGACTT (SEQ ID NO: 10) Based on

The obtained 16S rDNA copy number was calculated as the median at each collection time of feces. The 16S rDNA copy number (median) of whole eubacteria is shown in the line graph of FIG. 1, the 16S rDNA copy number (median) of Fusobacterium bacteria is shown in the line graph of FIG. The values are shown in the line graph of FIG. Assuming that the 16S rDNA copy number at the start of the test is 100%, the 16S rDNA copy number is expressed as a percentage at one month, two months after the start of the test and one month after the end of intake (three months). It was the rate (%). In addition, the 16S rDNA copy number of total eubacteria was 100%, and the 16S rDNA copy number of each of Fusobacterium bacteria and Sterella bacteria was expressed as a percentage, and this was taken as the occupancy rate (%). The results for whole eubacteria are shown in Table 2, the results for Fusobacterium bacteria are shown in Table 3, and the results for Sterella bacteria are shown in Table 4.

As shown in FIG. 1 and Table 2, the 16S rDNA copy number of whole eubacteria is 1 month after the start of the test, 2 months after and 1 month after the end of the intake of 1-kestose (3 months after), It increased with the passage of time. On the other hand, as shown in FIG. 2 and Table 3, the 16S rDNA copy number of Fusobacterium bacteria decreased with the lapse of time from the start of the test. The 16S rDNA copy number of Sterella bacteria also decreased with the passage of time from the start of the test, as shown in FIG. 3 and Table 4.

Specifically, as shown in Table 3, the rate of change of Fusobacterium bacteria was 33% at one month after the start of the test, 40% at two months, and 32% at three months. That is, the number of 16S rDNA copies of the Fusobacterium bacteria is lower than that at the start of the test at any one month after the start of the test, two months after the start of the test, and one month after the end of intake of 1-kestose (three months). It became remarkably small to about 1/3.

In addition, the occupancy rate of the Fusobacterium bacteria was 4.76% at the start of the test, but 1.20% after one month from the start of the test, 1.35% after two months, after three months The rate was 0.82%. That is, the percentage of Fusobacterium bacteria in total eubacterial bacteria at one month after the start of the test, two months after the start of the test and one month after the end of the intake of 1-kestose (after three months) In comparison, they were significantly reduced to about 1⁄4, 1⁄3 and 1⁄6, respectively.

As described above, both the 16S rDNA copy number of the Fusobacterium bacteria in feces and the proportion in the total eubacteria were significantly reduced by the intake of 1-kestose. In addition, the reduction effect continued even after the end of 1-kestose intake. From these results, it was revealed that 1-kestose has a remarkably large effect of suppressing the number of Fusobacterium bacteria in the living body of a dog.

Next, as shown in Table 4, the rate of change of Sterella bacteria was 59% one month after the start of the test, 50% two months later, and 17% three months later. That is, the number of 16S rDNA copies of the Sterella bacteria is 1 month after the start of the test, 2 months after the start of the test, and 1 month after the end of the intake of 1-kestose (3 months after). It becomes significantly smaller from about 1/2 to less than 1/5.

In addition, the occupancy rate of Sterella bacteria was 0.13% at the start of the test, while 0.06% at one month after the start of the test, 0.04% at two months after the test The result was 0.01%. That is, in any one month after the start of the test, two months after, and one month after the end of intake of 1-kestose (three months after), the ratio of the bacteria of the bacteria belonging to all eubacterial bacteria is the same as at the start of the test. In comparison, they were significantly reduced to 1/4, 1/6 and 1/24, respectively.

As described above, both the 16S rDNA copy number and the proportion of total eubacteria in the Sterella bacteria in feces were significantly reduced by the intake of 1-kestose. In addition, the reduction effect continued even after the end of 1-kestose intake. From these results, it was revealed that 1-kestose has a significantly large effect of suppressing the number of Sterella bacteria in the living body of dogs.

Claims (8)

1. The 1-kestose is an active ingredient which is an agent for controlling the number of Fusobacterium bacteria and / or Stellara bacteria.
2. The microbe number suppressing agent according to claim 1, which is used to suppress the number of Fusobacterium bacteria and / or Stellara bacteria in dogs.
3. The microbe number suppressing agent according to claim 1 or 2, which is used for the prevention or treatment of acute hemorrhagic diarrhea.
4. 1-A food composition for controlling the number of Fusobacterium bacteria and / or Stelerus bacteria, which comprises 1-kestose as an active ingredient.
5. 1-Animal feed for controlling the number of Fusobacterium bacteria and / or Stelerus bacteria, which comprises 1-kestose as an active ingredient.
6. The number of Fusobacterium bacteria and / or Sterella bacteria having a step of suppressing the number of Fusobacterium bacteria and / or Stelerus bacteria in the human or animal body by feeding 1-kestose to the human or animal How to control.
7. A human or animal suffering from or capable of suffering from acute hemorrhagic diarrhea, is a Fusobacterium bacteria and / or bacteria of the genus Stellara in the human or animal by taking 1-kestose. A method for preventing or treating acute hemorrhagic diarrhea, comprising the step of suppressing the number.
8. Use of 1-kestose for the manufacture of a medicament for the prevention or treatment of acute hemorrhagic diarrhea.

Images