WO2019023149A1 - Use of bromodomain-containing protein 9 antagonists in combination with vitamin d receptor agonists in diabetes treatment - Google Patents

Use of bromodomain-containing protein 9 antagonists in combination with vitamin d receptor agonists in diabetes treatment Download PDF

Info

Publication number
WO2019023149A1
WO2019023149A1 PCT/US2018/043345 US2018043345W WO2019023149A1 WO 2019023149 A1 WO2019023149 A1 WO 2019023149A1 US 2018043345 W US2018043345 W US 2018043345W WO 2019023149 A1 WO2019023149 A1 WO 2019023149A1
Authority
WO
WIPO (PCT)
Prior art keywords
vdr
brd9
cal
vitamin
antagonists
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/043345
Other languages
French (fr)
Inventor
Ronald M. Evans
Michael Downes
Zong WEI
Annette Atkins
Ruth T. Yu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Salk Institute for Biological Studies
Original Assignee
Salk Institute for Biological Studies
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Salk Institute for Biological Studies filed Critical Salk Institute for Biological Studies
Publication of WO2019023149A1 publication Critical patent/WO2019023149A1/en
Priority to US16/737,312 priority Critical patent/US11376264B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/59Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425Thiazoles
    • A61K31/427Thiazoles not condensed and containing further heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4365Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system having sulfur as a ring hetero atom, e.g. ticlopidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/59Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
    • A61K31/5929,10-Secoergostane derivatives, e.g. ergocalciferol, i.e. vitamin D2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/59Compounds containing 9, 10- seco- cyclopenta[a]hydrophenanthrene ring systems
    • A61K31/5939,10-Secocholestane derivatives, e.g. cholecalciferol, i.e. vitamin D3
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders

Definitions

  • This disclosure provides methods of using an agent compound that increases the biological activity of a vitamin D receptor (VDR) (e.g., a VDR agonist), in combination with an antagonist of bromodomain-containing protein 9 (BRD9), to reduce blood glucose in a mammal, for example to treat type II diabetes.
  • VDR vitamin D receptor
  • BBD9 bromodomain-containing protein 9
  • VDR vitamin D receptor
  • Bromodomain-containing protein 9 is a member of a diverse nuclear and cytoplasmic family of proteins that recognize acetylated lysines (Filippakopoulos and Knapp, 2014, Nat. Rev. Drug Discov. 13, 337-356). Structural differences in the bromodomain of BRD9 distinguish it from other members such BRD2, BRD4 and BRDT (Filippakopoulos et al., 2010, Nature 468, 1067-73). BRD9 is a core component of the SWF/SNF (BAF) complex and, similar to other BAF components, is found to be mutated in multiple cancers (Kadoch et al., 2013, Nature genetics 45, 592-601).
  • BAF SWF/SNF
  • VDR is a modulator of the stress response in beta ( ⁇ ) cells
  • BRD9 is a determinant in the VDR-driven anti-inflammatory and pro-survival responses. In the absence of stress, BRD9 recruits the suppressive BAF transcriptional complex to silence VDR. In a dual regulatory mechanism, inhibition of the VDR-BRD9 interaction in combination with ligand activation of VDR cooperate to dismiss the BAF complex in favor of the activating PBAF complex to induce a coordinated transcriptional response.
  • VDR ligand in combination with a
  • BRD9 inhibitor is able to partially restore ⁇ cell function and glucose homeostasis in T2D mouse models. These results reveal an unexpected post-translational control of VDR function through a bromodomain reader and implicate its potential therapeutic function in diabetes. Based on these observations, methods of using a therapy that uses both a vitamin D receptor (VDR) agonist and a bromodomain-containing protein 9 (BRD9) antagonist are provided. In some examples, such methods are used to treat a disorder that benefits from increased VDR activity, such as fibrosis (such as fibrosis of the lung, liver, kidney or pancreas), autoimmune disorders, and type II diabetes (T2D).
  • VDR vitamin D receptor
  • BTD9 bromodomain-containing protein 9
  • the methods include administering a therapeutically effective amount of one or more VDR agonists and one or more BRD9 antagonists to reduce blood glucose in a mammal, such as a decrease of at least 5%, at least 10%, at least 25%, at least 50%, or at least 75%. In some examples the methods include administering a therapeutically effective amount of one or more VDR agonists and one or more BRD9 antagonists to treat type 2 diabetes in a mammal.
  • the methods include administering a therapeutically effective amount of one or more VDR agonists and one or more BRD9 antagonists to reduce fed and fasting blood glucose (such as a decrease of at least 5%, at least 10%, at least 25%, at least 50%, or at least 75%), increase insulin sensitivity (such as an increase of at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 200%, or at least 300%), increase glucose tolerance (such as an increase of at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 200%, or at least 300%), increase insulin secretion (such as an increase of at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 200%, or at least 300%), increase beta cell function (such as an increase of at least 10%, at least 25%, at
  • compositions that include one or more VDR agonists and one or more
  • kits that include one or more VDR agonists and one or more BRD9 antagonists.
  • VDR agonists examples include but are not limited to vitamin D, a vitamin D precursor, a vitamin D analog, a vitamin D receptor ligand, a vitamin D receptor agonist precursor, and combinations thereof.
  • BRD9 antagonists examples include but are not limited to i-BRD9, TP742, BI-7273, BI-9564, dBRD9, G E-375 and LP-99.
  • FIGS. 1A-1F VDR is essential for ⁇ cell homeostasis.
  • A Schematic representation of the genome-wide CRISPR loss-of-function screen in human iPSC-derived ⁇ -like cells.
  • B Gene ontology analysis of targets compromising ⁇ -like cell function (p ⁇ 0.01, 156 total genes).
  • C p- value rank order plot of genes enriched in the loss-of-function screen, VDR is labeled in red.
  • D Distribution of normalized reads of individual sgRNAs in GFP sorted cells; VDR sgRNAs are labeled in red.
  • FIGS. 2A-2B VDR is expressed in ⁇ cells.
  • FIGS. 3A-3J VDR is essential for ⁇ cell function.
  • A Percentage of apoptotic cells, as measured by FACS analysis for Annexin5, in control and VDR knockdown human ⁇ -like cells.
  • B Heat map of relative gene expression changes between control (siCtrl) and VDR knockdown (siVDR) INS 1 cells in response to different stress conditions, as determined by qPCR.
  • E Staining of
  • FIGS. 4A-4L Bromodomain-containing proteins BRD7 and BRD9 bind acetylated VDR.
  • A Heat map of VDR interacting proteins in human ⁇ -like cells in the absence or presence of ligand Cal, determined by MudPIT analyses (24 h after doxycycline induction of HA-VDR and ligand addition). Spectral counts normalized to VDR.
  • B Western blot of endogenous BRD9 in immunoprecipitates from 293T cells expressing HA-tagged VDR treated with vehicle (DMSO), Cal, the BRD9 inhibitor iBRD9, or Cal+iBRD9.
  • C Western blot of ectopically expressed VDR in immunoprecipitates from 293T cells expressing Flag-tagged BRD9, lh after treatment with DMSO, Cal, iBRD9, or Cal+iBRD9.
  • E Alignment of T-box sequences from related nuclear receptors showing conservation of the VDR acetylated lysine K91 (from top to bottom, SEQ ID NOS: 45-50).
  • F Crystal structure of the DNA binding domains of VDR (red) bound to DNA (blue), highlighting the sidechain of K91 (green) (PDB ID: lkb2).
  • FIGS. 5A-5J VDR acetylation and BAF interaction.
  • A Immunoprecipitation of endogenous BAF/PBAF components in 293 T cells shows that BRD9 interacts with BAF components BRG1 and ARID IB, but does not interact with PBAF component ARID2;
  • B B
  • FIGS. 6A-6F BRD9 represses VDR activation upon acute cytokine stress in ⁇ cells.
  • A Heat map of MudPit mass-spectral analyses of VDR interactomes in INSl cells expressing HA- tagged VDR.
  • Ligand and iBRD9-treated cells show increased interactions between VDR and PBAF-specific components PBRMl and ARID2, but not BAF-specific components ARID 1 A and ARIDIB. Interactions between VDR and mediator components, NURD complex and other co- factors also increase upon ligand or iBRD9 treatment. Spectral counts in individual samples are normalized by counts of VDR.
  • FIGS. 7A-7I Synergy between iBRD9 and Cal directly reverse the transcriptome changes brought by ILi and influence global DNA accessibility.
  • A Number of genes significantly induced or repressed by 1 hour ILi stress. The black bars represent genes rescued by Cal+iBRD9.
  • B Heat map of all Cal+iBRD9 rescued genes.
  • C Gene ontology categories of Cal+iBRD9 rescued ILi -repressed genes indicate that the majority of these genes are related to ⁇ cell function including hormone secretion, development, and anti-ER stress response.
  • D Gene ontology categories of Cal+iBRD9-rescued ILi -induced genes indicate that the majority of these genes are related to ⁇ cell inflammatory and stress responses.
  • a "hyper-activated” state is seen upon combinatorial treatment of Cal and iBRD9.
  • G Enriched transcription factors (TF) motifs in Cal+iBRD9 induced ATAC-seq peaks.
  • H Chromatin accessibility at identified VDR response elements (VDREs) increases with Cal+iBRD9 treatment.
  • II Genome browser tracks of ATAC-seq signals at 3 representative gene loci: Nfkbia, Nfkbiz, and Cckar, all showing a synergistic effect of Cal+iBRD9 at enhancer regions.
  • FIGS. 8A-8L VDR regulates NFKB signaling.
  • G-I ChlP-qPCR of ARID IB, a BAF-specific component, show that addition of iBRD9 reduces BAF complex binding at key VDR target loci Nfkbia, Nfkbiz, and Camk4;
  • J-L ChlP-qPCR of BAF 180, a PBAF-specific component, show that addition of iBRD9 increases PBAF complex binding at key VDR target loci Nfkbia, Nfkbiz, and Camk4.
  • FIGS. 9A-9L Activation of VDR directly antagonizes the global enhancer dynamics induced by ILi .
  • A Heat map of all H3K27Ac peaks repressed by ILlp (>1.5 fold) 1 hour after treatment. The decreases in H3K27Ac were partially recovered by ligand activation of VDR.
  • B Heat map of all H3K27Ac peaks induced by ⁇ .1 ⁇ (>1.5 fold) 1 hour after treatment. The increases in H3K27Ac were partially repressed by ligand activation of VDR.
  • C Enriched TF binding motifs in VDR ligand-induced H3K27Ac peaks shows that the VDR binding element (VDRE) is highly enriched.
  • VDRE VDR binding element
  • H3K27Ac signal intensity around accessible VDREs (within ATAC-seq peaks) related to Cal+iBRD9-rescued ILi -repressed genes. ILi significantly reduces H3K27Ac at VDREs, which was rescued by Cal+iBRD9.
  • E H3K27Ac signal intensity around accessible VDREs (within ATAC-seq peaks) related to Cal+iBRD9 rescued ILi induced genes. ⁇ .1 ⁇ significantly induced H3K27Ac at VDREs, which was rescued by Cal+iBRD9.
  • Genome browser tracks showing H3K27Ac at 2 loci: Camk4 and Cckar, showing ILi causes a decrease in H3K27 acetylation, which could be reversed with Cal+iBRD9 treatment.
  • G Total number of H3K27Ac peaks synergistically enhanced by iBRD9 (ILl +Cal+iBRD9 vs. ILip+Cal) and the fraction containing VDREs, 6 hours after treatment.
  • H GO categories enriched in genes associated with peaks in (G).
  • Genome browser tracks comparing H3K27Ac between Cal and Cal+iBRD9-treated samples at Nfkbia and Camk4 loci.
  • FIGS. 10A-10I Combinatorial treatment of Cal and iBRD9 rescue ⁇ cell dysfunction and improve glucose metabolism in type 2 diabetes animal models.
  • Cal+iBRD9 treatment significantly reduced overnight fasted glucose levels in db/db (BKS) mice (n 8, error bars show S.E.M., *P ⁇ 0.05).
  • G) Cal and Cal+iBRD9-treated db/db (BKS) mice have higher fasting serum insulin levels (n 5, error bars show S.E.M., *P ⁇ 0.05).
  • FIGS. 11A-11F Cal and iBRD9 do not affect whole body metabolism.
  • FIGS. 12A-12J Cal and iBRD9 combination restores glucose metabolism in multiple mouse models.
  • C Key hepatic gluconeogenesis genes are repressed in Cal-treated db/db (B6) mice, suggesting higher levels of serum insulin suppresses gluconeogenesis from liver.
  • FIGS. 13A-13L Activation of VDR reverses ⁇ cell stress in vivo.
  • A Volcano plot of gene expression changes induced in islets isolated from Cal-treated db/db (B6) mice, determined by RNA-seq analyses, reveals the induction of key factors for ⁇ cell function, whereas multiple proinflammatory genes are down-regulated.
  • B GO analysis shows enrichment in pathways related to ⁇ cell function in the gene set whose expression is increased in islets upon Cal treatment.
  • C H&E staining of db/db (BKS) pancreata treated with vehicle or Cal for 3 months. (Scale bar: 50 ⁇ ).
  • VDR Activation of VDR partially rescues the morphological degeneration caused by ILi .
  • Scale bar ⁇ ⁇ ).
  • L Schematic representation of the mechanism underlying the synergy between Cal and iBRD9 in directing the association of VDR with alternate chromatin remodeling complexes and the consequential effects on transcription. Data reported as mean ⁇ SEM, *p ⁇ 0.05, **p ⁇ 0.01.
  • FIGS. 14A-14B Calcipotriol Treatment Increases Ex Vivo Human Islet Survival and Insulin Secretion.
  • nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • sequence Listing is submitted as an ASCII text file, created on May 25, 2018, 32 KB, which is incorporated by reference herein. In the accompanying sequence listing:
  • SEQ ID NOS : 1 -44 are PCR primers.
  • SEQ ID NOS: 45-50 show exemplary T-box sequences from related nuclear receptors.
  • Administration To provide or give a subject an agent, such as a VDR agonist and a
  • BRD9 antagonist by any effective route.
  • routes of administration include, but are not limited to, oral, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous, intra-articular, and intrathecal), sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
  • Bromodomain-containing protein 9 A protein containing a bromodomain, which recognizes acetylated lysines on post-translationally modified proteins. This protein is upregulated in multiple cancer cell lines. It is closely related to BRD7. Sequences are publicly avaible, for example from the GenBank® database, such as GenBank® Accession Nos.
  • Diabetes mellitus A group of metabolic diseases in which a subject has high blood sugar, either because the pancreas does not produce enough insulin, or because cells do not respond to the insulin that is produced.
  • Type 1 diabetes results from the body's failure to produce insulin. This form has also been called “insulin-dependent diabetes mellitus” (IDDM) or "juvenile diabetes”.
  • IDDM insulin-dependent diabetes mellitus
  • Type 2 diabetes results from insulin resistance, a condition in which cells fail to use insulin properly, sometimes combined with an absolute insulin deficiency. This form is also called “non- insulin-dependent diabetes mellitus” (NIDDM) or "adult-onset diabetes.” The defective responsiveness of body tissues to insulin is believed to involve the insulin receptor. Diabetes mellitus is characterized by recurrent or persistent hyperglycemia, and in some examples diagnosed by demonstrating any one of:
  • Effective amount or therapeutically effective amount The amount of agent, such as a VDR agonist and a BRD9 antagonist, that is an amount sufficient to prevent, treat (including prophylaxis), reduce, and/or ameliorate the symptoms and/or underlying causes of any of a disorder or disease.
  • an "effective amount" is sufficient to reduce or eliminate a symptom of type II diabetes in a mammal, for example by lowering blood glucose.
  • Mammal This term includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects (such as cats, dogs, cows, and pigs) and rodents (such as mice and rats).
  • compositions and formulations suitable for pharmaceutical delivery of the one or more VDR agonists and one or more BRD9 antagonists are conventional. Remington 's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15 th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the one or more VDR agonists and one or more BRD9 antagonists.
  • parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, or the like as a vehicle.
  • pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, or the like as a vehicle.
  • physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, or the like
  • solid compositions e-g-, powder, pill, tablet, or capsule forms
  • conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
  • compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
  • Subject Any mammal, such as humans, non-human primates, pigs, sheep, cows, dogs, cats, rodents and the like which is to be the recipient of the particular treatment, such as treatment with a VDR agonist and a BRD9 antagonist.
  • a subject is a human subject or a murine subject.
  • the subject has type 2 diabetes.
  • the subject has elevated blood glucose.
  • Treating a disease “Treatment” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition (for instance, fibrosis) after it has begun to develop.
  • Treatment refers to inhibiting the full development of a disease, for example in a person who is known to have a predisposition to a disease such as a person who has been or is at risk for developing type II diabetes.
  • Vitamin D A group of fat-soluble secosteroid prohormones and hormones, the two major forms of which are vitamin D2 (ergocalciferol), and vitamin D3 (cholecalciferol) which is converted to l ,25 dihydroxyvitamin D 3 (1 a,25-(OH) 2 -D3), also known as calcitriol, the physiologically active form of vitamin D.
  • Vitamin D agonist or analog Any compound, synthetic or natural, that binds to and activates the VDR, such as a VDR ligand (e.g., calcitriol), VDR agonist precursor, vitamin D analogs, vitamin D precursors.
  • VDR ligand e.g., calcitriol
  • vitamin D agonists and analogs include la,25(OH) 2 D 3 , calcipotriol, LG190090, LG9190119, LG190155, LG190176, and
  • LG190178 see, for instance, Boehm et al, (1999) Chemistry & Biology, 6:265-275); LY2108491, and LY2109866 (Ma et al, (2006) J Clin. Invest., 116:892-904); 2p-(3-Hydroxypropoxy)la,25- Dihydroxyvitamin D 3 (ED-71) (Tsurukami et al, (1994) Calcif. Tiss. Int. 54: 142-149); EB1089 (Pepper et al, (2003) Blood, 101 :2454-2460); OCT(22-oxa-calcitrol) (Makibayashi et al, (2001) Am. J.
  • Vitamin D precursor A compound capable of being converted to an agonist of the vitamin D receptor by an enzyme.
  • that enzyme is CYP27B1.
  • vitamin D precursors include vitamin D 3 (cholecalciferol), 25- hydroxy-vitamin D 3 (25-OH-D 3 ) (calcidiol), as well as vitamin D2 (ergocalciferol) and its precursors.
  • Vitamin D receptor A member of the nuclear hormone receptor (HR) superfamily and is a key regulator of calcium homeostasis and skeletal health.
  • VDR possesses the common nuclear receptor structure, for example, is comprised of an N-terminal activation domain, a DNA-binding region (DBD) with two zinc finger domains, a hinge region and a ligand-binding domain (LBD).
  • BBD DNA-binding region
  • LBD ligand-binding domain
  • VDR activated gene transcription requires initial nuclear translocation via importin-a, heterodimerization with RXR, and binding to response elements present in target genes.
  • VDR regulates genes associated with the maintenance of calcium and phosphate homeostasis in the intestine and kidney.
  • VDR/RXR heterodimers The signal initiated by VDR/RXR heterodimers is modulated by the association of co-activating or co-repressing proteins and also depends on other signaling partners in the nuclear compartment.
  • the VDR/RXR heterodimer is non-permissive, in that the presence or absence of RXR ligands is not known to affect VDR responses.
  • Endogenous activators of the VDR include the biologically active form of vitamin D
  • bile acids such as lithocholic acid (LCA) and its derivatives (LCA- acetate, LCA-formate, 3-keto LCA).
  • VDR vitamin D receptor
  • VDR-BRD9 inhibition synergistically cooperates with ligand-dependent VDR activation to abrogate cytokine-induced transcriptomic changes, in part via PBAF-mediated changes in chromatin accessibility and enhancer landscape.
  • the inventors show that combined VDR activation and BRD9 inhibition significantly restores ⁇ cell function to ameliorate hyperglycemia in multiple murine T2D models.
  • VDR is a critical factor in ⁇ cell survival and function. Initially identified in an unbiased CRISPR knockout screen, genetic loss-of-function and ex vivo gain-of- function demonstrate a protective role for VDR in ⁇ cells and the modulation of islet stress. In exploring the regulatory mechanisms of VDR-driven transcriptional action the shuttling of VDR between competing chromatin remodeling complexes was observed (FIG. 13L). Specifically, provided is a novel acetylated lysine in VDR that facilitates its recognition by the highly related bromodomain reader proteins, BRD9 and BRD7, respective components of the BAF and PBAF complexes.
  • VDR shuttles between BAF and PBAF complexes in a ligand-dependent fashion It is shown that VDR shuttles between BAF and PBAF complexes in a ligand- dependent fashion.
  • a highly selective BRD9 inhibitor, iBRD9 cooperates with VDR ligand to favor PBAF complex binding and significantly potentiates VDR signaling.
  • binding of the PBAF complex enhances chromatin accessibility at consensus VDR binding elements to modulate the expression of key inflammatory response genes including the inhibitor of F-kB, Nfkbia.
  • the BAF and PBAF complexes are distinct assemblies (Hodges et al., 2016, Cold Spring Harbor Prespect. Med. 6. a026930). While the PBAF complex is a superior transcriptional activator compared to the BAF complex in vitro (Lemon et al., 2001, Nature 414, 924-928; Rafati et al., 2011, PLoS biology 9, el001206), the ability of these two complexes to mediate ligand-dependent signaling was not previously known.
  • the inventors describe herein a novel mechanism in which acetylation at K91 in VDR is recognized by the BRD7/9 subfamily of bromodomain proteins to direct the association of the PBAF and BAF complexes in a ligand-dependent fashion.
  • the switching of VDR' s partner from BAF- BRD9 to PBAF-BRD7 can also be pharmacologically manipulated by targeting the "reader" of VDR acetylation, thereby providing an additional level of nuclear receptor signaling regulation.
  • cytokines such as ILip and TNF-a are detrimental to ⁇ cell function (Nackiewicz et al., 2014, Diabetologia 57, 1645-1654) and multiple clinical trials targeting these cytokines are ongoing (Imai et al., 2013, Trends Endocrinol. Metab. 24, 351-360).
  • use of selective inhibitors of inflammation to treat T2D has seen only modest improvements.
  • VDR as a negative modulator of NFKB signaling in ⁇ cells is highly effective, and that combining a VDR activator with a BRD9 inhibitor results in prolonged suppression of the damaging effects of inflammatory insults.
  • Such methods can include administering a therapeutically effective amount of one or more VDR agonists to the mammal, and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby reducing the blood glucose.
  • blood glucose is decreased by of at least 5%, at least 10%, at least 25%, or at least 50%, for example as compared to administration of no VDR agonists and no BRD9 antagonists (e.g., administration of PBS).
  • Such methods can include administering a therapeutically effective amount of one or more VDR agonists to the mammal, and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby treating the type 2 diabetes in the mammal.
  • Such a method can include administering a therapeutically effective amount of one or more VDR agonists to the mammal, and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby reducing fed and fasting blood glucose.
  • the fed and fasting blood glucose is reduced in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, or at least 90% as compared to an absence of administration of the VDR agonists and BRD9 antagonists.
  • an autoimmune disease is one in which the immune system produces an immune response (for example, a B cell or a T cell response) against an antigen that is part of the normal host (that is, an autoantigen), with consequent injury to tissues.
  • An autoantigen may be derived from a host cell, or may be derived from a commensal organism such as the micro-organisms (known as commensal organisms) that normally colonize mucosal surfaces.
  • Exemplary autoimmune diseases affecting mammals that can be treated with the disclosed combination of VDR agonist and BRD9 antagonist include rheumatoid arthritis, juvenile oligoarthritis, collagen-induced arthritis, adjuvant-induced arthritis, Sjogren's syndrome, multiple sclerosis, experimental autoimmune encephalomyelitis, inflammatory bowel disease (for example, Crohn's disease, ulcerative colitis), autoimmune gastric atrophy, pemphigus vulgaris, psoriasis, vitiligo, type 1 diabetes, non-obese diabetes, myasthenia gravis, Grave' s disease, Hashimoto's thyroiditis, sclerosing cholangitis, sclerosing sialadenitis, systemic lupus erythematosis, autoimmune thrombocytopenia purpura, Goodpasture's syndrome, Addison's disease, systemic sclerosis, polymyositis, dermatomyositis, autoimmune hemolytic an
  • Such methods can include administering a therapeutically effective amount of one or more VDR agonists to a mammal (such as one with type II diabetes), and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby reducing fed and fasting blood glucose, increasing insulin sensitivity, increasing glucose tolerance, increasing insulin secretion, increasing beta cell function, increasing the size of islets, reducing beta cell death, increasing insulin granules, or combinations thereof.
  • the fed and fasting blood glucose is reduced in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, or at least 90% as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s).
  • insulin sensitivity is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%, at least 100%), at least 200%, at least 300% or at least 500%, as compared to an absence of
  • VDR agonist(s) and BRD9 antagonist(s) administration of the VDR agonist(s) and BRD9 antagonist(s).
  • glucose tolerance is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%, at least 100%, at least 200%, at least 300% or at least 500%, as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s).
  • insulin secretion is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%, at least 100%, at least 200%, at least 300% or at least 500%), as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s).
  • beta cell function is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%, at least 100%, at least 200%), at least 300% or at least 500%, as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s).
  • the size or number of islets is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%), at least 100%, at least 200%, at least 300% or at least 500%, as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s).
  • beta cell death is reduced in the treated subject by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, or at least 90% as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s).
  • insulin granules e.g., the amount or number of
  • insulin granules is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%), at least 100%, at least 200%, at least 300% or at least 500%, as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s). In some examples, combinations of these reductions are achieved.
  • fibrosis such as fibrosis of the liver, pancreas, or kidney.
  • Such methods can include administering therapeutically effective amounts of one or more VDR agonists to a mammal (such as one with type II diabetes), and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby reducing fibrosis.
  • fibrosis is reduced in the treated mammal by at least 10%, at least 20%), at least 30%>, at least 50%, at least 75%, or at least 90% as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s).
  • the disclosed methods of administering a therapeutically effective amount of one or more VDR agonists to a mammal, and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal treats a disease, such as a liver disease, kidney disease, or pancreatic disease in the subject.
  • liver diseases that can be treated using the disclosed methods include one or more of alcohol liver disease, fatty liver disease, liver fibrosis/cirrhosis, biliary fibrosis/ cirrhosis, liver cancer, hepatitis B virus infection, hepatitis C virus infection, sclerosing cholangitis, Budd-Chiari syndrome, jaundice, nonalcoholic
  • the liver cancer is a hepatocellular carcinoma, cholangiocarcinoma, angiosarcoma, or hemangiosarcoma.
  • pancreatic diseases that can be treated with the disclosed methods include but are not limited to pancreatitis, pancreatic fibrosis and pancreatic ductal adenocarcinoma (PDA).
  • the kidney disease is fibrosis of the kidney.
  • the disclosed methods can further include administering one or more additional therapeutic compounds, such as those used to regulate insulin, blood sugar, or reduce inflammation, such as insulin, an alpha-glucosidase inhibitor, amylin agonist, dipeptidyl-peptidase 4 (DPP-4) inhibitor, meglitinide, sulfonylurea, or a peroxisome proliferator-activated receptor (PPAR)-gamma agonist.
  • additional therapeutic compounds such as those used to regulate insulin, blood sugar, or reduce inflammation, such as insulin, an alpha-glucosidase inhibitor, amylin agonist, dipeptidyl-peptidase 4 (DPP-4) inhibitor, meglitinide, sulfonylurea, or a peroxisome proliferator-activated receptor (PPAR)-gamma agonist.
  • additional therapeutic compounds such as those used to regulate insulin, blood sugar, or reduce inflammation, such as insulin, an alpha-glucosidase inhibitor, amylin agonist
  • the subject is a mammal, such as a human, cat, or dog.
  • the subject has diabetes.
  • Methods of administration are routine, and can include subcutaneous, intraperitoneal, intrathecal, intramuscular, or intravenous injection or infusion.
  • use of VDR agonists with BRD9 antagonists does not lead to (or significantly reduces, such as a reduction of at least 20%, at least 50%, at least 75%, or at least 90%) the adverse side effects observed with thiazolidinediones (TZDs) therapeutic insulin sensitizers, including weight gain, increased liver steatosis and bone fractures (e.g., reduced effects on bone mineral density, trabecular bone architecture and cortical bone thickness).
  • TGDs thiazolidinediones
  • the one or more VDR agonists and one or more BRD9 antagonists are administered concurrently. In some examples, the one or more VDR agonists and one or more BRD9 antagonists are administered sequentially. In some examples, the therapeutically effective amount of the one or more VDR agonists is at least 0.01 mg/kg, such as at least 0.1 mg/kg, or at least 0.5 mg/kg. In some examples, the therapeutically effective amount of the one or more BRD9 antagonists is at least 0.1 mg/kg, such as at least 1 mg/kg, or at least 10 mg/kg. In some examples, the one or more VDR agonists, one or more BRD9 antagonists, or both, are part of a nanoparticle.
  • the VDR agonist (or composition containing such) can increase the biological activity of the VDR by at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 100%, at least 200%, at least 300%, at least 400% or at least 500%, as compared to the biological activity in the absence of the compound.
  • a compound that increases the biological activity of a VDR protein can decrease fasting blood glucose by at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 80%, or at least 90%, as compared to an absence of the agonist.
  • VDR agonist activity is determined by monitoring expression of VDR target genes such as Cyp24Al .
  • the VDR agonist (or composition containing such) can increase Cyp24Al expression by at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 100%, at least 200%, at least 300%, at least 400% or at least 500%, as compared to the biological activity in the absence of the compound. In some embodiments, the VDR agonist is not significantly degraded by Cyp24Al .
  • VDR agonists include but are not limited to: vitamin D, a vitamin D precursor, a vitamin D analog, a vitamin D receptor ligand, a vitamin D receptor agonist precursor, or combinations thereof.
  • VDR agonists include but are not limited to calcipotriol, 25-hydroxy-D 3 (25-OH-D 3 ) (calcidiol); vitamin D3 (cholecalciferol); vitamin D2 (ergocalciferol), l,a25-dihydroxyvitamin D 3 (calcitriol), and combinations thereof.
  • a BRD9 antagonist need not completely inhibit BRD9 protein activity.
  • such compounds reduce BRD9 protein activity by at least 10%, at least 20%, at least 25%, at least 40%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 99%.
  • a BRD9 antagonist binds in the pocket of BRD9 where the acetylated lysine (K-91) binds.
  • BRD9 antagonists include but are not limited to: I-BRD-9, TP742, BI-7273, BI-9564, dBRD9, GNE-375 and LP-99.
  • the one or more VDR agonists comprises calcipotriol and the one or more BRD9 antagonists comprises I-BRD9.
  • compositions that include one or more VDR agonists, and one or more
  • the one or more VDR agonists, and one or more BRD9 antagonists, or both, are part of a nanoparticle.
  • nanoparticles that can be used in the disclosed compositions and methods include, but are not limited to those provided in US
  • the nanoparticle is a lipid or polymeric nanoparticle.
  • the nanoparticle includes a linear-dendritic hybrid polymer for encapsulating biologically active materials, comprising: a ligand for a predetermined target; a dendron; and a polyethylene glycol (PEG) chain linking the ligand to the dendron.
  • the nanoparticle includes on its surface one or more of albumin (such as BSA), retinol binding protein, mannose-6-phosphase modified albumin, a fatty acid ester, a retinyl ester, and a linear-dendritic hybrid polymer.
  • albumin such as BSA
  • retinol binding protein such as BSA
  • mannose-6-phosphase modified albumin mannose-6-phosphase modified albumin
  • fatty acid ester such as a fatty acid ester
  • a retinyl ester a linear-dendritic hybrid polymer.
  • nanoparticle is between about 0.1 nm and 5000 nm in diameter, such as 1-100 nm, 0.1-1 nm, 5-20 nm, 5-15 nm, 10-5,000 nm, 20-1,000 nm, 10-500 nm, 10-200 nm, 10-150 nm, 10-100 nm, 10-25 nm, 20-40 nm, or 10, 15, 20, 25, 35, 45, 50, 75, 100, 150 or 200 nm in diameter
  • the composition includes a pharmaceutically acceptable carrier.
  • kits that include one or more VDR agonists, and one or more BRD9 antagonists, for example in the same or separate containers.
  • the one or more VDR agonists, and one or more BRD9 antagonists, or both are part of a nanoparticle.
  • the nanoparticle is or includes a lipid nanoparticle and/or a polymeric nanoparticle.
  • compositions and kits can further include at least one additional therapeutic compound, such as insulin, an alpha-glucosidase inhibitor, amylin agonist, dipeptidyl-peptidase 4 (DPP-4) inhibitor, meglitinide, sulfonylurea, or a peroxisome proliferator-activated receptor (PPAR)-gamma agonist.
  • additional therapeutic compound such as insulin, an alpha-glucosidase inhibitor, amylin agonist, dipeptidyl-peptidase 4 (DPP-4) inhibitor, meglitinide, sulfonylurea, or a peroxisome proliferator-activated receptor (PPAR)-gamma agonist.
  • PPAR-gamma agonists include a thiazolidinedione (TZD), aleglitazar, farglitazar, muraglitazar, and tesaglitazar.
  • Exemplary TZDs include pioglitazone, rosi
  • VDR agonist and BRD9 antagonists are provided.
  • One or more VDR agonists and one or more BRD9 antagonists such as 1, 2, 3, 4 or 5 different VDR agonists and 1, 2, 3, 4 or 5 different BRD9 antagonists (such as one VDR agonist and one BRD9 antagonist) can be administered in therapeutically effective amounts, for example to reduce blood glucose, reduce fed and fasting blood glucose, reduce fibrosis, increase insulin sensitivity, increase glucose tolerance, increase insulin secretion, increase beta cell function, increase the size of islets, reduce beta cell death, increase insulin granules or combinations thereof, in a mammal.
  • such methods can be used to treat a disease, for example type II diabetes, an autoimmune disease, or fibrosis (such as fibrosis of the liver, pancreas or kidney).
  • a disease for example type II diabetes, an autoimmune disease, or fibrosis (such as fibrosis of the liver, pancreas or kidney).
  • such methods are useful to treat any disease or condition where increased VDR activity is beneficial.
  • such effects are observed for at least one week after treatment, at least two weeks after treatment, at least three weeks after treatment, at least one month after treatment, at least five weeks after treatment, at least six weeks after treatment, at least seven weeks after treatment, at least eight weeks after treatment, or at least two months after treatment (such as after a single dose of a VDR agonist and a single dose of a BRD9 antagonist).
  • such effects are observed within 1 week after treatment, within 2 weeks after treatment, within 3 weeks after treatment, within 4 weeks after treatment, within 5 weeks after treatment, within 6 weeks after treatment, within 7 weeks after treatment, within 8 weeks after treatment, within 9 weeks after treatment, within 10 weeks after treatment, within 11 weeks after treatment, or within 12 weeks after treatment (such as after a single dose of a VDR agonist and a single dose of a BRD9 antagonist).
  • the one or more VDR agonists and one or more BRD9 antagonists can be administered to humans or other mammals by any means, including orally, intravenously, intramuscularly, intraperitoneally, intranasally, intradermally, intrathecally, subcutaneously, via inhalation or via suppository.
  • the one or more VDR agonists and one or more BRD9 antagonists are administered via injection. Administration can be systemic or local. In some examples, site-specific administration of the composition can be used, for example by
  • pancreas tissue for example by using a pump, or by implantation of a slow release form at the site of the pancreas.
  • the particular mode of administration and the dosage regimen can be selected by the attending clinician, taking into account the particulars of the case.
  • Treatment can involve daily or multi-daily (e.g., twice daily, 3x daily, 4x daily), or less than daily (e.g., twice weekly, every other week, monthly, every 7 days, every 10 days, every 14 days, every 30 days, every 60 days, etc.) doses over a period of a few days, few weeks, to months, or even years.
  • a therapeutically effective amount of one or more VDR agonists and one or more BRD9 antagonists can be administered in a single dose, twice daily, twice a week, three times a week, weekly, every other week, or in several doses, for example daily, or during a course of treatment.
  • treatment involves once daily dose, twice daily dose, once weekly dose, every other week dose, or monthly dose.
  • the amount of VDR agonist(s) and BRD9 antagonist(s) administered can be dependent on the subject being treated, the severity of the affliction, and the manner of administration. Within these bounds, the formulation to be administered will contain a quantity of the VDR agonist(s) and BRD9 antagonist(s) in amounts effective to achieve the desired effect in the subject being treated.
  • a therapeutically effective amount of VDR agonist(s) and BRD9 antagonist(s) can be the amount of each necessary to treat diabetes, treat fibrosis, treat an autoimmune disease, or reduce blood glucose levels (for example a reduction of at least 5%, at least 10% or at least 20%, for example relative to no administration of VDR agonist(s) and BRD9 antagonist(s)).
  • the VDR agonist(s) and BRD9 antagonist(s) are administered in combination (such as sequentially or simultaneously or contemporaneously) with one or more other agents, such as those useful in the treatment of diabetes or insulin resistance (e.g., insulin), those useful in the treatment of fibrosis (e.g., one or more nuclear receptor ligands), or those useful in the treatment of autoimmune disorders (e.g., steroid such as prednisone, immunosuppressants).
  • one or more other agents such as those useful in the treatment of diabetes or insulin resistance (e.g., insulin), those useful in the treatment of fibrosis (e.g., one or more nuclear receptor ligands), or those useful in the treatment of autoimmune disorders (e.g., steroid such as prednisone, immunosuppressants).
  • Anti-diabetic agents are generally categorized into six classes: biguanides (e.g., metformin); thiazolidinediones (including rosiglitazone (Avandia ® ), pioglitazone (Actos ® ), rivoglitazone, and troglitazone); sulfonylureas; inhibitors of carbohydrate absorption; fatty acid oxidase inhibitors and anti-lipolytic drugs; and weight-loss agents. Any of these agents can also be used in the methods or compositions disclosed herein. Exemplary anti -diabetic agents include those disclosed in Diabetes Care, 22(4):623-634. One class of anti-diabetic agents of use is the sulfonylureas.
  • Another class of anti-diabetic agents is the biguanide antihyperglycemics. Other examples are provided herein.
  • the VDR agonist(s) and BRD9 antagonist s) can be administered in combination with effective doses of anti -diabetic agents (such as biguanides, thiazolidinediones, or incretins) and/or lipid lowering compounds (such as statins or fibrates).
  • anti -diabetic agents such as biguanides, thiazolidinediones, or incretins
  • lipid lowering compounds such as statins or fibrates.
  • the terms "administration in combination,” “co-administration,” or the like, refer to both concurrent and sequential administration of the active agents.
  • Administration of the VDR agonist(s) and BRD9 antagonist(s) may also be in combination with lifestyle modifications, such as increased physical activity, low fat diet, low sugar diet, and smoking cessation.
  • Additional agents that can be used in combination with the VDR agonist(s) and BRD9 antagonist(s) include, without limitation, anti-apoptotic substances such as the Nemo-Binding Domain and compounds that induce proliferation such as cyclin dependent kinase (CDK)-6, CDK- 4 and Cyclin Dl .
  • anti-apoptotic substances such as the Nemo-Binding Domain and compounds that induce proliferation such as cyclin dependent kinase (CDK)-6, CDK- 4 and Cyclin Dl .
  • active agents can be utilized, such as antidiabetic agents for example, insulin, metformin, sulphonylureas (e.g., glibenclamide, tolbutamide, glimepiride), nateglinide, repaglinide, thiazolidinediones (e.g., rosiglitazone, pioglitazone), peroxisome proliferator-activated receptor (PPAR)-gamma-agonists (such as C 1262570) and antagonists, PPAR-gamma/alpha modulators (such as KRP 297), alpha-glucosidase inhibitors (e.g., acarbose, voglibose), Dipeptidyl peptidase (DPP)-IV inhibitors (such as LAF237, MK-431), alpha2-antagonists, agents for lowering blood sugar, cholesterol-absorption inhibitors, 3-hydroxy-3-methylglutaryl-coenzyme A
  • HMGCoA HMGCoA reductase inhibitors
  • statin insulin and insulin analogues
  • GLP-1 and GLP- 1 analogues e.g., exendin-4
  • amylin e.g., amylin.
  • the agent is an immunomodulatory factor such as anti-CD3 mAb, growth factors such as HGF, vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), lactogens, or parathyroid hormone-related protein (PTHrP).
  • HGF vascular endothelial growth factor
  • PDGF platelet-derived growth factor
  • PTHrP parathyroid hormone-related protein
  • methods are provided for treating diabetes or pre-diabetes in a subject by administering a therapeutically effective amount of a composition including the VDR agonist(s) and BRD9 antagonist(s), to the subject.
  • the subject can have T2D.
  • the subject can be any mammalian subject, including human subjects and veterinary subjects such as cats and dogs.
  • the subject can be a child or an adult.
  • the subject can also be administered insulin.
  • the method can include measuring blood glucose levels.
  • the method includes selecting a subject with diabetes, such as T2D, or a subject at risk for diabetes, such as a subject with pre-diabetes. These subjects can be selected for treatment with the VDR agonist(s) and BRD9 antagonist(s).
  • a subject with diabetes may be clinically diagnosed by a fasting plasma glucose (FPG) concentration of greater than or equal to 7.0 millimole per liter (mmol/L) (126 milligram per deciliter (mg/dL)), or a plasma glucose concentration of greater than or equal to 11.1 mmol/L (200 mg/dL) at about two hours after an oral glucose tolerance test (OGTT) with a 75 gram (g) load, or in a patient with classic symptoms of hyperglycemia or hyperglycemic crisis, a random plasma glucose concentration of greater than or equal to 11.1 mmol/L (200 mg/dL), or HbAlc levels of greater than or equal to 6.5%.
  • FPG fasting plasma glucose
  • a subject with pre-diabetes may be diagnosed by impaired glucose tolerance (IGT).
  • IGT impaired glucose tolerance
  • An OGTT two-hour plasma glucose of greater than or equal to 140 mg/dL and less than 200 mg/dL (7.8-11.0 mM), or a fasting plasma glucose (FPG) concentration of greater than or equal to 100 mg/dL and less than 125 mg/dL (5.6-6.9 mmol/L), or HbAlc levels of greater than or equal to 5.7% and less than 6.4%> (5.7-6.4%) is considered to be IGT, and indicates that a subject has pre-diabetes. Additional information can be found in Standards of Medical Care in Diabetes— 2010 (American Diabetes Association, Diabetes Care 33 : S 11-61, 2010).
  • the subject treated with the VDR agonist(s) and BRD9 antagonist(s) has HbAlC of greater than 6.5% or greater than 7%.
  • treating diabetes includes one or more of increasing glucose tolerance (such as an increase of at least 5%, at least 10%, at least 20%, or at least 50%, for example relative to no administration of the VDR agonist(s) and BRD9 antagonist(s), decreasing insulin resistance (for example, decreasing plasma glucose levels, decreasing plasma insulin levels, or a combination thereof, such as decreases of at least 5%, at least 10%, at least 20%, or at least 50%), for example relative to no administration of the VDR agonist(s) and BRD9 antagonist(s)), decreasing serum triglycerides (such as a decrease of at least 10%, at least 20%, or at least 50%, for example relative to no administration of the VDR agonist(s) and BRD9 antagonist(s), decreasing free fatty acid levels (such as a decrease of at least 5%, at least 10%, at least 20%, or at least 50%, for example relative to no administration of the VDR agonist(s) and BRD9 antagonist s)), and decreasing HbAlc levels in the subject
  • administering treats T2D or pre-diabetes, by decreasing of HbAlC, such as a reduction of at least 0.5%, at least 1%, or at least 1.5%, such as a decrease of 0.5% to 0.8%, 0.5% to 1%, 1 to 1.5% or 0.5% to 2%.
  • the target for HbAlC is less than about 6.5%, such as about 4-6%, 4-6.4%, or 4-6.2%.
  • target levels are achieved within about 26 weeks, within about 40 weeks, or within about 52 weeks.
  • Methods of measuring HbAlC are routine, and the disclosure is not limited to particular methods. Exemplary methods include HPLC, immunoassays, and boronate affinity chromatography.
  • administration of the VDR agonist(s) and BRD9 antagonist(s) treats diabetes or pre-diabetes by increasing glucose tolerance, for example, by decreasing blood glucose levels (such as two-hour plasma glucose in an OGTT or FPG) in a subject.
  • the method includes decreasing blood glucose by at least 5% (such as at least 10%, at least 15%, at least 20%), at least 25%, at least 30%, at least 35%, or more) as compared with a control (such as no administration of any of insulin, VDR agonist(s), or BRD9 antagonist(s).
  • a decrease in blood glucose level is determined relative to the starting blood glucose level of the subject (for example, prior to treatment with the VDR agonist(s) and BRD9 antagonist(s).
  • decreasing blood glucose levels of a subject includes reduction of blood glucose from a starting point (for example greater than about 126 mg/dL FPG or greater than about 200 mg/dL OGTT two-hour plasma glucose) to a target level (for example, FPG of less than 126 mg/dL or OGTT two-hour plasma glucose of less than 200 mg/dL).
  • a target FPG may be less than 100 mg/dL.
  • a target OGTT two-hour plasma glucose may be less than 140 mg/dL.
  • the disclosed methods include comparing one or more indicators of diabetes (such as glucose tolerance, triglyceride levels, free fatty acid levels, or HbAlc levels) to a control (such as no administration of insulin, VDR agonist(s) or BRD9 antagonist(s)), wherein an increase or decrease in the particular indicator relative to the control (as discussed above) indicates effective treatment of diabetes.
  • the control can be any suitable control against which to compare the indicator of diabetes in a subject.
  • the control is a sample obtained from a healthy subject (such as a subject without diabetes).
  • control is a historical control or standard reference value or range of values (such as a previously tested control sample, such as a group of subjects with diabetes, or group of samples from subjects that do not have diabetes).
  • control is a reference value, such as a standard value obtained from a population of normal individuals that is used by those of skill in the art. Similar to a control population, the value of the sample from the subject can be compared to the mean reference value or to a range of reference values (such as the high and low values in the reference group or the 95% confidence interval).
  • the control is the subject (or group of subjects) treated with placebo compared to the same subject (or group of subjects) treated with the therapeutic compound in a cross-over study. In further examples, the control is the subject (or group of subjects) prior to treatment.
  • the disclosed methods can be used to reduce fibrosis (for example by decreasing the fibrotic content of a fibrotic liver, kidney or pancreas).
  • the method reduces fibrosis (for example by decreasing the fibrotic content of a fibrotic liver, kidney or pancreas) by at least 10%, at least 20%, at least 25%, at least 40%, at least 50%, at least 75%, at least 80%), at least 90%, or at least 95%, as compared to an absence of the treatment with the VDR agonist(s) and BRD9 antagonist(s).
  • the disclosed methods are prophylactic.
  • the method can include administering a subject at risk for developing fibrosis a therapeutic composition that includes a VDR agonist(s) and a BRD9 antagonist(s).
  • a therapeutic composition that includes a VDR agonist(s) and a BRD9 antagonist(s) can delay the onset of the symptoms of fibrosis of the liver, kidney or pancreas.
  • prophylactic administration of a composition that includes a VDR agonist(s) and BRD9 antagonist(s) can be used to prevent the onset of one or more symptoms or features of fibrosis. For example, as an organ undergoes fibrosis, the functional cellular mass of the organ is reduced as it is replaced by scar tissue (collagens and other abnormal matrix components).
  • fibrosis causes architectural disorganization that can diminish function and lead to pathology, such as portal hypertension and increased risk of hepatocellular carcinoma in the case of the liver. Severe portal hypertension usually manifests as bleeding esophageal/gastric varices and/or ascities. In the kidney and pancreas the features of advanced fibrosis are renal failure and endocrine and/or exocrine pancreatic failure.
  • the VDR agonist(s) and BRD9 antagonist(s) can be used for treatment of fibrosis in combination with other therapeutic agents, such as chemotherapies and biotherapies.
  • the other therapeutic agents include one or more nuclear receptor ligands, including but not limited to ligands for peroxisome proliferator-activated receptor-gamma (PPAR- ⁇ , R1C3), peroxisome proliferator-activated receptor-alpha (PPAR-a, R1C1) and peroxisome proliferator- activated receptor-delta (PPAR- ⁇ , R1C2), farnesoid X receptor (FXR, NR1H4), interferon- gamma (IFN- ⁇ ), angiotensin converting enzyme inhibitors, angiotensin II receptor antagonists, ursodeoxycholic acid (UDCA), curcumin, anti-oxidants including, but not limited to vitamin E, retinoids such as Vitamin A, and therapies that deliver proteases to the liver to degrade pathological ECM.
  • other therapeutic agents are part of a composition provided herein.
  • VDR agonists such as a VDR ligand
  • VDR agonists include but are not limited to la,25(OH)2-D3 and precursors and analogs thereof, VDR ligands, and VDR agonist precursors.
  • the disclosure is not limited to particular vitamin D agonists. A variety of biologically active vitamin D agonists are contemplated.
  • la,25(OH)2D 3 or a vitamin D precursor or analog is used as a VDR agonist. It is not necessary to use the most biologically active form of vitamin D to achieve a beneficial therapeutic effect.
  • the naturally occurring ligand of the vitamin D receptor is calcitriol.
  • precursors of calcitriol are administered to a subject, and are then converted within the target cell population to calcitriol.
  • hepatic stellate cells express CYP24A1, a cytochrome P450 enzyme that terminates the biological effect of calcitriol by side chain hydroxylation.
  • CYP24A1 a cytochrome P450 enzyme that terminates the biological effect of calcitriol by side chain hydroxylation.
  • a VDR ligand or other VDR agonist or agonist precursor that is resistant to deactivation by CYP24A1 is used to achieve more effective and longer lasting VDR activation in target cell populations.
  • the VDR ligand is one that can be activated by
  • CYP27B 1 while being resistant to deactivation by CYP24A1.
  • VDR agonists include those molecules that activate the VDR.
  • Methods of determining if an agent is a VDR agonist are routine. For example, induction of CYP24A1 expression can be measured in cells that express VDR after contact with the agent, wherein an increase in CYP24A1 expression (such as a 10- to 20-fold increase in expression) indicates that the agent is a VDR agonist.
  • Other methods include transfected reporter gene constructs and FRET assays.
  • binding of an agonist to a purified LBD is detected by measuring induced recruitment for coactivator peptides (e.g., LXXLL).
  • VDR agonists can increase CYP24A1 expression in a VDR-expressing cell by at least 20%, at least 50%, at least 75%, at least 80%, at least 90% at least 100%, at least 200% or even at least 1000% or more as compared to the absence of the agonist.
  • VDR agonists include vitamin D compounds, precursors and analogs thereof.
  • Vitamin D compounds include, but are not limited to compounds which have at least one of the following features: the C-ring, D-ring and 3P-hydroxycyclohexane A-ring of vitamin D interconnected by the 5,7 diene double bond system of vitamin D together with any side chain attached to the D-ring (e.g., compounds with a ' vitamin D nucleus ' and substituted or unsubstituted A-, C-, and D-rings interconnected by a 5,7 diene double bond system typical of vitamin D together with a side chain attached to the D-ring).
  • Vitamin D analogs include those non-secosteroid compounds capable of mimicking various activities of the secosteroid calcitriol. Examples of such compounds include, but are not limited to, LG190090, LG190119, LG190155, LG190176, and LG1900178 (See, Boehm et al, Chemistry & Biology 6:265-275, 1999).
  • Vitamin D compounds include those vitamin D compounds and vitamin D analogs which are biologically active in vivo, or are acted upon in a mammalian subject such that the compound becomes active in vivo.
  • examples of such compounds include, but are not limited to: vitamin D, calcitriol, and analogs thereof [e.g., la-hydroxyvitamin D 3 (la-OH-D 3 ), 1,25-dihydroxyvitamin D 2 (l,25-(OH) 2 D 2 ), la-hydroxyvitamin D 2 (la-OH-D 2 ), la,25-(OH) 2 -16-ene-D 3 , la,25-(OH) 2 -24- oxo-16-ene-D 3 , la,24R(OH) 2 -D 3 , la,25(OH) 2 -22 -oxa-D 3 , 20-epi-22-oxa-24a,24b,-dihomo- la,25(OH) 2 -D 3; 20 -epi-22-oxa
  • the VDR agonist is one or more of the following vitamin D, 1, ⁇ 25 dihydroxyvitamin D 3 , calcipotriol, la-hydroxyvitamin D 3 , 1,25-dihydroxyvitamin D 2 , la- hydroxyvitamin D 2 , la,25-(OH) 2 -16-ene-D 3 , la,25-(OH) 2 -24-oxo-16-ene-D 3 , la,24R(OH) 2 -D 3 , la,25(OH) 2 -22 -oxa-D 3 , 20-epi-22-oxa-24a,24b,-dihomo-la,25(OH) 2 -D 3 , 20-epi-22-oxa- 24a,26a,27a,-trihomo-la25(OH) 2 -D 3 , 20-epi-22-oxa-24homo-la,25(OH) 2 -D 3 , and l,25-(OH) 2 - 16,23E
  • the biologically active vitamin D compound is selected from 1, ⁇ 25- dihydroxyvitamin D 3 , 19-nor-l,25-dihydroxyvitamin D 2 , 19-nor-l,25-dihydroxy-21-epi-vitamin D 3 , 1, 25-dihydroxy-24-homo-22-dehydro-22E- vitamin D 3 , and 19-nor-l,25-dihydroxy-24-homo- 22-dehydro-22E-vitamin D 3 , and non-secosteroidal vitamin D mimics.
  • the biologically active VDR agonist is selected from the analogs represented by the following formula:
  • X 1 and X 2 are each selected from the group consisting of hydrogen and acyl; wherein Y 1 and Y 2 can be H, or one can be O-aiyl or O-alkyl while the other is hydrogen and can have a ⁇ or a configuration, Z 1 and Z 2 are both H, or Z 1 and Z 2 taken together are CH 2 ; and wherein R is an alkyl, hydroxyalkyl or fluoroalkyl group, or R may represent the following side chain:
  • (a) may have an S or R configuration and wherein R 1 represents hydrogen, hydroxy or O- acyl, R 2 and R 3 are each selected from the group consisting of alkyl, hydroxyalkyl and fluoroalkyl, or, when taken together represent the group ⁇ (CH 2 )m ⁇ where (m) is an integer having a value of from 2 to 5, R 4 is selected from the group consisting of hydrogen, hydroxy, fluorine, O-acyl, alkyl, hydroxyalkyl and fluoroalkyl, R 5 is selected from the group consisting of hydrogen, hydroxy, fluorine, alkyl, hydroxyalkyl and fluoroalkyl, or, R 4 and R 5 taken together represent double-bonded oxygen, R 6 and R 7 taken together form a carbon-carbon double bond and R 8 may be H or C3 ⁇ 4, and wherein (n) is an integer having a value of from 1 to 5, and wherein the carbon at any one of positions 20, 22, or 23 in the side chain may be replaced by an O, S
  • the VDR agonists do not cause symptoms of hypercalcemia when administered to a subject. In another example, the VDR agonists do not generate as much (i.e., a lesser degree) of a calcemic response as compared to calcitriol when administered to a subject. In one example, VDR agonists have low calcemic response characteristics as compared to calcitriol.
  • these compounds are selected from la,25-(OH) 2 -24-epi-D 2 , la,25-(OH) 2 - 24a-Homo-D 3 , 1 ⁇ ,25-( ⁇ ) 2 24a-Dihomo-D 3 , 1 ⁇ ,25-( ⁇ ) 2 -19-nor-D 3 , and 20-epi-24-homo-la,25- (OH) 2 -D 3 .
  • VDR agonists that can be used are provided in Table 1.
  • vitamin D2 and D3 range, from about 50 IU to about 50,000 IU.
  • vitamin D2 and/or D3 is administered in an oral dose of, for example, less than about 75 IU, about 100 IU, about 250 IU, about 500 IU, about 750 IU, about 1,000 IU, about 1,500 IU, about 2,000 IU, about 2,500 IU, about 5,000 IU, about 7,500 IU, about 10,000 IU, about 15,000 IU, about 20,000 IU, about 25,000 IU, about 40,000 IU, or about 50,000 IU, or more.
  • calcitriol is administered in a dose of from 0.001 to 10 micrograms.
  • calcitrol is administered, in some embodiments, in a dose of about 0.01 ⁇ g, about 0.05 ⁇ g, about 0.1 ⁇ g, about 0.25 ⁇ g, about 0.5 ⁇ g, about 1 ⁇ g, about 5 ⁇ g, or about 10
  • the VDR agonist is cholecalciferol or calcidiol.
  • a higher dose than usual is administered, but with less frequency, for example, 50,000 to 500,000 units weekly.
  • a daily dose between 1.0 and 100 ⁇ g per day per 160 pound patient is administered, such as between 5.0 and 50 ⁇ g per day per 160 pound patient.
  • a daily dose of between 0.1 and 20 ⁇ g per day per 160 pound patient is administered, while a preferred dose is between 0.5 and 10 ⁇ per day per 160 pound patient. In a particular example, the dose is between 3-10 ⁇ g per day.
  • the disclosed methods and compositions use or include one or more BRD9 antagonists.
  • the BRD9 antagonist is specific for BRD9.
  • BRD9 antagonists include but are not limited to I-BRD9, TP742, BI-7273, BI-9564, dBRD9, G E-375 and LP-99, as well as BRD9 antagonists provided in Remillard et al., Angew. Chem. Int. Ed. 56: 1-7, 2017 and Theodoulou et al., J. Med. Chem. 99: 1425-39, 2016 (all herein incorporated by reference).
  • BRD9 antagonists are contemplated.
  • a variety of biologically active BRD9 antagonists are contemplated.
  • Methods of determining if an agent is a BRD9 antagonist are known. For example, the TR- FRET methods described in Theodoulou et al., J. Med. Chem. 99: 1425-39, 2016 can be used. Briefly, compounds can be incubated with Alexa Fluor647 ligand (GSK2833930A) in Greiner 384- well black low volume microtitre plates and incubated in the dark for 30 min at room temperature. Detection reagents can include Eu-W1024 Anti-6xHis antibody. The plates can be read to determine donor and acceptor counts.
  • BRD9 antagonists can decrease BRD9 activity by at least 20%, at least 50%, at least 75%, at least 80%), at least 90% at least 100%, at least 200%> or even at least 1000%) or more as compared to the absence of the antagonist.
  • compositions that include one or more VDR agonists, and one or more BRD9 antagonists, are provided.
  • the one or more VDR agonists, and one or more BRD9 antagonists, or both, are part of a nanoparticle.
  • Such compositions can be formulated with an appropriate pharmaceutically acceptable carrier, depending upon the particular mode of administration chosen.
  • the pharmaceutical compositions can include a therapeutically effective amount of another agent.
  • Other active agents can be utilized, such as antidiabetic agents for example one or more of: insulin, metformin, meglitinide, sulphonylureas (e.g., glibenclamide, tolbutamide, glimepiride), nateglinide, repaglinide, thiazolidinediones (e.g., rosiglitazone, pioglitazone), an alpha-glucosidase inhibitor, a amylin agonist, peroxisome proliferator-activated receptor (PPAR)-gamma-agonists (such as C1262570, aleglitazar, farglitazar, muraglitazar, tesaglitazar, and TZD) and PPAR- ⁇ antagonists, PPAR-gamma/alpha modulators (such as KRP 297)
  • PPAR-gamma/alpha modulators such as
  • parenteral formulations usually include injectable fluids that are
  • non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
  • pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, pH buffering agents, or the like, for example sodium acetate or sorbitan monolaurate.
  • Excipients that can be included are, for instance, proteins, such as human serum albumin or plasma preparations.
  • Preparations for parenteral administration can include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti -oxidants, chelating agents, and inert gases and the like.
  • Formulations for topical administration can include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Therapeutic agents for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be included.
  • Therapeutic agents including the VDR agonist(s) and BRD9 antagonist s) composition, can be administered as a pharmaceutically acceptable acid- or base-addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
  • the composition including one or more VDR agonists, and one or more BRD9 antagonists is included in a controlled release formulation, for example, a
  • microencapsulated formulation Various types of biodegradable and biocompatible polymers, methods can be used (see, for example, U.S. Patent Publication Nos. 2007/0148074;
  • a composition including one or more VDR agonists, and one or more BRD9 antagonists is included in a nanodispersion system.
  • Nanodispersion systems and methods for producing such nanodispersions are known See, e.g., U.S. Pat. No. 6,780,324; U.S. Pat.
  • a nanodispersion system includes a biologically active agent and a dispersing agent (such as a polymer, copolymer, or low molecular weight surfactant).
  • a dispersing agent such as a polymer, copolymer, or low molecular weight surfactant.
  • exemplary polymers or copolymers include polyvinylpyrrolidone (PVP), poly(D,L- lactic acid) (PLA), poly(D,L-lactic-co-glycolic acid (PLGA), poly(ethylene glycol).
  • Exemplary low molecular weight surfactants include sodium dodecyl sulfate, hexadecyl pyridinium chloride, polysorbates, sorbitans, poly(oxyethylene) alkyl ethers, poly(oxyethylene) alkyl esters, and combinations thereof.
  • the nanodispersion system includes PVP and ODP or a variant thereof (such as 80/20 w/w).
  • the nanodispersion is prepared using the solvent evaporation method, see for example, Kanaze et al, Drug Dev. Indus. Pharm. 36:292-301, 2010; Kanaze et al, J. Appl. Polymer Sci. 102:460-471, 2006.
  • release delivery systems for the composition including one or more VDR agonists, and one or more BRD9 antagonists can be used.
  • examples include polymer based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides.
  • Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent No. 5,075,109.
  • Delivery systems also include non-polymer systems, such as lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like.
  • lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides
  • hydrogel release systems such as silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like.
  • Specific examples include, but are not limited to: (a) erosional systems in which the composition is contained in a form within a matrix such as those described in U.S. Patent Nos.
  • Long-term sustained release implant may be particularly suitable for treatment of chronic conditions, such as type II diabetes and autoimmune disorders.
  • Long-term release as used herein, means that the implant is constructed and arranged to deliver therapeutic levels of the active ingredient for at least 30 days, such as at least 60 days.
  • Long-term sustained release implants include some of the release systems described above (see U.S. Patent No. 6,218,371).
  • the dosage form of the pharmaceutical composition can be determined by the mode of administration chosen.
  • Topical preparations can include eye drops, ointments, sprays, patches, and the like.
  • Inhalation preparations can be liquid (e.g., solutions or suspensions) and include mists, sprays and the like.
  • Oral formulations can be liquid (e.g., syrups, solutions or suspensions), or solid (e.g., powders, pills, tablets, or capsules).
  • Suppository preparations can also be solid, gel, or in a suspension form.
  • conventional non-toxic solid carriers can include pharmaceutical grades of mannitol, lactose, cellulose, starch, or magnesium stearate. Methods of preparing such dosage forms are known.
  • compositions that include one or more VDR agonists, and one or more
  • BRD9 antagonists can be formulated in unit dosage form, suitable for individual administration of precise dosages.
  • a unit dosage contains from about 1 mg to about 1 g of one or more VDR agonists, such as about 10 mg to about 100 mg, about 50 mg to about 500 mg, about 100 mg to about 900 mg, about 250 mg to about 750 mg, or about 400 mg to about 600 mg.
  • a therapeutically effective amount of one or more VDR agonists protein is about 0.01 mg/kg to about 50 mg/kg, for example, about 0.05 mg/kg to about 10 mg/kg, about 0.05 mg/kg to about 0.1 mg/kg, about 0.01 mg/kg to about 0.1 mg/kg, or about 1 mg/kg to about 10 mg/kg.
  • a unit dosage contains from about 1 mg to about 5 g of one or more BRD9 antagonists, such as about 10 mg to about 100 mg, about 50 mg to about 500 mg, about 100 mg to about 1000 mg, about 250 mg to about 750 mg, or about 400 mg to about 800 mg.
  • a therapeutically effective amount of one or more BRD9 antagonists protein is about 0.01 mg/kg to about 50 mg/kg, for example, about 0.5 mg/kg to about 25 mg/kg, about 0.5 mg/kg to about 15 mg/kg, about 1 mg/kg to about 20 mg/kg, or about 1 mg/kg to about 10 mg/kg.
  • the disclosure is illustrated by the following non-limiting Examples.
  • hiPSCs derived from HUVECs and including GFP under the control of the human insulin promoter, INS-GFP
  • hiPSCs were cultured to 90% confluency in complete mTeSR Media, at which time the media was changed to 100 ng/ml Activin (R&D Systems, 338- AC), 25 ng/ml Wnt3a (R&D Systems, 5036-WN) in differentiation media (800 ml DMEM/F12, 13.28 g BSA, 10 ml Glutamax, 560 mg NaHC03, 330 mg thiamine, 100 mg reduced glutathione, 3300 mg vitamin C, 14 ⁇ g selenium, 10 ml NEAA, 2 ml trace element B, 1 ml trace element C, 7 ⁇ ⁇ - ⁇ , 2 ml DLC, 2 ml GAB A, 2 ml LiCl, 129.7 ⁇ g
  • media was replaced with differentiation media with 1 ⁇ dorsomorphin (Biovision, 1656-5), 2 ⁇ retinoic acid (Sigma, R2625-1G), 10 ⁇ SB431542 (Sigma, S4317-5MG), and 1% B27 supplement (GfflCO, 17504- 044) for 7 days.
  • Doxycycline was added for 1 week. Finally, the cells were FACS-sorted by GFP expression and both GFP+ and GFP- cells from the same batch were collected, genomic DNA extracted and libraries were prepared for high throughput sequencing.
  • the sgRNA sequences were amplified with primers described in Wang et al. (Science 343, 80-84, 2014) and sequenced by an Illumina HiSeq 2000. The sequences were aligned and analyzed by MAGeCK (Li et al., 2014, Genome biology 15, 554).
  • mice strains were from Jackson: VDR KO (B6.129S4-VdrtmlMbd/J), B6 db
  • Db/db mice were grouped based on glucose levels at the age of 5 weeks. Treatments were started from 6 weeks and animals were treated with vehicle (30% 2-Hydroxypropyl- Cyclodextrin, Sigma, H-107) or drugs 3 times a week. Calcipotriol (Tocris, 60 ug/kg) and iBRD9 (R&D, 10 mg/kg) were dissolved in 30% ⁇ -cyclodextran and injected intraperitoneally 3 times a week. For db/db (BKS) mice, treatment started from age of 10 weeks. Calcipotriol (Tocris, 30ug/kg) and iBRD9 (R&D, 5 mg/kg) were dissolved in 30% ⁇ -cyclodextran and injected intraperitoneally 3 times a week.
  • Sequencing libraries were prepared from 100-500 ng total RNA using the TruSeq RNA Sample Preparation Kit v2 (Illumina) according to the manufacturer's protocol. Briefly, mRNA was purified, fragmented, and used for first-, then second-strand cDNA synthesis followed by adenylation of 3' ends. Samples were ligated to unique adapters and subjected to PCR
  • RNA- Seq libraries prepared from two biological replicates for each experimental condition were sequenced on the Illumina Hi Seq 2000 using bar-coded multiplexing and a lOObp read length. High-throughput sequencing and analysis
  • rNfkbia RP CCATTACAGGGCTCCTGAG (SEQ ID NO: 2)
  • rRela FP TGTGAAGAAGCGAGACCTG (SEQ ID NO: 3)
  • rRela RP TCCTCTATGGGAACTTGAAAGG (SEQ ID NO: 4)
  • rRelb FP ATCGAGCTTCGAGACTGTG (SEQ ID NO: 5)
  • rRelb RP AGTTGTTAAAGCTGTGCCG (SEQ ID NO: 6)
  • rNfkbl FP GGGAGATGTGAAGATGCTG (SEQ ID NO: 7)
  • rNfkbl RP AAGTGTAGGACACTGTCCC (SEQ ID NO: 8)
  • mCyp24Al FP TGCCCTATTTAAAGGCCTGTCT (SEQ ID NO: 9)
  • mCyp24Al RP CGAGTTGTGAATGGCACACTT (SEQ ID NO: 10)
  • mFbpl FP ACGGATATCAGCACCCTGAC (SEQ ID NO: 11)
  • mFbpl RP ATTGGTTGAGCCAGCGATAC (SEQ ID NO: 12)
  • mG6Pase FP GACTGTGGGCATCAATCTCC (SEQ ID NO: 13)
  • mG6Pase RP ACAGGTGACAGGGAACTGCT (SEQ ID NO: 14)
  • mPEPCK FP TCTCTGATCCAGACCTTCCAA (SEQ ID NO: 15)
  • mPEPCK RP GAAGTCCAGACCGTTATGCAG (SEQ ID NO: 16)
  • mIns2 FP TTTGTCAAGCAGCACCTTTG (SEQ ID NO: 17)
  • mlns2 RP TCT AC AATGCC ACGCTTCTG (SEQ ID NO : 18)
  • mCaspl FP GAGAAATGAAGTTGCTGCTG (SEQ ID NO: 19)
  • mCaspl RP CTTTCACCATCTCCAGAGC (SEQ ID NO: 20)
  • mCcl2 FP CAACTCTCACTGAAGCCAG (SEQ ID NO: 21)
  • mCcl2 RP TTAACTGCATCTGGCTGAG (SEQ ID NO: 22)
  • mCxcll FP CAGAGCTTGAAGGTGTTGC (SEQ ID NO: 23)
  • mCxcll RP AGTGTGGCTATGACTTCGG (SEQ ID NO: 24)
  • mlllb FP GAAATGCCACCTTTTGACAGTG (SEQ ID NO: 25)
  • mil lb RP TGGATGCTCTCATCAGGACAG (SEQ ID NO: 26)
  • mI16 FP TAGTCCTTCCTACCCCAATTTCC (SEQ ID NO: 27)
  • mI16 RP TTGGTCCTTAGCCACTCCTTC (SEQ ID NO: 28)
  • mNlrp3 FP ATCTTTGCTGCGATCAACAG (SEQ ID NO: 29)
  • mNlrp3 RP TGATGTACACGTGTCATTCCA (SEQ ID NO: 30)
  • msXBPl FP GAGTCCGCAGCAGGTG (SEQ ID NO: 31)
  • msXBPl RP GTGTCAGAGAGTCCATGGGA (SEQ ID NO: 32)
  • mUcn3 FP AAGTCCACTTACAGGGAGC (SEQ ID NO: 33)
  • mUcn3 RP TAGAACTTGTGGGAGAGGC (SEQ ID NO: 34)
  • mPDXl FP AAATCCACCAAAGCTCACG (SEQ ID NO: 35)
  • mPDXl RP ATTCCTTCTCCAGCTCCAG (SEQ ID NO: 36)
  • mNkx6- 1 FP GTACTTGGC AGGACC AGAG (SEQ ID NO : 37)
  • mNkx6-l RP TTCTGGAACCAGACCTTGAC (SEQ ID NO: 38)
  • C0 2 production, O2 consumption, RER, and ambulatory counts by x-peak were determined for 3 consecutive days and nights, with at least 24 hr adaptation before data recording.
  • FFPE tissues sections were deparaffinized and antigen retrieval performed using Vector Antigen Unmasking buffer (H3301).
  • VectaStain ABC kit and ImmPACT DAB substrate (Vector Lab) were used to develop signal.
  • DAPI-containing mounting media (VECTASHIELD mounting medium for fluorescence) was used for nuclear staining. Immunostaining was visualized by ZEISS 780 confocal microscopy analysis.
  • Immunoprecipitations were performed as described previously (He et al., 2010, Mol. Cell 38, 428-38). Briefly, cells are lysed using ice-cold lysis buffer (HEPES 20mM pH8, EDTA 0.2mM, NaCl 0.3 mM, NP40 0.5%, 15% glycerol) for 15 min, and after centrifuging the supernatant was collected. For HA- or Flag-tagged proteins, immunoprecipitations were performed using HA-magnetic beads (Pierce, PI88836), or Flag-magnetic beads (Sigma, M8823) for 1.5 hr at 4°C.
  • Samples were precipitated by methanol/chloroform. Dried pellets were dissolved in 8 M urea/100 mM TEAB, pH 8.5. Proteins were reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Sigma-Aldrich) and alkylated with 10 mM chloroacetamide (Sigma- Aldrich). Proteins were digested overnight at 37°C in 2 M urea/100 mM TEAB, pH 8.5, with trypsin (Promega). Digestion was quenched with formic acid, 5 % final concentration.
  • TCEP tris(2-carboxyethyl)phosphine hydrochloride
  • the digested samples were analyzed on a Fusion Orbitrap tribrid mass spectrometer
  • Thermo Thermo The digest was injected directly onto a 30cm, 75um ID column packed with BEH 1.7um C18 resin (Waters). Samples were separated at a flow rate of 200nl/min on a nLC 1000 (Thermo). Buffers A and B were 0.1% formic acid in water and acetonitrile, respectively. A gradient of 1- 30%B over 90min, an increase to 40%B over 30min, an increase to 90%B over another lOmin and held at 90%B for a final lOmin of washing was used for 140min total run time. Column was re- equilibrated with 20ul of buffer A prior to the injection of sample.
  • Protein and peptide identification were done with Integrated Proteomics Pipeline - IP2 (Integrated Proteomics Applications). Tandem mass spectra were extracted from raw files using RawConverter (refl) and searched with ProLuCID (ref2) against rat UniProt database. The search space included all fully-tryptic and half-tryptic peptide candidates. Carbamidomethylation on cysteine was considered as a static modification. Acetylation (42.010565) was considered as a differential modification on Lysine and the N-terminus. Data was searched with 50 ppm precursor ion tolerance and 600 ppm fragment ion tolerance. Data was filtered to 10 ppm precursor ion tolerance post search. Identified proteins were filtered using DTASelect (ref3) and utilizing a target-decoy database search strategy to control the false discovery rate to 1% at the protein level. siRNA knock-down assay
  • INS1 cells were cultured at 37°C in 5% C0 2 in air in RPMI-1640 (Sigma Aldrich) supplemented with 10% (v/v) fetal bovine serum, 1% (v/v) Antibiotic-Antimycotic (Gibco) 10 mM HEPES, 2 mM glutamax, 1 mM sodium pyruvate, and 50 ⁇ ⁇ -mercaptoethanol (RPMI for INS1 medium).
  • INS1 cells were transfected with Lipofectamine RNAiMAX (Invitrogen) for 24 hr, and cytokines were added for 24 hr or 1 hour.
  • siRNAs were from GE Healthcare (VDR: L-097753-02- 0005, PCAF: L-085879-02-0005, BAF180: L-088113-02-0005, non-targeting pool: D-001810-10- 05).
  • Intraperitoneal Glucose or Insulin Tolerance Tests (TT) were from GE Healthcare (VDR: L-097753-02- 0005, PCAF: L-085879-02-0005, BAF180: L-088113-02-0005, non-targeting pool: D-001810-10- 05).
  • Intraperitoneal GTTs were performed on overnight fasted mice. Blood glucose values were assessed before and at 0, 15, 30, 60, and 120 min after i.p. administration of 0.5 g/kg of glucose. Serum insulin levels were assessed before and at 0, 15, and 60 min after the i.p. administration of glucose using a rat/mouse Insulin ELISA kit (Millipore). ⁇ - ⁇ assays were performed on mice after a 6 hr fast with an injection of 2 U/kg of insulin (Humalin R, Eli Lilly). shRNA knockdown
  • Lentiviral shRNAs were produced in 293T cells and polybrene (6 ⁇ g/ml) was used in transduction. Puromycin selection was performed for 1 week at lug/ml.
  • Annexin V staining was performed per manufacturers' instructions (Ebioscience, 88-8008-
  • Antibodies used were: BRD9 (Bethyl A303-781A), VDR (Santa Cruz, scl008, sc-13133), FLAG (Sigma F3165), HA (Roche, 11867423001), Lysine acetylation (Cell Signaling 9441s), GST (Santa Cruz sc-4033), PCAF (Cell Signaling 3378s), SMARCCl/2 (Cell Signaling, 11956), BRG1 (Cell Signaling 3508), PBRMl (Bethyl, A301-591A), PHF10 (Genetex, GTX116314), ARIDIB (Bethyl, A301-040A), HDAC3 (Cell Signaling 2632), KAT7 (Bethyl, A302-224A), NCOA5 (Bethyl A300-790A), THRAP3 (Bethyl A300-955A), 1KB a (Cell Signaling 4814), p65 (Cell Signaling 8242), I
  • H3K4Mel (Abeam, ab8895), H3K27Ac (Abeam, ab4729), H3K4Me3 (Abeam ab8580), KX6-1 (Cell Signaling, 54551), Glucagon (Abeam, ab82270).
  • ELISA ELISA were performed per manufacturer's instructions: mouse insulin (Millipore, EZRMI-
  • mouse proinsulin (Mercodia, NC9088881).
  • INS1 cells were treated with Cal (100 nM), iBRD9 (lOuM) and/or ⁇ .1 ⁇ prior to harvest for ChIP assays.
  • Cal 100 nM
  • iBRD9 1 nM
  • ⁇ .1 ⁇ prior to harvest for ChIP assays.
  • the experimental procedure for ChIP was as previously described (Barish et al.,
  • Peaks were identified by searching for clusters of tags within a sliding 200 bp window, requiring adjacent clusters to be at least 1 kb away from each other.
  • the threshold for the number of tags that determine a valid peak was selected for an FDR ⁇ 0.001, as empirically determined by repeating the peak finding procedure using randomized tag positions. Peaks are required to have at least 4-fold more tags (normalized to total count) than input or immunoglobulin G control samples and 4-fold more tags relative to the local background region (10 kb) to avoid identifying regions with genomic duplications or nonlocalized binding.
  • INS1 cells were pretreated with vehicle, Cal, iBRD9, or iBRD9 16 hrs before ILi were added for 1 hr and 5xl0 4 cells were harvested to prepare ATAC-seq libraries. Reads were aligned by Bowtie to rn4 and peaks were called by Homer using default settings. Differential peaks were called by Homer using default settings (Fold change >4, p value ⁇ 0.0001).
  • Islets in suspension were pelleted in 2% low melting point agarose and subsequently fixed in 2.5% glutaraldehyde with 2% paraformaldehyde in 0.15M cacodylate buffer containing 2mM calcium chloride, pH 7.4, for one hour at 4°C.
  • the pellet was trimmed down to contain the minimal amount of agarose possible, washed in buffer, and secondarily fixed in 1% osmium tetroxide/0.3% potassium ferrocyanide in buffer. Subsequently, the pellet was washed in water and en bloc stained with 2% uranyl acetate followed by a graded dehydration in ethanol (35%, 50%, 70%, 90%, 100%, 100%)).
  • d4-succinate An internal standard of d4-succinate was added to all samples prior to analysis. 500 mL of methanol containing 100 pmol of d4-succinate was added to 50 uL plasma samples and vortexed for 1 min. The samples were then centrifuged at 17.000 x g for 10 min at 4°C. After drying the supernatant via SpeedVac, the extract was dissolved in H20 (50 mL) and 10 mL was subjected to liquid chromatography mass spectrometry (LC-MS).
  • LC-MS liquid chromatography mass spectrometry
  • Compound i-BRD9 was measured using a TSQ Quantiva mass spectrometer (Thermo) and Dionex Ultimate 3000 (Thermo) fitted with a Gemini C18 HPLC column (5 mm; 4.6 mm x 50 mm, Phenomenex).
  • LC solvents used were:
  • VDR is required for ⁇ cell maintenance in vitro
  • a genomic CRISPR knock-out screen (Wang et al., 2014, Science 343, 80-84) was performed in human induced pluripotent stem (iPS) cell-derived ⁇ -like cells (Yoshihara et al., 2016, Cell metabolism 23, 622- 634).
  • iPS human induced pluripotent stem
  • INS-GFP human insulin promoter-driven GFP reporter
  • VDR VDR to be one of the most highly expressed transcription factors in mouse islet cells, particularly in ⁇ cells (FIGS. 2A-2B).
  • VDR-depleted ⁇ -like cells iPS cell lines harboring inducible shRNA knockdowns of VDR were differentiated into ⁇ -like cells and then challenged with ⁇ , ⁇ . Consistent with VDR playing a role in cell survival during stress, increased cytokine-induced cell death was seen in the VDR-depleted ⁇ -like cells (FIG. 3 A). Furthermore, in the rat ⁇ cell line INS1, the expression of key ⁇ cell genes was reduced in cytokine and palmitic acid treated cells upon VDR knockdown (FIG. 3B).
  • VDR knock-out mice display increased islet staining for proinsulin, a marker of ER stress and ⁇ cell dysfunction, and an increased proinsuliminsulin ratio in the serum (FIGS. IE, IF, 3C, 3D) (Bouillon et al., 2008, Endocrine Rev. 29, 726-776; Hasnain et al., 2014, Nature Med. 20, 1417-26; Hasnain et al., 2016, J Mol Endocrinol 56, R33-54).
  • FIG. 3E whole body VDR knock-out mice display increased islet staining for proinsulin, a marker of ER stress and ⁇ cell dysfunction, and an increased proinsuliminsulin ratio in the serum (FIGS. IE, IF, 3C, 3D) (Bouillon et al., 2008, Endocrine Rev. 29, 726-776; Hasnain et al., 2014, Nature Med. 20, 1417-26; Hasnain et al., 2016, J Mol End
  • VDR activation can protect ⁇ cells against inflammatory damage.
  • Isolated mouse islets were cultured with ⁇ .1 ⁇ in the presence or absence of the VDR ligand, calcipotriol (Cal), and the transcriptomic changes determined by RNA-Seq. Exposure to ⁇ .1 ⁇ for 48 hours induced widespread transcriptional changes, with 704 and 718 genes up- and down-regulated, respectively (p ⁇ 0.05, FIG. 3F). These transcriptional changes were largely maintained, with some even amplified, upon prolonged exposure (1090 and 989 genes up- and down-regulated after 96 hours, FIG. 3F). Co-treatment with Cal protected islets from ILi -induced damage, with more pronounced effects evident at the later time point (FIGS.
  • VDR interactome was characterized in human ⁇ -like cells.
  • INS-GFP iPS cells incorporating an inducible ectopic expression system for HA-tagged VDR were differentiated into ⁇ -like cells, and VDR expression induced to coincide with the peak expression of insulin, as measured by GFP expression.
  • VDR was subsequently immunoprecipitated from cells grown in the presence or absence of Cal 24 hours after VDR induction, and associating proteins identified by mass spectrometry.
  • VDR multiple transcription elongation factors and components of the mediator and FACT complexes co-immunoprecipitated with VDR
  • novel VDR-interacting proteins were identified, most notably the bromodomain-containing factor 9 (BRD9), and its paralog, BRD7 (FIG. 4A).
  • BRD9 was recently identified as a core component of the B AF complex, whereas BRD7 is found in the PBAF complex.
  • VDR acetylation indeed increased when expressed together with PCAF, but not with the enzymatically dead PCAF D608A mutant (Jin et al., EMBO reports 15, 1192-1201, 2014) (FIG. 4L).
  • these observations demonstrate an unrecognized regulatory mechanism for VDR, whereby T-box acetylation partitions recruitment between BRD9 or BRD7, depending on the absence or presence of VDR ligand, respectively.
  • VDR ligand (Cal) was used to favor BRD7-PBAF association, iBRD9 to block re-association to BAF.
  • VDR association of proteins common to the BAF and PBAF complexes increased in the presence of Cal or iBRD9 (e.g., SMARCAl,
  • VDR Enhanced Activation of VDR Promotes a ⁇ Cell Stress Response
  • FIGS. 1-10 -25% of the ILi -induced transcriptional changes (141 up- and 127 down-regulated genes, FIGS.
  • Cal+iBRD9 significantly protects against cytokine- induced damage by reducing the pro-inflammatory response and preventing the loss in functionality of ⁇ cells.
  • proteomics data indicated that inhibiting the interaction with BRD9 redirects VDR towards the PBAF complex (FIGS. 6 A and 6C). Consistent with this, it was observed that
  • Cal+iBRD9 treatment reduced ARID IB binding -a component of the BAF complex, and increased BAF 180 binding - a component of the PBAF complex, at multiple target gene promoters (FIGS. 8A-8L).
  • Cal and iBRD9 as single agents antagonized a large portion of these changes, resulting a significant increase (> 4-fold) in chromatin accessibility at -4% (1,935 and 1,703 peaks) of all ATAC-seq peaks in ILi -treated cell (FIGS. 7E and 7F).
  • the combined Cal+iBRD9 treatment increased accessibility and resulted in global increases (> 4-fold) at > 3 times more peaks (-15%, 7,932 out of 51,397 peaks) (FIGS. 7E and 7F).
  • VDR Activation of VDR reverses cytokine-induced changes in enhancer landscape
  • Cal+iBRD9 treatment reduced H3K27Ac at 1232 peaks, of which 130 (10.5%) contain VDREs (FIG. 9J), with the VDRE + gene set mainly related to the inflammatory response (FIGS. 9K and 9L).
  • VDR-PBAF complex reverses ⁇ cell dysfunction to reduce hyperglycemia
  • the improvements in markers of ⁇ cell survival and function with Cal+iBRD9 treatment indicate that this approach may have therapeutic utility.
  • the benefits of Cal+iBRD9 treatment in a dietary stress mouse model were examined.
  • mice B6.BKS(D)-Lepdb/J (hereafter referred to as db/db (B6)) mice have markedly increased levels of cytokines that lead to ⁇ cell dysfunction and insulin resistance (Chan et al. 2013, Diabetes 62: 1557-1568).
  • VDR-driven therapies are protective against dietary-induced inflammatory stress.
  • mice were injected with vehicle, Cal alone (60 ⁇ g/kg i.p.), iBRD9 alone (10 mg/kg i.p.), or the combination (Cal: 60 ⁇ g/kg i.p. + iBRD9: 10 mg/kg i.p.) 3 times a week for 9 weeks.
  • Intraperitoneal glucose tolerance tests were performed to evaluate the functionality of the ⁇ cells independent of the incretin effect. While mice treated with Cal alone showed improved glucose clearance compared to vehicle-treated mice, more significant improvements were achieved with Cal+iBRD9 (FIG. IOC), indicating improved insulin secretion with the combination therapy. Consistent with this, random fed serum insulin levels were significantly increased by Cal+iBRD9 treatment, and increased insulin secretion was observed during an intraperitoneal glucose challenge (FIGS. 10D, 10E). These observations indicate that activation of VDR combined with the dismissal of the BAF complex improves ⁇ cell function and thereby glucose homeostasis in an inflammation-driven diabetes model.
  • IPGTT Intraperitoneal glucose tolerance tests
  • mice lacking the leptin receptor on a BKS genetic background develop a more severe diabetic phenotype than db/db (B6) mice.
  • Cal+iBRD9 reduced the fasting blood glucose levels, and continued treatment maintained these levels for -10 weeks without any body weight changes (FIGS. 10F, 1 IF). Consistent with improved glucose management, Cal+iBRD9 treatment partially ameliorated the hallmark hypoinsulinemia associated with the db/db (BKS) model (FIG. 10G).
  • Cal+iBRD9 treatment provided extended improvements in glucose control (FIG. 10H) and increased glucose tolerance and serum insulin levels (FIGS. 101, 12D).
  • VDR ligand and iBRD9 results in enhanced ⁇ cell function and insulin secretion in each of the three mouse models representing different stages of
  • Intracellular insulin level was also rescued by Cal or Cal+iBRD9 treatment (FIG. 13H), indicating that the ⁇ cell dysfunction(Guo et al., 2013, J. Clin. Invest. 123, 3305-16) is reversed upon VDR activation.
  • Cal+iBRD9 As a model of phase III or end stage diabetes, low-dose STZ treatment induces islet loss and a cell expansion (Li et al., 2000, J. Endocrinol. 165, 93-99). Cal+iBRD9 was protective against progressive ⁇ cell death, with increased insulin and decreased glucagon staining seen after 7 weeks of treatment (FIGS. 131, 13J). These changes were accompanied by an increase in the level of NKX6-1, a marker for ⁇ cell function (FIG. 12E), further indicating that the ⁇ cell dysfunction caused by multiple layers of stress is ameliorated upon enhanced VDR activation. Therefore, Cal+iBRD9 treatment improves glucose homeostasis in multiple diabetic mouse models through the reversal of ⁇ cell dysfunction and increased insulin secretion.
  • islets from aged (15 months) transgenic mice carrying a copy of human islet amyloid polypeptide driven by rat insulin II promoter (Janson et al., 1996) were treated with Cal or Cal+iBRD9 for 72 hr ex vivo. Multiple inflammatory and stress markers were reduced upon Cal or Cal+iBRD9 treatment (FIG. 12F).
  • thapsigargin or tunicamycin-induced ER stress in INS1 cells was attenuated by Cal treatment (FIG. 12G).
  • ER stress markers Calnexin and PERK were reduced in db/db (BKS) mice treated with Cal or Cal+iBRD9 (FIG. 12H), indicating that VDR activation can reduce ER stress in highly dysfunctional ⁇ cells in vivo.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Diabetes (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Obesity (AREA)
  • Dermatology (AREA)
  • Hematology (AREA)
  • Endocrinology (AREA)
  • Emergency Medicine (AREA)
  • Immunology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

L'invention concerne des méthodes permettant de réduire le taux de glycémie, qui utilisent un agent qui augmente l'activité biologique d'un récepteur de la vitamine D (VDR) (par exemple, un agoniste du VDR), en association avec un antagoniste de la protéine 9 contenant un bromodomaine (BRD9). Dans certains exemples, de telles méthodes traitent le diabète de type II.Methods for reducing blood glucose, which utilize an agent that increases the biological activity of a vitamin D receptor (VDR) (e.g., a VDR agonist), in combination with an antagonist of the protein 9 containing a bromodomain (BRD9). In some examples, such methods treat type II diabetes.

Description

USE OF BROMODOMAIN-CONTAINING PROTEIN 9 ANTAGONISTS IN
COMBINATION WITH VITAMIN D RECEPTOR AGONISTS IN DIABETES
TREATMENT
CROSS-REFERENCE TO RELATED APPLICATION
This application claims priority to U.S. provisional application no. 62/536,154 filed July 24, 2017, herein incorporated by reference in its entirety.
FIELD
This disclosure provides methods of using an agent compound that increases the biological activity of a vitamin D receptor (VDR) (e.g., a VDR agonist), in combination with an antagonist of bromodomain-containing protein 9 (BRD9), to reduce blood glucose in a mammal, for example to treat type II diabetes.
ACKNOWLEDGMENT OF GOVERNMENT SUPPORT
This invention was made with government support under NIH-NCI CCSG: P30 014195 awarded by The National Institutes of Health. The government has certain rights in the invention.
BACKGROUND
Already a global epidemic, the incidence of T2D is expected to rapidly escalate in the coming decades. Initiated by insulin resistance, β cell dysfunction characterized by defective insulin secretion, endoplasmic reticulum (ER) stress and eventual β cell loss causally associates with disease progression (Ashcroft and Rorsman, 2012, Cell 148, 1160-71) (Halban et al., 2014, Diabetes care 37, 1751-8). Multiple therapeutic approaches currently combat hyperglycemia, however few treatments directly target β cell pathogenesis (Zhou et al., 2016, Nature reviews 12, 337-346). Thus, long-term control of disease progression remains challenging (Kahn et al., 2014, Lancet 383, 1068-1083).
The molecular underpinnings of obesity -induced β cell dysfunction are not fully understood (Donath et al., 2013, Cell metabolism 17, 860-872; Guo et al., 2013, J. Clin. Invest. 123, 3305-16; Talchai et al., 2012, Cell 150, 1223). Evidence links inflammation and specifically, the innate immune response of pancreatic islets to metabolic stress, to T2D progression (Donath and
Shoelson, 2011, Nature reviews 11, 98-107) (Fernandez-Real and Pickup, 2012, Diabetologia 55, 273-8; Imai et al., 2013, Trends Endocrinol. Metab. 24, 351-360). In particular, inflammatory stress associated with increased interleukin 1β (Π.1β) reduces insulin secretion and leads to β cell damage and loss of identity (Marzban, 2015, Diabetes 64, 1094-1096; Herder et al., 2015, TEM 26, 551-563; Morris, 2015, Molecular endocrinology 29, 946-962). Blocking ΙΙ β signaling by antagonists has shown modest β cell functional improvement, although the long term efficacy remains to be determined (Donath et al., 2013, Cell metabolism 17, 860-872).
The anti-inflammatory activities of the vitamin D receptor (VDR), combined with epidemiological and human genetic studies linking vitamin D and VDR to both type 1 and 2 diabetes (Takiishi et al., 2010, (Takiishi et al., 2010, Endocrinol. Metab. Clin. North Am. 39, 419- 446)), provide VDR as a therapeutic target for diabetes (Bouillon et al., 2008, Endocrine Rev. 29, 726-776; Baeke et al., 2010, Current Opin. Pharmacol. 10, 482-496; Cantorna et al., 2004, Am J Clin Nutr 80, 1717S-1720S). However, although vitamin D supplements reverse many diabetic phenotypes in T1D animal models (Del Pino-Montes et al., 2004, Calcif Tissue Int 75, 526-532; Mathieu et al., 1994, Diabetologia 37, 552-558), the therapeutic benefits in type 2 diabetic patients are less clear (Takiishi et al., 2010, Endocrinol. Metab. Clin. North Am. 39, 419-446). Given the limited understanding of the role of VDR in β cells, the potential benefits of activating VDR in pathological β cells in vivo are unknown.
Bromodomain-containing protein 9 (BRD9) is a member of a diverse nuclear and cytoplasmic family of proteins that recognize acetylated lysines (Filippakopoulos and Knapp, 2014, Nat. Rev. Drug Discov. 13, 337-356). Structural differences in the bromodomain of BRD9 distinguish it from other members such BRD2, BRD4 and BRDT (Filippakopoulos et al., 2010, Nature 468, 1067-73). BRD9 is a core component of the SWF/SNF (BAF) complex and, similar to other BAF components, is found to be mutated in multiple cancers (Kadoch et al., 2013, Nature genetics 45, 592-601).
SUMMARY
It is shown therein that VDR is a modulator of the stress response in beta (β) cells, and
BRD9 is a determinant in the VDR-driven anti-inflammatory and pro-survival responses. In the absence of stress, BRD9 recruits the suppressive BAF transcriptional complex to silence VDR. In a dual regulatory mechanism, inhibition of the VDR-BRD9 interaction in combination with ligand activation of VDR cooperate to dismiss the BAF complex in favor of the activating PBAF complex to induce a coordinated transcriptional response. Notably, VDR ligand in combination with a
BRD9 inhibitor is able to partially restore β cell function and glucose homeostasis in T2D mouse models. These results reveal an unexpected post-translational control of VDR function through a bromodomain reader and implicate its potential therapeutic function in diabetes. Based on these observations, methods of using a therapy that uses both a vitamin D receptor (VDR) agonist and a bromodomain-containing protein 9 (BRD9) antagonist are provided. In some examples, such methods are used to treat a disorder that benefits from increased VDR activity, such as fibrosis (such as fibrosis of the lung, liver, kidney or pancreas), autoimmune disorders, and type II diabetes (T2D).
In some examples the methods include administering a therapeutically effective amount of one or more VDR agonists and one or more BRD9 antagonists to reduce blood glucose in a mammal, such as a decrease of at least 5%, at least 10%, at least 25%, at least 50%, or at least 75%. In some examples the methods include administering a therapeutically effective amount of one or more VDR agonists and one or more BRD9 antagonists to treat type 2 diabetes in a mammal. In some examples the methods include administering a therapeutically effective amount of one or more VDR agonists and one or more BRD9 antagonists to reduce fed and fasting blood glucose (such as a decrease of at least 5%, at least 10%, at least 25%, at least 50%, or at least 75%), increase insulin sensitivity (such as an increase of at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 200%, or at least 300%), increase glucose tolerance (such as an increase of at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 200%, or at least 300%), increase insulin secretion (such as an increase of at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 200%, or at least 300%), increase beta cell function (such as an increase of at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 200%, or at least 300%), increase the size of islets (such as an increase of at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%, at least 200%, or at least 300%), reduce beta cell death (such as a decrease of at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90% or at least 95%), increase insulin granules (such as an increase of at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, at least 100%), at least 200%, or at least 300%), reduce fibrosis (such as a decrease of at least 5%, at least 10%, at least 25%, at least 50%, at least 75%, at least 80%, at least 90% or at least 95%), treat an autoimmune disease, or combinations thereof.
Also provided are compositions that include one or more VDR agonists and one or more
BRD9 antagonists. In some examples, such a composition is part of a nanoparticle. Also provided are kits that include one or more VDR agonists and one or more BRD9 antagonists.
Examples of VDR agonists that can be used include but are not limited to vitamin D, a vitamin D precursor, a vitamin D analog, a vitamin D receptor ligand, a vitamin D receptor agonist precursor, and combinations thereof. Examples of BRD9 antagonists that can be used include but are not limited to i-BRD9, TP742, BI-7273, BI-9564, dBRD9, G E-375 and LP-99.
The foregoing and other objects and features of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1A-1F. VDR is essential for β cell homeostasis. (A) Schematic representation of the genome-wide CRISPR loss-of-function screen in human iPSC-derived β-like cells. (B) Gene ontology analysis of targets compromising β-like cell function (p<0.01, 156 total genes). (C) p- value rank order plot of genes enriched in the loss-of-function screen, VDR is labeled in red. (D) Distribution of normalized reads of individual sgRNAs in GFP sorted cells; VDR sgRNAs are labeled in red. (E) Immunohistochemistry staining of pro-insulin in VDR+/" or VDR_/" islets (scale bar: ΙΟΟμπι). (F) Serum proinsulin/insulin ratio in VDR+/" and VDR_/" male mice measured by ELISA (n=3, error bars S.E.M, * / 0.05).
FIGS. 2A-2B. VDR is expressed in β cells. (A) Ranking of highly expressed
transcription factors by average RPKM in single-cell RNA seq. Average RPKM is shown. VDR is shown in red. (B) Heat map of single cell expression values of key alpha cell and β cell markers, together with VDR.
FIGS. 3A-3J. VDR is essential for β cell function. (A) Percentage of apoptotic cells, as measured by FACS analysis for Annexin5, in control and VDR knockdown human β-like cells. (B) Heat map of relative gene expression changes between control (siCtrl) and VDR knockdown (siVDR) INS 1 cells in response to different stress conditions, as determined by qPCR. (C) Serum insulin levels in VDR+/+ and VDR " mice (n=4, error bars show S.E.M., *P<0.05). (D) Serum proinsulin levels in VDR+/+ and VDR_/" mice (n=4, error bars show S.E.M. ). (E) Staining of
MAFA and Insulin in VDR WT and VDR KO islets. (F) Heat maps of gene expression in mouse islets treated with vehicle, Ιίΐ β, or ΙΕΙ β+Cal for 48 or 96 hours, showing the genes induced by Π,ΐ β are partially rescued by Cal treatment. (G) Venn diagram showing the overlap of between genes significantly suppressed by Π,ΐ β and genes rescued by Cal (VDR agonist calcipotriol) at 96 hours. (H) Gene ontology categories enriched in the 169 genes suppressed by Ιίΐ β and rescued by Cal at 96 hours. (I) Venn diagram showing the overlap between genes significantly induced by Π,ΐ β and genes rescued by Cal at 96 hours. (J) Gene ontology categories of the 332 genes induced by TLl fi and rescued by Cal at 96 hours. FIGS. 4A-4L. Bromodomain-containing proteins BRD7 and BRD9 bind acetylated VDR.
(A) Heat map of VDR interacting proteins in human β-like cells in the absence or presence of ligand Cal, determined by MudPIT analyses (24 h after doxycycline induction of HA-VDR and ligand addition). Spectral counts normalized to VDR. (B) Western blot of endogenous BRD9 in immunoprecipitates from 293T cells expressing HA-tagged VDR treated with vehicle (DMSO), Cal, the BRD9 inhibitor iBRD9, or Cal+iBRD9. (C) Western blot of ectopically expressed VDR in immunoprecipitates from 293T cells expressing Flag-tagged BRD9, lh after treatment with DMSO, Cal, iBRD9, or Cal+iBRD9. (D) In vitro interaction of purified full-length HA-VDR with the bromodomain of BRD9 fused to GST. (E) Alignment of T-box sequences from related nuclear receptors showing conservation of the VDR acetylated lysine K91 (from top to bottom, SEQ ID NOS: 45-50). (F) Crystal structure of the DNA binding domains of VDR (red) bound to DNA (blue), highlighting the sidechain of K91 (green) (PDB ID: lkb2). (G) Western blot of endogenous BRD9 in immunoprecipitates from 293T cells expressing wild type, K91R, or K91 A HA-tagged VDR. Acetylated VDR detected with pan acetyl lysine antibody. (H) Western blot of ectopically expressed VDR in immunoprecipitates from 293T cells expressing Flag-tagged BRD7, lh after treatment with DMSO, Cal, or Cal+iBRD9. (I) Western blot of ectopically expressed Flag-BRD7 in immunoprecipitates from 293T cells expressing wild type, K91R, or K91 A HA- tagged VDR. (J) Reported increases in hydrogen-deuterium exchange upon addition of 1,25 (OH)2 vitamin D mapped onto the crystal structure of the DNA binding domain of VDR. (K) Western blot of endogenous PCAF in IP from INS1 cells expressing HA-VDR, 1 hr after indicated treatments. (L) Western blot of ectopically expressed HA-VDR in IP from 293T cells
overexpressing wild-type or an enzymatically dead PCAF (D608A).
FIGS. 5A-5J. VDR acetylation and BAF interaction. (A) Immunoprecipitation of endogenous BAF/PBAF components in 293 T cells shows that BRD9 interacts with BAF components BRG1 and ARID IB, but does not interact with PBAF component ARID2; (B)
Scatterplot of the p value of all genes enriched in the drop-out screen with VDR labeled in red. Several epigenetic modifiers, including BRD7, are labeled in green; (C) Western blot of endogenous BRD9 in immunoprecipitates from 293T cells expressing HA-tagged VDR treated with vehicle (DMSO), Cal, the BRD9 inhibitor iBRD9, or Cal+iBRD9; (D) Quantification of relative signal intensity corresponding to (C) (n = 2, error bars show S.E.M., **p < 0.01); (E)
Quantification of relative signal intensity corresponding to FIG. 2C (n = 2, error bars show S.E.M., *p < 0.05, **p < 0.01); (F) Western blotting of full-length His- VDR showing that the SF9 (insect- produced recombinant protein is acetylated; (G) Mass-spectrum indicating that lysine 91 on human VDR is acetylated; (H) Quantification of relative signal intensity corresponding to FIG. 4G (n = 2, error bars show S.E.M., *p < 0.05, **p < 0.01); (I) Quantification of relative signal intensity corresponding to FIG. 4H (n = 2, error bars show S.E.M., **p < 0.01); (J) Quantification of relative signal intensity corresponding to FIG. 41 (n = 2, error bars show S.E.M., **p < 0.01).
FIGS. 6A-6F. BRD9 represses VDR activation upon acute cytokine stress in β cells. (A) Heat map of MudPit mass-spectral analyses of VDR interactomes in INSl cells expressing HA- tagged VDR. Ligand and iBRD9-treated cells show increased interactions between VDR and PBAF-specific components PBRMl and ARID2, but not BAF-specific components ARID 1 A and ARIDIB. Interactions between VDR and mediator components, NURD complex and other co- factors also increase upon ligand or iBRD9 treatment. Spectral counts in individual samples are normalized by counts of VDR. (B) Western blots demonstrating that the interaction of VDR with PBAF complex components BAF180, PHF10, as well as shared BAF/PBAF components BAF155 and BRG1, increased with Cal or iBRD9 treatment, whereas the interaction with BAF complex- specific component ARIDIB decreased upon activation of VDR. (C) qPCR results for early response (30min) of ILi stressed INSl cells show a synergy of Cal and iBRD9 in up-regulating Nfkbia (ΙκΒα), an early negative feedback regulator of NFKB signaling pathways. (n=3, error bars show S.E.M. *P<0.05). (D) Changes in NFKBIA (ΙκΒα) protein levels correlate with gene expression changes in INSl cells treated with ILi for 30 mins. (E) Time course of Nfkbia expression during cytokine stress suggest that a synergy between iBRD9 and Cal can increase the expression of Nfkbia upon ILi stress. The prolonged enhancement of Nfkbia expression can still be observed after 24 hrs, whereas Cal alone is not sufficient to induce a significant increase in Nfkbia expression (n=3, error bars show S.E.M. , *P<0.05). (F) siRNA knock-down of BRD9, PBAF complex key component PBRMl (BAF 180), as well as PCAF confirming their significance in regulating Nfkbia expression (n=3, error bars show S.E.M., *P<0.05).
FIGS. 7A-7I. Synergy between iBRD9 and Cal directly reverse the transcriptome changes brought by ILi and influence global DNA accessibility. (A) Number of genes significantly induced or repressed by 1 hour ILi stress. The black bars represent genes rescued by Cal+iBRD9. (B) Heat map of all Cal+iBRD9 rescued genes. (C) Gene ontology categories of Cal+iBRD9 rescued ILi -repressed genes indicate that the majority of these genes are related to β cell function including hormone secretion, development, and anti-ER stress response. (D) Gene ontology categories of Cal+iBRD9-rescued ILi -induced genes indicate that the majority of these genes are related to β cell inflammatory and stress responses. (E) Percentage of differentially accessible regions (>4 fold) in multiple comparisons. ILi stress (lhr) induces increases as well as decreases in ATAC-seq peak intensity. Compared with ILi stressed cells, Cal or iBRD9-treated samples primarily increase chromatin accessibility. The addition of both Cal and iBRD9 results in a synergistic increase in chromatin accessibility and demonstrate a genome-wide increase of accessibility for -15% of all ATAC-seq peaks. (F) Heat map showing changes in chromatin accessibility 1 hour after the indicated treatments. Compared with DMSO treatment, chromatin accessibility measured by ATAC-seq peak intensity is overwhelmingly suppressed by ILl β, which is rescued by Cal or iBRD9. A "hyper-activated" state is seen upon combinatorial treatment of Cal and iBRD9. (G) Enriched transcription factors (TF) motifs in Cal+iBRD9 induced ATAC-seq peaks. (H) Chromatin accessibility at identified VDR response elements (VDREs) increases with Cal+iBRD9 treatment. (I) Genome browser tracks of ATAC-seq signals at 3 representative gene loci: Nfkbia, Nfkbiz, and Cckar, all showing a synergistic effect of Cal+iBRD9 at enhancer regions.
FIGS. 8A-8L. VDR regulates NFKB signaling. (A-E) Quantification of relative signal intensities corresponding to FIG. 6B (n = 2, error bars show S.E.M., **p < 0.01); (F) INS-1 cells expressing VDR-WT or VDR-K91R were treated with Π.1 β plus and minus Cal for lhr, and Nfkbia levels were measured by qPCR (n = 3, error bars show S.E.M., *p < 0.05); (G-I) ChlP-qPCR of ARID IB, a BAF-specific component, show that addition of iBRD9 reduces BAF complex binding at key VDR target loci Nfkbia, Nfkbiz, and Camk4; (J-L) ChlP-qPCR of BAF 180, a PBAF-specific component, show that addition of iBRD9 increases PBAF complex binding at key VDR target loci Nfkbia, Nfkbiz, and Camk4.
FIGS. 9A-9L. Activation of VDR directly antagonizes the global enhancer dynamics induced by ILi . (A) Heat map of all H3K27Ac peaks repressed by ILlp (>1.5 fold) 1 hour after treatment. The decreases in H3K27Ac were partially recovered by ligand activation of VDR. (B) Heat map of all H3K27Ac peaks induced by Π.1 β (>1.5 fold) 1 hour after treatment. The increases in H3K27Ac were partially repressed by ligand activation of VDR. (C) Enriched TF binding motifs in VDR ligand-induced H3K27Ac peaks shows that the VDR binding element (VDRE) is highly enriched. (D) H3K27Ac signal intensity around accessible VDREs (within ATAC-seq peaks) related to Cal+iBRD9-rescued ILi -repressed genes. ILi significantly reduces H3K27Ac at VDREs, which was rescued by Cal+iBRD9. (E) H3K27Ac signal intensity around accessible VDREs (within ATAC-seq peaks) related to Cal+iBRD9 rescued ILi induced genes. Π.1 β significantly induced H3K27Ac at VDREs, which was rescued by Cal+iBRD9. (F) Genome browser tracks showing H3K27Ac at 2 loci: Camk4 and Cckar, showing ILi causes a decrease in H3K27 acetylation, which could be reversed with Cal+iBRD9 treatment. (G) Total number of H3K27Ac peaks synergistically enhanced by iBRD9 (ILl +Cal+iBRD9 vs. ILip+Cal) and the fraction containing VDREs, 6 hours after treatment. (H) GO categories enriched in genes associated with peaks in (G). (I) Genome browser tracks comparing H3K27Ac between Cal and Cal+iBRD9-treated samples at Nfkbia and Camk4 loci. (J) Total number of H3K27Ac peaks synergistically repressed by iBRD9 (ILi +Cal+iBRD9 vs. ILi +Cal) and the fraction containing VDREs, 6 hours after treatment. (K) GO categories enriched in genes associated with peaks in (J). (L) Genome browser tracks comparing H3K27Ac between Cal and Cal+iBRD9-treated samples at Ccl28 and Txnip loci.
FIGS. 10A-10I. Combinatorial treatment of Cal and iBRD9 rescue β cell dysfunction and improve glucose metabolism in type 2 diabetes animal models. (A) 9 week old db/db (B6) male mice were grouped and treated with vehicle, Cal, iBRD9 or Cal+iBRD9 through i.p.
injections 3 times a week. Treatment with Cal mildly reduces overnight fasting glucose levels in db/db (B6) mice, whereas Cal+iBRD9 potently reduces glucose levels (n=6-l 1, error bars show S.E.M., *P<0.05). (B) Mice in all groups maintain similar weight (n=6, error bars show S.E.M.). (C) Cal-treated and Cal+iBRD9 treated db/db (B6) mice (after 9 weeks treatment) have better glucose tolerance based on IP glucose tolerance test (IPGTT) (n=6, error bars show S.E.M., *P<0.05). (D) Cal, iBRD9, and Cal+iBRD9-treated db/db (B6) mice have higher fasting serum insulin levels (n=4-6, error bars show S.E.M., *P<0.05). (E) Cal+iBRD9 treated db/db (B6) mice secrete more insulin during a glucose challenge. (F) 9 week old db/db (BKS) male mice were grouped and treated with vehicle, Cal or Cal+iBRD9 through i.p. injections 3 times a week.
Cal+iBRD9 treatment significantly reduced overnight fasted glucose levels in db/db (BKS) mice (n=8, error bars show S.E.M., *P<0.05). (G) Cal and Cal+iBRD9-treated db/db (BKS) mice have higher fasting serum insulin levels (n=5, error bars show S.E.M., *P<0.05). (H) 8 week old C57/B6 male mice were grouped and injected with low-dose STZ everyday for 5 consecutive days. 1 week after the final injection, the mice were grouped based on glucose levels and treated with vehicle, Cal or Cal+iBRD9 through i.p. injections 3 times a week. Cal+iBRD9 treatment significantly reduced overnight fasted glucose levels in low-dose STZ-treated mice (n=8-10, error bars show S.E.M., *P<0.05). (I) IPGTT of STZ-treated mice reveals better glucose tolerance for Cal+iBRD9 treated mice (n=5, error bars show S.E.M., *P<0.05).
FIGS. 11A-11F. Cal and iBRD9 do not affect whole body metabolism. (A) Liver weight of db/db (B6) mice treated with Vehicle, Cal, iBRD9, or Cal+iBRD9 (n=6, error bars show
S.E.M.). (B) Epididymal white adipose tissue (eWAT) weight of db/db (B6) mice treated with Vehicle, Cal, iBRD9, or Cal+iBRD9 (n=6, error bars show S.E.M.). (C) Oxygen consumption (V02) of mice treated with vehicle or Cal+iBRD9. (D) C02 production of mice treated with vehicle or Cal+iBRD9. (E) Serum calcium levels of mice in all treatment groups (n = 10, error bars show SD). (F) Whole body weights of db/db (BKS) mice during treatment with Vehicle, Cal or Cal+iBRD9.
FIGS. 12A-12J. Cal and iBRD9 combination restores glucose metabolism in multiple mouse models. (A) VDR target gene Cyp24Al expression in multiple tissues, indicating islets are directly targeted by Cal treatment (n=3, error bars show S.E.M., *P<0.05). (B) Islets from db/db (B6) mice treated with Cal show increased expression of Ins2 (n=3, error bars show S.E.M., *P<0.05). (C) Key hepatic gluconeogenesis genes are repressed in Cal-treated db/db (B6) mice, suggesting higher levels of serum insulin suppresses gluconeogenesis from liver. (D) Low-dose STZ treated mice show increased levels of insulin with Cal or iBRD9 treatment (n=8-10, error bars show S.E.M.). (E) Immunofluorescence staining of KX6-1 (red), a key transcription factor for β cell identity and function, in pancreas sections from vehicle and Cal+iBRD9-treated low-dose STZ treated mice. (Scale bar: 50 mm). (F) Heatmap of qPCR results of multiple inflammatory gene expression in islets from aged h-IAPP mice treated with Cal or Cal+iBRD9. Islets were collected from 15 month old mice and cultured ex vivo in ultra-low attachment plates. Cal or Cal+iBRD9 were treated for 72 hours. (G) Western blotting of ER stress marker p-PERK in INS-1 cells treated with Thapsigargin (0.25 mM) or Tunicamycin (5 mg/ml) overnight. Cal was pre-treated 1 hour. (H) Immunohistochemistry staining of ER stress markers Calnexin and PERK in pancreatic tissue sections in db/db (BKS) mice. (I) qPCR of Nfkbia expression in INS-1 cells exposed to Π.1β and Cal and multiple BRD9 inhibitors, (n = 3, error bars show S.E.M., *p < 0.05, **p < 0.01). (J) In vivo pharmacokinetic study of iBRD9 (n = 3, error bars show SEM).
FIGS. 13A-13L. Activation of VDR reverses β cell stress in vivo. (A) Volcano plot of gene expression changes induced in islets isolated from Cal-treated db/db (B6) mice, determined by RNA-seq analyses, reveals the induction of key factors for β cell function, whereas multiple proinflammatory genes are down-regulated. (B) GO analysis shows enrichment in pathways related to β cell function in the gene set whose expression is increased in islets upon Cal treatment. (C) H&E staining of db/db (BKS) pancreata treated with vehicle or Cal for 3 months. (Scale bar: 50μιη). (D) Islet area as percentage of total pancreas sections shows increased total islet area in Cal+iBRD9- treated db/db (BKS) mice. (n=6 for vehicle, n=15 for Cal, * p<0.05, error bars show S.E.M.). (E) Average islet size in vehicle and Cal+iBRD9-treated db/db (BKS) mice. (** p <0.01). (F)
Immunohistochemistry of Ki67, a proliferation marker, in vehicle and Cal+iBRD9-treated pancreas sections. Dark arrow labels Ki67+ cells within islets (Scale bar: 50μιη). (G) Bar graph showing quantification of Ki67+ cells in islets from vehicle and Cal+iBRD9-treated mice indicating an increase in proliferation in Cal+iBRD9-treated islets. (H) Immunofluorescent staining of insulin (red) in pancreas sections from vehicle, Cal and Cal+iBRD9-treated db/db (BKS) mice. (Scale bar: 50μιη). (I) Immunofluorescent staining of insulin (red) and glucagon (green) in pancreas sections from vehicle and Cal+iBRD9 treated low-dose STZ-treated mice (Scale bar: 50μιη). (J) Bar graphs showing the percentage of β and a cells in vehicle and Cal+iBRD9-treated db/db (BKS) mice. (K) Transmission electron microscopic images of healthy human islets 24 hours after treatment with vehicle, Π.1β, ILi +Cal, or ILi +Cal+iBRD9. Π.1β caused multiple subcellular morphological changes such as loss of dense insulin granules (upper right) and dilated ER (lower right). Activation of VDR partially rescues the morphological degeneration caused by ILi . (Scale bar: Ι μπι). (L) Schematic representation of the mechanism underlying the synergy between Cal and iBRD9 in directing the association of VDR with alternate chromatin remodeling complexes and the consequential effects on transcription. Data reported as mean ± SEM, *p < 0.05, **p < 0.01.
FIGS. 14A-14B. Calcipotriol Treatment Increases Ex Vivo Human Islet Survival and Insulin Secretion. (A) Cell numbers of ex vivo cultured human islets treated with vehicle or calcipotriol for 4 weeks (n = 3, error bars show S.E.M., *p < 0.05). (B) Insulin secretion assay of ex vivo cultured human islets treated with vehicle or calcipotriol for 1 week, (n = 3, error bars show S.E.M., **p < 0.01).
SEQUENCE LISTING
The nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on May 25, 2018, 32 KB, which is incorporated by reference herein. In the accompanying sequence listing:
SEQ ID NOS : 1 -44 are PCR primers.
SEQ ID NOS: 45-50 show exemplary T-box sequences from related nuclear receptors.
DETAILED DESCRIPTION
The following explanations of terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure.
The singular forms "a," "an," and "the" refer to one or more than one, unless the context clearly dictates otherwise. For example, the term "comprising a VDR agonist" includes single or plural agonists and is considered equivalent to the phrase "comprising at least one VDR agonist." The term "or" refers to a single element of stated alternative elements or a combination of two or more elements, unless the context clearly indicates otherwise. As used herein, "comprises" means "includes." Thus, "comprising A or B," means "including A, B, or A and B," without excluding additional elements. Dates of GenBank® Accession Nos. referred to herein are the sequences available at least as early as July 24, 2017. All references and GenBank® Accession numbers cited herein are incorporated by reference in their entireties.
Unless explained otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting.
In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided: Administration: To provide or give a subject an agent, such as a VDR agonist and a
BRD9 antagonist, by any effective route. Exemplary routes of administration include, but are not limited to, oral, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous, intra-articular, and intrathecal), sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
Bromodomain-containing protein 9 (BRD9): A protein containing a bromodomain, which recognizes acetylated lysines on post-translationally modified proteins. This protein is upregulated in multiple cancer cell lines. It is closely related to BRD7. Sequences are publicly avaible, for example from the GenBank® database, such as GenBank® Accession Nos.
NP_076413.3, NP_001304880.1 , NP_001009877.2, NP_001019679.2, and NP_001180021.1 (proteins), and NM_001317951.1 , NM_023924.4, and NM_001024508.3 (nucleic acids).
Diabetes mellitus: A group of metabolic diseases in which a subject has high blood sugar, either because the pancreas does not produce enough insulin, or because cells do not respond to the insulin that is produced. Type 1 diabetes results from the body's failure to produce insulin. This form has also been called "insulin-dependent diabetes mellitus" (IDDM) or "juvenile diabetes". Type 2 diabetes results from insulin resistance, a condition in which cells fail to use insulin properly, sometimes combined with an absolute insulin deficiency. This form is also called "non- insulin-dependent diabetes mellitus" (NIDDM) or "adult-onset diabetes." The defective responsiveness of body tissues to insulin is believed to involve the insulin receptor. Diabetes mellitus is characterized by recurrent or persistent hyperglycemia, and in some examples diagnosed by demonstrating any one of:
a. Fasting plasma glucose level > 7.0 mmol/1 (126 mg/dl);
b. Plasma glucose > 11.1 mmol/1 (200 mg/dL) two hours after a 75 g oral glucose load as in a glucose tolerance test;
c. Symptoms of hyperglycemia and casual plasma glucose > 11.1 mmol/1 (200 mg/dl);
d. Glycated hemoglobin (Hb AIC) > 6.5%
Effective amount or therapeutically effective amount: The amount of agent, such as a VDR agonist and a BRD9 antagonist, that is an amount sufficient to prevent, treat (including prophylaxis), reduce, and/or ameliorate the symptoms and/or underlying causes of any of a disorder or disease. In one embodiment, an "effective amount" is sufficient to reduce or eliminate a symptom of type II diabetes in a mammal, for example by lowering blood glucose.
Mammal: This term includes both human and non-human mammals. Similarly, the term "subject" includes both human and veterinary subjects (such as cats, dogs, cows, and pigs) and rodents (such as mice and rats).
Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in this invention are conventional. Remington 's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the one or more VDR agonists and one or more BRD9 antagonists.
In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, or the like as a vehicle. For solid compositions (e-g-, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Subject: Any mammal, such as humans, non-human primates, pigs, sheep, cows, dogs, cats, rodents and the like which is to be the recipient of the particular treatment, such as treatment with a VDR agonist and a BRD9 antagonist. In two non-limiting examples, a subject is a human subject or a murine subject. In some examples, the subject has type 2 diabetes. In some examples, the subject has elevated blood glucose. Treating a disease: "Treatment" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition (for instance, fibrosis) after it has begun to develop. "Prevention" refers to inhibiting the full development of a disease, for example in a person who is known to have a predisposition to a disease such as a person who has been or is at risk for developing type II diabetes.
Vitamin D: A group of fat-soluble secosteroid prohormones and hormones, the two major forms of which are vitamin D2 (ergocalciferol), and vitamin D3 (cholecalciferol) which is converted to l ,25 dihydroxyvitamin D3 (1 a,25-(OH)2-D3), also known as calcitriol, the physiologically active form of vitamin D.
Vitamin D agonist or analog: Any compound, synthetic or natural, that binds to and activates the VDR, such as a VDR ligand (e.g., calcitriol), VDR agonist precursor, vitamin D analogs, vitamin D precursors.
Specific, non-limiting examples of natural and synthetic vitamin D agonists and analogs include la,25(OH)2D3, calcipotriol, LG190090, LG9190119, LG190155, LG190176, and
LG190178 (see, for instance, Boehm et al, (1999) Chemistry & Biology, 6:265-275); LY2108491, and LY2109866 (Ma et al, (2006) J Clin. Invest., 116:892-904); 2p-(3-Hydroxypropoxy)la,25- Dihydroxyvitamin D3 (ED-71) (Tsurukami et al, (1994) Calcif. Tiss. Int. 54: 142-149); EB1089 (Pepper et al, (2003) Blood, 101 :2454-2460); OCT(22-oxa-calcitrol) (Makibayashi et al, (2001) Am. J. Path., 158: 1733-1741); (laOH-2, 19-nor-25hydroxyvitaminD3) and (l,3-Deoxy-2- CHCH2OH- 19-nor-25-hydroxyvitaminD3) (Posner et al, (2005) Bioorganic & Medicinal Chemistry, 13 :2959-2966) and any of the vitamin D analogs disclosed in Rey et al, (1999) J. Organic Chem., 64:3196-3206; and bile acid derivatives such as lithochoic acid (LCA) and ursodoxycholic acid (UDCA) (see, for instance, Nehring et al, (2007) PNAS, 104: 10006-10009; Makishima et al, (2002) Science, 296: 1313-1316; Copaci et al, (2005) Rom. J. Gastroenterol, 14:259-266). Each of these references is hereby incorporated by reference in its entirety.
Vitamin D precursor: A compound capable of being converted to an agonist of the vitamin D receptor by an enzyme. In certain, non-limiting examples, that enzyme is CYP27B1. Specific, non-limiting examples of vitamin D precursors include vitamin D3 (cholecalciferol), 25- hydroxy-vitamin D3 (25-OH-D3) (calcidiol), as well as vitamin D2 (ergocalciferol) and its precursors.
Vitamin D receptor (VDR): A member of the nuclear hormone receptor ( HR) superfamily and is a key regulator of calcium homeostasis and skeletal health. VDR possesses the common nuclear receptor structure, for example, is comprised of an N-terminal activation domain, a DNA-binding region (DBD) with two zinc finger domains, a hinge region and a ligand-binding domain (LBD). VDR activated gene transcription requires initial nuclear translocation via importin-a, heterodimerization with RXR, and binding to response elements present in target genes. VDR regulates genes associated with the maintenance of calcium and phosphate homeostasis in the intestine and kidney. The signal initiated by VDR/RXR heterodimers is modulated by the association of co-activating or co-repressing proteins and also depends on other signaling partners in the nuclear compartment. The VDR/RXR heterodimer is non-permissive, in that the presence or absence of RXR ligands is not known to affect VDR responses.
Endogenous activators of the VDR include the biologically active form of vitamin D
(la,25(OH)2D3 (calcitriol)) and bile acids such as lithocholic acid (LCA) and its derivatives (LCA- acetate, LCA-formate, 3-keto LCA).
Overview
The primary cause of disease progression in type 2 diabetes (T2D) is inflammatory stress- induced β cell dysfunction; however, preservation of β cell function under diabetic conditions remains challenging. It is shown herein that the vitamin D receptor (VDR) is a key modulator of the inflammatory response in β cells. It was found that a ligand-dependent switch between the BAF and PBAF chromatin remodeling complexes is mediated by the alternate binding of bromodomain-containing proteins 9 (BRD9) and BRD7, respectively, to acetyl ated VDR.
Mechanistically, BRD9 inhibition synergistically cooperates with ligand-dependent VDR activation to abrogate cytokine-induced transcriptomic changes, in part via PBAF-mediated changes in chromatin accessibility and enhancer landscape. The inventors show that combined VDR activation and BRD9 inhibition significantly restores β cell function to ameliorate hyperglycemia in multiple murine T2D models. These results establish the VDR-BRD9 as a central hub in orchestrating β cell anti-inflammatory responses and demonstrate its therapeutic use in treatment of T2D.
It is shown herein that VDR is a critical factor in β cell survival and function. Initially identified in an unbiased CRISPR knockout screen, genetic loss-of-function and ex vivo gain-of- function demonstrate a protective role for VDR in β cells and the modulation of islet stress. In exploring the regulatory mechanisms of VDR-driven transcriptional action the shuttling of VDR between competing chromatin remodeling complexes was observed (FIG. 13L). Specifically, provided is a novel acetylated lysine in VDR that facilitates its recognition by the highly related bromodomain reader proteins, BRD9 and BRD7, respective components of the BAF and PBAF complexes. It is shown that VDR shuttles between BAF and PBAF complexes in a ligand- dependent fashion. In addition, a highly selective BRD9 inhibitor, iBRD9, cooperates with VDR ligand to favor PBAF complex binding and significantly potentiates VDR signaling.
Mechanistically, binding of the PBAF complex enhances chromatin accessibility at consensus VDR binding elements to modulate the expression of key inflammatory response genes including the inhibitor of F-kB, Nfkbia.
Despite many shared components, the BAF and PBAF complexes are distinct assemblies (Hodges et al., 2016, Cold Spring Harbor Prespect. Med. 6. a026930). While the PBAF complex is a superior transcriptional activator compared to the BAF complex in vitro (Lemon et al., 2001, Nature 414, 924-928; Rafati et al., 2011, PLoS biology 9, el001206), the ability of these two complexes to mediate ligand-dependent signaling was not previously known. The inventors describe herein a novel mechanism in which acetylation at K91 in VDR is recognized by the BRD7/9 subfamily of bromodomain proteins to direct the association of the PBAF and BAF complexes in a ligand-dependent fashion. Fortuitously, the switching of VDR' s partner from BAF- BRD9 to PBAF-BRD7 can also be pharmacologically manipulated by targeting the "reader" of VDR acetylation, thereby providing an additional level of nuclear receptor signaling regulation.
Pro-inflammatory cytokines such as ILip and TNF-a are detrimental to β cell function (Nackiewicz et al., 2014, Diabetologia 57, 1645-1654) and multiple clinical trials targeting these cytokines are ongoing (Imai et al., 2013, Trends Endocrinol. Metab. 24, 351-360). However, use of selective inhibitors of inflammation to treat T2D has seen only modest improvements. In contrast, it is shown herein that exploiting VDR as a negative modulator of NFKB signaling in β cells is highly effective, and that combining a VDR activator with a BRD9 inhibitor results in prolonged suppression of the damaging effects of inflammatory insults.
While multiple therapies aimed at improving β cell function are in the clinic or under development, chronic stress-induced damage to β cells poses a serious challenge for long term therapeutic efficacy (Zhou et al., 2016, Nature reviews 12, 337-346). By focusing on the VDR shuttle between BAF and PBAF complexes, provided herein is a novel therapeutic strategy to suppress inflammation via sustained receptor activation in β cells. This method demonstrates the power of genomic reprogramming, tackling the problem at the genome-wide level. As this is how β cells limit chronic inflammation, exploiting the power of the VDR, its acetylation, and the safety of its ligands offer a very different approach in the treatment of T2D.
Based on these observations, provided here are methods of reducing blood glucose in a mammal. Such methods can include administering a therapeutically effective amount of one or more VDR agonists to the mammal, and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby reducing the blood glucose. In some examples, blood glucose is decreased by of at least 5%, at least 10%, at least 25%, or at least 50%, for example as compared to administration of no VDR agonists and no BRD9 antagonists (e.g., administration of PBS).
In addition, provided are methods of treating type 2 diabetes in a mammal. Such methods can include administering a therapeutically effective amount of one or more VDR agonists to the mammal, and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby treating the type 2 diabetes in the mammal.
Provided are methods of reducing fed and fasting blood glucose. Such a method can include administering a therapeutically effective amount of one or more VDR agonists to the mammal, and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby reducing fed and fasting blood glucose. In some examples, the fed and fasting blood glucose is reduced in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, or at least 90% as compared to an absence of administration of the VDR agonists and BRD9 antagonists.
In addition, provided are methods of treating an autoimmune disease. Such methods can include administering a therapeutically effective amount of one or more VDR agonists to the mammal having an autoimmune disease, and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby treating the autoimmune disease. An autoimmune disease is one in which the immune system produces an immune response (for example, a B cell or a T cell response) against an antigen that is part of the normal host (that is, an autoantigen), with consequent injury to tissues. An autoantigen may be derived from a host cell, or may be derived from a commensal organism such as the micro-organisms (known as commensal organisms) that normally colonize mucosal surfaces. Exemplary autoimmune diseases affecting mammals that can be treated with the disclosed combination of VDR agonist and BRD9 antagonist include rheumatoid arthritis, juvenile oligoarthritis, collagen-induced arthritis, adjuvant-induced arthritis, Sjogren's syndrome, multiple sclerosis, experimental autoimmune encephalomyelitis, inflammatory bowel disease (for example, Crohn's disease, ulcerative colitis), autoimmune gastric atrophy, pemphigus vulgaris, psoriasis, vitiligo, type 1 diabetes, non-obese diabetes, myasthenia gravis, Grave' s disease, Hashimoto's thyroiditis, sclerosing cholangitis, sclerosing sialadenitis, systemic lupus erythematosis, autoimmune thrombocytopenia purpura, Goodpasture's syndrome, Addison's disease, systemic sclerosis, polymyositis, dermatomyositis, autoimmune hemolytic anemia, and pernicious anemia.
In addition, provided are methods of reducing fed and fasting blood glucose, increasing insulin sensitivity, increasing glucose tolerance, increasing insulin secretion, increasing beta cell function, increasing the size of islets, reducing beta cell death, increasing insulin granules, or combinations thereof. Such methods can include administering a therapeutically effective amount of one or more VDR agonists to a mammal (such as one with type II diabetes), and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby reducing fed and fasting blood glucose, increasing insulin sensitivity, increasing glucose tolerance, increasing insulin secretion, increasing beta cell function, increasing the size of islets, reducing beta cell death, increasing insulin granules, or combinations thereof. In some examples, the fed and fasting blood glucose is reduced in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, or at least 90% as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s). In some examples, insulin sensitivity is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%, at least 100%), at least 200%, at least 300% or at least 500%, as compared to an absence of
administration of the VDR agonist(s) and BRD9 antagonist(s). In some examples, glucose tolerance is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%, at least 100%, at least 200%, at least 300% or at least 500%, as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s). In some examples, insulin secretion is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%, at least 100%, at least 200%, at least 300% or at least 500%), as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s). In some examples, beta cell function is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%, at least 100%, at least 200%), at least 300% or at least 500%, as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s). In some examples, the size or number of islets is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%), at least 100%, at least 200%, at least 300% or at least 500%, as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s). In some examples, beta cell death is reduced in the treated subject by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, or at least 90% as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s). In some examples, insulin granules (e.g., the amount or number of) is increased in the treated mammal by at least 10%, at least 20%, at least 30%, at least 50%, at least 75%, at least 90%), at least 100%, at least 200%, at least 300% or at least 500%, as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s). In some examples, combinations of these reductions are achieved. In addition, provided are methods of reducing fibrosis, such as fibrosis of the liver, pancreas, or kidney. Such methods can include administering therapeutically effective amounts of one or more VDR agonists to a mammal (such as one with type II diabetes), and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal, thereby reducing fibrosis. In some examples, fibrosis is reduced in the treated mammal by at least 10%, at least 20%), at least 30%>, at least 50%, at least 75%, or at least 90% as compared to an absence of administration of the VDR agonist(s) and BRD9 antagonist(s).
In some examples, the disclosed methods of administering a therapeutically effective amount of one or more VDR agonists to a mammal, and administering a therapeutically effective amount of one or more BRD9 antagonists to the mammal treats a disease, such as a liver disease, kidney disease, or pancreatic disease in the subject. Examples of liver diseases that can be treated using the disclosed methods include one or more of alcohol liver disease, fatty liver disease, liver fibrosis/cirrhosis, biliary fibrosis/ cirrhosis, liver cancer, hepatitis B virus infection, hepatitis C virus infection, sclerosing cholangitis, Budd-Chiari syndrome, jaundice, nonalcoholic
steatohepatitis, hemochromatosis, and Wilson's disease. In some examples the liver cancer is a hepatocellular carcinoma, cholangiocarcinoma, angiosarcoma, or hemangiosarcoma. Examples of pancreatic diseases that can be treated with the disclosed methods include but are not limited to pancreatitis, pancreatic fibrosis and pancreatic ductal adenocarcinoma (PDA). In some examples, the kidney disease is fibrosis of the kidney.
The disclosed methods can further include administering one or more additional therapeutic compounds, such as those used to regulate insulin, blood sugar, or reduce inflammation, such as insulin, an alpha-glucosidase inhibitor, amylin agonist, dipeptidyl-peptidase 4 (DPP-4) inhibitor, meglitinide, sulfonylurea, or a peroxisome proliferator-activated receptor (PPAR)-gamma agonist.
In some examples, the subject is a mammal, such as a human, cat, or dog. In some examples, the subject has diabetes. Methods of administration are routine, and can include subcutaneous, intraperitoneal, intrathecal, intramuscular, or intravenous injection or infusion. In some examples, use of VDR agonists with BRD9 antagonists does not lead to (or significantly reduces, such as a reduction of at least 20%, at least 50%, at least 75%, or at least 90%) the adverse side effects observed with thiazolidinediones (TZDs) therapeutic insulin sensitizers, including weight gain, increased liver steatosis and bone fractures (e.g., reduced effects on bone mineral density, trabecular bone architecture and cortical bone thickness).
In some examples, the one or more VDR agonists and one or more BRD9 antagonists are administered concurrently. In some examples, the one or more VDR agonists and one or more BRD9 antagonists are administered sequentially. In some examples, the therapeutically effective amount of the one or more VDR agonists is at least 0.01 mg/kg, such as at least 0.1 mg/kg, or at least 0.5 mg/kg. In some examples, the therapeutically effective amount of the one or more BRD9 antagonists is at least 0.1 mg/kg, such as at least 1 mg/kg, or at least 10 mg/kg. In some examples, the one or more VDR agonists, one or more BRD9 antagonists, or both, are part of a nanoparticle.
In some examples the VDR agonist (or composition containing such) can increase the biological activity of the VDR by at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 100%, at least 200%, at least 300%, at least 400% or at least 500%, as compared to the biological activity in the absence of the compound. Thus in one example, a compound that increases the biological activity of a VDR protein can decrease fasting blood glucose by at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 80%, or at least 90%, as compared to an absence of the agonist. In one example, VDR agonist activity is determined by monitoring expression of VDR target genes such as Cyp24Al . Thus, in some examples the VDR agonist (or composition containing such) can increase Cyp24Al expression by at least 25%, at least 50%, at least 75%, at least 90%, at least 95%, at least 100%, at least 200%, at least 300%, at least 400% or at least 500%, as compared to the biological activity in the absence of the compound. In some embodiments, the VDR agonist is not significantly degraded by Cyp24Al .
Examples of VDR agonists include but are not limited to: vitamin D, a vitamin D precursor, a vitamin D analog, a vitamin D receptor ligand, a vitamin D receptor agonist precursor, or combinations thereof. Specific examples of VDR agonists include but are not limited to calcipotriol, 25-hydroxy-D3 (25-OH-D3) (calcidiol); vitamin D3 (cholecalciferol); vitamin D2 (ergocalciferol), l,a25-dihydroxyvitamin D3 (calcitriol), and combinations thereof.
A BRD9 antagonist need not completely inhibit BRD9 protein activity. In some examples, such compounds reduce BRD9 protein activity by at least 10%, at least 20%, at least 25%, at least 40%, at least 50%, at least 75%, at least 80%, at least 90%, at least 95%, or at least 99%. In some examples, a BRD9 antagonist binds in the pocket of BRD9 where the acetylated lysine (K-91) binds. Examples of BRD9 antagonists include but are not limited to: I-BRD-9, TP742, BI-7273, BI-9564, dBRD9, GNE-375 and LP-99.
In some examples, the one or more VDR agonists comprises calcipotriol and the one or more BRD9 antagonists comprises I-BRD9.
Also provided are compositions that include one or more VDR agonists, and one or more
BRD9 antagonists. In some examples, the one or more VDR agonists, and one or more BRD9 antagonists, or both, are part of a nanoparticle. Examples of nanoparticles that can be used in the disclosed compositions and methods include, but are not limited to those provided in US
Publication Nos. 20130287688, 20130287857, 20100233251, 20100092425, 20120027808, 20080226739, and 20050215507 and U.S. Pat. Nos. 7,427,394, 8,343,497, 8,562,998, 7,550,441, 7,727,969, 8,343,498, and 8,277,812, all herein incorporated by reference. In some examples the nanoparticle is a lipid or polymeric nanoparticle. In a specific example, the nanoparticle includes a linear-dendritic hybrid polymer for encapsulating biologically active materials, comprising: a ligand for a predetermined target; a dendron; and a polyethylene glycol (PEG) chain linking the ligand to the dendron. In some examples the nanoparticle includes on its surface one or more of albumin (such as BSA), retinol binding protein, mannose-6-phosphase modified albumin, a fatty acid ester, a retinyl ester, and a linear-dendritic hybrid polymer. In some examples, the
nanoparticle is between about 0.1 nm and 5000 nm in diameter, such as 1-100 nm, 0.1-1 nm, 5-20 nm, 5-15 nm, 10-5,000 nm, 20-1,000 nm, 10-500 nm, 10-200 nm, 10-150 nm, 10-100 nm, 10-25 nm, 20-40 nm, or 10, 15, 20, 25, 35, 45, 50, 75, 100, 150 or 200 nm in diameter In some examples, the composition includes a pharmaceutically acceptable carrier.
Also provided are kits that include one or more VDR agonists, and one or more BRD9 antagonists, for example in the same or separate containers. In some examples, the one or more VDR agonists, and one or more BRD9 antagonists, or both, are part of a nanoparticle. In one example, the nanoparticle is or includes a lipid nanoparticle and/or a polymeric nanoparticle. Such compositions and kits can further include at least one additional therapeutic compound, such as insulin, an alpha-glucosidase inhibitor, amylin agonist, dipeptidyl-peptidase 4 (DPP-4) inhibitor, meglitinide, sulfonylurea, or a peroxisome proliferator-activated receptor (PPAR)-gamma agonist. Exemplary PPAR-gamma agonists include a thiazolidinedione (TZD), aleglitazar, farglitazar, muraglitazar, and tesaglitazar. Exemplary TZDs include pioglitazone, rosiglitazone, rivoglitazone, and troglitazone. Other exemplary additional compounds are provided herein.
Treatment Using VDR Agonists and BRD9 Antagonists
Methods of using a combination VDR agonist and BRD9 antagonist are provided. One or more VDR agonists and one or more BRD9 antagonists, such as 1, 2, 3, 4 or 5 different VDR agonists and 1, 2, 3, 4 or 5 different BRD9 antagonists (such as one VDR agonist and one BRD9 antagonist), can be administered in therapeutically effective amounts, for example to reduce blood glucose, reduce fed and fasting blood glucose, reduce fibrosis, increase insulin sensitivity, increase glucose tolerance, increase insulin secretion, increase beta cell function, increase the size of islets, reduce beta cell death, increase insulin granules or combinations thereof, in a mammal. For example, such methods can be used to treat a disease, for example type II diabetes, an autoimmune disease, or fibrosis (such as fibrosis of the liver, pancreas or kidney). In fact, such methods are useful to treat any disease or condition where increased VDR activity is beneficial. In some examples, such effects are observed for at least one week after treatment, at least two weeks after treatment, at least three weeks after treatment, at least one month after treatment, at least five weeks after treatment, at least six weeks after treatment, at least seven weeks after treatment, at least eight weeks after treatment, or at least two months after treatment (such as after a single dose of a VDR agonist and a single dose of a BRD9 antagonist). In some examples, such effects are observed within 1 week after treatment, within 2 weeks after treatment, within 3 weeks after treatment, within 4 weeks after treatment, within 5 weeks after treatment, within 6 weeks after treatment, within 7 weeks after treatment, within 8 weeks after treatment, within 9 weeks after treatment, within 10 weeks after treatment, within 11 weeks after treatment, or within 12 weeks after treatment (such as after a single dose of a VDR agonist and a single dose of a BRD9 antagonist).
The one or more VDR agonists and one or more BRD9 antagonists can be administered to humans or other mammals by any means, including orally, intravenously, intramuscularly, intraperitoneally, intranasally, intradermally, intrathecally, subcutaneously, via inhalation or via suppository. In one non-limiting example, the one or more VDR agonists and one or more BRD9 antagonists are administered via injection. Administration can be systemic or local. In some examples, site-specific administration of the composition can be used, for example by
administering one or more VDR agonists and one or more BRD9 antagonists to pancreas tissue (for example by using a pump, or by implantation of a slow release form at the site of the pancreas). The particular mode of administration and the dosage regimen can be selected by the attending clinician, taking into account the particulars of the case. Treatment can involve daily or multi-daily (e.g., twice daily, 3x daily, 4x daily), or less than daily (e.g., twice weekly, every other week, monthly, every 7 days, every 10 days, every 14 days, every 30 days, every 60 days, etc.) doses over a period of a few days, few weeks, to months, or even years. For example, a therapeutically effective amount of one or more VDR agonists and one or more BRD9 antagonists can be administered in a single dose, twice daily, twice a week, three times a week, weekly, every other week, or in several doses, for example daily, or during a course of treatment. In a particular non- limiting example, treatment involves once daily dose, twice daily dose, once weekly dose, every other week dose, or monthly dose.
The amount of VDR agonist(s) and BRD9 antagonist(s) administered can be dependent on the subject being treated, the severity of the affliction, and the manner of administration. Within these bounds, the formulation to be administered will contain a quantity of the VDR agonist(s) and BRD9 antagonist(s) in amounts effective to achieve the desired effect in the subject being treated. For example, a therapeutically effective amount of VDR agonist(s) and BRD9 antagonist(s) can be the amount of each necessary to treat diabetes, treat fibrosis, treat an autoimmune disease, or reduce blood glucose levels (for example a reduction of at least 5%, at least 10% or at least 20%, for example relative to no administration of VDR agonist(s) and BRD9 antagonist(s)).
In some examples, the VDR agonist(s) and BRD9 antagonist(s) are administered in combination (such as sequentially or simultaneously or contemporaneously) with one or more other agents, such as those useful in the treatment of diabetes or insulin resistance (e.g., insulin), those useful in the treatment of fibrosis (e.g., one or more nuclear receptor ligands), or those useful in the treatment of autoimmune disorders (e.g., steroid such as prednisone, immunosuppressants).
Anti-diabetic agents are generally categorized into six classes: biguanides (e.g., metformin); thiazolidinediones (including rosiglitazone (Avandia®), pioglitazone (Actos®), rivoglitazone, and troglitazone); sulfonylureas; inhibitors of carbohydrate absorption; fatty acid oxidase inhibitors and anti-lipolytic drugs; and weight-loss agents. Any of these agents can also be used in the methods or compositions disclosed herein. Exemplary anti -diabetic agents include those disclosed in Diabetes Care, 22(4):623-634. One class of anti-diabetic agents of use is the sulfonylureas.
Another class of anti-diabetic agents is the biguanide antihyperglycemics. Other examples are provided herein.
In some examples, the VDR agonist(s) and BRD9 antagonist s) can be administered in combination with effective doses of anti -diabetic agents (such as biguanides, thiazolidinediones, or incretins) and/or lipid lowering compounds (such as statins or fibrates). The terms "administration in combination," "co-administration," or the like, refer to both concurrent and sequential administration of the active agents. Administration of the VDR agonist(s) and BRD9 antagonist(s), may also be in combination with lifestyle modifications, such as increased physical activity, low fat diet, low sugar diet, and smoking cessation.
Additional agents that can be used in combination with the VDR agonist(s) and BRD9 antagonist(s) include, without limitation, anti-apoptotic substances such as the Nemo-Binding Domain and compounds that induce proliferation such as cyclin dependent kinase (CDK)-6, CDK- 4 and Cyclin Dl . Other active agents can be utilized, such as antidiabetic agents for example, insulin, metformin, sulphonylureas (e.g., glibenclamide, tolbutamide, glimepiride), nateglinide, repaglinide, thiazolidinediones (e.g., rosiglitazone, pioglitazone), peroxisome proliferator-activated receptor (PPAR)-gamma-agonists (such as C 1262570) and antagonists, PPAR-gamma/alpha modulators (such as KRP 297), alpha-glucosidase inhibitors (e.g., acarbose, voglibose), Dipeptidyl peptidase (DPP)-IV inhibitors (such as LAF237, MK-431), alpha2-antagonists, agents for lowering blood sugar, cholesterol-absorption inhibitors, 3-hydroxy-3-methylglutaryl-coenzyme A
(HMGCoA) reductase inhibitors (such as a statin), insulin and insulin analogues, GLP-1 and GLP- 1 analogues (e.g., exendin-4) or amylin. In some embodiments the agent is an immunomodulatory factor such as anti-CD3 mAb, growth factors such as HGF, vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), lactogens, or parathyroid hormone-related protein (PTHrP).
In some embodiments, methods are provided for treating diabetes or pre-diabetes in a subject by administering a therapeutically effective amount of a composition including the VDR agonist(s) and BRD9 antagonist(s), to the subject. The subject can have T2D. The subject can be any mammalian subject, including human subjects and veterinary subjects such as cats and dogs. The subject can be a child or an adult. The subject can also be administered insulin. The method can include measuring blood glucose levels.
In some examples, the method includes selecting a subject with diabetes, such as T2D, or a subject at risk for diabetes, such as a subject with pre-diabetes. These subjects can be selected for treatment with the VDR agonist(s) and BRD9 antagonist(s). In some examples, a subject with diabetes may be clinically diagnosed by a fasting plasma glucose (FPG) concentration of greater than or equal to 7.0 millimole per liter (mmol/L) (126 milligram per deciliter (mg/dL)), or a plasma glucose concentration of greater than or equal to 11.1 mmol/L (200 mg/dL) at about two hours after an oral glucose tolerance test (OGTT) with a 75 gram (g) load, or in a patient with classic symptoms of hyperglycemia or hyperglycemic crisis, a random plasma glucose concentration of greater than or equal to 11.1 mmol/L (200 mg/dL), or HbAlc levels of greater than or equal to 6.5%. In other examples, a subject with pre-diabetes may be diagnosed by impaired glucose tolerance (IGT). An OGTT two-hour plasma glucose of greater than or equal to 140 mg/dL and less than 200 mg/dL (7.8-11.0 mM), or a fasting plasma glucose (FPG) concentration of greater than or equal to 100 mg/dL and less than 125 mg/dL (5.6-6.9 mmol/L), or HbAlc levels of greater than or equal to 5.7% and less than 6.4%> (5.7-6.4%) is considered to be IGT, and indicates that a subject has pre-diabetes. Additional information can be found in Standards of Medical Care in Diabetes— 2010 (American Diabetes Association, Diabetes Care 33 : S 11-61, 2010).
In some examples, the subject treated with the VDR agonist(s) and BRD9 antagonist(s) has HbAlC of greater than 6.5% or greater than 7%.
In some examples, treating diabetes (such as T2D) includes one or more of increasing glucose tolerance (such as an increase of at least 5%, at least 10%, at least 20%, or at least 50%, for example relative to no administration of the VDR agonist(s) and BRD9 antagonist(s), decreasing insulin resistance (for example, decreasing plasma glucose levels, decreasing plasma insulin levels, or a combination thereof, such as decreases of at least 5%, at least 10%, at least 20%, or at least 50%), for example relative to no administration of the VDR agonist(s) and BRD9 antagonist(s)), decreasing serum triglycerides (such as a decrease of at least 10%, at least 20%, or at least 50%, for example relative to no administration of the VDR agonist(s) and BRD9 antagonist(s), decreasing free fatty acid levels (such as a decrease of at least 5%, at least 10%, at least 20%, or at least 50%, for example relative to no administration of the VDR agonist(s) and BRD9 antagonist s)), and decreasing HbAlc levels in the subject (such as a decrease of at least 0.5%, at least 1%, at least 1.5%, at least 2%, or at least 5% for example relative to no administration of the VDR agonist(s) and BRD9 antagonist(s)). In some embodiments, the disclosed methods include measuring glucose tolerance, insulin resistance, plasma glucose levels, plasma insulin levels, serum triglycerides, free fatty acids, and/or HbAlc levels in a subject.
In some examples, administration of the VDR agonist(s) and BRD9 antagonist(s) treats T2D or pre-diabetes, by decreasing of HbAlC, such as a reduction of at least 0.5%, at least 1%, or at least 1.5%, such as a decrease of 0.5% to 0.8%, 0.5% to 1%, 1 to 1.5% or 0.5% to 2%. In some examples the target for HbAlC is less than about 6.5%, such as about 4-6%, 4-6.4%, or 4-6.2%. In some examples, such target levels are achieved within about 26 weeks, within about 40 weeks, or within about 52 weeks. Methods of measuring HbAlC are routine, and the disclosure is not limited to particular methods. Exemplary methods include HPLC, immunoassays, and boronate affinity chromatography.
In some examples, administration of the VDR agonist(s) and BRD9 antagonist(s) treats diabetes or pre-diabetes by increasing glucose tolerance, for example, by decreasing blood glucose levels (such as two-hour plasma glucose in an OGTT or FPG) in a subject. In some examples, the method includes decreasing blood glucose by at least 5% (such as at least 10%, at least 15%, at least 20%), at least 25%, at least 30%, at least 35%, or more) as compared with a control (such as no administration of any of insulin, VDR agonist(s), or BRD9 antagonist(s). In particular examples, a decrease in blood glucose level is determined relative to the starting blood glucose level of the subject (for example, prior to treatment with the VDR agonist(s) and BRD9 antagonist(s). In other examples, decreasing blood glucose levels of a subject includes reduction of blood glucose from a starting point (for example greater than about 126 mg/dL FPG or greater than about 200 mg/dL OGTT two-hour plasma glucose) to a target level (for example, FPG of less than 126 mg/dL or OGTT two-hour plasma glucose of less than 200 mg/dL). In some examples, a target FPG may be less than 100 mg/dL. In other examples, a target OGTT two-hour plasma glucose may be less than 140 mg/dL. Methods to measure blood glucose levels in a subject (for example, in a blood sample from a subject) are routine.
In other embodiments, the disclosed methods include comparing one or more indicators of diabetes (such as glucose tolerance, triglyceride levels, free fatty acid levels, or HbAlc levels) to a control (such as no administration of insulin, VDR agonist(s) or BRD9 antagonist(s)), wherein an increase or decrease in the particular indicator relative to the control (as discussed above) indicates effective treatment of diabetes. The control can be any suitable control against which to compare the indicator of diabetes in a subject. In some embodiments, the control is a sample obtained from a healthy subject (such as a subject without diabetes). In some embodiments, the control is a historical control or standard reference value or range of values (such as a previously tested control sample, such as a group of subjects with diabetes, or group of samples from subjects that do not have diabetes). In further examples, the control is a reference value, such as a standard value obtained from a population of normal individuals that is used by those of skill in the art. Similar to a control population, the value of the sample from the subject can be compared to the mean reference value or to a range of reference values (such as the high and low values in the reference group or the 95% confidence interval). In other examples, the control is the subject (or group of subjects) treated with placebo compared to the same subject (or group of subjects) treated with the therapeutic compound in a cross-over study. In further examples, the control is the subject (or group of subjects) prior to treatment.
Treatment or Prevention of Fibrosis
In some examples, the disclosed methods can be used to reduce fibrosis (for example by decreasing the fibrotic content of a fibrotic liver, kidney or pancreas). Thus, in some examples, the method reduces fibrosis (for example by decreasing the fibrotic content of a fibrotic liver, kidney or pancreas) by at least 10%, at least 20%, at least 25%, at least 40%, at least 50%, at least 75%, at least 80%), at least 90%, or at least 95%, as compared to an absence of the treatment with the VDR agonist(s) and BRD9 antagonist(s). In some examples, the disclosed methods are prophylactic. For example, the method can include administering a subject at risk for developing fibrosis a therapeutic composition that includes a VDR agonist(s) and a BRD9 antagonist(s). Such prophylactic administration can delay the onset of the symptoms of fibrosis of the liver, kidney or pancreas. For example, prophylactic administration of a composition that includes a VDR agonist(s) and BRD9 antagonist(s) can be used to prevent the onset of one or more symptoms or features of fibrosis. For example, as an organ undergoes fibrosis, the functional cellular mass of the organ is reduced as it is replaced by scar tissue (collagens and other abnormal matrix components). In addition, fibrosis causes architectural disorganization that can diminish function and lead to pathology, such as portal hypertension and increased risk of hepatocellular carcinoma in the case of the liver. Severe portal hypertension usually manifests as bleeding esophageal/gastric varices and/or ascities. In the kidney and pancreas the features of advanced fibrosis are renal failure and endocrine and/or exocrine pancreatic failure. The VDR agonist(s) and BRD9 antagonist(s) can be used for treatment of fibrosis in combination with other therapeutic agents, such as chemotherapies and biotherapies. In one example, the other therapeutic agents include one or more nuclear receptor ligands, including but not limited to ligands for peroxisome proliferator-activated receptor-gamma (PPAR-γ, R1C3), peroxisome proliferator-activated receptor-alpha (PPAR-a, R1C1) and peroxisome proliferator- activated receptor-delta (PPAR-δ, R1C2), farnesoid X receptor (FXR, NR1H4), interferon- gamma (IFN-γ), angiotensin converting enzyme inhibitors, angiotensin II receptor antagonists, ursodeoxycholic acid (UDCA), curcumin, anti-oxidants including, but not limited to vitamin E, retinoids such as Vitamin A, and therapies that deliver proteases to the liver to degrade pathological ECM. In some examples, other therapeutic agents are part of a composition provided herein.
Exemplary VDR Agonists
The disclosed methods and compositions use or include one or more VDR agonists (such as a VDR ligand) that can bind to and activate the VDR. VDR agonists include but are not limited to la,25(OH)2-D3 and precursors and analogs thereof, VDR ligands, and VDR agonist precursors.
The disclosure is not limited to particular vitamin D agonists. A variety of biologically active vitamin D agonists are contemplated.
In some examples, la,25(OH)2D3 or a vitamin D precursor or analog is used as a VDR agonist. It is not necessary to use the most biologically active form of vitamin D to achieve a beneficial therapeutic effect. The naturally occurring ligand of the vitamin D receptor is calcitriol.
In one embodiment, precursors of calcitriol (such as calcidiol) are administered to a subject, and are then converted within the target cell population to calcitriol.
In addition, hepatic stellate cells (HSCs) express CYP24A1, a cytochrome P450 enzyme that terminates the biological effect of calcitriol by side chain hydroxylation. Thus, in one embodiment, a VDR ligand or other VDR agonist or agonist precursor that is resistant to deactivation by CYP24A1 is used to achieve more effective and longer lasting VDR activation in target cell populations. In specific examples, the VDR ligand is one that can be activated by
CYP27B 1 while being resistant to deactivation by CYP24A1.
Exemplary VDR agonists include those molecules that activate the VDR. Methods of determining if an agent is a VDR agonist are routine. For example, induction of CYP24A1 expression can be measured in cells that express VDR after contact with the agent, wherein an increase in CYP24A1 expression (such as a 10- to 20-fold increase in expression) indicates that the agent is a VDR agonist. Other methods include transfected reporter gene constructs and FRET assays. In some examples, binding of an agonist to a purified LBD is detected by measuring induced recruitment for coactivator peptides (e.g., LXXLL). For example VDR agonists can increase CYP24A1 expression in a VDR-expressing cell by at least 20%, at least 50%, at least 75%, at least 80%, at least 90% at least 100%, at least 200% or even at least 1000% or more as compared to the absence of the agonist.
VDR agonists include vitamin D compounds, precursors and analogs thereof. Vitamin D compounds include, but are not limited to compounds which have at least one of the following features: the C-ring, D-ring and 3P-hydroxycyclohexane A-ring of vitamin D interconnected by the 5,7 diene double bond system of vitamin D together with any side chain attached to the D-ring (e.g., compounds with a 'vitamin D nucleus' and substituted or unsubstituted A-, C-, and D-rings interconnected by a 5,7 diene double bond system typical of vitamin D together with a side chain attached to the D-ring).
Vitamin D analogs include those non-secosteroid compounds capable of mimicking various activities of the secosteroid calcitriol. Examples of such compounds include, but are not limited to, LG190090, LG190119, LG190155, LG190176, and LG1900178 (See, Boehm et al, Chemistry & Biology 6:265-275, 1999).
Vitamin D compounds include those vitamin D compounds and vitamin D analogs which are biologically active in vivo, or are acted upon in a mammalian subject such that the compound becomes active in vivo. Examples of such compounds include, but are not limited to: vitamin D, calcitriol, and analogs thereof [e.g., la-hydroxyvitamin D3 (la-OH-D3), 1,25-dihydroxyvitamin D2 (l,25-(OH)2D2), la-hydroxyvitamin D2 (la-OH-D2), la,25-(OH)2 -16-ene-D3, la,25-(OH)2 -24- oxo-16-ene-D3, la,24R(OH)2-D3, la,25(OH)2-22 -oxa-D3, 20-epi-22-oxa-24a,24b,-dihomo- la,25(OH)2-D3; 20 -epi-22-oxa-24a,26a,27a,-trihomo-la25(OH)2-D3, 20-epi-22-oxa-24homo- la,25(OH)2-D3, l,25-(OH)2-16,23E-diene-26-trifluoro-19-nor-D3, and nonsecosteroidal vitamin D mimics.
In one example, the VDR agonist is one or more of the following vitamin D, 1,α25 dihydroxyvitamin D3, calcipotriol, la-hydroxyvitamin D3, 1,25-dihydroxyvitamin D2 , la- hydroxyvitamin D2, la,25-(OH)2 -16-ene-D3, la,25-(OH)2 -24-oxo-16-ene-D3, la,24R(OH)2-D3, la,25(OH)2-22 -oxa-D3, 20-epi-22-oxa-24a,24b,-dihomo-la,25(OH)2-D3, 20-epi-22-oxa- 24a,26a,27a,-trihomo-la25(OH)2-D3, 20-epi-22-oxa-24homo-la,25(OH)2-D3, and l,25-(OH)2- 16,23E-diene-26-trifluoro- 19-nor-D3.
In a one embodiment, the biologically active vitamin D compound is selected from 1,α25- dihydroxyvitamin D3, 19-nor-l,25-dihydroxyvitamin D2, 19-nor-l,25-dihydroxy-21-epi-vitamin D3, 1, 25-dihydroxy-24-homo-22-dehydro-22E- vitamin D3, and 19-nor-l,25-dihydroxy-24-homo- 22-dehydro-22E-vitamin D3, and non-secosteroidal vitamin D mimics. In an additional example, the biologically active VDR agonist is selected from the analogs represented by the following formula:
Figure imgf000029_0001
wherein X1 and X2 are each selected from the group consisting of hydrogen and acyl; wherein Y1 and Y2 can be H, or one can be O-aiyl or O-alkyl while the other is hydrogen and can have a β or a configuration, Z1 and Z2 are both H, or Z1 and Z2 taken together are CH2; and wherein R is an alkyl, hydroxyalkyl or fluoroalkyl group, or R may represent the following side chain:
Figure imgf000029_0002
wherein (a) may have an S or R configuration and wherein R1 represents hydrogen, hydroxy or O- acyl, R2 and R3 are each selected from the group consisting of alkyl, hydroxyalkyl and fluoroalkyl, or, when taken together represent the group ~(CH2)m~ where (m) is an integer having a value of from 2 to 5, R4 is selected from the group consisting of hydrogen, hydroxy, fluorine, O-acyl, alkyl, hydroxyalkyl and fluoroalkyl, R5 is selected from the group consisting of hydrogen, hydroxy, fluorine, alkyl, hydroxyalkyl and fluoroalkyl, or, R4 and R5 taken together represent double-bonded oxygen, R6 and R7 taken together form a carbon-carbon double bond and R8 may be H or C¾, and wherein (n) is an integer having a value of from 1 to 5, and wherein the carbon at any one of positions 20, 22, or 23 in the side chain may be replaced by an O, S, or N atom.
In one example, the VDR agonists do not cause symptoms of hypercalcemia when administered to a subject. In another example, the VDR agonists do not generate as much (i.e., a lesser degree) of a calcemic response as compared to calcitriol when administered to a subject. In one example, VDR agonists have low calcemic response characteristics as compared to calcitriol. In another embodiment, these compounds are selected from la,25-(OH)2 -24-epi-D2, la,25-(OH)2- 24a-Homo-D3, 1α,25-(ΟΗ)2 24a-Dihomo-D3, 1α,25-(ΟΗ)2 -19-nor-D3, and 20-epi-24-homo-la,25- (OH)2-D3.
Other exemplary VDR agonists that can be used are provided in Table 1.
Table 1. l,25-(OH)2D3 and its synthetic analogs (taken from Nagpal et al., Endocr. Rev.
2005;26:662-687)
Figure imgf000030_0002
Figure imgf000030_0001
Figure imgf000030_0003
In one example, therapeutically effective doses of vitamin D2 and D3 range, from about 50 IU to about 50,000 IU. In some embodiments, vitamin D2 and/or D3 is administered in an oral dose of, for example, less than about 75 IU, about 100 IU, about 250 IU, about 500 IU, about 750 IU, about 1,000 IU, about 1,500 IU, about 2,000 IU, about 2,500 IU, about 5,000 IU, about 7,500 IU, about 10,000 IU, about 15,000 IU, about 20,000 IU, about 25,000 IU, about 40,000 IU, or about 50,000 IU, or more. In other embodiments, calcitriol is administered in a dose of from 0.001 to 10 micrograms. For instance, calcitrol is administered, in some embodiments, in a dose of about 0.01 μg, about 0.05 μg, about 0.1 μg, about 0.25 μg, about 0.5 μg, about 1 μg, about 5 μg, or about 10 In one example, the VDR agonist is cholecalciferol or calcidiol. In some examples, a higher dose than usual is administered, but with less frequency, for example, 50,000 to 500,000 units weekly.
In another embodiment, if the VDR agonist is not a la-hydroxy compound, a daily dose between 1.0 and 100 μg per day per 160 pound patient is administered, such as between 5.0 and 50 μg per day per 160 pound patient. In a different embodiment, if the biologically active vitamin D compound is a la-hydroxy compound, a daily dose of between 0.1 and 20 μg per day per 160 pound patient is administered, while a preferred dose is between 0.5 and 10 μ per day per 160 pound patient. In a particular example, the dose is between 3-10 μg per day. BRD9 Antagonists
The disclosed methods and compositions use or include one or more BRD9 antagonists. In some examples, the BRD9 antagonist is specific for BRD9. BRD9 antagonists include but are not limited to I-BRD9, TP742, BI-7273, BI-9564, dBRD9, G E-375 and LP-99, as well as BRD9 antagonists provided in Remillard et al., Angew. Chem. Int. Ed. 56: 1-7, 2017 and Theodoulou et al., J. Med. Chem. 99: 1425-39, 2016 (all herein incorporated by reference).
Figure imgf000032_0001
-31 -
Figure imgf000033_0001
BI-7273
Figure imgf000033_0002
BI-9564
Figure imgf000033_0003
dBRD9
Figure imgf000034_0001
G E-375
Figure imgf000034_0002
LP99
The disclosure is not limited to particular BRD9 antagonists. A variety of biologically active BRD9 antagonists are contemplated.
Methods of determining if an agent is a BRD9 antagonist are known. For example, the TR- FRET methods described in Theodoulou et al., J. Med. Chem. 99: 1425-39, 2016 can be used. Briefly, compounds can be incubated with Alexa Fluor647 ligand (GSK2833930A) in Greiner 384- well black low volume microtitre plates and incubated in the dark for 30 min at room temperature. Detection reagents can include Eu-W1024 Anti-6xHis antibody. The plates can be read to determine donor and acceptor counts. From this, the ratio of acceptor/donor is calculated (λεχ = 337 nm, em donor =615 nm, em acceptor = 665 nm) and used for data analysis. For example BRD9 antagonists can decrease BRD9 activity by at least 20%, at least 50%, at least 75%, at least 80%), at least 90% at least 100%, at least 200%> or even at least 1000%) or more as compared to the absence of the antagonist. Pharmaceutical Compositions
Pharmaceutical compositions that include one or more VDR agonists, and one or more BRD9 antagonists, are provided. In some examples, the one or more VDR agonists, and one or more BRD9 antagonists, or both, are part of a nanoparticle. Such compositions can be formulated with an appropriate pharmaceutically acceptable carrier, depending upon the particular mode of administration chosen.
Additional therapeutic agents, such as agents for the treatment of diabetes, can be included. Thus, the pharmaceutical compositions can include a therapeutically effective amount of another agent. Other active agents can be utilized, such as antidiabetic agents for example one or more of: insulin, metformin, meglitinide, sulphonylureas (e.g., glibenclamide, tolbutamide, glimepiride), nateglinide, repaglinide, thiazolidinediones (e.g., rosiglitazone, pioglitazone), an alpha-glucosidase inhibitor, a amylin agonist, peroxisome proliferator-activated receptor (PPAR)-gamma-agonists (such as C1262570, aleglitazar, farglitazar, muraglitazar, tesaglitazar, and TZD) and PPAR-γ antagonists, PPAR-gamma/alpha modulators (such as KRP 297), alpha-glucosidase inhibitors (e.g., acarbose, voglibose), dipeptidyl peptidase (DPP)-IV inhibitors (such as LAF237, MK-431), alpha2- antagonists, agents for lowering blood sugar, cholesterol-absorption inhibitors, 3-hydroxy-3- methylglutaryl-coenzyme A (HMGCoA) reductase inhibitors (such as a statin), insulin and insulin analogues, GLP-1 and GLP-1 analogues (e.g. exendin-4) or amylin. Exemplary TZDs that can be part of the composition include pioglitazone, rosiglitazone, rivoglitazone, and troglitazone.
The pharmaceutically acceptable carriers and excipients useful in this disclosure are conventional. See, e.g., Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, PA, 21st Edition (2005). For instance, parenteral formulations usually include injectable fluids that are
pharmaceutically and physiologically acceptable fluid vehicles such as water, physiological saline, other balanced salt solutions, aqueous dextrose, glycerol or the like. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, pH buffering agents, or the like, for example sodium acetate or sorbitan monolaurate. Excipients that can be included are, for instance, proteins, such as human serum albumin or plasma preparations.
Preparations for parenteral administration can include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti -oxidants, chelating agents, and inert gases and the like.
Formulations for topical administration, including topical administration of the VDR agonist(s) and BRD9 antagonist s) compositions provided herein, can include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
Therapeutic agents for oral administration, including oral administration of the VDR agonist(s) and BRD9 antagonist s) compositions provided herein, include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be included.
Therapeutic agents, including the VDR agonist(s) and BRD9 antagonist s) composition, can be administered as a pharmaceutically acceptable acid- or base-addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
In some embodiments, the composition including one or more VDR agonists, and one or more BRD9 antagonists is included in a controlled release formulation, for example, a
microencapsulated formulation. Various types of biodegradable and biocompatible polymers, methods can be used (see, for example, U.S. Patent Publication Nos. 2007/0148074;
2007/0092575; and 2006/0246139; U.S. Patent Nos. 4,522, 811; 5,753,234; and 7,081,489; PCT Publication No. WO/2006/052285; Benita, Microencapsulation: Methods and Industrial
Applications, 2nd ed., CRC Press, 2006).
In other embodiments, a composition including one or more VDR agonists, and one or more BRD9 antagonists is included in a nanodispersion system. Nanodispersion systems and methods for producing such nanodispersions are known See, e.g., U.S. Pat. No. 6,780,324; U.S. Pat.
Publication No. 2009/0175953. For example, a nanodispersion system includes a biologically active agent and a dispersing agent (such as a polymer, copolymer, or low molecular weight surfactant). Exemplary polymers or copolymers include polyvinylpyrrolidone (PVP), poly(D,L- lactic acid) (PLA), poly(D,L-lactic-co-glycolic acid (PLGA), poly(ethylene glycol). Exemplary low molecular weight surfactants include sodium dodecyl sulfate, hexadecyl pyridinium chloride, polysorbates, sorbitans, poly(oxyethylene) alkyl ethers, poly(oxyethylene) alkyl esters, and combinations thereof. In one example, the nanodispersion system includes PVP and ODP or a variant thereof (such as 80/20 w/w). In some examples, the nanodispersion is prepared using the solvent evaporation method, see for example, Kanaze et al, Drug Dev. Indus. Pharm. 36:292-301, 2010; Kanaze et al, J. Appl. Polymer Sci. 102:460-471, 2006.
Many types of release delivery systems for the composition including one or more VDR agonists, and one or more BRD9 antagonists can be used. Examples include polymer based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Patent No. 5,075,109. Delivery systems also include non-polymer systems, such as lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which the composition is contained in a form within a matrix such as those described in U.S. Patent Nos. 4,452,775; 4,667,014; 4,748,034; 5,239,660; and 6,218,371 and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Patent Nos. 3,832,253 and 3,854,480. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
Use of a long-term sustained release implant may be particularly suitable for treatment of chronic conditions, such as type II diabetes and autoimmune disorders. Long-term release, as used herein, means that the implant is constructed and arranged to deliver therapeutic levels of the active ingredient for at least 30 days, such as at least 60 days. Long-term sustained release implants include some of the release systems described above (see U.S. Patent No. 6,218,371).
The dosage form of the pharmaceutical composition can be determined by the mode of administration chosen. For instance, in addition to injectable fluids, topical, inhalation, oral, and suppository formulations can be employed. Topical preparations can include eye drops, ointments, sprays, patches, and the like. Inhalation preparations can be liquid (e.g., solutions or suspensions) and include mists, sprays and the like. Oral formulations can be liquid (e.g., syrups, solutions or suspensions), or solid (e.g., powders, pills, tablets, or capsules). Suppository preparations can also be solid, gel, or in a suspension form. For solid compositions, conventional non-toxic solid carriers can include pharmaceutical grades of mannitol, lactose, cellulose, starch, or magnesium stearate. Methods of preparing such dosage forms are known.
The pharmaceutical compositions that include one or more VDR agonists, and one or more
BRD9 antagonists can be formulated in unit dosage form, suitable for individual administration of precise dosages. In one non-limiting example, a unit dosage contains from about 1 mg to about 1 g of one or more VDR agonists, such as about 10 mg to about 100 mg, about 50 mg to about 500 mg, about 100 mg to about 900 mg, about 250 mg to about 750 mg, or about 400 mg to about 600 mg. In other examples, a therapeutically effective amount of one or more VDR agonists protein is about 0.01 mg/kg to about 50 mg/kg, for example, about 0.05 mg/kg to about 10 mg/kg, about 0.05 mg/kg to about 0.1 mg/kg, about 0.01 mg/kg to about 0.1 mg/kg, or about 1 mg/kg to about 10 mg/kg. In one non-limiting example, a unit dosage contains from about 1 mg to about 5 g of one or more BRD9 antagonists, such as about 10 mg to about 100 mg, about 50 mg to about 500 mg, about 100 mg to about 1000 mg, about 250 mg to about 750 mg, or about 400 mg to about 800 mg. In other examples, a therapeutically effective amount of one or more BRD9 antagonists protein is about 0.01 mg/kg to about 50 mg/kg, for example, about 0.5 mg/kg to about 25 mg/kg, about 0.5 mg/kg to about 15 mg/kg, about 1 mg/kg to about 20 mg/kg, or about 1 mg/kg to about 10 mg/kg. The disclosure is illustrated by the following non-limiting Examples.
Example 1
Materials and Methods
This example describes the materials and methods used to obtain the results described in Examples 2 -8. Also see Wei et al., Cell 173 : 1-15, 2018, herein incorporated by reference in its entirety.
Differentiation of hiPSC to human β-like cells
The method of Yoshihara et al. (Cell metabolism 23, 622-634, 2016) was used. Briefly, hiPSCs (derived from HUVECs and including GFP under the control of the human insulin promoter, INS-GFP) were cultured to 90% confluency in complete mTeSR Media, at which time the media was changed to 100 ng/ml Activin (R&D Systems, 338- AC), 25 ng/ml Wnt3a (R&D Systems, 5036-WN) in differentiation media (800 ml DMEM/F12, 13.28 g BSA, 10 ml Glutamax, 560 mg NaHC03, 330 mg thiamine, 100 mg reduced glutathione, 3300 mg vitamin C, 14 μg selenium, 10 ml NEAA, 2 ml trace element B, 1 ml trace element C, 7 μΐ β-ΜΕ, 2 ml DLC, 2 ml GAB A, 2 ml LiCl, 129.7 μg pipecolic acid, insulin 2 mg up to 1,000 ml) for 2 days and then 100 ng/ml activin in differentiation media for another 2 days. Subsequently, media was replaced with differentiation media with 1 μΜ dorsomorphin (Biovision, 1656-5), 2 μΜ retinoic acid (Sigma, R2625-1G), 10 μΜ SB431542 (Sigma, S4317-5MG), and 1% B27 supplement (GfflCO, 17504- 044) for 7 days. Media was then replaced with 10 μΜ Forskolin (Sigma, F6886-25MG), 10 μΜ dexamethasone (Sigma, D4902-100MG), 10 μΜ Alk5 inhibitor II (Calbiochem, 616452 or Enzo, ALX-270-445), 10 mM nicotinamide (Sigma, 72340-100G), luM 3,3',5-Triiodo-L-thyronine sodium salt (T3), and 1% B27 supplement for 10 days. At day 21, the expression of F S-GFP is confirmed regularly by fluorescence microscopy.
CRISPR screening
"Drop off genome-wide CRISPR screening was performed using a protocol similar to that described previously (Wang et al., 2014, Science 343, 80-84). A Tet-ON inducible rtTA and subsequently a genomic lentiviral sgRNA library (Wang et al., 2014, Science 343, 80-84) were transduced into an INS (human insulin promoter)-GFP iPS cell line as reported (Yoshihara et al., 2016, Cell metabolism 23, 622-634). Selection with 3 different markers (puromycin for rtTA, blasticidin for sgRNA library and neomycin for insulin-GFP), generated an iPS cell line that contained both vectors. At least 5xl07 cells were maintained at every passage to guarantee the coverage of the library. The cells were placed under a standard differentiation protocol and the rtTA was induced after 2 weeks of differentiation, concurrent with INS-GFP expression.
Doxycycline was added for 1 week. Finally, the cells were FACS-sorted by GFP expression and both GFP+ and GFP- cells from the same batch were collected, genomic DNA extracted and libraries were prepared for high throughput sequencing. The sgRNA sequences were amplified with primers described in Wang et al. (Science 343, 80-84, 2014) and sequenced by an Illumina HiSeq 2000. The sequences were aligned and analyzed by MAGeCK (Li et al., 2014, Genome biology 15, 554).
Mice
The following mice strains were from Jackson: VDR KO (B6.129S4-VdrtmlMbd/J), B6 db
(B6.BKS(D)-Leprdb/J), BKS db (BKS.Cg-Dock7m +/+ Leprdb/J), C57BL6/J. Animals were maintained in a specific pathogen-free animal facility on a 12-hr light-dark cycle at an ambient temperature of 23°C. Water and food were provided ad lib. All animal experiments used age- matched male mice. VDR KO and control littermate mice were maintained on a VDR KO rescue diet containing 21% calcium, 0.67% phosphorus, and 20% lactose supplemented with 4.4 U vitamin D per gram diet.
Low-dose STZ induction
8 week old C57B16 male mice were injected intraperitoneally with streptozotocin (Sigma,
S0130) at the dose of 50mg/kg every day for 5 consecutive days. Blood glucose was measured 1 week after final injection and mice were separated into different treatment groups to ensure all groups had a similar starting glucose level. T2D animal model treatment
Db/db (B6) mice were grouped based on glucose levels at the age of 5 weeks. Treatments were started from 6 weeks and animals were treated with vehicle (30% 2-Hydroxypropyl- Cyclodextrin, Sigma, H-107) or drugs 3 times a week. Calcipotriol (Tocris, 60 ug/kg) and iBRD9 (R&D, 10 mg/kg) were dissolved in 30% β-cyclodextran and injected intraperitoneally 3 times a week. For db/db (BKS) mice, treatment started from age of 10 weeks. Calcipotriol (Tocris, 30ug/kg) and iBRD9 (R&D, 5 mg/kg) were dissolved in 30% β-cyclodextran and injected intraperitoneally 3 times a week.
RNA-Seq library generation
Total RNA was isolated from tissue or cell pellets using the RNA mini kit (Qiagen).
Sequencing libraries were prepared from 100-500 ng total RNA using the TruSeq RNA Sample Preparation Kit v2 (Illumina) according to the manufacturer's protocol. Briefly, mRNA was purified, fragmented, and used for first-, then second-strand cDNA synthesis followed by adenylation of 3' ends. Samples were ligated to unique adapters and subjected to PCR
amplification. Libraries were then validated using the 2100 BioAnalyzer (Agilent), normalized, and pooled for sequencing. RNA- Seq libraries prepared from two biological replicates for each experimental condition were sequenced on the Illumina Hi Seq 2000 using bar-coded multiplexing and a lOObp read length. High-throughput sequencing and analysis
Image analysis and base calling were performed with Illumina CASAVA-1.8.2. This yielded a median of 29.9M usable reads per sample. Short read sequences were mapped to a UCSC mm9 reference sequence using the RNA-seq aligner STAR (Dobin et al., 2013). Known splice junctions from mm9 were supplied to the aligner and de novo junction discovery was also permitted. Differential gene expression analysis, statistical testing and annotation were performed using Cuffdiff 2 (Trapnell et al., 2013). Transcript expression was calculated as gene-level relative abundance in fragments per kilobase of exon model per million mapped fragments and employed correction for transcript abundance bias (Roberts et al., 2011). RNA-Seq results for genes of interest were also explored visually using the UCSC Genome Browser.
Gene Expression Analysis by qPCR
Samples were run in triplicate and expression was normalized to the levels of the housekeeping controls RplpO (36b4) for human and mouse. Samples were analyzed by qPCR, using SYBR Green dye (Bio-rad). Statistical comparisons were made using Student's t test. Error bars are mean ± SEM. Primers used are shown below: rNfkbia FP: CTCTATCCATGGCTACCTGG (SEQ ID NO: 1)
rNfkbia RP: CCATTACAGGGCTCCTGAG (SEQ ID NO: 2)
rRela FP: TGTGAAGAAGCGAGACCTG (SEQ ID NO: 3)
rRela RP: TCCTCTATGGGAACTTGAAAGG (SEQ ID NO: 4)
rRelb FP: ATCGAGCTTCGAGACTGTG (SEQ ID NO: 5)
rRelb RP: AGTTGTTAAAGCTGTGCCG (SEQ ID NO: 6)
rNfkbl FP: GGGAGATGTGAAGATGCTG (SEQ ID NO: 7)
rNfkbl RP: AAGTGTAGGACACTGTCCC (SEQ ID NO: 8)
mCyp24Al FP: TGCCCTATTTAAAGGCCTGTCT (SEQ ID NO: 9)
mCyp24Al RP: CGAGTTGTGAATGGCACACTT (SEQ ID NO: 10)
mFbpl FP: ACGGATATCAGCACCCTGAC (SEQ ID NO: 11)
mFbpl RP: ATTGGTTGAGCCAGCGATAC (SEQ ID NO: 12)
mG6Pase FP: GACTGTGGGCATCAATCTCC (SEQ ID NO: 13)
mG6Pase RP: ACAGGTGACAGGGAACTGCT (SEQ ID NO: 14)
mPEPCK FP: TCTCTGATCCAGACCTTCCAA (SEQ ID NO: 15)
mPEPCK RP: GAAGTCCAGACCGTTATGCAG (SEQ ID NO: 16)
mIns2 FP: TTTGTCAAGCAGCACCTTTG (SEQ ID NO: 17)
mlns2 RP : TCT AC AATGCC ACGCTTCTG (SEQ ID NO : 18)
mCaspl FP: GAGAAATGAAGTTGCTGCTG (SEQ ID NO: 19)
mCaspl RP: CTTTCACCATCTCCAGAGC (SEQ ID NO: 20)
mCcl2 FP: CAACTCTCACTGAAGCCAG (SEQ ID NO: 21)
mCcl2 RP: TTAACTGCATCTGGCTGAG (SEQ ID NO: 22) mCxcll FP: CAGAGCTTGAAGGTGTTGC (SEQ ID NO: 23)
mCxcll RP: AGTGTGGCTATGACTTCGG (SEQ ID NO: 24)
mlllb FP: GAAATGCCACCTTTTGACAGTG (SEQ ID NO: 25)
mil lb RP: TGGATGCTCTCATCAGGACAG (SEQ ID NO: 26)
mI16 FP: TAGTCCTTCCTACCCCAATTTCC (SEQ ID NO: 27)
mI16 RP: TTGGTCCTTAGCCACTCCTTC (SEQ ID NO: 28)
mNlrp3 FP: ATCTTTGCTGCGATCAACAG (SEQ ID NO: 29)
mNlrp3 RP: TGATGTACACGTGTCATTCCA (SEQ ID NO: 30)
msXBPl FP: GAGTCCGCAGCAGGTG (SEQ ID NO: 31)
msXBPl RP: GTGTCAGAGAGTCCATGGGA (SEQ ID NO: 32)
mUcn3 FP: AAGTCCACTTACAGGGAGC (SEQ ID NO: 33)
mUcn3 RP: TAGAACTTGTGGGAGAGGC (SEQ ID NO: 34)
mPDXl FP: AAATCCACCAAAGCTCACG (SEQ ID NO: 35)
mPDXl RP: ATTCCTTCTCCAGCTCCAG (SEQ ID NO: 36)
mNkx6- 1 FP : GTACTTGGC AGGACC AGAG (SEQ ID NO : 37)
mNkx6-l RP: TTCTGGAACCAGACCTTGAC (SEQ ID NO: 38)
Isolation of Pancreatic Islets
Mouse pancreatic islets were isolated as previously described (Yoshihara et al., 2010, Nat. Commun 1 : 127) with slight modification. Briefly, 0.5 mg/ml collagenase P (Roche
REF11213873001, diluted in HBSS buffer, GIBCO, 14170-112) was injected through the common bile duct, and the perfused pancreas dissected and incubated at 37°C for 21 min. Digested exocrine cells and intact islets were separated via centrifugation (900 χ g for 15 min) over Histopaque-1077 (Sigma, H8889), and intact islets were manually selected. Human islets were provided by the Integrated Islets Distribution Program (see details below). j OP Dan or jD Sex Age (years R<¾es §¾ Cause of Oesin
1448 Male 45 Whits 40.4 C-Br>s¾ ovsscu§ar stro:ke
1503 Mste m hi e 33.94 Aooxsa
1741 Mate 52 mkte 22.1 Cwstommm t!sto fat.
Metabolic Cage Analyses
Metabolic cage analyses were conducted with a Comprehensive Lab Animal Monitoring System (Columbus Instruments). C02 production, O2 consumption, RER, and ambulatory counts by x-peak were determined for 3 consecutive days and nights, with at least 24 hr adaptation before data recording.
Histology (H&E staining, Immunohistochemistry and immunofluorescence)
For immunohistochemistry, FFPE tissues sections were deparaffinized and antigen retrieval performed using Vector Antigen Unmasking buffer (H3301). VectaStain ABC kit and ImmPACT DAB substrate (Vector Lab) were used to develop signal. Antibodies used: Pro-insulin (R&D, MAB13361, 1 : 100), insulin (Abeam, ab7842, 1 : 100), MAFA (Novus, NB400-137, 1 :50), NKX6-1 (Cell Signaling, 54551, 1 : 100), and Glucagon (Abeam, ab82270, 1 : 100). DAPI-containing mounting media (VECTASHIELD mounting medium for fluorescence) was used for nuclear staining. Immunostaining was visualized by ZEISS 780 confocal microscopy analysis.
Immunoprecipitation
Immunoprecipitations were performed as described previously (He et al., 2010, Mol. Cell 38, 428-38). Briefly, cells are lysed using ice-cold lysis buffer (HEPES 20mM pH8, EDTA 0.2mM, NaCl 0.3 mM, NP40 0.5%, 15% glycerol) for 15 min, and after centrifuging the supernatant was collected. For HA- or Flag-tagged proteins, immunoprecipitations were performed using HA-magnetic beads (Pierce, PI88836), or Flag-magnetic beads (Sigma, M8823) for 1.5 hr at 4°C. For other immunoprecipitations, primary antibodies were incubated with lysates for 2 hr followed by Protein A magnetic beads (Life Technologies, 1000 ID). After 3 washes with wash buffer (HEPES lOmM pH8, EDTA 0.2 mM, NaCl 0.3 mM, NP40 0.1%, 15% glycerol), the beads were boiled with NuPage LDS sample buffer and the lysates were stored at -20°C.
Mudpit Mass-spec
Samples were precipitated by methanol/chloroform. Dried pellets were dissolved in 8 M urea/100 mM TEAB, pH 8.5. Proteins were reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Sigma-Aldrich) and alkylated with 10 mM chloroacetamide (Sigma- Aldrich). Proteins were digested overnight at 37°C in 2 M urea/100 mM TEAB, pH 8.5, with trypsin (Promega). Digestion was quenched with formic acid, 5 % final concentration.
The digested samples were analyzed on a Fusion Orbitrap tribrid mass spectrometer
(Thermo). The digest was injected directly onto a 30cm, 75um ID column packed with BEH 1.7um C18 resin (Waters). Samples were separated at a flow rate of 200nl/min on a nLC 1000 (Thermo). Buffers A and B were 0.1% formic acid in water and acetonitrile, respectively. A gradient of 1- 30%B over 90min, an increase to 40%B over 30min, an increase to 90%B over another lOmin and held at 90%B for a final lOmin of washing was used for 140min total run time. Column was re- equilibrated with 20ul of buffer A prior to the injection of sample. Peptides were eluted directly from the tip of the column and nanosprayed directly into the mass spectrometer by application of 2.5kV voltage at the back of the column. The Orbitrap Fusion was operated in a data-dependent mode. Full MSI scans were collected in the Orbitrap at 120K resolution with a mass range of 400 to 1600 m/z and an AGC target of 5e5. The cycle time was set to 3 sec, and within this 3 sec the most abundant ions per scan were selected for CID MS/MS in the ion trap with an AGC target of le4 and minimum intensity of 5000. Maximum fill times were set to 50ms and 100ms for MS and MS/MS scans respectively. Quadrupole isolation at 1.6m/z was used, monoisotopic precursor selection was enabled and dynamic exclusion was used with exclusion duration of 5 sec.
Protein and peptide identification were done with Integrated Proteomics Pipeline - IP2 (Integrated Proteomics Applications). Tandem mass spectra were extracted from raw files using RawConverter (refl) and searched with ProLuCID (ref2) against rat UniProt database. The search space included all fully-tryptic and half-tryptic peptide candidates. Carbamidomethylation on cysteine was considered as a static modification. Acetylation (42.010565) was considered as a differential modification on Lysine and the N-terminus. Data was searched with 50 ppm precursor ion tolerance and 600 ppm fragment ion tolerance. Data was filtered to 10 ppm precursor ion tolerance post search. Identified proteins were filtered using DTASelect (ref3) and utilizing a target-decoy database search strategy to control the false discovery rate to 1% at the protein level. siRNA knock-down assay
INS1 cells were cultured at 37°C in 5% C02 in air in RPMI-1640 (Sigma Aldrich) supplemented with 10% (v/v) fetal bovine serum, 1% (v/v) Antibiotic-Antimycotic (Gibco) 10 mM HEPES, 2 mM glutamax, 1 mM sodium pyruvate, and 50 μΜ β-mercaptoethanol (RPMI for INS1 medium). INS1 cells were transfected with Lipofectamine RNAiMAX (Invitrogen) for 24 hr, and cytokines were added for 24 hr or 1 hour. siRNAs were from GE Healthcare (VDR: L-097753-02- 0005, PCAF: L-085879-02-0005, BAF180: L-088113-02-0005, non-targeting pool: D-001810-10- 05). Intraperitoneal Glucose or Insulin Tolerance Tests (TT)
Intraperitoneal GTTs were performed on overnight fasted mice. Blood glucose values were assessed before and at 0, 15, 30, 60, and 120 min after i.p. administration of 0.5 g/kg of glucose. Serum insulin levels were assessed before and at 0, 15, and 60 min after the i.p. administration of glucose using a rat/mouse Insulin ELISA kit (Millipore). ΣΡ-ΙΤΤ assays were performed on mice after a 6 hr fast with an injection of 2 U/kg of insulin (Humalin R, Eli Lilly). shRNA knockdown
shRNA constructs for human VDR, as well as control shRNA, were from Transomics.
Lentiviral shRNAs were produced in 293T cells and polybrene (6μg/ml) was used in transduction. Puromycin selection was performed for 1 week at lug/ml.
FACS analysis
Annexin V staining was performed per manufacturers' instructions (Ebioscience, 88-8008-
74, BD, 561126). FACS analysis were performed using BD FACSCantoII.
Antibodies
Antibodies used were: BRD9 (Bethyl A303-781A), VDR (Santa Cruz, scl008, sc-13133), FLAG (Sigma F3165), HA (Roche, 11867423001), Lysine acetylation (Cell Signaling 9441s), GST (Santa Cruz sc-4033), PCAF (Cell Signaling 3378s), SMARCCl/2 (Cell Signaling, 11956), BRG1 (Cell Signaling 3508), PBRMl (Bethyl, A301-591A), PHF10 (Genetex, GTX116314), ARIDIB (Bethyl, A301-040A), HDAC3 (Cell Signaling 2632), KAT7 (Bethyl, A302-224A), NCOA5 (Bethyl A300-790A), THRAP3 (Bethyl A300-955A), 1KB a (Cell Signaling 4814), p65 (Cell Signaling 8242), IKKb (Cell Signaling 8943), pIKKa (Cell Signaling 2697), a-Tubulin (EMD,
Cp06-100), H3K4Mel (Abeam, ab8895), H3K27Ac (Abeam, ab4729), H3K4Me3 (Abeam ab8580), KX6-1 (Cell Signaling, 54551), Glucagon (Abeam, ab82270).
ELISA ELISA were performed per manufacturer's instructions: mouse insulin (Millipore, EZRMI-
13K), mouse proinsulin (Mercodia, NC9088881).
Chromatin Immunoprecipitation (ChIP)
INS1 cells were treated with Cal (100 nM), iBRD9 (lOuM) and/or Π.1 β prior to harvest for ChIP assays. The experimental procedure for ChIP was as previously described (Barish et al.,
2010, Genes Dev 24:2760-5). Briefly, after fixation, nuclei from were isolated, lysed, and sheared with a Diagenode Bioruptor to yield DNA fragment sizes of 200-1,000 bp followed by
immunoprecipitati on . ChlP-Seq Data Analysis
The procedure was as previously described (Barish et al., 2010, Genes Dev 24:2760-5). Briefly, short DNA reads were aligned against the mouse mm9 or rat rn4 reference genome using the Illumina CASAVA vl .8.2. Reads were aligned using the Bowtie aligner, allowing up to two mismatches in the read. Only tags that map uniquely to the genome were considered for further analysis. Subsequent peak calling and motif analysis were conducted using HOMER, a software suite for ChlP-seq analysis. The methods for HOMER, described below, have been implemented and are available at http://homer.ucsd.edu. One tag from each unique position was considered to eliminate peaks resulting from clonal amplification of fragments during the ChlP-seq protocol. Peaks were identified by searching for clusters of tags within a sliding 200 bp window, requiring adjacent clusters to be at least 1 kb away from each other. The threshold for the number of tags that determine a valid peak was selected for an FDR < 0.001, as empirically determined by repeating the peak finding procedure using randomized tag positions. Peaks are required to have at least 4-fold more tags (normalized to total count) than input or immunoglobulin G control samples and 4-fold more tags relative to the local background region (10 kb) to avoid identifying regions with genomic duplications or nonlocalized binding. Differential H3K27Ac peaks are called by Homer using a threshold of 1.5 fold change and p value< 0.0001. Peaks are annotated to gene products by identifying the nearest RefSeq transcriptional start site. Visualization of ChlP-seq results was achieved by uploading custom tracks onto the University of California, Santa Cruz genome browser. Gene ontology analysis were performed using Metascape (metascape.org) or DAVID (david.ncifcrf.gov).
ATAC-seq
INS1 cells were pretreated with vehicle, Cal, iBRD9, or iBRD9 16 hrs before ILi were added for 1 hr and 5xl04 cells were harvested to prepare ATAC-seq libraries. Reads were aligned by Bowtie to rn4 and peaks were called by Homer using default settings. Differential peaks were called by Homer using default settings (Fold change >4, p value <0.0001).
Transmission electronic microscopy (TEM)
Islets in suspension were pelleted in 2% low melting point agarose and subsequently fixed in 2.5% glutaraldehyde with 2% paraformaldehyde in 0.15M cacodylate buffer containing 2mM calcium chloride, pH 7.4, for one hour at 4°C. The pellet was trimmed down to contain the minimal amount of agarose possible, washed in buffer, and secondarily fixed in 1% osmium tetroxide/0.3% potassium ferrocyanide in buffer. Subsequently, the pellet was washed in water and en bloc stained with 2% uranyl acetate followed by a graded dehydration in ethanol (35%, 50%, 70%, 90%, 100%, 100%)). Samples were then rapidly infiltrated in Spurr's resin using a Pelco BioWave microwave processing unit (Ted Pella, Redding, CA), embedded in Pelco Pyramid tip mold (Ted Pella, Redding, CA), and cured at 60°C overnight. 70nm ultrathin sections were then cut on a Leica UC7 ultramicrotome (Leica, Vienna) and Islets were examined on a Libral20 (Zeiss, Oberkochen, Germany) at 120V.
LC-MS Analysis
An internal standard of d4-succinate was added to all samples prior to analysis. 500 mL of methanol containing 100 pmol of d4-succinate was added to 50 uL plasma samples and vortexed for 1 min. The samples were then centrifuged at 17.000 x g for 10 min at 4°C. After drying the supernatant via SpeedVac, the extract was dissolved in H20 (50 mL) and 10 mL was subjected to liquid chromatography mass spectrometry (LC-MS). Compound i-BRD9 was measured using a TSQ Quantiva mass spectrometer (Thermo) and Dionex Ultimate 3000 (Thermo) fitted with a Gemini C18 HPLC column (5 mm; 4.6 mm x 50 mm, Phenomenex). LC solvents used were:
solvent A, 0.1%> formic acid in water; solvent B, 0.1%> formic acid in acetonitrile. Separations took place over 16 min with a flow rate of 0.4 mL/min and consisted of the following steps: 5 to 50% solvent B over 9 min, 50 to 80% B over 1 min, 80% B for 1 min, 80 to 5% B over 0.1 min, and 5% B for 5 min. MS analyses were performed using electrospray ionization (ESI) in positive ion mode for i-BRD9 and negative ion mode for d4-succinate. Positive and negative mode source parameters were as follows: spray voltage 3.5 kV, ion transfer tube temperature of 325°C, and a vaporizer temperature of 275°C. Multiple reaction monitoring transitions for target compound and internal standard are shown in (Table 2). Table 2. MRM transitions for target compounds and internal standard
Figure imgf000047_0001
Data and Software availability
The accession number for the RNA-seq data reported herein is NCBI SRA: SRP103617. The accession number for the ChlP-seq and ATAC-seq data is SRA: SRP103615. Example 2
VDR is required for β cell maintenance in vitro
To identify the mechanisms regulating β cell survival and expansion, a genomic CRISPR knock-out screen (Wang et al., 2014, Science 343, 80-84) was performed in human induced pluripotent stem (iPS) cell-derived β-like cells (Yoshihara et al., 2016, Cell metabolism 23, 622- 634). The incorporation of an inducible Cas9 expression system into β-like cells carrying a human insulin promoter-driven GFP reporter (INS-GFP) allowed genes essential for β-like cell survival to be identified (enrichment of sgRNAs in GFP" compared to GFP+ cells, FIG. 1 A). Gene ontology analysis of the enriched genes reveals categories related to chromatin modification/remodeling, cell cycle and transcription (FIG. IB). This unbiased genomic screen identified VDR as one of the most enriched gene targets, with 6 of the 7 sgRNAs targeting VDR found only in the GFP" cells (FIGS. 1C, D). Consistent with a potential role for VDR in β cell identity and/or survival, published data sets confirm VDR expression in both β cells and a cells (Benner et al., 2014, BMC genomics 15, 620; DiGruccio et al., 2016, Mol Metab 5, 449-458; Xin et al., 2016, PNAS 113, 3293-8). Further interrogation of a single cell transcriptional dataset (Xin et al., 2016, PNAS 113, 3293-8) revealed VDR to be one of the most highly expressed transcription factors in mouse islet cells, particularly in β cells (FIGS. 2A-2B).
To determine the functional significance of VDR expression in β cells, iPS cell lines harboring inducible shRNA knockdowns of VDR were differentiated into β-like cells and then challenged with ΙΙ,Ιβ. Consistent with VDR playing a role in cell survival during stress, increased cytokine-induced cell death was seen in the VDR-depleted β-like cells (FIG. 3 A). Furthermore, in the rat β cell line INS1, the expression of key β cell genes was reduced in cytokine and palmitic acid treated cells upon VDR knockdown (FIG. 3B). Moreover, whole body VDR knock-out (KO) mice display increased islet staining for proinsulin, a marker of ER stress and β cell dysfunction, and an increased proinsuliminsulin ratio in the serum (FIGS. IE, IF, 3C, 3D) (Bouillon et al., 2008, Endocrine Rev. 29, 726-776; Hasnain et al., 2014, Nature Med. 20, 1417-26; Hasnain et al., 2016, J Mol Endocrinol 56, R33-54). Combined with reduced levels of insulin and MAFA in islets from VDR KO mice (FIG. 3E), these findings indicate that β cell function is compromised upon loss of VDR.
Given the above observations, it was determined whether VDR activation can protect β cells against inflammatory damage. Isolated mouse islets were cultured with Π.1β in the presence or absence of the VDR ligand, calcipotriol (Cal), and the transcriptomic changes determined by RNA-Seq. Exposure to Π.1β for 48 hours induced widespread transcriptional changes, with 704 and 718 genes up- and down-regulated, respectively (p<0.05, FIG. 3F). These transcriptional changes were largely maintained, with some even amplified, upon prolonged exposure (1090 and 989 genes up- and down-regulated after 96 hours, FIG. 3F). Co-treatment with Cal protected islets from ILi -induced damage, with more pronounced effects evident at the later time point (FIGS. 3F-3J). Gene ontology of the Π,ΐβ suppressed genes whose expression was restored upon Cal treatment are mainly associated with β cell function, whereas the ILi induced genes repressed by Cal are associated with inflammation (FIGS. 3H, 3J). These observations indicate that VDR can protect against ILi -induced β cell dysfunction, by counteracting the inflammatory response and maintaining β cell functionality.
Example 3
VDR Shuttles between BRD9 and BRD7
To determine the molecular underpinning of VDR function, the VDR interactome was characterized in human β-like cells. INS-GFP iPS cells incorporating an inducible ectopic expression system for HA-tagged VDR were differentiated into β-like cells, and VDR expression induced to coincide with the peak expression of insulin, as measured by GFP expression. VDR was subsequently immunoprecipitated from cells grown in the presence or absence of Cal 24 hours after VDR induction, and associating proteins identified by mass spectrometry.
Multiple transcription elongation factors and components of the mediator and FACT complexes co-immunoprecipitated with VDR (FIG. 4A). In addition, novel VDR-interacting proteins were identified, most notably the bromodomain-containing factor 9 (BRD9), and its paralog, BRD7 (FIG. 4A). BRD9 was recently identified as a core component of the B AF complex, whereas BRD7 is found in the PBAF complex. Interestingly, BRD7 was also identified in these CRISPR screen (p=0.002), (FIGS. IB, 5B).
To verify these novel interactions, it was confirmed that endogenous BRD9 co- immunoprecipitates with HA-tagged VDR, and conversely, that HA-tagged VDR can be immunoprecipitated with Flag-tagged BRD9 in 293T cells (FIG. 4B, 4C, 5C). Somewhat surprisingly, the strength of this interaction decreased in the presence of VDR ligand as measured by proteomic and Western blot analyses (FIGS. 4A-4C, 5C-5E). Furthermore, a selective inhibitor of the bromodomain of BRD9, but not BRD7, iBRD9 (Theodoulou et al, J. Med. Chem. 99: 1425- 39, 2016), reduced the interaction between VDR and BRD9, indicating that BRD9 directly binds to VDR via its bromodomain (FIGS. 4B and C). Consistent with this, it was observed that the bromodomain of BRD9 is sufficient for the interaction with VDR (purified recombinant His-tagged VDR binds the GST-tagged bromodomain of BRD9 (FIGS. 4D, 5F).
Since bromodomains bind acetylated lysines, it was hypothesized that acetylation of VDR was required for the interaction. Indeed, mass spectrometry clearly showed the presence of an acetylated lysine in a VDR peptide containing lysine 91 (K91 Ac) (FIG. 5G). Interestingly, K91 is located in the T-box domain (Lee et al., 1994, European J. Biochem. / FEBS 224, 639-650; Quack et al., 1998, Nucleic acids research 26, 5372-8) juxtaposed to the DNA-binding zinc fingers, a domain conserved in closely-related nuclear receptors including RARa and PXR (FIG. 4E). The crystal structure of the heterodimeric VDR:RXR DNA binding domains bound to direct repeat DNA elements (Shaffer and Gewirth, 2002, EMBO J 21, 2242-52) reveals the side-chain of K91 protruding away from the DNA double helix and on the opposite side to RXR, indicating it may serve as a docking site for the interaction with BRD9 (FIG. 4F). To confirm the importance of K91Ac in the VDR:BRD9 interaction, K91 was mutated to alanine (K91 A) or arginine (K91R). Mutating K91 significantly reduced the interaction with BRD9, as well as the total acetylation level of VDR (FIG. 4G, 5H).
Similarly, it was confirmed that HA-tagged VDR was able to immunoprecipitate Flag- tagged BRD7 (FIGS. 4H, 51). However, in contrast with BRD9, the interaction of VDR with BRD7 progressively increased in the presence of Cal and Cal+iBRD9, suggestive of competitive BRD9/BRD7 binding (FIG. 4H). Indeed, it was observed that VDR acetylation at the same site, K91, was required for the interaction with BRD7 (FIG. 41), supporting the competitive binding hypothesis.
The notion of a ligand-induced shift in the association of VDR from BRD9 to BRD7 is supported by previous findings that revealed increased conformational flexibility in the DNA- binding domain and T box regions upon binding of l,25(OH)2 vitamin D (Zhang et al., 2011, Nat. Struct. Mol. Biol. 18:556-63) (FIG. 4J).
As the T-box region has been implicated in the interaction of nuclear receptors with PCAF (KAT2b) (Blanco et al., 1998, Genes & Development 12: 1638-1651), the interaction between VDR and PCAF was examined. PCAF binding increased with Cal and/or iBRD9 treatment (FIG. 4K), as seen for BRD7 but the reverse of that seen for BRD9 binding. As a lysine acetyltransferase, it was determined whether PCAF directly acetylates VDR. VDR acetylation indeed increased when expressed together with PCAF, but not with the enzymatically dead PCAF D608A mutant (Jin et al., EMBO reports 15, 1192-1201, 2014) (FIG. 4L). Taken together, these observations demonstrate an unrecognized regulatory mechanism for VDR, whereby T-box acetylation partitions recruitment between BRD9 or BRD7, depending on the absence or presence of VDR ligand, respectively. Example 4
BRD9 Dissociation Promotes VDR-mediated transcription in β cells
To determine if BRD9 and BRD7 recruit the SWI/S F (BAF) and PBAF complexes, respectively, the effects of VDR ligand (Cal) and the BRD9 inhibitor (iBRD9) on the composition of the VDR protein complex was determined. VDR ligand (Cal) was used to favor BRD7-PBAF association, iBRD9 to block re-association to BAF.
Proteomic analyses of INS 1 cells expressing HA-tagged VDR confirmed the ligand- dependent association of VDR with its heterodimeric partners, the RXRs, as well as components of the basal transcriptional machinery (FIG. 6A). The VDR association of proteins common to the BAF and PBAF complexes increased in the presence of Cal or iBRD9 (e.g., SMARCAl,
SMARCA2, SMARCA4, FIGS. 6A, 6B, 8A-8E). The interactions of key components of the PBAF complex including PBRMl (BAF 180) and ARID2, but not components exclusive to the BAF complex (ARID 1 A and ARID IB), significantly increased in the presence of Cal or iBRD9 (FIGS. 6A, 6B, 8A-8E). This indicates that the activation state of VDRK91Ac (i.e., ± Cal or iBRD9), is conditional, dependent on its association with the BAF or PBAF complexes.
Based on these observations, it was proposed that BRD9 attenuates VDR activity. To determine if this regulatory mechanism is functional relevant in β cells, the effects of Cal and iBRD9 upon ILip-induced stress in INS1 cells were determined (Hahn et al., 1997, Transplantation Proceedings 29:2156-7; Riachy et al., 2006, Apoptosis 11 : 151-9). Within 30 minutes of exposure, ILi induced expression of Nflcbia (ΙκΒα, a key negative feedback early response gene, Verma et al., 1995, Genes & Development 9:2723-35). This anti-inflammatory modulator was increased with Cal and Cal+iBRD9 treatments (FIG. 6C), with parallel changes seen at the protein level (FIG. 6D).
Furthermore, the induction of Nflcbia upon Cal treatment was largely abrogated in cells expressing the VDR mutant lacking the crucial lysine (K91R) (FIG. 8F). Beyond an acute effect, the iBRD9-Cal combination led to sustained Nfkbia induction (>24 hr) (FIG. 6E) portending a possible sustained anti-inflammatory effect (see below). Moreover, knockdown of the PBAF component PBRMl or PCAF significantly compromised the activation of Nfkbia (FIG. 6F). These findings support BRD9 as a regulator of unliganded VDR, whereby inhibition of BRD9 binding allows increased association of VDR with the PBAF complex and PCAF to prolong
transcriptional activation.
Example 5
Enhanced Activation of VDR Promotes a β Cell Stress Response
Transcriptional changes induced by the addition of Cal and iBRD9 were used to explore mechanistic transitions in cytokine-stressed β cells.
ILi alone led to rapid widespread changes in INS 1 cells, with 499 and 496 genes significantly induced and repressed, respectively, 1 hour after treatment (fold change >1.5) (FIG. 7A). Co-treatment with Cal+iBRD9 protected the cells against cytokine-induced stress, abrogating
-25% of the ILi -induced transcriptional changes (141 up- and 127 down-regulated genes, FIGS.
7A and 7B). Gene ontology (GO) analyses of these Cal+iBRD9-responsive genes identified β cell function (FIG. 7C), and cytokine response and NF-κΒ signaling (FIG. 7D) in the ILi -repressed and induced gene sets, respectively. Thus, Cal+iBRD9 significantly protects against cytokine- induced damage by reducing the pro-inflammatory response and preventing the loss in functionality of β cells.
The proteomics data indicated that inhibiting the interaction with BRD9 redirects VDR towards the PBAF complex (FIGS. 6 A and 6C). Consistent with this, it was observed that
Cal+iBRD9 treatment reduced ARID IB binding -a component of the BAF complex, and increased BAF 180 binding - a component of the PBAF complex, at multiple target gene promoters (FIGS. 8A-8L).
Given the established roles of the BAF and PBAF complexes in chromatin remodeling, the impact of this VDR-directed switch on genome-wide chromatin accessibility was determined. Notably, transposase-based sequencing (ATAC-Seq) (Buenrostro et al., 2013, Nature methods 10, 1213-8) revealed a synergistic overhaul of chromatin accessibility upon Cal and iBRD9 treatments. ILi induced stress led to an overall reduction in chromatin accessibility in INS1 cells one hour after treatment (FIG. 7E). In contrast, Cal and iBRD9 as single agents antagonized a large portion of these changes, resulting a significant increase (> 4-fold) in chromatin accessibility at -4% (1,935 and 1,703 peaks) of all ATAC-seq peaks in ILi -treated cell (FIGS. 7E and 7F). The combined Cal+iBRD9 treatment increased accessibility and resulted in global increases (> 4-fold) at > 3 times more peaks (-15%, 7,932 out of 51,397 peaks) (FIGS. 7E and 7F).
Motif analyses of Cal+iBRD9-induced ATAC-Seq peaks identified Vitamin D response elements (VDREs) as the top-ranking motif together with CTCF (FIG. 7G), indicating a direct role of VDR in counteracting the effects of ILi . Indeed, chromatin accessibility was markedly increased at identified VDREs upon Cal+iBRD9 treatment (FIG. 7H). In particular, chromatin accessibility at Nfkbia and Nfkbiz was significantly increased upon Cal+iBRD9 treatment (FIG. 71), consistent with the sustained Nfkbia expression (FIG. 71). In addition, the reduction in chromatin accessibility induced by Π.1 β stress at key genes involved in β cell functionality including Cckar was reversed by Cal+iBRD9 treatment (FIG. 71).
These observations indicate dissociating BRD9 from VDR by ligand or inhibitor results in selected increases in chromatin accessibility at VDR target genes. Example 6
Activation of VDR reverses cytokine-induced changes in enhancer landscape
To determine how BRD9 regulates VDR-driven transcriptional responses, the genome-wide enhancer landscape was mapped using H3K27Ac as a mark of active enhancers (Rada-Iglesias et al., 2011, Nature 470, 279-283). Short-term Π.1β exposure (1 hour) significantly altered the enhancer landscape, with widespread decreases and increases in H3K27 acetylation (FIGS. 9A and 9B, respectively). As was observed for chromatin accessibility (FIG. 7E), Cal and iBRD9 as single agents were both able to partially reverse the impact of Π.1 β (FIGS. 9A and 9B). Examination of the sites where Cal+iBRD9 treatment increased H3K27 acetylation revealed VDRE as the most enriched motif (FIG. 9C), indicating a direct role for VDR in reversing the ΙΕΙ β-induced enhancer changes. Furthermore, an interrogation of the Cal+iBRD9 rescued gene set (FIG. 7B) revealed that the VDRE-proximal decreases (at repressed genes, FIG. 9D) and increases (at activated genes, FIG. 9E) in H3K27 acetylation induced by TLl fi were partially restored with Cal+iBRD9 treatment (FIGS. 9D-9F).
Given the sustained hyper-activation of Nfkbia expression observed with the combined Cal+iBRD9 treatment (FIG. 6E), the epigenomic changes after a prolonged TLlfi stress (6 hours) were determined. At this later time point, increased H3K27Ac with Cal+iBRD9 treatment was seen at 945 peaks compared to Cal alone, of which 149 (16%) contained VDREs (FIG. 9G). The genes associated with these VDRE+ peaks are mainly related to β cell function (e.g., Camk4) and anti-inflammatory responses {e.g., Nfkbia, FIGS. 9H-9I). Concomitantly, Cal+iBRD9 treatment reduced H3K27Ac at 1232 peaks, of which 130 (10.5%) contain VDREs (FIG. 9J), with the VDRE+ gene set mainly related to the inflammatory response (FIGS. 9K and 9L).
Together, these data indicate a synergistic action of Cal+iBRD9 on H3K27Ac levels that effect both transcriptional activation and repression. The less pervasive changes in H3K27Ac levels compared to those in chromatin accessibility are consistent with alterations in enhancer elements being secondary to changes in chromatin accessibility. Combined with the marked changes in chromatin accessibility (FIGS. 7E-7I), these data identify a balance between PBAF- and BAF-modulated VDR transcription whereby VDR activation in combination with BRD9 inhibition shifts VDR toward the PBAF complex, resulting in reshaping of the enhancer landscape and antagonism of cytokine-induced transcriptomic changes.
Example 7
VDR-PBAF complex reverses β cell dysfunction to reduce hyperglycemia The improvements in markers of β cell survival and function with Cal+iBRD9 treatment indicate that this approach may have therapeutic utility. The benefits of Cal+iBRD9 treatment in a dietary stress mouse model were examined.
B6.BKS(D)-Lepdb/J (hereafter referred to as db/db (B6)) mice have markedly increased levels of cytokines that lead to β cell dysfunction and insulin resistance (Chan et al. 2013, Diabetes 62: 1557-1568). To determine whether VDR-driven therapies are protective against dietary-induced inflammatory stress, mice were injected with vehicle, Cal alone (60 μg/kg i.p.), iBRD9 alone (10 mg/kg i.p.), or the combination (Cal: 60 μg/kg i.p. + iBRD9: 10 mg/kg i.p.) 3 times a week for 9 weeks. Vehicle-treated db/db (B6) mice developed pronounced hyperglycemia within 4 weeks, with fasted blood glucose levels ~400mg/dl (FIG. 10A). Cal and iBRD9 as single agents achieved modest improvements in blood glucose levels after 4-6 weeks treatment. However, mice receiving the Cal+iBRD9 combination showed a significant reduction in blood glucose after 4 weeks treatment, with the beneficial effects progressively increasing with treatment duration (FIG. 10A). These improvements in glucose homeostasis were achieved without significant changes in body weight (FIG. 10B), liver or epididymal white adipose tissue (eWAT) weights, serum calcium level, or metabolic rate (FIGS. 1 1 A-l IE).
Intraperitoneal glucose tolerance tests (IPGTT) were performed to evaluate the functionality of the β cells independent of the incretin effect. While mice treated with Cal alone showed improved glucose clearance compared to vehicle-treated mice, more significant improvements were achieved with Cal+iBRD9 (FIG. IOC), indicating improved insulin secretion with the combination therapy. Consistent with this, random fed serum insulin levels were significantly increased by Cal+iBRD9 treatment, and increased insulin secretion was observed during an intraperitoneal glucose challenge (FIGS. 10D, 10E). These observations indicate that activation of VDR combined with the dismissal of the BAF complex improves β cell function and thereby glucose homeostasis in an inflammation-driven diabetes model.
Mice lacking the leptin receptor on a BKS genetic background (C57BLKS-Leprdb, hereafter as db/db (BKS)) develop a more severe diabetic phenotype than db/db (B6) mice.
Chronic hyperglycemia in db/db (BKS) progresses to β cell atrophy, hypoinsulinemia and β cell failure, resembling the progression of patients with genetic defects in β cell function. In these genetically predisposed mice, treatment with Cal alone (60 μg/kg i.p. 3 times/week) provided only limited improvements in glucose management (FIG. 10F). In contrast, 3 weeks co-treatment with
Cal+iBRD9 reduced the fasting blood glucose levels, and continued treatment maintained these levels for -10 weeks without any body weight changes (FIGS. 10F, 1 IF). Consistent with improved glucose management, Cal+iBRD9 treatment partially ameliorated the hallmark hypoinsulinemia associated with the db/db (BKS) model (FIG. 10G).
The therapeutic utility of targeting VDR in a β cell damage model, designed to mimic the severe β cell loss observed in the final stages of T2D patients was examined. B6/J mice treated with low-doses of streptozotocin (STZ) progressively lost glucose control. Cal and iBRD9 as single agents provided limited to no benefit in this β cell damage model. Notably, the combination
Cal+iBRD9 treatment provided extended improvements in glucose control (FIG. 10H) and increased glucose tolerance and serum insulin levels (FIGS. 101, 12D).
In combination, in vivo application of VDR ligand and iBRD9 results in enhanced β cell function and insulin secretion in each of the three mouse models representing different stages of
T2D progression, demonstrating the therapeutic value of this combinatorial strategy.
Example 8
Targeting the VDR-BRD9 Axis Rescues
β cell dysfunction in mouse and human islets
To understand how VDR activation improves glucose homeostasis in each of the three mouse models, the molecular and structural changes induced in islets were compared. The marked induction of Cyp24Al, a classic VDR target gene, confirmed VDR activation in islets as well as in the intestine of the Cal-treated db/db (B6) mice (FIG. 12A). In addition, Ins2 mRNA levels trended upwards in Cal-treated islets, consistent with the increase seen in serum insulin levels (FIGS. 12B, 1 ID). Transcriptomic analysis revealed the upregulation of multiple key transcription factors including Mx6-i and Nr4al (FIG. 13 A), whose repression correlates with β cell dysfunction (Guo et al., 2013, J. Clin. Invest. 123, 3305-16; Talchai et al., 2012, Cell 150, 1223). Furthermore, multiple cytokine and chemokine genes were downregulated, further indicating that activation of VDR reduced the pro-inflammatory response in islets (FIG. 13 A). Gene ontology of the upregulated genes identified pathways involved in β cell function including OXPHOS, secretion and β cell proliferation (FIG. 13B) enriched in the Cal -treated islets. In addition, reduced expression of gluconeogenesis genes, including Pepck, Fbpl and G6pase, in the liver of Cal-treated mice, most likely caused by elevated serum insulin (FIG. 12C) was observed. Thus, the benefits of VDR activation in the inflammation-driven db/db (B6) model are multifactorial, including reduced inflammation, improved β cell function and decreased hepatic gluconeogenesis.
Distinct from diet-induced T2D models, β cell intrinsic defects in db/db (BKS) mice severely compromise β cell proliferation and are considered the major cause for the phenotype severity (Puff et al., 2011, Horm. Metab. Res. 43, 306-311). Notably, 12 weeks of Cal+iBRD9 treatment led to -70% increase in islet area in the pancreas, as well as a significant increase (-100%) in the size of individual islets in db/db (BKS) mice (FIGS. 13C-13E). Consistent with this observation, the number of proliferating cells measured by Ki67 labeling more than doubled after Cal+iBRD9 treatment (FIGS. 13F and 13G). Intracellular insulin level was also rescued by Cal or Cal+iBRD9 treatment (FIG. 13H), indicating that the β cell dysfunction(Guo et al., 2013, J. Clin. Invest. 123, 3305-16) is reversed upon VDR activation.
As a model of phase III or end stage diabetes, low-dose STZ treatment induces islet loss and a cell expansion (Li et al., 2000, J. Endocrinol. 165, 93-99). Cal+iBRD9 was protective against progressive β cell death, with increased insulin and decreased glucagon staining seen after 7 weeks of treatment (FIGS. 131, 13J). These changes were accompanied by an increase in the level of NKX6-1, a marker for β cell function (FIG. 12E), further indicating that the β cell dysfunction caused by multiple layers of stress is ameliorated upon enhanced VDR activation. Therefore, Cal+iBRD9 treatment improves glucose homeostasis in multiple diabetic mouse models through the reversal of β cell dysfunction and increased insulin secretion.
In addition to inflammation, ER stress, and IAPP amyloid deposition, lipo- and
glucotoxicity all contribute to islet dysfunction in human T2D patients. To determine whether vitamin D signaling can modulate the damage attributed to additional stressor, islets from aged (15 months) transgenic mice carrying a copy of human islet amyloid polypeptide driven by rat insulin II promoter (Janson et al., 1996) were treated with Cal or Cal+iBRD9 for 72 hr ex vivo. Multiple inflammatory and stress markers were reduced upon Cal or Cal+iBRD9 treatment (FIG. 12F). In addition, thapsigargin or tunicamycin-induced ER stress in INS1 cells was attenuated by Cal treatment (FIG. 12G). ER stress markers Calnexin and PERK were reduced in db/db (BKS) mice treated with Cal or Cal+iBRD9 (FIG. 12H), indicating that VDR activation can reduce ER stress in highly dysfunctional β cells in vivo.
While the significant improvements seen in the diabetic models are consistent with the effects observed in β cell lines upon Cal+iBRD9 treatment, efficacy in related tissues such as macrophages or the intestines, or off target effects cannot be excluded. In support of the specificity of iBRD9, structurally unrelated BRD9 inhibitors (Hohmann et al., 2016, Nat. Chem. Biol., 12:672-9; Martin et al., 2016, J. Med. Chem. 59:4462-75) induced similar anti-inflammatory effects on NF-kB signaling (FIG. 121). In addition, the maximum plasma iBRD9 concentration (-750 nM) (FIG. 12J) is sufficient to activate BRD9 (IC50 = 50 nM) while sparing other bromodomain members such as BRD4 (IC50 = 5 mM). Collectively, these data support that the therapeutic efficacy of iBRD9 in vivo is on-target.
As islet allogenic transplants are a medium-term therapy for select patients, the ability of VDR activation to protect isolated human islets was examined. Healthy human islets were challenged with an inflammatory stress (Arnush et al., 1998, J. Clin. Invest. 102:516-26)
(ILi +interferon γ [IFN γ] for 24 hr) with or without activation of VDR. Transmission electron microscopy confirmed that ILi and IFNy caused severe islet damage including loss of dense insulin granules and dilation of the ER (FIG. 13K, upper and lower insets, respectively).
Activation of VDR alone or in combination with iBRD9 rescued the damage caused by ILi and IFN γ, most notably at the level of the insulin granules (FIG. 13K, upper insets, bottom panels) and ER morphology (FIG. 13K, lower insets, bottom panel). Additionally, Cal increased survival and insulin secretion capacity in long term ex vivo human islet cultures (FIGS. 14A and 14B). These findings demonstrate that enhanced vitamin D signaling has significant beneficial effects on islets during cytokine stress.
In view of the many possible embodiments to which the principles of the disclosure may be applied, it should be recognized that the illustrated embodiments are only examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

We claim:
1. A method of reducing blood glucose in a mammal, comprising:
administering a therapeutically effective amount of one or more vitamin D receptor (VDR) agonists to the mammal, and
administering a therapeutically effective amount of one or more bromodomain-containing protein 9 (BRD9) antagonists to the mammal,
thereby reducing blood glucose in the mammal.
2. A method of treating type 2 diabetes in a mammal, comprising:
administering a therapeutically effective amount of one or more vitamin D receptor (VDR) agonists to the mammal, and
administering a therapeutically effective amount of one or more bromodomain-containing protein 9 (BRD9) antagonists to the mammal,
thereby treating type 2 diabetes in the mammal.
3. A method, comprising:
administering a therapeutically effective amount of one or more vitamin D receptor (VDR) agonists to a mammal, and
administering a therapeutically effective amount of one or more bromodomain-containing protein 9 (BRD9) antagonists to the mammal,
wherein the method reduces fed and fasting blood glucose, increases insulin sensitivity, increases glucose tolerance, increases insulin secretion, increases beta cell function, increases the size of islets, reduced beta cell death, increases insulin granules, reduces fibrosis, treats an autoimmune disease, or combinations thereof, in the mammal.
4. The method of any of claims 1-3, wherein the therapeutically effective amount of the one or more VDR agonists is at least 0.01 mg/kg.
5. The method of any of claims 1-4, wherein the therapeutically effective amount of the one or more BRD9 antagonists is at least 0.1 mg/kg.
6. The method of any of claims 1 to 5, wherein the administering is subcutaneous,
intraperitoneal, intramuscular, intravenous or intrathecal.
7. The method of any of claims 1 to 6, wherein the mammal is a cat or dog.
8. The method of any of claims 1 to 6, wherein the mammal is a human.
9. The method of any of claims 1 to 8, wherein the one or more VDR agonists comprises vitamin D, a vitamin D precursor, a vitamin D analog, a vitamin D receptor ligand, a vitamin D receptor agonist precursor, or a combination thereof.
10. The composition of any of claims 1 to 9, wherein the one or more VDR agonists comprises calcipotriol, 25-hydroxy-D3 (25-OH-D3) (calcidiol); vitamin D3 (cholecalciferol); vitamin D2 (ergocalciferol), la,25-dihydroxyvitamin D3 (calcitriol), or a combination thereof.
11. The method of any of claims 1 to 10, wherein the one or more BRD9 antagonists comprises one or more of I-BRD-9, TP742, BI-7273, BI-9564, dBRD9, G E-375 and LP-99.
12. The method of any of claims 1 to 11, wherein the one or more VDR agonists comprises calcipotriol and the one or more BRD9 antagonists comprises I-BRD9.
13. The method of any of claims 1 to 12, wherein the one or more VDR agonists and one or more BRD9 antagonists are administered concurrently.
14. The method of any of claims 1 to 12, wherein the one or more VDR agonists and one or more BRD9 antagonists are administered sequentially.
15. The method of any of claims 1 to 13, wherein the one or more VDR agonists, one or more BRD9 antagonists, or both, are part of a nanoparticle.
16. The method of any of claims 1 to 15, wherein the method further comprises administering an additional therapeutic compound.
17. The method of claim 16, wherein the additional therapeutic compound is insulin, an alpha- glucosidase inhibitor, amylin agonist, dipeptidyl-peptidase 4 (DPP-4) inhibitor, meglitinide, sulfonylurea, or a peroxisome proliferator-activated receptor (PPAR)-gamma agonist.
18. The method of claim 17, wherein the PPAR-gamma agonist is a thiazolidinedione (TZD), aleglitazar, farglitazar, muraglitazar, or tesaglitazar.
19. The method of claim 18, wherein the TZD is pioglitazone, rosiglitazone, rivoglitazone, or troglitazone.
20. A composition, comprising:
one or more VDR agonists, and
one or more BRD9 antagonists.
21. A kit, comprising:
one or more VDR agonists, and
one or more BRD9 antagonists, wherein the one or more VDR agonists, and the one or more BRD9 antagonists are in the same or separate containers.
22. The composition of claim 20 or the kit of claim 21, further comprising at least one additional therapeutic compound.
23. The composition or kit of claim 22, wherein the at least one additional therapeutic compound is insulin, an alpha-glucosidase inhibitor, amylin agonist, dipeptidyl-peptidase 4 (DPP- 4) inhibitor, meglitinide, sulfonylurea, or a peroxisome proliferator-activated receptor (PPAR)- gamma agonist.
24. The composition or kit of claim 23, wherein the PPAR-gamma agonist is a
thiazolidinedione (TZD), aleglitazar, farglitazar, muraglitazar, or tesaglitazar.
25. The composition or kit of claim 24, wherein the TZD is pioglitazone, rosiglitazone, rivoglitazone, or troglitazone.
PCT/US2018/043345 2017-07-24 2018-07-23 Use of bromodomain-containing protein 9 antagonists in combination with vitamin d receptor agonists in diabetes treatment Ceased WO2019023149A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/737,312 US11376264B2 (en) 2017-07-24 2020-01-08 Use of bromodomain-containing protein 9 antagonists in combination with vitamin D receptor agonists in diabetes treatment

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762536154P 2017-07-24 2017-07-24
US62/536,154 2017-07-24

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/737,312 Continuation US11376264B2 (en) 2017-07-24 2020-01-08 Use of bromodomain-containing protein 9 antagonists in combination with vitamin D receptor agonists in diabetes treatment

Publications (1)

Publication Number Publication Date
WO2019023149A1 true WO2019023149A1 (en) 2019-01-31

Family

ID=65040750

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/043345 Ceased WO2019023149A1 (en) 2017-07-24 2018-07-23 Use of bromodomain-containing protein 9 antagonists in combination with vitamin d receptor agonists in diabetes treatment

Country Status (2)

Country Link
US (1) US11376264B2 (en)
WO (1) WO2019023149A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019213005A1 (en) * 2018-04-30 2019-11-07 Dana-Farber Cancer Institute, Inc. Small molecule degraders of polybromo-1 (pbrm1)
US20210198629A1 (en) * 2018-08-20 2021-07-01 University Of Georgia Research Foundation, Inc. Compositions and methods for increasing beiging of white adipose tissue
WO2021207387A1 (en) * 2020-04-08 2021-10-14 Rumi Scientific Holdings, Inc. Use of bromodomain inhibitors for treatment of huntington's disease

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113874016A (en) 2019-01-29 2021-12-31 福宏治疗公司 Compound and use thereof
WO2021022163A2 (en) 2019-07-31 2021-02-04 Foghorn Therapeutics Inc. Compounds and uses thereof
US12528825B2 (en) 2020-01-29 2026-01-20 Foghorn Therapeutics Inc. Compounds and uses thereof
RU2750523C1 (en) * 2021-01-13 2021-06-29 Федеральное государственное бюджетное образовательное учреждение высшего образования "Самарский государственный медицинский университет" Министерства здравоохранения Российской Федерации Method of treatment of elderly patients with type 2 diabetes mellitus
CN115813925B (en) * 2022-11-30 2023-07-25 中南大学湘雅三医院 ACBI1 application
WO2024163641A2 (en) * 2023-02-01 2024-08-08 Foghorn Therapeutics Inc. Formulations for treating cancer
CN116942818B (en) * 2023-02-24 2025-09-02 中南大学 Application of BRD7 as a target in the preparation of drugs for obesity-related mental illnesses

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016077378A1 (en) * 2014-11-10 2016-05-19 Genentech, Inc. Substituted pyrrolopyrdines as inhibitors of bromodomain
WO2016139361A1 (en) * 2015-03-05 2016-09-09 Boehringer Ingelheim International Gmbh New pyridinones and isoquinolinones as inhibitors of the bromodomain brd9
WO2016149382A2 (en) * 2015-03-16 2016-09-22 The Trustees Of The University Of Pennsylvania Compositions and methods for suppressing or reducing systemic immune response in a subject

Family Cites Families (32)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4417851C1 (en) 1994-05-20 1995-10-05 Horst Heirler Dietary food with medium-chain fatty acids and its use
US6566353B2 (en) 1996-12-30 2003-05-20 Bone Care International, Inc. Method of treating malignancy associated hypercalcemia using active vitamin D analogues
US5961990A (en) 1997-05-02 1999-10-05 Kobo Products S.A.R.L. Cosmetic particulate gel delivery system and method of preparing complex gel particles
AUPO727097A0 (en) 1997-06-10 1997-07-03 Unisearch Limited Method of treatment of hepatoma and pharmaceutical compositions for use therein
US6358939B1 (en) 1999-12-21 2002-03-19 Northern Lights Pharmaceuticals, Llc Use of biologically active vitamin D compounds for the prevention and treatment of inflammatory bowel disease
AU2003250483A1 (en) 2002-08-19 2004-03-11 Pfizer Products Inc. Combination therapy for hyperproliferative diseases
AU2003295773A1 (en) 2002-11-21 2004-06-18 Novacea, Inc. Treatment of liver disease with active vitamin d compounds
CA2528378A1 (en) 2003-06-11 2004-12-23 Novacea, Inc. Treatment of immune-mediated disorders with active vitamin d compounds alone or in combination with other therapeutic agents
US20050124591A1 (en) 2003-07-29 2005-06-09 Jin Tian Use of vitamin Ds to treat kidney disease
US20050148557A1 (en) 2003-07-29 2005-07-07 Jin Tian Use of Vitamin Ds to treat kidney disease
WO2005117542A2 (en) 2004-05-10 2005-12-15 Novacea, Inc. Treatment of pancreatic cancer with active vitamin d compounds in combination with other treatments
WO2006032299A1 (en) 2004-09-24 2006-03-30 Susanna Miettinen Use of inhibitors of 24-hydroxylase in the treatment of cancer
US20060135610A1 (en) 2004-12-22 2006-06-22 Bortz Jonathan D Cardiovascular compositions
HUE056941T2 (en) 2004-12-22 2022-04-28 Nitto Denko Corp Drug carrier and drug carrier kit for inhibiting fibrosis
JP4533420B2 (en) 2004-12-22 2010-09-01 日東電工株式会社 Drug carrier and drug carrier kit for suppressing fibrosis
US8968806B2 (en) 2005-04-26 2015-03-03 Sean Joseph Delaney Method and system for creating and using a supplement to balance animal diets
EP2425874A3 (en) 2006-08-25 2013-05-15 Cougar Biotechnology, Inc. Use of a vitamin D compound and an additional therapeutic agent for the treatment of cancer
TW200833345A (en) 2006-11-01 2008-08-16 Novacea Inc Use of vitamin D compounds and mimics thereof to enhance delivery of therapeutics and oxygen to tumors and other tissues
JP2008174463A (en) 2007-01-16 2008-07-31 Ankhs:Kk TGF-beta SIGNAL TRANSMISSION MECHANISM INHIBITOR, SMAD DEGRADATION INDUCTOR, SMAD UBIQUITIN FORMATION PROMOTER, SMURF DEGRADATION INDUCTOR, SMURF UBIQUITIN FORMATION PROMOTER, METHOD FOR INHIBITING TGF-beta SIGNAL TRANSMISSION MECHANISM, METHOD FOR INDUCING SMAD DEGRADATION, METHOD FOR PROMOTING SMAD UBIQUITIN FORMATION, METHOD FOR INDUCING SMURF DEGRADATION, AND METHOD FOR PROMOTING SMURF UBIQUITIN FORMATION
WO2008134828A2 (en) 2007-05-04 2008-11-13 Katholieke Universiteit Leuven Tissue degeneration protection
WO2009061961A1 (en) 2007-11-06 2009-05-14 The Salk Institute For Biological Studies Use of vitamin d receptor agonists and precursors to treat fibrosis
US8318708B2 (en) 2007-11-06 2012-11-27 Salk Institute For Biological Studies Use of vitamin D receptor agonists, ligands, and precursors to treat pancreatic fibrosis
PL388252A1 (en) 2009-06-10 2010-12-20 Instytut Farmaceutyczny Combination therapy of colorectal cancer
IT1397901B1 (en) 2010-01-26 2013-02-04 Consiglio Nazionale Ricerche CYCLIC PEPTIDES THAT BIND THE CXCR4 RECEPTOR AND THEIR USE IN MEDICAL AND DIAGNOSTIC FIELDS.
MX2012013001A (en) 2010-05-13 2013-02-26 Univ Indiana Res & Tech Corp Glucagon superfamily peptides exhibiting nuclear hormone receptor activity.
EP2688560A2 (en) 2011-03-24 2014-01-29 Leo Pharma A/S A composition comprising lipid nanoparticles and a corticosteroid or vitamin d derivative
JP2013056834A (en) 2011-09-07 2013-03-28 Okayama Univ Agent for treatment of fibrotic diseases
CN102342914A (en) 2011-10-07 2012-02-08 南昌大学 Calcipotriol solid lipid nanoparticle and preparation method of same
CN105473147A (en) 2013-04-24 2016-04-06 萨克生物研究学院 Vitamin D receptor/SMAD genomic circuit gates fibrotic response
EP3473299A1 (en) 2013-06-05 2019-04-24 Salk Institute for Biological Studies Vitamin d receptor agonists to treat diseases involving cxcl12 activity
US20180200379A1 (en) 2013-06-05 2018-07-19 Salk Institute For Biological Studies Vitamin d receptor agonists to treat diseases involving cxcl12 activity
WO2018106738A1 (en) 2016-12-05 2018-06-14 Massachusetts Institute Of Technology Brush-arm star polymers, conjugates and particles, and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016077378A1 (en) * 2014-11-10 2016-05-19 Genentech, Inc. Substituted pyrrolopyrdines as inhibitors of bromodomain
WO2016139361A1 (en) * 2015-03-05 2016-09-09 Boehringer Ingelheim International Gmbh New pyridinones and isoquinolinones as inhibitors of the bromodomain brd9
WO2016149382A2 (en) * 2015-03-16 2016-09-22 The Trustees Of The University Of Pennsylvania Compositions and methods for suppressing or reducing systemic immune response in a subject

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ADORINI, L. ET AL.: "Inhibition of type 1 diabetes development by vitamin D receptor agonists", CURRENT MEDICINAL CHEMISTRY-ANTI-INFLAMMATORY & ANTI-ALLERGY AGENTS, vol. 4, no. 6, 2005, pages 645 - 651, Retrieved from the Internet <URL:DOI : 10.2174/156801405774933197> *
REMILLARD, D. ET AL.: "Degradation of the BAF complex factor BRD9 by heterobifunctional ligands", ANGEWANDTE CHEMIE INTERNATIONAL EDITION, vol. 56, no. 21, April 2017 (2017-04-01), pages 5738 - 5743, XP055414614 *
THEODOULOU, N. H. ET AL.: "Discovery of I-BRD9, a selective cell active chemical probe for bromodomain containing protein 9 inhibition", JOURNAL OF MEDICINAL CHEMISTRY, vol. 59, no. 4, 30 April 2015 (2015-04-30), pages 1425 - 1439, XP055216223, Retrieved from the Internet <URL:doi: 10.1021/acs.jmedchem.5b00256> *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019213005A1 (en) * 2018-04-30 2019-11-07 Dana-Farber Cancer Institute, Inc. Small molecule degraders of polybromo-1 (pbrm1)
US11771697B2 (en) 2018-04-30 2023-10-03 Dana-Farber Cancer Institute, Inc. Small molecule degraders of polybromo-1 (PBRM1)
US20210198629A1 (en) * 2018-08-20 2021-07-01 University Of Georgia Research Foundation, Inc. Compositions and methods for increasing beiging of white adipose tissue
WO2021207387A1 (en) * 2020-04-08 2021-10-14 Rumi Scientific Holdings, Inc. Use of bromodomain inhibitors for treatment of huntington's disease
CN115666562A (en) * 2020-04-08 2023-01-31 鲁米科学控股股份有限公司 Use of Bromodomain Inhibitors to Treat Huntington's Disease
CN115666562B (en) * 2020-04-08 2026-03-27 鲁米科学控股股份有限公司 Uses of bromine domain inhibitors in the treatment of Huntington's disease

Also Published As

Publication number Publication date
US20200129532A1 (en) 2020-04-30
US11376264B2 (en) 2022-07-05

Similar Documents

Publication Publication Date Title
US11376264B2 (en) Use of bromodomain-containing protein 9 antagonists in combination with vitamin D receptor agonists in diabetes treatment
Zammouri et al. Molecular and cellular bases of lipodystrophy syndromes
Wei et al. Vitamin D switches BAF complexes to protect β cells
Jiao et al. Butyric acid normalizes hyperglycemia caused by the tacrolimus-induced gut microbiota
Bugliani et al. DPP-4 is expressed in human pancreatic beta cells and its direct inhibition improves beta cell function and survival in type 2 diabetes
Gaspari et al. A GLP-1 receptor agonist liraglutide inhibits endothelial cell dysfunction and vascular adhesion molecule expression in an ApoE-/-mouse model
Petersen et al. Generation of L cells in mouse and human small intestine organoids
US9895381B2 (en) Vitamin D receptor agonists to treat diseases involving CXCL12 activity
Bitar et al. Hydrogen sulfide donor NaHS improves metabolism and reduces muscle atrophy in type 2 diabetes: implication for understanding sarcopenic pathophysiology
Feno et al. The dominant-negative mitochondrial calcium uniporter subunit MCUb drives macrophage polarization during skeletal muscle regeneration
Galvin et al. The human and mouse islet peptidome: effects of obesity and type 2 diabetes, and assessment of intraislet production of glucagon-like peptide-1
US20160106762A1 (en) Vitamin d receptor/smad genomic circuit gates fibrotic response
Kim et al. Metformin ameliorates lipotoxicity-induced mesangial cell apoptosis partly via upregulation of glucagon like peptide-1 receptor (GLP-1R)
KR20200095538A (en) Products and methods for assessing and increasing klotoprotein levels
Nakamura et al. Biological and functional characteristics of a novel low–molecular weight antagonist of glucose‐dependent insulinotropic polypeptide receptor, SKL‐14959, in vitro and in vivo
Kato et al. G protein-coupled receptor 40 activation ameliorates dextran sulfate sodium-induced colitis in mice via the upregulation of glucagon-likepeptide-2
Cao et al. Expression of cholecystokinin2-receptor in rat and human L cells and the stimulation of glucagon-like peptide-1 secretion by gastrin treatment
EP4035680A1 (en) Therapy for diabetes using stem cell migration agent
Zhang et al. Uncoupling protein 2 negatively regulates glucose-induced glucagon-like peptide 1 secretion
US20240058390A1 (en) Wnt+ adipocytes, exosomes from wnt+ adipocytes, and methods of making and using them
KR101491108B1 (en) Direct preparation of functional insulin producing cell from human dermal fibroblasts
EP4319734A2 (en) Prostaglandin receptor 3 (ep3) antagonists for use in the treatment of diabetes
Furrer et al. Metabolic dysregulation contributes to the development of dysferlinopathy
Zhao et al. Somatostatin receptor ligands suppressed proliferation and lipogenesis in 3T3‐L1 preadipocytes
Kumari et al. Activation of IRF3 in cardiomyocytes impairs mitochondrial oxidative function through PGC-1α inhibition and drives heart failure

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18837677

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18837677

Country of ref document: EP

Kind code of ref document: A1