WO2019020870A1 - Production améliorée d'oxalyl-coa, de glyoxylate et/ou d'acide glycolique - Google Patents

Production améliorée d'oxalyl-coa, de glyoxylate et/ou d'acide glycolique Download PDF

Info

Publication number
WO2019020870A1
WO2019020870A1 PCT/FI2018/050557 FI2018050557W WO2019020870A1 WO 2019020870 A1 WO2019020870 A1 WO 2019020870A1 FI 2018050557 W FI2018050557 W FI 2018050557W WO 2019020870 A1 WO2019020870 A1 WO 2019020870A1
Authority
WO
WIPO (PCT)
Prior art keywords
fungus
coa
oxalyl
activity
genetically modified
Prior art date
Application number
PCT/FI2018/050557
Other languages
English (en)
Inventor
Mervi Toivari
Marja ILMÉN
Merja Penttilä
Original Assignee
Teknologian Tutkimuskeskus Vtt Oy
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Teknologian Tutkimuskeskus Vtt Oy filed Critical Teknologian Tutkimuskeskus Vtt Oy
Priority to US16/633,608 priority Critical patent/US11124810B2/en
Priority to EP18752797.3A priority patent/EP3658677A1/fr
Publication of WO2019020870A1 publication Critical patent/WO2019020870A1/fr

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/40Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/42Hydroxy-carboxylic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/16Yeasts; Culture media therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/93Ligases (6)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/02Preparation of hydrocarbons or halogenated hydrocarbons acyclic
    • C12P5/026Unsaturated compounds, i.e. alkenes, alkynes or allenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/24Preparation of oxygen-containing organic compounds containing a carbonyl group
    • C12P7/26Ketones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y307/00Hydrolases acting on carbon-carbon bonds (3.7)
    • C12Y307/01Hydrolases acting on carbon-carbon bonds (3.7) in ketonic substances (3.7.1)
    • C12Y307/01001Oxaloacetase (3.7.1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y602/00Ligases forming carbon-sulfur bonds (6.2)
    • C12Y602/01Acid-Thiol Ligases (6.2.1)
    • C12Y602/01008Oxalate--CoA ligase (6.2.1.8)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y604/00Ligases forming carbon-carbon bonds (6.4)
    • C12Y604/01Ligases forming carbon-carbon bonds (6.4.1)
    • C12Y604/01001Pyruvate carboxylase (6.4.1.1)

Definitions

  • the present invention relates to the fields of industrial biotechnology, microbial production organisms and bio-based chemicals. Specifically, the invention relates to a method of converting oxalate to oxalyl-coA and/or oxalyl-coA to glyoxylate in a fungus and to a method of producing oxalyl-CoA, glyoxylate and/or glycolic acid. Still, the present invention relates to a genetically modified fungus comprising increased enzyme activity associated with oxalyl-CoA.
  • the present invention relates to use of the fungus of the present invention for producing oxalate, oxalyl- coA, glyoxylate and/or glycolic acid from a carbon substrate, or to use of the fungus of the present invention for producing polymers, emulsion polymers, biocompatible copolymers, polyglycolic acids, hot-melt adhesives, surfactants, surface treatment products, adhesives, food additives, flavoring agents, preservatives, solvents, cleaning additives or products, dyeing or tanning agents, plasticizers, fragrances, cosmetics, skin care agents and products, or pharmaceuticals. Still furthermore, the present invention relates to a method of producing specific products and to a method of preparing the genetically modified fungus of the present invention.
  • Glycolic acid (chemical formula C 2 H 4 O 3 ) is a 2-carbon organic acid that can be used e.g. in polymers as well as in cleaning and skin-care applications. Glycolic acids occur naturally but are mainly synthetically produced.
  • WO2016/193540 A1 describes a genetically modified fungal cell overexpressing a gene encoding glyoxylate reductase activity. Glyoxylate reductase converts glyoxylate to glycolic acid.
  • said fungal cell is utilized in a method for producing glycolic acid and said publication illustrates a modification of a pathway converting isocitrate to glyoxylate for increased production of glycolic acid.
  • WO2013/050659 A1 describes fungal cells having genetic modifications of glyoxylate reductase and having ability to produce glycolic acid.
  • the present invention describes a novel biotechnical production method of oxalyl- CoA, glyoxylate and/or glycolic acid from pyruvate by fermentation.
  • the object of the invention is to provide synthetic biological applications for sustainable bioecon- omy. Producing glycolic acid directly from renewable sources is a green alternative and at the same time an industrially feasible production process.
  • the present invention surprisingly reveals improved production of oxalyl-coA, glyoxylate and/or glycolic acid or any combination thereof.
  • great yields of oxalyl-coA, glyoxylate and/or glycolic acid or any combination thereof may be produced in fungi ( Figure 1 ).
  • the objects of the invention are achieved by utilizing a synthetic metabolic pathway converting pyruvate and CO2 or alternatively pyruvate to glycolic acid via oxalate/oxalyl-CoA/glyoxylate ( Figure 1 ), or any part of said pathway.
  • the present invention reveals that by genetically modifying expression of one or more enzymes associated with oxalyl-CoA (e.g. enzymes converting oxalate to oxalyl-CoA and/or converting oxalyl-CoA to glyoxylate) increased yield of ox- alyl-coA, glyoxylate and/or glycolic acid may be obtained.
  • one or more enzymes associated with oxalyl-CoA e.g. enzymes converting oxalate to oxalyl-CoA and/or converting oxalyl-CoA to glyoxylate
  • the present invention is based on a novel pathway for glycolic acid production which results in better yield and lower oxygen consumption compared to the previously described methods. Indeed, the present invention improves carbon yield for glycolic acid. There is also either endogenous or exogenous CO2 fixation involved, in case of oxaloacetate originating from pyruvate and CO2.
  • the present fermentation process for production of bio-based chemicals is as car- bon and energy efficient as possible. Indeed, the present invention provides a fast and high yield production process, which is suitable for an industrial scale. High yields of oxalyl-coA, glyoxylate and/or glycolic acid enable low production costs compared to the prior art. Also, the present invention provides efficient possibilities for further processing of high yields of glycolic acids.
  • the present invention enables combination of the new synthetic metabolic pathway and the glyoxylate route for production of glycolic acid.
  • the present invention it is possible to concentrate on efficient production of only one or some main products instead of several by-products.
  • the present invention relates to a method of converting oxalate to oxalyl-coA and/or oxalyl-coA to glyoxylate in a fungus, said method comprising
  • the present invention relates to a method of producing oxalate, oxalyl-coA and/or glyoxylate in a fungus, said method comprising
  • the present invention relates to a method of producing glycolic acid, said method comprising
  • the present invention relates to a genetically modified fungus comprising increased enzyme activity associated with oxalyl-CoA.
  • the present invention relates to use of the fungus of the present invention for producing oxalate, oxalyl-coA, glyoxylate and/or glycolic acid from a carbon substrate.
  • the present invention relates to a method of producing products selected from the group consisting of polymers, emulsion polymers, biocompatible copolymers, polyglycolic acids, hot-melt adhesives, surfactants, surface treatment products, ad- hesives, food additives, flavoring agents, preservatives, solvents, cleaning additives or products, dyeing or tanning agents, plasticizers, fragrances, cosmetics, skin care agents and products, and pharmaceuticals, said method comprising culturing the genetically modified fungus of the present invention in a carbon substrate containing medium to produce glycolic acids, recovering the resulting glycolic acids and utilizing the recovered glycolic acids in production of polymers, emulsion polymers, biocompatible copolymers, polyglycolic acids, hot-melt adhesives, surfactants, surface treatment products, adhesives, food additives, flavoring agents, preservatives, solvents, cleaning additives or products, dyeing or tanning agents, plasticizers, fra- grances, cosmetics, skin care
  • the present invention relates to use of the genetically modified fungus of the present invention for producing polymers, emulsion polymers, biocompatible copolymers, polyglycolic acids, hot-melt adhesives, surfactants, surface treatment products, adhesives, food additives, flavoring agents, preservatives, solvents, cleaning additives or products, dyeing or tanning agents, plasticizers, fragrances, cosmetics, skin care agents and products, or pharmaceuticals.
  • the present invention relates to a method of preparing the ge- netically modified fungus of the present invention, wherein said method comprises providing a fungus and genetically modifying the fungus to increase an enzyme activity associated with oxalyl-CoA.
  • Figure 1 shows an example of producing glycolic acid via oxalate pathway.
  • oxalate pathway pyruvate or phosphoenol pyruvate is first carboxylated into oxalo- acetate. Then oxaloacetate is split to oxalate and acetate, after which oxalate can be converted to oxalyl-CoA in an ATP dependent reaction, and oxalyl-coA is then reduced to glyoxylate and further to glycolic acid.
  • Acetate can be converted to ace- tyl-CoA, which further enters a glyoxylate cycle and is converted to glycolic acid (or to other products).
  • oxaloacetate for the reaction of specific embodiment of the present invention may originate from pyruvate via the tricarboxylic acid cycle (TCA) cycle.
  • TCA tricarboxylic acid cycle
  • Biomass, pyruvate and CO2 are the main side products of the (oxalate) pathway utilized in the present invention.
  • the invention is applicable for production/co-pro-duction of all acetate/acetyl-CoA derived compounds, for example lipids, terpenes, and polyketides.
  • isoprene may be produced from acetyl-CoA.
  • Figure 2 shows production of glycolic acid from pyruvate by a genetically modified fungus.
  • Figure 3 reveals that a control fungus (i.e. not genetically modified according to the present invention) is not capable of producing glycolic acid from pyruvate.
  • a genetically modified fungus is utilized in a method of converting oxalate to oxalyl-coA and/or oxalyl-coA to glyoxylate (e.g. first oxalate to oxalyl-coA and then oxalyl-coA to glyoxylate) or in a method of producing oxalate, oxalyl-CoA, glyoxylate and/or glycolic acid.
  • glycolic acid refers to a monomer of polyglycolic acid.
  • glycolic acid is produced via carbox- ylation of pyruvate to oxaloacetate (pyruvate is the normal intermediate in catabo- lism of glucose) and subsequently splitting oxaloacetate to oxalate and acetate by oxaloacetase enzyme, whereafter oxalate is converted to oxalyl-CoA and further to glyoxylate and glycolic acid.
  • Acetate may enter the glyoxylate cycle and be converted to glycolic acid.
  • the oxalate pathway includes a step for incorporation of CO2/HCO3- instead of producing CO2.
  • the fungus has increased glycolic acid, oxalate, oxalyl-coA and/or glyoxylate production.
  • Glycolic acids are produced from carbon substrates.
  • one or several carbon substrates are selected from the group consisting of pentose such as xylose, xylan or other oligomer of xylose; hexose such as glucose, fructose, mannose or galactose and oligomers of glucose such as maltose, malto- triose, isomaltotriose, starch or cellulose; and sugars such a sugars derived from lignocellulose; oxalate; CO2; ethanol; and any combination thereof.
  • pentose such as xylose, xylan or other oligomer of xylose
  • hexose such as glucose, fructose, mannose or galactose and oligomers of glucose such as maltose, malto- triose, isomaltotriose, starch or cellulose
  • sugars such a sugars derived from lignocellulose; o
  • “Sugars derived from lignocellulose” refer to sugar monomers of lignocellulose including but not lim- ited to glucose, xylose, fructose, mannose, galactose, rhamnose and arabinose.
  • “derived from” refers to products obtained from or isolated from a starting product, as well as modifications thereof.
  • the carbon substrate may comprise ethanol. In a very specific embodiment the production of glycolic acid is not achieved via ethanol.
  • the object of the present invention has been achieved by increasing oxalate-CoA ligase activity and/or oxalyl-CoA reductase activity and/or ketopantoate reductase activity.
  • the genetic modification utilized in the present invention is used for modifying, more specifically increasing, enzyme activity associated with oxalyl-CoA.
  • an enzyme activity associated with oxalyl-CoA refers to an enzyme activity of the oxalate pathway (see Figure 1 ), which is able to convert oxalate to oxalyl-CoA or oxalyl-CoA to glyoxylate.
  • the enzyme activity associated with oxalyl-CoA is oxalate-CoA ligase activity, oxalyl- CoA reductase activity or ketopantoate reductase activity, or any combination thereof (such as oxalate-CoA ligase and oxalyl-CoA reductase activities; oxalate- CoA ligase and ketopantoate reductase activities; oxalate-CoA ligase, oxalyl-CoA reductase and ketopantoate reductase activities).
  • both oxalate-CoA ligase activity and oxalyl- CoA reductase activity, or oxalate-CoA ligase activity and ketopantoate reductase activity may be increased.
  • the fungus has been genetically modified to increase oxalate-CoA ligase activity and/or oxalyl-CoA reductase activity and/or ketopantoate reductase activity.
  • the engineered fungi of the present invention comprises a genetic modification for increasing the production of oxalyl-CoA and/or glyoxylate by increasing oxalate-CoA ligase activity and/or oxalyl-CoA reductase/ketopantoate reductase activity, respectively.
  • the fungus has increased glycolic acid, oxalyl- coA and/or glyoxylate production.
  • An engineered fungus of the present invention comprises a genetic modification increasing protein or enzyme activity.
  • increased protein or enzyme activity refers to the presence of higher activity of a protein compared to a wild type protein, or higher total protein activity of a cell or fungus compared to an unmodified cell or fungus. Increased protein activity may result from up-regulation of the polypeptide expression, up-regulation of the gene expression, addition of at least part of a gene (including addition of gene copies or addition of a gene normally absent in said cell or fungus), increase of protein and/or increased activity of a protein. Specific examples of generating increased protein or enzyme activities are provided in the Example section.
  • Genetic modifications resulting in increased protein activity include but are not lim- ited to genetic insertions, deletions or disruptions of one or more genes or a fragments) thereof or insertions, deletions, disruptions or substitutions of one or more nucleotides, or addition of plasmids.
  • disruption refers to insertion of one or several nucleotides into the gene or polynucleotide sequence resulting in lack of the corresponding protein or presence of non-functional proteins or protein with lowered activity.
  • over-expression refers to excessive expression of a gene or polynucleotide by producing more products (e.g. protein) than an unmodified fungus.
  • one or more copies of a gene or genes may be transformed to a cell for overexpression.
  • the term also encompasses embodiments, where a regulating region such as a promoter or promoter region has been modified or changed or a regulating region (e.g. a promoter) not naturally present in the fungus has been inserted to allow the over-expression of a gene.
  • epigenetic modifications such as reducing DNA methylation or histone modifications are included in "genetic modifications” resulting in increased protein activity or overexpression of a gene.
  • “increased or up-regulated expression” refers to increased expression of the gene or polypeptide of interest compared to a wild type fungus without the genetic modification. Expression or increased expression can be proved for example by western, northern or southern blotting or quantitative PCR or any other suitable method known to a person skilled in the art.
  • the fungus of the invention may comprise one or several genetic modifications.
  • the fungus comprises a genetic modification reducing protein or enzyme activity.
  • Reduced activity refers to the presence of less activity, if any, in a specific protein or modified fungus compared to a wild type protein or fungus, respectively, or lower activity (if any) in a cell or fungus compared to an unmodified cell or fungus. Reduced activity may result from down regu- lation of the polypeptide expression, down regulation of the gene expression, lack of at least part of the gene, lack of protein and/or lowered activity of the protein.
  • There are various genetic techniques for reducing the activity of a protein and said techniques are well-known to a person skilled in the art. These techniques make use of the nucleotide sequence of the gene or of the nucleotide sequence in the proximity of the gene.
  • one or more proteins are inactivated.
  • activation refers to a situation wherein activity of a protein is totally inactivated i.e. a cell has no activity of a specific protein.
  • the gene can be inactivated e.g. by preventing its expression or by mutation or deletion of the gene or part thereof.
  • one or more genes or any fragment thereof has been deleted.
  • the recombinant fungus has been genetically modified by deleting at least part of a gene.
  • part of a gene refers to one or several nucleotides of the gene or any fragment thereof. For example gene knockout methods are suitable for deleting the nucleotide sequence that encodes a polypeptide having a specific activity, of any part thereof.
  • the knowledge of a polynucleotide sequence encoding a polypeptide can be used for genetically modifying a suitable fungus.
  • the fungus has been genetically modified to express or overex- press a gene encoding oxalate-CoA ligase and/or oxalyl-CoA reductase and/or ketopantoate reductase activity (e.g.
  • oxalate-CoA ligase and oxalyl-CoA reductase oxalate-CoA ligase and ketopantoate reductase
  • oxalate-CoA ligase, oxalyl-CoA re- ductase and ketopantoate reductase oxalate-CoA ligase and ketopantoate reductase
  • oxalate-CoA ligase refers to a protein having oxalate-CoA activity i.e. activity to convert oxalate to oxalyl-CoA.
  • the oxalate-CoA ligase is classified as EC 6.2.1 .8.
  • the oxalate-CoA ligase refers to not only Pichia kudriavzevii oxalate- CoA ligase but also to any other oxalate-CoA ligase homologue from any microorganism, e.g. fungus.
  • FAT2 proteins have oxalate-CoA ligase activity.
  • the FAT2 protein and FAT2 gene of the Saccharomyces cerevisiae are identified in the articles of Blobel F and Erdmann R (1996, Eur J Biochem 240(2):468- 76) and Foster J and Nakata PA (2014, FEBS Lett 588(1 ):160-6).
  • suit- able open reading frames include but are not limited to ORF of S. cerevisiae (PCS60, YBR222C).
  • oxalyl-CoA reductase refers to a protein having oxalate-CoA reductase activity i.e. activity to convert oxalyl-CoA to glyoxylate (i.e. glyoxylic acid).
  • the oxalyl-CoA reductase is classified as EC 1 .2.1 .17.
  • the oxalyl-CoA reductase refers to not only Pichia kudriavzevii oxalyl-CoA reductase (if there is such) but also to any other oxalyl-CoA reductase homologue from any micro-organism, e.g.
  • M. extorquens panE2 gene is described for example in the article of Schneider at al. (2012, J Bact 194: 3144-3155).
  • suitable open reading frames include but are not limited to ORF of M. extorquens (WP_015822665).
  • oxalyl-CoA reductase may also have ketopantoate reductase activity i.e. activity catalyzing the second step of the pantothenate pathway after ketoisova- lerate.
  • ketopantoate reductases may harbor oxalyl-CoA reductase activity.
  • the ketopantoate reductase is classified as EC 1 .1 .1 .169.
  • the ketopantoate re- ductase refers to not only Pichia kudriavzevii ketopantoate reductase but also to any other ketopantoate reductase homologue from any micro-organism, e.g. fungus.
  • panE2 protein of the Methylobacterium extorquens is identified in the article of Schneider at al. (2012, J Bact 194: 3144-3155).
  • M. extorquens panE2 gene is described for example in the article of Schneider at al. (2012, J Bact 194: 3144-3155).
  • the engineered fungus includes at least one (e.g. one, two, three, four, five, six or more) heterologous polynucleotide. Any of the inserted polynucleotides or genes (e.g. one, two, three, four, five, six or more) may be heterologous or homologous to the host fungus.
  • the fungus can be genetically modified by transforming it with a heterologous nucleic acid that encodes a heterologous protein.
  • heterologous promoters or other regulating sequences can be utilized in the fungus of the invention.
  • heterologous polynucleotide refers to a polynucleotide not naturally occurring in the host fungus.
  • polypeptide and “protein” are used interchangeably to refer to polymers of amino acids of any length.
  • an enzyme refers to a protein or polypeptide which is able to accelerate or catalyze chemical reactions.
  • polynucleotide refers to any polynucleotide, such as single or dou- ble-stranded DNA (genomic DNA or cDNA) or RNA, comprising a nucleic acid sequence encoding a polypeptide in question or a conservative sequence variant thereof.
  • Conservative nucleotide sequence variants i.e. nucleotide sequence modifications, which do not significantly alter biological properties of the encoded polypeptide
  • the fungus that has been genetically modified to increase an enzyme activity associated with oxalyl-CoA has further been genetically modified to increase at least gly- oxylate reductase (GLYR) activity, oxaloacetase activity, pyruvate carboxylase activity, carbonate dehydratase, isoprene synthase, isopentenyldiphosphate delta-iso- merase, HMG-CoA reductase, fatty acid synthase and/or acetyl-CoA carboxylase activity, or any combination thereof
  • GLYR gly- oxylate reductase
  • glyoxylate reductase and oxaloacetase activities e.g. glyoxylate reductase and oxaloacetase activities; glyoxylate reductase and pyruvate carboxylase activities; glyoxylate reductase and carbonate dehydratase activities; glyoxylate reductase and isoprene synthase activities; glyoxylate reductase and isopentenyldiphosphate delta-isomerase activities; glyoxylate reductase and HMG-CoA reductase activities; glyoxylate reductase and fatty acid synthase activi- ties; glyoxylate reductase and acetyl-CoA carboxylase activities;
  • oxaloacetase and pyruvate carboxylase activities oxaloacetase and carbonate dehydratase activities; oxaloacetase and isoprene synthase activities; oxaloacetase and isopentenyldiphosphate delta-isomerase activities; oxaloacetase and HMG- CoA reductase activities; oxaloacetase and fatty acid synthase activities; oxaloacetase and acetyl-CoA carboxylase activities;
  • pyruvate carboxylase and carbonate dehydratase activities pyruvate carboxylase and isoprene synthase activities; pyruvate carboxylase and isopentenyldiphosphate delta-isomerase activities; pyruvate carboxylase and HMG-CoA reductase activities; pyruvate carboxylase and fatty acid synthase activities; pyruvate carboxylase and acetyl-CoA carboxylase activities;
  • fatty acid synthase activities and acetyl-CoA carboxylase activities fatty acid synthase activities and HMG-CoA reductase activities;
  • isoprene synthase activity isopentenyldiphosphate delta-isomerase activity, oxaloacetase activity, HMG-CoA reductase activity, pyruvate carboxylase activity and glyoxylate reductase activity;
  • glyoxylate reductase activity oxaloacetase activity, pyruvate carboxylate activity, carbonate dehydratase activity, acetyl-CoA carboxylase activity and fatty acid synthase acivity
  • isoprene synthase activity isopentenyldiphosphate delta-isomerase activity, oxalo- acetase activity, HMG-CoA reductase activity, pyruvate carboxylase activity, carbonate dehydratase activity and glyoxylate reductase activity; glyoxylate reductase activity, oxaloacetase activity, pyruvate carboxylate activity, acetyl-CoA carboxylase activity and fatty acid synthase activity).
  • the fungus has been genetically modified to express or overexpress a gene encoding glyoxylate reductase, oxaloacetase, pyruvate carboxylase, carbonate dehydratase, isoprene synthase, isopentenyldiphosphate delta-isomerase, fatty acid synthase or acetyl-CoA carboxylase, or any combination thereof (see some of the possible combinations in the above chapter).
  • glyoxylate reductase refers to a protein having glyoxylate reductase activity i.e. activity to convert glyoxylate to glycolic acid.
  • the glyoxylate reductase is classified as EC 1 .1 .1 .79 or 1 .1 .126.
  • the glyoxylate reductase refers to not only Pichia kudriavzevii glyoxylate reductase but also to any other glyoxylate reductase homologue from any organism, e.g. fungus or plant (such as Arabidopsis tha- liana, Peptinophilus, Limnochorda or Desulfovibrio).
  • Glyrl protein (EC 1 .1 .1 .79) of the Arabidopsis thaliana is identified in the article of Hoover GJ et al.
  • GLYR1 gene is described for example in the article of Salanoubat et al (2000, Nature 408, 820-822).
  • suitable open reading frames include but are not limited to ORF of Arabidopsis thaliana (GenBank AY044183).
  • oxaloacetase refers to a protein having oxaloacetase activity i.e. activity to convert oxaloacetate to oxalate.
  • the oxaloacetase is classified as EC 3.7.1 .1 .
  • the oxaloacetase refers to not only Pichia kudriavzevii oxaloacetase (if there is such) but also to any other oxaloacetase homologue from any micro-organism, e.g.
  • OAH protein of the Aspergillus niger is identified in the article of Kobayashi K et al (2014, J Ind Microbiol Biotechnol 41 ,749-756). OAH gene is described for example in the article of Gom- bert AK et al. (201 1 , Fungal Genetics and Biology 48, 831-839. Examples of suitable open reading frames (ORF) include but are not limited to ORF of Penicillium chrysogenum (Pc22g24830).
  • pyruvate carboxylase refers to a protein having pyruvate carboxylase activity i.e. activity to convert pyruvate to oxaloacetate.
  • the pyruvate carboxylase is classified as EC 6.4.1 .1 .
  • the pyruvate carboxylase refers to not only Pichia kudriavzevii pyruvate carboxylase but also to any other pyruvate carboxylase homologue from any micro-organism, e.g. fungus (such as Saccharomyces cere- visiae).
  • PYC1 and PYC2 proteins of the Saccharomyces cerevisiae are identified in the article of Brewster NK, et al. (1994 Arch Biochem Biophys 31 1 (1 ):62-71 ). PYC1 and PYC2 genes are described for example in the article of Walker ME, et al. (1991 , Biochem Biophys Res Commun 176(3):1210-7). Examples of suitable open reading frames (ORF) include but are not limited to ORF of Saccharomyces cerevisiae (PYC2, YBR218C).
  • carbonate dehydratase refers to a protein having carbonate dehy- dratase activity i.e. activity to convert CO2 to bicarbonate.
  • the carbonate dehydratase is classified as EC 4.2.1 .1 .
  • the carbonate dehydratase refers to not only Pichia kudriavzevii carbonate dehydratase but also to any other carbonate dehydratase homologue from any micro-organism, e.g. fungus (such as Saccharomyces cerevisiae).
  • fungus such as Saccharomyces cerevisiae
  • NCE103 protein of the Saccharomyces cerevisiae is identi- fied in the article of Gabriele Amoroso et al.
  • ORF open reading frames
  • isoprene synthase refers to a protein having isoprene synthase activity i.e. activity to convert dimethylallyl diphosphate to isoprene. The isoprene synthase is classified as EC 4.2.3.27.
  • the isoprene synthase refers to not only Pichia kudriavzevii carbonate dehydratase but also to any other isoprene synthase homologue from any organism, e.g. green plant (such as Ipomoea batatas).
  • IspS protein of Ipomoea batatas is identified in the article of llmen M et al (2015, Metab Eng 31 , 153-162).
  • IspS gene of Ipomoea batatas is identified in the article of llmen M et al (2015, Metab Eng 31 , 153-162).
  • suitable reading frames include but are not limited to ORF of Ipomoea batatas (JP105673.1 ).
  • isoprene is co-produced (or produced) with glycolic acid.
  • isopentenyl diphosphate:dimethylallyl diphosphate isomerase also known as “isopentenyl pyrophosphate isomerase” or “isopentenyl-diphosphate delta isomerase” (IDI) refers to a protein catalyzing the isomerization between isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). The isomerization reaction is part of the biosynthesis of isoprenoids and the sterol precursor squalene. The isopentenyl diphosphate:dimethylallyl diphosphate isomerase is classified as EC 5.3.3.2.
  • the isopentenyl diphosphate:dimethylallyl diphosphate isomerase refers to not only Pichia kudriavzevii isopentenyl diphosphate:dimethylallyl diphosphate isomerase but also to any other isopentenyl diphosphate:dimethylallyl diphosphate isomerase homologue from any organism, e.g. fungus (such as Saccharomy- ces cerevisiae).
  • IDI1 protein of the Saccharomyces cerevisiae are identified in the article of Anderson MS, et al. (1989, J Biol Chem 264(32), 19169- 19175). IDI1 gene is described for example in the article of Mayer MP, et al. (1992, Yeast 8(9), 743-748).
  • suitable open reading frames include but are not limited to ORF of Saccharomyces cerevisiae ⁇ IDI1, YPL1 17C).
  • HMG-CoA reductase refers to a protein having hy- droxymethylglutaryl-CoA reductase activity i.e. activity to convert hydroxymethylglu- taryl-CoA (HMG-CoA) to mevalonate.
  • HMG-CoA reductase is classified as EC 1 .1 .1 .34.
  • the HMG-CoA reductase refers to not only Pichia kudriavzevii HMG-CoA reductase but also to any other pyruvate carboxylase homologue from any microorganism, e.g. fungus (such as Saccharomyces cerevisiae).
  • HMG1 protein i.e. lacking amino acids 1 -552
  • HMG1 and HMG2 genes are described for example in the article of Basson ME, et al. (1986, Proc Natl Acad Sci U S A 83(15):5563-5567).
  • ORF open reading frames
  • suitable open reading frames include but are not limited to ORF of Saccharomyces cerevisiae (HMG1, YML075C).
  • acetyl-CoA carboxylase refers to a protein having carboxylating activity i.e. activity to convert acetyl-CoA and CO2 to malonyl-CoA.
  • the acetyl-CoA carboxylase is classified as EC 6.4.1 .2.
  • the acetyl-CoA carboxylase refers to not only Pichia kudriavzevii acetyl-CoA carboxylase but also to any other acetyl-CoA carboxylase homologue from any micro-organism, e.g. fungus (such as Saccharomyces cerevisiae).
  • ACC1 protein of the Saccharomyces cerevisiae is identified in the article of M. Mishina et al. (1980, Eur J Biochem 1 1 1 (1 ):79-87). ACC1 gene is described for example in the article of Runguphan and Keasling (2014, Metab Eng. 21 :103-13).
  • suitable open reading frames include but are not limited to ORF of Saccharomyces cerevisiae (YNR016C).
  • fatty acid synthase refers to a protein that catalyses fatty acid synthesis. The fatty acid synthase is classified as EC 2.3.1 .85.
  • the fatty acid synthase refers to not only Pichia kudriavzevii fatty acid synthase but also to any other fatty acid synthase homologue from any micro-organism, e.g. fungus (such as Saccha- romyces cerevisiae).
  • fungus such as Saccha- romyces cerevisiae
  • FAS1 protein of the Saccharomyces cere- visiae is identified in the article of M. Schweizer et al. (1986, Mol Gen Genet 203(3):479-86).
  • FAS1 and FAS2 genes are described for example in the article of Runguphan and Keasling (2014, Metab Eng. 21 :103-13).
  • suitable open reading frames include but are not limited to ORF of Saccharomyces cerevisiae (YKL182W and YPL231W).
  • the fungus expresses the oxalate pathway.
  • the biotechnological route for producing glycolic acid by fermentation from pyruvate comprises at least five proteins selected from the group consisting of oxalate-CoA ligase, oxalyl-CoA reductase /ketopantoate reductase, glyoxylate reductase, oxaloacetase, pyruvate carboxylase and carbonate dehydratase (e.g.
  • the genetically modified fungus may be prepared e.g. by allowing at least one or more polynucleotides encoding oxalate-CoA ligase, oxalyl-CoA reductase and/or ketopantoate reductase to be expressed in a fungus (e.g. by in- serting one or more encoding polynucleotides in question to said fungus or by modifying the regulation sequence of said encoding polynucleotide).
  • a fungus of the present invention may also comprise one or several genetic modifications in one or several other genes.
  • These genetic modifications include any genetic modifications including but not limited to genetic insertions, deletions or disruptions of one or more genes or a fragment(s) thereof or insertions, deletions, disruptions or substitutions of one or more nucleotides, or addition of plasmids.
  • disruption refers to insertion of one or several nucleotides into the gene or polynucleotide sequence resulting in lack of the corresponding protein or presence of non-functional proteins or protein with lowered activity.
  • Other genetic modifications may be selected from one or several modifications causing down regulation and/or over-expression of a gene or not affecting the expression of a gene.
  • the fungus comprises a genetic modification of one or more genes selected from the group consisting of malate synthase MLS (such as MLS1), pyruvate decarboxylase PDC (such as PDC1), glycerol-3-phosphate dehydrogenase GPD (such as GPD1), IDP (such as IDP1) and any combination thereof (i.e. MLS and PDC; MLS, PDC and GPD; PDC and GPD; MLS and GPD), or further comprises a genetic modification of a promoter (e.g. change of a promoter).
  • the fungus has been genetically modified by deleting at least part of a gene or by inactivating a gene selected from the group consisting of MLS (such as MLS1), PDC (such as PDC1), GPD (such as GPD1), IDP (such as IDP1), and any combination thereof (i.e. MLS and PDC; MLS, PDC and GPD; MLS, PDC, GPD and /DP; PDC and GPD; PDC, GPD and IDP; MLS and GPD; MLS, GPD and /DP; MLS and IDP; MLS, PDC and IDP; PDC and /DP; GPD and /DP).
  • MLS such as MLS1
  • PDC such as PDC1
  • GPD such as GPD1
  • IDP such as IDP1
  • Reduced expression of MLS e.g.
  • MLS1 results in avoiding conversion of glyoxylate to malate.
  • Reduced expression of PDC results in avoiding ethanol formation.
  • Reduced expression of GPD results in avoiding glycerol formation.
  • the non-modified fungus (i.e. fungus prior to genetic mod- ification of the present invention) comprises one, two, three or more copies of MLS, PDC, GDP and/or IDP genes. In such cases one, two, three or more copies of said genes may have been genetically modified.
  • MLS gene refers to a gene encoding a malate synthase, an enzyme of the glyoxylate cycle.
  • the malate synthase is classified as EC 2.3.3.9. All isozymes, isoforms and variants are included with the scope of MLS.
  • PDC gene refers to a gene encoding a pyruvate decarboxylase, which catalyzes the degradation of pyruvate into acetaldehyde and carbon dioxide.
  • PDC1 , PDC5, and PDC6 encode three different isozymes of pyruvate decarboxylase.
  • the pyruvate decarboxylase is classified as EC 4.1 .1 .1 . All isozymes, isoforms and variants are included with the scope of PDC.
  • GPD gene refers to a gene encoding NAD-dependent glycerol-3- phosphate dehydrogenase, which is a key enzyme of glycerol biosynthesis catalyzing the reaction of dihydroxyacetone phosphate to glyceroi-3-phosphate.
  • Two unlinked genes, GPD1 and GPD2 encode related but not identical polypeptides.
  • the NAD-dependent glycerol-3-phosphate dehydrogenase is classified as EC 1 .1 .1 .8. All isozymes, isoforms and variants are included with the scope of GPD.
  • IDP gene refers to a gene encoding either cytosolic (IDP2) or mito- chondria! (IDP1 ) NADP-specific isocitrate dehydrogenase, which catalyzes the oxidation of isocitrate to a!pha-ketog!utarate.
  • the isocitrate dehydrogenase is classified as EC 1 .1 .1 .42. All isozymes, isoforms and variants are included with the scope of IDP.
  • the fungus of the present invention may also contain other genetic modifications than those specifically described herein.
  • the presence, absence or amount of protein activities in a cell or fungus can be detected by any suitable method known in the art.
  • suitable detection methods include enzymatic assays, PCR based assays (e.g., qPCR, RT- PCR), immunological detection methods (e.g., antibodies specific for said proteins) and combinations thereof.
  • the isoprene pathway, triacylglyceride (TAG) pathway, lipid pathway and/or any pathway starting from acetate/acetyl-CoA is present in said fungus.
  • TAG triacylglyceride
  • lipid pathway lipid pathway and/or any pathway starting from acetate/acetyl-CoA
  • isoprene pathway relates to a pathway wherein acetyl-CoA produced from acetate is converted to isoprene.
  • TAG pathway relates to a pathway wherein acetyl-CoA is converted to triacylglyceride.
  • Triacylglyceride is an ester derived from glycerol and three fatty acids.
  • lipid pathway relates to a lipid metabolism pathway including but not limited to lipid biosynthesis and degradation (e.g. de novo synthesis, uptake of external lipids, and turnover of lipids).
  • acetyl-CoA derived from citrate degradation or from acetate is carboxylated to form malonyl-CoA which serves as a two carbon building block in the following FA synthesis reactions.
  • Lipids are categorized into eight classes which are fatty acids (FA), glycerolipids, glycerophospholipids, sterols and sterol derivatives, sphingolipids, prenol lipids, glycolipids, and polyke- tides.
  • FA fatty acids
  • glycerolipids glycerophospholipids
  • sterols and sterol derivatives glycerophospholipids
  • sphingolipids prenol lipids
  • glycolipids glycolipids
  • polyke- tides any pathway starting from acetate/acetyl-CoA” includes but is not limited to isoprene pathway, TAG pathway, lipid pathway, terpene/terpenoid pathway, polyketide pathway, malonic acid pathway, acetoin pathway, acetone pathway, amino acid pathway, n-butanol pathway, fatty acid ethyl ester pathway, alkane pathway, polyhydroxyalkanoate pathway, pathways via T
  • An engineered microorganism utilized in the present invention is a fungus.
  • "Fungi” "fungus” and “fungal” as used herein refer to yeast and filamentous fungi (i.e. moulds). In one embodiment of the invention the fungus is a yeast or filamentous fungus.
  • a microorganism selected for the present invention is suitable for genetic manipula- tion and often can be cultured at cell densities useful for industrial production of a target product.
  • a microorganism selected may be maintained in a fermentation device.
  • the genetically modified fungi of the invention are obtained by performing specific genetic modifications.
  • a "recombinant fungi” refers to any fungi that has been genetically modified to contain different genetic material compared to the fungi before modification (e.g. comprise a deletion, substitution, disruption or insertion of one or more nucleic acids including an entire gene(s) or parts thereof compared to the fungi before modification).
  • the recombinant fungi also refers to a host cell comprising said genetic modification.
  • a yeast selected from the genera Arxula, Cryptococcus, Candida, Debaryomyces, Galactomyces, Hansenula, Kazachstania, Kluyveromyces, Lipomyces, Lodderomy- ces, Metschnikowia, Millerozyma, Priceomyces, Rhodosporidium, Rhodotorula, Saccharomyces, Sugiyamaella, Trichosporon, Pichia and Yarrowia and Zygosac- charomyces, specifically from the group consisting of Arxula adeninivorans, Candida sp., Candida catenulata, Candida glycerinogenes, Candida haemulonii, Candida humilis Candida maltosa, Candida parapsilopsis, Candida rhagii, Candida ru- gosa, Candida sake, Candida tenuis Cryptococcus curvatus, Cryptococcus albidus, Debaryomyces hansenii, Deb
  • a filamentous fungus selected from the genera Aspergillus, Cunninghamella, Fusarium, Glomus, Humicola, Mortierella, Mucor, Penicillium, Pythium and Rhizo- pus, specifically from the group consisting of Aspergillus nidulans, Aspergillus ory- zae, Aspergillus terreus, Aspergillus niger, Cuninghamella blakesleeana, Cuninghamella japonica, Fusarium moniliforme, Fusarium oxysporum, Glomus cal- edonius, Humicola lanuginose, Mortierella isabellina, Mortierella pusilla, Mortierella vinacea, Mucor circinelloides, Mucor plumbeus, Mucor ramanniana, Penicillium fre- quentans, Penicillium lilacinum, Penicillium soppii, Penicillium spinulosum, Pythium ultimum and Rhizo
  • yeast is Pichia kudriavzevii.
  • the recombinant fungus is able to produce ethanol. In another embodiment the fungus is not able to produce ethanol. In a very specific embodiment production of oxalate, oxalyl-coA, glyoxylate and/or glycolic acid is achieved directly from glucose and not via ethanol.
  • the genetically modified fungus is acid tolerant.
  • the genetically modified or recombinant fungi are cultured in conditions allowing the expression of oxalate-CoA ligase and/or oxalyl-CoA reductase and/or ketopantoate reductase.
  • the methods of the present invention are carried out under culture conditions in which the cultured micro-organisms produce oxalate, oxalyl-coA, glyoxylate and/or glycolic acid.
  • the glycolic acid production capacity of the genetically modified fungal hosts may be examined by cultivation under conditions appropriate for glycolic acid production.
  • the genetically modified fungi of the present invention are capable of producing increased levels of glycolic acids.
  • the increase may be at least a 1 .5, 2, 3, 4, 5, 10, 15, 20, 30, 50, 100, 500 or 1000 fold increase in glycolic acid concentration in genetically modified fungus of the present invention compared to an unmodified fungus or any fungus with other modifications during cultivation.
  • it may be at least a 1 .5, 2, 3, 4, 5, 10, 15, 20, 30, 50, 100, 500 or 1000 fold increase in glycolic acid yield per used carbon source compared to an unmodified fungus or any fungus with other modifications.
  • Said increase may also refer to at least a 1 .5, 2, 3, 4, 5, 10, 15, 20, 30, 50, 100, 500 or 1000 fold increase in glycolic acid production rate (mg/l/h) compared to an unmodified fungal strain or any fungus with other modifications.
  • glycolic acid production may be detected either intracellularly or in the amount of glycolic acids in culture medium.
  • the genetically modified fungi are cultivated in a medium containing appropriate carbon sources together with other optional ingredients selected from the group consisting of nitrogen or a source of nitrogen (such as amino acids, proteins, inorganic nitrogen sources such as ammonia or ammonium salts), yeast extract, peptone, minerals and vitamins.
  • Suitable cultivation conditions such as temperature, cell density, selection of nutrients, and the like are within the knowledge of a skilled person and can be selected to provide an economical process with the micro-organism in question. Temperatures during each of the growth phase and the production phase may range from above the freezing temperature of the medium to about 50°C, although the optimal temperature will depend somewhat on the particular micro-organism. In a specific embodiment the temperature, particularly during the production phase, is from about 25 to 30°C.
  • the pH of the cultivation process may or may not be controlled to remain at a constant pH, but is usually between 3 and 9, depending on the production organism. Optimally the pH is controlled to a constant pH of 5-8.
  • the present invention may also be implemented at a very low pH, even as low as 1 .5.
  • Suitable buffering agents include, for example, calcium hydroxide, calcium carbonate, sodium hydroxide, po- tassium hydroxide, potassium carbonate, sodium carbonate, ammonium carbonate, ammonia, ammonium hydroxide and the like. In general, those buffering agents that have been used in conventional cultivation methods are also suitable here.
  • the cultivation is conveniently conducted aerobically or microaerobically. If desired, specific oxygen uptake rate can be used as a process control.
  • the process of the invention can be conducted continuously, batch-wise, or some combination thereof.
  • the method further comprises recovering the resulting glycolic acid from the medium.
  • the cells producing glycolic acids do not need to be disrupted.
  • glycolic acid may be recovered from the fermentation medium by e.g. ion exchange chromatography or reactive extraction. In some em- bodiments glycolic acid may be polymerized in the medium and recovered thereafter.
  • the method further comprises recovering the resulting oxalate, oxalyl-coA and/or glyoxylate from the medium or from the cells.
  • the cells producing oxalate, oxalyl-coA and/or glyoxylate have to be disrupted.
  • the production method of the present invention further comprises isolating and/or purifying oxalate, oxalyl-coA, glyoxylate and/or glycolic acid.
  • Oxalate, oxalyl-coA, glyoxylate and/or glycolic acid may be isolated and purified (for example from the medium) by using any conventional methods known in the art such as ion exchange chromatography, reactive extraction, two phase extraction, molecular distillation, melt crystallization, hexane extraction, CO2 extraction or distillation.
  • Glycolic acids are used for producing bio-based chemicals.
  • Glycolic acid produced and recovered by the present invention may be utilized for producing e.g. one or several products selected from the group consisting of polymers, emulsion polymers, biocompatible copolymers, polyglycolic acids, hot-melt adhesives, surfac- tants, surface treatment products, adhesives, food additives, flavoring agents, preservatives, solvents, cleaning additives or products, dyeing or tanning agents, plas- ticizers, fragrances, cosmetics, skin care agents and products, and pharmaceuticals.
  • Uses and methods for producing said products are well known to a person skilled in the art.
  • glycolic acid may be polymerized to polyglycolic acid, which has high gas barrier properties and mechanical strength and furthermore it is biodegradable.
  • glycolic acid based plastics or films offer unique properties.
  • glycolic acid may also be used as a copolymer with other chemical agents such as lactic acid.
  • H4155 overexpressing A. thaliana GLYR1 has been described earlier (Koivistoinen et al. WO 2013/050659). H4155 has both copies of diploid P. kudriavzevii MLS1 genes replaced by A. thaliana GLYR1.
  • Penicillium chrysogenum oah (Pc22g24830), was synthesized and codon optimized for expression in S. cerevisiae.
  • the oxaloa- cetase expression vector pMIPk1 17 (SEQ ID NO: 3) consists of P. kudriavzevii PDC1 3' homology region - MEL5 marker cassette flanked by loxP sites - P. kudriavzevii TDH1 promoter - Penicillium chrysogenum. oah - S. cerevisiae PGK1 terminator - P.
  • pMIPk1 17 (SEQ ID NO: 3) was digested with Not ⁇ and transformed into P. kudriavzevii H4738 using the lithium acetate method. The transformants were selected based on blue colour on yeast peptone dextrose (YPD) medium containing 5-bromo-4-chloro-3-indolyl-a-D-galac- topyranoside (X-alpha-gal). The presence of the transforming DNA in the trans- formant yl_IF-050 was confirmed by PCR.
  • S. cerevisiae PYC2 was PCR amplified from genomic DNA of S. cerevisiae with the primers LIF108 (CCTCCACTAGTGGTCTCAGATCTAGAATGAGCAGTAGCAAGAAATTGGC (SEQ ID NO: 1 )) and LIF109
  • pMIPk1 18 (SEQ ID NO: 5) consists of P. kudriavzevii PDC1 5' homology region - P. kudriavzevii PGK1 promoter - S. cerevisiae PYC2 - S. cerevisiae ADH1 terminator - hygromycin resistance cassette flanked by loxP sites - P.
  • kudriavzevii PDC1 3' homology region pMIPkl 18 (SEQ ID NO: 5) was digested with Not ⁇ and transformed into P. kudriavzevii yLIF- 050 using the lithium acetate method. The transformants were selected on yeast peptone dextrose (YPD) medium containing 500 g/ml hygromycin. The presence of the transforming DNA in the transformant yl_IF-065 was confirmed by PCR.
  • YPD yeast peptone dextrose
  • the MEL5 and hygromycin resistance markers were excised from yl_IF-065 using the Cre-loxP system.
  • the Cre recombinase was expressed from plasmid pKLNat- Cre+loPGK.
  • the transformant yl_IF-065 was retransformed with a modified plasmid pKINatCre Steensma and Ter Linde (2001 , Yeast 18:469-472), expressing the Cre recombinase.
  • P. kudriavzevii the S. cerevisiae GAL1 promoter in pKINatCre was replaced with P.
  • kudriavzevii PGK1 pro- moter as described in (WO14162063A1 ).
  • the transformants were selected on yeast peptone dextrose (YPD) medium containing 200 g/ml nourseothricin.
  • YPD yeast peptone dextrose
  • the marker- less transformant yLIF-164 was isolated.
  • pMLV209 (SEQ ID NO: 6) was constructed using yeast recombination.
  • pMLV209 (SEQ ID NO: 6) consists of P. kudriavzevii GPD1 3' homology region - hygromycin resistance cassette flanked by loxP sites - P. kudriavzevii PYK1 promoter - S. cerevisiae FAT2 - S. cerevisiae PDC1 terminator P. kudriavzevii TEF1 promoter - M. extorquens panE2 - S.
  • pMLV209 (SEQ ID NO: 6) was digested with Not ⁇ and transformed into P. kudriavzevii yLIF-164 using the lithium acetate method.
  • the transformants were selected on yeast peptone dextrose (YPD) medium containing 500 g/ml hygromycin. The presence of the transforming DNA in the transformant yLIF-270 was confirmed by PCR.
  • pMIPk1 14 (SEQ ID NO: 7) consists of P. kudriavzevii PDC1 3' homology region, MEL5 marker flanked by loxP sites - P. kudriavzevii TDH1 promoter - A. niger oah -S. cerevisiae PGK1 terminator.
  • pMIPkl 14 (SEQ ID NO: 7) was digested with Not ⁇ and transformed into P.
  • kudriavzevii yLIF-270 using the lithium acetate method.
  • the transformants were selected based on blue colour on yeast peptone dextrose (YPD) medium containing 5-bromo-4-chloro-3-indolyl-a-D-galactopyra- noside (X-alpha-gal).
  • the MEL5 and hygromycin resistance markers is excised from yl_IF309 using the Cre-loxP system as described above.
  • the markerless derivative of yl_IF309 is transformed with Notl digested pMIPk120 (SEQ ID NO: 8).
  • pMIPk120 (SEQ ID NO: 8) consists of P. kudriavzevii PDC1 5' homology region - P. kudriavzevii PGK1 promoter - S. cerevisiae PYC2 - S. cere- visiae ADH1 terminator - P. kudriavzevii FBA1 promoter - S.
  • pMIPk120 (SEQ ID NO: 8) is digested with Not ⁇ and transformed into the markerless derivative of P. kudriavzevii yl_IF309 using the lithium acetate method.
  • the transformants are selected on yeast peptone dextrose (YPD) medium containing 500 g/ml hygromycin. The presence of the transforming DNA in the transformants is confirmed by PCR.
  • Pichia kudriavzevii strain yl_IF309 was cultured in Multifors bioreactors (max. work- ing volume 500 ml, Infors HT, Switzerland) at pH 5, 30°C, 0.7 volume air [volume culture]-1 min-1 (vvm) and 900 rpm - 1050 rpm agitation with 2 marine impellors. pH was maintained constant by addition of 2 M NaOH or 1 M H2PO 4 . Clerol anti- foaming agent (Cognis, France, 0.2 ml 1-1 ) was added to prevent foam formation. Minimal media (Verduyn with additional KH2PO 4 , MgSO 4 and (NH 4 )2SO 4 ) was used.
  • the culture was first in a batch mode (starting volume 200 ml, 50 g/l glucose), after which the feed (200 g/l glucose) was started and culture continued in a fed-batch mode.
  • Biomass was measured as optical density (OD) at 600 nm (OD600) or as dry weight. For dry weight, samples were collected in 2 ml pre-dried, pre-weighed microcentrifuge tubes, washed twice with equal volume distilled water and dried at 100°C.
  • Control strain Pichia kudriavzevii strain yLIF164 was cultured in Multifors bioreactors (max. working volume 500 ml, Infors HT, Switzerland) at pH 5, 30°C, Gasflow 1 vvm (100% CO2 flow and air flow mixed together to have total of 10% CO2 in the mixture going to reactors) and 700 rpm - 900 rpm agitation with 2 rushton impellors. pH was maintained constant by addition of 5 M KOH or 2 M H2PO 4 . Clerol antifoaming agent (Cognis, France, 0.5 ml 1-1 ) was added to prevent foam formation.
  • Minimal media (Verduyn with additional KH2PO 4 , MgSO 4 and (NH 4 )2SO 4 ) was used.
  • the culture was run in a batch mode (volume 400 ml, 100 g/l glucose). Biomass was measured as optical density (OD) at 600 nm (OD600) or as dry weight. For dry weight, samples were collected in 2 ml pre-dried, pre-weighed microcentrifuge tubes, washed twice with equal volume distilled water and dried at 100°C.
  • the Pichia kudriavzevii strain yLIF309 is cultured in minimal and/or rich media in culture conditions where final pH is lower than 3.5.
  • the glycolic acid produced in the culture supernatant is measured as described in example 2.
  • isoprene producing P. kudriavzevii has been described in WO16018036A1 .
  • the isoprene producing strain overexpresses the heterologous Ipomoea batatas isoprene synthase IspS, and S. cerevisiae isopentenyl-diphos- phate delta-isomerase (IDI1).
  • IDI1 S. cerevisiae isopentenyl-diphos- phate delta-isomerase
  • the isoprene producing transformant Pk/lspS+IDI1 - 72 (WO16018036A1 ) was retransformed with a modified plasmid pKINatCre, expressing the Cre recombinase as described above and the markerless transformant H4735 was isolated.
  • P. kudriavzevii The isoprene producing strain overexpresses the heterologous Ipomoea batatas iso
  • pMIPk1 13 (SEQ ID NO: 9) was constructed.
  • pMIPkl 13 (SEQ ID NO: 9) consists of P. kudriavzevii PDC1 3' homology region, MEL5 marker flanked by loxP sites - P. kudriavzevii TDH1 promoter - P. chrysosporium oah -S. cerevisiae PGK1 terminator - P. kudriavzevii PGK1 promoter - S.
  • pMIPk1 13 (SEQ ID NO: 9) was digested with Not ⁇ and transformed into P. kudriavzevii H4735 using the lithium acetate method.
  • the trans- formants were selected based on blue colour on yeast peptone dextrose (YPD) medium containing 5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside (X-alpha-gal).
  • YPD yeast peptone dextrose
  • X-alpha-gal 5-bromo-4-chloro-3-indolyl-a-D-galactopyranoside
  • pyruvate carboxylase pMIPk1 18 (SEQ ID NO: 5) was digested with Not ⁇ and transformed into P. kudriavzevii yLIF-142 using the lithium ac- etate method.
  • the transformants were selected on yeast peptone dextrose (YPD) medium containing 500 g/ml hygromycin.
  • YPD yeast peptone dextrose
  • the MEL5 and hygromycin resistance markers are excised from yLIF-146 using the Cre-loxP system as described above. Both copies of diploid P. kudriavzevii MLS1 genes are replaced by A. thaliana GLYR1 as decribed in (Koivistoinen et al. WO 2013/050659).
  • the transformation marker genes hph and MEL5, located between loxP sites, are removed from the genome with the Cre recombinase expression plasmid pKLNatCre+loPGK. The markerless strain is then transformed with Notl di- gested pMLV209 (SEQ ID NO: 6).
  • the presence of oxalate-CoA ligase and oxalyl- CoA reductase is verified by PCR.
  • the resulting strain has pathways for production of isoprene and oxalate, oxalyl-coA, glyoxylate and/or glycolic acid directly from glucose.
  • the resulting strains are cultivated in minimal and/or rich media and the glycolic acid produced in the culture supernatant is measured as described in example 2. Production of isoprene is measured with mass spectrometry. Example 5.
  • the Pichia kudriavzevii strain yl_IF309 producing glycolic acid is modified to also produce triacylglycerids as described in Runguphan (2014, Metab Eng. 21 :103-13). Codon optimised synthetic genes coding for acetyl-CoA carboxylase and fatty acid synthase are cloned under constitutive, endogenous promoters and introduced into the genome of P. kudriavzevii by either homologous recombination into targeted gene loci or by ran- dom integration into the genome.
  • the resulting strains are cultivated in minimal and/or rich media and the glycolic acid produced in the culture supernatant is measured as described in example 2. Production of triacylglycerids is measured with mass spectrometry. Example 6. Production of glycolic acid from oxalate
  • the Pichia kudriavzevii strain yl_IF309 producing glycolic acid is cultivated in minimal and/or rich media containing oxalate and/or oxalic acid and the glycolic acid produced in the culture supernatant is meas- ured as described in example 2.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne un procédé de conversion d'oxalate en oxalyl-CoA et/ou d'oxalyl-CoA en glyoxylate dans un champignon et un procédé de production d'acide glycolique. En outre, la présente invention concerne un champignon génétiquement modifié comprenant une activité enzymatique accrue associée à l'oxalyl-CoA. Et de plus, la présente invention concerne l'utilisation du champignon de la présente invention pour la production d'oxalate, d'oxalyl-CoA, de glyoxylate et/ou d'acide glycolique à partir d'un substrat de carbone. En outre, la présente invention concerne un procédé de production de produits spécifiques et un procédé de préparation du champignon génétiquement modifié de la présente invention.
PCT/FI2018/050557 2017-07-28 2018-07-27 Production améliorée d'oxalyl-coa, de glyoxylate et/ou d'acide glycolique WO2019020870A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US16/633,608 US11124810B2 (en) 2017-07-28 2018-07-27 Production of oxalyl-CoA, glyoxylate and/or glycolic acid
EP18752797.3A EP3658677A1 (fr) 2017-07-28 2018-07-27 Production améliorée d'oxalyl-coa, de glyoxylate et/ou d'acide glycolique

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FI20175703 2017-07-28
FI20175703 2017-07-28

Publications (1)

Publication Number Publication Date
WO2019020870A1 true WO2019020870A1 (fr) 2019-01-31

Family

ID=63165396

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FI2018/050557 WO2019020870A1 (fr) 2017-07-28 2018-07-27 Production améliorée d'oxalyl-coa, de glyoxylate et/ou d'acide glycolique

Country Status (3)

Country Link
US (1) US11124810B2 (fr)
EP (1) EP3658677A1 (fr)
WO (1) WO2019020870A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114507611A (zh) * 2022-02-17 2022-05-17 大自然生物集团有限公司 α-酮戊二酸生产用耐高温酵母及发酵方法

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007141316A2 (fr) 2006-06-09 2007-12-13 Metabolic Explorer Production d'acide glycolique par fermentation à partir de ressources renouvelables
WO2011036213A2 (fr) 2009-09-25 2011-03-31 Metabolic Explorer Processus de fermentation pour la production d'acide glycolique
WO2013050659A1 (fr) 2011-10-04 2013-04-11 Teknologian Tutkimuskeskus Vtt Cellules eucaryotes et procédé de production d'acide glycolique
WO2014162063A1 (fr) 2013-04-05 2014-10-09 Teknologian Tutkimuskeskus Vtt Production d'acide(s) et d'alcool à partir de sucres par utilisation de levure
WO2016018036A1 (fr) 2014-07-28 2016-02-04 Sk Innovation Co., Ltd. Nouvelle isoprène synthase et procédé de préparation d'isoprène l'utilisant
WO2016193540A1 (fr) 2015-05-29 2016-12-08 Teknologian Tutkimuskeskus Vtt Oy Conversion directe de sucres en acide glycolique

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105073214A (zh) 2012-12-31 2015-11-18 英威达技术有限责任公司 通过甲酯保护的碳链延伸生产6碳化学物的方法
US11273184B2 (en) 2015-08-31 2022-03-15 Synlogic Operating Company, Inc. Bacteria engineered to treat disorders in which oxalate is detrimental

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007141316A2 (fr) 2006-06-09 2007-12-13 Metabolic Explorer Production d'acide glycolique par fermentation à partir de ressources renouvelables
WO2011036213A2 (fr) 2009-09-25 2011-03-31 Metabolic Explorer Processus de fermentation pour la production d'acide glycolique
WO2013050659A1 (fr) 2011-10-04 2013-04-11 Teknologian Tutkimuskeskus Vtt Cellules eucaryotes et procédé de production d'acide glycolique
WO2014162063A1 (fr) 2013-04-05 2014-10-09 Teknologian Tutkimuskeskus Vtt Production d'acide(s) et d'alcool à partir de sucres par utilisation de levure
WO2016018036A1 (fr) 2014-07-28 2016-02-04 Sk Innovation Co., Ltd. Nouvelle isoprène synthase et procédé de préparation d'isoprène l'utilisant
WO2016193540A1 (fr) 2015-05-29 2016-12-08 Teknologian Tutkimuskeskus Vtt Oy Conversion directe de sucres en acide glycolique

Non-Patent Citations (32)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. AY044183
AGUILERA J. ET AL., FEMS YEAST RES, vol. 5, 2005, pages 579 - 593
ANDERSON MS ET AL., J BIOL CHEM, vol. 264, no. 32, 1989, pages 19169 - 19175
BARITUGO ET AL: "Metabolic engineering of Corynebacterium glutamicum for fermentative production of chemicals in biorefinery", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 102, 20 March 2018 (2018-03-20), pages 3915 - 3937, XP036477576 *
BASSON ME ET AL., PROC NATL ACAD SCI U S A, vol. 83, no. 15, 1986, pages 5563 - 5567
BLOBEL F; ERDMANN R, EUR J BIOCHEM, vol. 240, no. 2, 1996, pages 468 - 76
BREWSTER NK ET AL., ARCH BIOCHEM BIOPHYS, vol. 311, no. 1, 1994, pages 62 - 71
FOSTER ET AL: "An oxalyl-CoA synthetase is important for oxalate metabolism in Saccharomyces cerevisiae", FEBS LETTERS, vol. 588, 2014, pages 160 - 166, XP055320823 *
FOSTER J; NAKATA PA, FEBS LETT, vol. 588, no. 1, 2014, pages 160 - 6
GABRIELE AMOROSO ET AL., MOLECULAR MICROBIOLOGY, vol. 56, no. 2, 2005, pages 549 - 558
GÄDDA ET AL: "The industrial potential of bio-based glycolic acid and polyglycolic acid", APPITA, vol. 67, 2014, pages 352, XP009507854 *
GOM-BERT AK ET AL., FUNGAL GENETICS AND BIOLOGY, vol. 48, 2011, pages 831 - 839
HOOVER GJ ET AL., CAN J BOT., vol. 85, no. 9, 2007, pages 883 - 895
KOBAYASHI K ET AL., J IND MICROBIOL BIOTECHNOL, vol. 41, 2014, pages 749 - 756
KOIVISTOINEN ET AL: "Engineering yeast for production of glycolic acid", CONFERENCE ABSTRACT, 2016, pages 1, 13, XP002784464, Retrieved from the Internet <URL:http://toc.proceedings.com/32408webtoc.pdf> [retrieved on 20180905] *
KOIVISTOINEN ET AL: "Glycolic acid production in the engineered yeasts Saccharomyces and Kluyveromyces lactis", MICROBIAL CELL FACTORIES, vol. 12, 2013, pages 1 - 16, XP021164132 *
KOIVISTOINEN: "Catabolism of biomass-derived sugars in fungi and metabolic engineering as a tool for organic acid production", THESIS, 2013, pages 1 - 86, XP002784470, Retrieved from the Internet <URL:https://helda.helsinki.fi/bitstream/handle/10138/41116/koivistoinen_dissertation.pdf?sequence=1&isAllowed=y> [retrieved on 20180905] *
LLMEN M ET AL., METAB ENG, vol. 31, 2015, pages 153 - 162
M. MISHINA ET AL., EUR J BIOCHEM, vol. 111, no. 1, 1980, pages 79 - 87
M. SCHWEIZER ET AL., MOL GEN GENET, vol. 203, no. 3, 1986, pages 479 - 86
MAYER MP ET AL., YEAST, vol. 8, no. 9, 1992, pages 743 - 748
METAB ENG., vol. 21, 2014, pages 103 - 13
POLAKOWSKI T. ET AL., APPL MICROBIOL BIOTECHNOL, vol. 49, no. 1, 1998, pages 66 - 71
RUNGUPHAN, METAB ENG., vol. 21, 2014, pages 103 - 13
RUNGUPHAN; KEASLING, METAB ENG., vol. 21, 2014, pages 103 - 13
SALANOUBAT ET AL., NATURE, vol. 408, 2000, pages 820 - 822
SALUSJÄRVI ET AL: "Production of ethylene glycol or glycolic acid from D-xylose in Saccharomyces cerevisiae", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 101, 16 October 2017 (2017-10-16), pages 8151 - 8163, XP036347977 *
SCHNEIDER ET AL: "Oxalyl-Coenzyme A reduction to glyoxylate is the preferred route of oxalate assimilation in Methylobacterium extorquens AM1", JOURNAL OF BACTERIOLOGY, vol. 194, 2012, pages 3144 - 3155, XP002784523 *
SCHNEIDER, J BACT, vol. 194, 2012, pages 3144 - 3155
STEENSMA; TER LINDE, YEAST, vol. 18, 2001, pages 469 - 472
TOIVARI: "Fungi - excellent hosts for production of organic acids in Finland", CONFERENCE PAPER (ABSTRACT), 19 April 2016 (2016-04-19), San Diego, pages 2 - 3, XP002784463, Retrieved from the Internet <URL:https://www.bio.org/sites/default/files/eBook%203.28.16_0.pdf?_ga=1.131262991.1005408171.1456107776> [retrieved on 20180905] *
WALKER ME ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 176, no. 3, 1991, pages 1210 - 7

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114507611A (zh) * 2022-02-17 2022-05-17 大自然生物集团有限公司 α-酮戊二酸生产用耐高温酵母及发酵方法
CN114507611B (zh) * 2022-02-17 2023-10-13 大自然生物集团有限公司 α-酮戊二酸生产用耐高温酵母及发酵方法

Also Published As

Publication number Publication date
EP3658677A1 (fr) 2020-06-03
US20200199632A1 (en) 2020-06-25
US11124810B2 (en) 2021-09-21

Similar Documents

Publication Publication Date Title
US20230193299A1 (en) Compositions and methods for succinate production
US9689005B2 (en) Succinic acid production in a eukaryotic cell
US7109010B2 (en) Methods and materials for the synthesis of organic products
JP6061862B2 (ja) 3‐ヒドロキシプロピオン酸生産用の組成物及び方法
US10704064B2 (en) Recombinant yeast producing 3-hydroxypropionic acid and method for producing 3-hydroxypropionic acid using the same
EP2764085B1 (fr) Cellule eukaryote et procédé de production de l&#39;acide glycolique
WO2009065779A1 (fr) Production d&#39;acide dicarboxylique dans une levure recombinante
KR101674361B1 (ko) 유기산 제조에서의 모나스쿠스의 용도
WO2013112939A2 (fr) Procédés de production de succinate
US20140045230A1 (en) Dicarboxylic acid production in a filamentous fungus
WO2016193540A1 (fr) Conversion directe de sucres en acide glycolique
US11124810B2 (en) Production of oxalyl-CoA, glyoxylate and/or glycolic acid
WO2014207099A1 (fr) Production biologique anoxique de carburants et de produits chimiques en vrac à partir de matières premières de deuxième génération
US20130309736A1 (en) Compositions and methods for malate and fumarate production
WO2012103263A2 (fr) Compositions et méthodes pour la production de malate et de fumarate
WO2019195382A1 (fr) Production accrue d&#39;alcool à partir de levure produisant une quantité accrue de protéine hac1 active

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18752797

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2018752797

Country of ref document: EP