WO2019014768A1 - ANTI-BETA-AMYLOID ANTIBODY - Google Patents
ANTI-BETA-AMYLOID ANTIBODY Download PDFInfo
- Publication number
- WO2019014768A1 WO2019014768A1 PCT/CA2018/050875 CA2018050875W WO2019014768A1 WO 2019014768 A1 WO2019014768 A1 WO 2019014768A1 CA 2018050875 W CA2018050875 W CA 2018050875W WO 2019014768 A1 WO2019014768 A1 WO 2019014768A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- seq
- beta
- sequence
- antibodies
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
- G01N33/6896—Neurological disorders, e.g. Alzheimer's disease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
- G01N2333/4701—Details
- G01N2333/4709—Amyloid plaque core protein
Definitions
- the present disclosure relates to humanized antibodies that are selective for Amyloid beta (A- beta or ⁇ ) oligomers as well as compositions and uses thereof.
- Amyloid-beta which exists as a 36-43 amino acid peptide, is a product released from amyloid precursor protein (APP) by the enzymes ⁇ and ⁇ secretase.
- APP amyloid precursor protein
- A- beta can be present in soluble monomers, insoluble fibrils and soluble oligomers. In monomer form, A- beta exists as a predominantly unstructured polypeptide chain. In fibril form, A-beta can aggregate into distinct morphologies, often referred to as strains. Several of these structures have been determined by solid-state NMR.
- PDB Protein Data Bank
- 2M4J a crystallographic database of atomic resolution three dimensional structural data, including a 3-fold symmetric A/3 structure (PDB entry, 2M4J); a two-fold symmetric structure of A/3-40 monomers (PDB entry 2LMN), and a single-chain, parallel in-register structure of A/3-42 monomers (PDB entry 2MXU).
- A-beta oligomers have been shown to kill cell lines and neurons in culture and block a critical synaptic activity that subserves memory, referred to as long term potentiation (LTP), in slice cultures and living animals.
- LTP long term potentiation
- the structure of the oligomer has not been determined to date. Moreover, NMR and other evidence indicates that the oligomer exists not in a single well-defined structure, but in a conformationally-plastic, malleable structural ensemble with lim ited regularity. Moreover, the concentration of toxic oligomer species is far below either that of the monomer or fibril (estimates vary but are on the order of 1000-fold below or more), making this target elusive.
- DISEASES discloses chimeric antibodies that recognize one or more binding sites on A-beta and are useful for the treatment for ocular diseases.
- AMYLOID OR AMYLOID-LIKE PROTEINS describes pharmaceutical compositions and discontinuous antibodies that bind A-beta including an epitope between amino acid residues 12 to 24 for the treatment of amyloid-related diseases.
- WO2003070760A2 titled ANTI-AMYLOID BETA ANTIBODIES AND THEIR USE discloses antibodies that recognize an A-beta discontinuous epitope, wherein the first region comprises the amino acid sequence AEFRHDSGY or a fragment thereof and wherein the second region comprises the amino acid sequence VHHQKLVFFAEDVG or a fragment thereof.
- US20110171243A1 titled COMPOUNDS TREATING AMYLOIDOSES discloses a peptide mimotope capable of inducing the in vivo formation of antibodies that bind HQKLVFand/or HQKLVFFAED, and its use.
- WO2008088983A1 and WO2001062801 A2 disclose a pegylated antibody fragment that binds A-beta amino acids 13-28 and its use in treating A-beta related diseases. Solanezumab and Crenezumab bind amino acids 16-26 on A-beta. Crenezumab interacts with the monomer, oligomer and fibril. Midregion antibodies, including solanezumab (picomolar affinity) and crenezumab (nanomolar affinity), appear to preferentially bind monomeric A-beta [13].
- WO2009149487A2 titled COMPOUNDS FOR TREATING SYMPTOMS ASSOCIATED WITH PARKINSON'S DISEASE describes compounds comprising a peptide having binding capacity for an antibody specific for an A-beta epitope such as EVHHQKL, HQKLVF and HQKLVFFAED.
- HHQK (SEQ ID NO: 7) domain is described as involved in plaque induction of neurotoxicity in human microglia, as described in Giulian D ef al. [11 ] and Winkler ef al. [12].
- Non- antibody therapeutic agents that bind HHQK (SEQ ID NO: 7) have been disclosed for the treatment of protein folding diseases (US20150105344A1 , WO2006125324A1 ).
- WO2009086539A2 titled TREATMENT AND PROPHYLAXIS OF AMYLOIDOSIS is directed to Amyloidosis and amyloid light chain amyloidosis, by administering peptides comprising neoepitopes, such as amyloid protein A (AA) fragments from a C-terminal region of AA, and antibodies specific for neoepitopes of aggregated amyloid proteins, for example, antibodies specific for the C-terminal region of AA fibrils.
- AA amyloid protein A
- WO2003070760 titled ANTI-AMYLOID BETA ANTIBODIES AND THEIR USE is directed towards antibody molecules capable of specifically recognizing two regions of the R-A4 peptide, wherein the first region comprises the amino acid sequence AEFRHDSGY or a fragment thereof and wherein the second region comprises the amino acid sequence VHHAEDVFFAEDVG or a fragment thereof.
- IMPROVING COGNITION is directed to improved agents and methods for treatment of diseases associated with beta amyloid and in particular to the identification and characterization of a monoclonal antibody, 12A11 , that specifically binds to ⁇ peptide and is effective at reducing plaque burden associated with amyloidogenic disorders (e.g., AD).
- a monoclonal antibody, 12A11 that specifically binds to ⁇ peptide and is effective at reducing plaque burden associated with amyloidogenic disorders (e.g., AD).
- GLYCOSYLATED IN THE VARIABLE REGION is directed to a purified antibody molecule preparation being characterized in that at least one antigen binding site comprises a glycosylated asparagine (Asn) in the variable region of the heavy chain (VH).
- WO 03/016466 is directed variant 266 antibodies that are engineered to lack an N- glycosylation site within the CDR2 of the heavy chain, pharmaceutical compositions thereof, and polynucleotide sequences, vectors, and transformed cells useful to express the variant antibodies.
- the variants are described to sequester soluble A-beta peptide from human biological fluids and specifically bind an epitope contained within position 13-28 of the amyloid beta peptide.
- Yu et al. describes a hexavalent foldable ⁇ 1-15 (6 ⁇ 15) fused to PADRE or toxin-derived carrier proteins.
- Wang et al 2016 report that peripheral administration of this antibody mitigates Alzheimer's disease like pathology and cognitive decline in a transgenic animal of aged Alzheimer Disease [14], [15].
- Antibodies that preferentially or selectively bind A-beta oligomers over monomers or over fibrils or over both monomers and fibrils are desirable.
- An aspect includes an isolated humanized antibody having CDRs comprising or consisting of SEQ ID NOs: 74-79 or SEQ ID Nos:1-6 or SEQ ID Nos: 1 , 2, 80 and 4-6 or SEQ ID Nos: 1 , 2, 80-83 and having a heavy chain variable region having a sequence and/or a light chain variable region having a sequence selected from the sequences in Table 4A or 4B or having at least 50% sequence identity to a sequence selected from the sequences in Table 4A or 4B, wherein the CDR amino acid sequences are as shown therein or selected from SEQ ID NOs: 74-79 or SEQ ID Nos: 1-6 or SEQ ID Nos: 1 , 2, 80 and 4-6 or SEQ ID Nos: 1 , 2, 80-83.
- the humanized antibody selectively or specifically binds a cyclic peptide having sequence of SEQ ID NO: 12, relative to a linear peptide of the same sequence or selectively or specifically binds oligomeric Abeta relative to A-beta monomer and/or A-beta fibril.
- the antibody is an antibody binding fragment of an antibody described herein selected from Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and multimers thereof.
- An aspect includes immunoconjugate comprising the humanized antibody described herein and a detectable label or cytotoxic agent.
- the detectable label comprises a positron emitting radionuclide, optionally for use in subject imaging such as PET imaging.
- An aspect includes a composition comprising the antibody described herein, or the immunoconjugate described herein, optionally with a diluent.
- An aspect includes a nucleic acid molecule encoding a proteinaceous portion of the compound or immunogen described herein, the antibody described herein or proteinaceous immunoconjugates described herein.
- An aspect includes a vector comprising the nucleic acid described herein.
- An aspect includes a cell expressing an antibody described herein, optionally wherein the cell is a hybridoma comprising the vector described herein.
- An aspect includes a kit comprising the antibody described herein, the immunoconjugate described herein, the composition described herein, the nucleic acid molecule described herein, the vector described herein or the cell described herein.
- An aspect includes a method of determining if a biological sample comprises A-beta, the method comprising:
- the biological sample contains A-beta oligomer the method comprising:
- the presence of detectable complex is indicative that the sample may contain A-beta oligomer.
- the amount of complex is measured.
- the sample comprises brain tissue or an extract thereof, whole blood, plasma, serum and/or CSF.
- the sample is a human sample.
- the sample is compared to a control, optionally a previous sample.
- the level of A-beta is detected by an analytical assay including but not limited to SPR, Kinexa, Mesoscale, ELISA, Singulex, Luminex and Simoa.
- An aspect includes a method of measuring a level of A-beta in a subject, the method comprising administering to a subject at risk or suspected of having or having AD, an immunoconjugate comprising a humanized antibody described herein wherein the humanized antibody is conjugated to a detectable label; and detecting the label, optionally quantitatively detecting the label.
- the label is a positron emitting radionuclide.
- An aspect includes a method of inhibiting A-beta oligomer propagation, the method comprising contacting a cell or tissue expressing A-beta with or administering to a subject in need thereof an effective amount of an A-beta oligomer specific or selective antibody or immunoconjugate described herein, to inhibit A-beta aggregation and/or oligomer propagation.
- An aspect includes a method of treating AD and/or other A-beta amyloid related diseases, the method comprising administering to a subject in need thereof 1 ) an effective amount of a chimeric antibody, humanized antibody or immunoconjugate described herein, or a pharmaceutical composition comprising said antibody; 2) a nucleic acid or vector comprising a nucleic acid encoding the antibody of 1 , to a subject in need thereof.
- a biological sample from the subject to be treated is assessed for the presence or levels of A-beta using an antibody described herein.
- the antibody, immunoconjugate, composition or nucleic acid or vector is administered directly to the brain or other portion of the CNS.
- FIG. 1 is a graph reporting effect of antibodies on propagation of A-beta oligomers in vitro.
- FIG. 2 is a graph showing that the humanized antibody shows significantly better binding to the toxic oligomer enriched LMVV fraction of AD extract.
- FIGs. 3A to 3F are a series of brain sections stained with various Abeta and control antibodies.
- FIG 4A is a trace an AD soluble brain extract separated
- FIGs. 4B to 4D are graphs showing the levels of A-beta detected in LMVV and HMVV fractions.
- FIG. 5A is a graph showing levels of human IgG detectable in brain and plasma at
- FIG. 5B is a graph showing levels of anti-Abeta antibody CNS penetrance.
- FIGs. 5C and 5D show levels of IgG detected in brain and plasma or non-transgenic and App/PS1 mice 1-21 days after injection of anti-Abeta antibodies.
- chimeric and humanized antibodies comprising CDRs having sequences as shown in Table 2, and/or having variable region sequences provided in any of Tables 4A and 4B are described, immunotherapeutic compositions thereof and methods of use thereof.
- Said antibodies may target epitopes preferentially accessible in toxic oligomeric species of A-beta, including oligomeric species associated with Alzheimer's disease (AD).
- AD Alzheimer's disease
- antibodies raised using a cyclic peptide comprising HHQK preferentially bound oligomeric Abeta and/or selectively bound the cyclic peptide compared to a linear peptide of the same sequence (e.g. corresponding linear sequence).
- Experimental results are described and identify epitope-specific and conformationally selective antibodies that bind synthetic oligomer selectively compared to synthetic monomers, bind CSF from AD patients preferentially over control CSF and/or bind soluble brain extract from AD patients preferentially over control soluble brain extract. Further staining of AD brain tissue identified antibodies that show no or negligible plaque binding and in vitro studies found that the antibodies inhibited ⁇ oligomer propagation and aggregation.
- humanized antibody 301 -17 showed improved characteristics such as improved binding of oligomeric A-beta compared to the mouse monoclonal antibody.
- the humanized antibodies also had improved specificity compared to the parental monoclonal.
- the humanized antibody has increased binding, such as 50% increased or up to 200% increased (or any number inbetween) compared to mouse monoclonal antibody, to oligomeric A-beta, optionally oligomeric Abeta present in low molecular weight fractions of samples such as brain extracts or other biological samples.
- 'A-beta' may alternately be referred to as 'amyloid beta'
- Amyloid beta is a peptide of 36-43 amino acids and includes all wild- type and mutant forms of all species, particularly human A-beta.
- A-beta40 refers to the 40 amino acid form;
- A-beta42 refers to the 42 amino acid form, etc.
- the amino acid sequence of human wildtype A- beta42 is shown in SEQ ID NO: 73.
- A-beta monomer herein refers to any of the individual subunit forms of the A-beta (e.g. 1-40, 1-42, 1-43) peptide.
- A-beta oligomer herein refers to a plurality of any of the A- beta subunits wherein several (e.g. at least two) A-beta monomers are non-covalently aggregated in a conformationally-flexible, partially-ordered, three-dimensional globule of less than about 100, or more typically less than about 50 monomers.
- an oligomer may contain 3 or 4 or 5 or more monomers.
- A-beta oligomer as used herein includes both synthetic A-beta oligomer and/or native A-beta oligomer.
- “Native A-beta oligomer” refers to A-beta oligomer formed in vivo, for example in the brain and CSF of a subject with AD.
- A-beta fibril refers to a molecular structure that comprises assemblies of non-covalently associated, individual A-beta peptides which show fibrillary structure under an electron microscope.
- the fibrillary structure is typically a "cross beta" structure; there is no theoretical upper limit on the size of multimers, and fibrils may comprise thousands or many thousands of monomers. Fibrils can aggregate by the thousands to form senile plaques, one of the primary pathological morphologies diagnostic of AD.
- HHQK means the amino acid sequence histidine, histidine, glutamine, lysine, as shown in SEQ ID NO: 7.
- the reference of the amino acid sequence can refer to a sequence in A-beta or an isolated peptide, such as the amino acid sequence of a cyclic compound.
- amino acid includes all of the naturally occurring amino acids as well as modified L-amino acids.
- the atoms of the amino acid can include different isotopes.
- the amino acids can comprise deuterium substituted for hydrogen nitrogen-15 substituted for nitrogen-14, and carbon-13 substituted for carbon-12 and other similar changes.
- antibody as used herein is intended to include, monoclonal antibodies, polyclonal antibodies, single chain, veneered, humanized and other chimeric antibodies and binding fragments thereof, including for example a single chain Fab fragment, Fab'2 fragment or single chain Fv fragment.
- the antibody may be from recombinant sources and/or produced in animals such as rabbits, llamas, sharks etc.
- human antibodies that can be produced in transgenic animals or using biochemical techniques or can be isolated from a library such as a phage library.
- Humanized or other chimeric antibodies may include sequences from one or more than one isotype or class or species.
- isolated antibody refers to antibody produced in vivo or in vitro that has been removed from the source that produced the antibody, for example, an animal, hybridoma or other cell line (such as recombinant insect, yeast or bacteria cells that produce antibody).
- the isolated antibody is optionally “purified”, which means at least: 80%, 85%, 90%, 95%, 98% or 99% purity.
- binding fragment as used herein to a part or portion of an antibody or antibody chain comprising fewer amino acid residues than an intact or complete antibody or antibody chain and which binds the antigen or competes with intact antibody.
- Exemplary binding fragments include without limitations Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and multimers thereof. Fragments can be obtained via chemical or enzymatic treatment of an intact or complete antibody or antibody chain. Fragments can also be obtained by recombinant means. For example, F(ab')2 fragments can be generated by treating the antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. Papain digestion can lead to the formation of Fab fragments.
- Fab, Fab' and F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be constructed by recombinant expression techniques.
- IMGT numbering or “ImMunoGeneTics database numbering”, which are recognized in the art, refer to a system of numbering amino acid residues which are more variable (i.e. hypervariable) than other amino acid residues in the heavy and light chain variable regions of an antibody, or antigen binding portion thereof.
- the term "conformational epitope” refers to an epitope where the epitope amino acid sequence has a particular three-dimensional structure wherein at least an aspect of the three-dimensional structure not present or less likely to be present in another form for example a corresponding linear peptide or Abeta monomer and is specifically and/or selectively recognized by the cognate antibody.
- Antibodies which specifically bind a conformation-specific epitope recognize the spatial arrangement of one or more of the amino acids of that conformation-specific epitope.
- an HHQK (SEQ ID NO: 7) conformational epitope refers to an epitope of HHQK (SEQ ID NO:7) that is recognized by antibodies selectively, for example at least 2 fold, 3 fold, 5 fold, 10 fold, 50 fold, 100 fold, 250 fold, 500 fold or 1000 fold or greater more selectivity as compared to antibodies raised using linear HHQK (SEQ ID NO: 7).
- an antibody is said to selectively bind an epitope such as a conformational epitope, such as HHQK (SEQ ID NO: 7), what is meant is that the antibody preferentially binds one or more particular conformations containing the specified residues or a part thereof with greater affinity than it binds said residues in another conformation.
- an antibody when an antibody is said to selectively bind a cyclopeptide comprising HHQK or related epitope relative to a corresponding linear peptide, the antibody binds the cyclopeptide with at least a 2 fold greater affinity than it binds the linear peptide.
- the antibody when an antibody is said to selectively bind oligomeric Abeta, the antibody binds the oligomeric species with at least a 2 fold greater affinity than it binds Abeta monomer and/or plaque fibrils.
- the term "no or negligible plaque binding” or “lacks or has negligible plaque binding” as used herein with respect to an antibody means that the antibody does not show typical plaque morphology staining on immunohistochemistry (e.g. in situ, optionally as compared to plaque staining seen with Abeta antibody 6E10) and the level of staining is comparable to or no more than 2 fold the level seen with an IgG negative (e.g. irrelevant) isotype control.
- the term "Isolated peptide” refers to peptide that has been produced, for example, by recombinant or synthetic techniques, and removed from the source that produced the peptide, such as recombinant cells or residual peptide synthesis reactants. The isolated peptide is optionally “purified”, which means at least: 80%, 85%, 90%, 95%, 98% or 99% purity and optionally pharmaceutical grade purity.
- detectable label refers to moieties such as peptide sequences
- the label may be radio-opaque, positron-emitting radionuclide (for example for use in PET imaging), or a radioisotope, such as 3 H, 3 N, 4 C, 8 F, 32 P, 35 S, 123
- the detectable label may be also detectable indirectly for example using secondary antibody.
- epitope as commonly used means an antibody binding site, typically a polypeptide segment, in an antigen that is specifically recognized by the antibody.
- epitope can also refer to the amino acid sequences or part thereof identified on A-beta using the collective coordinates method described. For example an antibody generated against an isolated peptide corresponding to a cyclic compound comprising the identified target region HHQK SEQ ID NO:7), recognizes part or all of said epitope sequence.
- An epitope is "accessible” in the context of the present specification when it is accessible to binding by an antibody.
- greater affinity refers to a relative degree of antibody binding where an antibody X binds to target Y more strongly (K on ) and/or with a smaller dissociation constant (Koff) than to target Z, and in this context antibody X has a greater affinity for target Y than for Z.
- lesser affinity refers to a degree of antibody binding where an antibody X binds to target Y less strongly and/or with a larger dissociation constant than to target Z, and in this context antibody X has a lesser affinity for target Y than for Z.
- the affinity of binding between an antibody and its target antigen can be expressed as KA equal to 1/KD where KD is equal to k 0 n/k 0 ff.
- the k on and k 0 ft values can be measured using surface plasmon resonance technology, for example using a Molecular Affinity Screening System (MASS-1 ) (Sierra Sensors GmbH, Hamburg, Germany).
- MASS-1 Molecular Affinity Screening System
- An antibody that is selective for a conformation presented in a cyclic compound optional a cyclic peptide for example has a greater affinity for the cyclic compound (e.g. cyclic peptide) compared to a corresponding sequence in linear form (e.g. the sequence non-cyclized).
- corresponding linear compound refers to a compound, optionally a peptide, comprising or consisting of the same sequence or chemical moieties as the cyclic compound but in linear (i.e. non-cyclized) form, for example having properties as would be present in solution of a linear peptide.
- the corresponding linear compound can be the synthesized peptide that is not cyclized.
- specifically binds in reference to an antibody means that the antibody recognizes an epitope sequence and binds to its target antigen with a minimum affinity.
- a multivalent antibody binds its target with a KD of at least 1 e-6, at least 1 e-7, at least 1 e-8, at least 1 e-9, or at least 1 e-10. Affinities greater than at least 1 e-8 may be preferred.
- the KD may be in the nanomolar range or the picomolar range.
- An antigen binding fragment such as Fab fragment comprising one variable domain, may bind its target with a 10 fold or 100 fold less affinity than a multivalent interaction with a non-fragmented antibody.
- the term "selectively binds" as used herein with respect to an antibody that selectively binds a form of A-beta (e.g. fibril, monomer or oligomer) or a cyclic compound means that the antibody binds the form with at least 2 fold, at least 3 fold, or at least 5 fold, at least 10 fold, at least 100 fold, at least 250 fold, at least 500 fold or at least 1000 fold or more greater affinity. Accordingly an antibody that is more selective for a particular conformation (e.g. oligomer) preferentially binds the particular form of A-beta with at least 2 fold etc. greater affinity compared to another form and/or a linear peptide.
- A-beta e.g. fibril, monomer or oligomer
- a cyclic compound means that the antibody binds the form with at least 2 fold, at least 3 fold, or at least 5 fold, at least 10 fold, at least 100 fold, at least 250 fold, at least 500 fold or at least
- animal or "subject” as used herein includes all members of the animal kingdom including mammals, optionally including or excluding humans.
- a "conservative amino acid substitution” as used herein, is one in which one amino acid residue is replaced with another amino acid residue without abolishing the protein's desired properties. Suitable conservative amino acid substitutions can be made by substituting amino acids with similar hydrophobicity, polarity, and R-chain length for one another. Examples of conservative amino acid substitution include:
- sequence identity refers to the percentage of sequence identity between two polypeptide sequences or two nucleic acid sequences. To determine the percent identity of two amino acid sequences or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g. , gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino acid or nucleic acid sequence). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
- the determination of percent identity between two sequences can also be accomplished using a mathematical algorithm.
- a preferred, non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. U.S.A. 87:2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. U.S.A. 90:5873-5877.
- Gapped BLAST can be utilized as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402.
- PSI-BLAST can be used to perform an iterated search which detects distant relationships between molecules (Id.).
- the default parameters of the respective programs e.g., of XBLAST and NBLAST
- Another preferred non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, 1988, CABIOS 4:11 -17.
- ALIGN program version 2.0 which is part of the GCG sequence alignment software package.
- a PAM120 weight residue table a gap length penalty of 12
- a gap penalty of 4 a gap penalty of 4.
- the percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.
- percentage sequence identities can be determined when antibody sequences maximally aligned by IMGT or other (e.g. Kabat numbering convention). After alignment, if a subject antibody region (e.g., the entire mature variable region of a heavy or light chain) is being compared with the same region of a reference antibody, the percentage sequence identity between the subject and reference antibody regions is the number of positions occupied by the same amino acid in both the subject and reference antibody region divided by the total number of aligned positions of the two regions, with gaps not counted, multiplied by 100 to convert to percentage.
- IMGT e.g. Kabat numbering convention
- nucleic acid sequence refers to a sequence of nucleoside or nucleotide monomers consisting of naturally occurring bases, sugars and intersugar (backbone) linkages. The term also includes modified or substituted sequences comprising non-naturally occurring monomers or portions thereof.
- the nucleic acid sequences of the present application may be deoxyribonucleic acid sequences (DNA) or ribonucleic acid sequences (RNA) and may include naturally occurring bases including adenine, guanine, cytosine, thymidine and uracil. The sequences may also contain modified bases.
- nucleic acid can be either double stranded or single stranded, and represents the sense or antisense strand.
- nucleic acid includes the complementary nucleic acid sequences as well as codon optimized or synonymous codon equivalents.
- isolated nucleic acid sequences refers to a nucleic acid substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors, or other chemicals when chemically synthesized. An isolated nucleic acid is also substantially free of sequences which naturally flank the nucleic acid (i.e. sequences located at the 5' and 3' ends of the nucleic acid) from which the nucleic acid is derived.
- “Operatively linked” is intended to mean that the nucleic acid is linked to regulatory sequences in a manner which allows expression of the nucleic acid.
- Suitable regulatory sequences may be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes. Selection of appropriate regulatory sequences is dependent on the host cell chosen and may be readily accomplished by one of ordinary skill in the art. Examples of such regulatory sequences include: a transcriptional promoter and enhancer or RNA polymerase binding sequence, a ribosomal binding sequence, including a translation initiation signal. Additionally, depending on the host cell chosen and the vector employed, other sequences, such as an origin of replication, additional DNA restriction sites, enhancers, and sequences conferring inducibility of transcription may be incorporated into the expression vector.
- vector comprises any intermediary vehicle for a nucleic acid molecule which enables said nucleic acid molecule, for example, to be introduced into prokaryotic and/or eukaryotic cells and/or integrated into a genome, and include plasmids, phagemids, bacteriophages or viral vectors such as retroviral based vectors, Adeno Associated viral vectors and the like.
- plasmid as used herein generally refers to a construct of extrachromosomal genetic material, usually a circular DNA duplex, which can replicate independently of chromosomal DNA.
- At least moderately stringent hybridization conditions it is meant that conditions are selected which promote selective hybridization between two complementary nucleic acid molecules in solution. Hybridization may occur to all or a portion of a nucleic acid sequence molecule. The hybridizing portion is typically at least 15 (e.g. 20, 25, 30, 40 or 50) nucleotides in length.
- the parameters in the wash conditions that determine hybrid stability are sodium ion concentration and temperature.
- a 1% mismatch may be assumed to result in about a 1 °C decrease in Tm, for example if nucleic acid molecules are sought that have a >95% identity, the final wash temperature will be reduced by about 5°C.
- stringent hybridization conditions are selected.
- Moderately stringent hybridization conditions include a washing step in 3x SSC at 42°C. It is understood, however, that equivalent stringencies may be achieved using alternative buffers, salts and temperatures.
- treating means an approach for obtaining beneficial or desired results, including clinical results.
- beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of disease, stabilized (i.e. not worsening) state of disease, preventing spread of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission (whether partial or total), whether detectable or undetectable.
- Treating and “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment.
- Treatment as used herein also include prophylactic treatment.
- a subject with early stage AD can be treated to prevent progression can be treated with a compound, antibody, immunogen, nucleic acid or composition described herein to prevent progression.
- administered means administration of a therapeutically effective dose of a compound or composition of the disclosure to a cell or subject.
- the phrase "effective amount” means an amount effective, at dosages and for periods of time necessary to achieve a desired result. Effective amounts when administered to a subject may vary according to factors such as the disease state, age, sex, weight of the subject. Dosage regime may be adjusted to provide the optimum therapeutic response.
- pharmaceutically acceptable means that the carrier, diluent, or excipient is compatible with the other components of the formulation and not substantially deleterious to the recipient thereof.
- compositions or methods "comprising” or “including” one or more recited elements may include other elements not specifically recited.
- a composition that "comprises” or “includes” an antibody may contain the antibody alone or in combination with other ingredients.
- an aspect includes an antibody comprising a light chain variable region and a heavy chain variable region, optionally fused, the heavy chain variable region comprising complementarity determining regions CDR-H1 , CDR-H2 and CDR-H3, the light chain variable region comprising complementarity determining region CDR-L1 , CDR-L2 and CDR-L3 and with the amino acid sequences of said CDRs comprising the sequences of SEQ ID NOs: 1 -3 and 4-6.
- the antibody comprises a heavy chain variable region comprising: i) an amino acid sequence as set forth in SEQ ID NO: 9; ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to SEQ ID NO: 9, wherein the CDR sequences are as set forth in SEQ ID NO: 1 , 2 and 3, or iii) a conservatively substituted amino acid sequence i) wherein the CDR sequences are as set forth in SEQ ID NO: 1 , 2 and 3.
- the antibody comprises a light chain variable region comprising i) an amino acid sequence as set forth in SEQ ID NO: 1 1 , ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to SEQ ID NO: 1 1 , wherein the CDR sequences are as set forth in SEQ ID NO: 4, 5 and 6, or iii) a conservatively substituted amino acid sequence of i) wherein the CDR sequences are as set forth in SEQ I D NO: 4, 5 and 6.
- the heavy chain variable region amino acid sequence is encoded by a nucleotide sequence as set forth in SEQ ID NO: 8 or a codon degenerate or optimized version thereof; and/or the antibody comprises a light chain variable region amino acid sequence encoded by a nucleotide sequence as set out in SEQ ID NO: 10 or a codon degenerate or optimized version thereof.
- the heavy chain variable region comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 9 and/or the light chain variable region comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 1 1.
- the antibody is an antibody that competes for binding to a cyclic peptide having sequence of SEQ ID NO: 12, and/or to human A-beta oligomers with an antibody comprising the CDR sequences as recited herein in SEQ ID Nos: 1-6.
- the antibody a cyclic peptide having sequence of SEQ ID NO:
- Another aspect includes an isolated conformation specific and/or selective antibody comprising a light chain variable region and a heavy chain variable region, optionally fused, the heavy chain variable region comprising complementarity determining regions CDR-H1 , CDR-H2 and CDR- H3, the light chain variable region comprising complementarity determining region CDR-L1 , CDR-L2 and CDR-L3 and with the amino acid sequences of said CDRs comprising the sequences SEQ ID NOs 1 , 2, 80 and 4-6.
- the antibody comprises a heavy chain variable region comprising: i) an amino acid sequence as set forth in SEQ ID NO: 85; ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to SEQ ID NO: 85, wherein the CDR sequences are as set forth in SEQ ID NO: 1 , 2 and 80, or iii) a conservatively substituted amino acid sequence i) wherein the CDR sequences are as set forth in SEQ ID NO: 1 , 2 and 80.
- the antibody comprises a light chain variable region comprising i) an amino acid sequence as set forth in SEQ ID NO: 87, ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to SEQ ID NO: 89, wherein the CDR sequences are as set forth in SEQ ID NO: 4, 5 and 6, or iii) a conservatively substituted amino acid sequence of i) wherein the CDR sequences are as set forth in SEQ ID NO: 4, 5 and 6.
- the heavy chain variable region amino acid sequence is encoded by a nucleotide sequence as set forth in SEQ ID NO: 84 or a codon degenerate or optimized version thereof; and/or the antibody comprises a light chain variable region amino acid sequence encoded by a nucleotide sequence as set out in SEQ ID NO: 86 or a codon degenerate or optimized version thereof.
- the heavy chain variable region comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 85 and/or the light chain variable region comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 87.
- the antibody is an antibody that competes for binding to a cyclic peptide having sequence of SEQ ID NO: 12, and/or human A-beta oligomers with an antibody comprising the CDR sequences as recited herein in SEQ ID Nos: 1 , 2, 80, 4-6.
- the antibody is an antibody that binds a cyclic peptide having sequence of SEQ ID NO: 12, and/or human A-beta oligomers with an antibody comprising the heavy chain variable chain sequence of SEQ ID NO: 85 and/or the light chain variable region sequence of SEQ ID NO: 87.
- Another aspect includes an isolated conformation specific and/or selective antibody comprising a light chain variable region and a heavy chain variable region, optionally fused, the heavy chain variable region comprising complementarity determining regions CDR-H1 , CDR-H2 and CDR- H3, the light chain variable region comprising complementarity determining region CDR-L1 , CDR-L2 and CDR-L3 and with the amino acid sequences of said CDRs comprising the sequences SEQ ID NOs: 1 , 2, 80 and 81-83.
- the antibody comprises a heavy chain variable region comprising: i) an amino acid sequence as set forth in SEQ ID NO: 85; ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to SEQ ID NO: 85, wherein the CDR sequences are as set forth in SEQ ID NO: 1 , 2 and 80, or iii) a conservatively substituted amino acid sequence i) wherein the CDR sequences are as set forth in SEQ ID NO: 1 , 2 and 80.
- the antibody comprises a light chain variable region comprising i) an amino acid sequence as set forth in SEQ ID NO: 89, ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to SEQ ID NO: 89, wherein the CDR sequences are as set forth in SEQ ID NO: 81 , 82 and 83, or iii) a conservatively substituted amino acid sequence of i) wherein the CDR sequences are as set forth in SEQ ID NO: 81 , 82 and 83.
- the heavy chain variable region amino acid sequence is encoded by a nucleotide sequence as set forth in SEQ ID NO: 84 or a codon degenerate or optimized version thereof; and/or the antibody comprises a light chain variable region amino acid sequence encoded by a nucleotide sequence as set out in SEQ ID NO: 88 or a codon degenerate or optimized version thereof.
- the heavy chain variable region comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 85 and/or the light chain variable region comprises or consists of an amino acid sequence as set forth in SEQ ID NO: 89.
- the antibody is an antibody that competes for binding to a cyclic peptide having sequence of SEQ ID NO: 12, and/or human A-beta oligomers with an antibody comprising the CDR sequences as recited herein in SEQ ID Nos: 1 , 2, 80-3.
- the antibody is an antibody that binds a cyclic peptide having sequence of SEQ ID NO: 12, and/or human A-beta oligomers with an antibody comprising the heavy chain variable chain sequence of SEQ ID NO: 85 and/or the light chain variable region sequence of SEQ ID NO: 89.
- the antibody lacks binding a linear peptide comprising the sequence
- HHQK (SEQ ID NO: 7), optionally wherein the sequence of the linear peptide is a linear version of a cyclic sequence used to raise the antibody, optionally under conditions described in the Examples.
- the antibody specifically binds an epitope on A-beta as present in vivo, the epitope comprising or consisting HHQK (SEQ ID NO: 7), or a part thereof.
- the antibody does not specifically bind and/or is not selective for linear peptides consisting of HHQK (SEQ ID NO: 7). Selective binding can be measured using an ELISA or surface plasmon resonance measurement, as described herein.
- the antibody selectively binds a cyclic compound comprising HHQK
- SEQ ID NO: 7 or a part thereof, optionally in the context of cyclo(CGHHQKG) (SEQ ID NO: 12) relative to a linear peptide comprising HHQK (SEQ ID NO: 7), optionally in the context of linear CGHHQKG (SEQ ID NO: 12).
- the antibody selectively binds HHQK (SEQ ID NO: 7) in a cyclic conformation and has at least 2 fold, at least 5 fold, at least 10 fold at least 20 fold, at least 30 fold, at least 40 fold, at least 50 fold, at least 100 fold, at least 500 fold, at least 1000 fold more selective for HHQK (SEQ ID NO: 7) in the cyclic conformation compared to HHQK (SEQ ID NO: 7) in a linear compound such as a corresponding linear compound, for example as measured by ELISA or surface plasmon resonance, optionally using a method described herein.
- the antibody selectively binds a cyclic compound comprising the epitope sequence relative to linear peptide or a species of A-beta such as A-beta oligomer relative to monomer.
- the selectivity is at least 2 fold, at least 3 fold, at least 5 fold, at least 10 fold, at least 20 fold, at least 30 fold, at least 40 fold, at least 50 fold, at least 100 fold, at least 500 fold, at least 1000 fold more selective for the cyclic compound and/or A-beta oligomer over a species of A- beta selected from A-beta monomer and/or A-beta fibril and/or linear HHQK (SEQ ID NO: 7), optionally linear CGHHQKG (SEQ ID NO: 12).
- the antibody is a monoclonal antibody.
- the production of monoclonals is described in the Examples.
- antibody producing cells can be harvested from a subject immunized with an immunogen described herein, and fused with myeloma cells by standard somatic cell fusion procedures thus immortalizing these cells and yielding hybridoma cells.
- Such techniques are well known in the art, (e.g. the hybridoma technique originally developed by Kohler and Milstein (Nature 256:495-497 (1975)) as well as other techniques such as the human B-cell hybridoma technique (Kozbor et al., Immunol. Today 4:72 ( 1983)), the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al.
- Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with the desired epitopes and the monoclonal antibodies can be isolated.
- Specific antibodies, or antibody fragments, reactive against particular antigens or molecules may also be generated by screening expression libraries encoding immunoglobulin genes, or portions thereof, expressed in bacteria with cell surface components.
- Fab fragments, VH regions and FV regions can be expressed in bacteria using phage expression libraries (see for example Ward et al., Nature 41 :544-546 (1989); Huse et al., Science 246:1275-1281 (1989); and McCafferty et al., Nature 348:552-554 (1990).
- the antibody is a chimeric antibody, optionally comprising CDRS in
- an lgG4 framework optionally comprising the heavy chain variable region of SEQ ID NO 42, an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to SEQ ID NO: 42, wherein the CDR sequences are SEQ ID NO: 74-76, or a conservatively substituted amino acid sequence of SEQ ID NO: 42, wherein the CDR sequences are the sequences SEQ ID NO: 74-76.
- the antibody is a chimeric antibody, optionally comprising CDRS in
- an lgG4 framework optionally comprising the light chain variable region of SEQ ID NO 56, an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to SEQ ID NO: 56, wherein the CDR sequences are SEQ ID NO: 77-79, or a conservatively substituted amino acid sequence of SEQ ID NO: 56, wherein the CDR sequences are the sequences SEQ ID NO: 77-79.
- the antibody is a humanized antibody. As demonstrated in the
- Humanized forms of rodent antibodies can be generated by CDR grafting (Riechmann et al. Nature, 332:323-327, 1988). In this approach the six CDR loops comprising the antigen binding site of the rodent monoclonal antibody are linked to corresponding human framework regions. CDR grafting often yields antibodies with reduced affinity as the amino acids of the framework regions may influence antigen recognition (Foote & Winter. J Mol Biol, 224: 487-499, 1992). To maintain the affinity of the antibody, it is often necessary to replace certain framework residues by site directed mutagenesis or other recombinant techniques and may be aided by computer modeling of the antigen binding site (Co et al. J Immunol, 152: 2968-2976, 1994).
- variable region can be grafted into a human framework and for example the introduction of specific mutations can be introduced into the variable region outside of the CDRs.
- Humanized forms of antibodies are optionally obtained by resurfacing (Pedersen et al.
- the humanized antibody comprises CDRS as shown in Table 2.
- An aspect includes a humanized antibody comprising a sequence as set forth in Table
- the humanized antibody comprises a heavy chain variable region comprising: i) an amino acid sequence as set forth in any one of SEQ ID NO: 16, 18, 20, 22, 24 and 26; ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to any one of SEQ ID NO: 16, 18, 20, 22, 24 and 26, wherein the CDR sequences are as set forth in SEQ ID NO: 1 , 2 and 3, or iii) a conservatively substituted amino acid sequence i) wherein the CDR sequences are as set forth in SEQ ID NO: 1 , 2 and 3.
- the antibody comprises a light chain variable region comprising i) an amino acid sequence as set forth any one of SEQ ID NO: 30, 32, 34, 36, 38 and 40, ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to any one of SEQ ID NO: 30, 32, 34, 36, 38 and 40, wherein the CDR sequences are as set forth in SEQ ID NO: 4, 5 and 6, or iii) a conservatively substituted amino acid sequence of i) wherein the CDR sequences are as set forth in SEQ ID NO: 4, 5 and 6.
- the heavy chain variable region amino acid sequence is encoded by a nucleotide sequence as set forth in any one of SEQ ID NO: 15, 17, 19, 21 , 23 and 25 or a codon degenerate or optimized version thereof; and/or the antibody comprises a light chain variable region amino acid sequence encoded by a nucleotide sequence as set out in any one of SEQ ID NO: 29, 31 , 33, 35, 37 and 39 or a codon degenerate or optimized version thereof.
- the heavy chain variable region comprises or consists of an amino acid sequence as set forth in any one of SEQ ID NO: 16, 18, 20, 22, 24 and 26 and/or the light chain variable region comprises or consists of an amino acid sequence as set forth in SEQ ID any one of SEQ ID NO: 30, 32, 34, 36, 38 and 40.
- the antibody is an antibody that competes for binding to a cyclic peptide having sequence of SEQ ID NO: 12, and/or human A-beta optionally human A-beta oligomers with an antibody comprising the heavy chain sequence as shown in Table 4A, optionally comprising a light chain sequence shown in Table 4A.
- the antibody is an antibody that competes for binding to a cyclic peptide having sequence of SEQ ID NO: 12, and/or human A-beta, optionally human A-beta oligomers with an antibody comprising the heavy chain variable chain sequence in any one of SEQ ID NO: 16, 18, 20, 22, 24 and 26 and/or the light chain variable region sequence as set forth in SEQ ID any one of SEQ ID NO: 30, 32, 34, 36, 38 and 40.
- the antibody comprises SEQ ID NO: 16 and 30; SEQ ID NO: 18 and 32; SEQ ID NO: 20 and 34; SEQ ID NO: 22 and 36; SEQ ID NO: 24 and 38; or SEQ ID NO: 36 and 40, or sequences with sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity thereto wherein the CDRs are maintained as shown in Table 2.
- the humanized antibody comprises a sequence as shown in
- the humanized antibody comprises a heavy chain variable region comprising: i) an amino acid sequence as set forth in any one of SEQ ID NO: 44, 46, 48, 50, 52 and 54; ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to any one of SEQ ID NO: 44, 46, 48, 50, 52 and 54, wherein the CDR sequences are the sequences shown underlined therein (also in SEQ ID NO: 74-76), or iii) a conservatively substituted amino acid sequence of i) wherein the CDR sequences are the sequences shown underlined therein (e.g. SEQ ID NO: 74-76).
- the antibody comprises a light chain variable region comprising i) an amino acid sequence as set forth any one of SEQ ID NO: 58, 60, 62, 64, 66 and 68, ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to any one of SEQ ID NO: 58, 60, 62, 64, 66 and 68, wherein the CDR sequences are the sequences shown underlined therein (also in SEQ ID NOs:77-79), or iii) a conservatively substituted amino acid sequence of i) wherein the CDR sequences are the sequences shown underlined therein (also in SEQ ID NOs:77-79).
- the heavy chain variable region amino acid sequence is encoded by a nucleotide sequence as set forth in any one of SEQ ID NO: 43, 45, 47, 49, 51 and 53; or a codon degenerate or optimized version thereof; and/or the antibody comprises a light chain variable region amino acid sequence encoded by a nucleotide sequence as set out in any one of SEQ ID NO: 57, 59, 61 , 63, 65 and 67 or a codon degenerate or optimized version thereof.
- the heavy chain variable region comprises or consists of an amino acid sequence as set forth in any one of SEQ ID NO: 44, 46, 48, 50, 52 and 54 and/or the light chain variable region comprises or consists of an amino acid sequence as set forth in SEQ ID any one of SEQ ID NO: 58, 60, 62, 64, 66 and 68.
- the antibody is an antibody that competes for binding to a cyclic peptide having sequence of SEQ ID NO: 12, and/or human A-beta oligomers with an antibody comprising the heavy chain sequence as shown in Table 4B, optionally wherein the antibody further comprises a light chain sequence shown in Table 4B.
- the antibody is an antibody that competes for binding to a cyclic peptide having sequence to SEQ ID NO: 12, and/or human A-beta oligomers with an antibody comprising the heavy chain variable chain sequence of any one of SEQ ID NO: 44, 46, 48, 50, 52 and 54 and/or the light chain variable region sequence of any one of SEQ ID NO: 58, 60, 62, 64, 66 and 68.
- the antibody comprises SEQ ID NO: 44 and 58; SEQ ID NO: 46 and 60; SEQ ID NO: 48 and 62; SEQ ID NO: 50 and 64; SEQ ID NO: 52 and 66; or SEQ ID NO: 54 and 68, or sequences with sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity thereto wherein the CDRs are maintained as shown underlined therein (also in in SEQ ID Nos:74-79).
- an antibody described herein comprises a constant region having i) an amino acid sequence as set forth in SEQ ID NO:70 and/or 72; ii) an amino acid sequence with at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity to any one of SEQ ID NO:70 and/or 72; or iii) a conservatively substituted amino acid sequence i).
- the heavy chain constant region amino acid sequence is encoded by a nucleotide sequence as set forth in SEQ ID NO: 69; or a codon degenerate or optimized version thereof; and/or the antibody comprises a light chain constant region amino acid sequence encoded by a nucleotide sequence as set out in SEQ ID NO:71 , or a codon degenerate or optimized version thereof.
- the humanized antibody comprises the sequences of VH2 Vk5.
- the humanized antibody is a Fab fragment.
- the Fab fragment comprises any of the variable regions in Table 4A and 4B. in an embodiment the Fab fragment comprises VH2 Vk5.
- the antibody comprises the CH1 and/or CL portion of lgG4 in
- the antibody comprises sequences in Table 5 or a conservative variant thereof or a sequence with at least 50%, 60%, 70%, 89%, 90% or 95% sequence identity thereto.
- the antibody comprises a KD of at least or about 1x 10- 10 , at least or about 8 x10 " , at least or about 6x 10 "11 , at least or about 4 x 10 "11 or at least or about 2 x 10 "11 for the cyclic peptide with sequence of SEQ ID NO: 12.
- Human antibodies specific to a particular antigen may be identified by a phage display strategy (Jespers et al. Bio/Technology, 12: 899-903, 1994).
- the heavy chain of a rodent antibody directed against a specific antigen is cloned and paired with a repertoire of human light chains for display as Fab fragments on filamentous phage.
- the phage is selected by binding to antigen.
- the selected human light chain is subsequently paired with a repertoire of human heavy chains for display on phage, and the phage is again selected by binding to antigen.
- the result is a human antibody Fab fragment specific to a particular antigen.
- libraries of phage are produced where members display different human antibody fragments (Fab or Fv) on their outer surfaces (Dower et al., WO 91/17271 and McCafferty et al., WO 92/01047). Phage displaying antibodies with a desired specificity are selected by affinity enrichment to a specific antigen.
- the human Fab or Fv fragment identified from either approach may be recloned for expression as a human antibody in mammalian cells.
- JH heavy chain joining region
- Humanized antibodies are typically produced as antigen binding fragments such as Fab,
- human or humanized antibodies may exist in monomeric or polymeric form.
- the humanized antibody optionally comprises one non-human chain and one humanized chain (i.e. one humanized heavy or light chain).
- Antibodies including humanized or human antibodies are selected from any class of immunoglobulins including: IgM, IgG, IgD, IgA or lgE; and any isotype, including: lgG1 , lgG2, lgG3 and lgG4.
- the humanized or human antibody may include sequences from one or more than one isotype or class.
- Antibodies having the CDRs shown in SEQ ID Nos: 74-79 were codon optimized and made to lgG1 or lgG2a isotype. Sequences are shown in Table 8.
- the antibody has a sequence or a part thereof as provided in Table 8, the part comprising at least the CDRs, optionally the heavy chain CDRs and/or the light chain CDRs.
- the part is the variable chain portion of a sequence selected from the sequences in Table 8.
- the constant region shown in Table 8 (for example determinable by comparing to other sequences provided herein such as SEQ ID NOs: 42 and 56 can also be combined with the variable sequences of antibodies with CDRS having SEQ ID NOs: 1-6, or 1 , 2, 80, 4-6 or 1 , 2, 80-83.
- antibodies specific for the epitopes described herein are readily isolated by screening antibody phage display libraries.
- an antibody phage library is optionally screened by using a disease specific epitope of the current invention to identify antibody fragments specific for the disease specific epitope.
- Antibody fragments identified are optionally used to produce a variety of recombinant antibodies that are useful with different embodiments of the present invention.
- Antibody phage display libraries are commercially available, for example, through Xoma (Berkeley, California) Methods for screening antibody phage libraries are well known in the art.
- the antibody is a monoclonal antibody.
- the antibody is a chimeric antibody such as a humanized antibody comprising the CDR sequences as recited in Table 2.
- an antibody comprising CDRs as listed in Table
- the antibodies herein can be single chain antibodies.
- the humanized antibodies described are also in an embodiment, single chain antibodies.
- antibodies that compete for binding to a cyclic peptide having sequence of SEQ ID NO: 12, and/or human A-beta oligomers with an antibody comprising the CDR sequences as recited in Table 2, or comprising a sequence as provided in any one of Tables 3, 4A, 4B and 8.
- Competition between antibodies can be determined for example using an assay in which an antibody under test is assessed for its ability to inhibit specific binding of a reference antibody to the common antigen.
- a test antibody competes with a reference antibody if an excess of a test antibody (e.g., at least a 2 fold, 5, fold, 10 fold or 20 fold) inhibits binding of the reference antibody by at least 50%, at least 75%, at least 80%, at least 90% or at least 95% as measured in a competitive binding assay.
- the antibody is isolated. In an embodiment, the antibody is an exogenous antibody.
- the antibody does not bind monomeric A-beta, for example under conditions described in the Examples. In an embodiment, the antibody does not bind A-beta in senile plaques, for example in situ in AD brain tissue, for example under conditions described in the Examples.
- the antibody does not selectively bind monomeric A-beta compared to native- or synthetic- oligomeric A-beta.
- the A-beta oligomer comprises A-beta 1-42 subunits.
- the antibody lacks A-beta fibril plaque (also referred to as senile plaque) staining, for example as measured by immuohistochemistry. Absence of plaque staining can be assessed by comparing to a positive control such as A-beta-specific antibodies 6E10 and 4G8 (Biolegend, San Diego, CA), or 2C8 (Enzo Life Sciences Inc., Farmingdale, NY) and an isotype control.
- An antibody described herein lacks or has negligible A-beta fibril plaque staining if the antibody does not show typical plaque morphology staining and the level of staining is comparable to or no more than 2 fold the level seen with an IgG negative isotype control.
- the scale can for example set the level of staining with isotype control at 1 and with 6E10 at 10.
- An antibody lacks A-beta fibril plaque staining if the level of staining on such a scale is 2 or less.
- the antibody shows minimal A-beta fibril plaque staining, for example on the foregoing scale, levels scored at less about or less than 3.
- a further aspect is an antibody conjugated to a therapeutic, detectable label or cytotoxic agent.
- the detectable label is a positron-emitting radionuclide.
- a positron-emitting radionuclide can be used for example in PET imaging.
- a further aspect relates to an antibody complex comprising an antibody described herein and/or a binding fragment thereof and oligomeric A-beta.
- a further aspect is an isolated nucleic acid encoding an antibody or part thereof described herein.
- Nucleic acids encoding a heavy chain or a light chain or parts thereof are also provided, for example encoding a heavy chain comprising CDR-H1 , CDR-H2 and/or CDR-H3 regions described herein or encoding a light chain comprising CDR-L1 , CDR-L2 and/or CDR-L3 regions described herein, variable chains described herein and codon optimized and codon degenerate versions thereof.
- the present disclosure also provides variants of the nucleic acid sequences that encode for the antibody and/or binding fragment thereof disclosed herein.
- the variants include nucleotide sequences that hybridize to the nucleic acid sequences encoding the antibody and/or binding fragment thereof disclosed herein under at least moderately stringent hybridization conditions or codon degenerate or optimized sequences
- the variant nucleic acid sequences have at least 50%, at least 60%, at least 70%, most preferably at least 80%, even more preferably at least 90% and even most preferably at least 95% sequence identity to nucleic acid sequences encoding any of the amino acid sequences shown in Tables 2, 3, 4A, 4B and 8.
- a further aspect is an isolated nucleic acid encoding an antibody described herein , for example the nucleic acids shown in any of Tables 2, 3, 4A, 4B and 8.
- Another aspect is an expression cassette or vector comprising the nucleic acid herein disclosed.
- the vector is an isolated vector.
- the vector can be any vector, including vectors suitable for producing an antibody and/or binding fragment thereof or expressing a peptide sequence described herein.
- the nucleic acid molecules may be incorporated in a known manner into an appropriate expression vector which ensures expression of the protein.
- Possible expression vectors include but are not limited to cosmids, plasmids, or modified viruses (e.g. replication defective retroviruses, adenoviruses and adeno-associated viruses).
- the vector should be compatible with the host cell used.
- the expression vectors are "suitable for transformation of a host cell", which means that the expression vectors contain a nucleic acid molecule encoding the peptides corresponding to epitopes or antibodies described herein.
- the vector is suitable for expressing for example single chain antibodies by gene therapy.
- the vector can be adapted for specific expression in neural tissue, for example using neural specific promoters and the like.
- the vector comprises an IRES and allows for expression of a light chain variable region and a heavy chain variable region. Such vectors can be used to deliver antibody in vivo.
- Suitable regulatory sequences may be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes.
- Examples of such regulatory sequences include: a transcriptional promoter and enhancer or RNA polymerase binding sequence, a ribosomal binding sequence, including a translation initiation signal.
- other sequences such as an origin of replication, additional DNA restriction sites, enhancers, and sequences conferring inducibility of transcription may be incorporated into the expression vector.
- the regulatory sequences direct or increase expression in neural tissue and/or cells.
- the vector is a viral vector.
- the recombinant expression vectors may also contain a marker gene which facilitates the selection of host cells transformed, infected or transfected with a vector for expressing an antibody or epitope peptide described herein.
- the recombinant expression vectors may also contain expression cassettes which encode a fusion moiety (i. e. a "fusion protein") which provides increased expression or stability of the recombinant peptide; increased solubility of the recombinant peptide; and aid in the purification of the target recombinant peptide by acting as a ligand in affinity purification, including for example tags and labels described herein.
- a proteolytic cleavage site may be added to the target recombinant protein to allow separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein.
- Typical fusion expression vectors include pGEX (Amrad Corp.
- GST glutathione S-transferase
- Systems for the transfer of genes for example into neurons and neural tissue both in vitro and in vivo include vectors based on viruses, most notably Herpes Simplex Virus, Adenovirus, Adeno-associated virus (AAV) and retroviruses including lentiviruses.
- viruses most notably Herpes Simplex Virus, Adenovirus, Adeno-associated virus (AAV) and retroviruses including lentiviruses.
- Alternative approaches for gene delivery include the use of naked, plasmid DNA as well as liposome-DNA complexes.
- Another approach is the use of AAV plasmids in which the DNA is polycation-condensed and lipid entrapped and introduced into the brain by intracerebral gene delivery (Leone et al. US Application No. 2002076394).
- the compounds, immunogens, nucleic acids, vectors and antibodies described herein may be formulated in vesicles such as liposomes, nanoparticles, and viral protein particles, for example for delivery of antibodies, compounds, immunogens and nucleic acids described herein.
- vesicles such as liposomes, nanoparticles, and viral protein particles, for example for delivery of antibodies, compounds, immunogens and nucleic acids described herein.
- synthetic polymer vesicles, including polymersomes can be used to administer antibodies.
- Also provided in another aspect is a cell, optionally an isolated and/or recombinant cell, expressing an antibody described herein or comprising a vector herein disclosed.
- the recombinant cell can be generated using any cell suitable for producing a polypeptide, for example suitable for producing an antibody and/or binding fragment thereof.
- a nucleic acid e.g. a vector
- the cell may be transfected, transformed or infected, depending upon the vector employed.
- Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells.
- the proteins described herein may be expressed in bacterial cells such as E. coli, insect cells (using baculovirus), yeast cells or mammalian cells.
- the cell is a eukaryotic cell selected from a yeast, plant, worm, insect, avian, fish, reptile and mammalian cell.
- the mammalian cell is a myeloma cell, a spleen cell, or a hybridoma cell.
- the cell is a neural cell.
- Yeast and fungi host cells suitable for expressing an antibody or peptide include, but are not limited to Saccharomyces cerevisiae, Schizosaccharomyces pombe, the genera Pichia or Kluyveromyces and various species of the genus Aspergillus.
- yeast S. cerivisiae examples include pYepSed , pMFa, pJRY88, and pYES2 (Invitrogen Corporation, San Diego, CA). Protocols for the transformation of yeast and fungi are well known to those of ordinary skill in the art.
- Mammalian cells that may be suitable include, among others: COS (e.g., ATCC No. CRL).
- COS e.g., ATCC No. CRL
- Suitable expression vectors for directing expression in mammalian cells generally include a promoter (e.g., derived from viral material such as polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40), as well as other transcriptional and translational control sequences.
- a promoter e.g., derived from viral material such as polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40
- Examples of mammalian expression vectors include pCDM8 and pMT2PC.
- the cell is a fused cell such as a hybridoma cell, the hybridoma cell producing an antibody specific and/or selective for an epitope or epitope sequence described herein, including for example that selectively binds A-beta oligomers over A-beta monomers, selectively binds an epitope sequence presented in a cyclic compound relative to a linear compound or lacks or has negligible plaque binding.
- a further aspect is a hybridoma cell line producing an antibody comprising the a CDR set described herein.
- a further aspect is a composition comprising a nucleic acid, vector or antibody described herein.
- the composition comprises a diluent.
- Suitable diluents for nucleic acids include but are not limited to water, saline solutions and ethanol.
- Suitable diluents for polypeptides, including antibodies or fragments thereof and/or cells include but are not limited to saline solutions, pH buffered solutions and glycerol solutions or other solutions suitable for freezing polypeptides and/or cells.
- the composition is a pharmaceutical composition comprising any of the antibodies, nucleic acids or vectors disclosed herein, and optionally comprising a pharmaceutically acceptable carrier.
- compositions described herein can be prepared by per se known methods for the preparation of pharmaceutically acceptable compositions that can be administered to subjects, optionally as a vaccine, such that an effective quantity of the active substance is combined in a mixture with a pharmaceutically acceptable vehicle.
- compositions include, without limitation, lyophilized powders or aqueous or non-aqueous sterile injectable solutions or suspensions, which may further contain antioxidants, buffers, bacteriostats and solutes that render the compositions substantially compatible with the tissues or the blood of an intended recipient.
- Other components that may be present in such compositions include water, surfactants (such as Tween), alcohols, polyols, glycerin and vegetable oils, for example.
- Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, tablets, or concentrated solutions or suspensions.
- the composition may be supplied, for example but not by way of limitation, as a lyophilized powder which is reconstituted with sterile water or saline prior to administration to the patient.
- compositions may comprise a pharmaceutically acceptable carrier.
- suitable pharmaceutically acceptable carriers include essentially chemically inert and nontoxic compositions that do not interfere with the effectiveness of the biological activity of the pharmaceutical composition.
- suitable pharmaceutical carriers include, but are not limited to, water, saline solutions, glycerol solutions, ethanol, N-(1(2,3-dioleyloxy)propyl)N,N,N-trimethylammonium chloride (DOTMA), diolesylphosphotidyl-ethanolamine (DOPE), and liposomes.
- DOTMA N-(1(2,3-dioleyloxy)propyl)N,N,N-trimethylammonium chloride
- DOPE diolesylphosphotidyl-ethanolamine
- liposomes Such compositions should contain a therapeutically effective amount of the compound, together with a suitable amount of carrier so as to provide the form for direct administration to the patient.
- composition may be in the form of a pharmaceutically acceptable salt which includes, without limitation, those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylarnino ethanol,
- the composition comprises an antibody described herein.
- the composition comprises an antibody described herein and a diluent.
- the composition is a sterile composition.
- a further aspect includes an antibody complex comprising an antibody described herein and A-beta, optionally A-beta oligomer. The complex may be in solution or comprised in a tissue, optionally in vitro.
- a further aspect relates to a kit comprising i) an antibody and/or binding fragment thereof, ii) a nucleic acid of said antibody or a part thereof, iii) composition comprising an antibody, nucleic acid or cell described herein or iv) a recombinant cell described herein, comprised in a vial such as a sterile vial or other housing and optionally a reference agent and/or instructions for use thereof.
- a vial such as a sterile vial or other housing and optionally a reference agent and/or instructions for use thereof.
- the kit further comprises one or more of a collection vial, standard buffer and detection reagent.
- the kit is for diagnosing or monitoring Alzheimer's disease or a condition involving oligomeric Abeta.
- an antibody an antibody described herein selective for a conformational epitope of HHQK (SEQ ID NO: 7) using an antibody described herein, the method comprising administering to a subject, optionally a non-human subject, a cyclic compound comprising an epitope sequence described herein, and isolating antibody producing cells or antibodies that comprise the CDRs described herein.
- the method is for making a monoclonal antibody using for example a method as described herein.
- a method of making a chimeric antibody or binding fragment thereof comprising using recombinant technology to subcloning a nucleic acid encoding the variable region of an antibody (heavy and/or light) described herein into a vector comprising a nucleic acid encoding a human antibody constant domain (e.g. lgG1 , 2, 3, or 4), optionally with or without the Fc portion to produce a chimeric antibody vector; and expressing the chimeric antibody vector in a cell; and isolating the antibody.
- the chimera is a mouse human chimera.
- the method is for making a humanized antibody using for example a method described herein.
- the method comprises making a chimeric intermediate.
- the variable regions of the chimeric intermediate are for example mutagenized to introduce one or more amino acid changes outside the CDR regions.
- one or more CDR coding sequences described herein are inserted into a human antibody scaffold.
- Antibodies produced using a cyclic compound are selected as described herein and in the Examples such.
- the method comprises isolating antibodies that specifically or selectively bind cyclic peptide over linear peptide, are specific for the epitope sequence, specifically bind oligomer and/or lack or negligibly bind plaque in situ and/or corresponding linear peptide, optionally using a method described herein.
- a further aspect provides a method of detecting whether a biological sample comprises
- A-beta the method comprising contacting the biological sample with an antibody described herein and/or detecting the presence of any antibody complex.
- the method is for detecting whether a biological sample comprises oligomeric A-beta.
- the method comprises:
- the presence of detectable complex is indicative that the sample may contain A-beta oligomer.
- the level of complex formed is compared to a test antibody such as a suitable Ig control or irrelevant antibody.
- the detection is quantitated and the amount of complex produced is measured.
- the measurement can for example be relative to a standard.
- the measured amount is compared to a control.
- the method comprises:
- the control can be a sample control (e.g. from a subject without AD, or from a subject with a particular form of AD, mild, moderate or advanced), or be a previous sample from the same subject for monitoring changes in A-beta oligomer levels in the subject.
- the control can be a value derived from a plurality of patients with or without AD.
- the antibody is an antibody having the CDR sequences described herein. In an embodiment, the antibody is a humanized antibody. In an embodiment, the antibody is a chimeric antibody.
- the sample is a biological sample.
- the sample comprises brain tissue or an extract thereof and/or CSF.
- the sample comprises whole blood, plasma or serum.
- the sample is obtained from a human subject.
- the subject is suspected of, at a risk of or has AD.
- a number of methods can be used to detect an A-beta: antibody complex and thereby determine A-beta oligomers is present in a sample using the antibodies described herein, including immunoassays such as flow cytometry, Western blots, ELISA, SPR and immunoprecipitation followed by SDS-PAGE immunocytochemistry.
- surface plasmon resonance technology can be used to assess conformation specific binding. If the antibody is labeled or a detectably labeled secondary antibody specific for the complex antibody is used, the label can be detected. Commonly used reagents include fluorescent emitting and HRP labeled antibodies. In quantitative methods, the amount of signal produced can be measured by comparison to a standard or control. The measurement can also be relative.
- a further aspect includes a method of measuring a level of or imaging A-beta in a subject or tissue, optionally where the A-beta to be measured or imaged is oligomeric A-beta.
- the method comprises administering to a subject at risk or suspected of having or having AD, an antibody described herein conjugated to a detectable label; and detecting the label, optionally quantitatively detecting the label.
- the label in an embodiment is a positron emitting radionuclide which can for example be used in PET imaging.
- the methods may also be combined with other tests for AD or cognitive impairment.
- synaptic protein levels such as SNAP-25 or synaptic vesicle glycoprotein 2a (SVG2a) (Sci Transl Med. 2016 Jul 20;8(348):348ra96. doi: 10.1126/scitranslmed.aaf6667) in CSF can be measured.
- FDG-PET flourodeoxyglucose PET
- Detecting A-beta levels using an antibody described herein can be used alone or in combination with other methods to monitor response to treatment.
- Oligomeric A-beta species are believed to be the toxic propagating species in AD. Further as shown in FIG. 1 and described in the Examples, these antibodies are specific for oligomers, inhibited A-beta aggregation and A-beta oligomer propagation. Accordingly, also provided are methods of inhibiting A- beta oligomer propagation, the method comprising contacting a cell or tissue expressing A-beta with or administering to a subject in need thereof an effective amount of an A-beta oligomer specific or selective antibody described herein to inhibit A-beta aggregation and/or oligomer propagation. In vitro the assay can be monitored as described in the Examples.
- the antibodies may also be useful for treating AD and/or other A-beta amyloid related diseases.
- AD A-beta amyloid related diseases
- variants of Lewy body dementia and in inclusion body myositis exhibit similar plaques as AD and A-beta can also form aggregates implicated in cerebral amyloid angiopathy.
- the antibodies comprising the CDR sets as well as when in the humanized antibodies sequences described herein bind oligomeric A-beta which is believed to be a toxigenic species of A-beta in AD and inhibit formation of toxigenic A-beta oligomers in vitro.
- a further aspect is a method of treating AD and/or other A-beta amyloid related diseases, the method comprising administering to a subject in need thereof an effective amount of an antibody described herein comprising a CDR set described herein, optionally a humanized antibody described in Table 4A or 4B or selective or a pharmaceutical composition comprising said antibody, to a subject in need thereof.
- nucleic acids encoding the antibodies described herein can also be administered to the subject, optionally using vectors suitable for delivering nucleic acids in a subject.
- a biological sample from the subject to be treated is assessed for the presence or levels of A-beta using an antibody described herein.
- a subject with detectable A-beta levels e.g. A-beta antibody complexes measured in vitro or measured by imaging
- the antibody, peptides and nucleic acids can for example be comprised in a pharmaceutical composition as described herein, and formulated for example in vesicles for improving delivery.
- One or more antibodies targeting HHQK can be administered in combination.
- the antibodies disclosed herein can be administered with one or more other treatments such as a beta-secretase inhibitor or a cholinesterase inhibitor.
- compositions are also provided.
- isolated peptides are also provided.
- nucleic acids for treating AD or A-beta amyloid related diseases.
- compositions, antibodies, isolated peptides and nucleic acids, vectors etc. described herein can be administered for example, by parenteral, intravenous, subcutaneous, intramuscular, intracranial, intraventricular, intrathecal, intraorbital, ophthalmic, intraspinal, intracisternal, intraperitoneal, intranasal, aerosol or oral administration.
- the pharmaceutical composition is administered systemically.
- the pharmaceutical composition is administered directly to the brain or other portion of the CNS.
- such methods include the use of an implantable catheter and a pump, which would serve to discharge a pre-determined dose through the catheter to the infusion site.
- the catheter may be implanted by surgical techniques that permit visualization of the catheter so as to position the catheter adjacent to the desired site of administration or infusion in the brain. Such techniques are described in Elsberry et al. U.S. Patent 5,814,014 "Techniques of Treating Neurodegenerative Disorders by Brain Infusion", which is herein incorporated by reference.
- the pharmaceutical composition is administered to the brain using methods such as modifying the compounds to be administered to allow receptor-mediated transport across the blood brain barrier.
- compositions, antibodies, isolated peptides and nucleic acids described herein contemplate the co-administration of the compositions, antibodies, isolated peptides and nucleic acids described herein with biologically active molecules known to facilitate the transport across the blood brain barrier.
- compositions, antibodies, isolated peptides, and nucleic acids described herein across the blood brain barrier such as those directed at transiently increasing the permeability of the blood brain barrier as described in US patent 7012061 "Method for increasing the permeability of the blood brain barrier", herein incorporated by reference.
- Cyclo(CGHHQKG) (SEQ ID NO:12) peptide was generated at CPC Scientific, Sunnyvale, CA, USA (both cyclic and linear), and conjugated to KLH (for immunizing) and BSA (for screening) using a trifluoroacetate counter ion protocol.
- Hybridomas and monoclonal antibodies were generated to cyclo(CGHHQKG) (SEQ ID NO: 12) linked to Keyhole Limpet Hemocyanin (KLH).
- Lymphocytes were isolated and fused with murine SP2/0 myeloma cells in the presence of poly-ethylene glycol (PEG 1500). Fused cells were cultured using HAT selection. T.
- Tissue culture supernatants from the hybridomas were tested by indirect ELISA on screening antigen (cyclic peptide-BSA) and probed for both IgG and IgM antibodies using a Goat anti- lgG/lgM(H&L)-HRP secondary and developed with TMB substrate. Positive cultures were retested on screening antigen to confirm secretion and on an irrelevant antigen (Human Transferrin) to eliminate non-specific mAbs and rule out false positives. Selected clones were isotyped by antibody trapping ELISA to determine if they are IgG or IgM isotype.
- Selected clones were also tested by indirect ELISA on other cyclic peptide-BSA conjugates as well as linear peptide-BSA conjugates to evaluate cross- reactivity and linker reactivity.
- Antibodies were also screened by SPR analysis.
- A-beta40 and 42 peptides (California Peptide, Salt Lake City UT, USA) were dissolved in ice-cold hexafluoroisopropanol (HFIP). The HFIP was removed by evaporation overnight and dried in a SpeedVac centrifuge. To prepare monomers, the peptide film was reconstituted in DMSO to 5mM, diluted further to 100 ⁇ ⁇ in dH20 and used immediately. Oligomers were prepared by diluting the 5m M DMSO peptide solution in phenol red-free F12 medium (Life Technologies Inc. , Burlington ON, Canada) to a final concentration of 100 ⁇ ⁇ and incubated for 24 hours to 7 days at 4°C.
- HFIP hexafluoroisopropanol
- A-beta42 Monomer and A-beta42 Oligomer are covalently immobilized on individual flow cells of a High Amine Capacity (HAC) sensorchip (Sierra Sensors GmbH, Hamburg, Germany) and antibodies flowed over the surface.
- HAC High Amine Capacity
- Each sample was diluted and injected in duplicate over the immobilized peptide and BSA reference surfaces, followed by injection of running buffer only for the dissociation phase. After every analytical cycle, the sensor chip surfaces were regenerated. Sensorgrams were double-referenced by subtracting out binding from the BSA reference surfaces and blank running buffer injections, and binding response report points collected in the dissociation phase.
- Protein G purified mAbs were analyzed in a secondary screen using an SPR indirect
- Immunoglobulin gene transcripts expressed by the hybridomas were amplified from cDNA generated from the hybridoma cells using standard RT-PCR and sequenced using a standard dye-terminator capillary sequencing method.
- the light chain V region mRNA was amplified using a set of eight signal sequence-specific degenerate primer pools, seven for the kappa cluster (IgK-A to IgK-G) and one for the lambda cluster (IgA), together with ⁇ or ⁇ constant region primers.
- the PCR products obtained were purified, cloned into a 'TA' cloning vector (pGEM-T Easy, Promega, Madison, USA), transformed into E. coli and individual colonies sequenced.
- V0H0 and VOkO Chimeric constructs (V0H0 and VOkO) were prepared using the variable regions from the hybridoma which were cloned into a human lgG4 framework. The chimeric constructs were then humanized to create 6 humanized heavy chains (VH 1 -6) and 6 light chains (Vk1 -6). VH1 -6 and Vk4-6 constructs were mixed to create different humanized antibodies e.g. VH2Vk4.
- the S241 P hinge variant comprises an altered disulfide bond arrangement of an lgG4 molecule by mutation of the Cys at the N terminus of the heavy chain constant domain 1 (CH1 ) (Kabat position 127) to a Ser and introduction of a Cys at a variety of positions (positions 227-230) at the C terminus of CH1.
- An inter-LC-CHl disulfide bond is formed [17].
- the fully humanized antibodies were prepared using Composite Human AntibodyTM technology.
- the humanized variable region genes were cloned into vectors encoding a human lgG4 (S241 P hinge variant) heavy chain constant domain and a human kappa light chain constant domain.
- Chimeric and humanized antibodies were transiently expressed in CHO cells and Protein A purified and tested. All 301 -17 humanized antibodies selectively bound the cyclic peptide conjugated to BSA with binding affinities within 2-fold of the reference chimeric antibody and greater than 10 fold and about 20 of the reference monoclonal antibody.
- the chimeric and humanized antibodies had a KD(M) of about 2 x 10 - whereas the KD of the monoclonal antibody had a KD ( M) of 4 x 10 0 for the cyclic peptide. As shown in Fig. 2 this translates to an improved affinity for oligomeric Abeta.
- Binding was determined using single cycle Biacore analysis. Antibodies were analysed in two separate experiments.
- Humanized antibody sequences are provided in Table 4B (301 -17). The CDR sequences of each antibody sequences are bolded and underlined. The CDRs of 301 -1 1 or any other antibody described herein can be used to replace the CDRs in the humanized constructs as shown for example in Table 4A.
- Antibodies were tested in one or more assays for their ability to bind cyclic peptide, linear peptide, A-beta 1-42 monomer and A-beta 1-42 oligomers prepared as described above.
- Clones 301 -3, 301 -1 1 and 301 -17 antibodies were sequenced.
- the CDR sequences of 301 -3 and 301 -1 1 are provided in Table 2.
- the CDRs for 301-17 are provided in SEQ ID Nos 74-79.
- the consensus DNA sequence and polypeptide sequences of the variable portion of the heavy and light chain of the antibodies are provided in Table 3.
- Consensus DNA sequence and translated protein sequences of the variable region are underlined according to IMTG/LIGM-DB.
- Kappa 2 CCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGCAGATCTAGT SLGDOASISCRSSQSI SEQ ID NO: CAGAGCATTGTACATAGTAATGGAAACACCTATTTAGAATGGTAC VHSNGNTYLEWYLOKP
- CAGAGCATTGTACATAGTAATGGAAACACCTATTTAGAATGGTAC VHSNGNTYLEWYLQKP CTGCAGAAACCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTT GQS PKLL lYKVSNRFS SEQ ID NO: TCCAAC C GAT TTTCTGGGGTCC C AGAC AGGT T C AGT GGC AGT GGA GVPDRFS GS GS GTDFT T C AGGGAC AGAT T T C AC AC T CAAGAT C AGC AGAGT GGAGGC T GAG LKI SRVEAEDLGVYYC
- VH1 SEQ ID NO: 15, 16
- AAT GC TAAGT T CAAGAGC AGAGC C AC AC T GAC T C T GGAC AC AT C C KSRATLTLDTS IS TAY AT AAGC AC AGC C T AC AT GC AGC T C AGC AGC C T GAC AT C T GAGGAC MQL S S LT SEDSAVYYC TCTGCGGTCTAT T AC T GT AGCAGATCCCATGGTAACACCTACTGG SRSHGNTYWFFDVWGO TTTTTTGACGTCTGGGGC CAAGGCACCACGGTCACCGTCTCCTCA GTTVTVS S VH2 CAGGT C CAAC T GGT GC AGT C T GGGGC T GAGGT GAAGAAGC CTGGG QVQLVQS GAEVKKPGA GC T T C AGT GAAGAT GT C C T GCAAGGC T T C TGGCTACAGCTTCACC SVKMS CKAS GYSFTSY
- AAT GC TAAGT T C AAGAGC AGAGC C AC AC T GAC T C T GGAC AC AT C C KSRATLTLDTS IS TAY AT AAGC AC AGC C T AC AT GGAGC T CAGCAGC C T GAGAT C T GAGGAC MEL S S LRSEDTAVYYC AC GGCGGT CT AT TACT GT AGCAGATCCCATGGTAACACCTACTGG SRSHGNTYWFFDVWGO TTTTTTGACGTCTGGGGC CAAGGCACCACGGTCACCGTCTCCTCA GTTVTVS S
- AAT GC TAAGT T C AAGAGC AGAGC C AC AC T GAC T C T GGAC AC AT C C KSRATLTLDTS IS TAY AT AAGC AC AGC C T AC AT GGAGC T CAGCAGC C T GAGAT C T GAGGAC MEL S S LRSEDTAVYYC AC GGCGGT CT AT TACT GT AGCAGATCCCATGGTAACACCTACTGG SRSHGNTYWFFDVWGO TTTTTTGACGTCTGGGGC CAAGGCACCACGGTCACCGTCTCCTCA GTTVTVS S
- CAGGT C CAAC T GGT GC AGT C T GGGGC T GAGGT GAAGAAGC CTGGG QVQLVQS GAEVKKPGA GC T T C AGT GAAGGT GT C C T GCAAGGC T T C TGGCTACAGCTTCACC SVKVS CKASGYSFTSY
- AAT GC TAAGT T C CAGGGC AGAGT C AC AAT GAC T AGGGAC AC AT C C QGRVTMT RDT S I S T AY AT AAGC AC AGC C T AC AT GGAGC T CAGCAGC C T GAGAT C T GAGGAC MEL S S LRSEDTAVYYC AC GGCGGT CT AT TACT GT AGCAGATCCCATGGTAACACCTACTGG SRSHGNTYWFFDVWGO TTTTTTGACGTCTGGGGC CAAGGCACCACGGTCACCGTCTCCTCA GTTVTVS S
- VH0 and VKO denotes chimeric antibodies comprised of the human constant domain and mouse variable domain sequences
- Immunohistochemistry was performed on frozen human brain sections, with no fixation or antigen retrieval. In a humidified chamber, non-specific staining was blocked by incubation with serum-free protein blocking reagent (Dako Canada Inc., Mississauga, ON, Canada) for 1 h.
- serum-free protein blocking reagent Dako Canada Inc., Mississauga, ON, Canada
- the following primary antibodies were used for immunostaining: mouse monoclonal isotype controls lgG1 , lgG2a, and lgG2b, and anti-amyloidp 6E10, all purchased from Biolegend, and purified antibodies 301- 11 and 301-17. All antibodies were used at 1 ⁇ g/mL.
- Sections were incubated at room temperature for 1 h, and washed 3 x 5 min in TBS-T.
- Anti-Mouse IgG conjugated to Horseradish Peroxidase (1 : 1000) was applied to sections and incubated 45 min, then washed 3 x 5 min in TBS-T.
- DAB chromogen reagent Vector Laboratories, Burlington ON, Canada was applied and sections rinsed with distilled water when the desired level of target to background staining was achieved. Sections were counterstained with Mayer's haematoxylin, dehydrated and cover slips were applied.
- Brain ExtractsHuman brain tissues were obtained from the University of Maryland Brain and Tissue Bank upon approval from the UBC Clinical Research Ethics Board (C04-0595). Clinical diagnosis of probable AD was based on NINCDS-ADRDA criteria [5].
- SPR Analysis 4 brain extracts from AD patients and 4 brain extracts from age-matched controls were pooled and analyzed. Brain samples, homogenized in TBS, included frontal cortex Brodmann area 9. All experiments were performed using a Molecular Affinity Screening System (MASS-1 ) (Sierra Sensors GmbH, Hamburg, Germany), an analytical biosensor that employs high intensity laser light and high speed optical scanning to monitor binding interactions in real time. Purified antibodies generated for cyclopeptides described herein were captured on separate flow cells of a protein A-derivatized sensor chip and diluted samples injected over the surfaces for 180 seconds, followed by 120 seconds of dissociation in buffer and surface regeneration. Binding responses were double-referenced by subtraction of mouse control IgG reference surface binding and assay buffer, and the different groups of samples compared.
- MMS-1 Molecular Affinity Screening System
- the antibodies were tested for their ability to bind A-beta in soluble brain extracts, CSF and tissue samples of cavaderic healthy control and AD brains, results are shown in Table 6. Strength of positivity in Table 6 is shown by the number plus signs.
- Each of antibodies 301 -11 and 301 -17 showed positive binding with brain homogenates and CSF from AD patients compared to control patients.
- the purified antibodies showed preferential binding to AD vs non-AD in soluble brain extracts and CSF, and did not appreciably bind to plaque fibrils by IHC.
- A-beta42 Oligomer binding To further verify and validate A-beta42 Oligomer binding, purified antibodies were covalently immobilized to a sensorchip, followed by the injection over the surface of commercially-prepared stable A-beta42 Oligomers (I microM) (SynAging SAS, Vandcewin-les-Nancy, France).
- Antibodies 301-3, 301-11 and 307-17 bound the stable A-beta 42 oligomers (1 microM) with binding response units (BRUs) of an average of 14.5 (301-3), 19.3 (301-11 ) and 30 (301-17), respectively.
- BRUs binding response units
- the negative control lgG1 did not meaningfully bind to the oligomers (mean binding of BRU 2.5) while the pan- ⁇ positive control antibody 6E10 bound with an average BRU of 90.
- Tissue sections were probed with ⁇ g/ml of antibody with and without microwave antigen retrieval (AR).
- the pan-amyloid beta reactive antibody 6E10 was included along with selected antibody clones as a positive control.
- Antibodies were diluted in Antibody Diluent (Ventana), color was developed with OptiView DAB (Ventana). The staining was performed on the Ventana Benchmark XT IHC stainer. Images were obtained with an Olympus BX45 microscope. Images were analyzed blind by a professional pathologist with expertise in neuropathology.
- Recombinant lqG1 and lqG2a antibodies [00285] Recombinant lgG1 and lgG2a 301-17 construct were made by grafting the CDRs of hybridoma-derived 301-17 onto a murine lgG1 or lgG2a backbone (WuXi, Biologies). The sequences are provided in Table 8.
- Recombinant 301-17 lgG2a was amine-coupled to Proteon GLH biosensor chip and tested for binding to cyclopeptide of SEQ ID NO: 2 coupled to BSA. Cyclo-BSA 3-fold dilutions were used from 9 nM to 1 1 1 pM. Assay buffer was PBS-E + 0.05% Tween + 10 mg/ml BSA. Antibody 301 -17 lgG2a was found to bind cyclic peptide (SEQ ID NO: 12) conjugated to BSA with an approximate KD of 17 pM (average of 3 tests).
- the recombinant lgG1 301 -17 antibody gave a greater signal than the hybridoma -purified antibody in 2 tests (40-55 BRU vs 15-25 BRU, respectively). Little or no binding was detected with control mouse IgG.
- 301-17 IgG 1 MAAS-2 binding to cyclic peptide epitope Recombinant 301-17 lgG1 was immobilized on MAAS-2 sensor chip and tested for binding to cyclopeptide of SEQ ID NO: 12 coupled to BSA at pH 6.5, 7.5 or 8.0. Equivalently high levels of binding were observed for 301-17 lgG1 under all 3 pH conditions (-400 BRUs). Little or no binding was detected under any of the pH conditions for control mouse IgG or the pan-Abeta 6E10 antibody (Biolegend)
- ⁇ 1-42 (Bachem Americas Inc., Torrance, CA) was solubilized, sonicated, diluted in Tris-EDTA buffer (pH7.4) and added to wells of a black 96- well microtitre plate (Greiner Bio-One, Monroe, NC) to which equal volumes of cyclopeptide raised antibody or irrelevant mouse IgG antibody isotype controls were added, resulting in a 1 :5 molar ratio of ⁇ 1-42 peptide to antibody.
- ThT was added and plates incubated at room temperature for 24 hours, with ThT fluorescence measurements (excitation at 440nm, emission at 486nm) recorded every hour using a VVallac Victor3v 1420 Multilabel Counter (PerkinElmer, Waltham, MA). Fluorescent readings from background buffer were subtracted from all wells, and readings from antibody only wells were further subtracted from the corresponding wells.
- ⁇ 42 aggregation as monitored by ThT fluorescence, demonstrated a sigmoidal shape characterized by an initial lag phase with minimal fluorescence, an exponential phase with a rapid increase in fluorescence and finally a plateau phase during which the ⁇ molecular species are at equilibrium and during which there is no increase in fluorescence.
- Co-incubation of ⁇ 42 with an irrelevant mouse antibody did not have any significant effect on the aggregation process.
- co-incubation of ⁇ 42 with the test antibodies completely inhibited all phases of the aggregation process. Results obtained with antibody 301-11 are shown in FIG. 1.
- the antibodies demonstrate the potential to completely abrogate this process. Isotype control performed using mouse IgG control antibody showed no inhibition.
- Antibody and control IgG are each adjusted to a concentration such as 2 mg/mL.
- concentration such as 2 mg/mL.
- Various molar ratios of A-beta oligomer and antibody are tested along with a vehicle control, A-beta oligomer alone and a positive control such as the neuroprotective peptide humanin HNG.
- CTRL vehicle 1 ,68 ⁇ of oligomer buffer + 127,3 ⁇ PBS + 71 1 ⁇ culture medium
- CTRL ⁇ 1 ,68 ⁇ of ⁇ + 127, 3 ⁇ PBS + 71 1 ⁇ culture medium
- Novel Object Recognition utilizes the normal behavior of rodents to investigate novel objects for a significantly longer time than known objects. This test assesses recognition memory for items and its human equivalent is the visual pairwise-comparison (VPC). Recognition of objects is mediated by the perirhinal cortex in rodents, primates and humans. AD pathology develops first in the perirhinal and enthorinal cortex before the hippocampus. The VPC task detects memory deficit in mild cognitive impairment (MCI) and conversion from MCI to AD is predicted by this task (16).
- MCI mild cognitive impairment
- mice per group 12 -12 weeks old were ICV-injected with vehicle (buffer used for ⁇ oligomerization) or ⁇ (50 pmoles) in the presence of vehicle (PBS) or antibody 301 -17 on day 0.
- vehicle buffer used for ⁇ oligomerization
- ⁇ 50 pmoles
- the cognitive performance of all mice was determined by a Novel Object Recognition (NOR) test performed at days +7 and +8.
- mice were divided in four experimental groups with 12 mice per experimental group. All animals received a single (and unilateral) ICV injection of vehicle OR ⁇ in the absence or presence of antibody in a total volume of 5 ⁇ _.
- the experimental groups were defined as follow:
- mice received a single 5 ⁇ _ ICV injection of vehicle or ⁇ in the presence of vehicle or antibody.
- mice were habituated during a 10 min trial during which they are placed in an empty open field.
- the day of the cognitive test ⁇ i.e. Day +8), animals are placed in the same open field and are allowed to explore freely two identical objects for a trial of five minutes (acquisition trial). Then the animals are returned to their home cage for an inter-trial time of five minutes.
- animals are allowed to explore two different objects: the same familiar object and one novel object.
- the experimenter blind to the treatment, records the time the mouse is actively exploring each object.
- (Dl) (time exploring novel object - time exploring familiar object) / total exploration time. If the total exploration time is ⁇ 5 s, animals are excluded from the calculation of the discrimination index and statistical analysis.
- mice from the vehicle control group (Group A) exhibited normal behavior with a mean discrimination index of 0.443 ⁇ 0.053. These results are in agreement with previous observations of similar control groups at SynAging. As expected, a single ICV injection of ⁇ (Group B) resulted in a significant impairment (p ⁇ 0.0001 ) of the cognitive performance when compared to vehicle control mice; with a mean discrimination index of -0.062 ⁇ 0.048. ⁇ -injected mice were not able to discriminate between novel and familiar objects.
- the data suggest that antibody 301-17 offered protection against ⁇ -induced cognitive deficits.
- brain tissue can be collected and analyzed for levels of synaptic markers (PSD95, SNAP25, synaptophysin) and inflammation markers (IL-1-beta and TNF- alpha).
- Mice are sacrificed at -14 days post-ICV injection of oligomers and perfused with saline. Hippocampi are collected, snap frozen and stored at -80°C until analyzed. Protein concentrations of homogenized samples are determined by BCA. Concentration of synaptic markers are determined using ELISA kits (Cloud-Clone Corp, USA). Typically, synaptic markers are reduced by 25-30% in mice injected with A-beta oligomers and restored to 90-100% by the humanin positive control. Concentrations of the IL-1-beta inflammatory markers are increased approximately 3-fold in mice injected with A-beta oligomers and this increase is largely prevented by humanin.
- Brains are collected from mice that underwent the behavioral testing.
- the hippocampus (relevant structure for memory formation) is dissected and homogenized in RIPA buffer containing an anti-protease cocktail.
- the tissue is lysed by 3 freeze thaw cycles carried out in liquid nitrogen and a water bath at 37C. and the supernatants are recovered after centrifuging.
- the lysate can be analyzed for levels of TNF-alpha (increases with inflammation) and levels of the synaptic markers PSD-95 and SNAP-25 (which go down when there is synaptic damage).
- the antibody showed complete protection in the behavioral assay. It is expected that brains will also show an improvement in both SNAP25 and PSD-95 levels and a decrease in TNF-alpha levels in the brain.
- A-beta toxic oligomers and associated pathology can be studied in various rodent models of Alzheimer's disease (AD).
- AD Alzheimer's disease
- mice transgenic for human APP e.g. APP23 mice
- human APP and PSEN1 APPPS1 mice
- Intracerebral inoculation of oligomer-containing brain extracts can significantly accelerate this process (13, 14).
- These models provide a system to study inhibition of A-beta oligomer propagation by test antibodies administered intracerebrally or systemically.
- Table 10 A-beta Sequences and compounds
- HHQK (SEQ ID NO: 7)
- Recombinant antibodies HHQK
- Recombinant lgG1 and lgG2a 301-17 constructs were made by grafting the variable region of hybridoma-derived 301-17 onto a murine lgG1 or lgG2a backbone (VVuXi, Biologies).
- Recombinant 301-17 IgGl had a similar KD to the lgG2a recombinant.
- Recombinant 301-17 lgG2a was amine-coupled to Proteon GLH biosensor chip and tested for binding to cyclopeptide of SEQ ID NO: 2 coupled to BSA. Cyclo-BSA 3-fold dilutions were used from 9 nM to 111 pM. Assay buffer was PBS-E + 0.05% Tween + 10 mg/ml BSA. Antibody 301-17 lgG2a was found to bind cyclic peptide (SEQ ID NO: 2) conjugated to BSA with an approximate KD of 17 pM (average of 3 tests).
- 301-17 lgG1 MAAS-2 binding to AbO Recombinant 301-17 lgG1 and hybridoma- purified 301-17 lgG3 were immobilized on MAAS-2 sensor chips and tested for binding to AbO (SynAging) at 1 uM. Under the conditions tested, the recombinant lgG1 301 -17 antibody gave a greater signal than the hybridoma -purified antibody in 2 tests (40-55 BRU vs 15-25 BRU, respectively). Little or no binding was detected with control mouse IgG.
- 301-17 lgG1 MAAS-2 binding to cyclic peptide epitope Recombinant 301-17 lgG1 was immobilized on MAAS-2 sensor chip and tested for binding to cyclopeptide of SEQ ID NO: 2 coupled to BSA at pH 6.5, 7.5 or 8.0. Equivalently high levels of binding were observed for 301 -17 lgG1 under all 3 pH conditions (-400 BRUs). Little or no binding was detected under any of the pH conditions for control mouse IgG or the pan-Abeta 6E10 antibody (Biolegend) Example 13
- Soluble human AD brain extracts were separated into LMVV ( ⁇ 70kDa) and high molecular (HMVV; >70kDa) fractions by size-exclusion chromatography (SEC). Antibody binding to SEC fractions was assessed by surface plasmon resonance (SPR).
- SEC size-exclusion chromatography
- pooled fractions were concentrated and total protein concentration determined by BCA assay. Pooled fractions were diluted to 100ug/ml and injected over immobilized antibodies on sensor chip of MASS2.
- mouse monoclonal 301-17 and aducanumab show equivalent binding to the toxic oligomer-enriched LMVV fraction of soluble human AD brain extract.
- ⁇ 42 peptide (California Peptide, Salt Lake City UT, USA) was dissolved in ice-cold hexafluoroisopropanol (HFIP). The HFIP was removed by evaporation overnight and dried in a SpeedVac centrifuge. To prepare monomers, the peptide film was reconstituted in DMSO to 5mM, diluted further to 100 ⁇ in distilled water (dH20) and used immediately.
- HFIP hexafluoroisopropanol
- Oligomers were prepared by diluting the 5mM DMSO peptide solution in phenol red-free F12 medium (Life Technologies Inc., Burlington ON, Canada) to a final concentration of 100 ⁇ and incubated for 24 hours at 4°C followed by immediate use or storage at -80C.
- Brain tissues from 11 different human AD patients were obtained from the University of Maryland Brain and Tissue Bank and from Dr. Jiri Safar at Case Western Reserve University (Cleveland, Ohio, USA). The clinical diagnosis of AD was based on NINCDS-ADRDA criteria. Samples from frontal cortex were weighed and subsequently submersed in a volume of fresh, ice cold TBS buffer and EDTA-free protease inhibitor cocktail from Roche Diagnostics (Laval QC, Canada) such that the final concentration of brain tissue was 20% (w/v). Tissue was homogenized in this buffer using a mechanical probe homogenizer (3 x 30 sec pulses with 30 sec pauses in between, all performed on ice).
- TBS-homogenized samples were then subjected to ultracentrifugation for 90 min. Supernatants (soluble extracts) were collected, aliquoted and stored at -80°C. The protein concentration was determined using a bicinchoninic acid (BCA) protein assay. Pools of brain extracts from 3-8 patients were used in each analysis. Size exclusion chromatography
- the attached ⁇ aggregates are monomerized and eluted with HFIP.
- Monomerized ⁇ in the HFIP eluate was dried under a fume hood until complete evaporation of HFIP and resuspended in assay buffer.
- Measurement of resolved monomerized ⁇ aggregates was carried out in the MSD assay for ⁇ 38, 40 and 42.
- the total protein concentration in the LMW and HMW brain fractions was measured by BCA and the results are expressed as pg ⁇ species per mg total protein.
- Retrieval Solution Dako, Santa Clara CA, USA
- serum-free protein blocking reagent Dako
- the sections were incubated overnight at 4°C with primary antibodies (mu301-17, hu 301-17, aducanumab, bapineuzumab, isotype controls) at 1 ⁇ 9/ ⁇ and washed 3 times for 5 min in Tris-buffered saline containing 0.1% TritonX-100 (TBS-T) buffer.
- the sections were counte retained with haematoxylin QS (Vector Laboratories, Burlingame CA, USA).
- the slides were examined under a light microscope (Zeiss Axiovert 200M, Carl Zeiss Toronto ON, Canada) and representative images were captured using a Leica DC300 digital camera and software (Leica Microsystems Canada Inc., Vaughan ON, Canada). Images shown are representative of results obtained with 3 different AD brains.
- the lgG4 isotype (S241 P hinge mutation) humanized antibody VH2VK5 was compared to other antibodies.
- the humanized antibody retained selective binding for synthetic ⁇ vs ⁇ monomers as assessed by SPR as well as lack of plaque binding by immunohistochemistry on frozen AD brain sections.
- the ⁇ -directed antibodies bapineuzumab and aducanumab, known to bind fibrils showed robust staining of parenchymal ⁇ plaque and vascular deposits while neither the parent monoclonal (mu 301-17) nor the humanized 301-17 showed any staining above background. Similar results were obtained with brain sections from aged transgenic APP/PS1 transgenic mice). Binding to plaque and vascular deposits in AD clinical trials has been associated with the induction of amyloid-related imaging abnormalities due to edema (ARIA-E) and microhemorrhages (ARIA-H).
- HMVV fractions of soluble AD brain extract was assessed by SPR. Representative results from several separate assays utilizing different pooled extracts derived from multiple AD brains are shown in Fig. 4b.
- the hu301-17 antibody consistently showed high and preferential binding to the LMVV fraction.
- aducanumab and bapineuzumab showed lower and indiscriminate binding of the LMVV vs HMVV fraction.
- ⁇ protein and ⁇ aggregates were determined to be present in the LMVV fraction but to rule out the possibility that hu301-17 may have been binding to other protein(s) also present in this fraction, a sandwich SPR assay was conducted whereby the material captured by immobilized hu301- 17 was subsequently exposed to a detector antibody.
- Aducanumab was chosen as the detector antibody as it is known to be specific for ⁇ and was expected to bind/detect material captured by immobilized aducanumab, thereby acting as a positive control. As illustrated in Fig.
- accession numbers provided herein including for example accession numbers and/or biomarker sequences (e.g. protein and/or nucleic acid) provided in the Tables or elsewhere, are incorporated by reference in its entirely.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Urology & Nephrology (AREA)
- Hospice & Palliative Care (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Psychiatry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/631,676 US12286469B2 (en) | 2017-07-18 | 2018-07-18 | Humanized antibodies binding to amyloid-beta (A-beta) |
| CA3070085A CA3070085A1 (en) | 2017-07-18 | 2018-07-18 | Antibodies to amyloid beta |
| ES18835520T ES2984844T3 (es) | 2017-07-18 | 2018-07-18 | Anticuerpos contra beta amiloide |
| EP18835520.0A EP3574020B1 (en) | 2017-07-18 | 2018-07-18 | Antibodies to amyloid beta |
| JP2020502655A JP7330164B2 (ja) | 2017-07-18 | 2018-07-18 | アミロイドベータに対する抗体 |
| JP2023039300A JP2023086132A (ja) | 2017-07-18 | 2023-03-14 | アミロイドベータに対する抗体 |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CA2017/050866 WO2018014126A1 (en) | 2016-07-18 | 2017-07-18 | Antibodies to amyloid beta |
| CAPCT/CA2017/050866 | 2017-07-18 | ||
| US15/808,842 | 2017-11-09 | ||
| US15/808,842 US20180125920A1 (en) | 2016-11-09 | 2017-11-09 | Methods for preventing and treating A-beta oligomer-associated and/or -induced diseases and conditions |
| US201862622126P | 2018-01-25 | 2018-01-25 | |
| US62/622,126 | 2018-01-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2019014768A1 true WO2019014768A1 (en) | 2019-01-24 |
Family
ID=65014947
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/CA2018/050875 Ceased WO2019014768A1 (en) | 2017-07-18 | 2018-07-18 | ANTI-BETA-AMYLOID ANTIBODY |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP3574020B1 (https=) |
| JP (2) | JP7330164B2 (https=) |
| CA (1) | CA3070085A1 (https=) |
| ES (1) | ES2984844T3 (https=) |
| WO (1) | WO2019014768A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11779629B2 (en) | 2016-11-09 | 2023-10-10 | The University Of British Columbia | Compositions comprising cyclic peptides derived from an A-beta peptide |
| US12173055B2 (en) | 2015-11-09 | 2024-12-24 | The University Of British Columbia | N-terminal epitopes in amyloid beta and conformationally-selective antibodies thereto |
Citations (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1991017271A1 (en) | 1990-05-01 | 1991-11-14 | Affymax Technologies N.V. | Recombinant library screening methods |
| WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| EP0239400B1 (en) | 1986-03-27 | 1994-08-03 | Medical Research Council | Recombinant antibodies and methods for their production |
| US5593846A (en) | 1992-07-10 | 1997-01-14 | Athena Neurosciences | Methods for the detection of soluble β-amyloid peptide |
| US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5814014A (en) | 1996-04-30 | 1998-09-29 | Medtronic Incorporated | Techniques of treating neurodegenerative disorders by brain infusion |
| US5837672A (en) | 1992-07-10 | 1998-11-17 | Athena Neurosciences, Inc. | Methods and compositions for the detection of soluble β-amyloid peptide |
| US6114598A (en) | 1990-01-12 | 2000-09-05 | Abgenix, Inc. | Generation of xenogeneic antibodies |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| WO2001062801A2 (en) | 2000-02-24 | 2001-08-30 | Washington University | Humanized antibodies that sequester amyloid beta peptide |
| US20020076394A1 (en) | 1997-04-17 | 2002-06-20 | Paola Leone | Delivery system for gene therapy to the brain |
| WO2003016466A2 (en) | 2001-08-17 | 2003-02-27 | Eli Lilly And Company | ANTI-Aβ ANTIBODIES |
| WO2003070760A2 (en) | 2002-02-20 | 2003-08-28 | F. Hoffmann-La Roche Ag | Anti-amyloid beta antibodies and their use |
| WO2004071408A2 (en) | 2003-02-10 | 2004-08-26 | Applied Molecular Evolution, Inc. | Aβ BINDING MOLECULES |
| US7012061B1 (en) | 1998-10-19 | 2006-03-14 | New York University | Method for increasing the permeability of the blood brain barrier |
| US20060129126A1 (en) | 2004-11-19 | 2006-06-15 | Kaplitt Michael G | Infusion device and method for infusing material into the brain of a patient |
| WO2006066089A1 (en) | 2004-12-15 | 2006-06-22 | Neuralab Limited | Humanized amyloid beta antibodies for use in improving cognition |
| WO2006125324A1 (en) | 2005-05-27 | 2006-11-30 | Queen's University At Kingston | Treatment of protein folding disorders |
| WO2007068429A1 (en) | 2005-12-12 | 2007-06-21 | F. Hoffmann-La Roche Ag | Antibodies against amyloid beta 4 with glycosylated in the variable region |
| WO2008088983A1 (en) | 2007-01-18 | 2008-07-24 | Eli Lilly And Company | PEGYLATED Aβ FAB |
| WO2009048538A2 (en) | 2007-10-05 | 2009-04-16 | Genentech, Inc. | Humanized antibody |
| WO2009086539A2 (en) | 2007-12-28 | 2009-07-09 | Elan Pharmaceuticals, Inc. | Treatment and prophylaxis of amyloidosis |
| WO2009149487A2 (en) | 2008-06-12 | 2009-12-17 | Affiris Ag | Compounds for treating symptoms associated with parkinson's disease |
| US20110171243A1 (en) | 2008-06-12 | 2011-07-14 | Affiris Ag | Compounds for treating amyloidoses |
| US20150105344A1 (en) | 2004-03-24 | 2015-04-16 | Meiyu Geng | Algin oligosaccharides and the derivatives thereof as well as the manufacture and the use of the same |
| US9221812B2 (en) | 2010-04-16 | 2015-12-29 | Ac Immune Sa | Compounds for the treatment of diseases associated with amyloid or amyloid-like proteins |
| WO2017025918A1 (en) * | 2015-08-11 | 2017-02-16 | Novartis Ag | 5-bromo-2,6-di-(lh-pyrazol-l-yl)pyrimidin-4-amine for use in the treatment of cancer |
| WO2017079833A1 (en) | 2015-11-09 | 2017-05-18 | The University Of British Columbia | Epitopes in amyloid beta mid-region and conformationally-selective antibodies thereto |
| US20180125920A1 (en) * | 2016-11-09 | 2018-05-10 | The University Of British Columbia | Methods for preventing and treating A-beta oligomer-associated and/or -induced diseases and conditions |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7811563B2 (en) * | 2004-10-25 | 2010-10-12 | Northwestern University | Anti-addl antibodies and uses thereof |
| CA2589017A1 (en) * | 2004-12-15 | 2006-06-22 | Neuralab Limited | Amyloid beta antibodies for use in improving cognition |
| CN109476729A (zh) * | 2016-07-18 | 2019-03-15 | 英属哥伦比亚大学 | 淀粉样蛋白β的抗体 |
-
2018
- 2018-07-18 ES ES18835520T patent/ES2984844T3/es active Active
- 2018-07-18 EP EP18835520.0A patent/EP3574020B1/en active Active
- 2018-07-18 WO PCT/CA2018/050875 patent/WO2019014768A1/en not_active Ceased
- 2018-07-18 CA CA3070085A patent/CA3070085A1/en active Pending
- 2018-07-18 JP JP2020502655A patent/JP7330164B2/ja active Active
-
2023
- 2023-03-14 JP JP2023039300A patent/JP2023086132A/ja active Pending
Patent Citations (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0239400B1 (en) | 1986-03-27 | 1994-08-03 | Medical Research Council | Recombinant antibodies and methods for their production |
| US6114598A (en) | 1990-01-12 | 2000-09-05 | Abgenix, Inc. | Generation of xenogeneic antibodies |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| WO1991017271A1 (en) | 1990-05-01 | 1991-11-14 | Affymax Technologies N.V. | Recombinant library screening methods |
| WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5593846A (en) | 1992-07-10 | 1997-01-14 | Athena Neurosciences | Methods for the detection of soluble β-amyloid peptide |
| US5837672A (en) | 1992-07-10 | 1998-11-17 | Athena Neurosciences, Inc. | Methods and compositions for the detection of soluble β-amyloid peptide |
| US5766846A (en) | 1992-07-10 | 1998-06-16 | Athena Neurosciences | Methods of screening for compounds which inhibit soluble β-amyloid peptide production |
| US5814014A (en) | 1996-04-30 | 1998-09-29 | Medtronic Incorporated | Techniques of treating neurodegenerative disorders by brain infusion |
| US20020076394A1 (en) | 1997-04-17 | 2002-06-20 | Paola Leone | Delivery system for gene therapy to the brain |
| US7012061B1 (en) | 1998-10-19 | 2006-03-14 | New York University | Method for increasing the permeability of the blood brain barrier |
| WO2001062801A2 (en) | 2000-02-24 | 2001-08-30 | Washington University | Humanized antibodies that sequester amyloid beta peptide |
| WO2003016466A2 (en) | 2001-08-17 | 2003-02-27 | Eli Lilly And Company | ANTI-Aβ ANTIBODIES |
| WO2003070760A2 (en) | 2002-02-20 | 2003-08-28 | F. Hoffmann-La Roche Ag | Anti-amyloid beta antibodies and their use |
| WO2004071408A2 (en) | 2003-02-10 | 2004-08-26 | Applied Molecular Evolution, Inc. | Aβ BINDING MOLECULES |
| US20150105344A1 (en) | 2004-03-24 | 2015-04-16 | Meiyu Geng | Algin oligosaccharides and the derivatives thereof as well as the manufacture and the use of the same |
| US20060129126A1 (en) | 2004-11-19 | 2006-06-15 | Kaplitt Michael G | Infusion device and method for infusing material into the brain of a patient |
| WO2006066089A1 (en) | 2004-12-15 | 2006-06-22 | Neuralab Limited | Humanized amyloid beta antibodies for use in improving cognition |
| WO2006125324A1 (en) | 2005-05-27 | 2006-11-30 | Queen's University At Kingston | Treatment of protein folding disorders |
| WO2007068429A1 (en) | 2005-12-12 | 2007-06-21 | F. Hoffmann-La Roche Ag | Antibodies against amyloid beta 4 with glycosylated in the variable region |
| WO2008088983A1 (en) | 2007-01-18 | 2008-07-24 | Eli Lilly And Company | PEGYLATED Aβ FAB |
| WO2009048538A2 (en) | 2007-10-05 | 2009-04-16 | Genentech, Inc. | Humanized antibody |
| WO2009086539A2 (en) | 2007-12-28 | 2009-07-09 | Elan Pharmaceuticals, Inc. | Treatment and prophylaxis of amyloidosis |
| WO2009149487A2 (en) | 2008-06-12 | 2009-12-17 | Affiris Ag | Compounds for treating symptoms associated with parkinson's disease |
| US20110171243A1 (en) | 2008-06-12 | 2011-07-14 | Affiris Ag | Compounds for treating amyloidoses |
| US9221812B2 (en) | 2010-04-16 | 2015-12-29 | Ac Immune Sa | Compounds for the treatment of diseases associated with amyloid or amyloid-like proteins |
| WO2017025918A1 (en) * | 2015-08-11 | 2017-02-16 | Novartis Ag | 5-bromo-2,6-di-(lh-pyrazol-l-yl)pyrimidin-4-amine for use in the treatment of cancer |
| WO2017079833A1 (en) | 2015-11-09 | 2017-05-18 | The University Of British Columbia | Epitopes in amyloid beta mid-region and conformationally-selective antibodies thereto |
| US20180125920A1 (en) * | 2016-11-09 | 2018-05-10 | The University Of British Columbia | Methods for preventing and treating A-beta oligomer-associated and/or -induced diseases and conditions |
Non-Patent Citations (38)
| Title |
|---|
| "Current Protocols in Molecular Biology", 2002, JOHN WILEY & SONS |
| A.PETKOVAW.YAUR.TYCKO, EXPERIMENTAL CONSTRAINTS ON QUATERNARY STRUCTURE IN ALZHEIMER'S BETA-AMYLOID FIBRILS BIOCHEMISTRY, vol. 45, 2006, pages 498 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402 |
| CARTERMERCHANT, CURR OPIN BIOTECHNOL, vol. 8, 1997, pages 449 - 454 |
| CO ET AL., J IMMUNOL, vol. 152, 1994, pages 2968 - 2976 |
| COLE ET AL., METHODS ENZYMOL, vol. 121, 1986, pages 140 - 67 |
| DEBORAH BLACKERMARILYN S. ALBERTSUSAN S. BASSETTRODNEY C. P.LINDY E. HARRELLMARSHAI F. FOLSTEIN: "Reliability and Validity of NINCDS-ADRDA Criteria for Alzheimer's Disease The National Institute of Mental Health Genetics Initiative", ARCH NEUROL., vol. 51, no. 12, 1994, pages 1198 - 1204 |
| FOOTEWINTER, J MOL BIOL, vol. 224, 1992, pages 487 - 499 |
| GABRIELA A. N. CRESPISTEFAN J. HERMANSMICHAEL W. PARKERLUKE A. MILES: "Molecular basis for mid-region amyloid-b capture by leading Alzheimer's disease immunotherapies", SCIENTIFIC REPORTS, vol. 1, no. 5, 2015, pages 9649 |
| GIULIAN DHAVERKAMP LJYU JKARSHIN WTOM DLI JKAZANSKAIA AKIRKPATRICK JROHER AE: "The HHQK domain of β-amytoid provides a structural basis for the immunopathology of Alzheimer's disease", J.BIOLCHEM., vol. 273, no. 45, 1998, pages 29719 - 26 |
| HAMLEY, I.W., PEG-PEPTIDE CONJUGATES, vol. 15, 2014, pages 1543 - 1559 |
| HUSE ET AL., SCIENCE, vol. 246, 1989, pages 1275 - 1281 |
| J.X.LUW.QIANGW.M.YAUC.D.SCHWIETERSS.C.MEREDITHR.TYCKO: "MOLECULAR STRUCTURE OF BETA-AMYLOID FIBRILS IN AD BRAIN TISSUE", CELL, vol. 154, 2013, pages 1257 |
| JESPERS ET AL., BIO/TECHNOLOGY, vol. 12, 1994, pages 899 - 903 |
| KARLINALTSCHUL, PROC. NATL. ACAD. SCI. U.S.A., vol. 87, 1990, pages 2264 - 2268 |
| KARLINALTSCHUL, PROC. NATL. ACAD. SCI. U.S.A., vol. 90, 1993, pages 5873 - 5877 |
| KOHLERMILSTEIN, NATURE, vol. 256, 1975, pages 495 - 497 |
| KOZBOR ET AL., IMMUNOL.TODAY, vol. 4, 1983, pages 72 |
| MCCAFFERTY ET AL., NATURE, vol. 348, 1990, pages 552 - 554 |
| MYERSMILLER, CABIOS, vol. 4, 1988, pages 11 - 17 |
| PEDERSEN ET AL., J MOL BIOL, vol. 235, 1994, pages 959 - 973 |
| PETERS SJ ET AL.: "Engineering an Improved IgG4 Molecule with Reduced Disulfide Bond Heterogeneity and Increased Fab Domain Thermal Stability", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 287, 2012, pages 24525 - 24533, XP055069090, DOI: 10.1074/jbc.M112.369744 |
| PIETRO SORMANNIFRANCESCO A. APRILEMICHELE VENDRUSCOLO: "The camsol method of rational design of protein mutants with enhanced solubility", J OF MOL BIOL, vol. 427, no. 2, 2015, pages 478 - 490, XP029189184, DOI: 10.1016/j.jmb.2014.09.026 |
| RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 327 |
| ROBERTS, MJ ET AL., CHEMISTRY FOR PEPTIDE AND PROTEIN PEGYLATION, vol. 64, pages 116 - 127 |
| SAMBROOK ET AL.: "Molecular Cloning: a Laboratory Manual", 2001, COLD SPRING HARBOR LABORATORY PRESS |
| SAMUEL I. A. COHEN: "Proliferation of amyloid-p42 aggregates occurs through a secondary nucleation mechanism", PROC. NATL.L ACAD. SCI. USA, vol. 110, no. 24, 2013, pages 9758 - 9763, XP055347066, DOI: 10.1073/pnas.1218402110 |
| SCI TRANSL MED., vol. 8, no. 348, 20 July 2016 (2016-07-20), pages 348ra96 |
| SCIENTIFIC REPORTS, vol. 15, pages 9649 |
| SEVIGNY J ET AL.: "The antibody aducanumab reduces AD plaque in Alzheimer's disease", NATURE, vol. 537, 2016, pages 50 - 56 |
| VINCENT J. HILSERERNESTO FREIRE: "Structure-based calculation of the equilibrium folding pathway of proteins. correlation with hydrogen exchange protection factors", J. MOL. BIOL., vol. 262, 1996, pages 756 - 772, XP001007452, DOI: 10.1006/jmbi.1996.0550 |
| WANG, HCYU, YZLIU, SZHAO, MQ XU: "Peripherally administered sera antibodies recognizing amyloid- _oligomers mitigate Alzheimer's disease-like pathology and cognitive decline in aged 3x Tg-AD mice", VACCINE, 2016 |
| WARD ET AL., NATURE, vol. 41, 1989, pages 544 - 546 |
| WINKLER KSCHARNAGL HTISLJAR UHOSCHUTZKY HFRIEDRICH IHOFFMANN MMHUTTINGER MWIELAND HMARZ W: "Competition of Ap amyloid peptide and apolipoprotein E for receptor-mediated endocytosis", J.LIPID RES., vol. 40, no. 3, 1999, pages 447 - 55 |
| Y.XIAOB.MAD.MCELHENYS.PARTHASARATHYF.LONGM.HOSHIR.NUSSINOVY.LSHIIA BETA: "1-42) FIBRIL STRUCTURE ILLUMINATES SELF-RECOGNITION AND REPLICATION OF AMYLOID IN ALZHEIMER'S DISEASE", NAT.STRUCT.MOL.BIOL., vol. 22, 2015, pages 499 |
| YU YZWANG WBCHAO ACHANG QLIU SZHAO M ET AL.: "Strikingly reduced amyloid burden and improved behavioral performance in Alzheimer's disease mice immunized with recombinant chimeric vaccines by hexavalent foldable Ab 1-15 fused to toxin-derived carrier proteins", J ALZHEIMER'S DIS, vol. 41, 2014, pages 243 - 60 |
| ZOLA SMMANZANARES CMCLOPTON PLAH JJLEVEY AL: "A behavioral task predicts conversion to mild cognitive impairment and Alzheimer's disease", AM J ALZHEIMER'S DIS & OTHER DEMENTIA, vol. 28, no. 2, 2013, pages 179 - 184 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12173055B2 (en) | 2015-11-09 | 2024-12-24 | The University Of British Columbia | N-terminal epitopes in amyloid beta and conformationally-selective antibodies thereto |
| US11779629B2 (en) | 2016-11-09 | 2023-10-10 | The University Of British Columbia | Compositions comprising cyclic peptides derived from an A-beta peptide |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2020533955A (ja) | 2020-11-26 |
| EP3574020A1 (en) | 2019-12-04 |
| ES2984844T3 (es) | 2024-10-31 |
| JP2023086132A (ja) | 2023-06-21 |
| EP3574020B1 (en) | 2024-05-15 |
| EP3574020A4 (en) | 2020-03-25 |
| JP7330164B2 (ja) | 2023-08-21 |
| CA3070085A1 (en) | 2019-01-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250051428A1 (en) | Antibodies to amyloid beta | |
| US11779629B2 (en) | Compositions comprising cyclic peptides derived from an A-beta peptide | |
| AU2022201737B2 (en) | Epitopes in Amyloid beta mid-region and conformationally-selective antibodies thereto | |
| AU2016353553B2 (en) | Amyloid beta epitopes and antibodies thereto | |
| US20230141177A1 (en) | Antibodies to misfolded amyloid beta | |
| WO2017079834A1 (en) | Epitopes in amyloid beta and conformationally-selective antibodies thereto | |
| US12286469B2 (en) | Humanized antibodies binding to amyloid-beta (A-beta) | |
| JP2023086132A (ja) | アミロイドベータに対する抗体 | |
| US20250289877A1 (en) | Antibodies to Amyloid Beta | |
| HK40017344B (en) | Antibodies to amyloid beta | |
| HK40017344A (en) | Antibodies to amyloid beta |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18835520 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2018835520 Country of ref document: EP Effective date: 20190829 |
|
| ENP | Entry into the national phase |
Ref document number: 3070085 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2020502655 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWG | Wipo information: grant in national office |
Ref document number: 16631676 Country of ref document: US |