WO2018218166A1 - Using split deaminases to limit unwanted off-target base editor deamination - Google Patents
Using split deaminases to limit unwanted off-target base editor deamination Download PDFInfo
- Publication number
- WO2018218166A1 WO2018218166A1 PCT/US2018/034687 US2018034687W WO2018218166A1 WO 2018218166 A1 WO2018218166 A1 WO 2018218166A1 US 2018034687 W US2018034687 W US 2018034687W WO 2018218166 A1 WO2018218166 A1 WO 2018218166A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cell
- split
- deaminase
- ncas9
- fusion proteins
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0634—Cells from the blood or the immune system
- C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
- C07K2319/81—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/04—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
- C12Y305/04001—Cytosine deaminase (3.5.4.1)
Definitions
- BE Base editing technologies use an engineered DNA binding domain (such as RNA-guided, catalytically inactive Cas9 (dead Cas9 or dCas9), a nickase version of Cas9 (nCas9), or zinc finger (ZF) arrays) to recruit a cytosine deaminase domain to a specific genomic location to effect site-specific cytosine ⁇ thymine transition substitutions 1,2 .
- BEs are a particularly attractive tool for treating genetic diseases that manifest in cellular contexts where making precise mutations by homology directed repair (HDR) would be therapeutically beneficial but are difficult to create with traditional nuclease-based genome editing technology.
- HDR homology directed repair
- HDR high-length indel mutations
- BE technology has the potential to allow practitioners to make highly controllable, highly precise mutations without the need for cell-type- variable DNA repair mechanisms.
- Base editor platforms possess the unique capability to generate precise, user-defined genome-editing events without the need for a donor DNA molecule.
- Base Editors that include a single strand nicking CRISPR-Cas9 (nCas9) protein fused to cytosine deaminase domain and uracil glycosylase inhibitor (UGI) domains (e.g., BE3) efficiently induce cytosine-to-thymine (C-to-T) base transitions in a site- specific manner as determined by the CRISPR guide RNA (gRNA) spacer sequence 1 .
- BEs that use split deaminases (sDA) that are functional when brought into close proximity to each other, one fused to a ZF and one to an nCas9-UGI protein comprising one or more UGIs, so as to limit the ability of the deaminase domain from deaminating at off-target ssDNA target sites independent of nCas9 R-loop formation.
- sDA split deaminases
- fusion proteins comprising: (i) a first portion of a split deaminase (“sDA1”) enzyme fused to a programmable DNA-binding domain, preferably selected from the group consisting of such as a ZF, TALE, Cas9, catalytically inactive Cas9 (dCas9) or Cas9 ortholog (i.e., a homologous protein from another species such as dCpf1), nicking Cas9 (nCas9) or nicking Cas9 ortholog, wherein the sDA1 is an N-terminal truncated, catalytically inactive or deficient derivative of a parental deaminase selected from the group consisting of hAID, rAPOBEC1, mAPOBEC3, hAPOBEC3A, hAPOBEC3B, hAPOBEC3C,
- hAPOBEC3F hAPOBEC3F
- hAPOBEC3G hAPOBEC3H
- variants thereof e.g., variants that have altered substrate specificities or activities such as eA3A
- sDA2 split deaminase
- sDA1 portion e.g., dCpf1, TALE, ZF
- the sDA2 is a C- terminal truncated, catalytically inactive or deficient derivative of a parental deaminase selected from the group consisting of hAID, rAPOBEC1*, mAPOBEC3, hAPOBEC3A, hAPOBEC3B, hAPOBEC3C, hAPOBEC3F, hAPOBEC3G, or hAPOBEC3H, and/or variants thereof, e.g., with altered substrate specificities or activities such as eA3A.
- a parental deaminase selected from the group consisting of hAID, rAPOBEC1*, mAPOBEC3, hAPOBEC3A, hAPOBEC3B, hAPOBEC3C, hAPOBEC3F, hAPOBEC3G, or hAPOBEC3H, and/or variants thereof
- the split deaminases are not full length proteins, but are fragments thereof, wherein the co-expression of a fusion protein of (i) with a fusion protein of (ii) comprising a sDA1 and sDA2 portion from the same parental deaminase in eukaryotic cells, and their subsequent co-localization at adjacent genomic target sites, provides a catalytically active base-editor.
- sDA1 and“sDA2” are used herein to refer to the first and second split deaminases generally, and do not refer specifically to the exemplary split deaminases described herein.
- nucleic acids encoding the fusion proteins described herein, and compositions comprising one or more of those nucleic acids, e.g., wherein the nucleic acids encode a pair of the fusion proteins, e.g., comprising a SDA1 and SDA2 portion from the same parental deaminase.
- vectors comprising the nucleic acids, and isolated host cells comprising and optionally expressing the nucleic acids.
- the host cell is a stem cell, e.g., a hematopoietic stem cell.
- fusion proteins described herein comprising a SDA1 and SDA2 portion from the same parental deaminase, as well as one or more gRNAs that interact with Cas9 domains in the fusion proteins.
- one of the fusion proteins comprises nCas9
- the other fusion protein comprises ZF or TALE
- the ZF or TALE is targeted to a sequence of 9-24bp adjacent to the target site of the gRNA for the nCas9, wherein the gRNA binds to the nucleic acid comprising the selected cytosine.
- the nucleic acid is in a cell, e.g., a eukaryotic cell, and the method comprises contact the cell with the fusion proteins or expressing the fusion proteins in the cell.
- one of the fusion proteins comprises nCas9
- the other fusion protein comprises ZF or TALE
- the ZF or TALE is targeted to a sequence of 9-24bp adjacent to the target site of the gRNA for the nCas9, wherein the gRNA binds to the nucleic acid comprising the selected cytosine.
- the fusion protein is delivered as an RNP, mRNA, or plasmid.
- compositions comprising a purified fusion protein or pair of fusion proteins described herein, preferably a pair of fusion proteins described herein comprising a sDA1 and sDA2 portion from the same parental deaminase, an optionally one or more gRNAs that interact with Cas9 domains in the fusion proteins.
- the composition comprise one or more ribonucleoprotein (RNP) complexes.
- RNP ribonucleoprotein
- the fusion protein is delivered as an RNP, mRNA, or plasmid DNA.
- Also provided herein are methods for deaminating a selected cytosine in a nucleic acid the method comprising contacting the nucleic acid with a fusion protein or base editing system described herein.
- compositions comprising a purified a fusion protein or base editing system as described herein.
- nucleic acids encoding a fusion protein or base editing system described herein, as well as vectors comprising the nucleic acids, and host cells comprising the nucleic acids, e.g., stem cells, e.g., hematopoietic stem cells.
- FIGURE 1 Diagram of an exemplary typical high efficiency base editing setup.
- a nicking Cas9 bearing a catalytically inactivating mutation at one of its two nuclease domains binds to the target site dictated by the variable spacer sequence of the gRNA.
- the formation of a stable R-loop creates a ssDNA editing window on the non-deaminated strand.
- the Cas9 creates a single strand break in the genomic DNA, prompting the host cell to repair the lesion using the deaminated strand as a template, thus biasing repair towards the cytosine ⁇ thymine transition substitution. See Komor et al., 2016.
- FIGUREs 2A-2G Schematic representation of: 2A.) First-generation base editor targeting and deaminating at an on-target site, with a deaminase targeting an R- loop generated by an on-target nCas9.2B.) First-generation base-editor binding to and deaminating an off-target genomic R-loop independent of its nCas9 targeting capabilities.2C.) First-generation base-editor binding to and deaminating an off-target genomic transcription bubble independent of its nCas9 targeting capabilities.
- FIGUREs 3A-3B hAPOBEC3G with representative candidate split sites. Multiple rotational views of the hAPOBEC3G structure are shown. Magenta colored loop regions are candidate split sites selected on the bases of their lack of secondary structures and their distance from the catalytic center. PDB: 3E1U.
- FIGURE 4 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.1- 3AC3L-ZF-C and N-sDA2.1-nCas9-UGI-C proteins in several indicated orientations. Conversion rates at each position are indicated by shaded boxes with overlaid percentage numbers for residues in which significant mutation was observed.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIGURE 5 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.1- 3AC3L-ZF-C and N-sDA2.2-nCas9-UGI-C proteins in several indicated orientations. Conversion rates at each position are indicated by shaded boxes with overlaid percentage numbers for residues in which significant mutation was observed.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIGURE 6 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.2- 3AC3L-ZF-C and N-sDA2.1-nCas9-UGI-C proteins in several indicated orientations. Conversion rates at each position are indicated by shaded boxes with overlaid percentage numbers for residues in which significant mutation was observed.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIGURE 7 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.2- 3AC3L-ZF-C and N-sDA2.2-nCas9-UGI-C proteins in several indicated orientations. Conversion rates at each position are indicated by shaded boxes with overlaid percentage numbers for residues in which significant mutation was observed.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIG. 9 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.3-3AC3L- ZF-C and N-sDA2.2-nCas9-UGI-C proteins in several indicated orientations.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIG. 10 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.2- 3AC3L-ZF-C and N-sDA2.3-nCas9-UGI-C proteins in several indicated orientations. Conversion rates at each position are indicated by shaded boxes with overlaid percentage numbers for residues in which significant mutation was observed.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIG. 11 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.3- 3AC3L-ZF-C and N-sDA2.4-nCas9-UGI-C proteins in several indicated orientations. Conversion rates at each position are indicated by shaded boxes with overlaid percentage numbers for residues in which significant mutation was observed.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIG. 13 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.4- 3AC3L-ZF-C and N-sDA2.4-nCas9-UGI-C proteins in several indicated orientations. Conversion rates at each position are indicated by shaded boxes with overlaid percentage numbers for residues in which significant mutation was observed.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIG. 14 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.5- 3AC3L-ZF-C and N-sDA2.4-nCas9-UGI-C proteins in several indicated orientations. Conversion rates at each position are indicated by shaded boxes with overlaid percentage numbers for residues in which significant mutation was observed.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIG. 15 C-to-T transition mutations in the integrated EGFP gene from a split rAPO1 base editor architecture consisting of adjacently-targeting N-sDA1.5- 3AC3L-ZF-C and N-sDA2.6-nCas9-UGI-C proteins in several indicated orientations. Conversion rates at each position are indicated by shaded boxes with overlaid percentage numbers for residues in which significant mutation was observed.
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- Orientation information is depicted, with arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM) and ZF binding sites (with the arrow indicating the direction of ZF binding in reference to N ⁇ C orientation).
- FIG. 17 C-to-T conversion data with first-generation BE3 (described in reference 1) with both gRNAs used in this study. (Note that the coloration gradient of these samples is shaded lighter than graphs above and that direct comparison requires evaluation of relative numerical rates). Orientation information is depicted, with an arrows representing gRNA binding sites (with the arrow pointing in the direction of the PAM). EGFP target sequence,
- Figure 20 Evidence of C-to-T conversion when using adjacently-targeting N- sDA1.X-NLS-ZF-C and N-sDA2.X-nCas9-UGI-C human APOBEC3a (hA3A) split Base Editors in the indicated orientation. Pointed boxes representing the nCas9 gRNA binding site (gRNA2) and ZF binding site (ZF1) are shown, with the pointed ends indicating the PAM-proximal end of the gRNA and indicating the N ⁇ C orientation of the ZF, respectively. Conversion rates at each position are indicated by shaded boxes.
- Rates of deamination by split BE pairs are around 2.5% per cytosine using the sDA1.6 + sDA2.6 configuration and around 1.7% per cytosine for the sDA1.1 + sDA2.1 configuration, while a hAPOBEC3A-nCas9-UGI positive control possessed 3-4x the amount of on-target activity as active hA3A halfase pairs.
- gRNA target region
- Figures 21A-21D Summary of C-to-T conversion rate of all rAPO1 halfase combination base editors as compared to a benchmark BE3 base editor at an integrated EGFP locus. The sum of total C-to-T editing percentages among three cytosines within or near the target gRNA’s approximate editing window is shown, as averaged between two replicates.
- 21A shows the ZF1+gRNA1 data
- 21B shows the ZF1+gRNA2 data
- 21C shows the ZF2+gRNA1 data
- 21D shows the ZF2+gRNA2 data.
- FIG. 22 Representation of a portion of the EGFP reporter gene and the target sites used for the rAPO1 halfase combination experiments.
- EGFP target region GCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCG
- a cytosine deaminase (DA) domain and uracil glycosylase inhibitor (UGI; a small bacteriophage protein that inhibits host cell uracil DNA glycosylase (UDG), the enzyme responsible for excising uracil from the genome 1, 4 ) are both fused to nCas9 (derived from either Streptococcus pyogenes Cas9 (SpCas9) or Staphylococcus aureus Cas9 (SaCas9).
- the nCas9 forms an R-loop at a target site specified by its single guide RNA (gRNA) and recognition of an adjacent protospacer adjacent motif (PAM), leaving approximately 4-8 nucleotides of the non-target strand exposed as single stranded DNA (ssDNA) near the PAM-distal end of the R-loop ( Figure 1).
- This region of the ssDNA is the template that is able to be deaminated by the ssDNA-specific DA domain to produce a guanosine:uracil (G:U) mismatch and defines the editing window.
- the nCas9 nicks the non-deaminated strand of DNA, biasing conversion of the G:U mismatch to an adenine:thymine (A:T) base pair by directing the cell to repair the nick lesion using the deaminated strand as a template.
- deaminase domains described in these fusion proteins have been rat APOBEC1 (rAPO1), an activation-induced cytosine deaminase (AID) derived from lamprey termed CDA (PmCDA), human AID (hAID), or a hyperactive form of hAID lacking a nuclear export signal, or an engineered variant of human APOBEC3A (hA3A) termed eA3A 1-2, 5-7, 16 . Any of these deaminase domains from these BEs can be used as parental deaminases in the present fusion proteins.
- nSpCas9 nCas9 domain
- any Cas9-like nickase could be used based on any ortholog of the Cpf1 protein (including the related Cpf1 enzyme class) to perform this function, unless specifically indicated.
- a completely enzymatically dead dCas9 or Cas9-like enzyme can also be used as the targeting mechanism of a functional BE enzyme.
- BE in therapeutic settings will be to assess its genome-wide capacity for off-target mutagenesis and to modify the technology to minimize or, ideally, to eliminate the risks of stimulating deleterious off-target mutations.
- BEs we described technological improvements to BEs that can be used to reduce or eliminate potential unwanted BE mutagenesis. Using Split Deaminases to Limit Unwanted Off-target Base Editor Deamination
- AID/APOBEC enzymes Because of AID/APOBEC enzymes’ natural ability to bind and deaminate cytosines in genomic DNA and cytosines in RNA, non-specific spurious deamination events are a possibly important source of off-target mutagenesis in the genome and transcriptome from CRISPR Base Editor technology. In theory, even if the BE’s nCas9 domain (and any potential dCas9, TALE, and/or ZF domains) are eminently specific, this might do nothing to prevent the natural RNA- and ssDNA-targeting ability of the APOBEC enzyme from non-specifically deaminating globally across the transcriptome or the whichever regions of the genome are exposed as ssDNA, such as actively transcribed regions or DNA undergoing replication.
- sDA1 split deaminase
- ZF any DNA targeting domain orthogonal to Cas9, such as Cpf1, TALE, ZF, or a dCas9 orthogonal to the nCas9 used to target sDA2, may be suitable
- any DNA targeting domain orthogonal to Cas9 such as Cpf1, TALE, ZF, or a dCas9 orthogonal to the nCas9 used to target sDA2
- a reciprocal or somewhat overlapping C-terminal truncation of a deaminase fused to an nCas9-UGI fusion protein such that the N-terminal truncation and the C-terminal truncation together form a functional enzyme.
- the exemplary BEs were made in a similar orientation to the first- generation BE3 enzyme (sDA2-nCas9-UGI) targeting an adjacent sequence with a ⁇ 17-24bp target site 1 .
- a yeast cytosine deaminase yCD
- yCD yeast cytosine deaminase
- a split BE should generally increase the specificity of editing compared to typical BEs by virtue of the fact that the split BE system requires the binding of a higher number of sequential/adjacent DNA bases, thereby decreasing the off-target effects conferred by off-target binding of either halfase on its own.
- CRISPR BE architectures are known to induce C-to-T mutations in human cells at some genomic sites that are imperfect matches to their gRNAs 13 , and since ZFs are known to bind with some capacity to off-target sites it stands to reason that a ZF-BE architecture would also induce off-target mutagenesis to some capacity 14 .
- CRISPR/Cas-based targeting system including Cas9s from Streptococcus pyogenes or Stapholococcus aureus or Cpf1 proteins from various organisms could be used in place of the nCas9 portion of the sDA2-nCas9-UGI fusion protein, so long as the targeting mechanism results in specific DNA binding and the creation of an R-loop that exposes ssDNA to action by the reconstituted split deaminase.
- Table 1 contains a list of representative
- CRISPR/Cas targeting systems and the residues/mutations therein known to be important for creating nickase and catalytically inactive (dead) mutants.
- Cpf1 nickases have yet to be described
- catalytically null Cpf1 orthologs may replicate the targeting characteristics of nCas9 such that it could form the basis of a functional sDA2 halfase.
- ZF domains are chosen as the DNA binding domain for sDA1 due to their small size, presumed lack of immunogenicity, and because, unlike CRISPR-based targeting systems, they do not create an R-loop upon binding and do not expose additional substrate ssDNA to the deaminase domain. In principle, however, use of any engineered DNA binding domain, such as a
- CRISPR-based targeting complex or a TALE DNA binding domain could still result in functional sDA1 halfase.
- ZF domains targeting an integrated EGFP gene were used for the sDA1 halfases 15 .
- the present fusion proteins can include programmable DNA binding domains such as engineered C2H2 zinc-fingers, transcription activator effector-like effectors (TALEs), and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) Cas RNA-guided nucleases (RGNs) and their variants, including ssDNA nickases (nCas9) or their analogs and catalytically inactive dead Cas9 (dCas9) and its analogs, and any engineered protospacer-adjacent motif (PAM) variants.
- a programmable DNA binding domain is one that can be engineered to bind to a selected target sequence.
- the Cas9 nuclease from S. pyogenes can be guided via simple base pair complementarity between 17-20 nucleotides of an engineered guide RNA (gRNA), e.g., a single guide RNA or crRNA/tracrRNA pair, and the complementary strand of a target genomic DNA sequence of interest that lies next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG (Shen et al., Cell Res (2013); Dicarlo et al., Nucleic Acids Res (2013); Jiang et al., Nat Biotechnol 31, 233-239 (2013); Jinek et al., Elife 2, e00471 (2013); Hwang et al., Nat Biotechnol 31, 227-229 (2013); Cong et al., Science 339, 819-823 (2013); Mali et al., Science 339, 823-826 (2013c); Cho e
- Cpf1 The engineered CRISPR from Prevotella and Francisella 1 (Cpf1) nuclease can also be used, e.g., as described in Zetsche et al., Cell 163, 759-771 (2015); Schunder et al., Int J Med Microbiol 303, 51-60 (2013); Makarova et al., Nat Rev Microbiol 13, 722-736 (2015); Fagerlund et al., Genome Biol 16, 251 (2015).
- Cpf1 requires only a single 42-nt crRNA, which has 23 nt at its 3’ end that are complementary to the protospacer of the target DNA sequence (Zetsche et al., 2015).
- SpCas9 recognizes an NGG PAM sequence that is 3’ of the protospacer
- AsCpf1 and LbCp1 recognize TTTN PAMs that are found 5’ of the protospacer (Id.).
- the present system utilizes a wild type or variant Cas9 protein from S. pyogenes or Staphylococcus aureus, or a wild type Cpf1 protein from Acidaminococcus sp. BV3L6 or Lachnospiraceae bacterium ND2006 either as encoded in bacteria or codon-optimized for expression in mammalian cells and/or modified in its PAM recognition specificity and/or its genome-wide specificity.
- a number of variants have been described; see, e.g., WO 2016/141224,
- the guide RNA is expressed or present in the cell together with the Cas9 or Cpf1. Either the guide RNA or the nuclease, or both, can be expressed transiently or stably in the cell or introduced as a purified protein or nucleic acid.
- the Cas9 also includes one of the following mutations, which reduce nuclease activity of the Cas9; e.g., for SpCas9, mutations at D10A or H840A (which creates a single-strand nickase).
- the SpCas9 variants also include mutations at one of the following amino acid positions, which destroy the nuclease activity of the Cas9: D10, E762, D839, H983, or D986 and H840 or N863, e.g., D10A/D10N and
- H840A/H840N/H840Y to render the nuclease portion of the protein catalytically inactive; substitutions at these positions could be alanine (as they are in Nishimasu al., Cell 156, 935–949 (2014)), or other residues, e.g., glutamine, asparagine, tyrosine, serine, or aspartate, e.g., E762Q, H983N, H983Y, D986N, N863D, N863S, or N863H (see WO 2014/152432).
- the Cas9 is fused to one or more Uracil glycosylase inhibitor (UGI) protein sequences;
- UGI Uracil glycosylase inhibitor
- the UGIs are at the C-terminus of a BE fusion protein, but could
- Transcription activator like effectors of plant pathogenic bacteria in the genus Xanthomonas play important roles in disease, or trigger defense, by binding host DNA and activating effector-specific host genes. Specificity depends on an effector-variable number of imperfect, typically ⁇ 33-35 amino acid repeats.
- Polymorphisms are present primarily at repeat positions 12 and 13, which are referred to herein as the repeat variable-diresidue (RVD).
- RVDs of TAL effectors correspond to the nucleotides in their target sites in a direct, linear fashion, one RVD to one nucleotide, with some degeneracy and no apparent context dependence.
- the polymorphic region that grants nucleotide specificity may be expressed as a triresidue or triplet.
- Each DNA binding repeat can include a RVD that determines recognition of a base pair in the target DNA sequence, wherein each DNA binding repeat is responsible for recognizing one base pair in the target DNA sequence.
- the RVD can comprise one or more of: HA for recognizing C; ND for recognizing C; HI for recognizing C; HN for recognizing G; NA for recognizing G; SN for recognizing G or A; YG for recognizing T; and NK for recognizing G, and one or more of: HD for recognizing C; NG for recognizing T; NI for recognizing A; NN for recognizing G or A; NS for recognizing A or C or G or T; N* for recognizing C or T, wherein * represents a gap in the second position of the RVD; HG for recognizing T; H* for recognizing T, wherein * represents a gap in the second position of the RVD; and IG for recognizing T.
- TALE proteins may be useful in research and biotechnology as targeted chimeric nucleases that can facilitate homologous recombination in genome engineering (e.g., to add or enhance traits useful for biofuels or biorenewables in plants). These proteins also may be useful as, for example, transcription factors, and especially for therapeutic applications requiring a very high level of specificity such as therapeutics against pathogens (e.g., viruses) as non-limiting examples.
- pathogens e.g., viruses
- MegaTALs are a fusion of a meganuclease with a TAL effector; see, e.g., Boissel et al., Nucl. Acids Res.42(4):2591-2601 (2014); Boissel and Scharenberg, Methods Mol Biol.
- Zinc finger (ZF) proteins are DNA-binding proteins that contain one or more zinc fingers, independently folded zinc-containing mini-domains, the structure of which is well known in the art and defined in, for example, Miller et al., 1985, EMBO J., 4:1609; Berg, 1988, Proc. Natl. Acad. Sci. USA, 85:99; Lee et al., 1989, Science. 245:635; and Klug, 1993, Gene, 135:83.
- Crystal structures of the zinc finger protein Zif268 and its variants bound to DNA show a semi-conserved pattern of interactions, in which typically three amino acids from the alpha-helix of the zinc finger contact three adjacent base pairs or a“subsite” in the DNA (Pavletich et al., 1991, Science, 252:809; Elrod-Erickson et al., 1998, Structure, 6:451).
- the crystal structure of Zif268 suggested that zinc finger DNA-binding domains might function in a modular manner with a one-to-one interaction between a zinc finger and a three-base-pair “subsite” in the DNA sequence.
- multiple zinc fingers are typically linked together in a tandem array to achieve sequence-specific recognition of a contiguous DNA sequence (Klug, 1993, Gene 135:83).
- Such recombinant zinc finger proteins can be fused to functional domains, such as transcriptional activators, transcriptional repressors, methylation domains, and nucleases to regulate gene expression, alter DNA methylation, and introduce targeted alterations into genomes of model organisms, plants, and human cells (Carroll, 2008, Gene Ther., 15:1463-68; Cathomen, 2008, Mol. Ther., 16:1200-07; Wu et al., 2007, Cell. Mol. Life Sci., 64:2933-44).
- functional domains such as transcriptional activators, transcriptional repressors, methylation domains, and nucleases to regulate gene expression, alter DNA methylation, and introduce targeted alterations into genomes of model organisms, plants, and human cells
- module assembly One existing method for engineering zinc finger arrays, known as“modular assembly,” advocates the simple joining together of pre-selected zinc finger modules into arrays (Segal et al., 2003, Biochemistry, 42:2137-48; Beerli et al., 2002, Nat. Biotechnol., 20:135-141; Mandell et al., 2006, Nucleic Acids Res., 34:W516-523; Carroll et al., 2006, Nat. Protoc.1:1329-41; Liu et al., 2002, J. Biol. Chem.,
- the zinc finger arrays are described in, or are generated as described in, WO 2011/017293 and WO 2004/099366. Additional suitable zinc finger DBDs are described in U.S. Pat. Nos.6,511,808, 6,013,453, 6,007,988, and 6,503,717 and U.S. patent application 2002/0160940. Base Editors
- the base editor is a deaminase that modifies cytosine DNA bases, e.g., a cytosine deaminase from the apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like (APOBEC) family of deaminases, including APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D/E, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4 (see, e.g., Yang et al., J Genet Genomics.2017 Sep 20;44(9):423-437); activation-induced cytosine deaminase (AID), e.g., activation induced cytosine deaminase (AICDA), cytosine deaminase 1 (CDA1), and CDA2, and cytosine deamin
- AID
- split deaminase regions are shown in Table 3.
- Each split region listed in Table 3 represents a region of the enzyme either known to be a linker region devoid of secondary structure and positioned away from enzymatically important functions or predicted to be linker based on alignment with hAPOBEC3G where structural information is lacking (* indicates which proteins lack sufficient structural information).
- Unstructured recognition loops were not included due to their importance in determining substrate binding and specificity. All protein sequences acquired from uniprot.org. All positional information refers to positions within the full-length protein sequences as described below. Candidate split regions described only indicate our best attempt at a priori prediction of which splits will be functional. TABLE 3.
- the split deaminase regions can include mutations that may enhance base editing, e.g., when made to the nCas9-UGI portion, e.g., mutations corresponding to W90, R126, or R132 of SEQ ID NO:46, e.g., corresponding to W90Y, R126E, R132E, of SEQ ID NO:46 (see, e.g., Kim et al.“Increasing the Genome-Targeting Scope and Precision of Base Editing with Engineered Cas9-Cytosine Deaminase Fusions.” Nature Biotechnology 35(4):371–376 (2017)).
- the split deaminase regions can include mutations at positions corresponding to one or more of N57, Y130, or K60 of SEQ ID NO:49, e.g., mutations corresponding to N57G, N57A, N57Q, Y130F, K60D of SEQ ID NO:49 (see, e.g., reference 17).
- the components of the fusion proteins are at least 80%, e.g., at least 85%, 90%, 95%, 97%, or 99% identical to the amino acid sequence of a exemplary sequence (e.g., as provided herein), e.g., have differences at up to 1%, 2%, 5%, 10%, 15%, or 20% of the residues of the exemplary sequence replaced, e.g., with conservative mutations, e.g., including or in addition to the mutations described herein.
- the variant retains desired activity of the parent, e.g., nickase activity, and/or the ability to interact with a guide RNA and/or target DNA, optionally with improved specificity or altered substrate specificity.
- the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
- the length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%.
- the nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
- nucleic acid“identity” is equivalent to nucleic acid“homology”.
- the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. Percent identity between two
- polypeptides or nucleic acid sequences is determined in various ways that are within the skill in the art, for instance, using publicly available computer software such as Smith Waterman Alignment (Smith, T. F. and M. S. Waterman (1981) J Mol Biol 147:195-7);“BestFit” (Smith and Waterman, Advances in Applied Mathematics, 482- 489 (1981)) as incorporated into GeneMatcher Plus TM , Schwarz and Dayhof (1979) Atlas of Protein Sequence and Structure, Dayhof, M.O., Ed, pp 353-358; BLAST program (Basic Local Alignment Search Tool; (Altschul, S. F., W. Gish, et al.
- the length of comparison can be any length, up to and including full length (e.g., 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100%). For purposes of the present compositions and methods, at least 80% of the full length of the sequence is aligned.
- the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
- Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
- isolated nucleic acids encoding the split deaminase fusion proteins
- vectors comprising the isolated nucleic acids, optionally operably linked to one or more regulatory domains for expressing the variant proteins
- host cells e.g., mammalian host cells, comprising the nucleic acids, and optionally expressing the variant proteins.
- the host cells are stem cells, e.g., hematopoietic stem cells.
- the fusion proteins include a linker between the DNA binding domain (e.g., ZFN, TALE, or nCas9) and the BE domains.
- Linkers that can be used in these fusion proteins (or between fusion proteins in a concatenated structure) can include any sequence that does not interfere with the function of the fusion proteins.
- the linkers are short, e.g., 2-20 amino acids, and are typically flexible (i.e., comprising amino acids with a high degree of freedom such as glycine, alanine, and serine).
- the linker comprises one or more units consisting of GGGS (SEQ ID NO:5) or GGGGS (SEQ ID NO:6), e.g., two, three, four, or more repeats of the GGGS (SEQ ID NO:5) or GGGGS (SEQ ID NO:6) unit.
- Other linker sequences can also be used.
- the split deaminase fusion protein includes a cell- penetrating peptide sequence that facilitates delivery to the intracellular space, e.g., HIV-derived TAT peptide, penetratins, transportans, or hCT derived cell-penetrating peptides, see, e.g., Caron et al., (2001) Mol Ther.3(3):310-8; Langel, Cell-Penetrating Peptides: Processes and Applications (CRC Press, Boca Raton FL 2002); El- Andaloussi et al., (2005) Curr Pharm Des.11(28):3597-611; and Deshayes et al., (2005) Cell Mol Life Sci.62(16):1839-49.
- a cell- penetrating peptide sequence that facilitates delivery to the intracellular space
- HIV-derived TAT peptide e.g., HIV-derived TAT peptide, penetratins, transportans, or hCT
- CPPs Cell penetrating peptides
- cytoplasm or other organelles e.g. the mitochondria and the nucleus.
- molecules that can be delivered by CPPs include therapeutic drugs, plasmid DNA, oligonucleotides, siRNA, peptide-nucleic acid (PNA), proteins, peptides,
- CPPs are generally 30 amino acids or less, are derived from naturally or non-naturally occurring protein or chimeric sequences, and contain either a high relative abundance of positively charged amino acids, e.g. lysine or arginine, or an alternating pattern of polar and non-polar amino acids.
- CPPs that are commonly used in the art include Tat (Frankel et al., (1988) Cell.55:1189-1193, Vives et al., (1997) J. Biol. Chem.272:16010-16017), penetratin (Derossi et al., (1994) J. Biol.
- CPPs can be linked with their cargo through covalent or non-covalent strategies.
- Methods for covalently joining a CPP and its cargo are known in the art, e.g. chemical cross-linking (Stetsenko et al., (2000) J. Org. Chem.65:4900-4909, Gait et al. (2003) Cell. Mol. Life. Sci.60:844-853) or cloning a fusion protein (Nagahara et al., (1998) Nat. Med.4:1449-1453).
- Non-covalent coupling between the cargo and short amphipathic CPPs comprising polar and non-polar domains is established through electrostatic and hydrophobic interactions.
- biomolecules into cells examples include cyclosporine linked to polyarginine for immunosuppression (Rothbard et al., (2000) Nature Medicine 6(11):1253-1257), siRNA against cyclin B1 linked to a CPP called MPG for inhibiting tumorigenesis (Crombez et al., (2007) Biochem Soc. Trans.35:44-46), tumor suppressor p53 peptides linked to CPPs to reduce cancer cell growth (Takenobu et al., (2002) Mol.
- CPPs have been utilized in the art to transport contrast agents into cells for imaging and biosensing applications.
- green fluorescent protein (GFP) attached to Tat has been used to label cancer cells (Shokolenko et al., (2005) DNA Repair 4(4):511-518).
- Tat conjugated to quantum dots have been used to successfully cross the blood-brain barrier for visualization of the rat brain (Santra et al., (2005) Chem. Commun.3144-3146).
- CPPs have also been combined with magnetic resonance imaging techniques for cell imaging (Liu et al., (2006) Biochem. and Biophys. Res. Comm.347(1):133-140). See also Ramsey and Flynn, Pharmacol Ther. 2015 Jul 22. pii: S0163-7258(15)00141-2.
- the split deaminase fusion proteins can include a nuclear localization sequence, e.g., SV40 large T antigen NLS (PKKKRRV (SEQ ID NO:7)) and nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO:8)).
- PKKKRRV SEQ ID NO:7
- KRPAATKKAGQAKKKK SEQ ID NO:8
- Other NLSs are known in the art; see, e.g., Cokol et al., EMBO Rep.2000 Nov 15; 1(5): 411–415; Freitas and Cunha, Curr Genomics.2009 Dec; 10(8): 550–557.
- the split deaminase fusion proteins include a moiety that has a high affinity for a ligand, for example GST, FLAG or hexahistidine sequences.
- affinity tags can facilitate the purification of recombinant split deaminase fusion proteins.
- the split deaminase fusion proteins described herein can be used for altering the genome of a cell.
- the methods generally include expressing or contacting the split deaminase fusion proteins in the cells; in versions using one or two Cas9s, the methods include using a guide RNA having a region complementary to a selected portion of the genome of the cell.
- Methods for selectively altering the genome of a cell are known in the art, see, e.g., US 8,993,233; US 20140186958; US 9,023,649; WO/2014/099744; WO 2014/089290; WO2014/144592; WO144288;
- CRISPRs Clustered Regularly Interspaced Short Palindromic Repeats
- the proteins can be produced using any method known in the art, e.g., by in vitro translation, or expression in a suitable host cell from nucleic acid encoding the split deaminase fusion protein; a number of methods are known in the art for producing proteins.
- the proteins can be produced in and purified from yeast, E. coli, insect cell lines, plants, transgenic animals, or cultured mammalian cells; see, e.g., Palomares et al.,“Production of Recombinant Proteins: Challenges and
- split deaminase fusion proteins can be linked to a moiety that facilitates transfer into a cell, e.g., a lipid nanoparticle, optionally with a linker that is cleaved once the protein is inside the cell. See, e.g., LaFountaine et al., Int J Pharm.2015 Aug 13;494(1):180-194.
- the nucleic acid encoding the split deaminase fusion can be cloned into an intermediate vector for transformation into prokaryotic or eukaryotic cells for replication and/or expression.
- Intermediate vectors are typically prokaryote vectors, e.g., plasmids, or shuttle vectors, or insect vectors, for storage or manipulation of the nucleic acid encoding the split deaminase fusion for production of the split deaminase fusion protein.
- the nucleic acid encoding the split deaminase fusion protein can also be cloned into an expression vector, for
- a plant cell preferably a mammalian cell or a human cell, fungal cell, bacterial cell, or protozoan cell.
- a sequence encoding a split deaminase fusion protein is typically subcloned into an expression vector that contains a promoter to direct transcription.
- Suitable bacterial and eukaryotic promoters are well known in the art and described, e.g., in Sambrook et al., Molecular Cloning, A Laboratory Manual (3d ed.2001); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et al., eds., 2010).
- Bacterial expression systems for expressing the engineered protein are available in, e.g., E.
- Kits for such expression systems are commercially available.
- Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available.
- the promoter used to direct expression of a nucleic acid depends on the particular application. For example, a strong constitutive promoter is typically used for expression and purification of fusion proteins. In contrast, when the split deaminase fusion protein is to be administered in vivo for gene regulation, either a constitutive or an inducible promoter can be used, depending on the particular use of the split deaminase fusion protein. In addition, a preferred promoter for
- administration of the split deaminase fusion protein can be a weak promoter, such as HSV TK or a promoter having similar activity.
- the promoter can also include elements that are responsive to transactivation, e.g., hypoxia response elements, Gal4 response elements, lac repressor response element, and small molecule control systems such as tetracycline-regulated systems and the RU-486 system (see, e.g., Gossen & Bujard, 1992, Proc. Natl. Acad. Sci.
- the expression vector typically contains a transcription unit or expression cassette that contains all the additional elements required for the expression of the nucleic acid in host cells, either prokaryotic or eukaryotic.
- a typical expression cassette thus contains a promoter operably linked, e.g., to the nucleic acid sequence encoding the split deaminase fusion protein, and any signals required, e.g., for efficient polyadenylation of the transcript, transcriptional termination, ribosome binding sites, or translation termination.
- Additional elements of the cassette may include, e.g., enhancers, and heterologous spliced intronic signals.
- the particular expression vector used to transport the genetic information into the cell is selected with regard to the intended use of the split deaminase fusion protein, e.g., expression in plants, animals, bacteria, fungus, protozoa, etc.
- Standard bacterial expression vectors include plasmids such as pBR322 based plasmids, pSKF, pET23D, and commercially available tag-fusion expression systems such as GST and LacZ.
- Expression vectors containing regulatory elements from eukaryotic viruses are often used in eukaryotic expression vectors, e.g., SV40 vectors, papilloma virus vectors, and vectors derived from Epstein-Barr virus.
- eukaryotic vectors include pMSG, pAV009/A+, pMTO10/A+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV40 early promoter, SV40 late promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
- the vectors for expressing the split deaminase fusion protein can include RNA Pol III promoters to drive expression of the guide RNAs, e.g., the H1, U6 or 7SK promoters. These human promoters allow for expression of split deaminase fusion protein in mammalian cells following plasmid transfection.
- Some expression systems have markers for selection of stably transfected cell lines such as thymidine kinase, hygromycin B phosphotransferase, and dihydrofolate reductase.
- High yield expression systems are also suitable, such as using a baculovirus vector in insect cells, with the gRNA encoding sequence under the direction of the polyhedrin promoter or other strong baculovirus promoters.
- the elements that are typically included in expression vectors also include a replicon that functions in E. coli, a gene encoding antibiotic resistance to permit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of recombinant sequences.
- Standard transfection methods are used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of protein, which are then purified using standard techniques (see, e.g., Colley et al., 1989, J. Biol. Chem., 264:17619-22; Guide to Protein Purification, in Methods in Enzymology, vol.182 (Deutscher, ed., 1990)). Transformation of eukaryotic and prokaryotic cells are performed according to standard techniques (see, e.g., Morrison, 1977, J. Bacteriol. 132:349-351; Clark-Curtiss & Curtiss, Methods in Enzymology 101:347-362 (Wu et al., eds, 1983).
- Any of the known procedures for introducing foreign nucleotide sequences into host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, nucleofection, liposomes,
- the methods also include delivering a gRNA that interacts with the Cas9.
- the methods can include delivering the split deaminase fusion protein and guide RNA together, e.g., as a complex.
- the split deaminase fusion protein and gRNA can be can be overexpressed in a host cell and purified, then complexed with the guide RNA (e.g., in a test tube) to form a ribonucleoprotein (RNP), and delivered to cells.
- the split deaminase fusion protein can be expressed in and purified from bacteria through the use of bacterial expression plasmids.
- His-tagged split deaminase fusion protein can be expressed in bacterial cells and then purified using nickel affinity chromatography.
- RNPs circumvents the necessity of delivering plasmid DNAs encoding the nuclease or the guide, or encoding the nuclease as an mRNA. RNP delivery may also improve specificity, presumably because the half-life of the RNP is shorter and there’s no persistent expression of the nuclease and guide (as you’d get from a plasmid).
- the RNPs can be delivered to the cells in vivo or in vitro, e.g., using lipid-mediated transfection or electroporation. See, e.g., Liang et al.
- the present invention also includes the vectors and cells comprising the vectors, as well as kits comprising the proteins and nucleic acids described herein, e.g., for use in a method described herein.
- sDA1-containing expression plasmids were constructed by selectively amplifying desired regions of the rAPO1, hA3A, or BE3 genes, as well as DNA sequences encoding a 3AC3L-NLS or NLS only linker and desired EGFP-targeting ZFs, by the PCR method such that they had significant overlapping ends and using isothermal assembly (or“Gibson Assembly,” NEB) to assemble them in the desired order in a pCAG expression vector.
- sDA2-containing expression plasmids were constructed by truncating a BE3 gene by PCR and using Gibson assembly to put the resulting pieces into a pCAG expression plasmid. PCR was conducted using Q5 or Phusion polymerases (NEB).
- a HEK293 cell line in which an integrated EGFP reporter gene has been integrated was grown in culture using media consisting of Advanced Dulbeccos Modified Medium (Gibco) supplemented with 10% heat inactivated fetal bovine serum (Gibco), 1% 10,000 U/ml penicillin-streptomycin solution (Gibco), and 1% Glutamax (Gibco). Cells were passaged every 3-4 days to maintain an actively growing population and avoid anoxic conditions.
- Transfections containing 1.0 microgram of transfection quality DNA were conducted by seeding 1.5x10 5 cells in 24-well TC-treated plates (Corning) and using TransIT- 293 reagent according to manufacturer’s protocol (Mirus Bio).
- 400 nanograms contained the sDA1-encoding plasmid
- 400 nanograms contained the sDA2-encoding plasmid
- 200 nanograms contained an expression plasmid encoding the SpCas9 gRNA targeting the EGFP reporter gene.
- 400 nanograms contained BE-expressing plasmid
- 400 nanograms contained a pMax-GFP-encoding plasmid (Lonza)
- 200 nanograms contained an expression plasmid encoding the SpCas9 gRNA targeting the EGFP reporter gene.
- 400 nanograms contained the sDA-encoding plasmid
- 400 nanograms contained a pMax- GFP-encoding plasmid (Lonza)
- 200 nanograms contained an expression plasmid encoding the SpCas9 gRNA targeting the EGFP reporter gene.
- Genomic DNA was harvested 3 days post-transfection using the DNAdvance kit (Agencourt). High-throughput amplicon sequencing
- Rates of base editing at target loci were determined by deep-sequencing of PCR amplicons amplified off of genomic DNA isolated from transfected cells.
- Target site genomic DNA was amplified using EGFP-specific DNA primers flanking the sDA2 nCas9 binding sites.
- Illumina TruSeq adapters were added to the ends of the amplicons either by PCR or NEBNext Ultra II kit (NEB) and molecularly indexed with NEBNext Dual Index Primers (NEB). Samples were combined into libraries and sequenced on the Illumina MiSeq machine using the MiSeq Reagent Micro Kit v2 (Illumina). Sequencing results were analyzed using a batch version of the software CRISPResso (crispresso.rocks).
- “X” indicates an undetermined amino acid residue, indicating the variable regions of a ZF that are responsible for specific DNA binding.
- sDA1 halfases that contain a truncation variant from split region X are referred to as sDA1.X, and sDA2 halfases are similarly named. Tables 4-6 show the exact truncation variants that we have created and evaluated. In addition to exactly reciprocal halfase pairs (in which the sDA1 and sDA2 portions of the BE contain truncation variants of a deaminase perfectly bisected by a defined split site), we also tested split BEs in which the halfases shared overlapping peptide sequences.
- hA3A split BEs include an sDA1 with an sDA1-NLS-ZF configuration.
- rAPO1 sDA1.1 + rAPO1 sDA2.1, rAPO1 sDA1.2 + rAPO1 sDA2.1, rAPO1 sDA1.2 + rAPO1 sDA2.2, hA3A sDA1.1 + sDA2.1, and hA3A 1.6 + hA3A 2.6 show significant activity compared to a positive BE3 control ( Figures 4, 6, 7, 20, and 21).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Mycology (AREA)
- Developmental Biology & Embryology (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA3063449A CA3063449A1 (en) | 2017-05-25 | 2018-05-25 | Using split deaminases to limit unwanted off-target base editor deamination |
| EP18805050.4A EP3630198A4 (en) | 2017-05-25 | 2018-05-25 | USE OF SPLIT DEAMINASES TO LIMIT UNWANTED DIFFERENT BASE EDITOR DEAMINATIONS |
| CN201880045766.8A CN111093714A (en) | 2017-05-25 | 2018-05-25 | Deamination using a split deaminase to restrict unwanted off-target base editors |
| AU2018273968A AU2018273968A1 (en) | 2017-05-25 | 2018-05-25 | Using split deaminases to limit unwanted off-target base editor deamination |
| US16/615,538 US20200172895A1 (en) | 2017-05-25 | 2018-05-25 | Using split deaminases to limit unwanted off-target base editor deamination |
| JP2019564864A JP2020521451A (en) | 2017-05-25 | 2018-05-25 | Use of split deaminase to limit unwanted off-target base editor deamination |
| JP2023111873A JP2023126956A (en) | 2017-05-25 | 2023-07-07 | Use of split deaminase to limit unwanted off-target base editor deamination |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762511296P | 2017-05-25 | 2017-05-25 | |
| US62/511,296 | 2017-05-25 | ||
| US201762541544P | 2017-08-04 | 2017-08-04 | |
| US62/541,544 | 2017-08-04 | ||
| US201862622676P | 2018-01-26 | 2018-01-26 | |
| US62/622,676 | 2018-01-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018218166A1 true WO2018218166A1 (en) | 2018-11-29 |
Family
ID=64397083
Family Applications (3)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/034742 Ceased WO2018218206A1 (en) | 2017-05-25 | 2018-05-25 | Bipartite base editor (bbe) architectures and type-ii-c-cas9 zinc finger editing |
| PCT/US2018/034719 Ceased WO2018218188A2 (en) | 2017-05-25 | 2018-05-25 | Base editors with improved precision and specificity |
| PCT/US2018/034687 Ceased WO2018218166A1 (en) | 2017-05-25 | 2018-05-25 | Using split deaminases to limit unwanted off-target base editor deamination |
Family Applications Before (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2018/034742 Ceased WO2018218206A1 (en) | 2017-05-25 | 2018-05-25 | Bipartite base editor (bbe) architectures and type-ii-c-cas9 zinc finger editing |
| PCT/US2018/034719 Ceased WO2018218188A2 (en) | 2017-05-25 | 2018-05-25 | Base editors with improved precision and specificity |
Country Status (7)
| Country | Link |
|---|---|
| US (4) | US20200172895A1 (en) |
| EP (3) | EP3630849A4 (en) |
| JP (5) | JP2020521451A (en) |
| CN (3) | CN110959040B (en) |
| AU (4) | AU2018273968A1 (en) |
| CA (3) | CA3063733A1 (en) |
| WO (3) | WO2018218206A1 (en) |
Cited By (58)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| CN110564752A (en) * | 2019-09-30 | 2019-12-13 | 北京市农林科学院 | Application of differential agent technology in enrichment of C.T base substitution cells |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| WO2020191242A1 (en) * | 2019-03-19 | 2020-09-24 | The Broad Institute, Inc. | Methods and compositions for editing nucleotide sequences |
| CN112048497A (en) * | 2019-06-06 | 2020-12-08 | 中国科学院脑科学与智能技术卓越创新中心 | Novel single base editing technology and application thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| CN112725348A (en) * | 2019-10-28 | 2021-04-30 | 安徽省农业科学院水稻研究所 | Gene and method for improving single-base editing efficiency of rice and application of gene |
| US11028429B2 (en) | 2015-09-11 | 2021-06-08 | The General Hospital Corporation | Full interrogation of nuclease DSBs and sequencing (FIND-seq) |
| WO2021113611A1 (en) * | 2019-12-06 | 2021-06-10 | The General Hospital Corporation | Split deaminase base editors |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| JP2021536229A (en) * | 2018-08-23 | 2021-12-27 | サンガモ セラピューティクス, インコーポレイテッド | Manipulated target-specific base editor |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| WO2022008466A1 (en) | 2020-07-06 | 2022-01-13 | Wageningen Universiteit | Base editing tools |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| WO2022050377A1 (en) | 2020-09-04 | 2022-03-10 | 国立大学法人広島大学 | Method for editing target dna, method for producing cell having edited target dna, and dna edition system for use in said methods |
| US11286468B2 (en) | 2017-08-23 | 2022-03-29 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases with altered PAM specificity |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| KR20220053097A (en) * | 2020-10-21 | 2022-04-29 | 성균관대학교산학협력단 | Vector expressing cytosine base editor without off-target effect without reduction of on-target efficiency in industrial strains and uses thereof |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| JP2022526695A (en) * | 2019-02-02 | 2022-05-26 | シャンハイテック ユニバーシティ | Inhibition of unintentional mutations in gene editing |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| WO2023122722A1 (en) * | 2021-12-22 | 2023-06-29 | Sangamo Therapeutics, Inc. | Novel zinc finger fusion proteins for nucleobase editing |
| EP4031190A4 (en) * | 2019-09-17 | 2023-08-09 | Rutgers, the State University of New Jersey | Highly efficient dna base editors mediated by rna-aptamer recruitment for targeted genome modification and uses thereof |
| US11725228B2 (en) | 2017-10-11 | 2023-08-15 | The General Hospital Corporation | Methods for detecting site-specific and spurious genomic deamination induced by base editing technologies |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11845987B2 (en) | 2018-04-17 | 2023-12-19 | The General Hospital Corporation | Highly sensitive in vitro assays to define substrate preferences and sites of nucleic acid cleaving agents |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| EP4093879A4 (en) * | 2020-01-25 | 2024-02-28 | The Trustees of the University of Pennsylvania | Compositions for small molecule control of precise base editing of target nucleic acids and methods of use thereof |
| EP4103705A4 (en) * | 2020-02-14 | 2024-02-28 | Ohio State Innovation Foundation | NUCLEOBASE EDITORS AND METHODS OF USE THEREOF |
| US11946040B2 (en) | 2019-02-04 | 2024-04-02 | The General Hospital Corporation | Adenine DNA base editor variants with reduced off-target RNA editing |
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US12031129B2 (en) | 2018-08-28 | 2024-07-09 | Flagship Pioneering Innovations Vi, Llc | Methods and compositions for modulating a genome |
| US12037602B2 (en) | 2020-03-04 | 2024-07-16 | Flagship Pioneering Innovations Vi, Llc | Methods and compositions for modulating a genome |
| US12065666B2 (en) | 2017-01-05 | 2024-08-20 | Rutgers, The State University Of New Jersey | Targeted gene editing platform independent of DNA double strand break and uses thereof |
| US12104207B2 (en) | 2014-06-23 | 2024-10-01 | The General Hospital Corporation | Genomewide unbiased identification of DSBs evaluated by sequencing (GUIDE-Seq) |
| WO2024226156A1 (en) * | 2023-04-27 | 2024-10-31 | University Of Massachusetts | Cas-embedded cytidine deaminase ribonucleoprotein complexes having improved base editing specificity and efficiency |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12188043B2 (en) | 2015-07-15 | 2025-01-07 | Rutgers, The State University Of New Jersey | Nuclease-independent targeted gene editing platform and uses thereof |
| US20250011748A1 (en) * | 2020-01-28 | 2025-01-09 | The Broad Institute, Inc. | Base editors, compositions, and methods for modifying the mitochondrial genome |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12319938B2 (en) | 2020-07-24 | 2025-06-03 | The General Hospital Corporation | Enhanced virus-like particles and methods of use thereof for delivery to cells |
| US12351814B2 (en) | 2019-06-13 | 2025-07-08 | The General Hospital Corporation | Engineered human-endogenous virus-like particles and methods of use thereof for delivery to cells |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
Families Citing this family (36)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3630849A4 (en) | 2017-05-25 | 2021-01-13 | The General Hospital Corporation | ARCHITECTURES OF TWO-PART BASE EDITOR (BBE) AND TYPE II-C-CAS9-ZINKFINGER-EDITING |
| US11884947B2 (en) * | 2018-02-23 | 2024-01-30 | Shanghaitech University | Fusion proteins for base editing |
| AU2019265019B2 (en) | 2018-05-11 | 2025-11-06 | Beam Therapeutics Inc. | Methods of substituting pathogenic amino acids using programmable base editor systems |
| WO2020051562A2 (en) | 2018-09-07 | 2020-03-12 | Beam Therapeutics Inc. | Compositions and methods for improving base editing |
| EP3847254A4 (en) | 2018-09-07 | 2022-08-10 | Beam Therapeutics Inc. | Compositions and methods for delivering a nucleobase editing system |
| WO2020160517A1 (en) * | 2019-01-31 | 2020-08-06 | Beam Therapeutics Inc. | Nucleobase editors having reduced off-target deamination and methods of using same to modify a nucleobase target sequence |
| AU2020215730A1 (en) | 2019-01-31 | 2021-07-29 | Beam Therapeutics Inc. | Nucleobase editors having reduced non-target deamination and assays for characterizing nucleobase editors |
| CN120174005A (en) | 2019-02-13 | 2025-06-20 | 比姆医疗股份有限公司 | Modified immune cells with adenosine deaminase base editors for modifying nucleobases in target sequences |
| CN110804628B (en) * | 2019-02-28 | 2023-05-12 | 中国科学院脑科学与智能技术卓越创新中心 | High-specificity off-target-free single-base gene editing tool |
| WO2021030344A1 (en) * | 2019-08-12 | 2021-02-18 | Lifeedit, Inc. | Rna-guided nucleases and active fragments and variants thereof and methods of use |
| WO2021046155A1 (en) | 2019-09-03 | 2021-03-11 | Voyager Therapeutics, Inc. | Vectorized editing of nucleic acids to correct overt mutations |
| EP4034138A4 (en) | 2019-09-27 | 2024-07-31 | Beam Therapeutics, Inc. | COMPOSITIONS AND METHODS FOR TREATING BLOOD CANCER |
| WO2021155166A1 (en) * | 2020-01-31 | 2021-08-05 | University Of Massachusetts | A cas9-pdbd base editor platform with improved targeting range and specificity |
| WO2021163587A1 (en) * | 2020-02-13 | 2021-08-19 | Beam Therapeutics Inc. | Compositions and methods for engraftment of base edited cells |
| BR112022017704A2 (en) * | 2020-03-04 | 2022-11-01 | Suzhou Qi Biodesign Biotechnology Company Ltd | MULTIPLEX GENOME EDITING METHOD AND SYSTEM |
| JP2023517890A (en) * | 2020-03-04 | 2023-04-27 | スージョウ チー バイオデザイン バイオテクノロジー カンパニー リミテッド | Improved cytosine base editing system |
| CN116134141A (en) * | 2020-09-04 | 2023-05-16 | 国立大学法人神户大学 | Complex for double-stranded DNA modification comprising miniaturized cytidine deaminase |
| CN116261594A (en) * | 2020-09-25 | 2023-06-13 | 桑格摩生物治疗股份有限公司 | Zinc finger fusion proteins for nucleobase editing |
| CA3196831A1 (en) | 2020-09-25 | 2022-03-31 | Beam Therapeutics Inc. | Fratricide resistant modified immune cells and methods of using the same |
| US12123006B2 (en) * | 2021-05-18 | 2024-10-22 | Shanghaitech University | Base editing tool and use thereof |
| US20240327859A1 (en) * | 2021-07-02 | 2024-10-03 | University Of Maryland, College Park | Cytidine deaminases and methods of genome editing using the same |
| CN113774085B (en) * | 2021-08-20 | 2023-08-15 | 中国科学院广州生物医药与健康研究院 | Single base editing tool TaC9-ABE and application thereof |
| WO2023050169A1 (en) * | 2021-09-29 | 2023-04-06 | 深圳先进技术研究院 | Method for achieving tag-to-taa conversion on genome with high throughput |
| CN116355885A (en) * | 2021-12-28 | 2023-06-30 | 复旦大学 | Deaminase mutants and base editors based on deaminase mutants |
| CN119013310A (en) * | 2022-02-17 | 2024-11-22 | 正序(上海)生物科技有限公司 | Mutant cytosine deaminase with improved editing accuracy |
| JP2023131616A (en) * | 2022-03-09 | 2023-09-22 | 国立大学法人広島大学 | DNA editing system, method for editing target DNA using the same, and method for producing cells with edited target DNA |
| CN114774399B (en) * | 2022-03-25 | 2024-01-30 | 武汉大学 | Method for artificially modifying single-base resolution positioning analysis of 5-hydroxymethylcytosine modification in deaminase-assisted DNA |
| CN114686456B (en) * | 2022-05-10 | 2023-02-17 | 中山大学 | Base editing system based on bimolecular deaminase complementation and application thereof |
| US20250304940A1 (en) * | 2022-05-13 | 2025-10-02 | Huidagene Therapeutics (Singapore) Pte. Ltd. | Programmable adenine base editor and uses thereof |
| CN117384885B (en) | 2022-12-15 | 2025-06-10 | 中国科学院遗传与发育生物学研究所 | Base editor and application thereof |
| JP2026501648A (en) * | 2022-12-30 | 2026-01-16 | 北京大学 | Base editor systems and methods of use thereof |
| CN117659210A (en) * | 2023-11-30 | 2024-03-08 | 华南农业大学 | A recombinant fusion protein used as a plant double base editor and its application |
| WO2025213929A1 (en) * | 2024-04-11 | 2025-10-16 | 上海交通大学医学院附属松江医院 | Engineered cytosine deaminase, preparation method therefor and use thereof |
| CN119912582B (en) * | 2024-06-17 | 2025-11-04 | 中国农业大学 | Single base editor, deaminase used by same and application of deaminase |
| CN119431603B (en) * | 2024-10-09 | 2026-02-17 | 中山大学 | A fusion protein and its applications |
| CN119505015B (en) * | 2024-11-15 | 2025-10-17 | 北京大学 | Fusion protein and application method thereof |
Citations (78)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6007988A (en) | 1994-08-20 | 1999-12-28 | Medical Research Council | Binding proteins for recognition of DNA |
| US6294330B1 (en) * | 1997-01-31 | 2001-09-25 | Odyssey Pharmaceuticals Inc. | Protein fragment complementation assays for the detection of biological or drug interactions |
| US20020160940A1 (en) | 1999-01-12 | 2002-10-31 | Case Casey C. | Modulation of endogenous gene expression in cells |
| US6503717B2 (en) | 1999-12-06 | 2003-01-07 | Sangamo Biosciences, Inc. | Methods of using randomized libraries of zinc finger proteins for the identification of gene function |
| US6511808B2 (en) | 2000-04-28 | 2003-01-28 | Sangamo Biosciences, Inc. | Methods for designing exogenous regulatory molecules |
| WO2004099366A2 (en) | 2002-10-23 | 2004-11-18 | The General Hospital Corporation | Context sensitive parallel optimization of zinc finger dna binding domains |
| WO2008108989A2 (en) | 2007-03-02 | 2008-09-12 | Danisco A/S | Cultures with improved phage resistance |
| US20100076057A1 (en) | 2008-09-23 | 2010-03-25 | Northwestern University | TARGET DNA INTERFERENCE WITH crRNA |
| WO2010054108A2 (en) | 2008-11-06 | 2010-05-14 | University Of Georgia Research Foundation, Inc. | Cas6 polypeptides and methods of use |
| WO2011017293A2 (en) | 2009-08-03 | 2011-02-10 | The General Hospital Corporation | Engineering of zinc finger arrays by context-dependent assembly |
| US20110104787A1 (en) * | 2009-11-05 | 2011-05-05 | President And Fellows Of Harvard College | Fusion Peptides That Bind to and Modify Target Nucleic Acid Sequences |
| US20110189776A1 (en) | 2008-07-25 | 2011-08-04 | University Of Georgia Research Foundation, Inc. | PROKARYOTIC RNAi-LIKE SYSTEM AND METHODS OF USE |
| US20110223638A1 (en) | 2010-03-10 | 2011-09-15 | Blake Wiedenheft | Methods of Generating Nucleic Acid Fragments |
| US20110236530A1 (en) | 2008-12-12 | 2011-09-29 | Danisco A/S | Genetic Cluster of Strains of Streptococcus Thermophilus Having Unique Rheological Properties for Dairy Fermentation |
| US20110300538A1 (en) | 2008-11-07 | 2011-12-08 | Danisco A/S | Bifidobacteria crispr sequences |
| US20120088676A1 (en) | 2007-12-28 | 2012-04-12 | Institut Pasteur | Molecular typing and subtyping of salmonella by identification of the variable nucleotide sequences of the crispr loci |
| WO2012164565A1 (en) | 2011-06-01 | 2012-12-06 | Yeda Research And Development Co. Ltd. | Compositions and methods for downregulating prokaryotic genes |
| US20130130248A1 (en) | 2010-05-10 | 2013-05-23 | The Regents Of The University Of California | Endoribonuclease compositions and methods of use thereof |
| WO2013098244A1 (en) | 2011-12-30 | 2013-07-04 | Wageningen Universiteit | Modified cascade ribonucleoproteins and uses thereof |
| US20130288251A1 (en) | 2010-10-20 | 2013-10-31 | Dupont Nutrition Biosciences Aps | Lactococcus crispr-cas sequences |
| WO2013176772A1 (en) | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US20130330778A1 (en) | 2012-06-11 | 2013-12-12 | Agilent Technologies, Inc. | Method of adaptor-dimer subtraction using a crispr cas6 protein |
| WO2014004288A1 (en) | 2012-06-27 | 2014-01-03 | J2 Global, Inc. | Facilitating network login |
| US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
| WO2014089290A1 (en) | 2012-12-06 | 2014-06-12 | Sigma-Aldrich Co. Llc | Crispr-based genome modification and regulation |
| WO2014099744A1 (en) | 2012-12-17 | 2014-06-26 | President And Fellows Of Harvard College | Rna-guided human genome engineering |
| US20140179006A1 (en) | 2012-12-12 | 2014-06-26 | Massachusetts Institute Of Technology | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US20140179770A1 (en) | 2012-12-12 | 2014-06-26 | Massachusetts Institute Of Technology | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| US20140186958A1 (en) | 2012-12-12 | 2014-07-03 | Feng Zhang | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| US20140186919A1 (en) | 2012-12-12 | 2014-07-03 | Feng Zhang | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation |
| US20140186843A1 (en) | 2012-12-12 | 2014-07-03 | Massachusetts Institute Of Technology | Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| US20140201857A1 (en) | 2013-01-14 | 2014-07-17 | Recombinetics, Inc. | Hornless livestock |
| US20140199767A1 (en) | 2005-08-26 | 2014-07-17 | Dupont Nutrition Biosciences Aps | Use |
| US20140212869A1 (en) | 2013-01-25 | 2014-07-31 | Agilent Technologies, Inc. | Nucleic Acid Proximity Assay Involving the Formation of a Three-way junction |
| US20140234972A1 (en) | 2012-12-12 | 2014-08-21 | Massachusetts Institute Of Technology | CRISPR-CAS Nickase Systems, Methods And Compositions For Sequence Manipulation in Eukaryotes |
| US20140242664A1 (en) | 2012-12-12 | 2014-08-28 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| US20140242702A1 (en) | 2013-02-25 | 2014-08-28 | Sigma Aldrich Co. Llc | Methods and compositions for enhancing nuclease-mediated gene disruption |
| US20140273230A1 (en) | 2013-03-15 | 2014-09-18 | Sigma-Aldrich Co., Llc | Crispr-based genome modification and regulation |
| WO2014144592A2 (en) | 2013-03-15 | 2014-09-18 | The General Hospital Corporation | Using truncated guide rnas (tru-grnas) to increase specificity for rna-guided genome editing |
| US20140273235A1 (en) | 2013-03-15 | 2014-09-18 | Regents Of The University Of Minnesota | ENGINEERING PLANT GENOMES USING CRISPR/Cas SYSTEMS |
| US20140273226A1 (en) | 2013-03-15 | 2014-09-18 | System Biosciences, Llc | Crispr/cas systems for genomic modification and gene modulation |
| US20140287938A1 (en) | 2013-03-15 | 2014-09-25 | The Broad Institute, Inc. | Recombinant virus and preparations thereof |
| US20140298547A1 (en) | 2012-12-13 | 2014-10-02 | Dow Agrosciences Llc | Dna detection methods for site specific nuclease activity |
| US20140304853A1 (en) | 2013-04-05 | 2014-10-09 | Sangamo Biosciences, Inc. | Methods and compositions for integration of an exogenous sequence within the genome of plants |
| US20140310828A1 (en) | 2013-04-16 | 2014-10-16 | Regeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
| US20140315985A1 (en) | 2013-03-14 | 2014-10-23 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US20140335063A1 (en) | 2013-05-10 | 2014-11-13 | Sangamo Biosciences, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering |
| US20140349400A1 (en) | 2013-03-15 | 2014-11-27 | Massachusetts Institute Of Technology | Programmable Modification of DNA |
| US20140357530A1 (en) | 2012-12-12 | 2014-12-04 | The Broad Institute Inc. | Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof |
| US20140356867A1 (en) | 2013-05-29 | 2014-12-04 | Agilent Technologies, Inc. | Nucleic acid enrichment using cas9 |
| WO2014204578A1 (en) | 2013-06-21 | 2014-12-24 | The General Hospital Corporation | Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing |
| CA2915837A1 (en) | 2013-06-17 | 2014-12-24 | The Broad Institute, Inc. | Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation |
| US20140377868A1 (en) | 2013-03-15 | 2014-12-25 | The General Hospital Corporation | Rna-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US20150024500A1 (en) | 2013-07-19 | 2015-01-22 | Larix Bioscience, Llc | Methods and compositions for producing double allele knock outs |
| US20150044772A1 (en) | 2013-08-09 | 2015-02-12 | Sage Labs, Inc. | Crispr/cas system-based novel fusion protein and its applications in genome editing |
| US20150045546A1 (en) | 2012-03-20 | 2015-02-12 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| US20150056629A1 (en) | 2013-04-14 | 2015-02-26 | Katriona Guthrie-Honea | Compositions, systems, and methods for detecting a DNA sequence |
| US20150067922A1 (en) | 2013-05-30 | 2015-03-05 | The Penn State Research Foundation | Gene targeting and genetic modification of plants via rna-guided genome editing |
| US20150071899A1 (en) | 2013-09-06 | 2015-03-12 | President And Fellows Of Harvard College | Cas9-foki fusion proteins and uses thereof |
| US20150159174A1 (en) | 2013-12-11 | 2015-06-11 | Regeneron Pharmaceutical, Inc. | Methods and Compositions for the Targeted Modification of a Genome |
| US20150166969A1 (en) | 2012-02-24 | 2015-06-18 | Fred Hutchinson Cancer Research Center | Compositions and methods for the treatment of hemoglobinopathies |
| US20150176064A1 (en) | 2012-06-14 | 2015-06-25 | Agence Nationale de Securite Sanitaire de I'Alimentation, de I'Environnement et du Travail | Method for Detecting and Identifying Enterohemorrhagic Escherichia coli |
| US20150174169A1 (en) * | 2013-10-17 | 2015-06-25 | Sangamo Biosciences, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering in hematopoietic stem cells |
| WO2015099850A1 (en) | 2013-12-26 | 2015-07-02 | The General Hospital Corporation | Multiplex guide rnas |
| US20150191744A1 (en) | 2013-12-17 | 2015-07-09 | University Of Massachusetts | Cas9 effector-mediated regulation of transcription, differentiation and gene editing/labeling |
| US20150232883A1 (en) | 2013-12-12 | 2015-08-20 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components |
| US20150252358A1 (en) | 2014-03-10 | 2015-09-10 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating leber's congenital amaurosis 10 (lca10) |
| US20150315576A1 (en) | 2012-11-01 | 2015-11-05 | Massachusetts Institute Of Technology | Genetic device for the controlled destruction of dna |
| US20150356239A1 (en) | 2012-12-12 | 2015-12-10 | The Broad Institute Inc. | Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| US20150376652A1 (en) | 2013-02-27 | 2015-12-31 | Helmholtz Zentrum München Deutsches Forschungszentrum Für Gesundheit Und Umwelt | Gene editing in the oocyte by cas9 nucleases |
| US20160017301A1 (en) | 2013-08-29 | 2016-01-21 | Temple University Of The Commonwealth System Of Higher Education | Methods and compositions for rna-guided treatment of hiv infection |
| US20160024510A1 (en) | 2013-02-07 | 2016-01-28 | The Rockefeller University | Sequence specific antimicrobials |
| US20160024529A1 (en) | 2013-03-09 | 2016-01-28 | Agilent Technologies, Inc. | Methods of in vivo engineering of large sequences using multiple crispr/cas selections of recombineering events |
| WO2016028682A1 (en) * | 2014-08-17 | 2016-02-25 | The Broad Institute Inc. | Genome editing using cas9 nickases |
| WO2016112242A1 (en) * | 2015-01-08 | 2016-07-14 | President And Fellows Of Harvard College | Split cas9 proteins |
| WO2016141224A1 (en) | 2015-03-03 | 2016-09-09 | The General Hospital Corporation | Engineered crispr-cas9 nucleases with altered pam specificity |
| WO2017040348A1 (en) | 2015-08-28 | 2017-03-09 | The General Hospital Corporation | Engineered crispr-cas9 nucleases |
| WO2018035387A1 (en) * | 2016-08-17 | 2018-02-22 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
Family Cites Families (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2059122B1 (en) | 2006-08-28 | 2012-06-20 | University of Rochester | Methods and compositions related to apobec-1 expression |
| WO2010132092A2 (en) * | 2009-05-12 | 2010-11-18 | The Scripps Research Institute | Cytidine deaminase fusions and related methods |
| US9526784B2 (en) * | 2013-09-06 | 2016-12-27 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10190106B2 (en) * | 2014-12-22 | 2019-01-29 | Univesity Of Massachusetts | Cas9-DNA targeting unit chimeras |
| EP3237017A4 (en) * | 2014-12-24 | 2018-08-01 | Dana-Farber Cancer Institute, Inc. | Systems and methods for genome modification and regulation |
| US20180291372A1 (en) * | 2015-05-14 | 2018-10-11 | Massachusetts Institute Of Technology | Self-targeting genome editing system |
| JP7044373B2 (en) * | 2015-07-15 | 2022-03-30 | ラトガース,ザ ステート ユニバーシティ オブ ニュージャージー | Nuclease-independent targeted gene editing platform and its uses |
| US9926546B2 (en) | 2015-08-28 | 2018-03-27 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases |
| IL310721B2 (en) * | 2015-10-23 | 2025-11-01 | Harvard College | Nucleobase editors and their uses |
| WO2017173092A1 (en) * | 2016-03-31 | 2017-10-05 | The Regents Of The University Of California | Methods for genome editing in zygotes |
| AU2017257274B2 (en) * | 2016-04-19 | 2023-07-13 | Massachusetts Institute Of Technology | Novel CRISPR enzymes and systems |
| CN110214183A (en) | 2016-08-03 | 2019-09-06 | 哈佛大学的校长及成员们 | Adenosine nucleobase editing machine and application thereof |
| US11542496B2 (en) * | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| KR20240116572A (en) | 2017-03-23 | 2024-07-29 | 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 | Nucleobase editors comprising nucleic acid programmable dna binding proteins |
| US11591589B2 (en) | 2017-04-21 | 2023-02-28 | The General Hospital Corporation | Variants of Cpf1 (Cas12a) with altered PAM specificity |
| EP3630849A4 (en) | 2017-05-25 | 2021-01-13 | The General Hospital Corporation | ARCHITECTURES OF TWO-PART BASE EDITOR (BBE) AND TYPE II-C-CAS9-ZINKFINGER-EDITING |
| CA3073448A1 (en) | 2017-08-23 | 2019-02-28 | The General Hospital Corporation | Engineered crispr-cas9 nucleases with altered pam specificity |
| US20210395730A1 (en) | 2018-10-10 | 2021-12-23 | The General Hospital Corporation | Selective Curbing of Unwanted RNA Editing (SECURE) DNA Base Editor Variants |
| US11946040B2 (en) | 2019-02-04 | 2024-04-02 | The General Hospital Corporation | Adenine DNA base editor variants with reduced off-target RNA editing |
| WO2021042062A2 (en) | 2019-08-30 | 2021-03-04 | Joung J Keith | Combinatorial adenine and cytosine dna base editors |
| US20220411777A1 (en) | 2019-08-30 | 2022-12-29 | The General Hospital Corporation | C-to-G Transversion DNA Base Editors |
| US20230024833A1 (en) | 2019-12-06 | 2023-01-26 | The General Hospital Corporation | Split deaminase base editors |
-
2018
- 2018-05-25 EP EP18806041.2A patent/EP3630849A4/en not_active Withdrawn
- 2018-05-25 US US16/615,538 patent/US20200172895A1/en not_active Abandoned
- 2018-05-25 US US16/615,559 patent/US11326157B2/en active Active
- 2018-05-25 WO PCT/US2018/034742 patent/WO2018218206A1/en not_active Ceased
- 2018-05-25 US US16/616,014 patent/US20200140842A1/en not_active Abandoned
- 2018-05-25 WO PCT/US2018/034719 patent/WO2018218188A2/en not_active Ceased
- 2018-05-25 AU AU2018273968A patent/AU2018273968A1/en not_active Abandoned
- 2018-05-25 CA CA3063733A patent/CA3063733A1/en active Pending
- 2018-05-25 WO PCT/US2018/034687 patent/WO2018218166A1/en not_active Ceased
- 2018-05-25 EP EP18805050.4A patent/EP3630198A4/en not_active Withdrawn
- 2018-05-25 CN CN201880048366.2A patent/CN110959040B/en active Active
- 2018-05-25 AU AU2018272067A patent/AU2018272067B2/en active Active
- 2018-05-25 JP JP2019564864A patent/JP2020521451A/en active Pending
- 2018-05-25 CN CN201880048952.7A patent/CN110997728A/en active Pending
- 2018-05-25 JP JP2019564906A patent/JP7324713B2/en active Active
- 2018-05-25 CA CA3064828A patent/CA3064828A1/en active Pending
- 2018-05-25 JP JP2019564519A patent/JP2020521446A/en active Pending
- 2018-05-25 EP EP18806459.6A patent/EP3630970A4/en active Pending
- 2018-05-25 CN CN201880045766.8A patent/CN111093714A/en active Pending
- 2018-05-25 AU AU2018273986A patent/AU2018273986A1/en not_active Abandoned
- 2018-05-25 CA CA3063449A patent/CA3063449A1/en active Pending
-
2022
- 2022-05-09 US US17/739,418 patent/US20220275356A1/en active Pending
-
2023
- 2023-05-12 JP JP2023079369A patent/JP2023113672A/en active Pending
- 2023-07-07 JP JP2023111873A patent/JP2023126956A/en active Pending
-
2024
- 2024-10-11 AU AU2024227270A patent/AU2024227270A1/en active Pending
Patent Citations (120)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6013453A (en) | 1994-08-20 | 2000-01-11 | Medical Research Council | Binding proteins for recognition of DNA |
| US6007988A (en) | 1994-08-20 | 1999-12-28 | Medical Research Council | Binding proteins for recognition of DNA |
| US6294330B1 (en) * | 1997-01-31 | 2001-09-25 | Odyssey Pharmaceuticals Inc. | Protein fragment complementation assays for the detection of biological or drug interactions |
| US20020160940A1 (en) | 1999-01-12 | 2002-10-31 | Case Casey C. | Modulation of endogenous gene expression in cells |
| US6503717B2 (en) | 1999-12-06 | 2003-01-07 | Sangamo Biosciences, Inc. | Methods of using randomized libraries of zinc finger proteins for the identification of gene function |
| US6511808B2 (en) | 2000-04-28 | 2003-01-28 | Sangamo Biosciences, Inc. | Methods for designing exogenous regulatory molecules |
| WO2004099366A2 (en) | 2002-10-23 | 2004-11-18 | The General Hospital Corporation | Context sensitive parallel optimization of zinc finger dna binding domains |
| US20140199767A1 (en) | 2005-08-26 | 2014-07-17 | Dupont Nutrition Biosciences Aps | Use |
| US20110002889A1 (en) | 2007-03-02 | 2011-01-06 | Rodolphe Barrangou | Cultures with Improved Phage Resistance |
| WO2008108989A2 (en) | 2007-03-02 | 2008-09-12 | Danisco A/S | Cultures with improved phage resistance |
| US20150093473A1 (en) | 2007-03-02 | 2015-04-02 | Dupont Nutrition Biosciences Aps | Cultures with improved phage resistance |
| US20120088676A1 (en) | 2007-12-28 | 2012-04-12 | Institut Pasteur | Molecular typing and subtyping of salmonella by identification of the variable nucleotide sequences of the crispr loci |
| US20140093941A1 (en) | 2008-07-25 | 2014-04-03 | University Of Georgia Research Foundation, Inc. | PROKARYOTIC RNAi-LIKE SYSTEM AND METHODS OF USE |
| US20110189776A1 (en) | 2008-07-25 | 2011-08-04 | University Of Georgia Research Foundation, Inc. | PROKARYOTIC RNAi-LIKE SYSTEM AND METHODS OF USE |
| US20100076057A1 (en) | 2008-09-23 | 2010-03-25 | Northwestern University | TARGET DNA INTERFERENCE WITH crRNA |
| WO2010054108A2 (en) | 2008-11-06 | 2010-05-14 | University Of Georgia Research Foundation, Inc. | Cas6 polypeptides and methods of use |
| US20110217739A1 (en) | 2008-11-06 | 2011-09-08 | University Of Georgia Research Foundation, Inc. | Cas6 polypeptides and methods of use |
| US20110300538A1 (en) | 2008-11-07 | 2011-12-08 | Danisco A/S | Bifidobacteria crispr sequences |
| US20110236530A1 (en) | 2008-12-12 | 2011-09-29 | Danisco A/S | Genetic Cluster of Strains of Streptococcus Thermophilus Having Unique Rheological Properties for Dairy Fermentation |
| US20140271987A1 (en) | 2008-12-12 | 2014-09-18 | Dupont Nutrition Bioscienses APS | Genetic Cluster of Strains of Streptococcus Thermophilus Having Unique Rheological Properties for Dairy Fermentation |
| WO2011017293A2 (en) | 2009-08-03 | 2011-02-10 | The General Hospital Corporation | Engineering of zinc finger arrays by context-dependent assembly |
| US20110104787A1 (en) * | 2009-11-05 | 2011-05-05 | President And Fellows Of Harvard College | Fusion Peptides That Bind to and Modify Target Nucleic Acid Sequences |
| US20110223638A1 (en) | 2010-03-10 | 2011-09-15 | Blake Wiedenheft | Methods of Generating Nucleic Acid Fragments |
| US20130130248A1 (en) | 2010-05-10 | 2013-05-23 | The Regents Of The University Of California | Endoribonuclease compositions and methods of use thereof |
| US20130288251A1 (en) | 2010-10-20 | 2013-10-31 | Dupont Nutrition Biosciences Aps | Lactococcus crispr-cas sequences |
| WO2012164565A1 (en) | 2011-06-01 | 2012-12-06 | Yeda Research And Development Co. Ltd. | Compositions and methods for downregulating prokaryotic genes |
| US20140113376A1 (en) | 2011-06-01 | 2014-04-24 | Rotem Sorek | Compositions and methods for downregulating prokaryotic genes |
| WO2013098244A1 (en) | 2011-12-30 | 2013-07-04 | Wageningen Universiteit | Modified cascade ribonucleoproteins and uses thereof |
| US20150024499A1 (en) | 2011-12-30 | 2015-01-22 | Wageningen Universiteit | Modified cascade ribonucleoproteins and uses thereof |
| US20140294773A1 (en) | 2011-12-30 | 2014-10-02 | Wageningen Universiteit | Modified cascade ribonucleoproteins and uses thereof |
| US20150166969A1 (en) | 2012-02-24 | 2015-06-18 | Fred Hutchinson Cancer Research Center | Compositions and methods for the treatment of hemoglobinopathies |
| US20150050699A1 (en) | 2012-03-20 | 2015-02-19 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| US20150045546A1 (en) | 2012-03-20 | 2015-02-12 | Vilnius University | RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX |
| WO2013176772A1 (en) | 2012-05-25 | 2013-11-28 | The Regents Of The University Of California | Methods and compositions for rna-directed target dna modification and for rna-directed modulation of transcription |
| US20130330778A1 (en) | 2012-06-11 | 2013-12-12 | Agilent Technologies, Inc. | Method of adaptor-dimer subtraction using a crispr cas6 protein |
| US20150176064A1 (en) | 2012-06-14 | 2015-06-25 | Agence Nationale de Securite Sanitaire de I'Alimentation, de I'Environnement et du Travail | Method for Detecting and Identifying Enterohemorrhagic Escherichia coli |
| WO2014004288A1 (en) | 2012-06-27 | 2014-01-03 | J2 Global, Inc. | Facilitating network login |
| US20150315576A1 (en) | 2012-11-01 | 2015-11-05 | Massachusetts Institute Of Technology | Genetic device for the controlled destruction of dna |
| US20160017366A1 (en) | 2012-12-06 | 2016-01-21 | Sigma-Aldrich Co. Llc | Crispr-based genome modification and regulation |
| WO2014089290A1 (en) | 2012-12-06 | 2014-06-12 | Sigma-Aldrich Co. Llc | Crispr-based genome modification and regulation |
| US20140186843A1 (en) | 2012-12-12 | 2014-07-03 | Massachusetts Institute Of Technology | Methods, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| US20150203872A1 (en) | 2012-12-12 | 2015-07-23 | The Broad Institute Inc. | Crispr-cas systems and methods for altering expression of gene products |
| US20140234972A1 (en) | 2012-12-12 | 2014-08-21 | Massachusetts Institute Of Technology | CRISPR-CAS Nickase Systems, Methods And Compositions For Sequence Manipulation in Eukaryotes |
| US20140242664A1 (en) | 2012-12-12 | 2014-08-28 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| US20150291965A1 (en) | 2012-12-12 | 2015-10-15 | The Broad Institute, Inc. | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| US20140242700A1 (en) | 2012-12-12 | 2014-08-28 | Massachusetts Institute Of Technology | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation |
| US20140242699A1 (en) | 2012-12-12 | 2014-08-28 | Massachusetts Institute Of Technology | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| US20140248702A1 (en) | 2012-12-12 | 2014-09-04 | The Broad Institute, Inc. | CRISPR-Cas Nickase Systems, Methods And Compositions For Sequence Manipulation in Eukaryotes |
| US20140256046A1 (en) | 2012-12-12 | 2014-09-11 | Massachusetts Institute Of Technology | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| US20140273234A1 (en) | 2012-12-12 | 2014-09-18 | The Board Institute, Inc. | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation |
| US20140273232A1 (en) | 2012-12-12 | 2014-09-18 | The Broad Institute, Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| US20150247150A1 (en) | 2012-12-12 | 2015-09-03 | The Broad Institute Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| US20150356239A1 (en) | 2012-12-12 | 2015-12-10 | The Broad Institute Inc. | Methods, models, systems, and apparatus for identifying target sequences for cas enzymes or crispr-cas systems for target sequences and conveying results thereof |
| US20140273231A1 (en) | 2012-12-12 | 2014-09-18 | The Broad Institute, Inc. | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US20150232882A1 (en) | 2012-12-12 | 2015-08-20 | The Broad Institute Inc. | Engineering of systems, methods and optimized guide compositions for sequence manipulation |
| US20140227787A1 (en) | 2012-12-12 | 2014-08-14 | The Broad Institute, Inc. | Crispr-cas systems and methods for altering expression of gene products |
| US20150184139A1 (en) | 2012-12-12 | 2015-07-02 | The Broad Institute Inc. | Crispr-cas systems and methods for altering expression of gene products |
| US20140189896A1 (en) | 2012-12-12 | 2014-07-03 | Feng Zhang | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US20140357530A1 (en) | 2012-12-12 | 2014-12-04 | The Broad Institute Inc. | Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof |
| US20140186919A1 (en) | 2012-12-12 | 2014-07-03 | Feng Zhang | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation |
| US20140186958A1 (en) | 2012-12-12 | 2014-07-03 | Feng Zhang | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| US20140179770A1 (en) | 2012-12-12 | 2014-06-26 | Massachusetts Institute Of Technology | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| US8993233B2 (en) | 2012-12-12 | 2015-03-31 | The Broad Institute Inc. | Engineering and optimization of systems, methods and compositions for sequence manipulation with functional domains |
| US20150020223A1 (en) | 2012-12-12 | 2015-01-15 | The Broad Institute Inc. | Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications |
| US20150079681A1 (en) | 2012-12-12 | 2015-03-19 | The Broad Institute Inc. | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US20140310830A1 (en) | 2012-12-12 | 2014-10-16 | Feng Zhang | CRISPR-Cas Nickase Systems, Methods And Compositions For Sequence Manipulation in Eukaryotes |
| US20140179006A1 (en) | 2012-12-12 | 2014-06-26 | Massachusetts Institute Of Technology | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US20140170753A1 (en) | 2012-12-12 | 2014-06-19 | Massachusetts Institute Of Technology | Crispr-cas systems and methods for altering expression of gene products |
| US20150031134A1 (en) | 2012-12-12 | 2015-01-29 | The Broad Institute Inc. | Crispr-cas component systems, methods and compositions for sequence manipulation |
| US20140335620A1 (en) | 2012-12-12 | 2014-11-13 | The Broad Institute, Inc. | Engineering and optimization of improved systems, methods and enzyme compositions for sequence manipulation |
| US8697359B1 (en) | 2012-12-12 | 2014-04-15 | The Broad Institute, Inc. | CRISPR-Cas systems and methods for altering expression of gene products |
| US20140298547A1 (en) | 2012-12-13 | 2014-10-02 | Dow Agrosciences Llc | Dna detection methods for site specific nuclease activity |
| US9023649B2 (en) | 2012-12-17 | 2015-05-05 | President And Fellows Of Harvard College | RNA-guided human genome engineering |
| WO2014099744A1 (en) | 2012-12-17 | 2014-06-26 | President And Fellows Of Harvard College | Rna-guided human genome engineering |
| US20140201857A1 (en) | 2013-01-14 | 2014-07-17 | Recombinetics, Inc. | Hornless livestock |
| US20140212869A1 (en) | 2013-01-25 | 2014-07-31 | Agilent Technologies, Inc. | Nucleic Acid Proximity Assay Involving the Formation of a Three-way junction |
| US20160024510A1 (en) | 2013-02-07 | 2016-01-28 | The Rockefeller University | Sequence specific antimicrobials |
| US20140242702A1 (en) | 2013-02-25 | 2014-08-28 | Sigma Aldrich Co. Llc | Methods and compositions for enhancing nuclease-mediated gene disruption |
| US20150376652A1 (en) | 2013-02-27 | 2015-12-31 | Helmholtz Zentrum München Deutsches Forschungszentrum Für Gesundheit Und Umwelt | Gene editing in the oocyte by cas9 nucleases |
| US20160024529A1 (en) | 2013-03-09 | 2016-01-28 | Agilent Technologies, Inc. | Methods of in vivo engineering of large sequences using multiple crispr/cas selections of recombineering events |
| US20140315985A1 (en) | 2013-03-14 | 2014-10-23 | Caribou Biosciences, Inc. | Compositions and methods of nucleic acid-targeting nucleic acids |
| US20140273037A1 (en) | 2013-03-15 | 2014-09-18 | System Biosciences, Llc | Compositions and methods directed to crispr/cas genomic engineering systems |
| US20150167000A1 (en) | 2013-03-15 | 2015-06-18 | Regents Of The University Of Minnesota | ENGINEERING PLANT GENOMES USING CRISPR/Cas SYSTEMS |
| US20140273230A1 (en) | 2013-03-15 | 2014-09-18 | Sigma-Aldrich Co., Llc | Crispr-based genome modification and regulation |
| WO2014144592A2 (en) | 2013-03-15 | 2014-09-18 | The General Hospital Corporation | Using truncated guide rnas (tru-grnas) to increase specificity for rna-guided genome editing |
| US20140349400A1 (en) | 2013-03-15 | 2014-11-27 | Massachusetts Institute Of Technology | Programmable Modification of DNA |
| US20140273235A1 (en) | 2013-03-15 | 2014-09-18 | Regents Of The University Of Minnesota | ENGINEERING PLANT GENOMES USING CRISPR/Cas SYSTEMS |
| US20140273226A1 (en) | 2013-03-15 | 2014-09-18 | System Biosciences, Llc | Crispr/cas systems for genomic modification and gene modulation |
| US20140295556A1 (en) | 2013-03-15 | 2014-10-02 | The General Hospital Corporation | Using RNA-guided FokI Nucleases (RFNs) to Increase Specificity for RNA-Guided Genome Editing |
| US20140295557A1 (en) | 2013-03-15 | 2014-10-02 | The General Hospital Corporation | Using Truncated Guide RNAs (tru-gRNAs) to Increase Specificity for RNA-Guided Genome Editing |
| US20140287938A1 (en) | 2013-03-15 | 2014-09-25 | The Broad Institute, Inc. | Recombinant virus and preparations thereof |
| US20160024524A1 (en) | 2013-03-15 | 2016-01-28 | The General Hospital Corporation | Increasing Specificity for RNA-Guided Genome Editing |
| US20140377868A1 (en) | 2013-03-15 | 2014-12-25 | The General Hospital Corporation | Rna-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| WO2014152432A2 (en) | 2013-03-15 | 2014-09-25 | The General Hospital Corporation | Rna-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci |
| US20160024523A1 (en) | 2013-03-15 | 2016-01-28 | The General Hospital Corporation | Using Truncated Guide RNAs (tru-gRNAs) to Increase Specificity for RNA-Guided Genome Editing |
| US20140304853A1 (en) | 2013-04-05 | 2014-10-09 | Sangamo Biosciences, Inc. | Methods and compositions for integration of an exogenous sequence within the genome of plants |
| US20150056629A1 (en) | 2013-04-14 | 2015-02-26 | Katriona Guthrie-Honea | Compositions, systems, and methods for detecting a DNA sequence |
| US20140309487A1 (en) | 2013-04-16 | 2014-10-16 | Regeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
| US20140310828A1 (en) | 2013-04-16 | 2014-10-16 | Regeneron Pharmaceuticals, Inc. | Targeted modification of rat genome |
| US20140335063A1 (en) | 2013-05-10 | 2014-11-13 | Sangamo Biosciences, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering |
| US20140356867A1 (en) | 2013-05-29 | 2014-12-04 | Agilent Technologies, Inc. | Nucleic acid enrichment using cas9 |
| US20150067922A1 (en) | 2013-05-30 | 2015-03-05 | The Penn State Research Foundation | Gene targeting and genetic modification of plants via rna-guided genome editing |
| CA2915837A1 (en) | 2013-06-17 | 2014-12-24 | The Broad Institute, Inc. | Optimized crispr-cas double nickase systems, methods and compositions for sequence manipulation |
| WO2014204578A1 (en) | 2013-06-21 | 2014-12-24 | The General Hospital Corporation | Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing |
| US20150024500A1 (en) | 2013-07-19 | 2015-01-22 | Larix Bioscience, Llc | Methods and compositions for producing double allele knock outs |
| US20150044772A1 (en) | 2013-08-09 | 2015-02-12 | Sage Labs, Inc. | Crispr/cas system-based novel fusion protein and its applications in genome editing |
| US20160017301A1 (en) | 2013-08-29 | 2016-01-21 | Temple University Of The Commonwealth System Of Higher Education | Methods and compositions for rna-guided treatment of hiv infection |
| US20150071899A1 (en) | 2013-09-06 | 2015-03-12 | President And Fellows Of Harvard College | Cas9-foki fusion proteins and uses thereof |
| US20150174169A1 (en) * | 2013-10-17 | 2015-06-25 | Sangamo Biosciences, Inc. | Delivery methods and compositions for nuclease-mediated genome engineering in hematopoietic stem cells |
| US20150159174A1 (en) | 2013-12-11 | 2015-06-11 | Regeneron Pharmaceutical, Inc. | Methods and Compositions for the Targeted Modification of a Genome |
| US20150159175A1 (en) | 2013-12-11 | 2015-06-11 | Regeneron Pharmaceutical, Inc. | Methods and compositions for the targeted modification of a genome |
| US20150232883A1 (en) | 2013-12-12 | 2015-08-20 | The Broad Institute Inc. | Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components |
| US20150191744A1 (en) | 2013-12-17 | 2015-07-09 | University Of Massachusetts | Cas9 effector-mediated regulation of transcription, differentiation and gene editing/labeling |
| WO2015099850A1 (en) | 2013-12-26 | 2015-07-02 | The General Hospital Corporation | Multiplex guide rnas |
| US20150252358A1 (en) | 2014-03-10 | 2015-09-10 | Editas Medicine, Inc. | Crispr/cas-related methods and compositions for treating leber's congenital amaurosis 10 (lca10) |
| WO2016028682A1 (en) * | 2014-08-17 | 2016-02-25 | The Broad Institute Inc. | Genome editing using cas9 nickases |
| WO2016112242A1 (en) * | 2015-01-08 | 2016-07-14 | President And Fellows Of Harvard College | Split cas9 proteins |
| WO2016141224A1 (en) | 2015-03-03 | 2016-09-09 | The General Hospital Corporation | Engineered crispr-cas9 nucleases with altered pam specificity |
| WO2017040348A1 (en) | 2015-08-28 | 2017-03-09 | The General Hospital Corporation | Engineered crispr-cas9 nucleases |
| WO2018035387A1 (en) * | 2016-08-17 | 2018-02-22 | The Broad Institute, Inc. | Novel crispr enzymes and systems |
Non-Patent Citations (139)
| Title |
|---|
| "Current Protocols in Molecular Biology", 2010 |
| AL-ATTAR ET AL.: "Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs): The Hallmark of an Ingenious Antiviral Defense Mechanism in Prokaryotes", BIOL CHEM, vol. 392, 2011, pages 277 - 289 |
| ALTSCHUL, S. F.W. GISH ET AL., J MOL BIOL, vol. 215, 1990, pages 403 - 10 |
| AYNAUD, MARIE-MING ET AL.: "Human Tribbles 3 protects nuclear DNA from cytidine deamination by APOBEC3A", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 287, no. 46, 2012, pages 39182 - 39192 |
| BAE ET AL., NAT. BIOTECHNOL., vol. 21, 2003, pages 275 - 280 |
| BEERLI ET AL., NAT. BIOTECHNOL., vol. 20, 2002, pages 135 - 141 |
| BERG, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 99 |
| BOGDANOVE ET AL., 20URRO PIN PLANT BIOL, vol. 13, 2010, pages 394 - 401 |
| BOGDANOVEVOYTAS, SCIENCE, vol. 333, 2011, pages 1843 - 1846 |
| BOISSEL ET AL., NUCL. ACIDS RES., vol. 42, no. 4, 2014, pages 2591 - 2601 |
| BOISSELSCHARENBERG, METHODS MOL BIOL., vol. 1239, 2015, pages 171 - 96 |
| CARON ET AL., MOL THER., vol. 3, no. 3, 2001, pages 310 - 8 |
| CARROLL ET AL., NAT. PROTOC., vol. 1, 2006, pages 1637 - 52 |
| CARROLL, GENE THER., vol. 15, 2008, pages 1463 - 68 |
| CARROLL: "A CRISPR Approach to Gene Targeting", MOLECULAR THERAPY, vol. 20, no. 9, September 2012 (2012-09-01), pages 1658 - 1660, XP055106489, DOI: 10.1038/mt.2012.171 |
| CATHOMEN, MOL. THER., vol. 16, 2008, pages 1200 - 07 |
| CHOO ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 11163 |
| CHRISTIAN ET AL., GENETICS, vol. 186, 2010, pages 757 - 761 |
| CLARK-CURTISSCURTISS ET AL.: "Methods in Enzymology", vol. 101, 1983, pages: 347 - 362 |
| COKOL ET AL., EMBO REP., vol. 1, no. 5, 15 November 2000 (2000-11-15), pages 411 - 415 |
| COLLEY ET AL., J. BIOL. CHEM., vol. 264, 1989, pages 17619 - 22 |
| CROMBEZ ET AL., BIOCHEM SOC. TRANS., vol. 35, 2007, pages 44 - 46 |
| DAHLMAN ET AL., NAT BIOTECHNOL., vol. 33, no. 11, November 2015 (2015-11-01), pages 1159 - 61 |
| DEROSSI ET AL., J. BIOL. CHEM., vol. 269, 1994, pages 10444 - 10450 |
| DESHAYES ET AL., CELL MOL LIFE SCI., vol. 62, no. 16, 2005, pages 1839 - 49 |
| DICARLO ET AL., NUCLEIC ACIDS RES, 2013 |
| EAR, PO HIENSTEPHEN W. MICHNICK: "A General Life-death Selection Strategy for Dissecting Protein Functions", NATURE METHODS, vol. 6, no. 11, 2009, pages 813 - 16 |
| EL-ANDALOUSSI ET AL., CURR PHARM DES., vol. 11, no. 28, 2005, pages 3597 - 611 |
| ELROD-ERICKSON ET AL., STRUCTURE, vol. 6, 1998, pages 451 |
| FAGERLUND ET AL., GENOME BIOL, vol. 16, 2015, pages 251 |
| FRANKEL ET AL., CELL, vol. 55, 1988, pages 1189 - 1193 |
| FREITASCUNHA, CURR GENOMICS, vol. 10, no. 8, December 2009 (2009-12-01), pages 550 - 557 |
| FRIEDLAND, ARI E. ET AL.: "Characterization of Staphylococcus Aureus Cas9: a Smaller Cas9 for All-in-One Adeno-Associated Virus Delivery and Paired Nickase Applications", GENOME BIOLOGY, vol. 16, no. 1, 2015, XP055347837, DOI: 10.1186/s13059-015-0817-8 |
| FU ET AL., METHODS ENZYMOL., vol. 546, 2014, pages 21 - 45 |
| FUTAKI ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 5836 - 5840 |
| GAIT ET AL., CELL. MOL. LIFE. SCI., vol. 60, 2003, pages 844 - 853 |
| GASIUNAS ET AL.: "Cas9-crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA, vol. 109, no. 39, 4 September 2012 (2012-09-04), pages E2579 - E2586, XP055569955, DOI: 10.1073/pnas.1208507109 |
| GASIUNAS, G. ET AL.: "Cas9-CrRNA Ribonucleoprotein Complex Mediates Specific DNA Cleavage for Adaptive Immunity in Bacteria", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 109, no. 39, April 2012 (2012-04-01) |
| GEISSLER ET AL., PLOS ONE, vol. 6, 2011, pages e19722 |
| GOSSENBUJARD, PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 5547 |
| HALE ET AL.: "Essential Features and Rational Design of CRISPR RNAs That Function With the Cas RAMP Module Complex to Cleave RNAs", MOLECULAR CELL, vol. 45, 2012, pages 292 - 302, XP055038620, DOI: 10.1016/j.molcel.2011.10.023 |
| HARRIS, REUBEN S.SVEND K. PETERSEN-MAHRTMICHAEL S. NEUBERGER: "RNA Editing Enzyme APOBEC1 and Some of Its Homologs Can Act as DNA Mutators", MOLECULAR CELL, vol. 10, no. 5, 2002, pages 1247 - 253, XP001166837, DOI: 10.1016/S1097-2765(02)00742-6 |
| HIRANO, H. ET AL., CRYSTAL STRUCTURE OF FRANCISELLA NOVICIDA CAS9 RHA IN COMPLEX WITH SGRNA AND TARGET DNA (TGG PAM, February 2016 (2016-02-01) |
| HOCKEMEYE ET AL., NAT BIOTECHNOL, vol. 29, 2011, pages 699 - 700 |
| HOLTZ, COLLEEN M.HOLLY A. SADLERLOUIS M. MANSKY: "APOBEC3G cytosine deamination hotspots are defined by both sequence context and single-stranded DNA secondary structure", NUCLEIC ACIDS RESEARCH, 2013, pages 246 |
| HWANG ET AL., NAT BIOTECHNOL, vol. 31, 2013, pages 230 - 232 |
| ISALAN ET AL., NAT. BIOTECHNOL., vol. 19, 2001, pages 656 - 660 |
| JAMIESON ET AL., BIOCHEMISTRY, vol. 33, 1994, pages 5689 |
| JASIN, MARIARODNEY ROTHSTEIN: "Repair of strand breaks by homologous recombination", COLD SPRING HARBOR PERSPECTIVES IN BIOLOGY, vol. 5, no. 11, 2013, pages a012740, XP055269842, DOI: 10.1101/cshperspect.a012740 |
| JASON M. GERHKEOLIVER R. CERVANTESM. KENDELL CLEMENTLUCA PINELLOJ. KEITH JOUNG: "High-precision CRISPR-Cas9 base editors with minimized bystander and off-target mutations", BIORXIV, pages 273938 |
| JINEK ET AL., ELIFE, vol. 2, 2013, pages e00471 |
| JINEK ET AL., SCIENCE, vol. 337, 2012, pages 816 - 821 |
| JINEK ET AL.: "A Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity", SCIENCE, vol. 337, 17 August 2012 (2012-08-17), pages 816 - 821, XP055229606, DOI: 10.1126/science.1225829 |
| JOUNG ET AL., NAT. METHODS, vol. 7, 2010, pages 91 - 92 |
| KIM ET AL., GENOME RES., vol. 19, 2009, pages 1279 - 88 |
| KIM ET AL.: "Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins", GENOME RESEARCH, vol. 24, no. 6, 2014, pages 1012 - 1019, XP055277723, DOI: 10.1101/gr.171322.113 |
| KIM ET AL.: "Increasing the Genome-Targeting Scope and Precision of Base Editing with Engineered Cas9-Cytosine Deaminase Fusions", NATURE BIOTECHNOLOGY, vol. 35, no. 4, 2017, pages 371 - 376 |
| KLEINSTIVER ET AL., NAT BIOTECHNOL., vol. 33, no. 12, December 2015 (2015-12-01), pages 1293 - 1298 |
| KLEINSTIVER ET AL., NAT BIOTECHNOL., vol. 34, no. 8, August 2016 (2016-08-01), pages 869 - 74 |
| KLEINSTIVER ET AL., NATURE, vol. 523, no. 7561, 23 July 2015 (2015-07-23), pages 481 - 5 |
| KLEINSTIVER ET AL., NATURE, vol. 529, no. 7587, 28 January 2016 (2016-01-28), pages 490 - 5 |
| KLUG, GENE, vol. 135, 1993, pages 83 |
| KOMOR ET AL.: "Programmable Editing of a Target Base in Genomic DNA Without Double-Stranded DNA Cleavage", NATURE, vol. 533, no. 7603, 31 May 2016 (2016-05-31), pages 420 - 424, XP055548777 * |
| KOMOR, ALEXIS C.YONGJOO B. KIMMICHAEL S. PACKERJOHN A. ZURISDAVID R. LIU: "Programmable Editing of a Target Base in Genomic DNA without Double-stranded DNA Cleavage", NATURE, vol. 533, no. 7603, 2016, pages 420 - 24, XP093078921, DOI: 10.1038/nature17946 |
| KONERMANN ET AL., NATURE, vol. 517, no. 7536, 29 January 2015 (2015-01-29), pages 583 - 8 |
| KRIEGLER: "Gene Transfer and Expression: A Laboratory Manual", vol. 182, 1990, article "Guide to Protein Purification" |
| LAFOUNTAINE ET AL., INT J PHARM., vol. 494, no. 1, 13 August 2015 (2015-08-13), pages 180 - 194 |
| LEE ET AL., SCIENCE, vol. 245, 1989, pages 635 |
| LIANG ET AL.: "Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection", JOURNAL OF BIOTECHNOLOGY, vol. 208, 2015, pages 44 - 53, XP055196365, DOI: 10.1016/j.jbiotec.2015.04.024 |
| LIU ET AL., BIOCHEM. AND BIOPHYS. RES. COMM., vol. 347, no. 1, 2006, pages 133 - 140 |
| LIU ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 3850 - 56 |
| MAEDER ET AL., MOL. CELL, vol. 31, 2008, pages 294 - 301 |
| MAEDER, MORGAN L.: "Rapid 'Open-Source' Engineering of Customized Zinc-Finger Nucleases for Highly Efficient Gene Modification", CELL, vol. 31, no. 2, 2008, pages 294 - 301, XP055143755, DOI: 10.1016/j.molcel.2008.06.016 |
| MAHFOUZ ET AL., PROC NATL ACAD SCI U S A, vol. 108, 2011, pages 2623 - 2628 |
| MAKAROVA ET AL., NAT REV MICROBIOL, vol. 13, 2015, pages 722 - 736 |
| MAKAROVA ET AL.: "Evolution and classification of the CRISPR-Cas systems", NATURE REVIEWS MICROBIOLOGY, vol. 9, no. 6, June 2011 (2011-06-01), pages 467 - 477, XP055932744, DOI: 10.1038/nrmicro2577 |
| MALI ET AL., SCIENCE, vol. 339, 2013, pages 823 - 826 |
| MANDELL ET AL., NUCLEIC ACIDS RES., vol. 34, 2006, pages W516 - 523 |
| MICHNICK ET AL.: "Chapter 25: Protein-Fragment Complementation Assays for Large-Scale Analysis, Functional Dissection and Dynamic Studies of Protein-Protein Interactions in Living Cells", SIGNAL TRANSDUCTION PROTOCOLS, METHODS IN MOLECULAR BIOLOGY, vol. 756, 1 July 2011 (2011-07-01), pages 395 - 425, XP009165787 * |
| MILLER ET AL., EMBO J., vol. 4, 1985, pages 1609 |
| MORBITZER ET AL., T. PROC NATL ACAD SCI U S A, vol. 107, 2010, pages 21617 - 21622 |
| MORRISON, J. BACTERIOL., vol. 132, 1977, pages 349 - 351 |
| MOSCOUBOGDANOVE, SCIENCE, vol. 326, 2009, pages 1501 - 1512 |
| MUSSOLINO ET AL., NUCLEIC ACIDS RES, vol. 39, 2011, pages 6315 - 6325 |
| MYOU ET AL., J. IMMUNOL., vol. 171, 2003, pages 4399 - 4405 |
| NAGAHARA ET AL., NAT. MED., vol. 4, 1998, pages 1449 - 1453 |
| NEERING ET AL., BLOOD, vol. 88, 1996, pages 1147 - 55 |
| NISHIDA, K., T. ARAZOE, N. YACHIE, S. BANNO, M. KAKIMOTO, M. TABATA, M.MOCHIZUKI, A. MIYABE, M. ARAKI, K. Y. HARA, Z. SHIMATANI, A: "Targeted Nucleotide Editing Using Hybrid Prokaryotic and Vertebrate Adaptive Immune Systems", SCIENCE, vol. 353, no. 6305, 2016, XP055482712, DOI: 10.1126/science.aaf8729 |
| NISHIMASU, CELL, vol. 156, 2014, pages 935 - 949 |
| OLIGINO ET AL., GENE THER., vol. 5, 1998, pages 491 - 496 |
| OSBORN ET AL., HUM GENE THER., vol. 26, no. 2, February 2015 (2015-02-01), pages 114 - 26 |
| PALOMARES ET AL.: "Production of Recombinant Proteins: Challenges and Solutions", METHODS MOL BIOL., vol. 267, 2004, pages 15 - 52 |
| PALVA ET AL., GENE, vol. 22, 1983, pages 229 - 235 |
| PATTANAYAK, VIKRAM ET AL.: "Revealing off-Target Cleavage Specificities of Zinc-Finger Nucleases by in Vitro Selection", NATURE METHODS, vol. 8, July 2011 (2011-07-01), pages 765 - 770, XP055650557, DOI: 10.1038/nmeth.1670 |
| PAVLETICH ET AL., SCIENCE, vol. 252, 1991, pages 809 |
| RAMIREZ ET AL., NAT. METHODS, vol. 5, 2008, pages 374 - 375 |
| RAMSEYFLYNN, PHARMACOL THER, 22 July 2015 (2015-07-22) |
| REBAR ET AL., SCIENCE, vol. 263, 1994, pages 671 |
| REBHANDL, STEFANMICHAEL HUEMERRICHARD GREILROLAND GEISBERGER: "AID/APOBEC Deaminases and Cancer", ONCOSCIENCE, vol. 2, 2015, pages 320 |
| REES, HOLLY A. ET AL.: "Improving the DNA specificity and applicability of base editing through protein engineering and protein delivery", NATURE, vol. 8, 2017, pages 15790, XP055597104, DOI: 10.1038/ncomms15790 |
| RENDAHL ET AL., NAT. BIOTECHNOL., vol. 16, 1998, pages 757 - 761 |
| REYON ET AL., NATURE BIOTECHNOLOGY, vol. 30, 2012, pages 460 - 465 |
| ROTHBARD ET AL., NATURE MEDICINE, vol. 6, no. 11, 2000, pages 1253 - 1257 |
| SAMBROOK ET AL.: "Molecular Cloning, A Laboratory Manual", 2001 |
| SANTOS-PEREIRA, JOSE M.ANDRES AGUILERA: "R Loops: New Modulators of Genome Dynamics and Function", NATURE REVIEWS GENETICS, vol. 16, no. 10, 2015, pages 583 - 97 |
| SANTRA ET AL., CHEM. COMMUN., 2005, pages 3144 - 3146 |
| SCHOLZEBOCH, J. 21URRO PIN MICROBIOL, 2011 |
| SCHUNDER ET AL., INT J MED MICROBIOL, vol. 303, 2013, pages 51 - 60 |
| SCHWARZDAYHOF: "Atlas of Protein Sequence and Structure", 1979, pages: 353 - 358 |
| See also references of EP3630198A4 |
| SEGAL ET AL., BIOCHEMISTRY, vol. 42, 2003, pages 2137 - 48 |
| SHEN ET AL., CELL RES, 2013 |
| SHINOHARA, MASANOBU ET AL.: "APOBEC3B can impair genomic stability by inducing base substitutions in genomic DNA in human cells", SCIENTIFIC REPORTS, vol. 2, 2012, pages 806 |
| SHMAKOV ET AL., MOL CELL., vol. 60, no. 3, 5 November 2015 (2015-11-05), pages 385 - 97 |
| SHOKOLENKO ET AL., DNA REPAIR, vol. 4, no. 4, 2005, pages 511 - 518 |
| SMITH, T. F.M. S. WATERMAN, J MOL BIOL, vol. 147, 1981, pages 195 - 7 |
| SMITHWATERMAN, ADVANCES IN APPLIED MATHEMATICS, 1981, pages 482 - 489 |
| SNYDER ET AL., PLOS BIOL, vol. 2, 2004, pages E36 |
| STETSENKO ET AL., J. ORG. CHEM., vol. 65, 2000, pages 4900 - 4909 |
| SUSPENE, RODOLPHE ET AL.: "Recovery of APOBEC3-edited human immunodeficiency virus G—> A hypermutants by differential DNA denaturation PCR", JOURNAL OF GENERAL VIROLOGY, vol. 86, no. 1, 2005, pages 125 - 129, XP002505773, DOI: 10.1099/VIR.0.80426-0 |
| TAKENOBU ET AL., MOL. CANCER THER., vol. 1, no. 12, 2002, pages 1043 - 1049 |
| TANG, XU ET AL.: "A CRISPR-Cpfl System for Efficient Genome Editing and Transcriptional Repression in Plants", NATURE PLANTS, vol. 3, no. 7, 2017, pages 17103 |
| TSAI ET AL., NAT BIOTECHNOL., vol. 32, no. 6, June 2014 (2014-06-01), pages 569 - 76 |
| TSAIJOUNG, NAT REV GENET., vol. 17, no. 5, May 2016 (2016-05-01), pages 300 - 12 |
| VIVES ET AL., J. BIOL. CHEM., vol. 272, 1997, pages 16010 - 16017 |
| WANG ET AL., GENE THER., vol. 4, 1997, pages 432 - 441 |
| WENDER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 13003 - 13008 |
| WIEDENHEFT ET AL.: "RNA-guided genetic silencing systems in bacteria and archaea", NATURE, vol. 482, no. 331-338, 16 February 2012 (2012-02-16) |
| WU ET AL., CELL. MOL. LIFE SCI., vol. 64, 2007, pages 2933 - 44 |
| WU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 92, 1995, pages 344 |
| WYVEKENS ET AL., HUM GENE THER., vol. 26, no. 7, July 2015 (2015-07-01), pages 425 - 31 |
| YAMADA, MARI ET AL.: "Crystal Structure of the Minimal Cas9 from Campylobacter Jejuni Reveals the Molecular Diversity in the CRISPR-Cas9 Systems", MOLECULAR CELL, vol. 65, no. 6, 2017 |
| YAMANO, T. ET AL., CRYSTAL STRUCTURE OF ACIDAMINOCOCCUS SP. CPFL IN COMPLEX WITH CRRNA AND TARGET DNA, April 2016 (2016-04-01) |
| YANG ET AL., J GENET GENOMICS, vol. 44, no. 9, 20 September 2017 (2017-09-20), pages 423 - 437 |
| YANG ET AL.: "Engineering and Optimising Deaminase Fusions for Genome Editing", NATURE COMMUNICATIONS, vol. 7, 2 November 2016 (2016-11-02), pages 1 - 12, XP055548773 * |
| YANG ET AL.: "Engineering and Optimising Deaminase Fusions for Genome Editing", NATURE COMMUNICATIONS, vol. 7, 2 November 2016 (2016-11-02), pages 1 - 12, XP055548773, DOI: 10.1038/ncomms13330 |
| YANG, LUHANADRIAN W. BRIGGSWEI LEONG CHEWPRASHANT MALIMARC GUELLJOHN AACHDANIEL BRYAN GOODMANDAVID COXYINAN KANEMAL LESHA: "Engineering and Optimising Deaminase Fusions for Genome Editing", NATURE COMMUNICATIONS, vol. 7, 2016, pages 13330, XP055415680, DOI: 10.1038/ncomms13330 |
| ZETSCHE, BERND ET AL.: "Cpfl Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System", CELL, vol. 163, no. 3, 2015, pages 759 - 771 |
| ZURIS, JOHN A. ET AL.: "Cationic lipid-mediated delivery of proteins enables efficient protein-based genome editing in vitro and in vivo", NATURE BIOTECHNOLOGY, vol. 33, no. 1, 2015, pages 73 - 80, XP093037310, DOI: 10.1038/nbt.3081 |
Cited By (111)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12006520B2 (en) | 2011-07-22 | 2024-06-11 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US12584118B2 (en) | 2013-09-06 | 2026-03-24 | President And Fellows Of Harvard College | Cas9 variants and uses thereof |
| US12473573B2 (en) | 2013-09-06 | 2025-11-18 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US12215365B2 (en) | 2013-12-12 | 2025-02-04 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US12104207B2 (en) | 2014-06-23 | 2024-10-01 | The General Hospital Corporation | Genomewide unbiased identification of DSBs evaluated by sequencing (GUIDE-Seq) |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US12398406B2 (en) | 2014-07-30 | 2025-08-26 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US12188043B2 (en) | 2015-07-15 | 2025-01-07 | Rutgers, The State University Of New Jersey | Nuclease-independent targeted gene editing platform and uses thereof |
| US11028429B2 (en) | 2015-09-11 | 2021-06-08 | The General Hospital Corporation | Full interrogation of nuclease DSBs and sequencing (FIND-seq) |
| US12043852B2 (en) | 2015-10-23 | 2024-07-23 | President And Fellows Of Harvard College | Evolved Cas9 proteins for gene editing |
| US12344869B2 (en) | 2015-10-23 | 2025-07-01 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11999947B2 (en) | 2016-08-03 | 2024-06-04 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US12084663B2 (en) | 2016-08-24 | 2024-09-10 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US12065666B2 (en) | 2017-01-05 | 2024-08-20 | Rutgers, The State University Of New Jersey | Targeted gene editing platform independent of DNA double strand break and uses thereof |
| US12390514B2 (en) | 2017-03-09 | 2025-08-19 | President And Fellows Of Harvard College | Cancer vaccine |
| US12516308B2 (en) | 2017-03-09 | 2026-01-06 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US12435331B2 (en) | 2017-03-10 | 2025-10-07 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US12359218B2 (en) | 2017-07-28 | 2025-07-15 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11286468B2 (en) | 2017-08-23 | 2022-03-29 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases with altered PAM specificity |
| US11624058B2 (en) | 2017-08-23 | 2023-04-11 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases with altered PAM specificity |
| US12241096B2 (en) | 2017-08-23 | 2025-03-04 | The General Hospital Corporation | Engineered CRISPR-Cas9 nucleases with altered PAM specificity |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11725228B2 (en) | 2017-10-11 | 2023-08-15 | The General Hospital Corporation | Methods for detecting site-specific and spurious genomic deamination induced by base editing technologies |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US12406749B2 (en) | 2017-12-15 | 2025-09-02 | The Broad Institute, Inc. | Systems and methods for predicting repair outcomes in genetic engineering |
| US12601009B2 (en) | 2018-04-17 | 2026-04-14 | The General Hospital Corporation | Highly sensitive in vitro assays to define substrate preferences and sites of nucleic-acid binding, modifying, and cleaving agents |
| US11976324B2 (en) | 2018-04-17 | 2024-05-07 | The General Hospital Corporation | Highly sensitive in vitro assays to define substrate preferences and sites of nucleic-acid binding, modifying, and cleaving agents |
| US11845987B2 (en) | 2018-04-17 | 2023-12-19 | The General Hospital Corporation | Highly sensitive in vitro assays to define substrate preferences and sites of nucleic acid cleaving agents |
| US11898203B2 (en) | 2018-04-17 | 2024-02-13 | The General Hospital Corporation | Highly sensitive in vitro assays to define substrate preferences and sites of nucleic-acid binding, modifying, and cleaving agents |
| US12606867B2 (en) | 2018-04-17 | 2026-04-21 | The General Hospital Corporation | Highly sensitive in vitro assays to define substrate preferences and sites of nucleic-acid binding, modifying, and cleaving agents |
| US12157760B2 (en) | 2018-05-23 | 2024-12-03 | The Broad Institute, Inc. | Base editors and uses thereof |
| US12522807B2 (en) | 2018-07-09 | 2026-01-13 | The Broad Institute, Inc. | RNA programmable epigenetic RNA modifiers and uses thereof |
| US11834686B2 (en) | 2018-08-23 | 2023-12-05 | Sangamo Therapeutics, Inc. | Engineered target specific base editors |
| JP2021536229A (en) * | 2018-08-23 | 2021-12-27 | サンガモ セラピューティクス, インコーポレイテッド | Manipulated target-specific base editor |
| JP7541508B2 (en) | 2018-08-23 | 2024-08-28 | サンガモ セラピューティクス, インコーポレイテッド | Engineered target-specific base editors |
| US12398392B2 (en) | 2018-08-28 | 2025-08-26 | Flagship Pioneering Innovations Vi, Llc | Methods and compositions for modulating a genome |
| US12031129B2 (en) | 2018-08-28 | 2024-07-09 | Flagship Pioneering Innovations Vi, Llc | Methods and compositions for modulating a genome |
| US12281338B2 (en) | 2018-10-29 | 2025-04-22 | The Broad Institute, Inc. | Nucleobase editors comprising GeoCas9 and uses thereof |
| US12351837B2 (en) | 2019-01-23 | 2025-07-08 | The Broad Institute, Inc. | Supernegatively charged proteins and uses thereof |
| JP2024109660A (en) * | 2019-02-02 | 2024-08-14 | シャンハイテック ユニバーシティ | Preventing unintended mutations in gene editing |
| JP7761294B2 (en) | 2019-02-02 | 2025-10-28 | シャンハイテック ユニバーシティ | Preventing unintended mutations in gene editing |
| JP2022526695A (en) * | 2019-02-02 | 2022-05-26 | シャンハイテック ユニバーシティ | Inhibition of unintentional mutations in gene editing |
| JP7518549B2 (en) | 2019-02-02 | 2024-07-18 | シャンハイテック ユニバーシティ | Preventing unintended mutations in gene editing |
| EP3918083A4 (en) * | 2019-02-02 | 2023-03-29 | Shanghaitech University | INHIBITION OF UNINTENDED MUTATIONS IN GENE EDITING |
| US11946040B2 (en) | 2019-02-04 | 2024-04-02 | The General Hospital Corporation | Adenine DNA base editor variants with reduced off-target RNA editing |
| WO2020191242A1 (en) * | 2019-03-19 | 2020-09-24 | The Broad Institute, Inc. | Methods and compositions for editing nucleotide sequences |
| US12281303B2 (en) | 2019-03-19 | 2025-04-22 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12509680B2 (en) | 2019-03-19 | 2025-12-30 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12570972B2 (en) | 2019-03-19 | 2026-03-10 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US12473543B2 (en) | 2019-04-17 | 2025-11-18 | The Broad Institute, Inc. | Adenine base editors with reduced off-target effects |
| WO2020244122A1 (en) * | 2019-06-06 | 2020-12-10 | 中国科学院脑科学与智能技术卓越创新中心 | New-type single-base editing technique and use thereof |
| CN112048497B (en) * | 2019-06-06 | 2023-11-03 | 辉大(上海)生物科技有限公司 | Novel single-base editing technology and application thereof |
| CN112048497A (en) * | 2019-06-06 | 2020-12-08 | 中国科学院脑科学与智能技术卓越创新中心 | Novel single base editing technology and application thereof |
| US12404525B2 (en) | 2019-06-13 | 2025-09-02 | The General Hospital Corporation | Engineered human-endogenous virus-like particles and methods of use thereof for delivery to cells |
| US12351815B2 (en) | 2019-06-13 | 2025-07-08 | The General Hospital Corporation | Engineered human-endogenous virus-like particles and methods of use thereof for delivery to cells |
| US12351814B2 (en) | 2019-06-13 | 2025-07-08 | The General Hospital Corporation | Engineered human-endogenous virus-like particles and methods of use thereof for delivery to cells |
| EP4031190A4 (en) * | 2019-09-17 | 2023-08-09 | Rutgers, the State University of New Jersey | Highly efficient dna base editors mediated by rna-aptamer recruitment for targeted genome modification and uses thereof |
| CN110564752A (en) * | 2019-09-30 | 2019-12-13 | 北京市农林科学院 | Application of differential agent technology in enrichment of C.T base substitution cells |
| CN110564752B (en) * | 2019-09-30 | 2021-07-16 | 北京市农林科学院 | Application of differential surrogate technology in enrichment of C·T base substitution cells |
| US12435330B2 (en) | 2019-10-10 | 2025-10-07 | The Broad Institute, Inc. | Methods and compositions for prime editing RNA |
| CN112725348A (en) * | 2019-10-28 | 2021-04-30 | 安徽省农业科学院水稻研究所 | Gene and method for improving single-base editing efficiency of rice and application of gene |
| CN112725348B (en) * | 2019-10-28 | 2022-04-01 | 安徽省农业科学院水稻研究所 | Gene and method for improving single-base editing efficiency of rice and application of gene |
| WO2021113611A1 (en) * | 2019-12-06 | 2021-06-10 | The General Hospital Corporation | Split deaminase base editors |
| EP4069282A4 (en) * | 2019-12-06 | 2023-11-08 | The General Hospital Corporation | FRACTIONATED DEAMINASE BASE EDITORS |
| EP4093879A4 (en) * | 2020-01-25 | 2024-02-28 | The Trustees of the University of Pennsylvania | Compositions for small molecule control of precise base editing of target nucleic acids and methods of use thereof |
| US20250011748A1 (en) * | 2020-01-28 | 2025-01-09 | The Broad Institute, Inc. | Base editors, compositions, and methods for modifying the mitochondrial genome |
| EP4103705A4 (en) * | 2020-02-14 | 2024-02-28 | Ohio State Innovation Foundation | NUCLEOBASE EDITORS AND METHODS OF USE THEREOF |
| US12416001B2 (en) | 2020-02-14 | 2025-09-16 | Ohio State Innovation Foundation | Nucleobase editors and methods of use thereof |
| US12565666B2 (en) | 2020-03-04 | 2026-03-03 | Flagship Pioneering Innovations Vi, Llc | Methods and compositions for modulating a genome |
| US12065669B2 (en) | 2020-03-04 | 2024-08-20 | Flagship Pioneering Innovations Vi, Llc | Methods and compositions for modulating a genome |
| US12037602B2 (en) | 2020-03-04 | 2024-07-16 | Flagship Pioneering Innovations Vi, Llc | Methods and compositions for modulating a genome |
| US12031126B2 (en) | 2020-05-08 | 2024-07-09 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
| WO2022008466A1 (en) | 2020-07-06 | 2022-01-13 | Wageningen Universiteit | Base editing tools |
| US12319938B2 (en) | 2020-07-24 | 2025-06-03 | The General Hospital Corporation | Enhanced virus-like particles and methods of use thereof for delivery to cells |
| WO2022050377A1 (en) | 2020-09-04 | 2022-03-10 | 国立大学法人広島大学 | Method for editing target dna, method for producing cell having edited target dna, and dna edition system for use in said methods |
| KR20230058482A (en) | 2020-09-04 | 2023-05-03 | 고쿠리츠다이가쿠호진 히로시마다이가쿠 | Target DNA editing method, target DNA-edited cell production method, and DNA editing system used therefor |
| KR20220053097A (en) * | 2020-10-21 | 2022-04-29 | 성균관대학교산학협력단 | Vector expressing cytosine base editor without off-target effect without reduction of on-target efficiency in industrial strains and uses thereof |
| KR102399035B1 (en) | 2020-10-21 | 2022-05-17 | 성균관대학교산학협력단 | Vector expressing cytosine base editor without off-target effect without reduction of on-target efficiency in industrial strains and uses thereof |
| WO2023122722A1 (en) * | 2021-12-22 | 2023-06-29 | Sangamo Therapeutics, Inc. | Novel zinc finger fusion proteins for nucleobase editing |
| WO2024226156A1 (en) * | 2023-04-27 | 2024-10-31 | University Of Massachusetts | Cas-embedded cytidine deaminase ribonucleoprotein complexes having improved base editing specificity and efficiency |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3630849A4 (en) | 2021-01-13 |
| US20200140842A1 (en) | 2020-05-07 |
| CA3063733A1 (en) | 2018-11-29 |
| EP3630849A1 (en) | 2020-04-08 |
| AU2018273986A1 (en) | 2019-12-12 |
| JP2020521446A (en) | 2020-07-27 |
| US20200172885A1 (en) | 2020-06-04 |
| CA3063449A1 (en) | 2018-11-29 |
| EP3630198A4 (en) | 2021-04-21 |
| EP3630970A2 (en) | 2020-04-08 |
| EP3630198A1 (en) | 2020-04-08 |
| JP7324713B2 (en) | 2023-08-10 |
| AU2018272067B2 (en) | 2024-07-18 |
| AU2018272067A1 (en) | 2019-11-28 |
| WO2018218188A2 (en) | 2018-11-29 |
| CN110959040A (en) | 2020-04-03 |
| CA3064828A1 (en) | 2018-11-29 |
| WO2018218206A1 (en) | 2018-11-29 |
| US20200172895A1 (en) | 2020-06-04 |
| JP2023113672A (en) | 2023-08-16 |
| JP2023126956A (en) | 2023-09-12 |
| JP2020521451A (en) | 2020-07-27 |
| CN110997728A (en) | 2020-04-10 |
| AU2018273968A1 (en) | 2019-11-28 |
| JP2020521454A (en) | 2020-07-27 |
| CN111093714A (en) | 2020-05-01 |
| EP3630970A4 (en) | 2020-12-30 |
| US20220275356A1 (en) | 2022-09-01 |
| US11326157B2 (en) | 2022-05-10 |
| WO2018218188A3 (en) | 2019-01-03 |
| CN110959040B (en) | 2024-11-12 |
| AU2024227270A1 (en) | 2024-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200172895A1 (en) | Using split deaminases to limit unwanted off-target base editor deamination | |
| US12590299B2 (en) | Variants of CRISPR from Prevotella and Francisella 1 (Cpf1) | |
| US11946040B2 (en) | Adenine DNA base editor variants with reduced off-target RNA editing | |
| US10633642B2 (en) | Engineered CRISPR-Cas9 nucleases | |
| EP4021945A2 (en) | Combinatorial adenine and cytosine dna base editors | |
| US20200172899A1 (en) | Epigenetically Regulated Site-Specific Nucleases | |
| EP4022053A1 (en) | C-to-g transversion dna base editors | |
| US20170058271A1 (en) | Engineered CRISPR-Cas9 Nucleases | |
| WO2020077138A2 (en) | Selective curbing of unwanted rna editing (secure) dna base editor variants | |
| US20230024833A1 (en) | Split deaminase base editors | |
| WO2024086845A2 (en) | Engineered casphi2 nucleases | |
| BASE | Adenine Dna Base Editor Variants With Reduced Off-target Rna Editing | |
| WO2025171041A1 (en) | Engineered casphi2 (cas12j-2) proteins |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18805050 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 3063449 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2019564864 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2018273968 Country of ref document: AU Date of ref document: 20180525 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 2018805050 Country of ref document: EP Effective date: 20200102 |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 2018805050 Country of ref document: EP |




























