WO2018212627A1 - Mutant microorganism having enhanced succinic acid production capacity and succinic acid production method using same - Google Patents

Abstract

The present invention relates to a mutant microorganism having enhanced succinic acid production capacity and a succinic acid production method using the same. The present invention has the effect of obtaining a mutant microorganism that decreases in the production of fermented products such as lactic acid, ethanol, etc., but produces succinic acid at a high concentration due to the mutation of a transcription regulator factor associated with microbial sugar transport as a result of adaptive evolution upon deletion of a gene involved in the sugar transport in an anaerobic condition and of providing a method in which the obtained mutant microorganism is cultured to produce succinic acid at high yield or with high productivity.

Description

Mutant microorganism with improved succinic acid production capacity and succinic acid production method using the same

The present invention relates to a method for producing a mutant microorganism having high succinic acid production capacity, and more particularly, by selecting and evolving a microorganism lacking genes involved in sugar transport under anaerobic conditions, selecting a fast-growing mutant strain. It relates to a microbial evolution engineering method for producing a fermentation product succinic acid in high yield or high productivity by culturing the strain artificially introduced strains identified in strains or mutant strains under anaerobic conditions.

Succinic acid is a four-carbon dicarboxylic acid, an organic acid with high industrial and economic value, widely used as a precursor for chemicals used in medicine, food, cosmetics and other industries. Specifically, 1,4-butanediol (BDO), tetrahydrofuran (THF), gamma-butyrolactone (GBL), 2-pyrrolidone (C4 series chemicals) 2-pyrrolidone) and can be used as a raw material for the production of polybutyrene succinate (PBS) and various polyesters, a kind of biodegradable polymer. Large industrial applicability.

Most of succinic acid currently used commercially is converted to maleic anhydride produced by petrochemical process into succinic anhydride by liquid phase hydrogenation reaction. Converted to succinic acid through a hydration reaction and produced.

In nature, succinic acid is produced as an intermediate in the TCA cycle and also as a final metabolic product of anaerobic fermentation. Thus, succinic acid is produced from almost all microorganisms, from plants and animal cells, and in particular, it is known to produce a relatively large amount of succinic acid from bacteria isolated from rumens such as Aspergillus family of fungi and Actinobacillus and Mannheimia . Succinic acid production through fermentation includes actinobacillus , Anaerobiospirillum and Mannheimia Succinic acid production using the strain has been much research. American Michigan Biotechnology Institute (MBI) researchers Actinobacillus succinogenes A 130Z strain (ATCC No. 55618) was discovered to develop a succinic acid production process, and various mutant strains of Anaerobiospirillum succiniciproducens were developed using the classical chemical mutation method and used for the production and purification of succinic acid. In addition, KAIST's Sang-Yeop and his team identified the M. succiniciproducens MBEL55E (KCTC0769BP) strain, a lumen bacterium that exhibits succinic acid production, and published genomic sequences and metabolic characteristics. M. succiniciproducens LPK (KCTC10558BP), a mutant strain from which the lactic acid dehydrogenase gene ( ldhA ) and the pyruvate-formatease gene ( pfl ) was deleted, was further produced. Furthermore, the mutant strain M was inhibited to inhibit the production of acetic acid. . succiniciproducens Mutant strain M. succiniciproducens LPK7 (KCTC10626BP), in which phosphotransacetylacetylase gene ( pta ) and acetic acid kinase gene ( ackA ) were deleted from LPK, was produced and cultured in anaerobic conditions to prepare succinic acid. In addition, although the production of the by-products was suppressed in the above study, there was a problem that the growth rate of the strain was significantly lowered. However, through the subsequent study, the pyruvate-formic acid degrading enzyme gene ( pfl ) was not deleted in the M. succiniciproducens MBEL55E strain, and lactate dehydrogenation was performed. The enzyme gene ( ldhA ), phosphotransacetylacetylase gene ( pta ) and acetic acid kinase gene ( ackA ) produced a mutant strain M. succiniciproducens PALK (KCTC10973BP) that was deleted, and then the strain was subjected to glucose and glycerol in anaerobic conditions. Fermented by using as a carbon source to minimize the growth rate of microorganisms and at the same time developed a mutant microorganism and fermentation method that can produce succinic acid in high yield by completely blocking the production of various by-products including pyruvic acid.

Research on the production of succinic acid using recombinant Escherichia coli has been actively conducted, and a team of researchers from the University of Chicago, USA, removes genes ( ldhA and pflB ) that are involved in the production of lactic and formic acid in Escherichia coli, and at the same time, a glucose delivery system gene. to produce a (ptsG) Escherichia coli mutant strain AFP111 (ATCC No. 202021) was attempted to operate the increased acid production. Rhizobium, a research team at the University of Georgia making the AFP111 / pTrc99A-pyc strain by expressing pyruvate carboxylation gene (pyc) of etli in E. coli AFP111 strain of the strain, and by using this produced the acid.

As described above, attention is focused on microorganisms for producing succinic acid in high yield or high productivity, and research on the evolutionary engineering method for such microorganisms is required.

An object of the present invention is to provide a method for selecting a mutant microorganism strain showing a rapid growth rate and improved succinic acid production capacity by adaptively evolving a mutant microorganism strains genes related to the sugar transport system, and to identify a mutant target gene. It is another object of the present invention to provide a method for producing succinic acid in high yield or high productivity by anaerobic culture of a microorganism strain into which the adapted mutant microorganism or a mutant target gene is artificially introduced.

In order to solve the above problems, the invention is succinic acid producing ability improved, manX and ptsG gene is the or a further exuR or agaR gene deletion with the deletions of E. coli K-12 strain, exuR and agaR genes are both deleted E. coli K-12 mutant Provide strains.

The present invention also provides a succinic acid producing ability improved, in addition to the E. coli C strain manX and ptsG gene deletion or exuR agaR gene is a deletion or, exuR and agaR genes are both deleted Escherichia coli mutant strain C.

In addition, the present invention provides an E. coli C mutant strain having improved succinic acid production ability, in which agaW , agaE , agaF and agaA are deleted in addition to the E. coli C variant strain.

The present invention also ptsI gene is provided an adaptive evolution (adaptive evolution) as a strain obtained by the culture method, it enhanced E. coli K-12 mutant strain further the exuR gene ability deletions, succinic acid production in E. coli K-12 strain deleted .

The present invention also provides a succinic acid producing ability improved, ptsI gene is additionally exuR gene is an E. coli K-12 mutant strain deleted in a deletion of E. coli K-12 strain BW25113.

In addition, the present invention provides a method for producing succinic acid comprising the step of culturing the mutant strains to obtain succinic acid from the culture.

The present invention relates to a mutant microorganism having improved succinic acid production capacity and a succinic acid production method using the same, wherein when a gene involved in sugar transport of a microorganism is deleted in anaerobic conditions, it is a mutation of a sugar transport-related transcriptional regulator produced by adaptive evolution. Due to the production of fermentation products, such as lactic acid, ethanol is reduced, obtain a mutant microorganism having the characteristic of producing succinic acid at a high concentration, and by culturing the mutant microorganism to provide a method for producing succinic acid in high yield or high productivity have.

Figure 1 shows the growth and fermentation products of the parent strains HK907, HK898 and HK864 strain over time.

2 shows growth curves of progeny strains to which HK907, HK898 and HK864 strains have been adapted.

Figure 3 shows the mRNA expression level of the exuT gene of wild type strain (BW25113), parent strain (HK907) and adapted progeny strain (HK953) of K-12 strain.

Figure 4 shows the mRNA expression level of the exuT gene of wild type strain (KCTC2571), parent strain (HK864) and adapted progeny strain (HK878) of C strain.

In the previous paper published in Metabolic Engineering 년 in 2013, the present inventors produced mutant strains of deletions of hundreds of genes at the genome level in Escherichia coli, and obtained the results of genome-level studies on the production patterns of fermentation products through anaerobic fermentation. . In this study, especially in the case of ptsG gene deletion mutant strains related to the glucose-specific sugar transport system, the growth of succinic acid production was confirmed and reported, although the growth of the strain was reduced compared to the wild-type strain and residuals remained. Kim, HJ, et al., Metab Eng, 2013).

In the above study, since the ptsG gene deletion strain was cultured only for 24 hours, it did not consume all the added glucose and there was a problem that the growth of the strain was not as good as that of the wild type strain. Therefore, the present invention was cultured until all the added glucose was consumed, from which the adapted progeny strains were obtained, and the strains were recovered through anaerobic culture, and the strains with improved succinic acid production capacity were selected. In addition, the genomes of the mutant strains were identified through genome sequencing of the parent strains and progeny strains, and the gene complementarity test was used to determine whether the mutations of the identified genes affected the increase in succinic acid production. In addition, a microbial evolution engineering method for producing a fermentation product succinic acid in high yield or high productivity by culturing the adapted progeny strain or artificially introduced strains identified in the progeny strain under anaerobic conditions was completed.

The present invention provides for further exuR gene is the E. coli K-12 mutant strain deleted for succinic acid production ability increased, the deletion manX E. coli ptsG gene and K-12 strains.

The present invention is further enhanced ability to produce succinic acid, and manX ptsG gene is deleted E. coli K-12 strain agaR Provided are E. coli K-12 variant strains that have been deleted.

The present invention is further exuR agaR and the succinic acid producing ability improved, manX ptsG gene and the E. coli K-12 strain BW25113 deletion Provided are E. coli K-12 variant strains that have been deleted.

The present invention also provides a succinic acid producing ability improved, manX ptsG gene and the gene deletion with the deletions are additionally exuR E. coli C strain E. coli C strain variation.

Preferably, the E. coli C variant strain is Escherichia coli HK1014 strain described in the embodiment of the present invention, deposited with accession number KCTC13265BP.

The present invention also provides a succinic acid producing ability improved, manX ptsG gene and the gene deletion with the deletions are additionally agaR E. coli C strain E. coli C strain variation.

The present invention is further exuR agaR and the E. coli C strain with an improved, manX ptsG gene and acid production ability deletion Provided are E. coli C variant strains that have been deleted.

The invention also exuR agaR and the E. coli C strain is improved, and ptsG gene manX acid production ability deletion In addition to the E. coli C mutant strains, which are gene deleted, an E. coli C mutant strain lacking agaW , agaE , agaF and agaA is provided.

Preferably, the E. coli C variant strain is Escherichia coli HK1017 strain described in the embodiment of the present invention, deposited with accession number KCTC13266BP.

The present invention also ptsI gene is provided an adaptive evolution (adaptive evolution) as a strain obtained by the culture method, it enhanced E. coli K-12 mutant strain further the exuR gene ability deletions, succinic acid production in E. coli K-12 strain deleted .

Specifically, the adaptive evolution culture method may be cultured under anaerobic conditions in a medium containing kanamycin, but is not limited thereto.

Preferably, the E. coli K-12 variant strain is Escherichia coli HK950 strain described in the embodiment of the present invention, deposited with accession number KCTC13264BP.

In addition, the present invention provides an E. coli K-12 mutant strain, in which exuR gene is deleted, in addition to the E. coli K-12 strain, which is deleted from ptsI gene, which has improved succinic acid production capacity.

Glucose and town North specific leader transport system genes ptsG and manX was E. coli K-12 BW25113 strain, leader transport system complex in which Escherichia coli K-12 BW25113 strain and that E. coli C strain deleted for ptsG deleting a gene ptsI constituting the deletion per When (KCTC2571) is cultured under anaerobic conditions, the growth rate of the strain is reduced. Under the condition that the strain growth rate is lowered, the culture solution is plated on a solid medium at the time when 50 mM of all the glucose added by anaerobic culture is continuously consumed to obtain progeny strain. When the progeny strains thus obtained were again anaerobicly cultured under the same conditions, the growth rate of the strain was restored, and mutant strains with increased production capacity of succinic acid could be selected.

Specifically, Escherichia coli K-12 BW25113 Δ ptsG Δ manX The strain produced no lactic acid from 50 mM glucose and succinic acid produced 31 mM, but it took 84 hours to consume all the glucose. On the contrary, the adapted progeny strains consumed all of the glucose within 36 hours and grew faster than the parent strains. Also, the production of formic acid and ethanol was significantly decreased, and lactic acid, a byproduct, was not produced. The yield was further improved and found to be 36.7-40.3 mM. In addition, E. coli K-12 BW25113 Δ ptsI The strain produced no lactate and 53 mM succinic acid from 50 mM glucose, but it took 96 hours to consume all the glucose. On the contrary, the adaptation of the progeny strains took 48 hours to consume all the glucose and grew faster than the parent strains. By-products showed no production of lactic acid and very low production of formic acid and ethanol. Was very improved and found to be 51.9-54.4 mM.

In addition, the E. coli C (KCTC2571) Δ ptsG strain took 66 hours to consume all 50 mM glucose and produced 22.7 mM succinic acid, but the adapted progeny strain took 12 hours to consume all 50 mM glucose. Succinic acid has been shown to produce 18.6-20.3 mM. Thus, the yield of succinic acid produced per hour, ie productivity.

Genomes of the selected mutant progeny strains were analyzed using next-generation sequencing technology to compare and analyze the genome sequences of the parent strains to identify the target genes for which the mutations were generated.E. Coli K-12 BW25113 Δ ptsG If Δ is manX adaptive evolution was confirmed that a mutant gene is created on exuR, it was confirmed that the mutant gene is created on exuR even when the E. coli K-12 Δ BW25113 ptsI is adaptive evolution. In addition, E. coli C (KCTC2571) Δ ptsG Adaptive Evolution from Strains Mutations in the agaR gene were identified. Complementation tests show that exuR and agaR mutations can be found in E. coli K-12 BW25113 Δ ptsG With Δ manX E. coli C (KCTC2571) Δ ptsG It was confirmed that to increase the growth rate of the strain, and to increase the production and productivity of succinic acid from glucose, respectively.

In particular, E. coli C (KCTC2571) Δ ptsG Δ agaR (aga- gam-) Δ exuR For the strain, it took 36 hours to consume all 50 mM glucose, succinic acid produced 42 mM to increase the yield of succinic acid, succinic acid productivity was significantly improved to 1.16 (mM / h).

Also exuR and agaR It was confirmed by qRT-PCR that the amount of mRNA of the genes exuT , agaV , agaB genes which are inhibited by the transcription regulators increased due to mutation of the ExuR and AgaR transcription regulators encoded by the gene. Thus it was when the transport system, such as a gene per ptsG, manX, ptsI deletion through a transport protein or Aga glucose transport protein complex per ExuT confirmed that the glucose into the cells can be transported.

In addition, the present invention comprises the steps of culturing the variant strain; And it provides a method for producing succinic acid comprising the step of obtaining succinic acid from the culture.

In detail, the culturing may be performed under anaerobic conditions.

In conclusion, by using the adaptive evolution of E. coli strains lacking the sugar transport-related genes, a gene capable of improving succinic acid production was selected and introduced into the E. coli strain, resulting in a greatly improved succinic acid production capacity. . As described above, the present invention provides a mutant microorganism having improved succinic acid production ability using evolutionary engineering and a succinic acid production method using the same.

In the present invention, the NCBI Gene ID of the gene having the mutation is as follows. manX (Gene ID: 946334), ptsG (Gene ID: 945651), exuR (Gene ID: 947602), agaR (Gene ID: 947636), agaW (Gene ID: 947647), agaE (Gene ID: 916505), agaF (Gene ID: 916152), agaA (Gene ID: 947646), and ptsI (Gene ID: 946879).

In the present invention, the newly identified “ExuT” sugar transport protein and “Aga” sugar transport protein complex using adaptive evolution may be the target of new metabolic engineering. In particular, it can be used to increase the production of succinic acid by introducing into various existing E. coli strains that have been developed as succinic acid producing strains. In addition, the glucose transport system of the present invention may be used to increase succinic acid production in succinic acid-producing ruminants.

In the present invention, the term 'deletion' is a concept encompassing a part or whole base of the gene, mutating, substituting or deleting, or introducing some base so that the gene is not expressed or does not exhibit enzymatic activity even when expressed. It includes everything that blocks the biosynthetic pathways involved in the enzymes of the gene.

In addition, the parent strain in the present invention is a strain in which the growth rate of the microorganism is reduced or does not produce the desired fermentation product well, both wild-type or specific gene mutants. In addition, the progeny strain had a mutation not possessed in the genome of the parent strain, so that the growth rate of the strain was recovered faster than that of the parent strain, and the desired fermentation product had a high yield or high productivity. It is a strain produced by. In addition, the adaptive evolution is a process of obtaining the offspring strains which have been grown at a rapid growth rate by culturing the parent strains with low growth rate until the carbon source such as glucose is depleted, and then spreading them on a solid medium.

In the present invention, the medium used for the adaptive evolution is not particularly limited, but the glucose concentration is preferably 8-20 g / L, most preferably 9 g / L as the initial carbon source, and the culture is 35-45. It can be carried out under a temperature of ℃, preferably 35 ~ 39 ℃, most preferably 37 ℃, and initial pH conditions of 6.0 ~ 7.5, preferably 6.3 ~ 6.7, most preferably 6.5. In addition, the culture is preferably carried out under anaerobic conditions, anaerobic conditions can be formed by supplying nitrogen to the head space of the incubator, by adding Na ₂ S to remove dissolved oxygen in the liquid medium. The incubator is not particularly limited but may exemplify a serum bottle.

Hereinafter, examples will be described in detail to help understand the present invention. However, the following examples are merely to illustrate the content of the present invention is not limited to the scope of the present invention. The embodiments of the present invention are provided to more completely explain the present invention to those skilled in the art.

< Example  1> Party transport system  Gene deletion Fungus  Production department Anaerobic Culture

Each single and multiple mutant genes were introduced into the genome of the microbial strain using homologous recombination through the P1 transduction method. Preparation of P1 lysate for P1 transduction was performed as follows. First, ptsG related to sugar transport system And mutant E. coli strain in ptsI gene is replaced with the kanamycin (kanamycin) resistance gene (E. coli Δ ptsG :: KmR, E. coli Δ ptsI :: KmR) was obtained through the KEIO collection, kanamycin is 25 ㎍ each strain Smear LB solid medium containing / ml, incubated single colonies in 25 ml LB liquid medium containing 0.01 M MgSO ₄ , 0.005 M CaCl ₂ and incubated at 37 ℃ until OD _600nm becomes 0.4, To inoculate 250 μl of P1 bacteriophage to dissolve each mutant strain, the cells were further incubated at 37 ° C. for 4 hours. 500 μl of chloroform was mixed in a 25 ml culture in which the strain was dissolved, followed by centrifugation at 3000 rpm for 10 minutes to obtain the supernatant except the lysed cell precipitate, which was mutated and the single deletion genotype (Δ ptsG :: KmR was dissolved. , P1 Lysate containing P1 bacteriophage with Δ ptsI :: KmR).

K-12 BW25113 (CGSC7636, The Coli Genetic Stock Center, Yale University) wild type strains to infect the prepared P1 lysate to induce gene deletion were cultured by inoculating LB liquid medium containing 0.01 M MgSO ₄ , 0.005 M CaCl ₂ . centrifuged at 5000 rpm after which the medium was removed, and the precipitate was suspended in the cell (cell pellets) of _{0.01 M MgSO 4, 0.005 1 ㎖} LB broth containing the M CaCl _2. After mixing 100 μl each of the P1 lysate prepared above and the wild type strain to introduce the gene deletion, incubate at 37 ° C. for 20 minutes, add 100 μl of 1 M Na ⁺ · Citrate · 2H ₂ O and mix well to obtain 25 μg / ml. Staining LB solid medium containing kanamycin and incubating at 37 ° C. to prepare the respective E. coli strains HK620 and HK898 in which the deletion of the gene substituted with kanamycin resistance (Δ ptsG :: KmR, Δ ptsI :: KmR) was introduced. It was.

Glucose and manos sugar-specific sugar transport genes ptsG And manX Both E. coli K-12 BW25113 strains were prepared as follows. first, A single deletion mutant strain in which each manX gene was substituted with a kanamycin resistance gene was obtained from the KEIO collection. PK20 (CGSC7629, The Coli Genetic Stock Center, Yale University) was transformed into the HK620 strain prepared by the above P1 transduction, and plated on 50 μg / mL of ampicillin (ampicillin) in an LB solid medium. Homologous recombination of the sequences was induced to construct an HK812 strain (E. coli K-12 BW25113 Δ ptsG ), in which only the kanamycin resistance gene was deleted. In other words, strain HK812 has a ptsG gene deletion but kanamycin resistance does not possess. These HK812 strain to accommodate strain and, manX deletion mutant strain (Δ manX :: KmR) to infect a P1 lysate prepared by a donor strain by P1 transduction of the E. coli K-12 performed BW25113 Δ Δ ptsG manX :: KmR A strain was produced and named parent strain HK907.

Escherichia coli C (KCTC2571, Korean Collection for Type Cultures) strain which deleted glucose specific ptsG was prepared as follows. To the ptsG single deletion mutation in the E. coli C strain wild-type strain to accommodate the donor strain HK864 strain was produced by performing the P1 transduction As a result, a parent strain. By the way, in the case of E. coli strain C, manX , a sugar-specific gene for sugar transport, It is already inactivated due to IS insertion into the gene.

The prepared parent strains HK907, HK898, and HK864 were plated on LB solid medium containing kanamycin at 25 μg / mL, respectively, and inoculated with 5 mL of LB liquid medium, and grown at 37 ° C. for 12 hours. Medium to the fermentation culture medium (glucose, 9g (final 50 mM ); yeast extract, 5g; NaHCO 3, 10g; NaH 2 PO 4 · H 2 O, 8.5g; K 2 HPO 4, 15.5g per liter (pH7.0 1) Inoculate 1 ml into a 125 ml serum bottle containing 100 ml, add 1 ml of Na ₂ S, seal it, and fill the upper layer with nitrogen gas to remove oxygen from the serum bottle and incubate at 37 ° C. Strain growth and fermentation products were analyzed every 6 hours. For growth and fermentation analysis of strains, 1 ml of each strain was taken, 100 ul was diluted 1:10 in PBS, and the OD _600nm value was measured to analyze the growth of the strain. The remaining culture was 10 minutes at 12000 rpm. Centrifuge and filter the culture using a 0.2 um nylon filter and use this filtrate for HPLC analysis. Glucose, succinic acid, lactic acid, formic acid, acetic acid and ethanol were analyzed using an Aminex HPX-87H column (Bio-rad) and 0.1 NH ₂ SO ₄ solution as the mobile phase.

Figure 1 shows the growth and fermentation yield of the parent strain under anaerobic conditions of HK907, HK898 and HK864. As shown in FIG. 1, the growth of the strain was observed after the HK907 strain had a delay period of about 48 hours, and it took 84 hours to consume all 50 mM glucose, wherein the succinic acid production was 31.7 mM, and the HK898 strain was about After 54 hours of delay, the growth of the strain was observed and it took 96 hours to consume all 50 mM glucose, with succinic acid production of 53.5 mM. In addition, the growth of the strain was observed after the HK864 strain had a delay period of about 36 hours, it took 66 hours to consume all 50 mM glucose, the succinic acid production was 22.7 mM (Fig. 1).

< Example  2> adapted Progeny  Succinic Acid Production and Productivity Improvement

Single culture colonies of progeny strains are obtained by spreading the culture medium of the parent strains that have consumed all of the glucose of Example 1 onto LB solid medium. Single progeny colonies of each progeny strain were precultured in the same manner as the parent strain, and were anaerobicly cultured in fermentation broth. As a result of the culture, it was confirmed that all of the added glucose was consumed by selecting strains having no delay and growth rate among progeny strains (FIG. 2).

HK907 progeny strains (HK953, HK954, HK955, HK956, HK957, HK958) were selected and consumed all of the glucose within 36 hours of anaerobic culture. . Therefore, compared to the parent strain HK907, the incubation time of the progeny strains was reduced by 48 hours, the production of succinic acid was increased by 5 ~ 8.6 mM, and the productivity of succinic acid was also increased.

Escherichia coli K-12 strain	genotype	OD 600	Fermentation Concentration (mM)						Time (h) †	Succinic Acid Productivity (mM / h)
			glucose	Acetic acid	ethanol	Formic acid	Lactic acid	Succinic acid
BW25113	Wild-type	5.6	ND§	34.2	34.0	61.7	9.6	5.1	6	0.85
HK620	Δ ptsG :: KmR	2.7	ND	40.8	29.1	58.3	5.2	21.8	48	0.45
HK907 (parent strain)	Δ ptsG Δ manX :: KmR	3.0	ND	44.7	18.5	58.5	ND	31.7	84	0.38
HK953 (offspring strain)	Δ ptsG Δ manX :: KmR	4.3	ND	38.7	11.5	39.9	ND	36.7	36	1.02
HK954 (offspring strain)	Δ ptsG Δ manX :: KmR	4.3	ND	38.6	11.6	39.5	ND	36.9	36	1.03
HK955 (offspring strain)	Δ ptsG Δ manX :: KmR	4.5	ND	34.4	15.8	28.8	ND	38.3	36	1.06
HK956 (offspring strain)	Δ ptsG Δ manX :: KmR	4.3	ND	33.9	16.9	25.7	ND	40.2	36	1.12
HK957 (offspring strain)	Δ ptsG Δ manX :: KmR	4.3	ND	33.7	17.1	25.1	ND	40.3	36	1.12
HK958 (offspring strain)	Δ ptsG Δ manX :: KmR	4.2	ND	34.1	16.8	26.5	ND	39.8	36	1.11
† Indicates time spent consuming all 50 mM added. § ND, Not detected.

In addition, six HK898 progeny strains (HK947, HK948, HK949, HK950, HK951, HK952) were selected, consumed all the glucose within 48 hours of anaerobic culture, and succinic acid production was found to be 51.9-54.4 mM (Table 1). 2). Therefore, compared to the parent strain HK898, the incubation time of the progeny strains was shortened by 48 hours, the production of succinic acid is almost no difference, but succinic acid productivity was increased.

Escherichia coli K-12 strain	genotype	OD 600	Fermentation Concentration (mM)						Time (h) †	Succinic Acid Productivity (mM / h)
			glucose	Acetic acid	ethanol	Formic acid	Lactic acid	Succinic acid
BW25113	Wild-type	5.6	ND§	34.2	34.0	61.7	9.6	5.1	6	0.85
HK898 (parent strain)	Δ ptsI :: KmR	2.2	ND	27.5	1.8	30.5	ND	53.4	96	0.56
HK947 (offspring strain)	Δ ptsI :: KmR	3.1	ND	29.1	5.8	5.1	ND	52.8	48	1.10
HK948 (offspring strain)	Δ ptsI :: KmR	3.0	ND	29.6	5.0	6.4	ND	52.6	48	1.10
HK949 (offspring strain)	Δ ptsI :: KmR	2.9	ND	29.3	5.1	6.1	ND	52.8	48	1.10
HK950 (offspring strain)	Δ ptsI :: KmR	2.9	ND	29.7	5.1	7.7	ND	51.9	48	1.08
HK951 (offspring strain)	Δ ptsI :: KmR	2.9	ND	29.6	5.9	3.8	ND	54.4	48	1.13
HK952 (offspring strain)	Δ ptsI :: KmR	2.9	ND	30.8	5.1	9.5	ND	51.9	48	1.08
† Indicates time spent consuming all 50 mM added. § ND, Not detected.

In addition, four progeny strains of HK864 (HK878, HK879, HK880, HK881) were selected, and these progeny strains consumed all the glucose at 12 hours, and the production of succinic acid was 18.6 ~ 20.3 mM (Table 3). ). Therefore, compared to the parent strain HK864, the growth time of the progeny strains was shortened by 54 hours. Thus, the production of succinic acid per hour, that is, the productivity (productivity) increased by about 4.6-5 times.

E. coli strain	genotype	OD 600	Fermentation Concentration (mM)						Time (h)	Succinic Acid Productivity (mM / h)
			glucose	Acetic acid	ethanol	Formic acid	Lactic acid	Succinic acid
KCTC2571	manX :: IS	5.4	ND§	32.4	29.2	54.2	17.4	6.2	6	1.03
HK864 (parent strain)	manX :: ISΔ ptsG :: KmR	3.5	ND	38.9	29.8	50.8	4.2	22.7	66	0.34
HK878 (offspring strain)	manX :: ISΔ ptsG :: KmR	5.5	ND	40.0	27.0	60.7	1.5	20.3	12	1.69
HK879 (offspring strain)	manX :: ISΔ ptsG :: KmR	5.5	ND	35.3	33.2	38.1	1.6	20.2	12	1.68
HK880 (offspring strain)	manX :: ISΔ ptsG :: KmR	5.6	ND	36.9	31.9	53.4	1.3	20.0	12	1.67
HK881 (offspring strain)	manX :: ISΔ ptsG :: KmR	5.2	ND	40.2	31.5	62.7	2.3	18.6	12	1.55
† Indicates time spent consuming all 50 mM added. § ND, Not detected.

Example 3 Identification of Mutant Genes of Progeny Strains by Genomic Analysis

Mutant target genes were identified through genome analysis of progeny strains with increased growth and increased succinic acid production. Single colonies of parent strains (HK907, HK878, HK864) and progeny strains (HK956, HK949, HK878, HK881) to be used for genome analysis were inoculated in 5 ml LB liquid medium, incubated at 37 ° C for 16 hours, and 1 ml of the culture was 3000 rpm, The supernatant was removed by centrifugation for 10 minutes and the cells were recovered. Cells were isolated from strain genomic DNA using Wizard Genomic DNA purification kit (Promega). For genome analysis, HiSeq2000, a large-capacity genome detoxification instrument, was used, and the library production was in compliance with Illumina's standard method (A260 / 280 ratio of Sample DNA over 1.8, minimum concentration over 100 ng / μl, total amount over 5 μg), Pretreatment of the sequence data and assembly of sequence fragments were performed to compare and analyze the genome sequences of the parent strain and the genome sequences of the progeny strain to identify newly acquired mutations in the progeny strain.

Genomic sequencing revealed that exuR, which encodes the transcriptional regulator ExuR protein, in HK956, the offspring of HK907. It was confirmed that 5 bases were deleted after the 431 base of the gene. Based on this, exuR in other progeny strains HK953, HK954, HK955, HK957, and HK958 ExuR when the sequence was analyzed by sanger sequencing method by amplifying the gene region by PCR It was confirmed that there are other types of mutations in the genes (Table 4).

Strain		genotype	Adaptive evolution mutations
Escherichia coli K-12 strain	BW25113	Wild-type	-
	HK620	Δ ptsG :: KmR	-
	HK907 (parent strain)	Δ ptsG Δ manX :: KmR	-
	HK953 (offspring strain)	Δ ptsG Δ manX :: KmR	exuR G500A (W167Z)
	HK954 (offspring strain)	Δ ptsG Δ manX :: KmR	exuR T467A (L159Q)
	HK955 (offspring strain)	Δ ptsG Δ manX :: KmR	exuR :: IS30
	HK956 * (offspring strain)	Δ ptsG Δ manX :: KmR	exuR 5 bp deletion after T431
	HK957 (offspring strain)	Δ ptsG Δ manX :: KmR	exuR :: IS60 (1226 bp) after C360
	HK958 (offspring strain)	Δ ptsG Δ manX :: KmR	exuR T167A (L56Q)
* Strains were subjected to genome analysis.

Then, in the progeny of the HK898 strain HK949 exuR that encoding a transcription factor protein ExuR It was confirmed that 127 bases were deleted after base 531 of the gene. Based on this, exuR in other progeny strains HK947, HK948, HK950, HK951, and HK952 ExuR when the sequence was analyzed by sanger sequencing method by amplifying the gene region by PCR It was confirmed that there are other types of mutations in the genes (Table 5).

Strain		genotype	Adaptive evolution mutations
Escherichia coli K-12 strain	BW25113	Wild-type	-
	HK898 (parent strain)	Δ ptsI :: KmR	-
	HK947 (offspring strain)	Δ ptsI :: KmR	exuR C304T (Q102Z † )
	HK948 (offspring strain)	Δ ptsI :: KmR	exuR C304T (Q102Z)
	HK949 * (offspring strain)	Δ ptsI :: KmR	exuR 127 bp deletion after A531
	HK950 (offspring strain)	Δ ptsI :: KmR	exuR :: IS1 (777 bp) after A171
	HK951 (offspring strain)	Δ ptsI :: KmR	exuR :: IS5 (1200 bp) after G616
	HK952 (offspring strain)	Δ ptsI :: KmR	exuR :: IS5 (1200 bp) after G616
* Strains were subjected to genome analysis. † Z is a premature termination due to a stop codon due to mutation.

In addition, in HK878, a progeny strain of HK864, 256 bp sequences (C239 to C494) of the agaR gene encoding the N-Acetylgalactosamine inhibitor were repeated. In HK881, agaR Mutations in which the 469th base of the gene was substituted for G to A were identified. When agaR gene regions of HK879 and HK880, which are different progeny strains, were amplified by PCR and analyzed by sequencing method, it was confirmed that different base substitution mutations were introduced (Table 6).

Strain		genotype	Adaptive evolution mutations
Escherichia coli C strain	KCTC2571	manX :: IS	-
	HK864 (parent strain)	manX :: ISΔ ptsG :: KmR	-
	HK878 * (offspring strain)	manX :: ISΔ ptsG :: KmR	tandem repeats (C239-C494) in agaR
	HK879 (offspring strain)	manX :: ISΔ ptsG :: KmR	agaR C398A (A133E)
	HK880 (offspring strain)	manX :: ISΔ ptsG :: KmR	agaR C203T (A68V)
	HK881 * (offspring strain)	manX :: ISΔ ptsG :: KmR	agaR G469A (G157R)
* Strains were subjected to genome analysis.

Therefore, ptsG, manX plurality deletion BW25113 parent strain BW25113 and ptsI single deletions by the adaptive evolution in anaerobic conditions from the parent strain to grow faster and succinic acid production and the increased productivity progeny strains is exuR Was confirmed to have a mutation of a gene, ptsG manX plurality deletion of E. coli C parent strain was confirmed that the succinic acid productivity is significantly increased by the mutation of the gene agaR.

<Example 4> exuR  And agaR  Increasing Succinate Production Through Mutation of Genes

ExuR and agaR to determine if the identified mutant traits affect the growth recovery and succinic acid production of the strain compared to the parent strain A single gene deletion was intended to be introduced into the parent strain. HK907 strain, a parent strain of K-12 BW25113, and HK864 strain, a strain of C (KCTC2571) strain, were used to remove the kanamycin antibiotic resistance gene using the pCP20 plasmid as in Example 1 above. HK918 and HK902 strains were produced, respectively. P1 lysate was prepared by infecting HK918 strain with exuR single gene deletion trait, and P1 transduction was performed. In the background of E. coli K-12 BW25113 strain, ptsG, manX And an HK966 strain with exuR gene deletion mutations.

In addition, the HK918 strain ptsG, manX agaR deletion and gene deletion and aga An HK923 strain into which the gene group constituting the operon ( agaWEFA ) was introduced was prepared. aga The gene group constituting the operon ( agaWEFA ) is deleted in the K-12 BW25113 strain, and thus the agaR gene, which is a gene encoding a transcriptional regulator, is deleted. In order to introduce glucose into cells through the Aga sugar transport protein complex encoded by the aga operon, a gene group constituting the aga operon was introduced into the K-12 BW25113 strain. Specifically, the K-12 BW25113 strain in which the agaR gene region was substituted with kanamycin was obtained from the KEIO collection, and PCR amplified to include the agaR :: KmR region, thereby obtaining a PCR product, and containing the αβγ gene of lambda phage, thus homologous linear DNA. the HK902 strain which is transformed with the plasmid pKD46 to induce recombination of the introduced PCR products via electroporation to obtain a C (KCTC2571) strain HK919 strain which is substituted with a gene agaR kanamycin antibiotic resistance gene. P1 bacteriophage was infected with HK909 strain to prepare P1 lysate, which was then introduced into the HK918 strain, which is a receiving strain of K-12 BW25113, to prepare a HK923 strain. The resulting HK966 and HK923 strains were cultured under anaerobic conditions to analyze the growth of the strain and the organic acid of the final fermentation product. The presence or absence of aga operon gene group is represented by aga + gam + or aga-gam- respectively.

The HK966 strain took 36 hours to consume 50 mM glucose, remained 2.3 mM of residual sugar, and produced 33.0 mM of succinic acid without lactic acid. Thus, succinic acid production increased 1.3 mM and productivity increased 2.4 times compared to HK904 parent strain.

In addition, in the case of HK923 strain, it took 18 hours to consume all 50 mM glucose, produced 1.9 mM lactic acid and produced 12.3 mM succinic acid. In through the results of E. coli K-12 strain BW25113 background in case of ptsG, manX gene deletion exuR It can be seen that the production of succinic acid increases when the gene deletion is introduced, The growth rate was very fast due to agaR gene deletion and introduction of aga operon, but no increase in succinic acid production was observed.

Escherichia coli K-12 strain		OD 600	Fermentation Concentration (mM)						Time (h)	Succinic Acid Productivity (mM / h)
			glucose	Acetic acid	ethanol	Formic acid	Lactic acid	Succinic acid
BW25113	Wild-type	5.6 ± 0.1	ND	34.2 ± 0.2	34.0 ± 0.4	61.7 ± 0.2	9.6 ± 0.2	5.1 ± 0.1	6	0.85
HK907	BW25113 Δ ptsG Δ manX	3.0 ± 0.1	ND	44.6 ± 0.2	18.5 ± 0.6	58.5 ± 0.7	ND	31.7 ± 0.6	84	0.38
HK966	BW25113 Δ ptsG Δ manX Δ exuR	4.3 ± 0.2	2.3 ± 0.3	32.8 ± 0.3	25.0 ± 0.3	24.9 ± 0.3	ND	33.0 ± 0.4	36	0.92
HK923	BW25113 ptsG Δ Δ Δ manX agaR (aga gam + +)	4.7 ± 0.1	ND	41.1 ± 0.8	37.5 ± 0.1	56.2 ± 0.6	1.9 ± 0.1	12.3 ± 0.3	18	0.68

HK919 strains with ptsG and agaR deletion mutations in the E. coli C (KCTC2571) strain background were prepared as above, and HK1014 strains with ptsG and exuR deletion mutations prepared P1 lysate with exuR single gene deletion trait and were the recipient strains. It was obtained by infection with HK902 and P1 transduction. In addition, the strains HK1017 and HK1015 deleted ptsG , agaR and exuR were prepared as follows. P1 lysate with exuR single gene deletion trait was prepared and ptsG , agaR and exuR were carried out by H1 and B1 strains containing HK976 strain resistant to kanamycin antibiotic resistance using pCP20 plasmid in HK919. A (aga + gam +) HK1015 strain was produced having agaWEFA , a gene deleted and constituting an aga operon. Also, exuR with a P1 lysate with a single gene-deficient trait at HK912 using pCP20 plasmid by the HK1016 strain to remove the kanamycin antibiotic resistance gene into a receiving strain carried the P1 transduction with a gene agaWEFA constituting aga operon is deleted ( aga-gam-) HK1017 strain was prepared. HK1015 and HK1017 have different aga operons, and HK1017 strain is additionally added to transport glucose to the sugar transport protein ExuT due to the deletion of the transcriptional regulator ExuR. aga operon fruited . These strains were cultured under anaerobic conditions to analyze the growth of the strain and the organic acid of the final fermentation product. The results are shown in Table 8.

Escherichia coli C strain		OD 600	Fermentation Concentration (mM)						Time (h)	Succinic Acid Productivity (mM / h)
			glucose	Acetic acid	ethanol	Formic acid	Lactic acid	Succinic acid
KCTC2571	manX :: IS	5.4 ± 0.1	ND	32.4 ± 0.4	29.2 ± 0.2	54.2 ± 0.9	17.4 ± 0.1	6.2 ± 0.0	6	1.03
HK864	KCTC2571 Δ ptsG	3.5 ± 0.2	ND	38.9 ± 1.1	29.8 ± 2.2	50.8 ± 2.7	4.2 ± 0.5	22.7 ± 1.6	66	0.34
HK1014	KCTC2571Δ ptsG Δ exuR	4.1 ± 0.1	ND	32.2 ± 0.5	32.2 ± 0.9	20.2 ± 1.4	ND	34.4 ± 0.7	24	1.43
HK919	KCTC2571 Δ ptsG Δ agaR (aga + gam +)	5.8 ± 0.1	ND	39.8 ± 0.1	36.2 ± 0.1	55.0 ± 1.3	2.2 ± 0.0	16.8 ± 0.2	9	1.87
HK1015	KCTC2571Δ ptsG Δ agaR (aga + gam +) Δ exuR	5.2 ± 0.2	ND	40.4 ± 0.1	36.2 ± 0.6	50.0 ± 1.0	2.1 ± 0.1	17.0 ± 0.2	15	1.13
HK1017	KCTC2571 Δ ptsG Δ agaR (aga- gam-) Δ exuR	2.8 ± 0.1	ND	28.6 ± 0.2	21.9 ± 0.6	10.5 ± 0.1	ND	42.0 ± 0.3	36	1.16

The HK1014 strain, ptsG and exuR multiple deletion mutant Escherichia coli strain C, took 24 hours to consume 50 mM glucose, did not produce lactic acid, and produced 34.4 mM of succinic acid. Succinic acid productivity was significantly improved to 1.43 (mM / h). Also The HK919 strain, ptsG and agaR plural deletion mutant Escherichia coli strains, took 9 hours to consume all 50 mM glucose. When lactic acid was produced at 2.2 mM, succinic acid was produced at 16.8 mM. The amount of succinic acid produced was not large, but the growth rate was very fast, and it was confirmed that the productivity of succinic acid increased significantly to 1.87 (mM / h).

Also, ptsG, agaR exuR plurality deletion mutation in E. coli C strain Hayeoteul when introducing a gene deletion was confirmed that productivity is increased, this case showed that vary according to the productivity aga operon or not. aga in ptsG , agaR , exuR ascites deletion mutant The HK1015 strain with operon took 15 hours to consume all the glucose and produced 17.0 mM of succinic acid, with a productivity of 1.13 (mM / h). The HK1017 strain , which lacks the ptsG , agaR , exuR multiple deletions, and the aga operon gene family, takes 36 hours to consume all the glucose, but does not produce lactic acid but produces 42 mM succinic acid with a succinic acid productivity of 1.16 (mM / h It was confirmed that).

If through the above results, the ptsG gene deletion in E. coli C strain background was confirmed that the glucose in the succinic acid production increased by consumption when exuR gene deletion is introduced, agaR It was confirmed that succinic acid productivity greatly increased due to gene deletion.

< Example  5> exuR  And agaR  Through mutation of a gene exuT gene, aga  Increasing mRNA expression of operon

From the above Example 3 and Example 4 ptsG, in K-12 strains manX deletion and the growth of the strain recovery through mutations in exuR gene was confirmed that the succinic acid productivity is increased, the C strain of ptsG deletion agaR Through mutation of the gene, the growth of the strain was recovered and it was confirmed that the productivity of succinic acid increased. exuR Genes and agaR genes encode ExuR transcription regulators and AgaR transcription regulators, respectively. ExuR transcription regulators are known to inhibit the expression of exuT , a gene encoding ExuT, a transport protein of aldohexuronates such as D-galacturonate and D-glucuronate (Mata-Gilsinger, M., Ritzenthaler, P., Mol Gen Genet, 1983). AgaR transcription regulators are also known to inhibit the expression of the aga gene family ( agaZVWEFA ), which encodes proteins involved in the transport of N-acetylgalactosamine and D-galactosamine (Ray, WK, Larson, TJ, Mol Microbiol, 2004). . Therefore, the reason for the increase of strain growth and succinic acid production due to mutation of exuR and agaR genes is that the expression inhibitory function of the transcriptional regulator exuT gene and aga gene group is lost, and thus the expression of glycoprotein is increased. Glucose was predicted to be transported into cells and metabolized.

First, with respect to the K-12 strain, the Escherichia coli wild type strain (BW25113) and ptsG, manX QRT-PCR was performed as follows to compare the expression levels of exuT genes of the parent strain (HK907) and the adapted progeny strain (HK953). The wild type BW25113 strain of the K-12 strain, the parent strain HK907 and the progeny strain HK953 strain were cultured at the beginning of the logarithmic phase of OD _600nm = 1 during incubation under anaerobic conditions. The strain BW25113 was 3 hours old, and the parent strain HK907 took 6 hours of delay and 54 hours of onset of growth, and the strain of HK953, a progeny strain, took 3 hours of RNA protection bacterial reagent (Qiagen). After mixing with the solution, total RNA was purified using RNAeasy Mini kit (Qiagen) (FIG. 3). Purified total RNA was measured using NanoDrop, and each primer for qRT-PCR was determined using Roche's Universal Library Assay Design Center (https://lifescience.roche.com). exuT gene was specifically produced (Table 9). CDNA was synthesized using 5 ng of total RNA (50 ° C., 40 minutes), and cDNA amplification (95 ° C., 20 sec; 60 ° C., 1 min; 40 cycles) was performed. Data obtained through qRT-PCR were analyzed using the LightCycler 96 (Roche Diagnostics, Mannheim, Germany) program, and the relative expression levels compared to the expression level of 16S ribosomal RNA were analyzed. In wild-type strains In the parent strain HK907 compared to the expression level of the gene exuT exuT Although the gene was hardly expressed at the 3 hour delay period, the growth rate of the strain was about 6.8 times higher than that of the wild type strain, and 41.8 times higher than that of the progeny strain HK953. Therefore exuR according to adaptive evolution It was confirmed that the expression of the exuT gene is increased due to the mutation of the gene (FIG. 3). In addition, it was confirmed that glucose can be transported into cells through ExuT transport protein due to increased expression of exuT gene.

For C strain, E. coli wild type strain (KCTC2571) and ptsG QRT-PCR was performed to compare the expression levels of the agaV and agaB genes of the parent strain (HK864) and the adapted progeny strain (HK878). C strains were cultured at the beginning of the logarithmic phase of OD _600nm = 1 during culturing of wild type KCTC2571 strain, parent strain HK864 and progeny strain HK878 strain under anaerobic conditions. KCTC2571 strain was 3 hours, the parent strain HK864 strain was delayed at 12 hours and growth started at 54 hours, and progeny strain HK878 strain was taken at 3 hours and RNA protect bacterial reagent (Qiagen) After mixing with the solution, total RNA was purified using RNAeasy Mini kit (Qiagen). qRT-PCR was performed as described above, and the primers for qRT-PCR were specifically constructed for agaV and agaB genes (Table 9). The expression levels of agaV and agaB genes in the wild-type strain and the parent strain HK864 were found to be almost the same, and at the 54 hours when the growth of the parent strain was confirmed, it was found to increase about 3.3 times compared to the wild-type strain. In addition, the progeny strain HK878 was found to increase by 3.8 times. Therefore, it was confirmed that the expression of agaV , agaB gene is increased due to the mutation of the agaR gene according to the adaptive evolution (Fig. 4). Also aga Due to the increased expression of the gene group, it was confirmed that glucose can be transported into the cell through the Aga transport protein.

As a result, it was confirmed that when the transport system, such as a gene per ptsG, manX, ptsI in the E. coli deletions into the cell via a transport protein or Aga glucose transport protein complex per ExuT that glucose can be transported.

SEQ ID NO:	Primer name	Primer sequence (5 '→ 3')
One	16S-Fw		CAGCAGCCGCGGTAATAC
2	16S-Rev	ACCAGGGTATCTAATCCTGT
3	exuT_RTF	TTCGATTGGTGCGATGATT
4	exuT_RTR	CCAGCTGTGCATTACGATTG
5	agaV_RTF		CCGAAGATCCGGTACAACAA
6	agaV_RTR	TTTTGCAGCGTCCAGAAAC
7	agaB_RTF		TGATAACCGTCTGGTTCATGG
8	agaB_RTR	CGACTACCAGCAGATTTGCAC

Having described the specific parts of the present invention in detail, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (15)

1. Succinic acid producing ability improved, and manX ptsG gene in addition to the E. coli K-12 strain deleted exuR gene is the E. coli K-12 mutant strain deleted.
2. Succinic acid producing ability improved, and manX ptsG gene in addition to the E. coli K-12 strain deleted agaR gene is the E. coli K-12 mutant strain deleted.
3. Succinic acid producing ability improved, and manX ptsG gene with a further exuR and agaR gene deletion in the deletion of E. coli K-12 strain E. coli K-12 mutant strain.
4. Succinic acid producing ability improved, manX ptsG gene and the gene deletion with the deletions are additionally exuR E. coli C strain E. coli C strain variation.
5. The E. coli C mutant strain according to claim 4, wherein the E. coli C variant strain has been deposited with accession number KCTC13265BP.
6. Succinic acid producing ability improved, manX ptsG gene and the gene deletion with the deletions are additionally agaR E. coli C strain E. coli C strain variation.
7. Succinic acid producing ability improved, and manX ptsG gene with a further exuR and agaR gene deletion in the deletion strain of E. coli E. coli C C mutant strain.
8. E. coli C mutant strains with improved succinic acid production capacity of agaW , agaE , agaF and agaA in addition to the E. coli C variant strain according to claim 7.
9. The E. coli C mutant strain according to claim 8, wherein the E. coli C variant strain has been deposited with accession number KCTC13266BP.
10. ptsI gene is evolutionary adaptation of the E. coli K-12 strain deleted (adaptive evolution) strain as obtained by the culture method, enhanced E. coli K-12 mutant strain the gene is exuR additional deletion, succinic acid production ability.
11. The E. coli K-12 mutant strain having improved succinic acid production capacity according to claim 10, wherein the adaptive evolution culture method is cultured under anaerobic conditions in a medium containing kanamycin.
12. The E. coli K-12 mutant strain according to claim 10, characterized in that deposited with the accession number KCTC13264BP.
13. E. coli K-12 mutant strain having exuR gene deletion in addition to E. coli K-12 strain having ptsI gene having improved succinic acid production capacity.
14. Culturing the variant strain according to any one of claims 1 to 13; And

    Succinic acid production method comprising the step of obtaining succinic acid from the culture.
15. The method of claim 14, wherein the culturing is performed under anaerobic conditions.

Images