WO2018211148A1 - Dérivés de bisquinolium pour la prévention ou le traitement de cancers liés au veb - Google Patents

Dérivés de bisquinolium pour la prévention ou le traitement de cancers liés au veb Download PDF

Info

Publication number
WO2018211148A1
WO2018211148A1 PCT/EP2018/063410 EP2018063410W WO2018211148A1 WO 2018211148 A1 WO2018211148 A1 WO 2018211148A1 EP 2018063410 W EP2018063410 W EP 2018063410W WO 2018211148 A1 WO2018211148 A1 WO 2018211148A1
Authority
WO
WIPO (PCT)
Prior art keywords
group
crc
alkyl
alkyl group
compound
Prior art date
Application number
PCT/EP2018/063410
Other languages
English (en)
Inventor
Marc Blondel
Cécile VOISSET
Maria-José LISTA
Robin Fahraeus
Marie-Paule Teulade-Fichou
Original Assignee
Universite De Bretagne Occidentale
Centre Hospitalier Regional Universitaire De Brest
Institut National De La Sante Et De La Recherche Medicale (Inserm)
Universite Paris Diderot Paris 7
Universite Paris Descartes
Univ Paris Xiii Paris-Nord Villetaneuse
Centre National De La Recherche Scientifique (Cnrs)
Institut Curie
Universite Paris-Sud
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite De Bretagne Occidentale, Centre Hospitalier Regional Universitaire De Brest, Institut National De La Sante Et De La Recherche Medicale (Inserm), Universite Paris Diderot Paris 7, Universite Paris Descartes, Univ Paris Xiii Paris-Nord Villetaneuse, Centre National De La Recherche Scientifique (Cnrs), Institut Curie, Universite Paris-Sud filed Critical Universite De Bretagne Occidentale
Publication of WO2018211148A1 publication Critical patent/WO2018211148A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4375—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a six-membered ring having nitrogen as a ring heteroatom, e.g. quinolizines, naphthyridines, berberine, vincamine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/4965—Non-condensed pyrazines
    • A61K31/497—Non-condensed pyrazines containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D215/00—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16—Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/38—Nitrogen atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D519/00—Heterocyclic compounds containing more than one system of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring system not provided for in groups C07D453/00 or C07D455/00

Definitions

  • the present invention relates to bisquinolinium derivatives useful for treating or preventing cancers associated with the Epstein-Barr Virus (EBV-related cancers) by interfering with the interaction between the host cell protein nucleolin (NCL) and the virus-encoded EBNA1 mRNA.
  • EBV-related cancers Epstein-Barr Virus
  • Epstein-Barr virus is the first oncogenic virus discovered in human and has been linked to various cancers that include Burkitt and Hodgkin lymphomas and 10% of gastric cancers.
  • Another example is the nasopharyngeal carcinoma which is particularly frequent among men in China and Tunisia.
  • EBV-related specific cancers represent roughly 1 to 2-3% cancers worldwide.
  • most of tumoral cells are EBV-infected whereas only a small subset of non-tumoral cells are infected.
  • EBV evades the host immune system but has an Achilles heel: its genome maintenance protein (GMP) EBNA1 .
  • GMP genome maintenance protein
  • EBNA1 is essential for EBV genome replication and maintenance and as such expressed in all dividing EBV-infected cells.
  • EBNA1 is highly antigenic and CD8+ T cells directed towards EBNA1 epitopes exist in all infected individuals.
  • EBV has evolved a mechanism to limit EBNA1 production to the minimal level required for the viral genome replication and, at the same time, to minimize the production of EBNA1 -derived antigenic peptides presented to the cytotoxic T cells through the MHC class I pathway.
  • the central glycine-alanine repeat (GAr) of EBNA1 plays a critical role in this mechanism of immune evasion as it is able to self-inhibit the translation of its own mRNA in cis.
  • the high level of EBNA1 protein and the efficient T cell response following the infection by an EBV strain encoding a truncated version of EBNA1 in which GAr has been deleted (EBNAIAGAr) demonstrates the critical role of GAr in EBNA1 immune evasion.
  • EBNAIAGAr demonstrates the critical role of GAr in EBNA1 immune evasion.
  • EBNAIAGAr truncated version of EBNA1 in which GAr has been deleted
  • the GAr-encoding mRNA sequence is GC rich and forms predicted G-quadruplex (G4) structures that have been implicated in the regulation of EBNA1 synthesis in vitro (Murat et al Curr Opin Genet Dev 2014, 25, 22-29).
  • G4 are particular secondary structures of nucleic acid formed by the stacking of G-quartets which correspond to a planar arrangement of 4 guanines connected by Hoogsteen hydrogen bonds.
  • G4 structures within G-rich DNA or RNA sequences have been implicated in gene regulation where they can affect transcription, alternative splicing and translation. G4 modes of action are still relatively unknown but cellular factors that can interact with these structures are emerging.
  • GAr-based EBNA1 immune evasion is considered a relevant therapeutic target to treat EBV- related cancers as most tumor cells from EBV-related cancers are infected by EBV whereas, in healthy individuals, the latent infection by EBV is primarily restricted to a specific small pool of memory B cells.
  • overcoming GAr-based self-inhibition of EBNA1 translation should unveil EBV-carrying tumor cells to cytotoxic T cells without having significant effect on the vast majority of healthy host cells.
  • a yeast-based (Saccharomyces cerevisiae) assay that recapitulates all the aspects of the GAr- based inhibition of translation, including the GAr-length dependency, has been developed, that allowed understanding the mechanisms of GAr-mediated mRNA translation - suppression in cis, as well as the cellular factors involved (Lista et al. Biotechnol J 2015, 10, 1670-1681 ). This assay was successfully used to identify small molecular weight compounds that can stimulate EBNA1 expression both in yeast and mammalian cells and that relieve GAr-based limitation of antigen presentation (Voisset et al. Dis Model Mech 2014, 7, 435-444).
  • Nucleolin is a multifunctional DNA/RNA-binding protein widely conserved among eukaryotes. It is involved in RNA metabolism, in particular in rRNA maturation. NCL binds to G-rich sequences in coding and non-coding regions of various mRNA, many of which encode cancer-related proteins, and enhance their translation. In addition, NCL binds to some G4 structures within DNAs and RNAs. For example, it has been recently shown that NCL binds to and stabilizes G4 structures formed within the LTR promoter of HIV, thereby silencing the provirus transcription (Tosoni et al. Nucleic Acids Res 2015, 43, 8884-8897). NCL also affects the transcription of c-MYC by binding to and stabilizing G4 present in the promoter of this oncogene and that negatively regulate its activity.
  • the Inventors have performed a genetic screen to identify host cell genes involved in the GAr-mediated inhibition of translation. This way, the yeast NSR1 gene encoding the orthologue of human NCL was identified, and it was shown that NCL is critically involved in GAr-based limitation of translation and antigen presentation, and thus in EBNA1 immune evasion.
  • the NCL-EBNA1 mRNA interaction appeared as a relevant therapeutic target for the treatment and/or prevention of EBV-related cancers.
  • the Inventors further identified compounds able to prevent NCL from binding to G4 formed in the GAr mRNA sequence, and to stimulate GAr-limited translation and antigen presentation.
  • the present invention relates to a compound of formula (I), or a hydrate or a solvate thereof, for use as a drug for preventing and/or treating an Epstein-Barr- Virus (EBV)-related cancer:
  • EBV Epstein-Barr- Virus
  • Yi and Y 2 may be identical or different and are each independently CH or NR + ;
  • Zi is CH or NR + , provided that when Yi is CH, then Zi is NR + , and when Yi is NR + , then Zi is
  • Z 2 is CH or NR + , provided that when Y 2 is CH, then Z 2 is NR + , and when Y 2 is NR + , then Z 2 is CH;
  • R is Ci-C 6 alkyl, optionally substituted with a OH group or a 0-(Ci-C4)alkyl group,
  • X 2" is one or a plurality of pharmaceutically acceptable anion(s), selected so as to obtain an overall electrically neutral salt
  • L is (A), ( ⁇ '), (B), (C), (D) or (E), preferably L is (A), ( ⁇ '), (B), (D) or (E):
  • n, p, t, u and v may be identical or different and are each independently an integer selected from 0 to 2;
  • q, r and s may be identical or different and are each independently an integer selected from 0 to 3;
  • Ri to R 9 may be identical or different and are each independently a halogen atom, a CrC 6 alkyl group, a C 3 -C 8 cycloalkyl group, a 0(CrC 6 )alkyl group, a NR10R11 group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl or a 5- to 8-membered heterocycloalkenyl, said CrC 6 alkyl group, C 3 -C 8 cycloalkyl group, 0(Ci-C 6 )alkyl group, C 2 -C 6 alkenyl group, C 5 -C 8 cycloalkenyl group, 3- to 8-membered heterocycloalkyl or 5- to 8- memebered heterocycloalkenyl being optionally substituted with one to three halogen atoms, a OH group, a
  • Ri o and Rn may be identical or different and are each independently:
  • d-C-6 alkyl group optionally substituted with a OH group, a 0-(CrC 6 )alkyl group, a NH-(CrC 6 )alkyl group or a NHC(0)R'- group,
  • R' is:
  • (CrC 6 )alkyl group optionally substituted with an azido group, a biotinyl group or a 5- to 10-membered aryl group, wherein said 5- to 10-membered aryl group is optionally substituted with a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl, a 5- to 8-membered heterocycloalkenyl, a N((Ci -C6)alkyl) 2 group or a N((Ci-C 6 )haloalkyl) 2 group,
  • a 5- to 10-membered aryl group optionally substituted with a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl, a 5- to 8-membered heterocycloalkenyl, a N((CrC 6 )alkyl) 2 group, a N((CrC 6 )haloalkyl) 2 group or a C(0)-(5- to 10-membered)aryl group, or
  • pharmaceutically acceptable salt is intended to mean, in the framework of the present invention, a salt of a compound which is pharmaceutically acceptable, as defined above, and which possesses the pharmacological activity of the corresponding compound.
  • the present invention relates to the use of a compound of formula (I) as defined above or below, or a hydrate or a solvate thereof, for the manufacture of a medicament for preventing or treating an EBV-related cancer.
  • the present invention relates to a method for preventing or treating an EBV- related cancer comprising administering to a patient in need thereof a therapeutically effective amount of a compound of formula (I) as defined above or below, or a hydrate or a solvate thereof.
  • the present invention further concerns a pharmaceutical composition
  • a pharmaceutical composition comprising a compound of any of formula (I) as described above, or a hydrate or a solvate thereof, as active substance, and a pharmaceutically acceptable carrier for use as a drug for preventing and/or treating an Epstein-Barr- Virus (EBV)-related cancer.
  • EBV Epstein-Barr- Virus
  • the present invention relates to a composition
  • a composition comprising:
  • the compound of formula (I) as defined above or below and optionally another therapeutic agent preferably selected from antibiotics, anticancer agents, steroidal and non-steroidal anti-inflammatory drugs, and
  • the present invention relates to a kit comprising at least:
  • composition comprising another therapeutic agent preferably selected from antibiotics, anticancer agents, steroidal and non-steroidal anti-inflammatory drugs, for simultaneous, staggered or sequential use as a combination product for treating an EBV- related cancer.
  • another therapeutic agent preferably selected from antibiotics, anticancer agents, steroidal and non-steroidal anti-inflammatory drugs, for simultaneous, staggered or sequential use as a combination product for treating an EBV- related cancer.
  • the compounds of the invention may be prepared by methods known in the art, as described for instance in WO 2009/072027 and De Cian et al. ⁇ J. Am. C em. Soc. 2007, 129, 1856- 1857).
  • compounds wherein m, n, p, q, r, s, t, u, or v may easily be obtained from the corresponding dimethyl oxo derivative, which is easily converted into the dimethyl halogenated derivative (in particular the dimethyl chlorinated derivative), oxidized into the corresponding dicarboxylic acid halogenated (advantageously chlorinated) derivative.
  • Said derivative may then be subjected to a peptide coupling to form the corresponding bisquinoline halogenated (advantageously chlorinated) derivative.
  • Formation of the corresponding bisquinoilium derivative of the invention takes place under conditions known in the art.
  • the bisquinoline halogenated (advantageously chlorinated) derivative is subjected to a cross coupling reaction, in particular a Buchwald Hartwig reaction (for instance with an amine or alcohol), followed by an alkylation reaction to form the corresponding bisquinoilium derivative.
  • a cross coupling reaction in particular a Buchwald Hartwig reaction (for instance with an amine or alcohol)
  • an alkylation reaction to form the corresponding bisquinoilium derivative.
  • simply heating the bisquinoline halogenated (advantageously chlorinated) derivative in the presence of the required amine or alcohol leads to the corresponding amino or alkoxy bisquinoline, which is then subjected to n alkylation reaction to yield the corresponding bisquinoilium derivative.
  • Such a synthetic scheme is illustrated for instance in example 1 .
  • Yi is CH and Z ⁇ is NR + . In another embodiment, Yi is NR + and Z ⁇ is CH.
  • Y 2 is CH and Z 2 is NR + .
  • Y2 is NR + and Z 2 is CH.
  • Yi and Z 2 are CH, while Y 2 and Z ⁇ are each independently NR + . In another embodiment, Y 2 and Z ⁇ are CH, while Yi and Z 2 are each independently NR + .
  • Yi and Y 2 are identical, and Z ⁇ and Z 2 are identical.
  • Yi and Y 2 are CH, while Z ⁇ and Z 2 are each independently NR + .
  • Z ⁇ and Z 2 are CH, while Yi and Y 2 are each independently NR + .
  • the compound of formula (I) may be symmetrical.
  • R is a linear CrC 6 alkyl optionally substituted with a OH group or a linear 0-(Ci -C4)alkyl group.
  • R is a linear C1 -C4 alkyl optionally substituted with a OH group or a linear 0-(Ci -C-4)alkyl group.
  • R is a linear C1 -C4 alkyl optionally substituted with a OH group or a linear 0-(CrC 2 )alkyl group.
  • R is Ci -C 6 alkyl, preferably a C1 -C4 alkyl. In these embodiments, R is preferably linear. It may be a methyl or an ethyl group.
  • R is CH 3 , CH 2 CH 3 , CH 2 CH 2 OH or CH 2 CH 2 OCH 3 .
  • R is CH 3 or CH 2 CH 2 OH , for instance it is CH 3 .
  • X 2" is one or a plurality of pharmaceutically acceptable anion(s), selected so as to obtain an overall electrically neutral (pharmaceutically acceptable) salt.
  • Suitable pharmaceutically acceptable anions may be prepared from the corresponding base of an inorganic acid or an organic acid.
  • inorganic acids are hydrochloric, hydrobromic, hydroiodic, nitric, carbonic, sulfuric and phosphoric acid.
  • organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which are formic, acetic, propionic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, mesylic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, benzenesulfonic, pantothenic, 2-hydroxyethanesulfonic, toluenesulfonic, sulfanilic, cyclohexylaminosulfonic, stearic, algenic, hydroxybutyric, salicylic, galactaric and galacturonic acid
  • X 2" represents one or a plurality (generally 2) anion (s) with two negative charges.
  • X 2" represents 2 anions selected from the group consisting of a halogenide, a carboxylate, a CrC 6 alkylsulfonate, a Ci -C 6 haloalkylsulfonate and an alkylarylsulfonate, preferably a halogenide, a methanesulfonate, a trifluoromethanesulfonate or a tosylate.
  • X 2" represents 2 anions selected from the group consisting of CI " , Br, I " , and CHF3SO3-, such as I-, and CHF3SO3-.
  • n, p, u and v may be identical or different and are each independently 0, 1 or 2 provided that:
  • s is 1 , 2 or 3;
  • t 1 or 2;
  • q and r may be identical or different and are each independently an integer selected from 0 to 3, provided that at least one of q and r is not 0.
  • Ri to R 9 are each independently a halogen atom or a NR10R11 group
  • R10 as Rn as defined above or below.
  • R10 and R11 may be identical or different and are each independently:
  • C1-C-6 alkyl group optionally substituted with a OH group, a 0-(CrC 6 )alkyl group, a NH-(CrC 6 )alkyl group, a NHC(0)-R' group,
  • R10 is H and Rn is:
  • C1-C-6 alkyl group optionally substituted with a OH group, a 0-(CrC 6 )alkyl group (such as a OCH 3 group), a NH-(CrC 6 )alkyl group, a NHC(0)-R' group; or
  • Rn is a CrC 6 alkyl group substituted with a NHC(0)-R' group
  • R' is:
  • C 6 alkyl group a 0(CrC 6 )alkyl group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl, a 5- to 8-membered heterocycloalkenyl, a N((Ci-C 6 )alkyl) 2 group or a N((CrC 6 )haloalkyl) 2 group,
  • (Ci-C 6 )alkyl-(OCH 2 CH)j optionally substituted with an azido group or a (CrC 6 )alkyl group, wherein j being an interger between 1 and 6, preferably between 2 and 4 and wherein said (CrC 6 )alkyl group is optionally substituted with a halogen atom, a 0(CrC 6 )alkyl group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl, a 5- to 8-membered heterocycloalkenyl, a N((Ci -C6)alkyl)2 group or a N((Ci -C 6 )haloalkyl)2 group or a biotinyl group, preferably substituted with a a halogen atom or a 0(CrC 6 )alkyl group;
  • aryl group optionally substituted with a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl, a 5- to 8-membered heterocycloalkenyl, a N((Ci -C 6 )alkyl) 2 group, a N((Ci -C 6 )haloalkyl) 2 group or a C(0)-(5- to 10-)aryl group;
  • Rn is a a (Ci -C 6 )alkyl-(OCH 2 CH)i-(Ci -C6)alkyl-NHC(0)-R' group
  • R' is a (CrC 6 )alkyl group optionally substituted with an azido group, a C 2 -C 6 alkynyl group, a biotinyl group or a 5- to 10-membered aryl group, wherein said 5- to 10-membered aryl group is optionally substituted with a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl, a 5- to 8- membered heterocycloalkenyl, a N((CrC 6 )alkyl) 2 group or a N(((C
  • Ri o is H and Rn is:
  • R' as defined above or below and representing preferably a (C 2 -C 6 )alkynyl group; a (Ci - C 6 )alkyl group optionally substituted with an azido group, a biotinyl group; a 5- to 10- membered aryl group substituted with a N((CrC 6 )haloalkyl) 2 group or a C(0)-(5- to 10- )aryl group.
  • L is (A), ( ⁇ '), (B), (D) or (E).
  • L is (D) or (E). In another particular embodiment, L is (A), ( ⁇ '), (B) or (C) .
  • n, p, t, u and v may be identical or different and are each independently an integer selected from 0 to 2.
  • m, n, p, t, u and v may be identical or different and are each independently are independently 0 or 1 .
  • q, r and s may be identical or different and are each independently an integer selected from 0 to 3.
  • q, r and s may be identical or different and are each independently 0, 1 , or 2.
  • q, r and s may be identical or different and are each independently 0 or 1 .
  • each CrC 6 alkyl group, C 2 -C 6 alkenyl group, C 2 -C 6 alkynyl group, 0(Ci -C 6 )alkyl, NH-(Ci -C 6 )alkyl group, N( (Ci -C 6 )alkyl) 2 group or a N( (Ci - C 6 )haloalkyl) 2 group is preferably linear.
  • each CrC 6 alkyl group, C 2 -C 6 alkenyl group, C 2 -C 6 alkynyl group, 0(CrC 6 )alkyl, NH-(CrC 6 )alkyl group, N( (CrC 6 )alkyl) 2 group or a N( (CrC 6 )haloalkyl) 2 group is a (preferably linear) Ci -C 4 alkyl group, C 2 -C4 alkenyl group, C 2 - C 4 alkynyl group, 0(CrC 4 )alkyl, NH-(Ci -C 4 )alkyl group, N( (CrC 4 )alkyl) 2 group or a N( (Ci - C 4 )haloalkyl) 2 group.
  • the 5- to 10-membered aryl group is a 6- to 10-membered aryl group (such as a phenyl, a pyridyl, or a naphthyl group), even more preferably it is a 6- to 10-membered aromatic group, preferably a phenyl group.
  • the C 3 -C 8 cycloalkyl group is a C 3 -C 6 cycloalkyl group, such as a cyclopropyl, a cyclobutyl, a cyclopentyl or a cyclohexyl group.
  • the C 5 -C 8 cycloalkenyl group is a C 5 -C 6 cycloalkyl group, such as a a cyclopentenyl or a cyclohexenyl group.
  • the 3- to 8-membered heterocycloalkyi group is a 3- to 6-membered heterocycloalkyi, such as a.
  • the 5- to 8-membered heterocycloalkenyl group is a 5- to 6-membered heterocycloalkenyl, such as a dihydrofuran, a dihydrothiophene, a pyrrolin, a tetrahydropyrindine, a dihyrothiapyran.
  • Ri to R 9 may be identical or different and are each independently a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a NRi 0 Rn group, or a 3- to 8- membered heterocycloalkyi said CrC 6 alkyl group, 0(CrC 6 )alkyl group and 3- to 8-membered heterocycloalkyi being optionally substituted with one to three halogen atoms, a OH group, a 0-(CrC 6 )alkyl group, a NH-(CrC 6 )alkyl group or a NHC(0)-R' group,
  • Ri o and Rn may be identical or different and are each independently a hydrogen atom or a Ci - C-6 alkyl group optionally substituted with a OH group, a 0-(CrC 6 )alkyl group, a NH-(CrC 6 )alkyl group or a NHC(0)-R' group,
  • R' is as defined above or below.
  • R' is:
  • (CrC 6 )alkyl group optionally substituted with a 5- to 10-membered aryl group, wherein said 5- to 10-membered aryl group is optionally substituted with a halogen atom, a Ci - C 6 alkyl group, a 0(CrC 6 )alkyl group, a 3- to 8-membered heterocycloalkyl, a N((Ci-C 6 )alkyl) 2 group or a N((Ci-C 6 )haloalkyl)2 group, or
  • aryl group optionally substituted with a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a 3- to 8-membered heterocycloalkyl, a N((Ci-C 6 )alkyl) 2 group, a N((Ci-C 6 )haloalkyl) 2 group or a C(0)-(5- to 10-)aryl group.
  • Ri to R 9 may be identical or different and are each independently a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a NRi 0 Rn group, said CrC 6 alkyl group, 0(CrC 6 )alkyl group, being optionally substituted with one to three halogen atoms, a OH group, a 0-(CrC 6 )alkyl group, a NH-(CrC 6 )alkyl group or a NHC(0)-R' ;
  • Ri o and Rn may be identical or different and are each independently a hydrogen atom or a Ci - C 6 alkyl group optionally substituted with a OH group, a 0-(CrC 6 )alkyl group, a NH-(CrC 6 )alkyl group or a NHC(0)-R' group;
  • R' is:
  • aryl group optionally substituted with a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a N((Ci-C 6 )alkyl) 2 group, a N((Ci-C 6 )haloalkyl) 2 group or a
  • Ri to R 9 may be identical or different and are each independently a halogen atom, a NH(CrC 6 )alkyl group or a NH-(CrC 6 )alkyl-NHC(0)-R' group, with R' as defined above or below.
  • R' is:
  • L is (A) or ( ⁇ '), preferably (A).
  • Ri , R 2 and R 3 are as defined above or below, and preferably m, n and p are identical or different and are each independently 0 or 1 . More preferably:
  • n 0 or 1 , or
  • - m and n are 0, and p is 0 or 1 , or
  • - n is 0, and m and p are identical and are 0 or 1 .
  • L is (A) or ( ⁇ '), preferably (A), and m and p are 0, n is 0 or 1 , and R 2 is as defined above, preferably a halogen atom such as F or Br.
  • L is (A) or ( ⁇ '), preferably (A), and m and n are 0 and R 3 is as defined above, preferably a linear NH(C -(Ci-C 6 )alkyl-NHC(0)-R'
  • L is (A) or ( ⁇ '), preferably (A), and n is 0, and m and p are identical or different and are each independently preferably 0 or 1 .
  • Ri and R 3 may be identical or different and are then each independently as defined above, preferably a halogen atom, a NH(CrC 6 )alkyl group, more preferably a NH(CrC4)alkyl group.
  • L is (B) or (C).
  • q, r and s as well as R 4 , R 5 and R 6 are as defined above.
  • L is (C) and s is preferably 0 or 1 . In a particular emdodiment, L is (C) and s is 0. In another emdodiment, L is (C) and s is 1 .
  • R 6 is preferably a halogen atom or a NH(CrC 6 )alkyl group or a NH-(Ci-C 6 )alkyl-NHC(0)-R' group, with R' being:
  • L is (B), and q and r are preferably each independently 0 or 1 .
  • a and r are 0.
  • q is 0 and r is 1
  • q is 1 and r is 0, or q and r are 1 .
  • R4 and R 5 are idneitcal or different and are preferably each independently a halogen atom or a NH(CrC 6 )alkyl group or a NH-(Ci- C 6 )alkyl-NHC(0)-R' group, with R' being: - a (CrC 6 )alkyl group optionally substituted with a 5- to 10-membered aryl group, wherein said 5- to 10-membered aryl group is optionally substituted with a N(Ci -C 6 alkyl) 2 or N(Ci -C 6 haloalkyl) 2 , or
  • the compound of formula (I) is characterized in that:
  • Yi and Y 2 may be identical or different and are each independently CH or NR + ;
  • Zi is CH or NR + , provided that when Yi is CH , then Z ⁇ is NR + , and when Yi is NR + , then Z ⁇ is CH ;
  • Z 2 is CH or NR + , provided that when Y 2 is CH , then Z 2 is NR + , and when Y 2 is NR + , then Z 2 is CH ;
  • R is Ci -C 6 alkyl, optionally substituted with a OH group or a 0-(Ci -C4)alkyl group,
  • X 2" is one or a plurality of pharmaceutically acceptable anion(s), selected so as to obtain an overall electrically neutral salt
  • L is (A), ( ⁇ '), (B), (C) , (D) or (E), preferably (A), (B), (C), (D) or (E) or (A), ( ⁇ ') (B), (D) or (E), more preferably (A), (B), (D) or (E);
  • n, p, t, u and v may be identical or different and are each independently an integer selected from 0 to 2;
  • q, r and s may be identical or different and are each independently an integer selected from 0 to 3;
  • Ri to R 9 may be identical or different and are each independently a halogen atom, a CrC 6 alkyl group, a C 3 -C 8 cycloalkyl group, a 0(CrC 6 )alkyl group, a NRi 0 Rn group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl or a 5- to 8-membered heterocycloalkenyl, said CrC 6 alkyl group, C 3 -C 8 cycloalkyl group, 0(Ci -C 6 )alkyl group, C 2 -C 6 alkenyl group, C 5 -C 8 cycloalkenyl group, 3- to 8-membered heterocycloalkyl or 5- to 8- memebered heterocycloalkenyl being optionally substituted with one to three halogen atoms, a OH group,
  • Ri o and Rn may be identical or different and are each independently:
  • Ci-C 6 alkyl group optionally substituted with a OH group, a 0-(CrC 6 )alkyl group, a
  • R' is:
  • a (CrC 6 )alkyl group optionally substituted with a 5- to 10-membered aryl group, wherein said 5- to 10-membered aryl group is optionally substituted with a halogen atom, a Ci - C-6 alkyl group, a 0(CrC 6 )alkyl group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a C 2 - C-6 alkynyl group, a 3- to 8-membered heterocycloalkyi, a 5- to 8-membered heterocycloalkenyl, a N((Ci -C6)alkyl)2 group or a N((Ci-C 6 )haloalkyl)2 group, or
  • the compound of formula (I) is characterized in that:
  • R is a C1-C-6 alkyl, preferably a methyl
  • X 2" is one or a plurality of pharmaceutically acceptable anion(s), selected so as to obtain an overall electrically neutral salt, preferably selected from the group consisting of a halogenide, a carboxylate, a CrC 6 alkylsulfonate, a Ci-C 6 haloalkylsulfonate and an alkylarylsulfonate, preferably a halogenide, a methanesulfonate, a trifluoromethanesulfonate or a tosylate
  • L is (A), ( ⁇ '), (B), (C), (D) or (E), preferably (A), (B), (C), (D) or (E) or (A), ( ⁇ ') (B), (D) or (E), more preferably (A), (B), (D) or (E);
  • n, p, t, u and v may be identical or different and are each independently an integer selected from 0 to 2;
  • q, r and s may be identical or different and are each independently an integer selected from 0 to 3;
  • R' is:
  • (CrC 6 )alkyl group optionally substituted with a 5- to 10-membered aryl group, wherein said 5- to 10-membered aryl group is optionally substituted with a halogen atom, a Ci - C-6 alkyl group, a 0(CrC 6 )alkyl group, a 3- to 8-membered heterocycloalkyi, a N((Ci-C 6 )alkyl) 2 group or a N((Ci-C 6 )haloalkyl) 2 group, or
  • aryl group optionally substituted with a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a 3- to 8-membered heterocycloalkyi, a N((Ci-C 6 )alkyl) 2 group, a N((Ci-C 6 )haloalkyl) 2 group or a C(0)-(5- to 10-)aryl group.
  • the compound of formula (I) is characterized in that: R is C1-C-6 alkyl, optionally substituted with a OH group or a 0-(Ci-C-4)alkyl group,
  • X 2" is one or a plurality of pharmaceutically acceptable anion(s), selected so as to obtain an overall electrically neutral salt, preferably selected from the group consisting of a halogenide, a carboxylate, a CrC 6 alkylsulfonate, a Ci-C 6 haloalkylsulfonate and an alkylarylsulfonate, preferably a halogenide, a methanesulfonate, a trifluoromethanesulfonate or a tosylate L is preferably (A), ( ⁇ '), (B), (D) or (E), more preferably (A), (B), (D) or (E);
  • n, p, t, u and v may be identical or different and are each independently an integer selected from 0 to 2;
  • q, r and s may be identical or different and are each independently an integer selected from 0 to 3;
  • Ri and R 3 may be identical or different and are each independently a CrC 6 alkyl group, a 0(Ci - C 6 )alkyl group, a NR10R11 group, or a 3- to 8-membered heterocycloalkyi said CrC 6 alkyl group, 0(CrC 6 )alkyl group and 3- to 8-membered heterocycloalkyi being optionally substituted with one to three halogen atoms, a OH group, a 0-(CrC 6 )alkyl group, a NH-(CrC 6 )alkyl group or a NHC(0)-R' group;
  • R 2 and R4 to R 9 may be identical or different and are each independently a halogen atom, a C1-C-6 alkyl group, a 0(CrC 6 )alkyl group, a NR10R11 group, or a 3- to 8-membered heterocycloalkyi said CrC 6 alkyl group, 0(CrC 6 )alkyl group and 3- to 8-membered heterocycloalkyi being optionally substituted with one to three halogen atoms, a OH group, a 0-(CrC 6 )alkyl group, a NH-(CrC 6 )alkyl group or a NHC(0)-R' group;
  • R10 and Rn may be identical or different and are each independently:
  • R10 is H, Rn is not H, and when Rn is H, R10 is not H, or - a C4-C6 alkyl group optionally substituted with a OH group, a 0-(CrC 6 )alkyl group or a NHC(0)R' group, or
  • (CrC 6 )alkyl group optionally substituted with a 5- to 10-membered aryl group, wherein said 5- to 10-membered aryl group is optionally substituted with a halogen atom, a Ci - C 6 alkyl group, a 0(CrC 6 )alkyl group, a 3- to 8-membered heterocycloalkyl, a N((Ci-C 6 )alkyl) 2 group or a N((Ci-C 6 )haloalkyl) 2 group, or
  • aryl group optionally substituted with a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a 3- to 8-membered heterocycloalkyl, a N((Ci-C 6 )alkyl) 2 group, a N((CrC 6 )haloalkyl) 2 group or a C(0)-(5- to 10-)aryl group.
  • the compound of formula (I) is characterized in that: R is Ci-C 6 alkyl, optionally substituted with a OH group or a 0-(Ci-C-4)alkyl group,
  • X 2" is one or a plurality of pharmaceutically acceptable anion(s), selected so as to obtain an overall electrically neutral salt, preferably selected from the group consisting of a halogenide, a carboxylate, a CrC 6 alkylsulfonate, a Ci-C 6 haloalkylsulfonate and an alkylarylsulfonate, preferably a halogenide, a methanesulfonate, a trifluoromethanesulfonate or a tosylate L is preferably (A), ( ⁇ '), (B), (D) or (E), more preferably (A), (B), (D) or (E);
  • n, p, t, u and v may be identical or different and are each independently an integer selected from 0 to 2;
  • q, r and s may be identical or different and are each independently an integer selected from 0 to 3;
  • Ri is a hydrogen atom
  • R 2 to R 9 may be identical or different and are each independently a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a NR10R11 group, or a 3- to 8-membered heterocycloalkyl said C1-C-6 alkyl group, 0(CrC 6 )alkyl group and 3- to 8-membered heterocycloalkyl being optionally substituted with one to three halogen atoms, a OH group, a 0-(CrC 6 )alkyl group, a NH-(CrC 6 )alkyl group or a NHC(0)-R' group;
  • C1-C-6 alkyl group optionally substituted with a OH group, a 0-(CrC 6 )alkyl group (such as a OCH 3 group), a NH-(CrC 6 )alkyl group, a NHC(0)-R' group; or
  • Rn is a CrC 6 alkyl group substituted with a NHC(0)-R' group
  • R' is: - a (CrC 6 )alkyl group optionally substituted with a 5- to 10-membered aryl group, wherein said 5- to 10-membered aryl group is optionally substituted with a halogen atom, a Ci - C 6 alkyl group, a 0(CrC 6 )alkyl group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl, a 5- to 8-membered heterocycloalkenyl, a N((Ci -C 6 )alkyl) 2 group or a N((Ci -C 6 )haloalkyl) 2 group,
  • aryl group optionally substituted with a halogen atom, a CrC 6 alkyl group, a 0(CrC 6 )alkyl group, a C 2 -C 6 alkenyl group, a C 5 -C 8 cycloalkenyl group, a 3- to 8-membered heterocycloalkyl, a 5- to 8-membered heterocycloalkenyl, a N((CrC 6 )alkyl) 2 group, a N((CrC 6 )haloalkyl) 2 group or a C(0)-(5- to 10-)aryl group;
  • the compound of formula (I) is characterized in that: R is a linear Ci -C 4 alkyl, optionally substituted with one OH , preferably ethyl or methyl or CH 2 CH 2 OH , more preferably methyl,
  • X 2" is one or a plurality of pharmaceutically acceptable anion(s), selected so as to obtain an overall electrically neutral salt, preferably selected from the group consisting of a halogenide, a carboxylate, a CrC 6 alkylsulfonate, a Ci -C 6 haloalkylsulfonate and an alkylarylsulfonate, preferably a halogenide, a methanesulfonate, a trifluoromethanesulfonate or a tosylate, L is (A), ( ⁇ '), (B), or (C) , preferably L is (A), ( ⁇ ') or (B) or (A) or (B);
  • n, n, and p may be identical or different and are each independently 0 or 1 ;
  • q, r and s may be identical or different and are each independently 0 or 1 ;
  • Ri to R 9 may be identical or different and are each independently a halogen atom, a NH(Ci -
  • R' is:
  • (CrC 6 )alkyl group optionally substituted with a 5- to 10-membered aryl (preferably aromtic) group (such as a phenyl group), wherein said 5- to 10-membered aryl group is optionally substituted with a N(CrC 6 alkyl) 2 or N(CrC 6 haloalkyl) 2 , or
  • aryl group optionally substituted with a C(0)-(5- to 10-)aryl (preferably aromtic) group (such as a phenyl group).
  • the compound of formula (I) is characterized in that: R is a linear Ci-C 4 alkyl, preferably ethyl or methyl, more preferably methyl,
  • X 2" is one or a plurality of pharmaceutically acceptable anion(s), selected so as to obtain an overall electrically neutral salt, preferably selected from the group consisting of a halogenide, a carboxylate, a CrC 6 alkylsulfonate, a Ci-C 6 haloalkylsulfonate and an alkylarylsulfonate, preferably a halogenide, a methanesulfonate, a trifluoromethanesulfonate or a tosylate, L is ( ⁇ ), ( ⁇ '), (B), or (C);
  • n, n, and p may be identical or different and are each independently 0 or 1 ;
  • q, r and s may be identical or different and are each independently 0 or 1 ;
  • Ri to R 9 may be identical or different and are each independently a halogen atom, a NH(Ci- C 6 )alkyl group or a NH-(Ci-C 6 )alkyl-NHC(0)-R' group;
  • R' is:
  • (CrC 6 )alkyl group optionally substituted with a 5- to 10-membered aryl (preferably aromatic) group (such as a phenyl group), wherein said 5- to 10-membered aryl group is optionally substituted with a N(Ci-C 6 alkyl) 2 or N(Ci-C 6 haloalkyl) 2 , or
  • aromtic group such as a phenyl group
  • X 2" as defined above, especially representing 2 anions selected from the group consisting of a halogenide, a carboxylate, a Ci-C 6 alkylsulfonate, a Ci-C 6 haloalkylsulfonate and an alkylarylsulfonate, preferably a halogenide, a methanesulfonate, a trifluoromethanesulfonate or a tosylate foror instance, 2 anions selected from the group consisting of CI " , Br, I " , and CHF3SO3-, such as I-, and CHF3SO3-.
  • the compound of formula (I) is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
  • X 2" (BipyDC6) X 2" , with X 2" as defined above, especially representing 2 anions selected from the group consisting of a halogenide, a carboxylate, a Ci-C 6 alkylsulfonate, a Ci- Cehaloalkylsulfonate and an alkylarylsulfonate, preferably a halogenide, a methanesulfonate, a trifluoromethanesulfonate or a tosylate foror instance, 2 anions selected from the group consisting of CI " , Br, I " , and CHF3SO3 " , such as I " , and CHF3SO3 " .
  • the compound of the invention is (Br-PhenDC6) X 2" , (PhenDC3-C4-C) X 2" , (PhenDC3-C4-Bn) X 2 , or (PhenDC3-Bisalk1 ) X 2" , with X 2" as defined above, especially representing 2 anions selected from I “ , and CHF3SO3 " .
  • the compounds of formula (I) as described above may exist in tautomeric, diastereomeric or enantiomeric forms.
  • the present invention contemplates all such compounds, including cis- and trans-diastereomers, E- and Z-stereomers, R- and S-enantiomers, diastereomers, d- isomers, l-isomers, the racemic mixtures thereof and other mixtures thereof.
  • Pharmaceutically acceptable salts of such tautomeric, diastereomeric or enantiomeric forms are also included within the invention.
  • cis and trans denote a form of geometric isomerism in which two carbon atoms connected by a double bond will each have a hydrogen atom on the same side of the double bond ("cis") or on opposite sides of the double bond ("trans").
  • Some of the compounds described contain alkenyl groups, and are meant to include both cis and trans or “E” and “Z” geometric forms.
  • the present invention includes R, S, and mixtures of R and S forms for each stereocenter present.
  • the present invention encompasses only stable compounds.
  • the pharmaceutically acceptable excipient is selected, according to the dosage form and mode of administration desired, from the typical excipients known to persons skilled in the art.
  • the pharmaceutical compositions according to the invention can be administered parenterally (such as intravenously or intradermally), topically, orally or rectally.
  • parenteral includes subcutaneous, intravenous, intramuscular, intravesical or infusion techniques. Preferably, the term “parenteral” refers to infusion techniques.
  • Injectable preparations for example, sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
  • formulations for parenteral administration may be in the form of aqueous or non-aqueous isotonic sterile injection solutions or suspensions.
  • compositions of the invention are administered via oral route.
  • Solid dosage forms for oral administration may include capsules, tablets, pills, powders, and granules.
  • the compound is ordinarily combined with one or more adjuvants appropriate to the indicated route of administration.
  • Such capsules or tablets can contain a controlled-release formulation as can be provided in a dispersion of active compound in hydroxypropylmethyl cellulose.
  • the dosage forms can also comprise buffering agents such as sodium citrate, or magnesium or calcium carbonate or bicarbonate. Tablets and pills can additionally be prepared with enteric coatings.
  • Liquid dosage forms for oral administration may include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs containing inert diluents commonly used in the art, such as water.
  • Such compositions may also comprise adjuvants, such as wetting agents, emulsifying and suspending agents, and sweetening, flavoring, and perfuming agents.
  • compositions of the invention may be manufactured into one or several dosage forms for the controlled, sustained or timed release of one or more of the ingredients, as known in the art.
  • the amount of the compound of the invention that may be combined with the excipient materials to produce a single dosage of the composition will vary depending upon the subject and the particular mode of administration, as known in the art.
  • said compounds may be formulated as cyclodextrine inclusion complexes, in particular as inclusion complexes with ⁇ -, ⁇ - or ⁇ -cyclodextrins.
  • the pharmaceutical composition of the invention further comprises another one or more therapeutic compounds.
  • Another aspect of the present invention encompasses a combination of a compound of formula (I) as described above, with one or more therapeutic compounds.
  • the therapeutic compound is preferably selected from antibiotics, anticancer agents, steroidal and non-steroidal anti-inflammatory drugs, advantageously it is an anticancer agent.
  • the antibiotic is preferably selected from the group consisting of beta-lactams, aminoglycosides, tetracyclines, glycylcyclines, macrolides, azalides, ketolides, synergistins, lincosanides, fluoroquinolones, phenicols, rifamycins, sulfamides, trimethoprim, glycopeptides, oxazolidinones, nitromidazoles and lipopeptides.
  • the non-steroidal anti-inflammatory drug is preferably selected from the group consisting of salicylate and salts thereof, Celecoxib, Diclofenac and salts thereof, Diflunisal, Etodolac, Fenoprofen, Flurbiprofen, Ibuprofen, Indomethacin, Ketoprofen, Meclofenamate, Mefenamic acid, Meloxicam, Nabumetone, Naproxen, Oxaprozin, Piroxicam, Rofecoxib Salsalate, Sulindac, Tolmetin, and Valdecoxib.
  • the steroidal anti-inflammatory drug is preferably selected from the group consisting of Prednisone, Methylprednisolone, Prednisolone, aldosterone, Cortisol, cortisone, hydrocortisone, corticosterone, tixocortol, ciclesonide, prednicarbate Triamcinolone acetonide, triamcinolone alcohol, mometasone, amcinonide, budesonide, desonide, fluocinonide, fluocinolone acetonide, halcinonide, Hydrocortisone- 17-valerate, halometasone, alclometasone, betamethasone, prednicarbate, clobetasone-17-butyrate, clobetasol-17- propionate, fluocortolone, fluocortolone, fluprednidene acetate, dexamethasone, and mixtures thereof, and
  • the anticancer agent is preferably cisplatine, methotrexate, cyclophosphamide, doxorubicin, fluorouracil.
  • the combination comprises 1 , 2, 3, 4, or 5 therapeutic compounds, preferably one therapeutic compound.
  • the present invention relates to a kit comprising at least:
  • composition comprising another therapeutic agent, preferably selected from antibiotics, anticancer agents, steroidal and non-steroidal anti-inflammatory drugs, advantageously an anticancer agent.
  • another therapeutic agent preferably selected from antibiotics, anticancer agents, steroidal and non-steroidal anti-inflammatory drugs, advantageously an anticancer agent.
  • kits of the invention are used as a combination product for treating an EBV-related cancer.
  • the antibiotics, anticancer agent, steroidal and non-steroidal anti-inflammatory drug is in particular as listed above in connection with the pharmaceutical composition for use of the invention.
  • the other therapeutic compound is preferably selected from antibiotics, anticancer agents, steroidal and non-steroidal anti-inflammatory drugs. More preferably, it is an anticancer agent.
  • the compound or the composition or the kit of the invention is useful as a drug, in particular for preventing and/or treating an EBV-related cancer.
  • an "EBV-related cancer” is understood as a cancer which develops after and/or triggered by infection by the Epstein-Barr virus, which distinghuishes them from cancers in general.
  • an "EBV-related cancer” is understood as a cancer wherein more than 50%, typically more than 90%, in particular more than 95% of tumoral cells are infected by EBV, whereas most non tumoral cells are advantageously not infected by EBV.
  • B-cells memory cells
  • Such a profile of infection by EBV explains the specificity of the compounds of the invention in e method for treating EBV-related cancers.
  • G-quadruplex ligands are known to be useful in the treatment of certain cancers, they are not known to be active in the treatment of EBV-related cancer. Indeed, the compounds of the invention act through a new mode of action: they prevent NCL from binding to G4 formed in the GAr mRNA sequence, thus stimulating GAr-limited translation and antigen presentation. In other words, the compounds of the invention, by rendering EBV "visible”, stimulate the host immune system, which will then "attack" the EBV-infected tumoral cells, thus leading to tumoral cell death, and overall treatment of cancer.
  • the compound or the composition or the kit of the invention is used in combination, simultaneously, separately or sequentially, with ionizing or non-ionizing radiations or hyperthermia.
  • said EBV-related cancer is: Hodgkin's lymphoma, Burkitt's lymphoma, Nasopharyngeal carcinoma, some gastric cancers (about 10% are related to EBV infection), lymphomas in immunosuppressed patients (such as AIDS-suffering patients, post-transplant patients), T/NK cell lymphomas (such as nasal T/NK lymphoma, aggressive NK-cell leukaemia, T cell lymphoproliferative disorder of childhood).
  • the "effective dose" of a compound of the invention varies as a function of numerous parameters such as, for example, the route of administration and the weight, the age, the sex, the advancement of the pathology to be treated and the sensitivity of patient to be treated.
  • patient includes any mammal, and is preferably a human being.
  • halogen refers to a fluorine, bromine, chlorine or iodine atom, preferably a chlorine, bromine or fluorine atom.
  • azido refers to a -N 3 group.
  • biotinyl group refers to the following group:
  • (d-Ce lkyl) refers to a straight or branched saturated hydrocarbon chain containing from 1 to 6 carbon atoms including, but not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, t-butyl, n-pentyl, n-hexyl, and the like.
  • (Ci-C6)haloalkyl refers to a straight or branched saturated hydrocarbon chain containing from 1 to 6 carbon atoms substituted with halogen atoms, such as chlorine, bromine, iodine or fluorine atoms, preferably chlorine or fluorine atoms.
  • halogen atoms such as chlorine, bromine, iodine or fluorine atoms, preferably chlorine or fluorine atoms.
  • Examples of (Ci-C 6 )haloalkyl include, but are not limited to, CH 2 CI, CH 2 Br, CH 2 I, CH 2 F, CHF 2 , CF 3 , CH 2 CH 2 CI, CH 2 CH 2 BR, CH 2 CH 2 I, CH 2 CH 2 F, and the like.
  • (Cp-CB)alkenyl refers to a straight or branched unsaturated hydrocarbon chain containing from 2 to 6 carbon atoms and comprising at least one double bond including, but not limited to, ethenyl, propenyl, butenyl, pentenyl, hexenyl and the like.
  • (Cp-CB)alkynyl refers to a straight or branched unsaturated hydrocarbon chain containing from 2 to 6 carbon atoms and comprising at least one triple bond, preferably comprising only one unsaturation (i.e.a triple bond), including, but not limited to, ethynyl, propynyl, butynyl, pentynyl, hexynyl and the like.
  • (Cs-Cstevcloalkyl) refers to a hydrocarbon monocyclic or bicyclic (fused) ring having 3 to 8 carbon atoms including, but not limited to, cyclopropyl, cyclopentyl, cyclohexyl and the like.
  • (C 5 -Cio)cvcloalkenyl refers to a hydrocarbon monocyclic or bicyclic (fused) ring having 5 to 10 carbon atoms and comprising at least one double bond including, but not limited to, cyclopentenyl, cyclohexenyl and the like.
  • heteroatom refers to a hydrocarbon monocyclic or bicyclic (fused) ring having 3 to 8 ring atoms, containing at least one heteroatom, preferably 1 or 2 heteratoms, in the ring.
  • the heteroatom is preferably selected from O, N or S, and the S atom may be mono or dioxidized, i.e. the sulphur atom may be S, S(O) or S0 2 .
  • heterocycloalkyls include, but are not limited to, epoxide, aziridine, pyrrolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl.
  • heteroatom refers to a hydrocarbon monocyclic or bicyclic (fused) ring having 5 to 8 ring atoms, containing at least one heteroatom, preferably 1 or 2 heteratoms, in the ring, and comprising at least one double bond.
  • the heteroatom is preferably selected from O, N or S, and the S atom may be mono or dioxidized, i.e. the sulphur atom may be S, S(O) or S0 2 .
  • heterocycloalkenyls include, but are not limited to, pyrrolyl, dihydrofuranyl, dihydrothiophenyl, dihydropyranyl, tetrahydropyridinyl, dihydrooxazinyl, oxindolyl, benzothiazinyl, benzothiazinonyl, phthalimidyl, indolinyle, isoindolinyle.
  • an "aryl group” may be an aromatic or heteroaromatic group.
  • aromatic group as used herein alone or as part of another group denotes optionally substituted homocyclic aromatic groups, preferably monocyclic or bicyclic (fused) groups, containing from 6 to 10 carbons in the ring portion, such as phenyl, naphthyl and indenyle. Phenyl and naphthyl are the most preferred aromatic groups.
  • heteroaromatic as used herein alone or as part of another group denotes optionally substituted 5- to 10-membered aromatic groups having at least one heteroatom in at least one ring, and preferably 5 or 6 atoms in each ring.
  • the heteroaromatic group preferably has 1 to 3 heteroatoms preferably selected from O, N and S in the ring, and may be bonded to the remainder of the molecule through a carbon or heteroatom.
  • heteroaromatics include furyl, thiophenyl, pyrrolyl, isoxazolyl, oxazolyl, isothiazolyl, thiazolyl, imidazolyl, triazolyl, pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, indolyl, isoxindolyl, chromene-2-onyle (or coumarinyl), benzoxazolyl, benzothiazolyl, benzotriazolyl, quinolinyl, or isoquinolinyl and the like.
  • the heteroaromatic group is selected from a pyrrolyl, thiophenyl, isoxazolyl, triazolyl, oxazolyl, thiazolyl, benzothiazolyl, benzotriazolyl, pyrindinyl and pyrazinyl, in particular pyrrolyl, isoxazolyl,1 ,3-oxazolyl, 1 ,3-thiazolyl, 1 ,2,3-triazolyl, benzothiazolyl, benzotriazolyl, pyrindinyl and pyrazinyl.
  • alkylaryl refers to a (Ci-C 6 )alkyl-aryl group.
  • the alkylaryl group is a (Ci-C 6 )alkyl-aromatic group such as a benzyl group.
  • Me stands for methyl and Ph stands for phenyl. More generally, the abbreviations used to refer to chemical groups have the meaning commonly known in the art.
  • Figure 1 Identification and confirmation of the critical role of nucleolin in GAr-based translation inhibition in yeast.
  • NCL Human nucleolin
  • GAPDH was used as a loading control.
  • the 43GAr-Ade2p/GAPDH or Ade2p/GAPDH ratio are indicated below the gels.
  • Blots represent n ⁇ 3 Figure 2: Overexpression of NCL exacerbates GAr effect on protein expression whereas its downregulation reduces its inhibitory effect on translation in mammalian cells.
  • FIG. 3 NCL downregulation activates GAr-limited antigen presentation and recognition by specific T lymphocytes.
  • H1299 cells were transfected with mouse K b and 235GAr-OVA plasmids and control siRNA (left) or siRNA targeting NCL (right) and then mixed with naive OVA257-264 (SIINFEKL) specific CD8 + T cells isolated from peripheral and mesenteric lymph-nodes of mice and stained with CellTraceTM Violet. The proliferation of these SIINFEKL-specific T cells was determined by FACS analysis. Quantification of proliferating T lymphocytes when incubated in presence of cells treated by siRNA targeting NCL (si-NCL) or with control siRNA-treated cells (si-control) are shown on the right. The results were compared using the Student's /-test ( * p ⁇ 0.05).
  • G4 Schematic representation of a G-quadruplexe (G4) structure. Left) self-assembly of 4 guanines held together by Hoogsteen hydrogen bonds (dashed lines) giving a G-quartet in presence of K + and schematic representation depicted by grey rectangles. Several G-quartets stack to form G4. Right) the three main topologies adopted by G4 classified as function of strand orientation (indicated by arrows) and differing by loop arrangements. G4 RNA mostly adopt the parallel topology.
  • RNA pull-down using G4 forming RNA oligonucleotides covalently linked to biotin and streptavidin-coupled sepharose beads Lysate from H1299 cells was applied to the following matrices: streptavidin-coupled beads either alone (Empty), or together with GQ (containing the most probable G4 of GAr mRNA), GM (same sequence except that G critical for G4 formation were replaced by adenines or uridines) or ARPC2 (containing a G4 present in ARPC2 mRNA and that has been shown to bind NCL) RNA oligonucleotides. The sequence of these oligonucleotides is given in the Methods section. The proteins still bound to the beads after an 800 mM KCI wash were eluted and analyzed by SDS-PAGE and western blot.
  • PhenDC3 prevents GAr inhibition of protein expression and NCL binding to GAr's G4.
  • PhenDC3 competes for the binding of NCL on GAr and ARPC2 G4. Same experiment than in Figure 4 (c) in the presence of 10 ⁇ PhenDC3 or DMSO (vehicle) as indicated.
  • PhenDC3 increases endogenous EBNA1 expression in EBV-infected cells.
  • the level of endogenous EBNA1 in Mutu-1 (EBV-infected B cells, left panel) and NPC-6661 (EBV- infected cells from nasopharyngeal carcinoma, right panel) cells in response to 1 ⁇ PhenDC3 was determined by SDS-PAGE followed by western blot. Actin was used as a loading control and EBNA1/Actin ratio are indicated below the gels. Blots represent n ⁇ 3.
  • PhenDC3 increases T cell proliferation. Same experiment as in Figure 3 (c) & (d) except that 235GAr-OVA (upper panels) and OVA (lower panels) expressing H 1299 cells were treated with 5 ⁇ PhenDC3 or, as control, with DMSO as indicated. Quantification of proliferating T lymphocytes following PhenDC3 treatment as compared to DMSO-treated cells is shown in the graph on the right. The results were compared using the Student's /-test ( ** p ⁇ 0.01 ; ns: not significant).
  • Figure 8 Identification and confirmation of the critical role of nucleolin in GAr-based translation inhibition in yeast.
  • NSR1 overexpression On Ade2p level.
  • the overexpression of NSR1 gene which encodes the yeast nucleolin, has no effect on the white color of ADE2 expressing yeast cells and on the Ade2p protein level as evidenced by SDS-PAGE and western blot analysis (left panel).
  • GAPDH was used as a loading control.
  • the mean Ade2p/GAPDH ratios from 3 independent experiments are shown in the right panel and the results compared using the Student's /-test (ns: not significant).
  • siRNA-mediated NCL knockdown has no effect on EBNA1 and EBNAIAGAr mRNA level in H1299 cells.
  • H 1299 cells were transfected with EBNA1 or EBNAIAGAr and with control siRNA or siRNA against NCL, as indicated.
  • Relative levels of EBNA1 or EBNAIAGAr mRNA as compared to actin mRNA in cells treated with siRNA targeting NCL or control siRNA as indicated were determined by quantitative RT-PCR. The results were compared using the Student's /-test (ns: not significant).
  • FIG. 10 NCL downregulation activates antigen presentation and recognition by T lymphocytes.
  • Figure 11 PDS does not prevent NCL binding to both GAr's and ARPC2 G4s and has a lower affinity than PhenDC3 for GAr's G4.
  • PhenDC 3 -az R CH 2 -(0-CH 2 -CH 2 )3-N 3
  • PhenDC 3 -C4-C R ⁇ ⁇ Y ⁇ l
  • Phen-DC 3 -C4-Bn 4 benzoyl benzoic acid, EDCI , Et 3 N, HOBt , DMF, r. t., 18 h, for Phen-
  • DC 3 -C4-C 4- ⁇ 4-[bis(2-chloroethyl)amino]phenyl ⁇ butanoic acid, HTBU, DIPEA, DMT, r. t., 20h i) CH 3 I, DMF, 40 °C, 24 h.
  • Trimethylorthoacetate (30 eq) and Meldrum's acid (1 .5eq) were brought to a gentle reflux for 15 min, at 1 10 °C.
  • the resulting yellow solution was cooled down and 2-methylquinolin-8- amine (1 .0 eq) was added.
  • the reaction mixture was heated at reflux for 2 h and left under stirring at room temperature for 16 h.
  • the solvent was removed under vacuum and the red oil obtained was heated at 230 °C for 1 h in diphenylether.
  • petroleum ether was added and a dark red powder was obtained after filtration.
  • the product was purified by column chromatography (DCM/ethanol 90/10) affording a dark red solid (41 %).
  • PhenDC3n-C4-C 4- ⁇ 4-[bis(2-chloroethyl)amino]phenyl ⁇ butanoic acid (2 eq) was dissolved in DMF with PhenDC 3 n-NH 2 (1 eq), DIPEA (5 eq).
  • HBTU (2 eq) was added and the reaction mixture was stirred overnight at room temperature, with protection from light.
  • DMF was then removed under vacuum and the crude mixture was purified by flash chromatography (DCM 100 -> DCM/methanol 96/4) to afford the PhenDC 3 n-C4-C compound as a yellow powder (29 %).
  • yeast strains used in this study are derived from the W303 WT strain (Bondel et al. Genetics 2000, 155, 1033-1044): MATa, Ieu2-3, 112 trp1- 1 can1- 100 ura3-1 ade2-1 his3- 11, 15.
  • the ade2A strain genotype is: MATa, Ieu2-3, 112 trpl- 1 can1-100 ura3- 1 ade2- 1::his5 S. pombe.
  • Yeast cells were grown and used as previously described (Blondel et al, EMBO J 2005, 24, 1440-1452).
  • the media used for yeast growth were: YPD [1 % (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose], i/ 3 YPD [0.33% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) glucose].
  • Yeast minimal media w/o uracil [6.7% (w/v) yeast nitrogen base, 0.77% (w/v) amino acids without uracil, 2% (w/v) glucose].
  • Yeast minimal media w/o uracil and tryptophan [6.7% (w/v) yeast nitrogen base, 0.72% (w/v) amino acids without uracil, 2% (w/v) glucose].
  • Solid media contained 2% (w/v) agar.
  • a yeast genomic DNA library (a kind gift by F. Lacroute) constructed by inserting ⁇ 4 kb genomic DNA fragments (obtained by Sau3A partial digestion) at the unique BamHI site in the replicative 2 ⁇ multicopy pFL44L vector containing l//3 ⁇ 443-marker, was transformed into 43GAr- Ade2p pink yeast strain using standard lithium acetate procedures (Fukuda et al. J Bacteriol 1983, 153, 163-168). This multicopy plasmid is present at ⁇ 50-100 copies per yeast cell. Transformants were selected on uracil-free minimal solid medium and a positive selection was carried out based on the redder color phenotype.
  • Plasmids originated form the pFL44-based library were extracted from these 39 redder transformants, purified and amplified in E. coli and then re-transformed into 43GAr-Ade2p yeast strain for confirmation of the redder phenotype.
  • the extremities of the confirmed clones were sequenced using the following primers: F- 5' GTGCTGCAAGGCGATTAAGT 3' and R- 5TGTGGAATTGTGAGCGGATA 3'.
  • NSR1 coding sequence was amplified from genomic DNA of the S. cerevisiae W303 WT strain using the following primers:
  • PCR fragment was cloned into BamHI and Xhol cloning sites of p416 (GPD) centromeric vector.
  • GPD p416
  • NSR1 gene deletion was carried out by replacement with kanMX6 cassette amplified from PFA6a-kanMX6 vector (Longtine et al. Yeast 1998, 14, 953-961 ), using the following primers:
  • PCR fragment was transformed into W303 ade2A, 43GAr-ADE2 and W303 ade2A, ADE2 yeast strains using standard lithium acetate procedures (Fukuda et al. J Bacteriol 1983, 153, 163-168).
  • the transformed cells were spread on YPD + 100 ⁇ / ⁇ kanamycin plates which were then incubated 5 days at 29°C, after which the plates were replicated on fresh YPD + 100 ⁇ g/mL kanamycin plates, and the deletion of NSR1 gene in kanamycin-resistant colonies was checked by PCR, 367 using the following primers: nsrIA 368 Fbis-5' GTACTTAAGTGTAGCTGTTGC 3' and nsrIA Rbis-5' TAGAGATGGTGAATGAAAGG 3'.
  • Mammalian cells protein extracts Whole cells were harvested 48 hours post-transfection and lysed in 20 mM Tris-HCI, pH 7.5, 150 mM NaCI, 1 % Igepal containing protease inhibitors (Roche, Germany). Samples were centrifuged at 16,000 g during 20 min at 4°C and protein concentrations were measured using a Bradford assay.
  • Membranes were analyzed using the following antibodies: anti-HA serum (1 :2500); anti-Nsrl p mouse monoclonal antibody (Abeam, 1 :5000), anti-NCL rabbit polyclonal antibody (Abeam, 1 :5000), anti-GAPDH (Sigma, 1 :5000), anti-EBNA1 mouse monoclonal antibody (OT1 X, 1 :2000), anti-OVA rabbit polyclonal antibody (Sigma, 1 :2500), anti-actin (Sigma, 1/5000).
  • H1299 cells are derived from metastatic lymph node from lung carcinoma.
  • Raji cells are type III latency Burkitt's lymphoma.
  • HCT1 16 cells are derived from colorectal carcinoma.
  • B95.8 cells are derived from cotton-top Tamarin Monkey peripheral blood lymphocyte.
  • Mutu-1 cells are derived from an EBV-positive Burkitt's lymphoma biopsy specimen from a Kenyan patient.
  • NPC- 6661 cell line was established from a xenografted NPC in the early 90's 35 and was kindly provided by Prof. Kwok-Wai Lo from the Chinese University of Hong Kong.
  • H1299, Raji, B95.8 and Mutu-1 cells were cultured in RPMI-1640 media supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine.
  • HCT1 16 cells were cultured in McCoy's 5A Glutamax media supplemented with 10% FBS, and NPC-6661 cells in RPMI-1640 media supplemented with 25 mM HEPES (Gibco) and 2 mM L-glutamine and 10% FBS. All cells were cultured at 37°C with 5% C02. Transient transfections were performed using Genejuice reagent (Merck Bioscience) according to the manufacturer's protocol or electroporation using Gene PulserXL system (Biorad).
  • RNA extraction and quantitative real-time PCR Total yeast, H1299 and Mutu-1 cellular RNA was extracted using RNAeasy and RNAase-free, DNase kits (Qiagen). cDNA synthesis was carried out using 1 ⁇ g of DNA-free RNA using M- MLV reverse transcriptase (Invitrogen) and Oligo-dT primer. Triplicated cDNA samples were analysized by quantitative PCR using PERFECTA SYBR fastmix (Quanta Bioscience). The relative abundance of target mRNA was normalized using Actin as an endogenous control.
  • Quantification of gene expression was determined using the -2 Ct method.
  • the primers used for PCR were ⁇ D£2-forward: 5 419 '-ATTGTGCAAATGCCTAGAGGTG-3', ⁇ D£2-reverse: 5'- AATCATAA - GCGCCAAGCAGTC-3'; Actin-forward: 5 -ATGGTNGGNATGGGNCARAAR-3', Actin-reverse: 5 -CTCCATRTCRTCCCAGTTGGT-3'; EBNA /-forward: 5'- GGCAGTGGACCTCAAAGAAGAG-3'; EBNA 1- reverse: 5'-CAATGCAACTTGGACGTTTTT- 3'; OVA-forward: 5'-G AGG AGGCTTGG AACCTAT-3' ; OVA reverse: 5'- CAGTTTGAGAATCCACGGAG-3'. All the experiments were performed in triplicates and were repeated at least three times.
  • EBNA1 , EBNAIAGAr, 235GAr-OVA or OVA vectors were transfected with 0.75 g of EBNA1 , EBNAIAGAr, 235GAr-OVA or OVA vectors using standard procedures and incubated at 37°C for 8 hours. Cells were then transfected either with 40 nM of control siRNA or FlexiTube GeneSolution for NCL (Qiagen). siRNA transfection were performed using HiPerFect transfection reagent (Qiagen) following the manufacturer's protocol. 40 hours after siRNA transfection, cells were collected for western blot or flow cytometry analyses.
  • Mutu-1 cells were electroporated using SG Cell Line 4D-Nucleofector® X Kit from Lonza (V4XC-3012) following manufacturer's instructions and 300 nM of control siRNA or FlexiTube GeneSolution for NCL (Qiagen). 40 hours after siRNA transfection, cells were collected for western blot analyses.
  • H1299 cells were harvested after trypsin treatment and washed twice with 1 X PBS (Gibco).
  • Cells were suspended in 500 ⁇ of lysis buffer (20 mM Tris-HCI pH 7.5; 200 mM NaCI and 0.1 % Igepal) containing 1 X protease inhibitor cocktail (Roche).
  • lysis buffer (20 mM Tris-HCI pH 7.5; 200 mM NaCI and 0.1 % Igepal) containing 1 X protease inhibitor cocktail (Roche).
  • Cell lysis was performed by 5 series of vortex followed 445 by 10 min incubation on ice, and 3 series of 3 sec sonication at 20% amplitude. After lysis cells were centrifuged at 4°C for 15 min at 16,000g, and the supernatant was quantified by Bradford.
  • the whole cell extracts or recombinant GST-NCL were used for pull-down assays with the following G-quadruplex forming oligonucleotides: GQ- 5'-GGGGCAGGAGCAGGAGGA- 3'Biotin TEG, ARPC2- 5' AGCCGGGGGCUGGGCGGGGACCGGGCUUGU-3'Biotin TEG.
  • the negative control for EBNA1 G quadruplex was the GM- 5' GAGGCAGUAGCAGUAGAA- 3'Biotin TEG oligonucleotide which, according to the GQRS-H predictor software, is unable to form G4 structures.
  • high-affinity streptavidin sepharose beads (GE Healthcare) were incubated in 1 mL blocking buffer containing 10 mM Tris-HCI pH 7.5; 100 mM KCI; 0.1 mM EDTA; 1 mM DTT; 0.01 % Triton X-100; 0.1 % BSA; 0.02% S. cerevisiae tRNAs (Sigma), for 1 hour at 4°C on a rotating wheel. 10 pg of each folded biotinylated RNA oligos were incubated with 50 ⁇ _ of solution containing the streptaviding sepharose beads for 90 min at 4°C on a rotating wheel.
  • RNA oligonucleotides bound to the streptavidin beads 500 ⁇ g of cell extract or 200 ng of recombinant GST-NCL were incubated with the RNA oligonucleotides bound to the streptavidin beads during 90 min at room temperature. Beads were washed with increasing KCI concentration (200-800 mM). Protein still bound to beads after the washes were eluted using 2X SDS loading buffer and analyzed by western blotting against NCL, as previously described. In the input lane of the western blots was loaded a quantity of extract which corresponds to half of the quantity that was incubated with the beads for each condition.
  • PKA Proximity Ligation Assay
  • a blocking solution of 3% BSA 0.1 % saponine in 1 X PBS was added for 30 min followed by 2 hours incubation at room temperature with the primary antibodies (anti-digoxigenin 1/200 -Sigma- and anti-NCL 1/1000 -Abeam-) diluted in PBS 1 X, 0,3% BSA, 0.1 % saponine.
  • the proximity ligation assay (PLA) was carried out using the Duolink PLA in situ kit, PLA probe Anti-Rabbit Plus, the Duolink in situ PLA probe Anti-Mouse MINUS and the in situ detection reagent FarRed (all from Sigma) following the manufacturer's protocol.
  • PLA results were visualized using a Zeiss LSM780 confocal microscope. All the PLA experiments were performed at least three times independently and, each time, PLA dots were counted in 50 to 100 cells. For each PLA experiment the following controls were performed: w/o mRNA probe, w/o antibodies and with the control sense probe.
  • X 105 cells were transiently transfected with 4 ⁇ g of 235GAr-OVA or OVA vectors and, 8 hours later, NCL silencing was performed using 40 nM of NCL siRNA or control siRNA (as previously described). 40 hours after the transfection cells were incubated 30 min in a methionine-free medium. After incubation, 25 ⁇ of MG132 proteasome inhibitor was added to the medium and cells were incubated for 45 min. Cells were then cultured in a medium containing 0.15 mCi/mL 35 S-methionine (Perkin Elmer, Boston, USA) for i hour and harvested.
  • Cell pellets were suspended in 20 mM Tris-HCI, pH 7.5, 150 mM NaCI, 1 % Igepal and treated as described above. Lysates were pre-cleared with 1 ⁇ g normal rabbit serum (Dako) bound to protein G-Sepharose magnetic beads (GE Healthcare) for 30 min at 4°C and further immunoprecipitated with 1 ⁇ g of anti-OVA polyclonal antibody (Sigma) or IgG-rabbit (Dako), pre-bound to protein G-Sepharose magnetic beads overnight at 4°C. Beads were then washed and proteins eluted using 2X SDS loading buffer. Immunoprecipitates were analyzed by SDS- PAGE using 10% precast NUPAGE gels (Invitrogen). The amount of radiolabeled proteins was visualized using a Storm Phosphorimager (GE Healthcare).
  • CD8 + T cells were isolated by negative selection from peripheral and mesenteric lymph-nodes of 12-week-old female OT1 mice using the CD8+ T cell isolation kit (Miltenyi Biotec, Germany). Afterwards, CD8 + T cells were stained with CellTraceTM Violet (Thermo Fisher Scientific, USA) according to the manufacturer's protocol and mixed with H1299 cells cotransfected with mouse k b expression vector and OVA or GAr-OVA constructs.
  • 10 5 H1299 cells were harvested 48h after transfection and co-incubated with 4 x 10 5 stained T cells at 37°C in humidified air/C0 2 atmosphere in 1 497 ml of RPMI medium containing 10% FBS, 4 mM L-glutamine, 100 U/ml penicillin, 100 ⁇ g ml streptomycin, 5 mM HEPES and 0.05 mM 2-mercaptoethanol (Sigma-Aldrich).
  • Mutu-1 cells were plated in 0.1 ml in 96-well flat bottom plates and exposed to PhenDC3 at the indicated concentrations or DMSO (vehicle). After 24 hours, 10 ⁇ of 5 mg/ml MTT solution (CT01 -5, Merck Millipore) in PBS pH 7.4 were added to each well and incubated for 4 h. 0.1 mL of isopropanol-HCI 0.1 N-Triton X-100 10% were added to each well to dissolve the formazan crystals. The absorbance was then measured at 540 nm.
  • FID Fluorescence Intercalator Displacement
  • G4-FID assay is performed in a 96-well Non-Binding Surface Black with black bottom polystyrene microplates (Corning). Every ligand is tested on a line of the microplate, in duplicate (in other plate).
  • the microplate is filled with (a) K+100 solution (qs for 200 ⁇ _) (b) 10 ⁇ _ of a solution of pre-folded oligonucleotides (5 ⁇ ) and TO (10 ⁇ - 2 molar equiv.) and (c) an extemporaneously prepared 5 ⁇ ligand solution in K+100 buffer (0 to 100 ⁇ _ along the line of the microplate, i.e., from column A to column H: 0, 0.125, 0.25, 0.375, 0.5, 0.625, 0.75, 1.0, 1.25, 1.5, 2.0 and 2.5 ⁇ ).
  • fluorescence is measured using the following experimental parameters; positioning delay: 0.5 s, 20 flashes per well, emission/excitation filters for TO: 485/520, gain adjusted at 80% of the fluorescence from the most fluorescent well (i.e., a well from column A).
  • the percentage of displacement is then plotted as a function of the concentration of added ligand.
  • the DNA affinity is evaluated by the concentration of ligand required to decrease the fluorescence of the probe by 50%, noted DC50, and determined after non-linear fitting of the displacement curve.
  • Yeast nucleolin Nsrl p is required for GAr-based inhibition of protein expression in yeast and human nucleolin NCL can functionally replace Nsrl p
  • the yeast assay used in this genetic screen is based on a fusion between the yeast Ade2p reporter protein and a GAr domain of 43 amino acid (43GAr). Because GAr is able to self- inhibit the translation of its own mRNA in yeast, this leads to a reduction in Ade2p level. This can easily be monitored in yeast as cells which express Ade2p at a functional level form white colonies, whereas cells that do not express Ade2p readily form red colonies and any intermediate level of Ade2p leads to the formation of pink colonies whose intensity of coloration is inversely proportional to the level of Ade2p expressed.
  • 43GAr 43 amino acid
  • a yeast strain expressing the 43GAr-ADE2 construct from the constitutive ADH promoter forms pink colonies
  • a control strain expressing ADE2 from the same promoter forms white colonies
  • the 43GAr-ADE2 strain was used to identify yeast genes whose overexpression leads to a redder phenotype meaning that they potentially exacerbate GAr-based inhibition of translation.
  • the 43GAr-ADE2 yeast strain was transformed by a yeast genomic DNA library consisting of small genomic fragments ( ⁇ 4kb) cloned into a yeast 2 ⁇ multicopy plasmid which is present at -50 to 100 copies per yeast cell, hence potentially allowing to assess the effect of overexpressing the vast majority of yeast gene on GAr-based inhibition of translation.
  • Nsrl p the yeast orthologue of nucleolin
  • NCL the human nucleolin
  • NCL also controls GAr-dependent EBNA1 expression in EBV-infected cells
  • HA-NCL human nucleolin
  • NCL represents a host cell factor critically involved in the GAr-dependent suppression of EBNA1 synthesis, a mechanism at the basis of EBV immune evasion in latently infected cells.
  • OT1 cells naive CD8+ T cells recognizing specifically the OVA257-264 SIINFEKL epitope on the murine kb MHC class I molecule was determined.
  • the OT1 cells were isolated from peripheral and mesenteric lymph-nodes of 12-week-old mice and stained with the CellTraceTM Violet fluorescent dye. Then, OT1 cells were mixed with H1299 cells expressing 235GAr-OVA and the k b molecule. As a control, H1299 cells expressing OVA and the kb molecule were used.
  • 235GAr-OVA-expressing H1299 cells led to a much weaker activation of OT1 cells as compared to OVA-expressing H1299 cells (Fig. 3d, left panel), as determined by evaluating the number of dividing OT1 cells by FACS analysis.
  • siRNA-mediated NCL knockdown in 235GAr-OVA expressing H1299 cells significantly increased proliferation of OT1 cells (Fig. 3c, right panels) whereas it had no effect in OVA- expressing H1299 cells (Fig. 3d, right panels).
  • the efficiency of siRNA-mediated NCL downregulation and its effect on 235GAr-OVA or OVA expression are shown in Fig. 10b.
  • NCL directly interacts in the nucleus with G4 present in GAr-encoding mRNA sequence NCL has been reported to bind to some G-quadruplexes (G4) formed in both DNA (Gonzalez et al. J Biol Chem 2009, 284, 23622-23635) and RNA sequences (von Hacht et al. Nucleic Acids Res 2014, 42, 6630-6644).
  • G4 are composed and stabilized by the stacking of guanine tetrads which are assembled in a planar arrangement by Hoogsteen hydrogen bonding (Fig. 4a) and have been involved in the regulation of gene expression, DNA replication and telomere maintenance.
  • the G-rich sequence of GAr-encoding mRNA contains a cluster of 13 predicted G4. Hence, the ability of NCL to bind to these structures was determined.
  • a pulldown assay recently developed to identify RNA G4 binding proteins (von Hacht et al.) was adapted to an 18 nt long oligonucleotide containing the most probable G4 that can form in the GAr-encoding mRNA sequence. Briefly, this oligonucleotide (GQ) was linked to biotin and pulldown experiments using streptavidin-conjugated sepharose beads were performed.
  • GM oligonucleotide
  • ARPC2 30 nt-long oligonucleotide was used which corresponds to a G4 found in the ARPC2 mRNA and that has been shown to bind NCL (von Hacht et al.).
  • NCL was precipitated from H1299 cell extracts when using GQ or ARPC2 oligonucleotides, but no 21 1 t when using GM or empty beads showing that NCL binds to G4 formed in the GAr mRNA sequence.
  • PhenDC3 and analogs prevent NCL-EBNA1 mRNA interaction and GAr-based inhibition of protein expression
  • PhenDC3 prevents the binding of NCL on EBNA1 mRNA G4.
  • the same G4 oligonucleotide pulldown assay as in Figure 4c was performed in the presence or absence of 10 ⁇ PhenDC3 and it was observed that PhenDC3 does prevent the binding of NCL on GAr G4 (Fig. 6d), readily explaining its effect on 235GAr- OVA expression.
  • PhenDC3 prevents the binding of NCL on ARPC2 G4 (Fig. 6d).
  • PhenDC3 but not PDS, is also able to prevent the binding of NCL on these G4 structures by a competitive mechanism. This difference, which may be due, at least in part, to the lower affinity of PDS for GAr's G4, is consistent with the fact that PhenDC3 does interfere with the GAr self-inhibitory effect on protein expression whereas PDS is inactive.
  • PhenDC3 prevents the binding of NCL on EBNA1 mRNA in more physiological settings
  • the effect of PhenDC3 in the PLA experiment on EBV-infected Mutu-1 cells was tested.
  • the number of nuclear PLA dots per cell was significantly reduced (-3 fold) when Mutu-1 cells were treated with 0.75 ⁇ PhenDC3 confirming the ability of PhenDC3 to interfere with this interaction in a cellular context.
  • the same result was obtained when using H1299 cells expressing transfected EBNA1 (Fig. 5d and e).
  • PhenDC3 effect on endogenous EBNA1 expression in EBV infected cells was tested and it also increased the endogenous EBNA1 level in Mutu-1 (EBV-infected B-cells; Fig. 6e left panel) and NPC-6661 (EBV infected cells derived from a nasopharyngeal carcinoma (Hui et al. Cancer Genet Cytogenet 1998, 101, 83-88); Fig. 6e right panel) cells.
  • PhenDC3 had no effect on EBNA1 mRNA level in Mutu-1 cells (Fig. 1 1 c).
  • PhenDC3 is not significantly toxic on Mutu-1 cells when used at a concentration range (0.5-1 ⁇ ) in which it increases the expression of EBNA1 (Fig. 1 1 d).
  • PDS had no effect on endogenous EBNA1 level in Mutu-1 cells (Fig. 1 1 e) confirming that, contrary to PhenDC3, PDS is not able to interfere with the GAr-based self-inhibition of protein expression.
  • the PhenDC3 G4 ligand prevents the binding of NCL on GAr's G4 and, at the same time, leads to an increase in EBNA1 and 235GAr-OVA expression, thereby supporting the crucial role of NCL in GAr-based self-inhibition of translation by binding to G4 formed in the EBNA1 mRNA.
  • PhenDC3 activates GAr-limited antigen presentation
  • PhenDC3 significantly increased (two-fold change) the proliferation of OT1 T cells added to 235GAr-OVA-expressing H1299 cells whereas it had no effect on OT1 cells added to OVA-expressing cells.
  • a western blot analysis confirmed that PhenDC3 at 5 ⁇ increases the level of 235GAr-OVA whereas it has no effect on OVA (Fig. 7b).
  • nucleolin was identified as a host cell factor critically involved in GAr based EBNA1 immune evasion via its ability to bind G-quadruplexes formed in the GAr-encoding sequence of the EBNA1 mRNA.
  • yeast nucleolin Nsrl p was isolated as a critical host cell factor involved in GAr-based inhibition of protein expression in yeast. Indeed, the overexpression of Nsr1 p exacerbates the GAr effect whereas the deletion of NSR1 gene fully abrogates GAr ability to self-inhibit translation.
  • NCL has been also positively involved in EBV episome maintenance and transcription.
  • NCL appears to positively control both EBV episome maintenance and transcription on the one hand and the self-limitation of the EBV GMP expression on the other.
  • EBV one can consider it makes sense to have the same host cell protein regulating these two key aspects of EBV's latency.
  • NCL level is low, then the maintenance and transcription of EBV episome should be compromised but, as a result of NCL role in GAr-based limitation of EBNA1 expression, EBNA1 mRNA should be more efficiently translated, which may compensate for its reduced level and favor the maintenance of EBV genome.
  • NCL level is high, then EBV episome will be efficiently maintained and transcribed, hence leading to a high level of EBNA1 mRNA, but then the increased NCL could further downregulate its translation, thereby limiting the level of EBNA1 and therefore its detection by the immune system.
  • NCL in EBNA1 immune evasion
  • G4 structures present in EBNA1 mRNA whereas its role in episome maintenance and transcription involves its ability to interact with EBNAI 's N-terminal 100 amino acids (hence upstream of the GAr domain of EBNA1 protein). Therefore, targeting the NCL-EBNA1 mRNA interaction should specifically affect EBNA1 immune evasion.
  • EBNA1 G4 may constitute a recognition signal for NCL that is, itself, directly or indirectly, responsible for translation inhibition by interfering with either translation initiation and/or elongation machinery. Alternatively, NCL could stabilize G4 that, themselves, may inhibit the ribosome progression.
  • NCL-EBNA1 mRNA interaction occurs in the nucleus, either of these two possible mechanisms would explain why EBNA1 mRNA is translated mainly in mitosis, at a time when the nuclear envelope has been disaggregated. In either case, it is unlikely that the virus has developed a novel mechanism to exploit NCL for controlling gene expression. Rather, it is likely that this reflects a more general evolutionary conserved cellular pathway.
  • the fact that NCL effect on GAr-based limitation of protein expression is also operant in yeast strengthens this hypothesis as yeast has no common evolutionary history with EBV.
  • G4-ligands including PhenDC3 that, through binding to G4 that form in the GAr-encoding sequence of EBNA1 mRNA, prevent the interaction of the host cell protein nucleolin (NCL) with these G4, thereby interfering with the GAr-dependent immune evasion of EBV.
  • NCL host cell protein nucleolin
  • the effect of some G4-ligands presented here is at the level of RNA (and not DNA) and is due to the ability of these G4 ligands to interfere with an original mechanism of EBV immune evasion, and has therapeutic applications for the treatment of a specific sub-class of cancers, the cancers linked to EBV that roughly represent 1 to 2-3% of cancers worldwide, by unveiling tumour cells from these particular cancers to the immune system of the host.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des dérivés de bisquinolinium de formule (I): (I) avec Y1, Y2, Z1, Z2, X 2- et L tels que définis dans les revendications, utiles pour le traitement ou la prévention de cancers associés au Virus d'Epstein-Barr (cancers liés au VEB).
PCT/EP2018/063410 2017-05-19 2018-05-22 Dérivés de bisquinolium pour la prévention ou le traitement de cancers liés au veb WO2018211148A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17305588 2017-05-19
EP17305588.0 2017-05-19

Publications (1)

Publication Number Publication Date
WO2018211148A1 true WO2018211148A1 (fr) 2018-11-22

Family

ID=58779050

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/063410 WO2018211148A1 (fr) 2017-05-19 2018-05-22 Dérivés de bisquinolium pour la prévention ou le traitement de cancers liés au veb

Country Status (1)

Country Link
WO (1) WO2018211148A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110179798A (zh) * 2019-06-28 2019-08-30 河南牧业经济学院 G4配体PhenDC3在制备抗猪繁殖与呼吸综合征病毒的药物中的应用
CN110441533A (zh) * 2019-09-03 2019-11-12 桂林医学院 一种莪术醇靶标蛋白核仁素及其应用
CN111087394A (zh) * 2019-12-30 2020-05-01 西安瑞联新材料股份有限公司 一种2,9位取代的4-卤代-1,10-邻菲啰啉的合成方法
US11406631B2 (en) 2018-04-03 2022-08-09 Universite De Bretagne Occidentale Hydrazone derivatives for preventing or treating EBV-related cancers

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002096903A2 (fr) * 2001-05-28 2002-12-05 Aventis Pharma S.A. Derives chimiques et leur application comme agent antitelomerase
WO2004072027A2 (fr) * 2003-02-07 2004-08-26 Aventis Pharma S.A. Derives chimiques se liant de maniere tres specifique aux structures d'adn en g-quadruplexe et leur application comme agent anticancereux specifique
WO2009072027A2 (fr) 2007-12-07 2009-06-11 The Procter & Gamble Company Shampooing contenant un réseau de gel

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002096903A2 (fr) * 2001-05-28 2002-12-05 Aventis Pharma S.A. Derives chimiques et leur application comme agent antitelomerase
WO2004072027A2 (fr) * 2003-02-07 2004-08-26 Aventis Pharma S.A. Derives chimiques se liant de maniere tres specifique aux structures d'adn en g-quadruplexe et leur application comme agent anticancereux specifique
WO2009072027A2 (fr) 2007-12-07 2009-06-11 The Procter & Gamble Company Shampooing contenant un réseau de gel

Non-Patent Citations (28)

* Cited by examiner, † Cited by third party
Title
ASSITAN ET AL., BIOCHIMIE, vol. 94, no. 12, 2012, pages 2559 - 2568
BLONDEL ET AL., EMBO J, vol. 24, 2005, pages 1440 - 1452
BONCINA MATJAZ ET AL: "Thermodynamic fingerprints of ligand binding to human telomeric G-quadruplexes", NUCLEIC ACIDS RESEARCH, vol. 43, no. 21, December 2015 (2015-12-01), pages 10376 - 10386, XP002773921 *
BONDEL ET AL., GENETICS, vol. 155, 2000, pages 1033 - 1044
CHEN ET AL., PROC NATL ACAD SCI U S A, vol. 111, 2014, pages 243 - 248
DE CIAN ET AL., J. AM. CHEM. SOC., vol. 129, 2007, pages 1856 - 1857
E. LARGY ET AL., METHODS, vol. 57, no. 1, 2012, pages 129 - 137
ERIC LARGY ET AL: "A streptavidin paramagnetic-particle based competition assay for the evaluation of the optical selectivity of quadruplex nucleic acid fluorescent probes", METHODS, vol. 57, no. 1, 1 May 2012 (2012-05-01), pages 129 - 137, XP055054238, ISSN: 1046-2023, DOI: 10.1016/j.ymeth.2012.02.008 *
FREES ET AL., HUM GENOMICS, vol. 8, 2014, pages 8
FUKUDA ET AL., J BACTERIOL, vol. 153, 1983, pages 163 - 168
GONZALEZ ET AL., J BIOL CHEM, vol. 284, 2009, pages 23622 - 23635
HUI ET AL., CANCER GENET CYTOGENET, vol. 101, 1998, pages 83 - 88
LARSEN A F ET AL: "Tetrasubstituted phenanthrolines as highly potent, water-soluble, and selective G-quadruplex ligands", CHEMISTRY - A EUROPEAN JOURNAL 20120827 WILEY-VCH VERLAG DEU, vol. 18, no. 35, 27 August 2012 (2012-08-27), pages 10892 - 10902, XP002773924, DOI: 10.1002/CHEM.201200081 *
LARSEN ET AL., CHEM. EUR. J., vol. 18, 2012, pages 10892 - 10902
LARSEN ET AL., CHEMISTRY, vol. 18, no. 35, 2012, pages 10892 - 10902
LISTA ET AL., BIOTECHNOL J, vol. 10, 2015, pages 1670 - 1681
LONGTINE ET AL., YEAST, vol. 14, 1998, pages 953 - 961
MATJAZ ET AL., NUCLEIC ACIDS RESEARCH, vol. 43, no. 21, 2015, pages 10376 - 10386
MULLER ET AL., EXPERT REV CLIN PHARMACOL, vol. 7, 2014, pages 663 - 679
MURAT ET AL., CURR OPIN GENET DEV, vol. 25, 2014, pages 22 - 29
MURAT ET AL., NAT CHEM BIOL, vol. 10, 2014, pages 358 - 364
PENNARUN GAELLE ET AL: "Apoptosis related to telomere instability and cell cycle alterations in human glioma cells treated by new highly selective G-quadruplex ligands", ONCOGENE, vol. 24, no. 18, April 2005 (2005-04-01), pages 2917 - 2928, XP002773925, ISSN: 0950-9232 *
SIDIBE ASSITAN ET AL: "Effects of a halogenated G-quadruplex ligand from the pyridine dicarboxamide series on the terminal sequence of XpYp telomere in HT1080 cells", BIOCHIMIE (PARIS), vol. 94, no. 12, December 2012 (2012-12-01), pages 2559 - 2568, XP002773922, ISSN: 0300-9084(print) *
TOSONI ET AL., NUCLEIC ACIDS RES, vol. 43, 2015, pages 8884 - 8897
VERGA D ET AL., ANGEWANDTE CHEMIE, vol. 53, no. 4, 2014, pages 994 - 998
VERGA D ET AL: "Photo-cross-linking probes for trapping G-quadruplex DNA", ANGEWANDTE CHEMIE - INTERNATIONAL EDITION 20140120 WILEY-VCH VERLAG DEU, vol. 53, no. 4, 20 January 2014 (2014-01-20), pages 994 - 998, XP002773923, DOI: 10.1002/ANIE.201307413 *
VOISSET ET AL., DIS MODEL MECH, vol. 7, 2014, pages 435 - 444
VON HACHT ET AL., NUCLEIC ACIDS RES, vol. 42, 2014, pages 6630 - 6644

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11406631B2 (en) 2018-04-03 2022-08-09 Universite De Bretagne Occidentale Hydrazone derivatives for preventing or treating EBV-related cancers
CN110179798A (zh) * 2019-06-28 2019-08-30 河南牧业经济学院 G4配体PhenDC3在制备抗猪繁殖与呼吸综合征病毒的药物中的应用
CN110179798B (zh) * 2019-06-28 2022-04-26 河南牧业经济学院 G4配体PhenDC3在制备抗猪繁殖与呼吸综合征病毒的药物中的应用
CN110441533A (zh) * 2019-09-03 2019-11-12 桂林医学院 一种莪术醇靶标蛋白核仁素及其应用
CN111087394A (zh) * 2019-12-30 2020-05-01 西安瑞联新材料股份有限公司 一种2,9位取代的4-卤代-1,10-邻菲啰啉的合成方法

Similar Documents

Publication Publication Date Title
WO2018211148A1 (fr) Dérivés de bisquinolium pour la prévention ou le traitement de cancers liés au veb
Chu et al. Targeting the eIF4A RNA helicase as an anti-neoplastic approach
Wu et al. MicroRNA-199a-3p regulates endometrial cancer cell proliferation by targeting mammalian target of rapamycin (mTOR)
van Voss et al. Targeting RNA helicases in cancer: The translation trap
US20200347067A1 (en) Tricyclic amine compounds as cdk2 inhibitors
Liu et al. miR-375 targets the p53 gene to regulate cellular response to ionizing radiation and etoposide in gastric cancer cells
Huang et al. Attacking c-Myc: targeted and combined therapies for cancer
TW202045181A (zh) 細胞週期蛋白依賴性激酶2生物標記物及其用途
US20150267193A1 (en) MicroRNAs and Methods of Using Same
Sommer et al. Role of the RNA-binding protein La in cancer pathobiology
Xu et al. LncSHRG promotes hepatocellular carcinoma progression by activating HES6
Wang et al. PCBP1 inhibits the expression of oncogenic STAT3 isoform by targeting alternative splicing of STAT3 exon 23
Deng et al. High expression of the newly found long noncoding RNA Z38 promotes cell proliferation and oncogenic activity in breast cancer
Rong et al. Gambogic acid down-regulates MDM2 oncogene and induces p21Waf1/CIP1 expression independent of p53
Becker et al. Centromere localization of INCENP-Aurora B is sufficient to support spindle checkpoint function
EP2580231A1 (fr) Peptides, constructions et leurs utilisations
Xia et al. A novel triazole nucleoside suppresses prostate cancer cell growth by inhibiting heat shock factor 1 and androgen receptor
Li et al. Towards understandings of serine/arginine-rich splicing factors
Liu et al. A putative transcriptional elongation factor hIws1 is essential for mammalian cell proliferation
US20230018989A1 (en) Inhibiting the rna methyltransferase mettl3 or its interaction with eif3h to suppress oncogene translation and tumorigenesis
Rahman et al. Survivin clinical features in cervical cancer
KR101100248B1 (ko) 암에 대한 방사선 치료 증진용 약학 조성물 및 암에 대한 방사선 치료 증진용 활성물질을 스크리닝하는 방법
JP2011026203A (ja) オーロラカイネースａ及びオーロラカイネースｂ遺伝子選択的発現抑制剤
US11406631B2 (en) Hydrazone derivatives for preventing or treating EBV-related cancers
Chen et al. Lnc-GD2H promotes proliferation by forming a feedback loop with c-Myc and enhances differentiation through interacting with NACA to upregulate Myog in C2C12 myoblasts

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18725851

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18725851

Country of ref document: EP

Kind code of ref document: A1