WO2018203076A1

WO2018203076A1 - Modified microorganisms and methods for production of branched c5 carbon compounds

Info

Publication number: WO2018203076A1
Application number: PCT/GB2018/051196
Authority: WO
Inventors: Michelle GRADLEY
Original assignee: Gradley Michelle
Priority date: 2017-05-03
Filing date: 2018-05-03
Publication date: 2018-11-08
Also published as: GB201707034D0

Abstract

The present invention relates to the engineering of organisms to imbue or enhance the ability to convert central metabolic intermediates (acetyl CoA, pyruvate) into 2- methyl succinic acid and other important chemicals, using novel, unnatural pathways. The option to use acetate provided either endogenously or exogenously in place of, or as a source of acetyl CoA is also expressly included.

Description

MODIFIED MICROORGANISMS AND METHODS FOR PRODUCTION OF BRANCHED C5 CARBON COMPOUNDS

Technical field

The current invention relates generally to microorganisms, and related materials and methods, which have been modified to enhance their ability to produce valuable, branched C5 chemical products such as 2-methyl-1 ,4-butanediol, 2-methyl succinate, citramalate methyl-4-hydroxybutanoic acid and chemicals derived therefrom. The invention relates to the use of novel, unnatural, metabolic pathways involving key enzymes from the ethylmalonyl CoA pathway and other associated enzymes as appropriate to each product and to novel metabolic pathways for synthesis of 2-methyl succinate and chemicals derived therefrom, via citramalate and either mesaconate or citraconate.

Background art

2-Alkyl-1 ,4-butanediols, especially 2-methyl-1 ,4-butanediol, which can be derived directly from the pathways of this invention or derived from chemical conversion of the intermediates, have a variety of uses. For example, they can be cyclized to 3- methyl tetrahydrofuran or dehydrated to isoprene using an aluminium oxide catalyst (CN102533870 A) or using methodology similar to that used for dehydration of 1 ,4- butanediol to butadiene, e.g via 3-buten-1-ol (Inoue, H. et al. 2009. Appl. Catalysis A. General. 352, .66; Igarashi, A. et al. 2007. Catalysis Comm. 8, 807. Amongst other uses, 3-alkyl-tetrahydrofurans can be copolymerized with tetrahydrofuran to form polyether glycols (US6756501 B2). 3-Methyl tetrahydrofuran is also proposed to be a promising fuel component among the cyclic oxygenated species. (Parab, P.R et al. 2015. J. Phys. Chem. A. 119 (44), 10917-10928). Enantiomerically pure 2- methyl 1 ,4-butanediol is also a promising monomer for synthesis of liquid crystalline polyesters which are attracting interest in the industry (Uchimura, M. ef al. 2013. Res. Chem. Intermed.39, 403-414).

2-Methyl-1 ,4-butanediol has been prepared by a variety of chemical techniques. For example, by the reduction of itaconic acid via 2-methyl succinate (Xiaoran L, et.al 2016. Catalysis Today, 274, 88). Other examples include hydroformylation of 1 ,4- butenediol followed by hydrogenation of the hydroformylation reaction product as described in US3859369.

While the prior art methods are useful, they are not without their disadvantages. For example, the acetylene-based chemicals and chemical catalysts used in prior art processes are expensive and there is thus a need for a process which can be operated at a lower cost and preferably with associated environmental benefit.

With respect to the product 2-methyl succinic acid, it is useful to first discuss the related molecule itaconic acid. Itaconic acid is a five-carbon molecule that has a very similar structure to maleic anhydride and which can be chemically converted to products such as 2-methyl succinic acid; 3-methyl pyrrolidine; 3-methyl N-methyl-2- pyrrolidine; 4-methyl N-methyl-2-pyrrolidone; methyl-1 ,4-butanediol; 3-methyl tetrahydrofuran; 3-methyl gamma butyrolactone; 4-methyl gamma butyrolactone; 2- methyl-1 ,4-butanediamine, methacrylic acid (Determination of the market potential for selected platform chemicals. Weastro, sro, 7^th Framework programme, grant No 289194. KBB.2011.3.4.02; WO 2012107758 A1) and isoprene (Abdelraham, O.A. ef al. 2017. ACS Catalysis 7 (2), 1428). Other than for polymer and methacrylic acid application, conversion of itaconic acid to downstream products, typically operates via reduction of the methylene double bond to form 2-methyl succinic acid (Xiaoran, L ef al. Catalysis Today 2016. 274, 88; Catalysis for conversion of biomass and its derivatives 2013, ISBN: 9783844242829; Isikgor, F. et al. Polymer Chem. 2015. 6, 4497).

2-Methyl succinic acid can be chemically converted to itaconic acid via for example citraconic acid (US3931241) and also chemically converted to other higher value itaconic acid downstream products such as methacrylic acid, or methylmethacrylate (US3625996). Recently a chemical technology has been published which converts itaconic acid to isoprene via the 2-methyl succinic acid derivative 3-methyl tetrahydrofuran (Abdelrahman, O.A ef al. ACS. Catal, 2017. DOI: 10.1021/acscatal.6b03335; Spanjers, C.S. ef al. ChemCatChem 2016, 8, 3031). Applying this technology from 2-methyl succinate offers further advantage as one molecule of hydrogen is saved for every mole of isoprene produced. The use of more reduced 2-methylsuccinate downstream products such as methyl-4- hydroxybutyrate saves further moles of hydrogen. 2-Methyl succinic acid synthesis from traditional bio-based itaconic acid is considered as upgrading (Holzhauser, F. J. (Jan 2017) Green Chemistry. DOI: 10.1039/C6GC03153F Advance Article. Also, Verduyckt, J. and De Vos, D. E. Chem. Sci., 2017, 8, 2616 describe a method for the chemical conversion of bio-derived citric acid to 2-methyl succinate as an alternative to production from itaconic acid. Although the yield is quite high at 89%, direct fermentative production of 2-methyl succinate is preferable. Finally, optically active R or S-2-methyl succinic acid can be used as a chemical intermediate in the pharmaceutical industry for synthesis of chiral, substituted succinimides.

Overall, the industrial products described above for which itaconic acid could typically be a platform, can also be obtained from a methyl succinic acid platform, or from other chemical products derived from the novel, cost effective, metabolic pathways described in this invention.

Increasing the flexibility of inexpensive and readily available feedstocks while minimising the environmental impact of chemical production are two goals of a sustainable chemical industry. Feedstock flexibility relies on the introduction of methods that enable access and use of a wide range of materials as primary feedstocks for chemical manufacturing. The reliance on petroleum-based feedstocks warrants the development of renewable, cheaper or cleaner feedstock routes to chemicals. Current methods for biosynthesis of for example, 2-methyl-1 ,4-butanediol, 2-methyl succinate or methyl-4-hydroxybutanoic acid which can optionally be further chemically or enzymatically converted to a range of different products, are limited and expensive. Due to the diverse application of these chemicals it can be seen that developing microorganisms and methods of their use to ferment sustainable and/or cheaper feedstocks to 2-methyl-succinic acid and other important chemicals, would provide a contribution to the art.

Background to the natural ethylmalonyl CoA (EMC) pathway which forms part of the Group 1 pathways (Figure 2).

The metabolic pathways described in this invention are in two groups with optional interrelationship. Group 1 (Figure 2) pathways comprise sequential ethylmalonyl CoA enzymes operating from the general metabolic intermediate crotonyl CoA, in association with other enzymes as appropriate to each target product. Enzymes of the full ethylmalonyl CoA pathway (Figure 1), beyond the intermediate methyl succinyl CoA, are not used in this invention.

Oxidation of the metabolic intermediate acetyl CoA under aerobic conditions generally occurs via the TCA cycle. To circumvent the two steps where carbon is lost as C0₂, many organisms use the well-known glyoxylate cycle for net synthesis of cellular building blocks which operates in conjunction with the TCA cycle. Isocitrate lyase-negative organisms, that for example grow on acetate via conversion to acetyl CoA, but lack an operating glyoxylate cycle, use another strategy for carbon assimilation. Using biochemical studies together with mutant analysis, Erb, Alber and co-workers (Erb, T. J. et al. 2007. Proc. Natl. Acad. Sci. USA, 104, 10631 ; Erb, T. J. et al. 2009. Proc. Natl. Acad. Sci. USA, 106, 8871 ; Erb, T. J. et al. 2010. J. Bacteriol. 192,1249; Erb, T. J. et al. 2009. Mol Microbiol. 73, 992; Alber, B.E. ef al. 2006. Mol. Microbiol. 61 , 297) discovered the ethylmalonyl CoA (EMC) pathway (Figure 1) in Rhodobacter sphaeroides. The unique reductive carboxylation of crotonyl CoA by the enzyme crotonyl CoA carboxylase/reductase (Figure 1 and Figure 2, activity D), is the entry point into the C5 portion of the pathway. In 2011 , Birgit Alber, published a paper entitled 'Biotechnological potential of the ethylmalonyl CoA pathway' highlighting that the pathway contained many unique CoA ester intermediates such as (2R) and (2S) ethylmalonyl CoA and (2S)- methylsuccinyl CoA and novel enzymes for their interconversion (Appl. Microbiol. Biotechnol. 2011. 89,17.). The paper makes no mention of the construction of unnatural pathways for synthesis of the compounds described in this invention. Recently, attempts to exploit EMC pathway intermediates have been reported (Sonntag, F. ef al. Appl. Microbiol and Biotechnol, 2014, 98, 4533). Perturbation of the pathway was reported using thiolases to release low levels of organic acids (2- methyl succinate and mesaconic acid) from their CoA derivatives. Overall, EMC pathway enzymes are very under exploited in the field of industrial biotechnology. US20100190224A1 describes the synthesis of C3 or C4 compounds such as 3- hydroxypropionic acid or 3-hydroxyisobutyric acid using a pathway with methylmalonyl CoA or ethylmalonyl CoA as an intermediate, but offers no teaching with respect to this invention. US 20140212976A1 also specifically describes a novel pathway to butanol and other unrelated products which includes the EMC pathway enzyme crotonyl CoA carboxylase/reductase.

The current invention exploits the key enzymes of the EMC pathway namely crotonyl CoA carboxylase/reductase (EC 1.3.1.85) and ethylmalonyl CoA mutase (EC 5.4.99.63) to generate the C5 intermediate 2-methylsuccinyl CoA which is further converted to useful products which are not intermediates in the natural pathway, so creating novel unnatural pathways for synthesis of for example, 2- methylsuccinic acid, methyl-4-hydroxybutyrate (which may exist in equilibrium with the corresponding lactone) and 2-methyl-1 ,4-butanediol. However, any of the unnatural pathway intermediates may be considered as products themselves, or as intermediates for further conversion. The natural fate of 2-methylsuccinyl CoA is conversion to mesaconyl CoA via dehydrogenation Figure 1.

Background relating to citramalate involved with the Group 2 pathways of this invention.

Both (R) and (S)-citramalate are widely involved in various metabolic pathways, the details of which have been studied since the 1960's. For example, they are intermediates in pathways for degradation of itaconic acid, mesaconic or citraconic acid to acetyl CoA and pyruvate. Citramalate is also known to be involved in, among others, the anaerobic metabolism of glutamate via the methylaspartate pathway and in pathways for isoleucine synthesis {Howel!, D. M. 1999. J. Bacterid. 181 (1) 331- 333). It is also involved with autotrophic metabolism (Herter, S. et al. 2002. J. Bioi. Chem. 277, (23), 20277-20283). The synthesis of both enantiomers of citramalate using known enzymes has been reported in WO 2015022496 A2 and methods for synthesis of other derived products such as mesaconate and citraconate were also reported.

Summary of the invention

The present invention relates to the engineering of organisms to imbue or enhance the ability to convert central metabolic intermediates (acetyl CoA, pyruvate) into 2- methyl succinic acid and other important chemicals, using novel, unnatural pathways. The option to use acetate provided either endogenously or exogenously in place of or for conversion to acetyl CoA is also expressly included.

With respect to the Group 1 pathways of this invention (Figure 2) containing the key EMC enzymes crotonyl CoA carboxylase/reductase EC 1.3.1.85 and ethylmalonyl CoA mutase EC 5.4.99.63, the ethylmalonyl CoA pathway intermediate 2- methylsuccinyl CoA is generated, which is further converted into the target chemicals by use of additional, appropriate, non ethylmalonyl CoA pathway associated enzymes.

With respect to the Group 2 pathways of this invention (Figure 6) citramalate is generated which is dehydrated to either citraconic acid or mesaconic acid. Citraconic acid or mesaconic acid are reduced to 2-methyl succinic acid to uniquely drive the natural dehydration equilibrium within the cell. An option to further convert citramalate derived 2-methyl succinate into methyl-4-hydroxy butyrate (which may exist in equilibrium with methyl gamma butyrolactone) or 2-methyl 1 ,4-butanediol, using Group 1 pathway enzymes is included. Either via methyl succinyl CoA, or via direct reduction of 2-methyl succinate.

According to a first aspect of the present invention there is a recombinant microorganism engineered to express a gene encoding an enzyme having an activity selected from the list consisting of Activity D (e.g. crotonyl CoA carboxylase/reductase), Activity E (e.g. ethylmalonyl CoA epimerase), Activity F (e.g. ethylmalonyl CoA mutase), Activity G (e.g. methyl succinate semialdehyde dehydrogenase (acylating)), Activity H (e.g. methyl succinate semialdehyde reductase), Activity I (e.g. Aldehyde dehydrogenase/carboxylic acid reductase), Activity J (e.g. 2-methyl- 1 ,4-butanediol dehydrogenase), Activity K (e.g. methyl succinate semialdehyde dehydrogenase), Activity L (e.g. methyl succinyl CoA:acetate CoA transferase), Activity M (e.g. methyl succinate CoA ligase), Activity N (e.g. methyl succinyl coenzyme A hydrolase), Activity I and Activity H, and a combination of genes thereof,

wherein the microorganism does not contain an endogenous ethylmalonyl

CoA pathway or

wherein the recombinant microorganism is modified to lack a functional enzyme selected from the list consisting of 2-methyl succinyl CoA dehydrogenase or butyryl CoA dehydrogenase and a combination thereof.

According to a second aspect of the present invention there is a process for the formation of a non-natural C₅ carbon compound, comprising the steps of:

(i) combining the microorganism according to the first aspect with a liquid feedstock to form a broth,

(ii) culturing said broth for a sufficient time to form the non-natural C₅ carbon molecule, optionally in the presence of vitamin Bi₂ or a precursor thereof,

wherein the C₅ carbon molecule is non-natural in the sense that it is not produced via a metabolic pathway endogenous to the engineered microorganism.

According to a third aspect of the present invention there is a recombinant microorganism engineered to express gene(s) encoding an enzyme(s) having an activity selected from the list consisting of Activity P and Q (e.g. citramalate (pyruvate) lyase), Activity P (e.g. citramalate synthase), Activity R (e.g. citramalyl CoA lyase), Activity S (e.g. CoA transferase), Activity U (e.g. citraconase), Activity T (e.g. mesaconase), Activity U or T (e.g. citramalate dehydratase), Activity W (e.g. citraconate reductase), Activity V (e.g. mesaconate reductase) and a combination thereof.

According to a fourth aspect, there is a process for the formation of a non-natural C₅ carbon compound, comprising the steps of:

(i) Combining the microorganism according to the third aspect, with a liquid feedstock to form a broth,

(ii) Culturing said broth for a sufficient time to form the non-natural C5 carbon molecule,

wherein the C5 carbon molecule is non-natural in the sense that it is not produced via a metabolic pathway endogenous to the engineered microorganism.

According to a fifth aspect, there is a recombinant microorganism, genetically modified to synthesise citramalate and/or one or more of its downstream derivatives mesaconate, citraconate, 2-methylsuccinate, methyl-4-hydroxybutyrate and 2- methyl-1-4-butanediol, wherein the genetic modification permits utilisation of exogenous or endogenous acetate to convert endogenous pyrurate to citramalate Description of the Drawings

The present invention is described with reference to the accompanying drawings, wherein:

Figure 1 illustrates the natural ethylmalonyl CoA pathway;

Figure 2 illustrates non-natural pathways involving ethylmalonyl CoA pathway enzymes;

Figure 3 illustrates the Wood Ljungdahl pathway;

Figure 4 illustrates the citramalate (pyruvate) lyase complex EC 4.1.3.22; Figure 5 illustrates the butyrate synthetic pathway;

Figure 6 illustrates the synthesis of 2-methyl succinic acid via citramalate;

Figure 7 shows the nucleic acid sequence for a fusion protein having the activity of citramalyl CoA transferase and citramalyl CoA lyase; and

Figure 8 Shows SDS-PAGE gels of extracts made from either PrpD or FumD expressing yeast cells from Example 1.

Detailed description of the invention

The modified organisms of the invention are typically microorganisms capable of using renewable, cleaner, or inexpensive feedstocks or energy sources such as sunlight, glycerol, carbohydrates, methanol, acetate, synthesis gas and\or other gaseous carbon sources such as methane or C0₂/H₂, or combinations thereof, to generate the central metabolic intermediates acetyl CoA or pyruvate as appropriate to each pathway. The invention is defined with reference to enzyme activities A through to W, illustrated in Figures 2 and 6, where: Activity A defines an enzyme activity catalysing the conversation of acetyl CoA to acetoacetyl CoA; Activity B defines an enzyme activity catalysing the conversation of acetoacetyl CoA to 3-hydroxybutyryl CoA;

Activity C defines an enzyme activity catalysing the conversation of 3-hydroxybutyryl CoA to crotonyl CoA;

Activity D defines an enzyme activity catalysing the conversation of crotonyl CoA to ethylmalonyl CoA;

Activity E defines an enzyme activity catalysing the conversation of S-ethylmalonyl CoA to R-ethylmalonyl CoA, or R-ethylmalonyl CoA to S-ethylmalonyl CoA (epimerase);

Activity F defines an enzyme activity catalysing the conversation of ethylmalonyl CoA to methyl succinyl CoA;

Activity G defines an enzyme activity catalysing the conversation of methylsuccinyl CoA (2 or 3-methyl isomer) to methylsuccinate semialdehyde (2 or 3-methyl isomer);

Activity H defines an enzyme activity catalysing the conversation of methyl succinate semialdehyde (2 or 3-methyl isomer) to methyl 4-hydroxybutyrate (2 or 3-methyl isomer), or an enzyme activity catalysing conversation of methyl 4-hydroxybutanal (2 or 3-methyl isomer) to 2-methyl-1 ,4-butanediol;

Activity I defines an enzyme activity catalysing the conversion of methyl 4- hydroxybutyrate (2 or 3-methyl isomer) to methyl-4-hydroxybutanal (2 or 3-methyl isomer) or conversion of 2-methyl succinate to methyl succinate semialdehyde (2 or 3-methyl isomer);

Activity J defines an enzyme activity catalysing the conversation of methyl 4- hydroxybutanal (2 or 3-methyl isomer) to 2-methyl-1 ,4-butanediol;

Activity K defines an enzyme activity catalysing the conversation of methyl succinate semialdehyde to 2-methyl succinate; Activity L defines an enzyme activity catalysing the conversation of 2-methyl succinyl CoA to 2-methyl succinate, or 2-methyl succinate to methyl succinyl CoA (2 or 3-methyl isomer) (CoA transferase);

Activity M defines an enzyme activity catalysing the conversation of 2-methyl succinyl CoA to 2-methyl succinate, or 2-methyl succinate to methyl succinyl CoA (2 or 3-methyl isomer) (CoA ligase/synthetase); Activity N defines an enzyme activity catalysing the conversation of 2-methyl succinyl CoA to 2-methyl succinate (CoA hydrolase); Activity O defines a combination of two enzymes catalysing the conversion of 2- methyl succinate to methyl succinate semialdehyde (2 or 3-methyl isomer) catalysed by Activity I and the conversion of methyl succinate semialdehyde (2 or 3-methyl isomer) to methyl-4-hydroxybutyrate (2 or 3-methyl isomer) catalysed by Activity H; Activity P defines an enzyme activity catalysing the conversion of acetyl CoA and pyruvate to S or R-citramalate;

Activity Q defines a combination of two or three enzyme/protein components catalysing the conversation of acetate and pyruvate to R or S-citramalate;

Activity R defines an enzyme catalysing the conversion of acetyl CoA and pyruvate to R or S-citramalyl CoA;

Activity S defines an enzyme catalysing the conversion of R or S-citramalyl CoA and acetate or succinate to R or S-citramalate;

Activity T defines an enzyme catalysing the conversion of citramalate to mesaconate; Activity U defines an enzyme catalysing the conversion of citramalate to citraconate;

Activity V defines an enzyme catalysing the conversion of mesaconate to 2-methyl succinate; and Activity W defines an enzyme catalysing the conversion of citraconate to 2- methylsuccinate.

The present invention provides a non-naturally occurring microbial organism which includes a genetic modification in its genome which enhances production of 2- methylsuccinic acid, or derivatives e.g methyl-4-hydroxybutyrate or 2-methyl-1 ,4- butanediol by the microbial organism from at least one endogenous central metabolic intermediate and optionally acetate via a 2-methylsuccinic acid, methyl-4- hydroxybutyrate or 2-methyl- 1 ,4-butanediol synthetic pathway comprising both crotonyl CoA carboxylase/reductase EC 1.3.1.85 and ethylmalonyl CoA mutase EC 5.4.99.63 (Group 1 pathways, Figure 2).

The genetic modification will be such that said modified organism produces a greater flux of a pathway intermediate or product, for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol compared to a corresponding reference microbial organism not including said genetic modification, when grown on the same feedstock or energy source under the same conditions. For example, the modified organism may produce at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70. 80, 90, 100, 150, 200 times as much, or greater.

In a further aspect there is provided a non-naturally occurring microbial organism which includes a genetic modification in its genome which enhances production of 2- methylsuccinic acid, mesaconic acid, citraconic acid or citramalic acid by the microbial organism from at least one endogenous central metabolic intermediate and optionally acetate via a 2-methylsuccinic acid, mesaconic acid, citraconic acid or citramalic acid synthetic pathway comprising an enzyme, or enzyme complex capable of the coupling of pyruvate and acetyl CoA or pyruvate and acetate (e.g EC 4.1.3.22; EC 4.1.3.25; EC 4.1.3.46; EC 2.3.1.182; EC 2.3.3.13; EC 4.1.3.24) to form either (R) or (S)-citramalic acid or (R) or (S)-citramalyl CoA (Group 2 pathways, Figure 6). The genetic modification will be such that said modified organism produces a greater flux of a pathway intermediate or product, for example, 2-methylsuccinic acid, mesaconic acid, citraconic acid or citramalic acid compared to a corresponding reference microbial organism not including said genetic modification, when grown on the same feedstock or energy source under the same conditions. For example, the modified organism may produce at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70. 80, 90, 100, 150, 200 times as much, or greater.

In a further aspect there is provided a non-naturally occurring microbial organism which includes a genetic modification in its genome which enhances production of methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol by the microbial organism from at least one endogenous central metabolic intermediate and optionally acetate, via a methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol synthetic pathway comprising an enzyme, or enzyme complex capable of the coupling of pyruvate and acetyl CoA or pyruvate and acetate (e.g EC 4.1.3.22; EC 4.1.3.25; EC 4.1.3.46; EC 2.3.1.182; EC 2.3.3.13; EC 4.1.3.24) to form either (R) or (S)-citramalic acid or (R) or (S)- citramalyl CoA.

The genetic modification will be such that said modified organism produces a greater flux of a pathway intermediate or product, for example, methyl-4- hydroxybutyrate or 2-methyl-1 ,4-butanediol compared to a corresponding reference microbial organism not including said genetic modification, when grown on the same feedstock or energy source under the same conditions. For example, the modified organism may produce at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70. 80, 90, 100, 150, 200 times as much, or greater.

"Non-naturally occurring" in the present disclosure denotes the fact that the relevant modification which increases the flux to for example, 2-methylsuccinic acid, methyl- 4-hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconic acid, citraconic acid or citramalic acid is introduced to a reference organism by human intervention. A microbial organism of the invention preferably includes one or more of the following modifications within its genome:

(i) a modification which confers on the microorganism the capability to convert a feedstock described herein to, for example, 2-methylsuccinic acid, methyl-4- hydroxybutyrate or 2-methyl-1 ,4-butanediol, mesaconic acid, citraconic acid or citramalic acid, wherein the microorganism lacks the ability to carry out that conversion in the absence of said modification, (ii) a modification which increases the flux of a feedstock described herein to for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4- butanediol, mesaconic acid, citraconic acid or citramalic acid in a microorganism where that flux is initially very low or negligible. In one aspect, the modification typically relates to a crotonyl CoA carboxylase/reductase EC 1.3.1.85 and ethylmalonyl CoA mutase EC 5.4.99.63, or a variant thereof as described herein.

In a second aspect, the modification typically relates to an enzyme(s) capable of the coupling of acetyl CoA and pyruvate or acetate and pyruvate (e.g EC 4.1.3.22; EC 4.1.3.25; EC 4.1.3.46; EC 2.3.1.182; EC 2.3.3.13; EC 4.1.3.24) or a variant thereof as described herein.

Microbial organisms of the present invention may include any of the following genetic modifications:

(i) introduction of at least one heterologous gene encoding a pathway;

(ii) up-regulation of at least one endogenous gene encoding a pathway.

A preferred embodiment is a microbial organism wherein said modification is introduction of a heterologous nucleic acid encoding the enzyme.

The term "unnatural, novel pathway" in the present context refers to a series of enzymatically catalysed reactions occuring in a cell which convert one or more principle chemical starting materials or substrates (feedstocks) to for example, 2- methyl succinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconic acid, citraconic acid or citramalic acid, which involves an acyl derivative ('activated acetate') e.g the central metabolic intermediate acetyl CoA or an acyl protein intermediate. The invention embraces the introduction of all enzymes relevant to the unnatural, novel pathway, including those relating to early substrate utilisation and generation of the acyl derivative itself as well as those involved in conversion of e.g acetyl CoA to products such as 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4- butanediol, mesaconic acid, citraconic acid or citramalic acid. Thus, in addition to a modification relating to a crotonyl CoA carboxylase/reductase EC 1.3.1.85 and ethylmalonyl CoA mutase EC 5.4.99.63, or an enzyme(s) or enzyme complex capable of the coupling of acetyl CoA and pyruvate or acetate and pyruvate, (e.g EC 4.1.3.22; EC 4.1.3.25; EC 4.1.3.46; EC 2.3.1.182; EC 2.3.3.13; EC 4.1.3.24), microbial organisms may include one or more other modifications within its genome.

For example, said microbial organism may comprise one exogenous nucleic acid, encoding an unnatural, novel, pathway enzyme.

For example, said microbial organism may comprise two exogenous nucleic acids, each encoding an unnatural, novel, pathway enzyme.

For example, said microbial organism comprises three exogenous nucleic acids, each encoding an unnatural, novel, pathway enzyme.

For example, said microbial organism comprises four exogenous nucleic acids, each encoding an unnatural, novel, pathway enzyme. For example, said microbial organism comprises five exogenous nucleic acids, each encoding an unnatural, novel, pathway enzyme.

For example, said microbial organism comprises six exogenous nucleic acids, each encoding an unnatural, novel, pathway enzyme.

For example, said microbial organism comprises seven exogenous nucleic acids, each encoding an unnatural, novel, pathway enzyme.

For example, said microbial organism comprises eight exogenous nucleic acids, each encoding an unnatural, novel, pathway enzyme.

For example, said microbial organism comprises nine exogenous nucleic acids, each encoding an unnatural, novel, pathway enzyme. For example, said microbial organism comprises ten exogenous nucleic acids, each encoding an unnatural, novel, pathway enzyme.

As explained in more detail below, the invention also embraces the knockout or other impairment of enzyme activities which would otherwise direct flux away from the unnatural, novel pathway of choice.

In one aspect the invention provides, inter alia, a non-naturally occurring microorganism that through genetic engineering gains the ability to produce, for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4- butanediol, mesaconate, citraconate or citramalate from acetyl-CoA, or acetyl CoA and pyruvate or acetate and pyruvate, or gains the ability to produce an increased flux of 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate from the central metabolites (acetyl CoA, pyruvate) or derivatives or precursors thereof (e.g acetate), such that for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol, accumulates and can be recovered or further converted enzymatically or chemically without recovery.

As explained in more detail hereinafter, acetyl CoA may optionally be utilised via acetate.

By way of a non-limiting example, acetate can be converted to acetyl CoA via EC 6.2.1.1 or an acetate CoA transferase. Acetate may also be 'activated' as part of an acyl protein.

It will be appreciated that although "methyl succinate" may be referred to herein, depending on the pH and other conditions, it may likewise be present as methyl succinic acid, and therefore all these descriptors are used interchangeably, unless context demands otherwise. This applies mutatis mutandis to other salts or acids described herein - e.g. derivatives of butanoic acid etc. Also provided is a process or method for producing a microbial organism according to the invention, which comprises making a genetic modification as described herein.

The invention further provides a method for increasing the flux of for example, 2- methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate, produced by a microbial organism, which method comprises introducing one or more of the genetic modifications described herein into its genome. Thus, the present invention relates to the generation of microorganisms that are effective at producing for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate, from alternative substrates (or cheaper or cleaner) than traditional petroleum-based products. Methods of producing such a microorganism will typically comprise the step expressing, or causing or allowing the expression of, a heterologous nucleic acid for example, encoding at least a crotonyl CoA carboxylase/reductase EC 1.3.1.85 and ethylmalonyl CoA mutase EC 5.4.99.63, described herein for Group 1 pathways (Figure 2) or at least an enzyme typically assigned to EC 4.1.3.22; EC 4.1.3.25; EC 4.1.3.46; EC 2.3.1.182; EC 2.3.3.13; EC 4.1.3.24 for Group 2 pathways, Figure 6) within the host, following an earlier step of introducing the nucleic acid into the host or an ancestor of either. Suitable heterologous nucleic acids are discussed hereinafter. In other embodiments the methods may include the step of up- regulating, native enzymes using genetic engineering and\or repressing enzymes to reduce flux to competing pathways. Since the central intermediate acetyl CoA (or pyruvate) is present in all microbial systems, the actual choice of microbe utilised in the present invention will generally be based on the choice of feedstock or energy source which it is desired to use, along with the amenability of the microbe to genetic modification, or to the introduction of an unnatural, novel pathway.

Preferred processes disclosed herein involve sustainable manufacturing practices that utilise renewable feedstocks, though other feedstocks which may provide cost or environmental benefits compared to traditional petroleum products may also be used e.g. shale gas derived methanol or acetate

For example, the processes disclosed herein may utilise feedstocks such as syngas, C0₂, CO, and H₂, sugar, glycerol, methane and methanol (shale gas or biomass/ waste derived), acetate, (including as a by product of sustainable processing), or combinations thereof, to reduce energy intensity and cost and lower greenhouse gas emissions. Other feedstocks are discussed elsewhere herein.

Syngas is a mixture of primarily H₂ and CO that can be obtained via gasification of any organic feedstock, such as coal, coal oil, natural gas, biomass, or waste organic matter.

Alternative less desirable routes into 2-methylsuccinic acid, methyl-4- hydroxybutyrate or 2-methyl-1 ,4-butanediol pathways which bypass acetyl CoA, may involve synthesis of the pathway intermediate crotonyl CoA from expensive feedstocks such as glutarate and lysine (Vital, M et al. Mbio. 2014 5 (2) e00889-14).

It will be appreciated that -unless context demands otherwise where the term "syngas" is used, the embodiments of the invention will apply mutatis mutandis to other mixtures of carbon dioxide, carbon monoxide and/or hydrogen, and other substrates such as methane and methanol or carbohydrates.

Thus, the present invention preferably utilises microorganisms capable of utilizing methanol and gaseous carbon sources, or syngas or other gaseous carbon sources (C0₂, CO) with or without methanol, methane, glycerol or sugar co-utilisation (e.g Loubiere, P. et al. J. Gen Microbiol. 192, 138,979) or by use of methanol, methane, glycerol or sugars directly as sole feedstocks, or use or co use of waste streams containing e.g methanol or acetate or supply of acetate directly. Photosynthetic organisms (e.g. algae) capable of using sunlight as an energy source are also expressly included.

In another aspect of the invention there is disclosed a method for producing 2- methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate, that includes culturing the aforementioned non-naturally occurring microbial organisms under conditions and for a sufficient period of time to produce 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2- methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate. In another aspect of the invention there is provided a process for producing, for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4- butanediol which process comprises culturing a microbial organism of the invention on a reaction feedstock as described herein so that it metabolises the feedstock to produce 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate from acetyl CoA, pyruvate or acetate.

In some embodiments the microbe may be cultured in the presence of an additional energy source e.g. a carbohydrate such as a hexose, or sunlight.

The processes of the invention may further comprise recovering some or all of 2- methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4-butanediol e.g. by one or more of ion exchange, electrodialysis, solvent extraction, distillation, precipitation, crystalisation, or evaporation. However optionally, 2-methylsuccinic acid, methyl-4- hydroxybutyrate, 2-methyl-1 ,4-butanediol, may be converted chemically or enzymatically in situ to a downstream product or products, which may in turn be recovered by similar means. The processes of the invention may further comprise converting the 2- methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol, into a pharmaceutical, cosmetic, food, feed or chemical product, which for example, may optionally be an unsaturated alcohol, unsaturated acid, alkene, ketone, lactone, furan, carboxylic acid and so on.

Thus, in various aspects the invention provides non-naturally occurring microorganisms comprising one or more heterologous proteins conferring to the microorganism the capability to convert acetyl CoA, pyruvate or acetate to for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate as described herein. Alternatively, the heterologous protein may be directed at increasing the flux of reaction feedstocks such as syngas or other substrates described herein to 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate, in a microorganism where that flux is initially very low or negligible under relevant industrial culture conditions.

In various aspects the invention provides a non-naturally occurring microorganism which has been modified to up-regulate (increase expression of) a native protein, or to modify the localisation of a native protein, or to modify the activity or specificity of a native protein, thereby conferring to the microorganism the capability to convert syngas or other substrates described herein to, for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconate, citraconate, or citramalate, wherein the microorganism lacks the ability to carry out that conversion in the absence of said modification. Alternatively, the heterologous protein may be directed at increasing the flux of metabolic intermediates from the feedstock being utilised in a microorganism where that flux is initially very low or negligible. Thus, the invention provides a non-naturally occurring microbial organism having a genetically modified novel biosynthetic pathway and the competence to metabolise syngas or other feedstocks or energy source described herein to produce, for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4- butanediol.

Some aspects and embodiments of the invention will now be discussed in more detail:

Metabolic pathways leading to acetyl Co A and pyruvate

Acetyl CoA (or acetate) and pyruvate are the products of a considerable range of different central metabolic pathways for assimilation of carbon, or they can easily be derived from products of central metabolism, for example, acetyl CoA can be obtained from pyruvate generated from glycolysis, or pyruvate can be obtained from acetyl CoA generated from for example, the Wood Ljungdahl pathway. Acetyl CoA and pyruvate are normally converted to important cellular building blocks essential for life. In the present invention acetyl CoA or pyruvate are additionally utilised within a pathway, which pathway is at least in part the result of genetic engineering of the microbial organism.

As explained above, typically an organism is selected according to the feedstock it is desired to utilise and may be selected to have in its genome a particular metabolic pathway leading to acetyl CoA or an acetyl CoA precursor. Example metabolic pathways include:

• the Wood-Ljungdahl pathway

• the ribulose monophosphate (RuMP) pathway

· the reverse TCA cycle

• the serine cycle

• glycolysis and the pentose phosphate pathway

• the Calvin cycle via 3-phosphoglycerate

• other pathways such as the 3-hydroxypropionate/4-hydroxybutyrate cycle

In general, pathways producing acetyl CoA or pyruvate, are well reported and well understood by those skilled in the art. The Wood-Ljungdahl pathway, reverse TCA cycle, the serine cycle, the RuMP pathway and the Calvin cycle, are examples of C1 (gas and liquid) fixation pathways. In some case these pathways can be used alongside glycolysis.

For example, the Wood-Ljungdahl pathway (Figure 3) is important for redox balancing by using the reducing equivalents generated from glycolysis and pyruvate decarboxylation to acetyl CoA, to fix the released 2 C0₂ into a further molecule of acetyl CoA. The serine or the RuMP pathways are generally used by methanotropic and methylotrophic organisms for assimilation of C1 feedstocks such as methanol, methane and C0₂. These pathways are well described and well known in the art. The product of the RuMP pathway is pyruvate which would normally be converted primarily to biomass mainly via acetyl CoA.

The Calvin cycle is typically used by photosynthetic organisms such as algae for assimilation of C0₂ using light energy.

The serine cycle primarily produces acetyl CoA which can enter the ethylmalonyl CoA pathway for synthesis of building blocks for biomass synthesis or tapped off to other more useful compounds. The same principle can be used for all metabolic pathways producing pyruvate or acetyl CoA as the product or any metabolite which can be converted to acetyl CoA or pyruvate. Another example would be the reverse TCA cycle which again produces acetyl CoA from fixation of two molecules of C0₂. All these central metabolic pathways are well understood in the art.

"Acetogens" as used herein refers to anaerobic organisms able to reduce C0₂/CO to acetate via the Wood Ljungdahl pathway. Acetate is derived from acetyl CoA. Some acetogens such as Eubacterium limosum can also produce or co-produce other natural products such as butyrate. Acetogens can grow on (utilise or co-utilise) a variety of different substrates such as, hexoses and pentoses [e.g glucose, fructose and xylose], C2 and C1 compounds [gas and liquid] including methanol, C0₂/H₂ and CO gases. Acetogens are also known to utilise acetate directly. They are also capable of utilising alcohols and diols. Organisms capable of utilizing CO and syngas also generally have the capability of utilizing C0₂ and C0₂/H₂ mixtures through the same basic set of enzymes and transformations encompassed by the Wood-Ljungdahl pathway. H₂-dependent conversion of C0₂to acetate by microorganisms was recognized long before it was revealed that CO also could be used by the same organisms and that the same pathways were involved.

Thus in one embodiment the invention provides a non-naturally occurring microorganism having the Wood-Ljungdahl pathway and the capability of utilising syngas, CO, or methanol naturally and that through genetic engineering gains the ability to produce, for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2- methyl-1 ,4-butanediol, mesaconate, citraconate, or citramalate, or gains the ability to produce an increased flux of 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2- methyl-1 ,4-butanediol, mesaconate, citraconate, or citramalate. In the case of C0₂, additional sources include, but are not limited to, production of C0₂ as a byproduct in ammonia and hydrogen plants, where methane is converted to C0₂; combustion of wood and fossil fuels; production of C0₂ as a byproduct of fermentation of sugar in the brewing of beer, whisky and other alcoholic beverages, or other fermentative processes; thermal decomposition of limestone, CaC0₃, in the manufacture of lime, CaO; production of C0₂ as byproduct of sodium phosphate manufacture; and directly from natural carbon dioxide springs, where it is produced by the action of acidified water on limestone or dolomite.

The ability of acetogens to utilise methanol requires specific methyltransferases. Where such aceteogen methyltransferases are not naturally present, an acetogen can be engineered with heterologous methyltransferases and other associated proteins to allow it to utilise methanol as well as the other feedstocks discussed above.

Examples of enzymes required to give an acetogen the ability to grow on methanol include: methanol methyltransferase (MtaB); Corrinoid protein (MtaC); Methyltetrahydrofolate:corrinoid protein methyltransferase (MtaA); Methyltetrahydrofolate:corrinoid protein methyltransferase (AcsE) and Corrinoid iron-sulfur protein (AcsD).

The methylotrophs and methanotrophs also naturally grow on methanol and/or methane, utilising for example, the RuMP or serine cycle pathways for C1 metabolism.

Thus in one embodiment the invention provides a non-naturally occurring microorganism having the RUMP or serine cycle pathway encoded in its genome and the capability of utilising methanol or methane naturally and that through genetic engineering gains the ability to produce 2-methylsuccinic acid, methyl-4- hydroxybutyrate or 2-methyl-1 ,4-butanediol or gains the ability to produce an increased flux of 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4- butanediol, mesaconate, citraconate, or citramalate.

Photosynthetic organisms such as microalgae or cyanobacteria are autotrophs or heterotrophs able to utilise sunlight (light energy) for C0₂ fixation via the Calvin cycle. A product is glyceraldehyde-3-phosphate which can be converted to sugar or to pyruvate and acetyl CoA. Other bacteria such as Cupriavidus sp. also utilise the Calvin cycle for initial carbon fixation.

Many diverse microorganisms are heterotrophic and can utilise sugars as a source of carbon and energy via glycolytic pathways such as the Entner doudoroff pathway, Embden meyerhof pathway or pentose phosphate pathway. All sugar assimilation pathways are well understood in the art. A product of these pathways is typically pyruvate which may be converted to acetyl CoA for example, for entry into the TCA cycle for supply of cellular building blocks such as malate, oxaloacetate, succinate or fumarate. Many organisms not normally considered heterotrophs (e.g. acetogens or methylotrophs) are also capable of heterotrophic growth if sugars are supplied. Enzymes suitable for converting the metabolic intermediate acetyl CoA to for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4- butanediol, are discussed in more detail below, and example pathways are shown in Figure 2 (Group 1 pathways) and Figure 6 (Group 2 pathways). All Group 1 routes require synthesis of the common intermediate 2-methyl succinyl CoA. All Group 2 routes require synthesis of citramalate. Briefly: i) Group 1 pathways to 2-methylsuccinic acid, methyl-4-hydroxybutyrate and 2- methyl- 1 ,4-butanediol.

Routes to 2-methyl succinate proceed from methyl succinyl CoA via either Activity L, M, N or G and K or combinations thereof, using for example, enzymes typically assigned to EC 6.2.1.5; EC 6.2.1.4; EC 3.1.2.1 through to 3.1.2.27, EC 3.1.2.-; EC 2.8.3.18; EC 1.2.1.76; EC 1.2.1.75; EC 1.2.1.11 ; EC 1.2.1.16; EC 1.2.1.24; and EC 1.2.1.79, or using enzymes described in the examples. (Figure 2)

Routes to methyl-4-hydroxybuytrate proceed from methyl succinyl CoA or 2-methyl succinate via either Activity G and H (which may be combined in the same enzyme) or G, K, O, or Activities L, M, N, O, using for example, enzymes typically assigned to EC 6.2.1.5; EC 6.2.1.4; EC 3.1.2.1 through to 3.1.2.27, EC 3.1.2.-; EC 2.8.3.18; EC 1.2.1.76; EC 1.2.1.75; EC 1.2.1.11 ; EC 1.2.1.16; EC 1.2.1.24; and EC 1.2.1.79; EC 1.1.1.1 , EC 1.1.1.2, EC 1.1.1.72 or EC 1.1.1.265 or EC 1.1.1.283; EC 1.1.1.31 and EC 1.1.1.B47, or using enzymes described in the examples. Routes to 2-methyl 1 ,4-butanediol use the same activities to obtain methyl- hydroxybutyrate and then additionally require Activity I and J, H using for example EC 1.1.1.1 , EC 1.1.1.2, EC 1.1.1.72 or EC 1.1.1.265 or EC 1.1.1.283; EC 1.1.1.31 ; EC 1.1.1.1347; EC 1.2.7.5; EC 1.2.1.30; EC 1.2.99.6 and EC 1.2.1.3, or enzymes described in the examples. ii) Group 2 pathways to 2-methyl succinate, mesaconate, citraconate or citramalate.

Routes to (R) or (S)-citramalate proceed as appropriate through activity P, Q, R and S (Figure 6) using for example, enzymes typically assigned to EC 4.1.3.25; EC 4.1.3.46; EC 2.3.1.182; EC 2.3.3.13: EC 4.1.3.24 and EC 4.1.3.22; EC 2.8.3.22; EC 2.8.3.10 or EC 2.8.3.11 or enzymes described in the examples.

Routes to mesaconate proceed as appropriate via activity P, Q, R, S and T using for example, enzymes listed for citramalate synthesis and additional enzymes typically assigned to EC 4.2.1.79; EC 4.2.1.117 and EC 5.3.3.-; EC 4.2.1.24; EC 4.2.1.2; EC 4.2.1.34, or enzymes described in the examples.

Routes to citraconate proceed as appropriate via activity P, Q, R, S and U using for example, enzymes listed for citramalate synthesis and additional enzymes typically assigned to EC 4.2.1.79; EC 4.2.1.117 and EC 5.3.3.-; EC 4.2.1.35; EC 4.2.1.31 ; EC 4.2.1.33, or enzymes described in the examples.

Routes to (R) or (S)-2-methyl succinate proceed as appropriate via activity V or W using enzymes listed for citraconate or mesaconate synthesis and additional enzymes typically assigned to EC 1.3.5.4; EC 1.6.99.1 ; EC 1.3.1.6; EC 1.3.1.31 , EC 1.3.98.1 ; EC 1.3.1.14; EC 1.3.1.15, or enzymes described in the examples. iii) Group 2 pathways to methyl-4-hydroxy butyrate or 2-methyl- 1 ,4-butanediol Routes to methyl-4-hydroxybutyrate and 2-methyl-1 ,4-butanediol proceed from 2- methyl succinate as described in i) above.

The other enzyme examples utilised in all these routes are discussed in more detail hereinafter.

Preferred host organisms Group 1 pathways.

The inclusion of the enzyme ethylmalonyl CoA mutase in a pathway(s) requires in a host organism, either, the de novo biosynthesis of vitamin B12, more often the precursor hydroxocobalamin which is converted to the active forms methylcobalamin or adenosylcobalamin, or the ability to take up vitamin B12 or a precursor thereof. Ethylmalonyl CoA mutase is a vitamin B12 dependent enzyme and is inactive without the presence of bound adenosylcobalamin (AdoCbl).

Suitable, non-limiting examples of vitamin B12 synthesisers would be the acetogens such as Moorella thermoacetica, Acetobacterium woodii, Clostridium jungdahlii, Clostridium autoethanogenum, Eubacterium limosum, Oxobacter pfenngii, Sporomusa sp. Clostridium sp. and Butyribacterium methylotrophicum. However, again without limitation, the following genera in general are known to synthesise vitamin B12 denovo: Acetobacterium, Aerobacter, Agrobacterium, Alcaligenes, Azotobacter, Bacillus, Geobacillus, Clostridium, Moorella, Corynebacterium, Flavobacterium, Lactobacillus, Micromonospora, Mycobacterium, Nocardia, Propionibacterium, Protaminobacter, Proteus, Pseudomonas, Rhizobium, Salmonella, Serratia, Streptomyces, Streptococcus and Xanthomonas, Eubacterium. Examples of wild type organisms capable of uptake and metabolic use of vitamin B12 but which do not naturally have the full cobalamin synthetic pathway for vitamin B12, would be the bacterium E. coli (Lawrence, J.G. and Roth, J. R. 1995. J. Bacteriol. 177 (22) 6371), algae (Croft, M.T. et al. 2005. Nature 438,90) or organisms containing a gene coding for a vitamin B12 dependent enzyme subfamily e.g AdoCbl-dependent isomerases, MeCbl-dependent methyltransferases, and B12 dependent reductive dehalogenases, for example, methylmalonyl CoA mutase, EC 5.4.99.2, methyl aspartate mutase, EC 5.4.99.1 ; methyleneglutarate mutase, EC 5.4.99.4; isobutyryl CoA mutase, EC 5.4.99.13; methionine synthase, EC 2.1.1.13; glycerol dehydratase, EC 4.2.1.30; propanediol dehydratase, EC 4.2.1.28; tetrachloroethene reductive dehalogenase EC 1.97.1.8 and ethanolamine ammonia lyase EC 4.3.1.7. See review on cobalamin and corrinoid dependent enzymes (Matthews, R.G, 2009. Met. Ions Life Sci. 6, 53.)

An example of successful heterologous expression of a B12 dependent enzyme in a non B12-synthesising organism would be overexpression of recombinant methylmalonyl CoA mutase (EC 5.4.99.2) in Escherichia coli (Zhang, W. et al. 1999. Appl. Biochem. Biotechnol, 82 (3) 209). As highlighted above, any organism with the capacity to import vitamin B12 or a suitable vitamin B12 precursor e.g hydroxocobalamin which can be converted in vivo to the different forms of vitamin B12 (Dayem, L. et al. 2002. Biochem. 41 (16) 5193) would be a potentially suitable pathway host for this invention. Finally, Raux, E. ef al 1996 J. Bacteriol. 178, 753- 767 describe cloning of the S. typhimurium cobalamin (vitamin Bi₂) biosynthetic genes (cob operon) in E. coli. Organisms which naturally harbour the EMC pathway may be modified as described in this invention. With respect to organisms which do not harbour the full EMC pathway or its key enzymes crotonyl CoA carboxylase/reductase EC 1.3.1.85 and ethylmalonyl CoA mutase EC 5.4.99.63, in addition to a requirement for Vitamin B12 synthesis or uptake described herein, a preferred host would also be one capable of butyrate synthesis. Various butyrate producing strains are described by Vital, M et al. Mbio. 2014. 5 (2) e00889-14. A typical butyrate synthetic pathway is shown in Figure 5. and shares the common intermediate crotonyl CoA with the EMC pathway. Other routes to butyrate are described by Vital, M. ef al. ibid. Hence, elimination or reduction of the enzyme converting crotonyl CoA to butyryl CoA in the butyrate pathway would allow crotonyl CoA to be diverted into a 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol unnatural metabolic pathway.

Non-limiting examples of butyrate producing acetogens are: Eubacterium limosum;

Butyribacterium methylotrophicum; Clostridium carboxydivorans; Clostridium drakei; Clostridium scatologenes; Oxobacter pfenngii. (Jeong, J. ef al. Appl. Environ.

Microbiol. 2015. 81 , (14) 4782; Worden, R.M. ef al. Appl. Biochem. Biotechnol.

1989. 20, 687; Datta, R. et al. Biotech. Bioeng. 1983, 25 (4) 991 ; Debarati, P. et al.

J. Bacteriol. 2010, 192, (20) 5554; Liou, J. S-C. ef al. Internat. J. Syst. Evol.

Microbiol. 2005. 55, 2085; Bengelsdorf, F.R. ef al. Genome Announc. 2015, 3 (6) e01408-15; Kelly, W.J. et al. Standards in Genomic Sc. 2016, 11 , 26; Lindley, N.D. et al. J. Gen. Microbiol. 1987, 133, 3557; Kane, M. et al. Arch. Microbiol. 1991 , 156,

91.

Group 2 pathways.

One type of ideal host would be one with minimal natural carbon flux to intermediates other than acetyl CoA acetate or pyruvate. By non-limiting example, typically acetogens such as Acetobacterium sp. e.g Acetobacterium woodii; Blautia sp. e.g Blautia producta; Moorella sp. e.g Moorella thermoacetica; Sporomusa sp. e.g Sporomusa acidovorans; Eubacterium sp, e.g Eubacterium limosum (depending on feedstock) can direct significantly in excess of 80% of carbon through to acetate via acetyl CoA. The balance of the carbon is used for biomass synthesis which proceeds from acetyl CoA through pyruvate. Further preferred hosts for Group 2 pathways would include Acetobacterium, Aerobacter, Agrobacterium, Alcaligenes, Azotobacter, Bacillus, Geobacillis, Clostridium, Moorella, Corynebacterium, Flavobacterium, Lactobacillus, Micromonospora, Mycobacterium, Nocardia, Propionibacterium, Protaminobater, Proteus, Pseudomonas, Phizobium, Salmonella, Serratia, Streptomyces, Streptococcus, Sporomusa Xanthomonas, Escherichia, Saccharomyces, Schizosaccharomyces, Kluyveromyces, Candida, Pichia, Dekkera, Hansenula, Torulopsis, Yarrowia and Eubacterium. More preferred, e.g Eubacterium limosum, Acetobacterium woodii, Butyribacterium methylotrophicum, Clostridium carboxydivorans, Clostridium drakei, Clostridium scatologenes, Clostridium ljungdahlii, Clostridium autoethanogenum, Blautia producta, Oxobacter pfenngii, Escherichia coli, Sporomusa ovata, Sporomusa acidovorans, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Candida sonorensis, Pichia stipidis, Pichia pastoris, Dekkera bruxellensis, Hansenula polymorpha, Candida boidini and Yarrowia lipolytica. Clostridium ragsdalei or Clostridium drakei.

Down regulation of native enzymes

The modified organisms of the invention may be engineered to target (down- regulate, knockout or inhibit) the activity of enzymes which may otherwise direct the flux of intermediates in the unnatural novel pathways of this invention, to other products or biomass. Methods of targeting genes in this way are known in the art and are also discussed below.

In yeast such as Saccharomyces where pyruvate required for citramalate synthesis is typically directed to ethanol via acetaldehyde, targeting one or more (e.g PDC1 and PDC5) pyruvate decarboxylases may be required. Alternatively, it may be desirable to produce acetyl CoA from acetaldehyde in which case targeting one or more of the alcohol dehydrogenases producing ethanol will also be important e.g ADH1 , ADH2, ADH3, ADH4, ADH5, or SFA1.

The operation of any of the novel pathways described in this invention within a host organism naturally expressing the full, EMC pathway will require knockout of at least 2-methyl succinyl CoA dehydrogenase (Figure 1). In the full natural EMC pathway this enzyme is responsible for conversion of the common intermediate of the Group 1 pathways of this invention, 2-methylsuccinyl CoA, to mesaconyl CoA. With respect to this invention, synthesis of mesaconyl CoA would reduce flux to target products, for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4- butanediol. An example knockout of the gene coding for 2-methyl succinyl CoA dehydrogenase by homologous recombination in Rhodobacter sphaeroides (an example of a natural full EMC pathway harbouring organism) is described by Erb, T, J. et al. 2009. Mol Microbiol. 73, (6) 992. In butyrate producing organisms, loss of crotonyl CoA to butyryl CoA can be prevented by targeting butyryl CoA dehydrogenase (EC 1.3.8.1).

Other than for biomass production, loss of acetyl CoA, or where appropriate, its precursor/or derivative, pyruvate, to products other than acetoacetyl CoA for entry into the EMC pathways described in this invention (Group 1), or to products other than citramalate (Group 2 pathways), is also required to be prevented. In an acetogen loss of acetyl CoA to acetate may be prevented if necessary or reduced, by knockout or knowndown of one or more phosphotransacetylase (pta) or acetate kinase (ack) genes. Furthermore, acetate accumulation may be prevented by natural regulation, or by mutation which directs flux away from acetate synthesis while maintaining Wood Ljungdahl pathway activity. For example, growth of the acetogen Moorella thermoacetica (renamed from C. thermoaceticum) on CO and methanol in the presence of nitrate led to no acetate accumulation due to repression of key Wood Ljungdahl related gene expression (Seifritz, C. et al. J. Bacteriol. 1993, 175, 8008). In that example, sufficient ATP appeared to be provided from nitrate respiration.

In examples where pyruvate is the acetyl CoA precursor, undesired loss to lactate can be prevented by knockout of genes coding for enzymes capable of pyruvate reduction. For example, knockout of lactate and/or malate dehydrogenase (EC 1.1.1.27, EC 1.1.1.37). Pyruvate formate lyase (EC 2.3.1.54) may also be targeted as appropriate to ensure desired flux toward target pathway product synthesis without production of formate.

Other genes may be targeted for knockout to ensure efficient flux to Group 1 , EMC pathway products. For example, a pathway intermediate β-hydroxybutyryl CoA may be converted in some organisms such as Rhodobacter sp. to polyhydroxyalkanoates. Knockout of polyhydroxyalkanoate synthases (EC 2.3.1.-) for example, pha C, would be required to prevent this. Undesired loss of crotonyl CoA may also be prevented by knockout of crotonyl CoA reductase activity e.g EC 1.3.1.86 or EC 1.3.8.1.

When 2-methyl succinate is not the desired product from a Group 1 pathway of this invention, undesired carbon flux to 2-methyl succinate can be prevented by knockout or mutation of enzymes capable of cleavage of the CoA ester methyl succinyl CoA to methyl succinate, such as CoA transferase (e.g EC 2.8.3.8, EC 2.8.3.18); CoA synthetase (e.g EC 6.2.1.4, EC 6.2.1.5) or CoA hydrolase (e.g EC 1.3.1.86). Further, loss of the intermediate methyl succinate semialdehyde to 2- methyl succinate can be prevented by knockout of oxidative enzymes such as for example, EC 1.2.1.24.

Further, to maximise carbon flux to desired EMC pathway (Group 1 , Figure 2) products such as 2-methylsuccinic acid, methyl-4-hydroxybutyrate or 2-methyl-1 ,4- butanediol, it will be understood by those skilled in the art, that loss of CoA esters (such as acetoacetyl CoA, β-hydroxybutyryl CoA, crotonyl CoA, ethylmalonyl CoA or methylsuccinyl CoA, by CoA synthetase, CoA transferase or CoA hydrolase enzymes, other than to intermediates of the target EMC hybrid pathway, would be prevented by knockout or mutation of said undesired enzyme described above, or knockout or mutation of aldehyde dehydrogenase (acylating) enzymes capable of undesired CoA ester reduction to the corresponding aldehyde. .

Undesired oxidation of intermediates/products such as methy-4-hydroxybutyrate and/or methy-4-hydroxybutanal or the product 2-methyl-1 ,4-butanediol, can be prevented by knockout or mutation of appropriate enzymes such as those classified in EC 1.1.1.61 or EC 1.2.1.24. or EC 1.1.1.-, or EC 1.2.1.-. Undesired loss of accumulating mesaconate or citraconate from Group 2 pathways may occur via activation to the CoA ester, or more particularly via hydration by undesired hydratases such as mesaconase, fumarase or citraconases. Specific gene knockouts using techniques described in the art can be applied where necessary. In the limited examples where it has been tested, 2-methyl succinate has been described as non metabolisable. However, appropriate gene knockouts can be applied as appropriate if deemed necessary.

Genetic modification Based on the guidance provided herein, those skilled in the art will understand that the number of encoding nucleic acids to introduce in an expressible form will reflect any novel pathway deficiencies of the selected microbial host. Therefore, a non- naturally occurring microorganism of the invention can have one, two, three, or more, up to all nucleic acids encoding the enzymes or proteins constituting one of the unnatural novel pathways revealed herein. In some examples, the non-naturally occurring microorganisms also can include other genetic modifications that facilitate or optimise 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4- butanediol, mesaconate, citraconate or citramalate biosynthesis or that confer other useful functions onto the host microorganism.

Sources of encoding nucleic acids for use in the present invention can include any species where the encoded gene product is capable of catalysing the referenced reaction. Such species include both prokaryotic and eukaryotic organisms including, but not limited to, bacteria, including archaea and eubacteria, and eukaryotes, including yeast, plant, insect, animal and mammal, including human.

Exemplary sources of nucleic acids are described herein. However, with the large number of complete genome sequences available, the identification of genes encoding the requisite biosynthetic activity (e.g. the crotonyl CoA carboxylase/reductase and ethylmalonyl CoA mutase described herein) for one or more genes in related or distant species, including for example, homologs, orthologs, paralogs and non-orthologous gene displacements of known genes, and the interchange of genetic alterations between organisms is routine and well known to those skilled in the art, and can be carried out in the present context in the light of the teaching herein. Consequently, in the light of the present disclosure, the metabolic modifications enabling biosynthesis of, for example, 2-methylsuccinic acid, methyl-4- hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate described herein with reference to a particular organism such as Saccharomyces cerevisiae, E.coli, or Eubacterium limosum, or Acetobacterium woodii can be readily applied to other microorganisms. Those skilled in the art will know that a metabolic modification exemplified in one organism can be applied equally to other organisms.

Those skilled in the art will recognise that whenever a particular protein or nucleic acid is referred to herein e.g. with reference to an accession number or other deposit identification, that a functional variant of that sequence may also be used. Since the present invention is primarily concerned with enzyme activities, it will be appreciated that a functional variant will be one which catalyses the same substrate to product reaction as that catalysed by the enzyme referred to, but has a different sequence.

Non-limiting examples of variants include the following:

(i) Novel, naturally occurring, nucleic acids, isolatable using the recited or referred to sequence. These may include alleles (which will include polymorphisms or mutations at one or more bases), paralogues, isogenes, or other homologous genes belonging to the same families as the relevant enzymes. Also included are orthologues or homologues from different microbial or other species.

Thus, included within the scope of the present invention are uses of nucleic acid molecules which encode amino acid sequences which are homologues of the genes referred to herein. Homology may be at the nucleotide sequence and/or amino acid sequence level, as discussed below. A homologue from a different species or strain encodes a product which causes a phenotype similar to that caused by the recited sequence.

(ii) Artificial nucleic acids, which can be prepared by the skilled person in the light of the present disclosure. Such derivatives may be prepared, for instance, by site directed or random mutagenesis, or by direct synthesis. Preferably the variant nucleic acid is generated either directly or indirectly (e.g. via one or more amplification or replication steps) from an original nucleic acid having all or part of the sequence referred to herein.

Changes may be desirable for a number of reasons. For instance, they may introduce or remove restriction endonuclease sites or alter codon usage.

Alternatively changes to a sequence may produce a derivative by way of one or more (e.g. several) of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid, leading to the addition, insertion, deletion or substitution of one or more (e.g. several) amino acids in the encoded polypeptide. Other desirable mutations may be random or site directed mutagenesis in order to alter or evolve the activity (e.g. specificity) or stability of the encoded polypeptide. Changes may be by way of conservative variation, i.e. substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as arginine for lysine, glutamic for aspartic acid, or glutamine for asparagine. As is well known to those skilled in the art, altering the primary structure of a polypeptide by a conservative substitution may not significantly alter the activity of that peptide because the side-chain of the amino acid which is inserted into the sequence may be able to form similar bonds and contacts as the side chain of the amino acid which has been substituted out. This is so even when the substitution is in a region which is critical in determining the peptides conformation. Also included are variants having non-conservative substitutions. As is well known to those skilled in the art, substitutions to regions of a peptide which are not critical in determining its conformation may not greatly affect its activity because they do not greatly alter the peptide's three dimensional structure. In regions which are critical in determining the peptides conformation or activity such changes may confer advantageous properties on the polypeptide. Indeed, changes such as those described above may confer slightly advantageous properties on the peptide e.g. altered stability or specificity.

The term 'variant' nucleic acid as used herein encompasses all of these possibilities. When used in the context of polypeptides or proteins it indicates the encoded expression product of the variant nucleic acid. Some of the aspects of the present invention relating to variants will now be discussed in more detail.

Sequence identity may be assessed as using BLASTp (proteins) or Megablast (nucleic acids) from NCBI (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) using default settings, as used in the Examples.

Variants of the sequences disclosed herein preferably share at least 55%, 56%, 57%, 58%, 59%, 60%, 65%, or 70%, or 80% identity, most preferably at least about 90%, 95%, 96%, 97%, 98% or 99% identity. Such variants may be referred to herein as "substantially homologous".

Nucleic acid fragments may encode particular functional parts of the enzyme (i.e. encoding a biological activity of it). Thus, the present invention provides for the production and use of fragments of the full-length polypeptides disclosed herein, especially active portions thereof. An "active portion" of a polypeptide means a peptide which is less than said full length polypeptide, but which retains its essential biological activity.

Generally speaking, those skilled in the art are well able to construct vectors and design protocols for the recombinant genetic manipulations described herein. Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al, 1989, Cold Spring Harbor Laboratory Press or Current Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1992.

A "vector" as used herein need not include a promoter or other regulatory sequence, particularly if the vector is to be used to introduce nucleic acid into cells for recombination into the genome.

However, for expression purposes the nucleic acid in the vector will typically be under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a microbial host cell. It may include a native promoter. In the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.

By "promoter" is meant a sequence of nucleotides from which transcription may be initiated of DNA operably linked downstream (i.e. in the 3' direction on the sense strand of double-stranded DNA). "Operably linked" means joined as part of the same nucleic acid molecule, suitably positioned and oriented for transcription to be initiated from the promoter. DNA operably linked to a promoter is "under transcriptional initiation regulation" of the promoter. In one embodiment, the promoter is an inducible promoter. The term "inducible" as applied to a promoter is well understood by those skilled in the art. In essence, expression under the control of an inducible promoter is "switched on" or increased in response to an applied stimulus. The nature of the stimulus varies between promoters. Some inducible promoters cause little or undetectable levels of expression (or no expression) in the absence of the appropriate stimulus. Other inducible promoters cause detectable constitutive expression in the absence of the stimulus. Whatever the level of expression is in the absence of the stimulus, expression from any inducible promoter is increased in the presence of the correct stimulus.

The present disclosure teaches how pathways may be engineered into an organism by selection of the appropriate enzymes, cloning their corresponding genes into a production host, optimising the stability and expression of these genes, attenuation or functional deletion of the competitive pathways, optimising fermentation conditions for the genetically engineered strain to produce the desired product, and assaying for product formation following fermentation.

The term "heterologous" is used broadly herein to indicate that the gene/sequence of nucleotides in question (e.g. encoding crotonyl CoA carboxylase/reductase, ethylmalonyl CoA mutase or citramalate lyase, has been introduced into a host cell or an ancestor thereof, using genetic engineering, i.e. by human intervention. Nucleic acid heterologous to a host cell will be non-naturally occurring in cells of that type, variety or species. Thus, the heterologous nucleic acid may comprise a coding sequence of or derived from a microorganism, placed within a different microorganism. A further possibility is for a nucleic acid sequence to be placed within a cell in which it or a homologue is found naturally, but wherein the nucleic acid sequence is linked and/or adjacent to nucleic acid which does not occur naturally within the cell, such as operably linked to one or more regulatory sequences, such as a promoter sequence, for control of expression.

"Transformed" in this context means that the nucleotide sequences of the heterologous nucleic acid alter one or more of the cell's characteristics and hence phenotype e.g. with respect to, for example, 2-methylsuccinic acid, methyl-4- hydroxybutyrate or 2-methyl-1 ,4-butanediol.

"Nucleic acid" when used in the present invention may include cDNA, RNA, genomic DNA and modified nucleic acids or nucleic acid analogs (e.g. peptide nucleic acid). Where a DNA sequence is specified, e.g. with reference to a figure, unless context requires otherwise the RNA equivalent, with U substituted for T where it occurs, is encompassed. Nucleic acid molecules according to the present invention may be provided isolated and/or purified from their natural environment, in substantially pure or homogeneous form, or free or substantially free of other nucleic acids of the species of origin, and double or single stranded. Where used herein, the term "isolated" encompasses all of these possibilities. The nucleic acid molecules may be wholly or partially synthetic. In particular, they may be recombinant in that nucleic acid sequences which are not found together in nature (do not run contiguously) have been ligated or otherwise combined artificially. Nucleic acids may comprise, consist, or consist essentially of, any of the sequences discussed hereinafter.

In the methods herein any shuttle vectors available for Gram-positive bacteria that carry at least one nucleotide sequence homologous to one gene encoding the desired enzyme can be employed for transformation of M. thermoacetica or other microorganism of interest.

An expression plasmid is obtained by inserting at least a gene responsible for replication of the plasmid in Gram-positive and more specifically in Clostridia species or acetogens. The plasmid capable of introducing the desired gene into an acetogen is not particularly limited as long as it contains at least a gene responsible for replication and amplification in acetogenic bacteria. Specific examples thereof include pAK201 (Kim, A. and Blashek, H. P., Appl. Environ. Microbiol. 55 (2):360- 365 (1988), pHB101 (Blaschek H. P. et al, J. Bacterial. 147(1):262-266 (1981)), any of the series modular plasmids pMTL8000 (Heap, J.T. ef al., J. Microbiol. Methods 78:79-85 (2009), pMS1 , pMS2, pMS3, pMS4, pKV12 (Staetz, M. ef al, Appl. Environ. Microbiol. 1033-1037 (1994), pUB110 (McKenzie ef al., 1984), plMP1 (Mermelstein, L et al. 1992), pITF (Dong, H. et al. 2010).

Novel shuttle vectors, which are chimeras of pUB110 or any of the above-mentioned plasmids and a general E. coll cloning vectors such as pUC19 (Yanisch-Perron, C. ef al, Gene 33:103-119 (1985)) or pBluescript II SK (+/-) can be easily generated and tested. These chimera plasmids are propagated in E. coli for plasmid isolation and employed for the genetic engineering work of M. thermoacetica or another acetogen or Gram-positive bacterium which is naturally sensitive towards the antibiotic gene expressed by the plasmid. If needed, sub-cloning can be employed to replace the antibiotic resistance cassettes on the existing plasmids with suitable ones based on the antibiotic sensitivity of the target organism. Standard techniques for DNA amplification using a high-fidelity DNA polymerase and molecular sub- cloning, including restriction enzyme digestion, ligation and E. coli transformation can be used for engineering of the plasmids (Sambrook, 1989).

The operon or one gene of the operon encoding the required activity can be ligated into the multiple cloning site between two convenient restriction sites.

In order to achieve optimum gene(s) expression for the heterologous genes introduce, the heterologous genes can be codon optimised for the target organism with techniques well known to those skilled in the art.

To ease the detection and quantification of the gene product(s) expression, an N-or C-terminus tag sequence can be added to the gene sequences cloned as understood by those skilled in the art.

Many Clostridia species have been successfully transformed with prior methylated DNA vectors. The methylation of the transformable DNA protects it from being degraded by the host. In vivo methylation of the transformable DNA is achieved by its propagation in methylation E. coli strains such as Top10 (pAN2) (Kuit et al., Appl. Microbiol. Biotechnol. 94:729-741 (2012)).

Heterologous (or exogenous, the terms are used interchangeably) gene(s) can be introduced into the chosen host cellusing techniques well known in the art including, but not limited to, conjugation, electroporation, chemical transformation, transduction, transfection and electrofusion. For electroporation and conjugation, published protocols of Clostridium perfringens, Clostridium acetobutylicum, Clostridium ljungdahli, Eubacterium limosum, Clostridium cellulolyticum and Acetobacterium woodii may be used. Protocols for organisms such as yeast and E. coli are well reported in the art.

In some embodiments it may be desired to target or inactivate genes in the host microbial cell, for example to increase flux of target metabolic intermediates and\or 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate, or divert metabolic pathways away from biomass generation. An example is to minimise loss of pyruvate away from one of the novel pathways if pyruvate is a precursor to acetyl CoA, or to prevent acetyl CoA loss to acetate. To permanently inactivate genes in host organisms a plasmid can be constructed for gene deletion by integrational mutagenesis or gene replacement techniques well known in the art. Integrational mutagenesis and gene replacement can selectively inactivate undesired genes from host genomes. Such methods have been developed and successfully used to create metabolically engineered mutants of Clostridial strains (Green et a/., 1996). In this technique, a fragment of the target gene is cloned into a non-replicative vector with a selection marker, resulting in the non-replicative integrational plasmid. The partial gene in the non-replicative plasmid can recombine with the internal homologous region of the original target gene in the parental chromosome (double crossover), which results in the insertional inactivation of the target gene, Idh locus in this particular example. The use of gene replacement (by double recombination) is preferred to insertional inactivation (single recombination) since it permits the generation of more stable engineered strains, without the need to maintain selection of vectors.

Using this technique, in the same manner non-natural microorganisms can be generated having complete or partial deletion of one, two, three, four, five, or more genes in order to remove competitive pathways.

Reduction of expression of the target genes can also be used as an alternative to gene disruption. This may be achieved using expression of antisense RNA for the target gene, which will inhibit but not completely abolish gene expression. The antisense RNA system serves as a convenient approach of gene knock-down of a desired gene with the advantage that it can reduce expression of genes for which complete inactivation could be damaging or lethal to the organism. In using anti-sense genes or partial gene sequences to down-regulate gene expression, a nucleotide sequence is placed under the control of a promoter in a "reverse orientation" such that transcription yields RNA which is complementary to normal mRNA transcribed from the "sense" strand of the target gene. See, for example, Rothstein et al, 1987; Smith et al, (1988) Nature 334, 724-726.

The complete sequence corresponding to the coding sequence (in reverse orientation for anti-sense) need not be used. For example, fragments of sufficient length may be used. It is a routine matter for the person skilled in the art to screen fragments of various sizes and from various parts of the coding sequence to optimise the level of anti-sense inhibition. It may be advantageous to include the initiating ATG codon, and perhaps one or more nucleotides upstream of the initiating codon. A further possibility is to target a conserved sequence of a gene, e.g. a sequence that is characteristic of one or more genes, such as a regulatory sequence.

The sequence employed may be about 500 nucleotides or less, possibly about 400 nucleotides, about 300 nucleotides, about 200 nucleotides, or about 100 nucleotides. It may be possible to use oligonucleotides of much shorter lengths, 14- 23 nucleotides, although longer fragments, and generally even longer than about 500 nucleotides are preferable where possible, such as longer than about 600 nucleotides, than about 700 nucleotides, than about 800 nucleotides, than about 1000 nucleotides or more.

It may be preferable that there is complete sequence identity in the sequence used for down-regulation of expression of a target sequence, and the target sequence, although total complementarity or similarity of sequence is not essential. One or more nucleotides may differ in the sequence used from the target gene. Thus, a sequence employed in a down-regulation of gene expression in accordance with the present invention may be a wild-type sequence (e.g. gene) selected from those available, or a variant of such a sequence in the terms described above. The sequence need not include an open reading frame or specify an RNA that would be translatable.

The transformation, expression and application of antisense RNA inhibition tools have been demonstrated for mesophilic Clostridia such as: Clostridium acetobutylicim (Desai R. ef al. Appl. Environ & Eviron Microbiol. 65(3):936-945 (1999)) Fierro-Monti IP ef al., J Bacteriol. 174(23): 7642-7647 (1992)) and Clostridium cellulolyticum (Perret S. ef al., Mol. Microbiol. 51 (2): 599-607 (2004)) as well as for termophiles such as Thermus thermophilus (Moreno, R. ef al., J. Bacteriol., 7804 (2004) and may be applied herein.

An attractive approach for down-regulation expression of a target gene is to replace the native promoter with a less active promoter for example one from another gene. This can be achieved by double-recombination/gene replacement techniques well known in the art. Alternatively, expression can be reduced by altering the ribosome binding site or the spacing between the RBS and the translation initiation start codon, or using a less efficient start codon.

The results of these studies permit for phenotypic characterisation of the mutants generated as well as allowing genetic engineering of any host microorganism. Further optimisation can be performed to develop genetic systems by varying methods, plasmids and conditions to achieve optimum results. Specifically, the metabolic modifications enabling biosynthesis of, for example, 2-methylsuccinic acid, methyl-4-hydroxybutyrate, 2-methyl-1 ,4-butanediol, mesaconate, citraconate or citramalate, described herein with reference to a particular organism such as Saccharomyces cerevisiae can be readily applied to other microorganisms, including prokaryotic and eukaryotic organisms alike.

Any subtitles herein are included for convenience only and are not to be construed as limiting the disclosure in any way.

The invention will now be further described with reference to the following non- limiting Figures and Examples. Other embodiments of the invention will occur to those skilled in the art in the light of these. The disclosure of all references cited herein, inasmuch as it may be used by those skilled in the art to carry out the invention, is hereby specifically incorporated herein by cross-reference. Methods and materials - cloning, expression and activity assay for gene(s) for engineering into host organisms to produce 2-methylsuccinic acid, methyl-4- hydroxybutyrate, 2-methyl-1,4-butanediol or intermediates within the pathways. Metabolic engineering of microorganisms for synthesis of higher value chemicals from a diverse range of feedstocks is, depending on the host organism, either a well established, or rapidly developing field. For example, considerable information is available in the literature for engineering organisms such as E. coli and yeast. Those skilled in the art will be aware of how to engineer these organisms for application to the efficient synthesis of the target chemicals of this invention. However, to assist in that regard, several references and examples are provided below of direct relevance to the required pathway engineering.

For example, with respect to the Group 2 pathways of this invention, the efficient production of the first intermediate citramalate (115g/l) from glucose via acetyl CoA and pyruvate in E. coli, using enzymes described in this invention, is described in detail in WO 2015022496 A2. WO 2015022496 A2 is included as an example herein. Further, Wu, X. and Eiteman, M.A. 2016. Biotechnol. Bioeng.113: 2670-2675, also give considerable detail regarding engineering E. coli for efficient production of citramalate, including prevention of metabolism of the key substrates acetyl CoA and pyruvate. Knockout of the genes gltA and ackA are described as crucial for efficient citramalate production in this system. In a continuous fermentation process the yield of citramalate on glucose was excellent at 0.77g/g which is 94% of theoretical. In batch fed systems the final concentration of citramalate was 46.5g/l with a theoretical yield of 77%. One of the major challenges with respect to channeling carbon flux through a desired non-natural metabolic pathway, is ensuring efficient availability of the substrates required. The study by Wu, X and Eiteman, M. A. in particular, clearly demonstrates how acetyl CoA and pyruvate can be made available for synthesis of citramalate, which is step 1 of the Group 2 pathways. Following the instruction given within this invention with respect to the addition of genes coding for citramalate dehydration and subsequent double bond reduction, will generate strains capable of efficient synthesis of 2-methyl succinate or further downstream products.

Teaching with respect to citraconate synthesis using a mutant of CimA (citramalate synthase) from Methanococcus jannaschii for improved performance in E. coli is provided by Atsumi, S. and Liao, J.S. 2008. Appl. Environ. Microbiol. 74 (24), 7802- 7808. The work described by Atsumi and Liao could be further applied to this invention. For example, cloning of only CimA and LeuCD without the rest of the pathways described to synthesis propanol and butanol via LeuB, would generate citraconate in equilibrium with citramalate and β-methyl-D-malate. Reduction of citraconate using approaches described herein would drive the equilibrium towards 2-methyl succinate production. Perturbation of an equilibrium generated by application of LeuCD or other dehydratases, can be achieved in this way in any organism.

Full exemplification of the ability to produce 2-methylsuccinate (titre 3.61 g/L with a molar yield of 0.36) using metabolic pathways of this invention, via the use of for example CimA, is provided by Wang, J. et al. 2018. Metabolic Engineering, 45,1. https://doi.org/10.1016/i.vmben.2017.11.007. This reference is included in its entirety as an example, including supplementary material and references within.

Overexpression of a citramalate synthase (cim A) for coupling of acetyl CoA and pyruvate in Saccharomyces is also described in detail as part of a novel butanol production pathway (Shuobo, S. et al. 2016. Scientific Reports, 6, Article number: 25675, | 6:25675 | DOI: 10.1038/srep25675, including supplementary information and refences within). The same principle applies, flux through citramalate into another unnatural metabolic pathway indicates the essential availability of the substrates pyruvate and acetyl CoA. This indicates that citramalate can also be directed into the pathways of this invention using the appropriate required genes as listed below. Further, in organisms such as yeast where pyruvate is normally efficiently produced and in the wild type may be primarily reduced to ethanol, a suitable yeast engineered for 2-methyl succinate production (e.g involving deletion of one of more of PDC1 , PDC5, and PDC6) may additionally include provision of exogenous acetate as a precursor to acetyl CoA. Yeast are typically able to convert acetate to acetyl CoA (as is the case for other organisms) via acetyl CoA synthetase (e.g ACS2), but may also be engineered for greater efficiency. Additionally, acetaldehyde generated from pyruvate may be oxidised to acetate and again converted to acetyl CoA via an enzyme such as acetyl CoA synthetase. Acetaldehyde may also be efficiently converted to acetyl CoA via introduction of a heterologous acylating acetaldehyde dehydrogenase (EC 1.2.1.10), or pyruvate may also be converted to acetyl CoA via heterologous pyruvate formate lyase (EC 2.3.1.54). Options for provision of the required cytosolic acetyl CoA in yeast are described by Kozak, B. et al. Metabolic Engineering 2014. 21 , 46-59; Harmen, M. van H. ef al. Metabolic Engineering 2016, 36,99. However, yeast may also be engineered for efficient acetyl CoA production by introduction of a cytosolic pyruvate dehydrogenase complex. Hence converting pyruvate to acetyl CoA with the electrons transferred to NAD. This latter engineering success was reviewed by Jens Nielsen. Mbio 2014 Volume 5 Issue 6 e02153-14 and described as a major scientific and technological breakthrough for metabolic engineering of yeast for acetyl CoA requiring pathways.

Overall, many options exist for efficient provision of acetyl CoA in a yeast which naturally efficiently produces pyruvate for production of 2-methyl succinate and other products of this invention. However, a preferred option would be the use of cytosolically expressed (S)-Citramalate (pyruvate) lyase enzyme complex. (EC 4.1.3.22) or components thereof (e.g lyase, β-subunit and CoA transferase, a- subunit) because this enzyme complex is able to utilise acetate directly (or acetyl CoA) for coupling with pyruvate to form citramalate. Typically, this approach avoids the energy efficiency limitations associated with the production of pyrophosphate when converting acetate to acetyl CoA using acetyl CoA synthetase. Cloning and cellular performance of the heterologous citramalyl CoA lyase and citramalyl CoA transferase components of citramalate pyruvate lyase enzyme complex, may benefit from operation as a fusion protein. An example fusion protein sequence optimised for yeast is shown in Figure 7.

Further informative references relating to Group 2 pathways include, Astumi, S. and Liao, J.C. 2008. Appl. Environ. Microbiol. 74 (24), 7802-7808, who describe engineering of citramalate synthase (cimA) for improved in vivo production of citramalate.

With respect to Group 1 pathways, detail is provided for cloning and channeling carbon flux through a butyrate pathway in E. coli. Saini, M. et al. 2014. Agric. Food. Chem. 62 (19), 4342-4348). The butyrate pathway shares the first three genes of the Group 1 pathways of this invention (Activity A, B, and C, Figure 2) generating crotonyl CoA. The further genes required to complete the Group 1 pathways up to methyl succinyl CoA, have also all been individually cloned and expressed in E. coli and the methodology described in detail, (Erb, T.J. 2007. PNAS, 104 (25), 10631- 10636; Good, N. M. et al. 2015. J. Bacteriol. 197 (4), 727). Hence, with the appropriate gene selection, the novel, unnatural Group 1 pathways of this invention can be constructed in E. coli. E. coli is also a producer of the by product acetate. Hence, if appropriate and required, acetate can be available for release of 2-methyl succinate via the CoA transferase approach described below. Hence, full information has been provided which allows those skilled in the art to construct pathways of this invention within E. coli and yeast by addition of the appropriate genes described in the tables below or references herein as appropriate for each target product. Those skilled in the art will also understand how to apply the teaching to other organisms.

The ability to engineer organisms such as the acetogens is gaining pace and a number of publications now exist revealing techniques and tools for the introduction of heterologous DNA (including integration into the genome), knockouts and more recently more sophisticated genome editing using CRISPR.

With respect to genetic tools improvement in Clostridium ljungdahlii an effective lactose inducible system has been developed. Successful induction of AdhE1 was achieved (30 fold over the WT level) leading to an increase in ethanol production and a decrease in acetate. Further lactose inducible expression of four heterologous genes necessary for acetone production from acetyl CoA diverted up to 60% of carbon flux to acetone (Banerjee, A. et al. 2014. Appl. Environ. Microbial. 80 (8) 2410-2416).

Clostridium ljungdahlii has been engineered to produce butyrate which is not a natural product of the organism Toshiyuki, U. 2014. MBio. September/October 5 (5). This work describes introduction of the first 3 genes of the Group 1 pathways (Figure 2, Activity A, B and C) up to the intermediate crotonyl CoA into an acetogen which does not naturally harbour these genes. Substitution of the butyrate genes (bed, ptb, buk) with examples specifically given below for each of the Group 1 pathways would convert the organism into one capable of 2-methyl succinate, methyl-4-hydroxybutyrate or 2-methyl-1 ,4-butanediol production. Heterologous genes required for butyrate production from acetyl-coenzyme A (CoA) were identified and introduced initially on plasmids and in subsequent strain designs integrated into the C. ljungdahlii chromosome. Iterative strain designs involved increasing translation of a key enzyme by modifying a ribosome binding site, inactivating the gene encoding the first step in the conversion of acetyl-CoA to acetate, disrupting the gene which encodes the primary bifunctional aldehyde/alcohol dehydrogenase for ethanol production, and interrupting the gene for a CoA transferase that potentially represented an alternative route for the production of acetate. These modifications yielded a strain in which up to 70% of the carbon and electron flow was diverted to the production of butyrate strongly indicating potential for direction into the pathways af this invention using the provided approach. A clostridial acetone pathway was used for the formation of acetone in Acetobacterium woodii. The acetone production operon (APO) containing the genes thIA (encoding thiolase A), ctfAlctfB (encoding CoA transferase), and adc (encoding acetoacetate decarboxylase) from Clostridium acetobutylicum were cloned under the control of the thIA promoter into four vectors having different replicons for Gram-positives (plP404, pBP1 , pCB102, and pCD6). Stable replication was observed for all constructs. A. wood// [pJ I R_act_thiA] achieved the maximal acetone concentration under autotrophic conditions (15.2±3.4 mM). Promoter sequences of the genes ackA from A. woodii and pta-ack from C. ljungdahlii were determined by primer extension (PEX) and cloned upstream of the APO (Hoffmeister, S. et al. 2016. Metabolic Eng. 36, 37-47).

Further considerable detail regarding engineering of acetogen microorganisms for production of acetone and propanol which can be directly applied to the pathways of this invention, including knockout of adhE1 by the ClosTron system is provide by Bengelsdorf, F. ef al. 2016. Front, in Microbiol. Volume 7, Article 1036, doi: 0.3389/fmicb.2016.01036. Those skilled in the art will understand how to apply these further examples to the engineering of acetogen microrganisms and non acetogen organisms, for example, Clostridial organisms for the Group 1 and Group 2 pathways of this invention. The optimised detail with respect to ClosTron technology for Clostridia is described by Heap, J. et.al. 2010. J. Microbiol. Methods. 80, 49-55. Scarless genome editing of Clostridium autoethanogenum has been demonstrated using a reliable CRISPR cas9 leading to Δ 2,3-bdh mutant (Nagaraju, S. et al. 2016. Biotechnol. Biofuels. 9, 21) adding further elegant methodology.

Further examples of the application of genetic systems to the engineering of acetogens for application to industrial biotechnology are described by Leang, C. et al. 2013. Appl. Environ. Microbiol. 79 (4), 1102.; Liew, F. et al. 2017. Metabolic Eng. http://dx.doi.Org/10.1016/i.vmben.2017.01.007: Iwasaki, Y. et al. 2013. FEMS Microbiol. Letts. 343 (1), 8-12; Akihisa, K. et al. 2013. J. Biosc. Bioeng. 115 (4), 347- 352; Molitor, B. et.al. 2016. Scientific Reports. 6:31518 | DOI: 10.1038/srep31518.

An example where carbon flux can be directed from the Wood ljungdahl pathway to products derived both from pyruvate and from acetyl CoA in acetogens, is the well reported co-production of acetate, ethanol and 2,3-butanediol in Clostridial acetogens (e.g. C. Ijungdahlii and C. autoethanogenum) (Liew, F. et al. 2016. Front. Microbiol. 7, 64, doi: 10.3389/fmicb.2016.00694). The production of ethanol (derived from acetyl CoA or acetate) and 2,3-butanediol (derived from pyruvate) at similar concentration is in the progress of being commercialised. Synthesis of the Group 2 pathway products of this invention require approximately the same distribution of carbon directed from pyruvate.

All tools, techniques and approaches described in the above references for engineering of bacteria and yeast for application to industrial biotechnology, can be applied to engineering microorganisms or acetogen microorganisms as appropriate, for the pathways described in this invention and for application in other organisms as appropriate e.g non-acetogenic Clostridia.

The approach to construction of an unnatural, novel pathway to any of the desired products in a chosen host, maybe influenced by which pathway genes are already present in the host organism. Those endogenous genes considered suitable for pathway construction may be overexpressed to ensure adequate flux through the pathway along with any heterologous genes, for pathway product synthesis.

With respect to Group 1 pathway variants (Figure 2) requiring the enzymes crotonyl CoA carboxylase/reductase and ethylmalonyl CoA mutase, the metabolic engineering requirements up to the intermediate methylsuccinyl CoA will be common to each pathway (Figure 2). Group 1 pathways to products other than 2- methylsuccinate described in this invention also share some common steps and these will be discussed in further detail as appropriate.

Group 1 pathways involving the key enzymes crotonyl CoA carboxylase/reductase and ethylmalonyl CoA mutase - Synthesis of the common pathway intermediate methyl succinvl CoA (Figure 2) Synthesis of the common pathway intermediate methyl succinyl CoA, uses enzymes which can be found in the natural ethylmalonyl CoA pathway (EMC). As described, many of these enzymes are also present in other non-EMC pathway organisms. With respect to these organisms, introduction of genes coding for crotonyl CoA synthesis from acetyl CoA may not be required, although they may still need to be up regulated. The C5 compound methylsuccinyl CoA requires synthesis of crotonyl CoA which is the substrate for a key ethylmalonyl CoA pathway enzyme crotonyl CoA carboxylase/reductase (EC 1.3.1.85, Activity D). Crotonyl CoA can be preferably synthesised from acetyl CoA using Activity A (for example, EC 2.3.1.9); Activity B (for example, EC1.1.1.35) and Activity C (for example, EC 4.2.1.55). Crotonyl CoA is also an intermediate in many metabolic pathways. For example, from succinic semialdehyde in 3 steps through dehydration of 4-hydroxybutyryl CoA (EC 1.1.1.61 , EC 2.8.3.-, EC 4.2.1.120) when organisms grow on succinate or when degrading glutamate to butyrate.

Following synthesis of ethylmalonyl CoA, the pathways of this invention follow the natural epimerisation of crotonyl CoA carboxylase/reductase-produced S- ethylmalonyl CoA into R-ethylmalonyl CoA using a promiscuous epimerase EC 5.1.99.1 , Activity E, followed by rearrangement into the common intermediate of this invention methyl succinyl CoA using the second key ethylmalonyl CoA pathway enzyme, ethylmalonyl CoA mutase EC 5.4.99.63, Activity F, (first key enzyme being crotonyl CoA carboxylase/reductase). If a crotonyl CoA carboxylase/reductase is used which produces R-ethylmalonyl CoA the epimerisation step is not required. Although specific stereochemistries are given, the opposite stereochemistry is also implied where appropriate. This is also the case in Figure 2 where the 3-methyl isomers of intermediate compounds and products are drawn e.g methyl-4- hydroxybutyrate. The 2-methyl isomers are implied as appropriate.

Activity A, for example thiolase (EC 2.3.1.9) is a common, widespread enzyme involved in well-studied pathways such as mevalonate synthesis, polyhydroxyalkanoate synthesis, butyrate and butanol synthesis and more recently the ethylmalonyl CoA pathway. Example gene sequences expressing enzymes for Activity A, are shown in Table 1.

Activity B, for example, acetoacetyl CoA reductase (EC 1.1.1.36, EC 1.1.1.35, 1.1.1.157) is also a common widespread metabolic enzyme involved in pathways such as polyhydroxyalkanoate synthesis, butyrate and butanol synthesis and the ethylmalonyl CoA pathway. Example sequences expressing enzymes for Activity B, are shown in Table 2. Enzymes generating both the S and R enantiomers of 3- hydroxybutyryl CoA are provided. Activity C, for example, 3-hydroxybutyryl CoA dehydratase, EC 4.2.1.55, 4.2.1.17 EC 4.2.1.150, is commonly found in association with Activity A and B in central metabolism. Example sequences expressing enzymes for Activity C, are shown in Table 3. Activity D, crotonyl CoA carboxylase/reductase (EC 1.3.1.85) is a key enzyme in the full ethymalonyl CoA pathway. The enzyme has been cloned into E. coli and ethylmalonyl CoA pathway involvement was reported in 2007 by Erb, T. J ef al. PNAS, 104, (25), 10631. However, it is also a key enzyme involved with polyketide biosynthesis particularly in Streptomyces as reviewed by Wilson, M. C. and Bradley, S.M. Nat. Prod. Rep., 2012, 29,72. Example sequences expressing enzymes for Activity D, are shown in Table 4. Note EC: 1.3.1.86 crotonyl CoA reductase is also capable of reductive carboxylation of crotonyl CoA to ethyl malonyl CoA, (Liu, Y. ef al. J. Am Chem Soc. 2009, 131 , (30) 10376).

Activity E, e.g. epimerase EC 5.1.99.1. Ethyl malonyl CoA epimerase also known as ethylmalonyl CoA/methylmalonyl CoA epimerase. It is considered to be a promiscuous enzyme capable of the epimerisation of both ethyl and methylmalonyl CoA. In the natural EMC pathway this enzyme is required for the conversion of 2- (S)-ethylmalonyl CoA ultimately into 2-(S)-methylsuccinyl CoA by catalysing the essential epimerisation of 2-(S)-ethylmalonyl CoA into 2-(R)-ethymalonyl CoA which is the required stereochemistry for ethylmalonyl CoA mutase (Activity F). Although this described activity is associated with the natural ethylmalonyl CoA pathway, enzymes described in the literature as methylmalonyl CoA epimerase, which are wide spread in nature, may also be expected to catalyse epimerisation of ethylmalonyl CoA. Example sequences expressing enzymes for Activity E, are shown in Table 5.

Activity F, ethylmalonyl CoA mutase EC 5.4.99.63 is the final enzyme required for synthesis of the common intermediate methylsuccinyl CoA. Ethylmalonyl CoA mutase along with ethylmalonyl CoA epimerase from Rhodobacter sphaeroides, have been heterologously expressed in E. coli. Ethylmalonyl CoA mutase is specific for ethylmalonyl CoA and accepts methylmalonyl CoA at only 0.2% relative activity, Erb, T.J. ef al. J. Biol. Chem. 2008, 283, (47), 32283. Example sequences expressing enzymes for Activity F, are shown in Table 6. In addition, some methyl malonyl CoA mutases (EC 5.4.99.2) are known to be active on ethyl malonyl CoA producing predominantly the opposite enantiomer, R-2-methyl succinyl CoA. e.g Retey, J. et al. Eur. J. Biochem. 1978, 83,437.

Table 1. Example gene sequences expressing enzymes for conversion of acetyl CoA to acetoacetyl CoA (Activity A). EC 2.3.1.9.

Additional genes cod ing for ace tyl-CoA transferase and other genes coding for enzymes capable of (or involved with) acetyl CoA transferase activity (Activity A) can be identified based on sequence homology to those examples in Table 1. Table 2. Example gene sequences expressing enzymes for conversion of acetoacetyl CoA to 3-hydroxybutyryl CoA (Activity B). EC 1.1.1.35, EC1.1.1.36, 1.1.1.157

Additiona genes cod ing for hydroxybutyryl CoA dehydrogenase and other genes coding for enzymes capable of (or involved with) hydroxybutyryl CoA dehydrogenase (Activity B) can be identified based on sequence homology to those examples in Table 2. Table 3. Example gene sequences expressing enzymes for conversion of hydroxybutyryl CoA to crotonyl CoA (Activity C). EC 4.2.1.17, EC 4.2.1.55, 4.2.1.150

Additional genes coding for 'crotonase' activity and other genes coding for enzymes capable of (or involved with) hydroxybutyryl CoA dehydration (Activity C) can be identified based on sequence homology to those examples in Table 3.

Table 4. Example gene sequences expressing enzymes for conversion of crotonyl CoA to ethylmalonyl CoA (Activity D). EC 1.3.1.85

Additional genes coding for ethyl malonyl CoA synthesis and other genes coding for enzymes capable of (or involved with) ethyl malonyl CoA synthesis (Activity D) can be identified based on sequence homology to those examples in Table 4. Table 5. Example gene sequences expressing enzymes for epimerisation of ethylmalonyl CoA (Activity E). EC 5.1.99.1

Additional genes coding for ethyl malonyl CoA epimerase activity and other genes coding for enzymes capable of (or involved with) epimerisation of ethyl malonyl CoA (Activity E) can be identified based on sequence homology to those examples in Table 5.

Table 6. Example gene sequences expressing enzymes for conversion of ethylmalonyl CoA to 2-methyl succinyl CoA (Activity F), EC 5.4.99.63, EC 5.4.99.2

Additional genes coding for ethyl malonyl CoA mutase activity and other genes coding for enzymes capable of synthesis of 2-methyl succinyl CoA from ethyl malonyl CoA (Activity F) can be identified based on sequence homology to those examples in Table 6.

Synthesis of the product 2-methvl succinate

2-Methyl succinate can either be produced from methyl succinyl CoA via crotonyl CoA carboxylase/reductase (Group 1 pathways, Figure 2) or via citramalate (Group 2 pathways, Figure 6).

a) Synthesis of 2-methvl succinate from methyl succinyl CoA (Group 1 pathways, Figure 2).

Synthesis of 2-methyl succinate directly from the common intermediate methylsuccinyl CoA requires release of the free dicarboxylic acid from the CoA ester. This can be achieved by using either of three different approaches: Via a CoA ligase (also known as a CoA synthetase), via a CoA hydrolase, or via a CoA transferase enzyme. 2-Methylsuccinate can also be synthesised indirectly from methylsuccinyl CoA via methylsuccinate semialdehyde, which is discussed separately herein.

CoA ligase and CoA transferases are energy conserving enzymes and are the preferred options. In the case of the ligase, the energy in the CoA moiety may be used to synthesise a molecule of ATP. In the case of the transferase, the CoA moiety energy is simply moved to another molecule (e.g acetate). In the case of the CoA hydrolase, the energy in the CoA ester is lost by hydrolysis. Acetate is an ideal co-substrate for a CoA transferase, and may be supplied endogenously (e.g acetogens) or exogenously (any organism). It is important to also note that reversible enzymes described below, such as

Succinyl-CoA: acetate CoA-transferase from for example, A. aceti coded for by aarC, which are confirmed to be able to synthesise methyl succinyl CoA from 2-methyl succinate and enzymes such as the sucCD gene coding for succinyl CoA

synthetase of Advenella mimigardefordensis strain DPN7T are one optional link between the Group 1 and Group 2 pathways with respect to synthesis of the more reduced pathway products methy-4-hydroxybutyrate and 2-methyl-1 ,4-butanediol. For example, synthesis of methyl succinyl CoA via citramalate may be converted to the more reduced products using the relevant Group 1 pathway genes instead of production of methyl succinyl CoA via ethyl malonyl CoA i) Use of succinate-CoA ligase (EC 6.2.1.5, EC 6.2.1.4) also typically called succinyl CoA synthetase. Figure 2, Activity M.

Succinate-CoA ligase is commonly an enzyme of the citric acid cycle, where it catalyses the only step that involves substrate-level phosphorylation (ATP synthesis). In the citric acid cycle, the enzyme acts not as a ligase, but as a thiolase. It uses the energy of the succinyl CoA thioester to phosphorylate itself on an active site histidine residue and then transfers the phosphoryl group to (in the case of EC 6.2.1.5) ADP to form ATP and the free carboxylic acid. EC 6.2.1.5, EC 6.2.1.4 are also known to be fully reversible enzymes.

With relevance to this invention, the sucCD gene coding for reversible succinyl CoA synthetase of Advenella mimigardefordensis strain DPN7T has been shown to also accept other substrates including itaconic acid and malic acid which are very closely related to 2-methyl succinic acid, Schurmann, M. et al. J. Bacteriol. 2011 , 193 (12) 3078; Johannes, C. N. et al. Appl. Environ. Microbiol. 2014. 80, (1) 166. Further, the enzyme does not accept malonyl CoA or mono carboxylic acids making it or a mutant if such, highly suited to the desired application in this invention. Other excellent candidate succinyl CoA synthetase enzymes are found in E. coli and Alcanivorax borkumensis (ibid). Further succinyl CoA synthetases, for example from Pseudomonas sp. are also known to accept itaconic acid (Schurmann, M. et al. J. Bacteriol. 2011 , 193 (12) 3078). It is predicted that acceptance of substrates such as 2-methyl succinate/methyl succinyl CoA in addition to succinate/succinyl CoA, is common for succinyl CoA synthetase enzymes.

Shikata, K. et al. J. Biol. Chem. 2007, 282 (37) 26963 described the role of a structurally novel succinyl CoA synthetase (SCS, succinate CoA ligase) in the obligate anaerobe Thermococcus kodakaraensis (SCSTk). The enzyme was characterised after expression in E. coli. The enzyme is involved in energy conservation converting CoA esters particularly succinyl CoA to acids, for example succinic acid. Thermococcus kodakaraensis accumulates succinic acid from succinyl CoA when growing on amino acids.

SCSTk showed high activity for succinate (16.2 units/mg), but malonate was not recognized as a substrate. Isovalerate and 3-methyl thiopropionate were converted by SCSTk with activity levels of approximately two-thirds compared with succinate converting activity. Glutarate (121 %), adipate (59%), and butyrate (48%) also served as good substrates for SCSTk whereas propionate (10%) and oxalate (9%) did not. Considering the structures of these compounds, SCSTk prefers mono- or dicarboxylates with a backbone of four or more carbons. Methyl groups are also accepted. As described previously acceptance can be further improved through the use of standard mutagenesis techniques. Although reversible, the enzyme is cited to work best in the ATP forming desired direction for this invention, i.e. release of the CoA from the ester so forming the free carboxylic acid. Hence, 2-methyl succinate or more relevantly, methyl succinyl CoA would be expected to be a substrate for this class of SCS.

Table 7. Example gene sequences expressing ligase enzymes for conversion of methylsuccinyl CoA to methylsuccinate (or reverse) (Activity M). EC 6.2.1.4, EC 6.2.1.5.

Additional genes coding for succinate CoA ligase activity and other genes coding for enzymes capable of (or involved with) conversion of methyl succinyl CoA to 2- methyl succinate (Activity M) can be identified based on sequence homology to those examples in Table 7. ii) 2-Methylsuccinate production using CoA hydrolase (thioesterase) activity. Figure 2, Activity N.

Thioesterases are diverse and widespread enzymes classified into EC 3.1.2.1 through to EC 3.1.2.27 based on their activities on different substrates, with many remaining unclassified (EC 3.1.2.-) They have been reviewed by Cantu, D. C. et al. Protein Sci 2010, 19, (7) 1281. Selected genes code for enzymes able to hydrolyse a number of acyl-CoAs. Examples are the mouse and human ACOT enzymes which have been cloned and expressed in E. coli, such as the human ACOT4 (Hunt, M. C. et al. FASEB J. 2006, 20 (11) 1855) which is active on succinyl CoA, glutaryl CoA and long chain acyl CoAs making this enzyme and other ACOTs reported in the publication, good candidates for selective hydrolysis of methylsuccinyl CoA.

Examples known to be capable of hydrolysis of methylsuccinyl CoA to 2- methylsuccinic acid are described by Sonntag, F. ef al. 2014. Appl. Microbiol. Biotechnol. 98, 4533.

Table 8. Example gene sequences expressing hydrolase enzymes for conversion of methylsuccinyl CoA to 2-methylsuccinate (Activity N). EC 3.1.2.-.

Additional genes coding for CoA thioesterase and other genes coding for enzymes capable of (or involved with) conversion of methyl succinyl CoA to 2-methyl succinate (Activity N) can be identified based on sequence homology to those examples in Table 8. Also, may be selected from acyl-ACP thioesterases, EC 3.1.2.14 or EC 3.1.2.22, and acyl -CoA thioesterases, particularly EC 3.1.2.2, EC 3.1.2.18, EC 3.1.2.19, EC 3.1.2.20 or EC 3.1.2.22. iii) 2-Methylsuccinate production using CoA transferase activity. Figure 2, Activity L

Coenzyme A (CoA) transferases belong to an evolutionary conserved family of enzymes catalysing the reversible transfer of CoA from one carboxylic acid to another. Family I consists of CoA-transferases for 3-oxoacids, short-chain fatty acids and glutaconate. Most use succinyl-CoA or acetyl-CoA as CoA donors.

Family II consists of enzymes which catalyse the transfer of acyl carrier protein (ACP) with a covalently bound CoA derivative, but can accept free CoA thioesters as well.

Family III consists of formyl-CoA: oxalate CoA-transferase, succinyl-CoA:(R)- benzylsuccinate CoA-transferase, (E)-cinnamoyl-CoA:(R)-phenyllactate CoA- transferase, and butyrobetainyl-CoA:(R)-carnitine CoA-transferase. These CoA- transferases occur in prokaryotes and eukaryotes and catalyse CoA-transfer reactions in a highly substrate- and stereo-specific manner.

Family I and family II, for example EC 2.8.3.18 (succinyl-CoA:acetate CoA- transferase and EC 2.8.3.11 citramalyl CoA transferase which is sometimes mistakenly annotated as citryl CoA transferase) may be of particular relevance to this invention. In appropriate pathways, for synthesis of 2-methylsuccinate using a CoA transferase, it is preferred for the enzyme to transfer the CoA moiety from methylsuccinyl CoA to acetate generating acetyl CoA which can enter the methylsuccinate metabolic pathway of this invention (Figure 2). Hence the energy in the CoA moiety is not lost but recycled through the pathway. Acetate can be provided either exogenously as a co-substrate, or can be endogenously produced. As acetate is a natural acetogen product it may be advantageous to link 2-methyl succinate synthesis to acetate recycle through the pathway. The flux of acetyl CoA into the 2-methyl succinate pathway or to acetate, can be manipulated by controlled expression of the genes coding for enzymes which convert acetyl CoA to acetate EC 2.3.1.8 phosphotransacetylase or EC 2.7.2.1 acetate kinase, while maintaining maximum efficiency of 2-methyl succinate synthesis.

The CoA transferase selected for transfer of the CoA moiety from methyl succinyl CoA to for example, acetate is required to be highly selective for methyl succinyl CoA as the donor and acetate as the recipient. The pathway of this invention contains many alternative CoA esters which could also act as CoA donors. EC 2.8.3.18, succinyl-CoA: acetate CoA-transferase is an enzyme selective for transfer of the CoA moiety from succinyl CoA to acetate. Further, the enzyme from Acetobacter aceti has been shown to be active on 2-methyl succinate (Mullens, E.A et al. Biochemistry 2012, 51 , 8422). CoA transferases are known to be generally able to function in either direction. Even though the activity towards 2-methyl succinate is poor compared to succinate (the CoA ester of which is not an intermediate in the 2-methyl succinate synthetic pathway of this invention), this enzyme is an excellent candidate for development by use of standard enzyme evolution techniques known in the art. Succinyl-CoA:acetate CoA-transferase activity in A. aceti is coded for by aarC, the crystal structure is known (ibid), and the mechanism thoroughly studied, making this enzyme also suitable for site directed mutagenesis. Key mutation targets are those which may allow better acceptance of the large methyl functionality such that the critical clamping, desolvation, and hydrogen bonding functions of Val270 are not adversely affected. Cloning of aarC is described (Fukaya, M. et al. J. Bacteriol. 1990, 172 (4) 2096). A. aceti contains a complete but unorthodox citric acid cycle in which the acetic acid resistance protein AarC converts succinyl-CoA and acetate to succinate and acetyl-CoA, (Mullens, E.A et al. J. Bacteriol. 2008, 190 (14), 4933). Other succinyl-CoA:acetate CoA- transferase enzymes are also expected to show activity towards methylsuccinate. Further, citramalyl CoA transferases (EC 2.8.3.11 , e.g sequence WP_035147539.1) are predicted to be active on the highly related structure methyl succinyl CoA.

Table 9. Example gene sequences expressing (methyl) succinyl-CoA:acetate CoA- transferase activity for conversion of methylsuccinyl CoA to 2-methylsuccinate (or the reverse) ( Activity L). EC 2.8.3.18

Additional genes coding for CoA transferase and other genes coding for enzymes capable of (or involved with) conversion of methyl succinyl CoA to 2-methyl succinate (or reverse) (Activity L) can be identified based on sequence homology to those examples in Table 9. iv) Synthesis of 2-methyl succinate from methyl succinate semialdehyde (Figure 2 activity G and K).

2-Methyl succinate can be obtained via reduction of the CoA moiety to an aldehyde followed by aldehyde oxidation to 2-methyl succinate. Step one (Activity G) in this sequence from methyl succinyl CoA is catalysed by a succinate semialdehyde dehydrogenase (succinyl CoA reductase) (acylating), EC 1.2.1.76. For example, the enzyme from Clostridium kluyvuri although described as preferring succinyl CoA is also active for reduction of other unrelated CoA esters (Sohling, B. and Gottschalk, 1993. Eur. J. Biochem. 212, 121-127). Hence, this enzyme is expected to accept the target substrate methyl succinyl CoA. Malonyl CoA reductase (malonate semialdehyde dehydrogenase, acylating) is commonly described as active on substrates other than just malonyl CoA. For example, one such additional substrate is succinyl CoA described by Alber, B. et al. 2006. J. Bacteriol. 188 (24), 8551-8559 for the malonyl CoA reductase from Sufolobus tokodaii. The Sulfolobus enzyme is also reported to be active on methyl malonyl CoA (US 20100068773 A1). Hence indicating acceptance of a C3 or C4 dicarboxylic acid with an a methyl group substitution.

Engineering of the Sulfolobus tokodaii CoA reductase for better methyl group acceptance is described by Demmer, U. et al. 2013 J. Biol. Chem. 288 (9): 6363- 6370. The authors examined in detail the structural binding of the malonyl and succinyl CoA substrates with respect to converting the enzyme to better accept a methyl group i.e. methyl malonyl CoA or methyl succinyl CoA. Specific target point mutations are proposed.

A further example of a promiscuous malonyl CoA reductase from Metallosphaera sedula also active on succinyl CoA is described by Kockelkorn, D. and Fuchs, G. 2009. J. Bacteriol. 191 (20), 6352-6362. US2017016033 used the same principle as above for finding an enzyme capable of methyl malonyl CoA reduction. The inventors screened enzymes capable of malonyl CoA reduction on the basis that reports already existed for this enzyme type accepting related substrates such as succinyl CoA and to a lesser degree methyl malonyl CoA. Aspartyl CoA dehydrogenase an enzyme also discussed by Demmer, U. et al. (ibid) was also included in the screening. Considerable detail is reported in US2017016033 with respect to obtaining and evaluating enzymes capable of methyl malonyl CoA reduction to methyl malonate semialdehyde. On the basis of information reported by Demmer ef al., it is strongly predicted herein that the methylmalonyl CoA reducing enzymes described in US2017016033 will be capable of the reduction of methyl succinyl CoA to methyl succinate semialdehyde. US2017016033 is provided in its entirety as containing example enzymes/sequences for conversion of methyl succinyl CoA to methyl succinate semialdehyde in this invention. Table 10. Example gene sequences expressing methyl succinyl-CoA reductase activity for conversion of methylsuccinyl CoA to methylsuccinate semialdehyde

(Activity G).

Additional genes coding for methyl succinyl CoA reductase activity and other genes coding for enzymes capable of (or involved with) conversion of methyl succinyl CoA to methyl succinate semialdehyde (Activity G) can be identified based on sequence homology to those examples in Table 10.

Oxidation of methyl succinate semialdehyde to 2-methyl succinate (Activity K) can be achieved by use of a succinate semialdehyde dehydrogenase within the metabolic pathway. Enzymes within EC 1.2.1.16; EC1.2.1.24 and EC 1.2.1.79 are known to have broad acceptance of a range of different aldehydes (BRENDA enzyme database). b) Synthesis of 2-methvl succinate via citramalate (Group 2 pathways. Figure

The synthesis of 2-methyl succinate is shown in Figure 6. It can be achieved from acetyl CoA (or acetate) and pyruvate via S or R-citramalate and either mesaconate or citraconate respectively. (S)-Citramalate typically dehydrates to mesaconate and (R)-citramalate typically dehydrates to citraconate. The final step is a reduction of the mesaconate or citraconate double bond forming 2-methyl succinate. This is an unnatural metabolic pathway which has not been described previously. Step 1 Enzymic conversion of acetyl CoA or acetate and pyruvate to (R) or (S)- citramalate (Activity P, Q and R coupled with S, Figure 6.)

Citramalate can exist as two enantiomers R and S, both of which are suitable to form components of novel metabolic pathways for synthesis of 2-methyl succinic acid.The coupling can be achieved for example by using S- or R-citramalyl-CoA lyase (EC:4.1.3.25, EC 4.1.3.46) or citramalate synthase (EC 2.3.1.182) or enzymes classified as isopropylmalate synthase (EC. 2.3.3.13) malyl CoA lyase (EC 4.1.3.24), or an enzyme complex (or components thereof) such as citramalate (pyruvate) lyase (EC 4.1.3.22), which show activity towards acetyl CoA and pyruvate, or acetate and pyruvate. Synthesis of the CoA ester rather than citramalate directly, requires an additional enzyme for release of the CoA moiety which is discussed below. (S)-Citramalate synthesis i) (S)-Citramalate (pyruvate) lyase. (EC 4.1.3.22). Activity Q or P.

Purification and detailed description of a citramalate (pyruvate) lyase enzyme complex is provided for Clostridium tetanomorphum (H1 , DSM528, NCI MB 11547, ATCC15920) by Dimroth, P. et al. 1977. Eur, J. Biochem. 80. 469-477. The enzyme complex consists of an acyl carrier protein (γ - subunit) and two further enzymes (a and β-subunits). The complex can be dissociated into the active components and these have each been purified, two of which are identical with EC 2.8.3.11 (citramalate CoA-transferase, a-subunit) which in the presence of (S)- citramalyl CoA and acetate catalysed synthesis of acetyl CoA and citramalate and EC 4.1.3.25 (citramalyl-CoA lyase, β-subunit) which reversibly cleaved (S)-citramalyl CoA into acetyl CoA and pyruvate. The enzyme complex is reversible and capable of converting acetate or acetyl CoA and pyruvate into (S)-citramalate. It acts by the same mechanistic sequence as citrate lyase (Buckel, W. et al. 1976. Eur. J. Biochem. 64, 255-262) Figure 4.). Pyruvate reacts with protein bound acetyl-S-ACP attached to the enzyme forming enzyme bound citramalyl-S-ACP, a molecule of acetate then binds to reform the enzyme bound acetyl-S-ACP releasing free S- citramalate. Optionally, the enzyme complex can accept an acetyl CoA molecule directly and couple with pyruvate. Hence, with respect to citramalate synthesis the key components are the a and β-subunits.

The citramalate lyase enzyme complex can be purified from Clostridium tetanomorphum (H1 , DSM528, NCIMB 11547, ATCC15920) as described in detail by Buckel, W. et al. 1976. Eur. J. Biochem. 64, 255-262 and then further by Dimroth, P. et al. 1977. Eur, J. Biochem. 80. 469-477. Example sequences for the complex's individual αβ -subunits of Clostridium tetanomorphum DSM 665 or Clostridium tetani 12124569 are shown in Table 11.

Table 11. Example genes coding for enzymes capable of the conversion of acetyl CoA or acetate and pyruvate to (S)-citramalate.

Additional genes coding for (S)-citramalate (pyruvate) lyase and other genes coding for enzymes capable of the conversion of both pyruvate and acetyl CoA and pyruvate and acetate to S-citramalate (Activity Q and P) can be identified based on sequence homology to those examples in Table 11. Typically, these genes are found in organisms metabolising glutamate via methyl aspartate and mesaconate.

For cloning of the citramalyl CoA lyase and CoA transferase genes into yeast, it may be advantageous to optimise the sequences and also to use them as a fusion. Such a sequence is shown in Figure 7. ii) (S)-Citramalyl CoA lyase (EC 4.1.3.25) and (R)-citramalyl CoA lyase (EC 4.1.3.46) Activity R and a CoA transferase Activity S.

(S-)-Citramalyl CoA lyase reversibly catalyses the synthesis of (S)-citramalyl CoA from acetyl CoA and pyruvate. The enzyme activity can also be referred to as L- malyl-CoA/beta-methylmalyl-CoA lyase (EC 4.1.3.24) in the case of enzymes having dual functionality. The reaction generates (S)-citramalyl CoA not citramalate and hence requires a means to release (S)-citramalate from the CoA ester (Activity S). Most preferably this is accomplished by a CoA transferase enzyme transferring the CoA moiety from citramalyl CoA to either acetate or succinate, but can also be achieved by a thioesterase or CoA synthetase/ligase. Succinyl-CoA:L-malate coenzyme A transferase exchanging the CoA moiety between malate and succinate is also known to accept S-citramalate (Friedmann, S. et al. 2006. J. Bacteriol. 188 (7), 2646-2655). The sequences for smtAB are given in the paper (ibid). Transfer of the CoA moiety from citramalyl CoA to acetate releasing (S)-citramalate can also be achieved by sub unit a of the citramalate (pyruvate) lyase enzyme complex from Clostridium tetanomorphum (H1 , DSM528, NCIMB 11547, ATCC15920), Dimroth, P. et al. 1977. Eur, J. Biochem. 80. 469-477 or other organisms harbouring EC 4.1.3.22 e.g. NCBI sequence WP_035147539.1 , or WP_023439565.1.

Citramalyl CoA lyase activity can also be catalysed by subunit β of the citramalate (pyruvate) lyase enzyme complex from Clostridium tetanomorphum (H1 , DSM528, NCIMB 11547, ATCC15920), ibid, or other organisms harbouring EC 4.1.3.22. e.g sequence WP_035147536.1 , or WP_023439566.1.

Chloroflexus aurantiacus is a source of (R)-citramalyl CoA lyase as well as (S)- citramalyl CoA lyase as both enzymes are used in the 3-hydroxypropionate cycle for C0₂ fixation (Friedmann S. et.al. 2007. J. Bacteriol. 189 (7), 2906-2914).

Table 12. Further example gene sequences coding for enzymes capable of the conversion of acetyl CoA and pyruvate to citramalyl CoA. (Activity R)

Additiona genes coding for (S) or [R)-citramalyl CoA lyase and o ther genes coding for enzymes capable of the conversion of pyruvate and acetyl CoA to S-citramalyl CoA (Activity R) can be identified based on sequence homology to those examples in Table 12.

Table 13. Further example gene sequences coding for enzymes capable of the conversion of citramalyl CoA to citramalate (Activity S).

Additional genes coding for citramalate synthesis from citramalyl CoA and other genes coding for enzymes capable of the conversion of citramalyl CoA to citramalate (Activity S) can be identified based on sequence homology to those examples in Table 13.

Further, a succinyl-CoA: R-citramalate coenzyme A transferase has been purified and studied by Friedmann, ef a/. 2006. J. BacterioL 188 (18), 6460-6468. The enzyme converts R-citramaiyi CoA to (R)-citramalate. After re-purification using the method provided, the gene sequence can be obtained by those skilled in the art using available methodology.

Citramalate synthase (EC 2.3.3.13/ EC 2.3.1.182) Activity P. A similar enzyme activity to citramalate CoA lyase was described for Rhodobacter sphaeroides as part of a citramalate cycle for acetate assimilation (Filatova, L. V. ef al. 2005. Microbiol. 74, (3) 265-269) and discussed for other organisms which can assimilate acetate but have no glyoxylate cycle Rhodospirillum rubrum, and Phaespirillum fulvum as well as some methylotrophic bacteria with the serine pathway, such as Methylobacterium extorquens AM1 have this property (ibid). Leroy, B. et al. 2015. Microbiol. 161 , 1061-1072 have proposed that a citramalate lyase (Rru_A0695, currently annotated as a 2-isopropylmalate synthase (LeuA) is responsible for synthesis of D- (R)-citramalate in Rhodospirillum sphaeroides as part of a branched chain amino acid metabolic pathway. Acetate assimilation in these organisms using the described citramalate lyase appears to be at the level of acetyl CoA.

In a non-limiting example, the pyruvate pathway or otherwise better known as the citramalate pathway, is used by organisms such as Rhodospirillum rubrum; Leptospira interrogans; Methanococcus jannaschii; Geobacter sulfurreducens; Cyanothece sp (Leroy, B. et al. Microbiol. 2015. 161 , 1061-1072; Wu, B. et al. Microbiol. 2010. 156, 596-602; Howell, D. M. et al. 1999. J. Bacteriol. 181(1):331-3; Xu, ef al. J. Bacteriol. 2004. 186, (16) 5400-5409; Ma. J. ef al. Biochem J. 2008. 415, 45-56; Risso ef al. J. Bacteriol. 2008. 190 (7) 2266-2274). Synthesis of R- citramalate in the pathway is catalysed by R-citramalate synthase. The Cyanothece sp. ATCC 51142 genome has been sequenced and cce_0248 gene in Cyanothece 51142 exhibits 53 % identity to the gene encoding citramalate synthase (CimA, GSU1798) from Geobacter sulfurreducens (Wu, B. et al. Microbiol. 2010. 156, 596- 602). Wu, B and co-workers also state that on the basis of their findings, citramalate synthase may be widespread amongst the cyanobacteria.

Mutation of CimA from Methanococcus jannaschii for improved performance in E. coli pathways, has been carried out by Atsumi, S. and Liao, J.S. 2008. Appl. Environ. Microbiol. 74 (24), 7802-7808. Such a mutant (CimA 3.7) would be advantageous for the pathways of this invention.

Table 14. Example gene sequences coding for enzymes capable conversion of acetyl CoA and pyruvate to citramalate. (Activity P).

Additiona genes coding for citramalate synthase and other genes coding for enzymes capable of the conversion of pyruvate and acetyl CoA to citramalate (Activity P) can be identified based on sequence homology to those examples in Table 14.

Step 2. Conversion of (R) or (S) -citramalate to citraconate or mesaconate respectively (Activity U and T)

Conversion of citramalate to either citraconate (Activity U) or mesaconate (Activity T) is a dehydration which can be catalysed by a hydratase/dehydratase enzyme. These enzymes are typically reversible. With respect to a biotech process application to a single target product, a means to drive the equilibrium formed between citramalate and either mesaconate or citraconate towards dehydration is required. With respect to this invention, this is uniquely achieved by reduction of the citraconate or mesaconate double bond to form desired 2-methylsuccinic acid.

In addition and following the same principle above, the dehydration of (S) or (R)- citramalate to mesaconate or citraconate can be achieved using an irreversible dehydratase enzyme. One such example can be found in E. coli. Blank, L. ef al. 2002. Microbiol. 148, 133-146 describe the purification and sequence of a 2-methyl citrate dehydratase, EC:4.2.1.79 (PrpD) from E. coli K12, active on a range of substrates including R,S (D,L)-citramalate. The enzyme catalyses dehydration but is not active on the corresponding unsaturated product. Data presented by Blank, L et al. (ibid) suggest that the enzyme is not strongly enantioselective. For example, the activities towards the structurally similar D and L-malate were 0.33 and 0.27 U/mg protein respectively. Activity towards D and L-tartrate were 0.12 and 0.35 U/mg protein respectively. Hence, although the authors did not report relative activity towards the individual (R) and (S) citramalate enantiomers (combined 0.61 U/mg), both are expected to be dehydrated by prpD making the enzyme suitable for a pathway operating via either mesaconate or citraconate.

PrpD orthologues are known to occur in Salmonella typhimurium and other species (Horswill & Escalante-Semerena, 1997. J Bacteriol. 179, 928-940; Claes, W.A et al. 2002. J. Bacteriol. 2728-2739). Hence, the prpD functionality with respect to the irreversible dehydration of (R) or (S)-citraconate is predicted to be present in other species. Some species use an 'aconitase like' activity acnD to replace prpD 2- methyl citrate dehydratase. AcnD is associated with protein prpF which has been confirmed to be an essential isomerase within the 2-methyl citric acid cycle (Garvey, G. S. et al. 2007. Protein Science. 16, 1274-1284). AcnD and prpF, are able to restore 2-methyl citrate dehydratase activity in prpD mutants (Grimek, T.L. & Escalante-Semerena. 2004. J. Bacteriol. 186 (2), 454-462;). Hence, AcnD may also catalyse the target citramalate dehydration to mesaconate or citraconate.

AcnD (EC 4.2.1.117) is known to catalyses the dehydration of (2S,3S)-2- methylcitrate, forming the trans isomer of 2-methyl-aconitate, whereas prpD EC 4.2.1.79, forms the cis isomer. Hence, these selectivities may prove advantageous with respect to optimal dehydration of citramalate to mesaconate (trans configuration) or citraconate (cis configuration). Table 15. Example gene sequences coding for enzymes capable of the irreversible dehydration of (R)-citramalate to citraconate or (S)-citramalate to mesaconate (Activity U or T).

Additional genes coding for irreversible citraconase or mesaconase activity and other genes coding for enzymes capable of the substantially irreversible conversion of citramalate to citraconate or mesaconate can be identified based on sequence homology to those examples in Table 15. i) Dehydration of (R)-citramalate to citraconate using reversible enzymes

Activity U can be achieved by using (f?)-2-methylmalate dehydratase, (citraconase EC 4.2.1.35). Subramanian, S. et al. 1968. J. Biol. Chem. 243, (9), 2367-2372 described purification of the enzyme citraconase which catalyses the reversible hydration of citraconate to R-citramalate. The enzyme was reported as not containing any other related enzymic activity except for very low isocitrate dehydrogenase activity. A malease/ citraconase (EC 4.2.1.31) from Pseudomonas pseudoalcaligenes NCI MB 9867 has been purified and characterised by Van der Werf, M.J. et al. 1993. Appl. Environ. Microbiol. 59, (9), 2823-2829. It is coded by the HbzlJ genes described below from the exact same strain.

Liu, K et al. 2015. Appl. Environ. Microbiol. 81 , (17), 5753-5760 describe the HbzlJ gene (GenBank No. DQ394580 https://www.ncbi.nlm.nih.gov/nuccore/DQ394580) from Pseudomonas alcaligenes NCI MB 9867 cloned into E coli and characterised as a maleate hydratase consisting of large and small subunits. Advantageously, the maleate dehydratase (malease) enzyme did not isomerise a-isopropylmalate, an often associated activity with maleate dehydratase. The enzyme isopropylmalate isomerase (EC 4.2.1.33) plays an important role in both the L-isoleucine and L-leucine biosynthesis pathways, where it isomerises (R)- citramalate to (2R,3S)-3-methylmalate, and (2S)-2-isopropylmalate to (2fl,3S)-3- isopropylmalate , respectively. The enzyme catalyses the isomerization reaction in a two-step process, first dehydrating its substrate to the intermediate citraconate or 2- isopropylmaleate), followed by hydration to the final isomerised product. Isopropylmalate isomerases are widely available and comprise two subunits, isopropylmalate isomerase large subunit (LeuC) isopropylmalate isomerase small subunit (LeuD). An isopropylmalate isomerase from Methanocaldococcus jannaschii DSM 2661 has been cloned and studied and shown to catalyse the dehydration of R-citramalate to citraconate (Drevland, R. M et al. 2007. J. Bacteriol. 189 (12), 4391-4400). As expected, the equilibrium lies on the side of citramalate, emphasising the requirement for double bond reduction of citraconate to 2-methyl succinate to drive the equilibrium.

Xylenol utilising microorganisms are also a good source of citraconase activity Ewers,

J.et al. 1989. Appl. Environ. Microbiol. 55, (11), 2904-2908. 2,6-Xylenol degradation proceeds via citraconate and citraconase activity was detected in cell free extracts of Mycobacterium sp. strain DM1. The molecular cloning of genes specifying some enzymes of the 3,5-xylenol degradative pathway in Pseudomonas putida NCIB9869 has been described by Jain, R.K. 1996. Appl. Microbiol Biotechol. 45, 502-508. One of the genes codes for a R-citraconase.

Table 16. Further example gene sequences coding for enzymes capable of the conversion of R-citramalate to citraconate. (Activity U).

Additiona genes coding for citraconase and ol her genes coding for enzymes capable of the conversion of citramalate to citraconate (Activity U) can be identified based on sequence homology to those examples in Table 16. ii) Dehydration of S-citramalate to mesaconate using reversible enzymes

Activity T can be achieved by using (S)-2-methylmalate dehydratase, {mesaeonase EC 4.2.1.24), or fumarase EC 4.2.1.2.

The enzyme fumarase (Class 1) has been known for some time to catalyse the reversible hydration of mesaconate (Suzuki, S. et al. 1977. J. Biochem. 81 , 1917- 1925) and this aspect is discussed below.

The class I enzymes are thermolabile homodimers with a molecular mass of ~120 kDa. They contain an oxygen-sensitive catalytic [4Fe-4S]-cluster acting as a Lewis acid to activate a hydroxyl from the substrate (for elimination) or water (for addition). Class I fumarases are predominantly found in bacteria, in some Archaea and Eukaryotes. Escherichia coli possesses class I enzymes, fumarases A and B (FumA and FumB), sharing a high degree of sequence similarity and having similar catalytic properties. In many Bacteria and Archaea, fumarase is encoded by two subunits homologous to the N and C-terminal parts of FumA of E. coli. Class II fumarases like fumarase C (FumC) of E. coli are thermostable tetramers with four identical 50 kDa subunits that do not require Fe2+ for the activity. They are oxygen tolerant enzymes catalyzing (S)-malate dehydration through the intermediate formation of an aci- carboxylate and can be found in many pro- and eukaryotic organisms.

Kronen, M. et al. 2015. Appl. Environ. Microbiol. 81 (16) 5632-5638, have recently shown that B. xenovorans class I fumarase is equally efficient in the hydration of fumarate to (S)-malate and mesaconate to (S)-citramalate and that it participates in mesaconate utilization in this bacterium. Kronen, M. et al. (ibid) also demonstrated excellent activity for the desired reverse reaction of this invention i.e the dehydration of S-citramalate to mesaconate. Hence, the B. xenovorans class I fumarase is a promiscuous fumarase/mesaconase. The cloning and expression in E. coli of the B. xenovorans class I fumarase (Bxe_A3136) is described (ibid). It is predicted that class 1 fumarases in general possess intrinsic mesaconase activity.

As highlighted above many E. coli possess class 1 fumarase enzyme FumA and FumB. However, the genomes of 14.8% of sequenced Enterobacteriaceae (26.5% of E. coli, 90.6% of E. coli 0157:H7 strains) possess an additional class I fumarase homologue which has been designated as fumarase D (FumD). The cloning and detailed characterisation (relative activities towards fumarate/malate and mesaconate/citramalate) of fumarase D from E. coli ATCC 700728and characterisation of E. coli K12 FumA and B, is described by Kronen, M. and Berg, I. A. Mesaconase/Fumarase FumD in Escherichia coli 0157:H7 and Promiscuity of Escherichia coli Class I Fumarases FumA and FumB. Dec 14 2015. PLOS ONE 1/18. Kronen and Berg provide clear evidence of the suitability of FumA, B and D for the dehydration of citramalate to mesaconate.

Table 17. Kinetic data taken from Kronen, M. and Berg, I. A. Dec 14 2015. PLOS ONE 1/18.

All characterized mesaconases accepted fumarate and (S)-malate as the substrates. It is predicted that mesaconases may actually be fumarases, or enzymes highly related to fumarases.

Table 18. Example gene sequences coding for enzymes capable of the conversion of (S)-citramalate to mesaconate. (Activity T).

Additiona genes cod ing for mesaconase and other genes coding for enzymes capable of the conversion of citramalate to mesaconate (Activity T) can be identified based on sequence homology to those examples in Table 18. In addition, further source examples for class 1 fumarases fumA, B and D are provided by Kronen, M. and Berg, I. A. Dec 14 2015. PLOS ONE 1/18.

Further, the two-component reversible mesaconase enzyme from Clostridium tetanomorphum has been purified and studied by Huntly Blair, A and Barker, H. A. 1966. J. Biol. Chem. 241 , (2), 400-408. Re-purification of the system would allow sequencing of the gene(s) using techniques well known in the art allowing application to a novel pathway for production of 2-methyl succinic acid via (S)- citramalate. Step 3 - Reduction of the double bond of citraconate or mesaconate to 2-methyl succinate. Activity Wand V. Figure 6.

Data base searches have indicated that YqjM reductase from Bacillus subtilis displays a high degree of sequence similarity to OYE1 from Saccharomyces carlsbergensis and its homologs. Pseudomonas putida XenA, a xenobiotic reductase, appears to be the closest homolog exhibiting 40% identity. Biochemical analysis of YqjM has shown that the enzyme shares some important common features with members of the OYE family. For example, YqjM binds the FMN cofactor non-covalently and reduces the flavin in the reductive half-reaction at the expense of NADPH. Like other members of the family, YqjM transfers electrons from the reduced flavin to the double bond of a variety of a, β-unsaturated carbonyl compounds. However, YqjM does have many unique features compared to other members of the family. For example, while all other OYE homologs are either monomeric or dimeric enzymes, YqjM is the only known family member that functions as a homotetramer. Kitzing, K. et al. 2005. J. Biol. Chem. 280, (30) 27904- 27913 confirmed that YqjM shares the overall fold of the OYE family. Also, they demonstrated unequivocally that YqjM is in fact the first characterized representative of a new class of OYE homologs showing fundamental differences to the classical OYE enzymes.

Typically, OYE family enzymes are poor acceptors of substrates such as mesaconate, citraconate and itaconate, (Hall, M. et al. 2008. Eur. J. Biochem. 1511- 1516). However, examples do exist within the OYE family which are capable of reduction of some of these substrates. One such example is YqjM from Bacillus subtilis (strain 168) described above and other OYE family enzymes or those possessing similar features to YqjM as described by Kitzing, K. et al. 2005. J. Biol. Chem. 280, (30) 27904-27913 are predicted to possess citraconate, mesaconate, or itaconate reducing activity. The quantitative reduction of citraconic acid to (R)-2- methyl succinic (ee>99%) using YqjM from Bacillus subtilis is described by Stueckler, C. et al. 2007. Organic Letts. 9 (26) 5409-5411. Concentration of YqjM was up to a maximum of 0.27mg/ml and citraconate concentration 5mM. Hence producing over 0.6g/l 2-methyl succinic acid. The cloning of YqjM into E. coli is described by Fitzpatrick, T. B. et al. 2003. J. Biol. Chem. 278 (22) 19891-19897. Further detail is available in Pesic, M. ef al. 2017 ChemistrySelect 2017, 2, 3866.

The enzyme fumarate reductase (NADH) (EC 1.3.1.6) catalyses reduction of fumarate to succinate (fumarate+NADH succinate+NAD). Reduction of fumarate by fumarate reductase is essentially irreversible. Fumarate reductase is generally found in obligate or facultative anaerobes.

Fumarate reductase/succinate dehydrogenase is well reported to reduce other substrates of which mesaconate is one accepted example (Wardrope, C. et al. 2006. FEBS Lett. 580, 1677-1680).

Wardrope, et al. studied the structural and mechanistic insights for the reduction of mesaconate (2-methyl fumarate) into confirmed (S)-2-methyl succinate by Shewanella frigidimarina soluble fumarate reductase (e.g gene fccA). The crystal structure was obtained to a resolution of 1.5 angstroms paving the way for development of the enzyme if required. The reaction was shown to proceed at a moderate kcat value of 9.0 ± 0.4 s^"1 with an excellent Km of 32 ± 8 μΜ for 2-methyl fumarate (mesaconate). The redox partner of these soluble fumarate reductases found within the periplasmic space is cytochrome cymA. If such a redox partner is absent from a chosen host organism the addition of cymA gene will be required. Although cymA is a membrane bound protein, soluble truncated versions have also been produced providing additional potential for a fusion protein (Myers, C. etal. 1997. J. Bacteriol. 179, (4), 1143; Schwalb, C. ef al. 2003. Biochem. 42, 9491 ; Schwalb, C. et al. 2002. Biochem, Soc. Trans. 30, (4), 658.

Guccione, E. ef al. 2010 also describe reduction of fumarate, mesaconate and crotonate by Mfr periplasmic reductase in Campylobacter jejuni. Environ. Microbiol. 12 (3) 576-591. The product of the reaction is 2-methyl succinic acid.

Eck, R. and Simon, H. Tetrahedron 1994, 50, 13631-13640 described the highly efficient reduction of mesaconate (1M) to (S)-2-methyl succinic acid (>99% ee) in Clostridium formicoaceticum ATCC 27076, DSM 92 resting cells (genome sequence, Karl, M.M. ef al. 2017. Genome Announc 5:e00423-17. https://doi .org/10.1128/genomeA.00423-17. This reduction is catalysed by a membrane bound fumarate reductase and is predicted to be common activity in acetogen microorganisms.

2-Enoate reductases have been shown to catalyse the reduction of mesaconate to 2-methyl succinate Preiss, U.; White, H.; Simon, H.; DECHEMA Biotechnol. Conf. 3, 189-192 (1989) and 2-enoate reductase genes from several Clostridial sp. have been cloned into E. coli (Rohdich, F. et al. 2001. J. Biol. Chem. 276 (8), 5779- 5787). Further, fumarate reductase from lactococci such as Streptococcus lactis (renamed Lactococcus lactis) have been shown to reduce mesaconate at the expense of NADH (Hillier, R.E. et al. Aust. J. Biol. Sci. 1979, 32,625). The relative poor activity (4%) compared to the natural substrate fumarate is likely to be related to the mesaconate methyl group functionality. Those skilled in the art will understand how, by use of techniques such crystallography and site directed mutagenesis/ random mutagenesis will generate mutants with improved mesaconate reduction efficiency. A further example with capacity for mesaconate reduction in Streptococcus faecalis (renamed Enterococcus faecalis) is decribed by Aue, B.J. et.al. 1967. J. Bacteriol. 93 (6) 1770-1776. Hence, it is predicted that the ability to reduce mesaconate, is likely to be a common functionality for fumarate reductases coded for by genes in a variety of bacterial species and particular members of the Lactococcus and Enterococcus genera. A further option for the reduction of mesaconate to 2-methyl succinate is use of dihydroorotate dehydrogenases (DHODH) which calayse oxidation of dihydroorotate to orotate. They are key enzymes in the pyrimidine biosynthetic pathway. These enzymes are divided into two classes with the Class 1 enzymes being of most relevance to this invention. Class 1 is further subdivided into A and B. The DHODH proteins from family 1A are homodimeric proteins, which can use fumarate as electron acceptor and are independent of oxygen (EC 1.3.98.1). These enzymes (e.g gene Ural from Saccharomyces) are also known to accept mesaconate as a substrate (Zameitat, E. FEMS Yeast Res. 2007, 7, (6), 897. DOI:10.1111/j.1567-1364.2007.00275.x and references within). Class 1 B enzymes use either NAD or NADP (EC 1.3.1.14, EC 1.3.1.15) as electron acceptors. These enzymes are fully reversible. However, Marcinkeviciene, J. et al. Biochem. 1999, 38, 13129, describe the DHODH from Enterococcus faecalis as catalytically more active for orotate reduction than dihydroorotate oxidation.

A number of organisms contain both the 1A and 1 B versions and it is suggested that 1 B is more involved with orotate reduction in the cell, whereas 1A is more involved with dihydroorotate oxidation. Considerable information is available in the art regarding both 1A and 1 B enzymes (Norager, S.et al. 2003. J. Biochem. 278, (3), 28812; Andersen, P.S. etal. 1996. J. Bacteriol. 178, (16), 5005; Andersen, P.S. 1994. J. Bacteriol. 176, (13) 3975; Marcinkeviciene, J. et al. 2000. Arch Biochem. 379, (1), 178).

Combining dihydroorotate dehydrogenase 1A and 1 B in an organism with capacity to produce mesaconate would allow reduction of mesaconate to 2-methyl succinate with oxidation of dihydroorotate to orotate, combined with reduction of orotate back to dihydroorotate at the expense of NAD(P)H. This would create a 2-methyl succinate producing cycle utilising pyridine dinucleotide reducing equivalents. The process could also be carried out with exogenous addition of dihydroorate or orotate. Table 19. Example gene sequences coding for enzymes capable of the conversion of citraconate or mesaconate to 2-methyl succinate. Activity W and V.

Additional genes coding for enzymes capable of the conversion of citraconate or mesaconate to 2-methyl succinate (Activity W and V) or involvement with e.g cymA, can be identified based on sequence homology to those examples in Table 19. A further useful option is isomerisation of either citraconate or mesaconate generated by a preceeding enzyme and reduction to 2-methyl succinate. Hence, for example, an optimal mesaconate synthetic pathway can be coupled to an optimal highly efficient citraconate reductase, or the reverse. The reaction may be catalysed by a maleate isomerase, citraconate isomerase, mesaconate isomerase or a mutant thereof.

Synthesis of the product methvl-4-hvdroxvbutvrate (also known as methyl gamma-butvrolactone in the cvclised form which may exist in equilibrium)

Methyl-4-hydroxybutyrate can be synthesised from methyl succinyl CoA via methyl succinate semialdehyde and reduction of the aldehyde moiety (Activity G and H, Figure 2) or from 2-methyl succinate (produced from either Group 1 or Group 2 pathways), by reduction of the carboxylate group to an alcohol (activity O, Figure 2.). Activity O is a combination of Activities I and Activity H or I and Activity J. Methyl succinyl CoA can also be synthesised from 2-methyl succinate produced from a Group 2 pathway. For example utilising citramalyl CoA lyase and citramalyl CoA transferase for citramalate synthesis alongside enzymes such as Succinyl- CoA:acetate CoA-transferase from for example, A. aceti coded for by aarC, which are confirmed to be able to synthesise 2-methyl succinyl CoA from 2-methyl succinate (See section iii above, 2-methyl succinate production using CoA transferases).

Synthesis of methyl succinate semialdehyde from methyl succinyl CoA is described in Example 2. Reduction of methyl succinate semialdehyde to methyl-4-hydroxy- butyrate (Activity H) may be achieved using a hydroxyisobutyrate dehydrogenase enzyme (EC 1.1.1.31) which is expected to have activity towards methyl succinate semialdehyde. 3-hydroxyisobutyrate dehydrogenase catalyses the reversible oxidation of the highly related substrate 3-hydroxy-isobutanoate to (S)-methylmalonate-semialdehyde. The enzyme is widely distributed in yeasts, molds, bacteria, and mammalian tissues Bannerjee, G. ef al. 1970. J. Biol. Chem. 245 (7), 1828-1835; Chowdhury, 1996. Biosci. Biotechnol. Biochem. 60 (12), 2043-2047. Alternatively methyl-4-hydroxybutyrate can be synthesised from methyl succinate semialdehyde using succinate semialdehyde reductase (NADPH) EC 1.1.1.B47. Some succinate semialdehyde reductase enzymes have dual functionality with the substrate malonic semialdehyde (Kockelkorn, D and Fuchs, G. 2009. J. Bacteriol. 191 (20) 6352-6362). Hence, malonic semialdehyde reductases are also suitable candidates. The semialdehyde reductase from Gluconobacter oxydans is another example Meyer, M. ef al. 2015. Appl. Microbiol. Biotechnol, 99 (9), 3929-3939. Further suitable examples are found in Geobacter sp. (Zhang, Y ef al. 2014. Biochimie. 104, 61-69). In addition, a wide range of dehydrogenases and reductases are also expected to accept methyl succinate semialdehyde as a substrate. For example, those categorised in EC 1.1.1.1 , EC 1.1.1.2, EC 1.1.1.72 or EC 1.1.1.265 or EC 1.1.1.283. GOX1615 being one example Richter, N. et al. Chembiochem. 2009, 10,1888. Table 20. Example gene sequences expressing methyl succinate semialdehyde reductase activity for conversion of methyl succinate semialdehyde to methyl-4- hydroxybutyrate (Activity H).

Additional genes coding for methyl succinate semialdehyde reductase activity and other genes coding for enzymes capable of (or involved with) conversion of methyl succinate semialdehyde to methyl-4-hydroxybutyrate (Activity H) can be identified based on sequence homology to those examples in Table 20.

Synthesis of the product 2-methvl-1 ,4-butanediol

2-Methyl-1 ,4-butanediol can be synthesised from methyl succinyl CoA by Activity G,

H, I and J. Activity H may optionally replace Activity J. Methyl succinyl CoA can also be synthesised from 2-methyl succinate produced from a Group 2 pathway. For example utilising citramalyl CoA lyase and citramalyl CoA transferase for citramalate synthesis alongside enzymes such as Succinyl-CoA:acetate CoA-transferase from for example, A. aceti coded for by aarC, which are confirmed to be able to synthesise 2-methyl succinyl CoA from 2-methyl succinate (See section iii, 2-methyl succinate production using CoA transferases)

Synthesis of the intermediate methyl-4-hydroxybutyrate (Activity G and H) is described in Example 3. 2-methyl-1 ,4-butanediol is synthesised from methyl-4- hydroxybutyrate by reduction of the carboxylate group to an alcohol in two steps.

The methyl-4-hydroxybutyrate carboxylate group can be reduced to methyl-4- hydroxybutanal using a carboxylic acid reductase enzyme (Activity I). Such enzyme activity mainly uses either reduced ferredoxin (aldehyde ferredoxin oxidoreductase) or ATP to drive the thermodynamically unfavourable reduction of a carboxylic acid moiety and tend to be classified in EC 1.2.7.5, EC 1.2.1.30, EC 1.2.99.6. or EC

I .2.1.3. The term carboxylic acid reductase and aldehyde oxidoreductase are used interchangeably in the literature. Aldehyde dehydrogenase is also used to describe enzymes capable of carboxylic acid reduction. An example of a well-studied carboxylic acid reductase can be found in Nocardia iowensis which catalyzes the magnesium, ATP and NADPH-dependent reduction of carboxylic acids to their corresponding aldehydes (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007)). This enzyme is encoded by the car gene and was cloned and functionally expressed in E. coll (Venkitasubramanian et al., J. Biol. Chem. 282:478-485 (2007). Expression of the npt gene product improved activity of the enzyme via post-translational modification. The npt gene encodes a specific phosphopantetheine transferase (PPTase) that converts the inactive apo-enzyme to the active holo-enzyme. The natural substrate of this enzyme is vanillic acid, and the enzyme exhibits broad acceptance of aromatic and aliphatic substrates as small as lactic acid (Venkitasubramanian et al., in Biocatalysis in the Pharmaceutical and Biotechnology Industries, ed. R. N. Patel, Chapter 15, pp. 425-440, CRC Press LLC, Boca Raton, Fla. (2006). A further well studied enzyme is the example from Mycobacterium marinum which has a wild type substrate preference for C6 to C18 acids (Kalim Akhtar, M. ef al. PNAS, 2013, 110, 87). Enzymes capable of carboxylic acid reduction may be evolved or mutated as described above to increase activity towards methyl-4- hydroxybutyrate using enzyme evolution techniques common in the art. The griC and griD genes from Streptomyces also code for a carboxylic acid reductase with diverse capability for acid reduction Suzuki ef al. 2007. J. Antibiot. 60 (6) 380. Finnigan, W. ef al. ChemCatChem 2017, 9, 1005, carried out a thorough biochemical characterisation and kinetic analysis of carboxylic reductases (sequences provided in supporting information, ibid) with various substrates and showed that they have a broad but similar substrate specificity. A diverse range of carboxylic acid were good substrates. The C5 carboxylic acids of this invention are highly likely to be accepted as substrates by these and other CAR enzymes. Note that CAR enzymes typically require co-expression with a phosphopantetheinyl transferase from for example, Bacillus subtilis (ibid).

Aldehyde ferredoxin oxidoreductase enzymes use ferredoxin not ATP to drive the carboxylate reduction and are present in many acetogens and other organisms (White, H et al. Biol. Chem Hoppe Seler 1991 , 372 (11) 999; White, H and Simon, H. Arch. Microbiol, 1992, 158, 81 ; Fraisse. L and Simon, H. Arch. Microbiol. 1988, 150,381 ; (Basen et al. 2014. PNAS, 111 (49), 17618). The carboxylic acid reducing enzyme from Moorella thermoacetica has been purified and characterised, White, H. ef al. Eur. J Biochem, 1989, 184, 89. Further, using propionate reduction to propionaldehyde, the specific activity was shown to increase when the corresponding aldehyde was removed during the reaction. In the case of application of such an enzyme to this invention, the product methyl-4-hydroxybutanal would be continuously removed by Activity H or J (Figure 2.) and would not be expected to accumulate significantly. Huber, C. et al. Arch. Microbiol, 1995, 64, 110.

A further source of aldehyde ferredoxin oxidoreductase are the hyperthermophiles, Thermococcus sp. (Kesen, J.H. J. Bacteriol. 1995, 177, 4757 and Pyrococcus sp. (Basen ef al. 2014. PNAS, 111 (49), 17618 where this enzyme has been used to effectively synthesise alcohols such as butanol from butyrate via butanal driven by carbon monoxide.

An aldehyde dehydrogenase (aldH) from E. coll has been shown to reduce 3- hydroxypropionic acid to the corresponding aldehyde as well as the preferred oxidation of 3-hydroxpropionaldehyde, Ji-Eun, J. ef al., Appl. Microbiol. Biotechnol 2008. 81 , 51. Hence, as these authors have shown the enzyme to be reversible, activity towards reduction of methyl-4-hydroxybutyrate is likely.

Table 21. Examples of genes expressing enzymes for application to the reduction of methyl-4-hydroxybutyrate to methyl-4-hydroxybutanal (Activity I).

Additional car and npt genes and other genes coding for enzymes capable of (or involved with) carboxylic acid reduction (Activity I) can be identified based on sequence homology to those examples in Table 21. Also, further sequences provided in Finnigan, W. et al. ChemCatChem 2017, 9, 1005.

Reduction of methyl-4-hydroxybutanal can be achieved by inclusion of a gene encoding activity H or alternatively the use of a separate Activity J. For example, a 3-hydroxybutanal reductase (DebiaDRAFT_04514) has been cloned and studied by Frey, J. ef al. 2016. BMC Microbiol. 16, 280, DOI 10.1186/s12866-016-0899-9. Examination of the substrate profile suggests that it is likely to be suitable for application to the Group 1 pathways of this invention. Further reductases active towards hydroxyaldehydes are described by Kim, T. ef al. 2017. Appl. Environ. Microbiol. 27^th Jan 2017,; Jeon et al., J. Biotechnoi. 135:127-133 (2008). Methyl-4- hydroxybutanal is predicted to be a substrate of a wide range of reductase and dehydrogenase enzyme both NADH and NADPH dependent. GOX1615 has a substrate profile which would also raise expectation that it would catalyse methyl-4- hydroxybutanal reduction (Richter, N. et al. Chembiochem. 2009, 10,1888). A range of butanol dehydrogenases (e.g bdh) are predicted to be suitable for reduction of methyl-4-hydroxybutanal to 2-methyl-1 ,4-butanediol. For example, Hwang, H. J. et al. Biotech Bioeng. 111 (7), 1374 describe the successful engineering of a butanol dehydrogenase from Clostridium saccharoperbutylacetonicum for reduction of 4-hydroxybutanal to 1 ,4-butanediol. A further non-limiting example is the adh gene from Geobacillus thermoglucosidasius M10EXG (Jeon et al., J. Biotechnol. 2008, 135:127).

Table 22. Example gene sequences expressing methyl-4-hydroxybutanal reductase activity for conversion of methyl-4-hydroxybutanal to 2-methyl-1 ,4-butanediol (Activity J).

Additional genes coding for methyl-4-hydroxybutanal reductase activity and other genes coding for enzymes capable of (or involved with) conversion of methyl-4- hydroxybutanal to 2-methyl-1 ,4-butanediol (Activity J) can be identified based on sequence homology to those examples in Table 22 and references herein. Culture of anaerobic strains for production of for example. 2-methvlsuccinate. methvl-4-hvdroxvbutvrate, 2-methvl-1 ,4-butanediol.

For the synthesis of 2-methylsuccinate, methyl-4-hydroxybutyrate or 2-methyl-1 ,4- butanediol, using anaerobes such as acetogens, the recombinant acetogen strain is cultured in a defined, semi-defined or undefined medium supplemented with for example syngas or other feedstock described herein or mixture thereof, as the only or principle carbon and energy source is well known in the art. Examples of additional sources of energy or carbon may be nitrate, methanol or sugar. It is highly desirable to maintain anaerobic conditions as the acetogen strains are strict anaerobes with only limited to moderate oxygen tolerance. Initial tests with the wild type organism and with genetically modified organisms before moving to a fermentor can be done in small bottles that are fitted with thick rubber stoppers and aluminium crimps employed to seal the bottles and as those skilled in the art will understand.

Suitable replicates such as triplicate cultures can be grown for each engineered strain and culture supernatants can be tested for products formed. For example, syngas composition in the media, metabolic intermediates, e.g acetoacetyl CoA, crotonyl CoA, ethylmalonyl CoA, citramalate, mesaconate etc and by-product(s) formed in the engineered production host can be measured as a function of time and can be analysed by methods such as High Performance Liquid Chromatography (HPLC), GC (Gas Chromatography), GC-MS (Gas Chromatography-Mass Spectroscopy) and LC-MS (Liquid Chromatography-Mass Spectroscopy) or other suitable analytical methods using routine procedures well known in the art.

Intermediates such as acetoacetyl CoA, crotonyl CoA and ethylmalonyl CoA and products such as 2-methylsuccinic acid or 2-methyl-1 ,4-butanediol, can be quantified by HPLC using as appropriate, a refractive index detector or UV detector or other suitable assay and detection methods well known in the art. The individual enzyme or protein activities expressed from the heterologous DNA sequences or overexpressed endogenous DNA sequences, can also be assayed using methods well known in the art. Fermentations can be performed in continuous cultures, batch or fed-batch. All of these processes are well known in the art. Important process considerations for syngas fermentation are high biomass concentration (optionally through cell recycle) and good gas-liquid mass transfer Bredwell et al, (1999), Biotechnol. Prog. 15:834- 844. As carbon monoxide has a lower solubility in water compared to oxygen, continuously gas-sparged fermentations are recommended and can be performed in controlled fermentors with constant off-gas analysis by mass spectrometry and periodic liquid sampling and analysis discussed above. Other feedstocks such as methanol which can be toxic at high concentration, or sugar can be progressively fed to the fermentor using traditional approaches. All the principles above equally apply to aerobic strains or those requiring minimal oxygen for growth or metabolism, except that oxygen or air is provided as appropriate. Information regarding the growth of a range of different acetogens is widely available in the literature. For example, Bainotti, A.E. ei a/ J. Ferment, Bioeng. 1996. 81 (4), 324; Cotter, J.L et al. 2009. Enz. Microbiol. Technol. 44, 281. The medium should be prepared using anaerobic techniques and typically contained under an N₂C0₂ atmosphere (80:20).

The growth of well studied organisms such as E. coli and yeast is also well reported in the literature and those skilled in the art will be very familiar with the required methodology. Chemical further conversion of biologically produced products.

Without limitation by example, (R) or (S)-2-methyl succinic acid can be chemically converted to further desirable products, with or without recovery of 2-methyl succinate from the culture broth. For example:

(R) or (S)-2-methyl succinic acid and derivatives such as esters and anhydrides, can be chemically converted to citraconic acid as described in US3931241A. The content of US3931241A is incorporated herein in its entirety as an example for this invention.

Citraconic acid can be converted to methacrylic acid or derivatives by methods described in WO 2012069813 A1. The content of WO 2012069813 A1 is incorporated herein in its entirety as an example for this invention.

(R) or (S)-2-methyl succinic acid can be converted to methacrylic acid or derivatives such as methyl methacrylate by approaches described in US 3625996 A. US 3625996 A is included in its entirety as an example for this invention. An important by product of this reaction is carbon monoxide gas which can be recovered and further converted to carbon containing chemicals either by chemical or biological means. For example, CO can be fermented by carboxydotrophic acetogens such as Clostridium ljungdahlii, Clostridium autoethanogenum or Eubacterium sp. Or chemically converted to methanol or a variety of chemicals such as acids, esters and alcohols. Carbon monoxide also produces and regenerates catalysts such as nickel carbonyl.

The production of carbon monoxide as a by product of the conversion of (R) or (S)- 2-methyl succinate (or derivatives such as esters) to methacrylic acid (or derivatives such as methylmethacrylate) offers additional potential economic and environmental advantages compared to the decarboxylation route described in WO 2012069813 A1. Decarboxylation produces C0₂ which typically requires an input of energy to be of further synthetic utility. However, carbon monoxide retains energy and as such is a useful chemical or biochemical feedstock. Hence, the use of a decarbonylation reaction (CO release) rather than a decarboxylation (C0₂ release) creates an opportunity for greater carbon efficiency with respect to conversion of feedstock carbon to products whether by chemical of biochemical processing.

Products such as butenoic acid (or ester derivatives) can also be obtained from (R) or (S)-2-methyl succinate esters by further decarbonylation methods such as that described in US4999453A. In this example loss of the carbon atom in the 2-methyl succinate dicarboxylic ester is from the carboxylic ester group on the more highly substituted carbon atom. This is the reverse of the method described in US 3625996 A where carbon is lost from the least substituted side generating methacrylic acid or esters such as methyl methacrylate. US4999453 A is included in its entirety as an example for this invention. As described above carbon monoxide by product can be recovered and further converted by chemical or biological means.

A range of further non-limiting products can be obtained from (R) or (S)-2-methyl succinic acid. Chiral configuration and purity is defined by the 2-methyl succinate starting material.

3-methyl gamma-butyrolactone; 4-methyl gamma-butyrolactone; 2-methyl-1 ,4- butanediol; 3-methyl tetrahydrofuran; 3-methyl-NMP (A -Methyl-2-pyrrolidone); 4- methyl-NMP, 2-methyl-1 ,4-butanediamine; 3-methyl pyrrolidine and isoprene Example 1. Cloning and expression of citramalate dehydratases PrpD and FumD in Saccharomyces cerevisiae

To generate FumD DNA for cloning, a synthetic sequence was designed in which each amino acid of FumD (Uniprot Q8X999, Table 18) was encoded by the fastest decoded codon according to data published in Chu, D. et a/ (2014). EMBO J. 33, 21. The resulting sequence was modified to remove local repeats without altering the expressed protein sequence (T177C, T180C, T534C, T537C, T630C, A642G, A819G, A1008G, T1599C, T1602C). For cloning, an N-terminal sequence was added comprising (in 5' to 3' order) of a BspQI site in forward orientation, the sequence corresponding to the 28 nucleotides upstream of the Xbal site in the cloning vector pBEVY-U (Miller, C. A. et al. 1998. Nucleic Acids Res. 26, 3577) and an Xbal site; and a C-terminal sequence was added comprising (in 5' to 3' order) of a C, an Xbal site, the 27 nucleotides downstream of the Xbal site in pBEVY-U, and a BspQI site in reverse orientation. The synthetic DNA was assembled by Eurofins Genomics (Ebersberg, Germany). Following synthesis, FumD was released from the synthesis vector by digesting 1.5 ug of vector DNA with 10 units BspQI (NEB, UK), and separation of the digest on a 1 % agarose gel in TAE. The 1700 bp band corresponding to FumD was excised and the DNA eluted from the agarose using a Gel Extraction Kit (Thermo Fisher, UK). To generate PrpD DNA for cloning, the genomic DNA corresponding to the PrpD gene (Uniprot P77243, Table 16) from E. coli BL21 (Jeong, H. ef al. 2009. J. Mol. Biol. 394, 644) was amplified by PCR using primers PrpD_f (CCAAGAACTTAGTTTCGACGGATCCTCTAGAATGTCAGCTCAAATCAACAACAT

CCG) and

PrpD_r

(GCTTGCATGCCTGCAGGTCGACTCTAGATTAAATGACGTACAGGTCGAGATAC TCATTGAC), using GoTaq 2x Master Mix (Promega, UK) and a thermal cycle consisting of 5 minutes at 94°C; then 30 cycles of 45 seconds at 94°C, 45 seconds at 54°C, 1 minute at 72°C; then 5 minutes at 72°C. The PCR product was separated on a 1% agarose gel, the 1400 bp product corresponding to PrpD was excised, and the DNA eluted from the agarose using a gel extraction kit.

The eluted FumD and PrpD sequences were inserted into Xbal digested pBEVY-U vector using Gibson assembly (Gibson, D. G. et al. 2009. Nat. Methods 6, 343) Successful cloning products were initially identified by analytical restriction enzyme digest with Xbal, followed by Sanger Sequencing (GATC Biotech, Constance, Germany).

The SDS-PAGE gels of extracts made with PrpD and FumD expressing cells are shown in Figure 8.

Example 2. Synthesis of 2-methyl succinate in yeast such as Saccharomyces cerevisiae via citramalyl CoA lyase and citramalyl CoA transferase, mesaconase and dihydroorotate dehydrogenases.

To achieve 2-methyl succinate synthesis in S. cerevisiae, exploiting the option to use a heterologous dihydroorotate dehydrogenase from Enterococcus faecalis (Uniprot P0DH76 and P0DH74, Table 19) and optional upregulation of native yeast dihydroorotate dehydrogenase, fumarate (Ural , Uniprot P28272), the required heterologous gene products need to be combined with yeast gene regulatory sequences. Alternative means of reducing the mesaconate double bond using sequences from Table 19, may replace the dihydroorotate dehydrogenase and utilise the same methodology. In order to reduce the number of expression constructs required, the different elements can be cloned into the pBEVY series of vectors which contain bi-directional promoter elements based on the natural yeast TDH3 and ADH1 promoters (Miller, CA et al. (1998) Nucleic Acids Research 26:3577-3583). These are high copy number plasmids with a variety of selectable markers, which can be combined freely in any yeast strain containing chromosomal gene mutations compatible with the specific genetic markers to be used (URA3, LEU2, ADE2, TRP1). The approach can be directly applied to other Group 2 pathways by appropriate exchange of the selected genes. For example, citramalate CoA transferase could be omitted, citramalate lyase could be exchanged for citramalate synthase (CimA, Uniprot Q58787, Table 14) and the FumD option to citraconase (GenBank under accession no. DQ394580, Table 16) or LeuCD (Uniprot P81291/Q58673). Dihydroorotate dehydrogenase may be exchanged for YqjM (Uniprot P54550, Table 19) etc, as appropriate. Table 23. illustrates a suitable combination of heterologous gene products and pBEVY vectors. Where required, the activity of enzymes in the 2-methyl succinate pathways containing FeS clusters can be optionally enhanced by introducing additional factors in the expression vectors which support FeS maturation or stability. One example would be overexpression of yeast NFS1 (Shi S I et al. (2016) Scientific Reports 6: 25675).

Table 23. [Expression constructs required for establishing 2-methyl succinate synthesis in S. cerevisiae via mesaconate.

The vector/ recombinant gene combination described in Table 23 can be achieved by amplification of the gene products from genomic DNA of the source organism with concurrent addition of restriction enzyme sites, and subsequent use of these sites for restriction enzyme- based cloning of the genes into the target vector. Alternatively, suitable terminal sequences can be introduced via the PGR primers to enable cloning by Gibson assembly (Gibson DG et al. (2009) Nature Methods 6: 343-345). Alternatively to PGR based cloning, synthetic sequences can be designed that maximise expression yield of the enzymes by selecting the fastest decoded codon for each amino acid as described in Chu et al. (2014, EM BO Journal 33:21- 34), followed by removal of conspicuous repeat sequences and/ or of conspicuous secondary structure elements as appropriate. These sequences can be integrated in the target vector using restriction enzyme- or Gibson assembly-based cloning as described above for PGR products. Successful cloning using these strategies of the mesaconate dehydratases FumD and PrpD is described in Example 1. To reduce the number of gene products that are required to be expressed, subunits of multi-subunit enzymes such as the citramalate CoA lyase and citramalate CoA transferase complex can be combined into a single fusion protein. A suitable fusion protein sequence (Figure 7) can be designed by combining the sequence of the citramalyl CoA transferase, followed by a flexible linker of the sequence [GGGGS]₃, the sequence of the citramalyl CoA lyase, and a HA tag (YPYDVPDYA) to facilitate detection. The DNA sequence encoding this fusion protein can be designed by selecting the fastest decoded codon for each amino acid as described above, except for the region encoding the linker sequence where slower codons can be introduced to facilitate separate independent folding of the linked proteins (Zhang G et al. Nature Structural and Molecular Biology, 16: 274-280). Repeat sequences and secondary structure elements can be removed by targeted codon changes in the sequence. The synthetic construct can be introduced in the expression vector using the methods described above.

The different vectors resulting from the procedures described above can be introduced into any yeast strain matching the genetic marker requirements of the vectors. For the vectors described above, S. cerevisiae BY4741 (Brachman CB et al. (1998) Yeast 4: 115) with an additional ade2 deletion is a suitable illustrative example. More vigorous strains from different backgrounds can also be selected, and if necessary engineered to fulfil the genetic requirements.

To increase the efficiency of mesaconate reduction the introduction of the heterologous pathway components can optionally be coupled to upregulation of native Ural This can be achieved by placing the URA1 gene under control of a constitutively active heterologous promoter from a closely related yeast species. The PGK1 promoter from Saccharomyces paradoxus can be amplified by PGR, using primers that amplify the 800 bp upstream of the S. paradoxus PGK1 gene while also introducing 40-45 nt flanking sequences from the S. cerevisiae URA 1 promoter and, optionally, peptide tags for detection of the gene product. The PGR product can be integrated through homologous recombination into the genomic DNA of S. cerevisiae, and this can be stimulated via a Cas9/guide RNA construct targeting the sequence GGGGAATACACTATTTAGGGTGG.

Claims

1. A recombinant microorganism engineered to express gene(s) encoding an enzyme having an activity selected from the list consisting of Activity P and Q (e.g. citramalate (pyruvate) lyase), Activity P (e.g. citramalate synthase), Activity R (e.g. citramalyl CoA lyase), Activity S (e.g. CoA transferase), Activity U (e.g. citraconase), Activity T (e.g. mesaconase), Activity U or T (e.g. citramalate dehydratase), Activity W (e.g. citraconate reductase), Activity V (e.g. mesaconate reductase) or a combination thereof.

2. The recombinant microorganism of claim 1 engineered to express either:

(i) genes encoding enzymes having activity P and Q and/or genes encoding enzymes having activity P, activity T or activity U or T, and activity V;

(ii) genes encoding enzymes having activity P and Q and/or genes encoding enzymes having activity P, activity T or activity U or T, and activity W;

iii) genes encoding enzymes having activity P and Q, activity T or activity U or T, and activity V;

iv) genes encoding enzymes having activity P and Q, activity U or activity U or T, and activity W;

v) genes encoding enzymes having activity R, activity S, activity T or activity

U or T, and activity V;

vi) genes encoding enzymes having activity R, activity S, activity U or activity U or T, and activity W;

vii) genes encoding enzymes having activity P and Q and/or activity P, and activity U or T;

viii) genes encoding enzymes having activity P and Q and activity U or T; or ix) genes encoding enzymes having activity R, activity S and activity U or T or

x) genes having activity P and Q or

xi) genes having activity R and S.

3. The recombinant microorganism of claim 2, engineered to express any of (i) to (vi) together with one or more genes encoding one or more enzymes having activity L (CoA tranferase) or activity M (CoA ligase/synthetase) or activity G and H, or activity G, H, J and I.

4. The recombinant microorganism of claim 2, engineered to express any of (i) to (vi) together with one or more genes encoding one or more enzymes having activity I and H or J.

5. The recombinant microorganism according to either claim 1 or 2, wherein

(i) the genes having activity P and Q is citramalate (pyruvate) lyase Table 11 ; and/or

(ii) the gene having activity P is selected from the list presented in table 14; and/or

(iii) the gene having activity R is selected from the list presented in table 12; and/or (iv) the gene having activity S is selected from the list presented in table 13; and/or

(v) the gene having activity V is selected from the list presented in table 19; and/or

(vi) the gene having activity T is selected from the list presented in table 18; and/or

(vii) the gene having activity U or T is selected from the list presented in table 15; and/or

(vii) the gene having activity W is selected from the list presented in table 19; and/or

(viii) the gene having activity U is selected from the list presented in table 16.

6. The recombinant microorganism according to any of claims 1 to 5, wherein the microorganism is engineered to express one or more enzymes having activity V, said enzyme(s) selected from the group consisting of those classified in EC 1.3.5.4; EC 1.6.99.1 ; EC 1.3.1.6; EC 1.3.1.31 , EC 1.3.98.1 ; EC 1.3.1.14; EC 1.3.1.15, EC 1.3.5.2, or those shown in Table 19.

7. The recombinant microorganism according to any of claims 1 to 5, wherein the microorganism is engineered to express one or more enzymes having activity W, said enzyme(s) selected from the group consisting of those classified in EC 1.3.5.4; EC 1.6.99.1 ; EC 1.3.1.6; EC 1.3.1.31 , EC 1.3.98.1 ; EC 1.3.1.14; EC 1.3.1.15, EC 1.3.5.2, or those shown in Table 19.

8. The recombinant microorganism according to any of claims 1 - 7, wherein the gene or genes are expressed from a trans genetic element.

9. The recombinant microorganism according to any of claims 1 - 8, wherein the gene or genes are expressed from a cis genetic element.

10. The recombinant microorganism according to any of claims 1 - 9, wherein the gene having activity U or T is 2-methyl citrate dehydratase.

11. The recombinant microorganism according to any of claims 1 - 10, wherein S- citramalate pyruvate lyase or components thereof α, β or γ subunit is derived from Clostridium tetanomorphum or Clostridium tetani.

12. The recombinant microorganism according to any of claims 1 - 11 that is engineered to express a gene that has pyruvate ferredoxin oxidoreductase activity.

13. The recombinant microorganism according to any of claims 1 - 11 that is engineered to have increased expression of endogenous pyruvate ferredoxin oxido reductase.

14. The recombinant microorganism according to any of claims 1 - 13, wherein the host microorganism is selected from the list consisting of Acetobacterium, Aerobacter, Agrobacterium, Alcaligenes, Azotobacter, Bacillus, Geobacillis, Clostridium, Moorella, Corynebacterium, Flavobacterium, Lactobacillus, Micromonospora, Mycobacterium, Nocardia, Propionibacterium, Protaminobater, Proteus, Pseudomonas, Phizobium, Salmonella, Serratia, Streptomyces, Streptococcus, Sporomusa Xanthomonas, Escherichia, Saccharomyces, Schizosaccharomyces, Kluyveromyces, Candida, Pichia, Dekkera, Hansenula, Torulopsis, Yarrowia and Eubacterium.

15. The recombinant microorganism according to any of claims 1 - 14, wherein the host microorganism is selected from the list consisting of Eubacterium limosum, Acetobacterium woodii, Butyribacterium methylotrophicum, Clostridium carboxydivorans, Clostridium drakei, Clostridium scatologenes, Clostridium ljungdahlii, Clostridium autoethanogenum, Oxobacter pfenngii, Escherichia coli, Sporomusa ovata, Sporomusa acidovorans, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Candida sonorensis, Pichia stipidis, Pichia pastoris, Dekkera bruxellensis, Hansenula polymorpha, Candida boidini and Yarrowia lipolytica

16. The recombinant microoganism according to any of claims 1 - 15, wherein the host microorganism is an acetogen.

17. The recombinant microorganism according to any of claims 1 - 15, wherein the host microorganism is Saccharomyces cerevisiae.

18. The recombinant microorganism according to any of claims 1 - 15, wherein the host microorganism is Escherichia coli.

19. A recombinanant microorganism, genetically modified to synthesise citramalate and/or one or more of its downstream derivatives mesaconate, citraconate, 2- methylsuccinate, methyl-4-hydroxybutyrate and 2-methyl-1-4-butanediol, wherein the genetic modification permits utilisation of exogenous or endogenous acetate to convert endogenous pyrurate to citramalate.

20. Use of the engineered microorganism according to any of claims 1 to 18 for the production of a C₅ carbon compound.

21. The use according to claim 20, wherein the C₅ carbon compound is selected from the list consisting of citramalate, mesaconate, citraconate, 2-methyl succinate, methyl-4-hydroxybutyrate, methyl gamma butyrolactone, 2-methyl-1 ,4-butanediol and a combination thereof.

22. A process for the formation of a non-natural C₅ carbon compound, comprising the steps of: (i) combining the microorganism according to any of claims 1 to 14 with a liquid feedstock to form a broth

(ii) culturing said broth for a sufficient time to form the non-natural C₅ carbon molecule,

23. A process according to claim 22, wherein the microorganism is a yeast the culturing is at a pH in the range of about pH 1 to pH 5.5, or wherein the microorganism is a bacterium the culturing is at a pH in the range of about pH 3 to pH 9, preferably about pH 4 to about pH 8, more preferably about pH 5 to about pH 8.

24. A process according to either claim 22 or claim 23, wherein the culturing is at a temperature in the range of about 20°C to about 75°C, preferably in the range of about 20°C to about 65°C, more preferably in the range of about 20°C to about 45°C.

25. A process according to any of claims 22 to 24, wherein the sufficient time is in the range of about 24 to 96 h, or wherein the broth is cultured continuously.

26. The process according to any of claims 22 to 25, wherein the feedstock is derived partially or entirely from a renewable source.

27. The process according to claim any of claims 22 to 26, further comprising the step of isolating the C₅ carbon compound.

28. The process according to claim any of claims 22 to 27, wherein the C₅ carbon molecule is selected from the list consisting of citramalate, mesaconate, citraconate, 2-methyl succinate, methyl-4-hydroxy butyrate, methyl gamma butyrolactone, 2- methyl-1 ,4-butanediol and a combination thereof.

29. A recombinant microorganism engineered to express a gene encoding an enzyme having an activity selected from the list consisting of Activity D (e.g. crotonyl CoA carboxylase/reductase), Activty E (e.g. ethylmalonyl CoA epimerase), Activity F (e.g. ethylmalonyl CoA mutase), Activity G (e.g. methyl succinate semialdehyde dehydrogenase (acylating)), Activity H (e.g. methyl succinate semialdehyde reductase), Activity I (e.g. Aldehyde dehydrogenase/carboxylic acid reductase), Activity J (e.g. 2-methyl- 1 ,4-butanediol dehydrogenase), Activity K (e.g. methyl succinate semialdehyde dehydrogenase), Activity L (e.g. 2-methyl succinyl CoA:acetate CoA transferase), Activity M (e.g. methyl succinate CoA ligase), Activity N (e.g. methyl succinyl coenzyme A hydrolase), Activity I and Activity H, and a combination of genes thereof, wherein the microorganism does not contain an endogenous ethylmalonyl CoA pathway or

wherein the recombinant microorganism is modified to lack a functional enzyme selected from the list consisting of 2-methyl succinyl CoA dehydrogenase or butyryl CoA dehydrogenase and a combination thereof

30. The recombinant microorganism of claim 29 engineered to express either:

(i) genes having activity G, H, I and/or J;

(ii) a gene having activity L, and optionally genes having activity I, H, and/or J;

(iii) genes having activity M or N, and optionally genes having activity I, H, and/or J; or

(iv) genes having activity G and K, and optionally genes having activity I, J, and/or H;

optionally wherein the microorganism is further engineered to express genes having activity D and/or E and/or F.

31. The recombinant microorganism according to claim 30 engineered to express:

(i) a gene having activity D;

(ii) a gene having activity F; or

(ii) a gene having activity D and a gene having activity E and a gene having activity F.

32. The recombinant microorganism according to any of claims 29 to 31 , wherein (i) the gene having activity D is selected from the list presented in table 4 and/or

(ii) the gene having activity F is selected from the list presented in table 6 and/or

(iii) the gene having activity G is selected from the list presented in table 10 and/or

(iv) the gene having activity H is selected from the list presented in table 20 and/or

(v) the gene having activity I is selected from the list presented in table 21 and/or

(vi) the gene having activity J is selected from the list presented in table 22 and/or

(vii) the gene having activity K is selected from the list consisting of EC 1.2.1.16; EC1.2.1.24 and EC 1.2.1.79; and/or

(viii) the gene having activity L is selected from the list presented in table 9 and/or

(ix) the gene having activity M is selected from the list presented in table 7 and/or

(x) the gene having activity N is selected from the list presented in table 8 and/or

(xi) the genes having activity H and Activity I are selected from the list presented in table 20 and 21 ; and/or (xii) the genes having activity E are selected from the list presented in table 5.

33. The recombinant microorganism according to any of claims 29 to 32, wherein the gene or genes are expressed from a trans genetic element.

34. The recombinant microorganism according to any of claims 29 to 33, wherein the gene or genes are expressed from a cis genetic element.

35. The recombinant microorganism according to any of claims 29 to 34, wherein the microorganism is either engineered to synthesize vitamin Bi₂ or contains an endogenous vitamin Bi₂ synthetic pathway.

36. The recombinant microorganism according to any of claims 29 to 35, wherein the host microorganism is selected from the list consisting of Acetobacterium,

Oxobacter, Sporomusa, Butyribacterium, Aerobacter, Agrobacterium, Alcaligenes, Azotobacter, Bacillus, Geobacillis, Clostridium, Moorella, Corynebacterium, Flavobacterium, Lactobacillus, Micromonospora, Mycobacterium, Nocardia, Propionibacterium, Protaminobacter, Proteus, Pseudomonas, Phizobium, Salmonella, Serratia, Streptomyces, Streptococcus, Xanthomonas, Escherichia and Eubacterium.

37. The recombinant microorganism according to any of claims 29 to 36, wherein the host microorganism is selected from the list consisting of Eubacterium limosum, Butyribacterium methylotrophicum, Clostridium carboxydivorans, Clostridium drakei, Clostridium scatologenes, Oxobacter pfenngii.

38. The recombinant microorganism according to any of claims 29 to 37, wherein the host microorganism is Eubacterium limosum.

39. Use of the engineered microorganism according to any of claims 29 to 38 for the production of a C₅ carbon compound.

40. The use according to claim 39, wherein the C₅ carbon compound is selected from the list consisting of methylsuccinate semialdehyde, 2-methyl succinate, methyl-4-hydroxybutyrate, methyl gamma butyrolactone, methyl-4-hydroxybutanal, 2-methyl-1 ,4-butanediol and a combination thereof.

41. A process for the formation of a non-natural C₅ carbon compound, comprising the steps of:

(i) combining the microorganism according to any of claims 29 to 38 with a liquid feedstock to form a broth,

42. A process according to claim 41 , wherein the culturing is at a pH in the range of about pH 3 to pH 9.

43. A process according to claim 42, wherein the culturing is at a pH in the range of about pH 4 to about pH 8.

44. A process according to claim 43, wherein the culturing is at a pH in the range of about pH 5 to about pH 8.

45. A process according to any of claims 41 to 44, wherein the culturing is at a temperature in the range of about 20°C to about 75°C.

46. A process according to any of claims 41 to 45, wherein the culturing is at a temperature in the range of about 20°C to about 65°C.

47. A process according to any of claims 41 to 46, wherein the culturing is at a temperature in the range of about 20°C to about 45°C.

48. A process according to any of claims 41 to 47, wherein the sufficient time is in the range of about 24 h to about 96 h, or wherein the broth is cultured continuously.

49. The process according to any of claims 41 to 48, wherein the feedstock is derived partially or entirely from a renewable source.

50. The process according to claim any of claims 41 to 49, further comprising the step of isolating the C₅ carbon compound.

51. The process according to claim any of claims 41 to 50, wherein the C₅ carbon molecule is selected from the list consisting of methylsuccinate semialdehyde, 2- methyl-succinate, methyl-4-hydroxybutyrate, methyl gamma butyrolactone, methyl- 4-hydroxybutanal, 2-methyl-1 ,4-butanediol and a combination thereof.

52. The process according to any of claims 41 to 51 , wherein the vitamin Bi₂ or precursor thereof is either produced endogenously within the microorganism, is produced within the microorganism engineered to produce vitamin Bi₂ or is added to the broth.

53. The process according to any of claims 22 to 28 or claims 41 to 52, wherein the process is performed continuously.

54. Use of 2 methyl succinate, 2-methyl succinate anhydride, or esters thereof obtained by a process of any of claims 22 to 28 or claims 41 to 52 in the

manufacture of methacrylic acid or methylmethacrylate.