WO2018195603A1 - Bacterial inoculants - Google Patents
Bacterial inoculants Download PDFInfo
- Publication number
- WO2018195603A1 WO2018195603A1 PCT/AU2018/050387 AU2018050387W WO2018195603A1 WO 2018195603 A1 WO2018195603 A1 WO 2018195603A1 AU 2018050387 W AU2018050387 W AU 2018050387W WO 2018195603 A1 WO2018195603 A1 WO 2018195603A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- microorganism
- inoculant
- bacterial inoculant
- bacterial
- canola plant
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
- A01N63/25—Paenibacillus
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/20—Bacteria; Substances produced thereby or obtained therefrom
- A01N63/28—Streptomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/465—Streptomyces
Definitions
- the present invention relates to bacterial inoculants, and methods for their use, to control a fungal root disease in a plant and promote plant growth in water limited conditions.
- Root diseases are a major constraint in cropping systems worldwide. Root diseases are difficult to control with fungicides as they are below ground and
- Rhizoctonia and Pythium Two major genera of fungal root rot pathogens are Rhizoctonia and Pythium which infect multiple crop types in broad acre and horticulture crops. These pathogens infect roots of plants, reducing germination and establishment of emerging seedlings and causing loss of root hairs and breakdown of roots in established plants and thereby reducing the plants access to water and nutrients resulting in reduced growth and yield.
- pathogens In broad acre cereal cropping systems these pathogens are ubiquitous and the increase in minimal or no -till tillage practices has increased the impact of these diseases.
- Their broad host range means there are few non-host crops to use in rotations to reduce pathogen inoculum and there are no resistant cereal cultivars available.
- Rhizoctonia root rot caused by Rhizoctonia solani anastomosis group AG8 is the main fungal root disease, especially in low rainfall zones, causing an estimated yield loss of Aus $77 mil per annum in
- R. oryzae is also an important root pathogen in cereals. Pythium damping off and root rot is caused by a number of Pythium species, with P. irregulare and P. ultimum being the main species infecting cereals with the prevalence and severity of disease increasing in higher rainfall zones causing an estimated yield loss of Aus $1 1 mil per annum in Australia.
- Rhizoctonia and Pythium diseases on crop plants are known to be influenced by soil and plant associated microbes, with numerous reports of bacteria and fungi able to reduce disease under controlled conditions in pots.
- further improved microbial inoculants to control fungal root diseases in valuable crops, such as wheat or canola are desirable.
- FIG. 1 depicts a phylogenetic tree visualizing the phylogenetic relationship between strain 9.4E (P9), strain 10.6D (P1 0), and other Paenibacillus strains.
- FIG. 2 depicts a phylogenetic tree visualizing the phylogenetic relationship between strain HCA1273 (S12), and other Streptomyces strains.
- FIG. 3 depicts a phylogenetic tree visualizing the phylogenetic relationship between strain BD141 (S14), and other Streptomyces strains.
- sequence identifier number SEQ ID NO:
- the present invention provides a bacterial inoculant for controlling a fungal root disease on a plant.
- a "bacterial inoculant” as referred to herein should be understood as any isolated microorganism which may be inoculated onto a plant in order to control a fungal root disease.
- an "isolated" bacterial microorganism should be understood to be any bacterial microorganism which has been removed from its native environment and grown or cultured in vitro.
- an isolated bacterial microorganism may be substantially purified and thus grown or cultured substantially in the absence of other microorganisms.
- the isolated bacterial microorganism may be substantially purified and thus grown or cultured substantially in the absence of other microorganisms.
- microorganism may be co-cultured with one or more additional microorganisms.
- terms such as “inoculating”, “inoculated”, “inoculation” and the like should be understood to include any method or process wherein a plant (including without limitation a plant seed, leaf, root) is brought into contact with a bacterial inoculant by human ingenuity such that the bacterial inoculant exists on or in the plant in a manner not found in nature prior to the application of the bacterial inoculant.
- inoculation may comprise the bacterial inoculant being applied to a wheat seed or canola plant seed.
- inoculation may comprise the bacterial inoculant being applied to soil in which a wheat or canola plant is growing or in which a wheat or canola seed will be planted.
- inoculation may comprise the bacterial inoculant being applied to root and/or shoot tissue of a wheat or canola plant.
- inoculation may be the mechanical or manual application, artificial inoculation or disposition of a bacterial inoculant onto or into a plant or plant growth medium.
- a plant growth medium is any composition or environment in which a plant may be grown. In some embodiments, the plant growth medium is soil.
- the bacterial inoculants contemplated by the present invention are from a specific genus or species, comprise a defining 16S rRNA gene nucleotide sequence, and/or comprise a defined bacterial strain.
- the present invention contemplates control of a fungal disease of a plant.
- the fungal disease is a root disease of a monocot or dicot plant.
- the monocot is a cereal plant.
- the cereal plant is member of the plant family Poaceae or Gramineae, for example: wheat, rice, corn, barley, millet, sorghum, oat, rye, or related grain producing plant.
- the dicot is a member of the plant family Fabaceae or Leguminosae, for example: soybeans, peas, beans, lentils, peanuts, alfalfa, clover, or related plants.
- the dicot is a member of the plant family Brassicaceae or Cruciferae, for example: canola, rapeseed, cabbage, cauliflower, kale, radish, mustard, turnip, or related plants.
- a "wheat plant”, as referred to herein, should be understood to include plants of the genus Triticum.
- the term “wheat” should be understood to include one or more of diploid wheat, tetraploid wheat and/or hexaploid wheat.
- the wheat plant may be a cultivated species of wheat including, for example, Triticum aestivum, Triticum durum, Triticum
- the term "wheat” refers to wheat of the species Triticum aestivum.
- a "canola plant”, as referred to herein, should be understood to include plants of the genus Brassica, particularly B. napus, B. rapa, B. campestris, B. oleracea, B. montana, and hybrids thereof.
- the term "canola” should be understood to include one or more of rape, rapeseed, oilseed rape, Argentine canola, and colza.
- the canola plant may be a cultivated species of canola.
- the canola plant may be a species canola of including, for example, B. napus subsp. oleifera, B. napus subsp. napus, B.
- canola refers to canola of the species Brassica napus L and subspecies thereof.
- the present invention contemplates bacterial inoculants for the control of a fungal disease in a plant.
- the fungal disease is a root disease of a monocot or dicot plant.
- the present invention contemplates bacterial inoculants for the control of a fungal root disease in a wheat plant or a canola plant.
- control of a fungal root disease in a plant may be understood as enhancement of one or more growth parameters in an inoculated plant relative to an uninoculated plant of the same taxon in the presence of the fungal root disease.
- the plant is a wheat plant or a canola plant.
- enhancement of a growth parameter will include an increase in the measured value of the growth parameter. For example, an increase in one or more of:
- a length and/or mass of a shoot a length and/or mass of a root; a number and/or mass of seed;
- an "increase" in a growth parameter may include, for example, a 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2- -fold, 5—fold, 10-fold, 20-fold, 50 ⁇ fold, 100-fold increase in the growth parameter in an inoculated plant relative to a plant of the same taxon that has not been inoculated.
- the plant is grown in the presence of a fungal root disease.
- the plant is grown in water limited conditions.
- the plant is a wheat plant or a canola plant.
- "enhancement" of the growth parameter may include a decrease in the measured value of the growth parameter.
- a decrease in the concentration and/or amount of a pathogen, disease symptom and/or toxin in the plant, and/or a decrease in the time of germination of a wheat or canola plant seed may be considered “enhancement" of such growth parameters.
- a "decrease" in a growth parameter may include, for example, a 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% decrease in the growth parameter in an inoculated plant relative to a plant of the same taxon that has not been inoculated.
- the plant is grown in the presence of a fungal root disease.
- the plant is grown in water limited conditions.
- the plant is a wheat plant or a canola plant.
- enhancement of a growth parameter may comprise enhancement within a particular time period.
- enhancement of the growth parameter may comprise enhancement over a time period of at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 70, 80, 90 or 100 days.
- the present invention contemplates a bacterial inoculant for controlling a fungal root disease on a wheat or canola plant.
- a "fungal root disease” as referred to herein should be understood as any disease of a plant which infects or damages the roots of the plant and which is caused by a fungus or fungal-like pathogen.
- a "fungal-like” pathogen should be understood to specifically include Oomycete pathogens such as pathogens of the genus Pythium.
- the fungal root disease is a disease of a wheat or canola plant.
- the fungal root disease is caused by a pathogen of the genus Rhizoctonia.
- the pathogen is of the species
- Rhizoctonia solani In some embodiments, the pathogen is Rhizoctonia solani AG8. In some embodiments, the pathogen is of the species Rhizoctonia oryzae.
- the bacterial inoculant of the first aspect of the invention includes a microorganism of the genus Paenibacillus that is able to at least control a fungal root disease caused by a pathogen of the genus Rhizoctonia.
- the microorganism of the genus Paenibacillus is able to at least control a pathogen of the genus Rhizoctonia on or in a wheat or canola plant.
- bacterial inoculant of the genus Paenibacillus includes a microorganism having a 16S rRNA gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 3.
- the microorganism comprises a 16S rRNA gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 1 00% sequence identity to SEQ ID NO: 3.
- bacterial inoculant of the genus Paenibacillus includes a microorganism having an atpD gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 7.
- the microorganism comprises an atpD gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 7.
- bacterial inoculant of the genus Paenibacillus includes a microorganism having a recA gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 8.
- the microorganism comprises a recA gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 8.
- bacterial inoculant of the genus Paenibacillus includes a microorganism having a trpB gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 9.
- the microorganism comprises a trpB gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 9.
- bacterial inoculant of the genus Paenibacillus includes a microorganism having a gyrB gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 10.
- the microorganism comprises a gyrB gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 10.
- bacterial inoculant of the genus Paenibacillus includes a microorganism having a recA gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 1 1 .
- the microorganism comprises a recA gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 1 1 .
- bacterial inoculant of the genus Paenibacillus includes a microorganism having an atpD gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 12.
- the microorganism comprises an atpD gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 12.
- bacterial inoculant of the genus Paenibacillus includes a microorganism having a trpB gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 13.
- the microorganism comprises a trpB gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 13.
- bacterial inoculant of the genus Paenibacillus includes a microorganism having a GyrB gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 14.
- the microorganism comprises a gyrB gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 14.
- the compared nucleic acid sequences should be compared over a comparison window of, for example, at least 100 nucleotide residues, at least 300 nucleotide residues, at least 600 nucleotide residues, at least 1000 nucleotide residues, at least 1 100 nucleotide residues, at least 1200 nucleotide residues, at least 1300 nucleotide residues or at least 1400 nucleotide residues.
- the comparison window may comprise the region in each of the compared nucleotide sequences between and including the binding sites of the 27f primer (SEQ ID NO: 1 ) and the 1465r primer (SEQ ID NO: 2) on the compared nucleotide sequences.
- the comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms such as the BLAST family of programs as, for example, disclosed by Altschul et al. (Nucl. Acids Res. 25: 3389--3402, 1997). A detailed discussion of sequence analysis can be found in Unit 1 9. 3 of Ausubel et al. (Current Protocols in Molecular Biology, John Wiley & Sons Inc., Chapter 15,1 998).
- the bacterial inoculant includes
- microorganism Paenibacillus sp. 1 0.6D as deposited on 9 March 2017 with the National Measurement Institute under NMI accession number V17/004922; or a mutant or derivative of said deposited microorganism that retains the ability to control a fungal root disease in a wheat or canola plant.
- the mutant or derivative retains the ability to control a fungal root disease in a wheat or canola plant, where the root disease is caused by a pathogen of the genus Rhizoctonia.
- a "mutant or derivative" of the subject deposited microorganisms referred to herein should be understood to encompass, for example, any spontaneous or induced mutant, conjugation progeny or genetically modified form of a deposited strains which retains the ability to enhance one or more growth parameters of a plant.
- a mutant or derivative retains the ability to enhance one or more growth parameters of a wheat or canola plant in the presence of the fungal root disease or under water limited conditions.
- Mutagenisation techniques that may be used to generate derivatives or mutants include, for example, chemical mutagenesis (e.g., EMS mutagenesis), ionising radiation-induced mutagenesis (e.g., X-ray mutagenesis, ⁇ -ray mutagenesis and UV mutagenesis), genetic insertion mutagenesis methods (e.g., transposon mutagenesis) and the like.
- the bacterial inoculant of the first aspect of the invention includes a microorganism of the genus Streptomyces that is able to at least control a fungal root disease caused by a pathogen of the genus Rhizoctonia.
- the microorganism of the genus Streptomyces is able to at least control a pathogen of the genus Rhizoctonia on or in a wheat or canola plant.
- bacterial inoculant of the genus Streptomyces includes a microorganism having a 16S rRNA gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 5.
- the microorganism comprises a 16S rRNA gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 5.
- the bacterial inoculant includes microorganism Streptomyces sp. HCA1273 as deposited on 9 March 2017 with the National Measurement Institute under NMI accession number V17/004924; or a mutant or derivative of said deposited microorganism that retains the ability to control a fungal root disease in a wheat or canola plant.
- the mutant or derivative retains the ability to control a fungal root disease in a wheat or canola plant, where the root disease is caused by a pathogen of the genus Rhizoctonia.
- the fungal root disease is caused by a pathogen of the genus Pythium.
- the pathogen is of the species Pythium irregulare.
- the pathogen is of the species Pythium ultimum.
- the bacterial inoculant of the first aspect of the invention includes a microorganism of the genus Paenibaciilus that is able to at least control a fungal root disease caused by a pathogen of the genus Pythium.
- the microorganism of the genus Paenibaciilus is able to at least control a pathogen of the genus Pythium in or on a wheat or canola plant.
- bacterial inoculant of the genus Paenibaciilus includes a microorganism having a 16S rRNA gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 4.
- the microorganism comprises a 16S rRNA gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 4.
- the bacterial inoculant includes microorganism Paenibacillus sp. 9.4E as deposited on 9 March 2017 with the National Measurement Institute under NMI accession number V17/004921 ; or a mutant or derivative of said deposited microorganism that retains the ability to control a fungal root disease in a wheat or canola plant.
- the mutant or derivative retains the ability to control a fungal root disease in a wheat or canola plant, where the root disease is caused by a pathogen of the genus Pythium.
- the bacterial inoculant of the first aspect of the invention includes a microorganism of the genus Streptomyces that is able to at least control a fungal root disease caused by a pathogen of the genus Pythium on a wheat or canola plant.
- the microorganism of the genus Streptomyces is able to at least control a pathogen of the genus Pythium on a wheat or canola plant.
- bacterial inoculant of the genus Streptomyces includes a microorganism having a 16S rRNA gene nucleotide sequence which is at least 98% identical to SEQ ID NO: 6.
- the microorganism comprises a 16S rRNA gene nucleotide sequence which is at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to SEQ ID NO: 6.
- bacterial inoculants and methods disclosed herein include a microorganism having a gene, e.g., a 1 6S rRNA gene, having a nucleotide sequence at least 97%, 98%, 99% or 100% identical to the same gene nucleotide sequence found in one of the genomic sequences found in Table 1 .
- the microorganism comprises a gene having a nucleotide sequence of at least 97%, at least 97.1 %, at least 97.2% at least 97.3%, at least 97.4%, at least 97.5%, at least 97.6%, at least 97.7%, at least 97.8%, at least 97.9%, at least 98%, at least 98.1 %, at least 98.2% at least 98.3%, at least 98.4%, at least 98.5%, at least 98.6%, at least 98.7%, at least 98.8%, at least 98.9%, at least 99%, at least 99.1 %, at least 99.2% at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% at least 99.9% or 100% sequence identity to the same gene nucleotide sequence found in one of the genomic sequences found in Table 1 .
- the bacterial inoculant includes microorganism Streptomyces sp. BD141 as deposited on 9 March 2017 with the National Measurement Institute under NMI accession number V17/004923; or a mutant or derivative of said deposited microorganism that retains the ability to control a fungal root disease in a wheat or canola plant.
- the mutant or derivative retains the ability to control a fungal root disease in a wheat or canola plant, where the root disease is caused by a pathogen of the genus Pythium.
- the present invention provides an inoculant composition comprising one or more bacterial inoculants as hereinbefore described.
- the inoculant composition further comprises a carrier or additive.
- the carrier or additives used will depend on the nature of the inoculant composition.
- the inoculant composition may be in the form of a liquid composition, a solid composition (such as a powder, pellet or granular composition) a seed dressing or the like.
- the inoculant composition comprises a seed dressing.
- a range of useful carriers or additives would be readily apparent to those of skill in the art and may include, for example: one or more gums (including xanthan gum), clay or peat based carriers, one or more nutrients including carbon or nitrogen sources, one or more antifungal or antibacterial agents, one or more seed coating agents, one or more wetting agents and the like.
- the inoculant compositions of the present invention may be adapted to be applied to a plant, for example a wheat or canola plant, in any suitable way.
- the inoculant composition could be adapted to be applied as a seed coating, applied as a solid or liquid composition to the foliage or roots of a plant, or applied as a solid or liquid composition to soil before, during or after sowing of a plant, for example a wheat or canola plant.
- the present invention provides a method for controlling a fungal root disease on a plant, the method comprising inoculating a plant with a bacterial inoculant or inoculant composition as hereinbefore described.
- the plant is a wheat plant or a canola plant.
- the root disease is caused by a pathogen of the genus
- the root disease is caused by a pathogen of the genus Pythium.
- the bacterial inoculant or inoculant composition are inoculated onto a seed. In some embodiments, the bacterial inoculant or inoculant composition are inoculated onto a wheat seed or canola seed.
- the present invention provides a method for improving growth of a plant under water limited conditions, the method comprising inoculating a plant with a bacterial inoculant or inoculant composition as hereinbefore described.
- the method provides for improving growth of a monocot or dicot plant under water limited conditions.
- the monocot is a cereal plant.
- the cereal plant is member of the plant family Poaceae or Gramineae, for example: wheat, rice, corn, barley, millet, sorghum, oat, rye, or related grain producing plant.
- the dicot is a member of the plant family Fabaceae or Leguminosae, for example: soybeans, peas, beans, lentils, peanuts, alfalfa, clover, or related plants.
- the dicot is a member of the plant family Brassicaceae or Cruciferae, for example: canola, rapeseed, cabbage, cauliflower, kale, radish, mustard, turnip, or related plants.
- Water limited conditions include but are not limited to, drought conditions and dryland (non-irrigated) environments.
- water limited conditions are growth conditions where the amount of water available to the plants is less than the amount necessary to support optimal plant growth.
- the water limited condition comprises less than 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, less than 100% of the amount necessary to support optimal plant growth.
- the amount of water necessary to support optimal plant growth is measured in average or above average yield.
- the water limited conditions are the amount of water that result in a reduction in average yield of un-inoculated plants by at least 5%, at least 10%, between 5-15%, about 15%, at least 20%, about 20%, between 20-25%, or at least 25%.
- the water limited conditions are a non-irrigated field.
- the water limited condition comprises a 1 %, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% reduction in rainfall relative to the 1 year, 2, 3, 4, 5 year, 6, 7, 8, 9, 10 year historical average rainfall for the geography.
- the water limited conditions are controlled by human endeavor in greenhouse or laboratory assays.
- a non-limiting example of a laboratory assay conducted in water limited conditions is growth of a plant in an aqueous solution comprising polyethylene glycol (PEG), for example 7.5% PEG 6000.
- PEG polyethylene glycol
- the present invention provides a bacterial inoculant as described herein with respect to any of the examples.
- the present invention provides an inoculant composition as described herein with respect to any of the examples.
- the present invention provides a method for controlling a fungal root disease on a wheat or canola plant as described herein with respect to any of the examples.
- the present invention provides a method for a method for improving growth of a wheat or canola plant under water limited as described herein with respect to any of the examples.
- a number of microbial strains were screened in a series of in planta bioassays, characterised and assessed in field trials using naturally occurring pathogen inoculum. Four strains were identified as being of interest, as shown in Table 1 .
- DNA of each strain was extracted. Two sections of 1 6S rRNA were amplified by PCR using primers 27f (agagtttgat cctggctcag, SEQ ID NO: 1 ) and 1492r (tacggytacc ttgttacgac tt, SEQ ID NO: 2). PCR products were sequenced by Sanger sequencing, two replicate extractions and forward and reverse directions of PCR fragments were sequenced. Sequences were identified using Ezbiocloud
- a A ACTC A A AG GAATTGACG G G GG CCCG C AC A AG CGGCGGAGCATGTGG CTTAAT
- GyrB AAGTTGGCGTTGTTGTCCTTAATCAAGCCATTTTTACGTGCATAATCGTTAATAATC CGGGTTAATGCACTCTTGAAACCTGATTCGTGAGTTCCGCCCTCATGGGTGTTGAT GTTGTTG G C AAA AG A ATAA ATATTCTCG GTATAGCTGTCGTT ATATTG C A ATG CCA CTTCGACTTGAATCATATCACGCGAGCCTTCGACATAAATCGGCTGTTCATGCAGC GCTTCTTTTTTGATTCAAAAATTGCACATATTCACTGATTCCGCCCTCGTAGTGA AATGTATCGCTGGCGCCCGTCCGTTCATCAGTCAAGCTGATTGCAATACCTTTGTT CAGGAAAGCCAACTCACGAATCCGTGTCTGGAGCGTATCATAGTCATATACGGTC GTTTCTGTAAAGATTTGATCGTCAGGATAAAAAGTCGTTTGGGTACCCGTCTCGTC TGTGTCACCGATGACTCTGACATCATACTGCGGAGCACCACGATGATATTCCTGCT
- Phylogenetic trees were generated as described above, using 16S, atpD, gyrB, recA, and trpB genes.
- FIG. 1 depicts a phylogenetic tree visualizing the phylogenetic relationship between strain 9.4E, strain 1 0.6D, and other Paenibacillus strains.
- FIG. 2 depicts a phylogenetic tree visualizing the phylogenetic relationship between strain HCA1 273, and other Streptomyces strains.
- FIG. 3 depicts a phylogenetic tree visualizing the phylogenetic relationship between strain BD141 , and other Streptomyces strains.
- Bioassays were conducted in a controlled envi9ronment room at 15°C, 12 hr day/night cycle. Wheat cv. Yitpi was used for all assays. For each assay there were three control treatments, (1 ) no-pathogen control (2) pathogen only control and (3) positive control of current best biocontrol strain, either Tnchoderma strain TB or Streptomyces strain EN1 6. Bioassays were conducted in soils collected from fields with continuing Rhizoctonia problems. Soils were from Netherton SA (grey siliceous sand) or Waikerie SA (Red calcareous sand).
- This assay consisted of 50 ml tube with 60 g Netherton soil at 8% moisture content with two Rhizoctonia solani infested millet seeds added and incubated 2 weeks at 15 2 C. Two pregerminated wheat seeds were planted and microbial inoculum added as suspension (150 ul) directly onto the seeds and incubated for 2 wks. Plants were assessed by shoot height and number of roots reaching the bottom of the tube. Two replicates were used per treatment. Results are shown in Table 4.
- strains were assessed in a pot bioassay containing 300 g Waikerie soil at 8% moisture. Six Rhizoctonia solani infested millet seeds were added to the soil and incubated 2 weeks at 15°C.
- microbes were harvested from agar plates, diluted to absorbance of 0.5 at 550nm in 3 ml dilute sticker solution (0.005% Na Alginate, 0.03% xantham gum) and 1 .5 g wheat seed added and soaked for 1 hr. The microbial suspension was drained and 7 seeds planted and later thinned to 5 after germination. Inoculum concentration was determined by dilution plate counts. Plants were grown for 4 wks.
- Root Disease Score %RI
- RDS Root Disease Score
- the length of seminal and nodal roots were measured and dry weights of roots and shoots obtained after drying at 60°C for 4 days. There were 4 replicates in a randomised complete block design. Data was analysed as ANOVA, RCBD. Results are shown in Tables 5 and 6.
- a tertiary assay was conducted on selected strains based on results of the secondary assay.
- the tertiary pot bioassay was conducted the same as for the secondary Rhizoctonia pot assay except that microbes were inoculated at 3 rates to indicate the most appropriate inoculation level.
- Seed cfu levels were measured on seeds at the highest inoculation rate by extracting cells from 5 seeds in 1 ml phosphate buffered saline (PBS) after shaking for 30 minutes, serially diluting the suspension and plating onto agar. Seed cfu levels at the lower rates were estimated from the highest rate. Results are shown in Tables 7 and 8.
- Rhizoctonia field trials Microplots
- Rhizoctonia field trials were carried out in fields used for commercial cereal production in South Australia with a continuing Rhizoctonia problem, with natural levels of Rhizoctonia solani AG8 DNA >100 pg/g soil (as measured by SARDI Root Disease Testing Service).
- Microplot trials were a split plot design, with each treated row paired with an untreated row in a randomised complete block design, 6 replicates.
- Rhizoctonia root rot is a patchy disease, so a split-plot design with paired treated and untreated rows was used to measure disease in the same disease space.
- Plants (10) were harvested at 8 wks and assessed for root disease score (0-5 scale) caused by Rhizoctonia on seminal and nodal roots and for dry weights of roots and shoots. Each strain was assessed at 2 sites.
- Chemical seed treatments Vibrance, Syngenta; EverGol Prime, Bayer
- Streptomyces strain EN16 were included for comparison. Results are shown in Tables 9 and 1 0.
- Rhizoctonia field trials 20m 3+3 row plots
- Grenade seeds were coated with microbes as a concentrated suspension in a sticker solution (0.3% xanthan gum, 0.05% Na alginate). Seeds were planted with a plot scale seeder and herbicide and fertilisers applied as per local best practice. Plants (21 ) from each split-plot were assessed at 8 wks (2013) or 1 1 wks (2014) and assessed for root disease score (0-5 scale) caused by Rhizoctonia on seminal and nodal roots and for dry weights of roots and shoots. Seeds were harvested at the end of season with a plot scale header. In 2014, Streptomyces strain EN16 and an in-furrow chemical treatment, Uniform (Syngenta) were included as controls. Results are shown in Table 1 1 .
- the primary Pythium tube assay was set up as for the Rhizoctonia tube assay with 60g washed sand at 1 1 % moisture with 3g/L Miracle Gro soluble fertiliser. Pythium irregulare strain 89 was added as one 1 1 mm agar plug, with no pre ⁇ incubation prior to seeding with two pre ⁇ germinated wheat cv. Yitpi seeds.
- microbes were harvested from agar plates, diluted to absorbance of 0.8 at 550nm in a dilute sticker solution (0.005% Na alginate, 0.03% xanthan gum) and 150 ul added directly to seeds. Plants were assessed by shoot height and number of roots reaching the bottom of the tube. Two replicates per treatment. Results are shown in Table 12.
- Washed sand 200 g/pot at 1 1 % moisture with 1 .5g/L Miracle Grow fertiliser was used. Pathogen was added as 3x8mm agar plugs of Pythium irregulare strain 89. Wheat cv. Yitpi seeds (2.2) were inoculated with a microbial suspension diluted to absorbance of 0.8 at 550nm in 3 ml dilute sticker solution (0.005% Na Alginate, 0.03% xanthan gum) and soaked for 1 hr prior to planting. Microbial suspension was drained and 7 seeds sown and thinned to 5 after 14 days. Plants were grown for 4 weeks and assessed for root disease on a 0-5 scale and for dry weight of shoots and roots. Results are shown in Tables 13 and 14.
- Seed coated microbes were assessed at two Pythium infested sited in 2015 and 2016 (Table 17). Plant establishment was increased in both years with microbial inoculation compared to controls, but this was only significantly different at the Conmurra sites. Significant yield responses of 4.6 to 6.3 % increase were evident in
- Table 17 Results from control of Pythium root rot on wheat field trials. Data is the mean plants/m at 3-4 wks, shoot dry weight (DW) mg per plant and seminal root disease score (DS, 0-5) at eight weeks and final grain yield, six replicates. Control treatment contains no fungicide or microbial inoculation. Microbes were applied as seed coatings. % increase in yield is relative to untreated Control.
- Microbial survival on seeds was assessed on 20 g seed lots (wheat cv. Yitpi) after inoculation and at 1 , 2 and 7 days.
- Concentrated microbial suspensions were made in a sticker solution (0.3% xanthan gum, 0.05% Na alginate) at various
- Rhizoctonia control was assessed for in vitro inhibition of four fungal pathogens, R. solani AG8 strain W1 9, Pythium irregulare strain 89 isolated from lucerne roots, Gaeumannomyces graminis var. tritici (Ggt) strain C3 isolated from wheat roots and Fusarium pseudograminearum strain B4a isolated from wheat crowns. Fungi were grown on PDA/4 for between 2 and 7 d depending on strain prior to use. Test fungal pathogens were added to the centre of 9 cm agar plates as 8 mm agar and test strains added as 2x 20 ⁇ spots (10 7 cfu/ml) on opposite sides of the plate 30 mm from the centre.
- Rhizoctonia solani AG8 Fusarium pseudograminearum, Pythium irregulare and Gaeumannomyces graminis tritici (Ggt) by strains isolated for Rhizoctonia control.
- Response of fungal pathogen to test strains are given as: - no sign of inhibition ; + hyphal avoidance but no clear zone of inhibition; ++ inhibition zone 1-2 mm; +++ inhibition zone >3mm.
- EXAMPLE 8 ENHANCED CANOLA GERMINATION AND GROWTH UNDER WATER LIMITED CONDITIONS.
- Seed coated microbes were assessed in field trials in a low rainfall zones in Parilla (Murray Mallee) in Australia.
- Paenibacillus 9.4E and Streptomyces BD141 had increased establishment growth (plants per meter), and significantly increased the number of secondary roots per plant (Table 21 ).
- Table 21 Results from field trials assessing microbial inoculants for increasing establishment, growth and yield of canola in the low rainfall zone. Data is the mean plants/m at 6 wks (Parilla), shoot dry weight (DW) g per plant and number of secondary roots at 13 wks and final grain yield, six replicates. Control treatment contains no fungicide or microbial inoculation. Microbes were applied as seed coatings.
- Paenibacillus 9.4E significantly increased grain yield at Turretfield in 201 6 by 1 1 .4%.
- Table 22 Results from control of Pythium root rot on canola field trials. Data presented is the mean plants/m at 3-4 wks, shoot dry weight (DW) mg per plant, root disease score (DS, 0-10), % of root system with root hairs at eight weeks and final grain yield, six replicates. Control treatment contains no fungicide or microbial inoculation. Microbes were applied as seed coatings. % increase in yield is relative to untreated Control.
- a microorganism includes a single microorganism as well as two or more microorganisms
- a wheat plant includes a single wheat plant as well as two or more wheat plants
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
Description
Claims
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP18791606.9A EP3629742A4 (en) | 2017-04-27 | 2018-04-27 | Bacterial inoculants |
BR112019022446-7A BR112019022446B1 (en) | 2017-04-27 | 2018-04-27 | COMPOSITIONS OF STREPTOMYCES BACTERIAL INOCULANTS AND METHOD FOR CONTROLLING FUNGAL ROOT DISEASE IN WHEAT OR CANOLA |
AU2018259162A AU2018259162A1 (en) | 2017-04-27 | 2018-04-27 | Bacterial inoculants |
CA3098455A CA3098455A1 (en) | 2017-04-27 | 2018-04-27 | Bacterial inoculants |
MX2019012842A MX2019012842A (en) | 2017-04-27 | 2018-04-27 | Bacterial inoculants. |
US16/608,421 US11882838B2 (en) | 2017-04-27 | 2018-04-27 | Bacterial inoculants |
AU2024216467A AU2024216467A1 (en) | 2017-04-27 | 2024-08-30 | Bacterial inoculants |
Applications Claiming Priority (4)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2017901523A AU2017901523A0 (en) | 2017-04-27 | Bacterial inoculants | |
AU2017901523 | 2017-04-27 | ||
US201762568763P | 2017-10-05 | 2017-10-05 | |
US62/568,763 | 2017-10-05 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2018195603A1 true WO2018195603A1 (en) | 2018-11-01 |
Family
ID=63917796
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/AU2018/050387 WO2018195603A1 (en) | 2017-04-27 | 2018-04-27 | Bacterial inoculants |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU2024216467A1 (en) |
WO (1) | WO2018195603A1 (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109456921A (en) * | 2018-11-30 | 2019-03-12 | 郝志敏 | A kind of Paenibacillus polymyxa, application and microbial bacterial agent, powders and granules |
WO2022023109A1 (en) | 2020-07-31 | 2022-02-03 | Basf Se | New agrochemical formulations for fusaricidin producing bacteria |
WO2022136003A1 (en) | 2020-12-23 | 2022-06-30 | Basf Se | Mixtures and compositions comprising fusaricidin a, fusaricidin b and fungicides |
WO2023020880A1 (en) | 2021-08-20 | 2023-02-23 | Basf Se | Paenibacillus strains producing low amounts of exopolysaccarides |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6602500B1 (en) * | 1998-05-20 | 2003-08-05 | The Governors Of The University Of Alberta | Paenibacillus polymyxa strain ATCC 202127 for biocontrol of bacteria and fungi |
WO2016200987A1 (en) * | 2015-06-08 | 2016-12-15 | Indigo Agriculture, Inc. | Streptomyces endophyte compositions and methods for improved agronomic traits in plants |
-
2018
- 2018-04-27 WO PCT/AU2018/050387 patent/WO2018195603A1/en active Search and Examination
-
2024
- 2024-08-30 AU AU2024216467A patent/AU2024216467A1/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6602500B1 (en) * | 1998-05-20 | 2003-08-05 | The Governors Of The University Of Alberta | Paenibacillus polymyxa strain ATCC 202127 for biocontrol of bacteria and fungi |
WO2016200987A1 (en) * | 2015-06-08 | 2016-12-15 | Indigo Agriculture, Inc. | Streptomyces endophyte compositions and methods for improved agronomic traits in plants |
Non-Patent Citations (10)
Title |
---|
AL-ASKAR AA: "Microbiological studies on the in vitro inhibitory effect of Streptomyces collinus albescens against some phytopathogenic fungi", AFRICAN JOURNAL OF MICROBIOLOGY RESEARCH, vol. 6, no. 13, April 2012 (2012-04-01), pages 3277 - 3283, XP055526853 * |
BARNETT S ET AL.: "Selection of microbes for control of Rhizoctonia root rot on wheat using a high throughput pathosystem", BIOLOGICAL CONTROL, vol. 113, October 2017 (2017-10-01), pages 45 - 57, XP085143628 * |
DATABASE Nucleotide [O] 20 May 2008 (2008-05-20), "Streptomyces collinus subsp. albescens gene for 16S rRNA, partial sequence, strain: NBRC 12547", XP055526830, Database accession no. AB184101 * |
DATABASE Nucleotide [O] 27 February 2017 (2017-02-27), "Streptomyces sp. strain LCG75 16S ribosomal RNA gene, partial sequence", XP055526833, Database accession no. KY643705 * |
DATABASE Nucleotide [O] 5 January 2014 (2014-01-05), "Streptomyces cyaneofuscatus strain X3X18 16S ribosomal RNA gene, partial sequence", XP055526837, Database accession no. KF951483 * |
DATABASE Nucleotide [O] 5 October 2009 (2009-10-05), "Streptomyces sp. 42.04 16S ribosomal RNA gene, partial sequence", XP055526823, retrieved from NCBI Database accession no. GQ475299 * |
DATABASE Nucleotide [O] 6 May 2015 (2015-05-06), "Streptomyces sp. FXJ1.135 16S ribosomal RNA gene, complete sequence", XP055526841, Database accession no. KJ152029 * |
DATABASE Nucleotide [O] 8 April 2014 (2014-04-08), "Streptomyces sp. DR-BS6 16S ribosomal RNA gene, partial sequence", XP055526845, Database accession no. KJ162248 * |
ORAKÇI GE ET AL.: "Selection of antagonistic actinomycete isolates as biocontrol agents against root-rot fungi", FRESENIUS ENVIRONMENTAL BULLETIN, vol. 19, no. 3, 2010, pages 417 - 424, XP055526813 * |
ZARRIN F., ET AL.: "Antifungal activity of plant growth-promoting rhizobacteria isolates against Rhizoctonia solani in wheat", AFRICAN JOURNAL OF BIOTECHNOLOGY, vol. 8, no. 19, 2009, pages 219 - 225, XP055526801 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109456921A (en) * | 2018-11-30 | 2019-03-12 | 郝志敏 | A kind of Paenibacillus polymyxa, application and microbial bacterial agent, powders and granules |
CN109456921B (en) * | 2018-11-30 | 2021-06-08 | 郝志敏 | Paenibacillus polymyxa, application thereof, microbial agent, powder and granules |
WO2022023109A1 (en) | 2020-07-31 | 2022-02-03 | Basf Se | New agrochemical formulations for fusaricidin producing bacteria |
WO2022136003A1 (en) | 2020-12-23 | 2022-06-30 | Basf Se | Mixtures and compositions comprising fusaricidin a, fusaricidin b and fungicides |
WO2023020880A1 (en) | 2021-08-20 | 2023-02-23 | Basf Se | Paenibacillus strains producing low amounts of exopolysaccarides |
Also Published As
Publication number | Publication date |
---|---|
AU2024216467A1 (en) | 2024-09-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Damodaran et al. | Identification of rhizosphere bacterial diversity with promising salt tolerance, PGP traits and their exploitation for seed germination enhancement in sodic soil | |
US7393678B2 (en) | Klebsiella pneumoniae inoculants for enhancing plant growth | |
WO2018195603A1 (en) | Bacterial inoculants | |
AU2002227228A1 (en) | Bacterial inoculants for enhancing plant growth | |
Amarger et al. | Rhizobium tropici nodulates field-grown Phaseolus vulgaris in France | |
KR100800566B1 (en) | Klebsiella oxytoca c1036 and plant growth promotion, diseases control and environmental stress reduction method using the same | |
US20220087265A1 (en) | Means and Methods for Improving Plant Growth and Yield | |
Hahn et al. | Rhizobial inoculation, alone or coinoculated with Azospirillum brasilense, promotes growth of wetland rice | |
WO2021112723A1 (en) | Strains for biological protection of agricultural crops against fusarium disease | |
CA3127910A1 (en) | Means and methods for improving plant growth and yield | |
US20160183533A1 (en) | Planting matrices comprising bacillus spp. microorganisms for benefiting plant growth | |
JP5074866B2 (en) | Methods to inhibit legume feeding by pests | |
US11882838B2 (en) | Bacterial inoculants | |
Liu | Characterisation of rhizobia and studies on N₂ fixation of common weed legumes in New Zealand: A thesis submitted in partial fulfilment of the requirements for the Degree of Doctor of Philosophy | |
CN116179399A (en) | Rhizosphere growth promoting bacterium and application thereof | |
CN112391314B (en) | Endogenous bacillus cereus, application and separation method thereof | |
FALAHI et al. | Reaction of Iranian cereal genotypes to multiple strains of Xanthomonas translucens pv. cerealis | |
CN111801005A (en) | Endophytes from wild barley populations to increase crop yield | |
Khumalo | Lucerne (Medicago sativa L.) establishment after inoculation with different carriers of Ensifer meliloti sown on five dates at Lincoln University | |
Renugadevi et al. | Applications of bacterial endophytes and their advanced identification methodologies | |
Gichuru et al. | Pathogenic and molecular characterisation of Pythium spp. inducing root rot symptoms in other crops intercropped with beans in Southwestern Uganda | |
Frémont et al. | A comparison of Bradyrhizobium strains using molecular, cultural and field studies | |
CN113416679A (en) | Bacillus methylotrophicus, microbial inoculum comprising bacillus methylotrophicus and application of bacillus methylotrophicus | |
JP7468842B2 (en) | Pesticide composition for controlling plant diseases and method for controlling plant diseases using the same | |
Hassan et al. | Molecular characterization of salt tolerant rhizobial strains induced by gamma rays using RAPD markers |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 18791606 Country of ref document: EP Kind code of ref document: A1 |
|
DPE1 | Request for preliminary examination filed after expiration of 19th month from priority date (pct application filed from 20040101) | ||
NENP | Non-entry into the national phase |
Ref country code: DE |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112019022446 Country of ref document: BR |
|
ENP | Entry into the national phase |
Ref document number: 2018259162 Country of ref document: AU Date of ref document: 20180427 Kind code of ref document: A |
|
ENP | Entry into the national phase |
Ref document number: 2018791606 Country of ref document: EP Effective date: 20191127 |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112019022446 Country of ref document: BR Free format text: ENVIAR NOVAS VIAS DO RELATORIO DESCRITIVO, POIS NAS VIAS ENVIADAS TEM-SE A NUMERACAO DA ULTIMA FOLHA COMO 63/66. |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01Y Ref document number: 112019022446 Country of ref document: BR Free format text: ANULADA A PUBLICACAO CODIGO 1.5 NA RPI NO 2580 DE 16/06/2020 POR TER SIDO INDEVIDA. |
|
REG | Reference to national code |
Ref country code: BR Ref legal event code: B01E Ref document number: 112019022446 Country of ref document: BR Free format text: APRESENTAR NOVA VIA DO PRIMEIRO RELATORIO DESCRITIVO, CORRIGINDO SUA NUMERACAO, TENDO EM VISTA QUE TODAS AS PAGINAS ESTAO NUMERADAS ATE A PAGINA 66 (PAGINA FINAL 63/66) |
|
ENP | Entry into the national phase |
Ref document number: 3098455 Country of ref document: CA |
|
ENP | Entry into the national phase |
Ref document number: 112019022446 Country of ref document: BR Kind code of ref document: A2 Effective date: 20191025 |