WO2018162696A1 - Variations génétiques communes au niveau du locus tcra-tcrd associé à la régulation de la fonction thymique chez les êtres humains - Google Patents

Variations génétiques communes au niveau du locus tcra-tcrd associé à la régulation de la fonction thymique chez les êtres humains Download PDF

Info

Publication number
WO2018162696A1
WO2018162696A1 PCT/EP2018/055873 EP2018055873W WO2018162696A1 WO 2018162696 A1 WO2018162696 A1 WO 2018162696A1 EP 2018055873 W EP2018055873 W EP 2018055873W WO 2018162696 A1 WO2018162696 A1 WO 2018162696A1
Authority
WO
WIPO (PCT)
Prior art keywords
allele
thymopoiesis
cells
impacted
polymorphic marker
Prior art date
Application number
PCT/EP2018/055873
Other languages
English (en)
Inventor
Antoine TOUBERT
Emmanuel CLAVE
Itaua LESTON ARAUJO
Matthew Albert
Lluis QUINTANA MURCI
Cécile ALANIO
Original Assignee
Institut Pasteur
Assistance Publique Hopitaux De Paris
INSERM (Institut National de la Santé et de la Recherche Médicale)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut Pasteur, Assistance Publique Hopitaux De Paris, INSERM (Institut National de la Santé et de la Recherche Médicale) filed Critical Institut Pasteur
Publication of WO2018162696A1 publication Critical patent/WO2018162696A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/7051—T-cell receptor (TcR)-CD3 complex
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the invention pertains to the field of precision medicine using genetic biomarkers.
  • the invention relates to a method of ev compacting thymic function in a subject comprising the detection of a genetic polymorphism in the T-cell receptor alpha-T cell receptor delta (TCRA-TCRD) locus associated with the level of T lymphocyte production by the thymus.
  • TCRA-TCRD T-cell receptor alpha-T cell receptor delta
  • the invention relates also to the use of said method and genetic polymorphism for the diagnostic, prognostic, treatment or monitoring of conditions or clinical situations where thymopoiesis is impacted, or that are impacted by thymopoiesis efficiency and/or quality, such as for example aging, allograft transplantation, acquired immunodeficiencies such as HIV/AIDS, vaccination, infectious diseases, cancer, autoimmune diseases and immunotherapy.
  • the thymus is the primary lymphoid organ where T lymphocytes are generated in the adaptive immune system of all vertebrates, through spatio-temporal interactions between thymocytes and specialized microenvironments (Shah et al., J Immunol, 2014, 192, 4017-4023: Calderon el al.. Cell, 2012, 149, 159-172). It is an organ sensitiv e to insults received throughout life upon inflammation and infections, reflected in its functional decline with age (Douek et al.. Nature, 1998, 396, 690-695; Palmer, Front. Immunol., 2013, 4, 3 16).
  • Thymus is a v ital organ for homeostatic maintenance of the peripheral immune system. In healthy individuals, continuous production of naive self-tolerant T cells by the thymus ensures potent immune responses towards newly encountered antigens from pathogens or tumors and contributes to maintenance of the naive T-cell repertoire.
  • Thymic function is high in newborns and during infancy, and diminishes with age (C. L. Mackall, R. E. Gress, Immunol. Rev., 1997, 160, 91 -102). Dysregulated thymopoiesis is associated with an increased risk of opportunistic infections, autoimmunity, cancer and inefficient vaccination in the elderly (D.D. Taub, D. L. Longo, Immunol. Rev., 2005, 205, 72-93). However, levels of thymic function vary significantly among individuals, and some adults have persistent, although reduced, thymopoiesis until at least their fifth decade of life (C. L. Mackall, R. E. Gress, Immunol. Rev., 1997, 160, 91-102; Mitchell WA, Lang PO, Aspinall R, Clin. Exp. Immunol, 2010, 161 , 497- 503). To date, the biological mechanisms underlying these natural variations have not been identified.
  • assessing the environmental and genetic determinants of variation in thymic function across healthy adults is of primary importance to delineate targets for new thymic regenerative or boosting therapies (T. Boehm, J. B. Swann, Nat. Rev. Immunol., 2013, 13, 831-838) in particular in conditions where thymopoiesis is impacted, such as aging (S. Ferrando -Martinez et al, Age (Dordr), 2013, 35, 251 -259), human immunodeficiency virus (HIV) infection (M. L.
  • Thymopoiesis is extraordinarly dependent on the thymic microenvironment which is broadly demarcated into an outer cortex and inner medulla, each defined by different subsets of thymic epithelial cells (TEC) (Abramson et al, Annu Rev Immunol, 2017, 35, 85-1 18).
  • TEC thymic epithelial cells
  • Thymocyte progenitors receive signals from cortical TEC (cTEC) for their commitment to the T-cell lineage via the engagement of the NOTCH 1 receptor with Delta-like 4 (DLL4) ligand ( Hozumi et al.. J Exp Med, 2008, 205.
  • cTEC cortical TEC
  • Naive T cells are heterogeneous including so-called recent thymic emigrants (RTE), a subset which undergoes further post-thymic maturation after positive selection ( Fink et al.. Nature reviews. Immunology 201 1 , 1 1 , 544-549).
  • RTE recent thymic emigrants
  • Tregs Tregs
  • Some phcnotypic markers have been proposed to stain RTE, such as CD31 (PECAM-1) in CD4 T cells.
  • CD31 expression can be maintained during cytokine-driven proliferation of CD4 T cells, making expression staining uncertain to interpret in terms of thymopoiesis (Kimmig et al., J Exp Med, 2002, 1 95, 789-794; Azevedo et al.. Blood, 2009, 113, 2999-3007 ).
  • RTE are enriched in T-celi receptor excision circles (TRECs) produced during thymic TCR somatic recombination (Junge et al., Eur J Immunol, 2007, 37, 3270-3280) ( Figure 1 A and I B ).
  • TRECs persist within mature T cells as episomal DNA (de Villartay et al..
  • the level of thymic function of a given individual can be evaluated on peripheral blood by a direct, non-invasive quantification of signal-joint (sj) and beta ( ⁇ ) T-cell
  • TCR TCR Excision Circles
  • TRECs are small circular DNAs generated during TCR somatic recombination that persist within T cells as episomal DNA (J. P. de Villartay et al , Nature, 1988, 335, 1 70- 1 74 ).
  • Signal joint TRECs sj TRECs are generated during the recombination of the alpha chain of the TCR, in all double-positive (DP) CD4 CD8 thymocytes, before positiv e and negative selection and lineage commitment (de Villartay et al.. Nature, 1988, 335, 1 70- 1 74).
  • T-cell receptor delta (TCRD or TRD) locus embedded within the T-cell receptor alpha ( TCRA or TRA ) locus ( Figure I B).
  • TCRA or TRA T-cell receptor alpha locus
  • the sjTRECs quantification assay is used in clinical laboratories as a diagnostic test for recovery of the naive T-cell repertoire during H IV treatment, after allo-HSCT and in the screening of severe combined immunodeficiencies in newborns (M. L. Dion et al , Immunity, 2004, 2 1 , 757-768; D. C. Douek et al, Nature, 1998, 396, 690-695; E. Clave et al, Blood, 2009, 1 13, 6477-6484: A Kwan et al , JAMA, 2014, 3 1 2, 729-738 ).
  • the inventors have quantified sjTRECs and PTRECs in peripheral blood of 1 ,000 age- and sex-stratified healthy adults of the Milieu Interieur cohort (S. Thomas et al., Clin. Immunol. 1 57, 201 5. 277-293 ).
  • age and sex were the only factors substantially impacting thymic function.
  • GWAS Genome-wide association studies
  • the method and variants are useful for the diagnostic, prognostic or monitoring of conditions or clinical situations where thymopoiesis is impacted, or that are impacted by thymopoiesis efficiency and/or quality, such as for example aging, allograft transplantation, acquired immunodeficiencies such as H IV/A IDS, vaccination, infectious diseases, cancer, autoimmune diseases , and immunotherapy.
  • the invention relates to an in vitro method of evaluating thymic function in an indiv idual, comprising:
  • TCRA-TCRD T-cell receptor alpha-T cell receptor delta
  • the allele that is associated with increased level of T lymphocyte production by the thymus i.e. , increased thymic function
  • effect allele the allele that is associated with increased level of T lymphocyte production by the thymus
  • other allele(s) the aiiele(s) that are not associated with increased level of T lymphocyte production by the thymus.
  • the level of production of T lymphocytes by the thymus is proportional to the number of effect alleles (0, 1 or 2) present in the individual ( Figure 1 1 A and 1 I B). The highest level is found in individuals homozygous for the effect allele, the lowest level is found in individual homozygous for the other allele and an intermediate level is found in heterozygous individuals.
  • Thymic function refers to thymopoiesis, which is the production of (naive) T lymphocytes by the thymus.
  • the level of thymic function of a given indiv idual at a given time can be evaluated on peripheral blood by quantification of signal-joint (sj), beta ( ⁇ ) T-cell Receptor (TCR) Excision Circles (TRECs) and or number of intrathymic divisions (log: of the ratio of sjTREC number over ⁇ TREC number (log 2 sjTREC/pTREC), according to standard methods based on the principles illustrated in Figure 1 A and IB. These standard methods which are well-known in the art are disclosed in the examples of the present application.
  • polymorphic marker refers to a genomic polymorphic site.
  • Each polymorphic marker has at least two sequence variations characteristic of particular alleles at the polymorphic site.
  • genetic association to a polymorphic marker implies that there is association to at least one specific allele of that particular polymorphic marker.
  • the marker can comprise any allele of any variant type found in the genome, including SNPs, mini- or microsatellites, translocations and copy number variations (insertions, deletions, duplications).
  • Polymorphic markers with population frequency higher than 5- 10% are in general most useful.
  • a "polymorphic site” referred to a nucleotide position at which more than one sequence is possible in a population.
  • allele refers to the nucleotide sequence of a given locus (position) on a chromosome.
  • a polymorphic marker allele thus refers to the composition (i.e., sequence) of the marker on a chromosome.
  • Genomic DNA from an indiv idual contains two alleles (i.e. allele-specific sequences) for any given polymorphic marker, representative of each copy of the marker on each chromosome.
  • SNP Single Nucleotide Polymorphism
  • SNP Single Nucleotide Polymorphism
  • SNP is a DNA sequence variation occurring when a single nucleotide at a speci fic location in the genome differs between members of a species or between paired chromosomes in an individual. Most SNP polymorphisms have two alleles. Each individual is in this instance either homozygous for one allele of the polymorphism (i.e. both chromosomal copies of the individual have the same nucleotide at the SNP location), or the individual is heterozygous (i.e. the two sister chromosomes of the individual contain different nucleotides).
  • the SNP nomenclature as reported herein refers to the official Reference SNP (rs) ID identification tag as assigned to each unique S N P by the National Center for Biotechnological In formation (NCBI )
  • a “variant”, as described herein, refers to a segment of DNA that differs from the reference DNA.
  • a “marker” or a “polymorphic marker”, as defined herein, is a variant. Alleles that differ from the reference are referred to as “variant” alleles.
  • Bio sample refers to a biological material comprising nucleic acid that is obtained from an i ndivi dual .
  • the biological material that may be derived from any biological source is removed from the individual by standard methods which are well- known to a person having ordinary skill in the art.
  • the biological sample is a lso named “sample” or "nucleic ac id sam ple".
  • Biomarker refers to a distinctive biological or biologically derived indicator of a process, event or condition.
  • a biomarker includes a genetic marker, a protein marker and other molecular marker.
  • a "woman” as described herein, refers to a female human of any age such as for example a baby, adult or elderly.
  • a marker as used herein is understood to represent one or more markers.
  • the term “a” (or “an”), “one or more” or “at least one” can be used interchangeably herein.
  • the TCRA-TCRD locus is situated on human chromosome 14 and corresponds to the nucleotide sequence from positions 2 1 ,62 1 ,904 to 22,552, 132 of NCBI reference sequence NC 000014.9.
  • the polymorphic marker is in the TCRD locus and corresponds to the nucleotide sequence from to positions 22,422,546 to 22,466.577 of NCBI reference sequence NC 000014.9 or positions 22,891 ,537 to 22.935,569 of NCBI reference sequence NC 000014.8. In a more preferred embodiment.
  • the polymorphic marker is in the region from the 5 ' end of the D delta 2 (D62) gene segment to the 3 ' of the D delta 3 ( D03 ) gene segment corresponding to positions 22,439.007 to 22.449.125 of NCBI reference sequence NC 000014.9 ( Figure 3B).
  • the polymorphic marker is characterized by the following features:
  • rs8013419, rs 1087301 8, rs12147006, rs2204985, and rs l 1 84471 5 (SEQ ID NO: 1 to 22: Table V) characterized by a numerical value of the linkage disequilibrium correlation measure r of greater than 0.2; preferably of greater than 0.3, 0.4, 0.5. 0.6 or 0.7; still more preferably of greater than 0.8 or 0.9; even more preferably of greater than 0.95 or 0.97.
  • the polymorphic marker is preferably in linkage disequilibrium with at least rs1087301 8.
  • the level of T lymphocyte production by the thymus is increased by at least 10% (0.1 fold), 25% (0.25 fold), 50% (0.5 fold), 75% (0.75 fold), 100% (1 fold) , 125% ( 1 .25 fold). 150% ( 1 .5 fold), 175% ( 1 .75 fold), 200% (2 fold), 225% (2.25 fold) or 250% (2.5 fold) in individuals carrying at least one effect allele of at least one polymorphic marker.
  • the lev el of T lymphocyte production by the thymus is preferably determined by measuring the number of signal-joint T-cell Receptor Excision Circles (sjTRECs) in the indiv idual.
  • the polymorphic marker is a single- nucleotide-polymorphism (SNP).
  • the SNP is preferably selected from the group consisting of rs38 1 1236, rs2301 199, rs2301200, rs32 16790, rs62762262, rs2331618, rs l 1 09130, rs2072616, rs8012481 , rs6572448, rs2 141988, rs916052, rs8021297, rs7492759, rs2204984, rs7 1 115550. rs201497432, rs8013419, rs l 087301 8, rs12147006, rs2204985. rs1 184471 5, and other polymorphic markers in linkage disequilibrium therewith.
  • the A allele of rs2141988, the A allele of rs916052, the T allele of 8021297, the G allele of rs 7492759, the A allele of rs2204984, the A allele of rs7 1 115550, the T allele of rs201497432, the A allele of rs8013419, the G allele of rs1087301 8, the A allele of rs12147006, the G allele of rs2204985 and the C allele of rsl 1844715 are indicative of an increased thymic function in an indiv idual.
  • determination of the presence of at least one of the above-listed allele is indicativ e of increased thymic function for the individual. Determination of the absence of any of these alleles is indicative that the indiv idual does not have the increased thymic function conferred by the allele. More preferably, the SNP is selected from the group consisting of rs381 1236, rs2141988, rs2204984, rs8013419, rs1087301 8, rs12147006, rs2204985, and rs11844715.
  • the SNP is selected from the group consisting of rs8013419, rs l 087301 8, rs12147006 and rs2204985. These 4 SNPs are in the region from the 5 'end of the D delta 2 (D62) gene segment to the 3 ' end of the D delta 3 (D53) gene segment. Even more preferably, the SNP is rs2204985.
  • the other polymorphic markers are characterized by numerical values of the linkage disequilibrium correlation measure r of greater than 0.2: still preferably of greater than 0.3, 0.4, 0.5, 0.6, 0.7 or 0.8; still more preferably of greater than 0.7 or 0.8.
  • the other polymorphic markers are preferably in linkage disequilibrium with at least rs l 087301 8.
  • SEQ ID NO: 1 to 22 are characterized by the following features in a whole population (women (Table II); men and women (Table III)):
  • SNPs are associated with a number of signal-joint T-cell Receptor Excision Circles (sjTR ECs) that is increased by up to 30 % in individuals heterozygous for the effect allele and up to 80 % in indiv iduals homozygous for the effect allele. Highest increase is observed with rs2204985, rs8013419, rs10873018, and rs12147006.
  • the individual is a human individual.
  • the individual can be of any age (baby, child, adult, elderly).
  • the individual is a female, preferably a woman.
  • the biological sample comprises genomic DNA.
  • Such biological sample can be obtained from any source that contains genomic DNA, including tissue or body fluid.
  • body fluids include blood (whole-blood), cerebral spinal fluid (CSF), amniotic fluid, urine and mucosal secretions.
  • Tissue sample can be with n o - limitati ons from skin, mucosa including buccal or conjunctival mucosa and gastrointestinal tract, muscle, hair, nail, tooth, placenta, or other organs. Sample includes swab.
  • the biological sample is blood, in particular whole-blood.
  • the blood is prelerably peripheral blood.
  • the sample is dried blood spot or dried pellet of unseparated peripheral blood lymphocytes.
  • the biological sample is derived from blood, in particular the biological sample comprises peripheral blood mononuclear cells (PBMC).
  • PBMC peripheral blood mononuclear cells
  • Analyzing a nucleic acid sample may include the step of isolating genomic nucleic acid from the sample using standard methods used for the isolation of nucleic acids from biological samples.
  • any method that provides the allelic identity at particular polymorphic sites is useful in the method of the invention.
  • Suitable methods include, for instance, whole genome sequencing methods, w hole genome analysis using SNP chips, cloning for polymorphisms, non-radioactive PCR-single strand conformation polymorphism analysis, denaturing high pressure liquid chromatography (DHPLC), DNA hybridization, computational analysis, single-stranded conformational polymorphism (SSCP), restriction fragment length polymorphism (RFLP), automated fluorescent sequencing, clamped denaturing gel electrophoresis (CDGE), denaturing gradient gel electrophoresis (DGGE), mobility shift analysis, restriction enzyme analysis, heteroduplex analysis, chemical mismatch cleavage (CMC), RNase protection assays, use of polypeptides that recognize nucleotide mismatches, such as E. coli mutS protein, allele-speci fic PCR, and direct manual and automated sequencing.
  • the method of the invention comprises at
  • Amplification is preferably performed by Polymerase Chain Reaction (PGR) techniques.
  • Pair of oligonucleotide primers that hybridize to opposite strands of a genomic segment comprising at least one polymorphic marker are used for amplification.
  • each oligonucleotide primer pair is designed to include an ailele-specific oligonucleotide to selectively amplify a fragment of the genome of the individual that includes at least one polymorphic marker of the invention.
  • Standard techniques for genotyping can be used to detect particular marker alleles, such as fluorescence-based techniques utilizing PCR, LCR, Nested PCR and other techniques for nucleic acid amplification.
  • Hybridization is preferably sequence-specific hybridization, i.e., hybridization with a nucleic acid probe that specifically hybridizes to a nucleic acid which contains a specific allele at a polymorphic site (ailele-speci fic oligonucleotide or ailele-specific oligonucleotide probe).
  • Arrays of oligonucleotide probes can be used to identify several genetic markers including one or more polymorphic markers according to the invention.
  • Oligonucleotide primers and probes including ailele-specific oligonucleotide probes and primers are usually of 10 to 30 or 10 to 50 nucleotides.
  • the oligonucleotide can be DNA, RNA, PNA or mixed, and may comprise locked nucleic acids ( LNA).
  • LNA locked nucleic acids
  • the oligonucleotide is advantageously labeled with a suitable label such as for example fluorescent label, radioisotope or magnetic label.
  • oligonucleotide primers and probes, including ailele-specific oligonucleotide probes and primers can be prepared using standard methods.
  • SNP genotyping include, but are not limited to, TaqMan genotyping assays and SNPlex platforms (Applied Biosystems), gel electrophoresis (Applied Biosystems), mass spectrometry (i.e., MassARRAYsystem from Sequenom ), minisequencing methods, real-time PGR, Bio- Plex system (BioRad), CEQ and SNPstream systems (Beck man ), array hybridization technology (i.e., Affymetrix GeneChip; Perlcgen): Bead Array Technologies (i.e., Illumina GoldenGate and Infinium assays), array tag technology (i.e., Parallele), and endonuclcase-based fluorescence hybridization technology ( InvadenThird Wave).
  • the method of the inv ention comprises the determination of at least one allele of at least two different polymorphic markers.
  • the method of the inv ention which allows to determine a genotype associated with thymic function lev el in an individual is useful for the diagnostic, prognostic, and/or monitoring of conditions or clinical situations where thymopoiesis is impacted or that are impacted by thymopoiesis efficiency and/or quality.
  • the method of the inv ention is useful for the diagnostic, prognostic, and/or monitoring of aging, of conditions or clinical situations of lymphopenia where immune regeneration is required, and of conditions or clinical situations where production of T-cell naive response is required.
  • the method of the inv ention is performed on a biological sample that may be from the patient or from the donor (in case allo-hematopoietic stem cell transplantation
  • a patient refers to an indiv idual, preferably a human, affected by a disease where thymopoiesis is impacted or that is impacted by thymopoiesis efficiency and/or quality, as defined abov e.
  • Conditions or clinical situations where immune regeneration is required include acquired immunodeficiencies, allo-hematopoietic stem cell transplantation (HSCT) and cellular therapies, gene therapy, immunosuppressive treatments such as in solid-organ transplantation, immunotherapy and immunoregenerative therapies.
  • HSCT allo-hematopoietic stem cell transplantation
  • cellular therapies gene therapy, immunosuppressive treatments such as in solid-organ transplantation, immunotherapy and immunoregenerative therapies.
  • expanded or manipulated hematopoietic stem cells are infused to give rise to lymphoid progenitors and T-cells as an adoptive or replacement immunotherapy.
  • Acquired immunodeficiencies include in particular Human Immunodeficiency Virus infection and acquired immune deficiency syndrome (HIV/AIDS ).
  • Immunoregenerative therapies of thymic function include in particular sex steroid ablation. IL-7 and or II. -22 therapy.
  • T-cell naive response Conditions or clinical situations where production of T-cell naive response is required include vaccination such as v accination against pathogens or tumors (anticancer vaccine), immunotherapy, infectious diseases including opportunistic infections, such as immunodeficiencies, and cancer.
  • Immunotherapy includes checkpoint inhibitor therapies for treatment of cancer.
  • Autoimmunity includes those with a high sex bias such as Systemic Lupus Erythematosus (SLE), Rheumatoid arthritis (RA) and Type 1 Diabetes.
  • SLE Systemic Lupus Erythematosus
  • RA Rheumatoid arthritis
  • autoimmune disorders the quality of T cells exiting the thymus is altered, due to defects in the so-called T-cell selection process, therefore generating autoreactive T-cells. It is therefore reasonable to anticipate that a higher production of autoreactive T cells resulting from the SNP polymorphism according to the inv ention may be associated with a higher susceptibility to the development or persistence of autoimmune diseases.
  • the presence of a particular allele at a polymorphic site is indicative of a different degree of susceptibility and/or severity of the disease.
  • Such allele is useful as prognostic marker.
  • the presence of the effect allele is indicative of a decreased susceptibility to the disease and/or a decreased severity of the disease for the indiv idual compared to individuals not having the effect allele.
  • the presence of the effect allele is indicative of an increased susceptibility to the disease and/or an increased severity of the disease for the individual compared to indiv iduals not having the effect allele.
  • the presence of a particular allele at a polymorphic site is also indicative of a different response to a particular treatment. This means that an individual such as a patient carrying at least one effect allele of at least one polymorphic allele according to the invention would response better to, or worse to, a specific therapeutic, drug, and/or other therapy used to treat the disease.
  • the identity of a marker allele would help in deciding what treatment should be used for the patient. For example, for a newly diagnosed patient, the presence of an effect allele o f a p o l y m o rp h i c a l l e l e of the present invention may be assessed. I f the patient is positive for the marker allele, then the physician recommends one particular therapy, w hile if the patient is negative for the at least one allele of a marker, then a different course of therapy may be recommended.
  • the patient's carrier status could be used to help determine whether a particular treatment modality should be administered.
  • the p o l y m o rp h i c markers of the invention, as described herein, may be used to assess response to these therapeutic options, or to predict the progress of therapy using any one of these treatment options.
  • genetic profiling can be used to select the appropriate treatment strategy based on the genetic status of the individual, or it may be used to predict the outcome of the particular treatment option, and thus be useful in the strategic selection of treatment options or a combination of available treatment options.
  • it may be an important marker predicting the response of immunotherapies, for example those utilized in the treatment of cancers, and guiding the choice of the dose to employ or the duration of the therapy. It may also influence the choice of adjuvant to be joined to the antigenic stimulation in the context of vaccination.
  • the method of the invention further comprises the determination of at least one other marker, such as for example polymorphic marker(s) different from those of the invention and or biomarker(s).
  • the other marker(s) may be determined concomitantly to the polymorphic marker(s) of the invention, or before or after the polymorphic marker(s) of the invention.
  • markers of thymic function include markers of thymic function, HLA hapiotype, in particular in the context of allogeneic HSCT, and drug-related or disease-related biomarkers related to conditions or clinical situations where thymopoiesis is impacted or that are impacted by thymopoiesis efficiency and/or quality, as described herein.
  • the polymorphic marker of the invention is combined with HLA allele(s), in particular alleles of the HLA class I genes, such as HLA-A,-B and -C alleles, and HLA class 11 genes, such as H L A- DP, -DQ, -DR, so as to determine the H LA hapiotype of the indiv idual. Determination of the H LA hapiotype of an individual is determined by standard methods such as by standard 1 1 LA genotyping methods. Determination of H LA allele(s) in addition to the polymorphic marker of the invention is useful in allo-HSCT to improv e donor choice algorithms in the search of unrelated donors, including cord blood or H LA haploidentical related donors.
  • the polymorphic marker of the invention is combined with another biomarker of thymic function such as sjTRECs, PTRECs, and or intrathymic divisions number, preferably sjTRECs number.
  • the method of the invention is also useful in drug screening and drug development, in particular to increase safety and effectiv eness of clinical trials.
  • indiv iduals carrying at least one effect allele of at least one polymorphic allele according to the inv ention may be more likely to respond fav orably to therapeutic agent or drug. Therefore, the strati fication of patients according to the genotype status of the polymorphic marker(s) according to the inv ention (presence or absence of marker effect allele) in a clinical trial can improv e the safety of clinical trials, but can also enhance the chance that a clinical trial will demonstrate statistically significant efficacy.
  • kits for performing the method of the inv ention comprising reagents necessary for selectiv ely detecting at least one allele of at least one polymorphic marker of the present inv ention in the genome of the individual, in particular, at least one SNP chosen from SEQ I D NO: 1 to 22, preferably chosen from SEQ ID NO: 1 , 1 1 , 15 and 18 to 22, more preferably chosen from SEQ I D NO: 18 to 21 , even more preferably SEQ ID NO: 21.
  • the kit usually comprise means for amplification of the nucleic acids of the invention (i.e., nucleic acid segment comprising one or more polymorphic markers of the invention), means for analyzing nucleic acid sequence of the nucleic acids, and/or means for allele-specific detection of the nucleic acids or amplified fragments thereof.
  • the kit comprises primers for amplification of nucleic acids of the invention, and/or hybridization probes for sequence specific hybridization to said nucleic acids, in particular allele-specific oligonucleotide probe and or primers.
  • the kit comprises allele-specific oligonucleotide probe and/or primers for the specific detection and/or amplification of one or both alleles of one or more SNPs chosen from SEQ ID NO: 1 to 22, preferably chosen from SEQ ID NO: 1 , 1 1 , 15 and 1 8 to 22, more preferably chosen from SEQ ID NO: 1 8 to 21 , even more preferably SEQ ID NO: 2 1 .
  • the kit can comprise necessary buffers and enzymes.
  • the kit comprises reagents for detecting at least two different polymorphic markers according to the invention, as described herein.
  • the kit further comprises reagents for detecting at least another marker as described herein, preferably HLA allele(s), in particular alleles of the HLA class I genes, such as HLA-A,-B and -C alleles, and HLA class II genes, such as HLA-DP, -DQ, -DR., so as to determine the H LA haplotype of the individual.
  • HLA allele(s) in particular alleles of the HLA class I genes, such as HLA-A,-B and -C alleles
  • HLA class II genes such as HLA-DP, -DQ, -DR.
  • Another object of the invention is the use of said polymorphic marker, in vitro, for evaluating thymic function level in a subject.
  • the polymorphic marker is used for the diagnostic, prognostic or monitoring of conditions or clinical situations where thymopoiesis is impacted or that are impacted by thymopoiesis efficiency and/or quality as described herein. In some preferred embodiments, the polymorphic marker is used for predicting the response to therapy of said conditions or the outcome of said clinical situations.
  • the polymorphic marker of the invention is used with another marker as described herein.
  • Another object of the invention is the use of said polymorphic marker for drug screening and/or drug development as described herein.
  • the polymorphic marker of the invention is used w ith another marker as described herein.
  • Another object of the invention is a method of treating a disease where thymopoiesis is impacted or that is impacted by thymopoiesis efficiency and/or quality in a patient, comprising:
  • a “desired allele” refers to an allele of at least one polymorphic marker according to the inv ention that is beneficial for a specific application, in particular a therapeutic application, including the treatment of a patient and allo-hematopoietic stem cell transplantation (HSCT) from a donor to a recipient.
  • HSCT allo-hematopoietic stem cell transplantation
  • the desired allele is either the effect allele (i.e. allele associated w ith increased lev el of T lymphocyte production by the thymus) or the other allele (allele not associated w ith increased lev el of T lymphocyte production by the thymus).
  • Another object of the inv ention is a method of selecting hematopoietic cells of interest, in particular hematopoietic stem cells or T lymphoid progenitor cells of interest, comprising:
  • the (desired) allele that is selected in the hematopoietic cells is the effect allele (i.e. allele associated with increased level of T lymphocyte production by the thymus) or the other allele (allele not associated with increased level of T lymphocyte production by the thymus).
  • the method may be used for selecting hematopoietic cells for allograft transplantation.
  • hematopoietic stem cells having the effect allele are selected.
  • said polymorphic marker is chosen from SEQ ID NO: 1 to 22, preferably SEQ ID NO: 1 , 1 1 , 15 and 18 to 22, more preferably SEQ ID NO: 18 to 21 , even more preferably SEQ ID NO: 21.
  • the method of selection is usually performed on a nucleic acid sample comprising genomic DNA from the cells, using standard methods that prov ide the allelic identity at particular polymorphic sites as described above.
  • the method of selection of the invention may be performed using hematopoietic cells including stem cells obtained from a variety of sources, using conventional methods known and available in the art.
  • hematopoietic cells may be recovered from bone marrow, mobilized peripheral blood mononuclear cells (PBMCs), umbilical cord blood, embryonic stem (ES) cells or induced pluripotent stem (IPS) cells.
  • PBMCs peripheral blood mononuclear cells
  • ES embryonic stem
  • IPS induced pluripotent stem
  • the hematopoietic cells are advantageously human hematopoietic cells.
  • the cells are CD34+ hematopoietic cells, preferably human CD34+ hematopoietic cells.
  • the method of selection further comprises the determination of another marker as defined above, in particular H LA allele( s) in the context of allogeneic HSCT, to improve donor choice algorithms in the search of unrelated donors, including cord blood or HLA haploidenticai related donors.
  • Another object of the invention is a genetically engineered hematopoietic cell as defined above, in particular a genetically engineered hematopoietic stem cell or T lymphoid progenitor cell, in which at least one allele of at least one polymorphic marker according to the invention has been replaced with the other allele (desired allele), in particular the effect allele.
  • said polymorphic marker is chosen from SEQ ID NO: 1 to 22, preferably SEQ ID NO: 1 , 1 1 , 1 5 and 1 8 to 22, more preferably SEQ ID NO: 18 to 21 , even more preferably SEQ ID NO: 2 1 .
  • the cells of the invention may be genetically-engineered using any known gene- editing system such as TALEN, Zinc-Finger meganucleases, CRISPR Cas and others.
  • the gene editing system is engineered for replacing specifically at least one allele with the other allele (desired allele), in particular the effect allele, according to the invention in the T-cell receptor alpha-T cell receptor delta locus of the hematopoietic stem cells or T lymphoid progenitors, using standard method that are well-known in the art.
  • the hematopoietic stem cells or T lymphoid progenitors are obtained from an indiv idual
  • the gene editing system is introduced in the hematopoietic stem cells or T lymphoid using standard nucleic acid and/or protein delivery agents or systems.
  • the genetically engineered hematopoietic cells may be administered to the donor (autologous graft transplantation/identical donor and recipient) or to another individual (allograft or xenograft transplantation/recipient different from the donor).
  • Another object of the invention is a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of hematopoietic cells having the desired allele of a polymorphic marker according to the invention, in particular hematopoietic stem cells or T lymphoid progenitor cells, either genetically engineered or obtained by the selection method according to the inv ention, and a pharmaceutically acceptable carrier, vehicle, and or excipient.
  • the hematopoietic cells either genetically engineered or obtained by the selection method according to the inv ention, may be from the patient or from a donor.
  • the hematopoietic cells are human hematopoietic cells.
  • the hematopoietic cells have the effect allele.
  • the hematopoietic cells are genetically engineered hematopoietic cells, in particular genetically engineered hematopoietic stem cells or T lymphoid progenitor cells.
  • the hematopoietic stem cells are human hematopoietic cells from a donor individual having the effect allele for ailo-HSCT to a recipient indiv idual (patient).
  • the human hematopoietic cells from the donor preferably human hematopoietic stem cells or T lymphoid progenitor cells, are either genetically engineered or obtained by the selection method according to the invention, preferably obtained by the selection method according to the invention.
  • Another object of the inv ention is a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of gene-editing system engineered for replacing specifically one allele of at least one polymorphic marker according to the inv ention w ith the other allele (desired allele), in the T-celi receptor aipha-T cell receptor delta locus of at least one hematopoietic stem cell or T lymphoid progenitor of a patient, and a pharmaceutically acceptable carrier, vehicle, and/or excipient.
  • the gene-editing system can be based on any-known gene-editing system as mentioned above.
  • a pharmaceutical composition according to the invention comprises a therapeutically effective amount of active agent (genetically engineered hematopoietic cells or gene editing system), which is a dose sufficient for reversing, allev iating or inhibiting the progress of the disorder or condition to which such term, applies, or reversing, alleviating or inhibiting the progress of one or more symptoms of the disorder or condition to which such term applies.
  • active agent genetically engineered hematopoietic cells or gene editing system
  • the effective dose is determined and adjusted depending on factors such as the composition used, the route of administration, the physical characteristics of the indiv idual under consideration such as sex, age and weight, concurrent medication, and other factors, that those skilled in the medical art will recognize.
  • a "pharmaceutically acceptable carrier, v ehicle, and/or excipient” refers to compounds, materials, compositions, and/or dosage forms that do not produce an adverse, allergic or other unwanted reaction when administered to a mammal, especially a human, as appropriate.
  • the pharmaceutical v ehicles, carriers, and/or excipients are those appropriate to the planned route of administration, which are well known in the art.
  • a pharmaceutically acceptable carrier, vehicle and/or excipient includes with no limitations, non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation of any type.
  • Another object of the invention is a pharmaceutical composition
  • a pharmaceutical composition comprising an effective amount of hematopoietic cells having the desired allele and/or gene-editing system for introducing the desired allele in hematopoietic cells as defined above, for use in the treatment of a condition where thymopoiesis is impacted or that is impacted by thymopoiesis efficiency and/or quality, as defined above.
  • Another object of the inv ention is a method of treating a disease where thymopoiesis is impacted or that is impacted by thymopoiesis in a patient, comprising administering an effective amount of hematopoietic cells hav ing the desired allele, gene- editing system for introducing the desired allele in hematopoietic cells, or pharmaceutical composition thereof to the patient.
  • the desired allele is either the effect allele (i.e. allele associated with increased level of T lymphocyte production by the thymus) or the other allele (allele not associated with increased lev el of T lymphocyte production by the thymus).
  • the above therapeutic method or use is for gene therapy, wherein hematopoietic cells from a patient are genetically engineered ex vivo or in vivo using a gene-editing system as defined abov e.
  • the genetically engineered hematopoietic cells are then reintroduced into the patient using standard methods.
  • the above therapeutic method or use is for cell therapy, wherein allogenic/xenogenic hematopoietic stem cells or T lymphoid progenitors hav ing the desired allele, either selected using the method of selection of the invention or genetically engineered to replace one allele of at least one polymorphic marker according to the inv ention with the other (desired) as defined abov e, are administered to the patient.
  • the abov e therapeutic method or use for gene or cell therapy comprises :
  • Thymic function associates with na ' ive T-cell immune phenotypes.
  • T cells differentiate in the thymus from double negative 1 (DN1) to single positiv e (SP) stage, ⁇ T-cell receptor excision circles ( ⁇ -Cs) are episomai DNA generated during the TCRB recombination.
  • Signal joint TRECs sjTRECs deriv e from the deletion of the TCRD locus during TCRA locus recombination (figure 1 B). The log2 of the sjTRECs/pTRECs ratio is used as an estimate of intrathymic proliferation between double negative 3 (DN3) and DP stages.
  • B Detailed view of the genetic association signal found in the TCRA-TCRD locus. The 22 most strongly associated SNPs with sjTREC levels are indicated in black. Primers (sjTREC F/R ) and probe (sjTREC P) used to quantify sjTRECs are shown in grey.
  • Meta-analysis /'-values were obtained by combining array-based, probe-based and imputed genotypes of the Milieu Interieur and MARTHA cohorts.
  • Variants that are significantly associated at the genome-wide level are indicated in black.
  • D Physical position of the four most strongly associated variants, relative to active transcription activ ity measured by the H3K27Ac historic acetylation mark and transcription factor binding sites (identified by ChlP-seq) (E. P. Consortium, Nature, 2012, 489, 57-74). Position of the DD3 gene segment (D53) is indicated. - Figure 5.
  • P is the FDR adjusted /'-v alues for the large sample chi-square likelihood ratio test of a sex effect obtained using a mixed model for the response variable logio sjTRECs including sex and TREC processing plate as fixed effects, and additional batch variables as random effects.
  • mice were generated in Balb/c Rag2 -/- Il2rg- /- Sirpa NOD ( BRGS ) hosts with rs2204985 A A (in pale grey), GA (in dark grey) or GG genotype (in black ) CD34 CD38- human fetal liver hematopoietic stem cells. sjTREC levels were measured in reconstituted thymi and spleen from 8-29 weeks old mice.
  • FIG. 8 Effect of the human TC RA-TCRD genetic v ariation on thymic I CR repertoire in immunodeficient mice.
  • Human TCRA- TCRD was sequenced using genomic DNA from 8 (3 males, 5 females) and1 2 (4 males, 8 females) immunodeficient mice thy mi grafted with A A and GG human fetal livers, respectively (Table IV ).
  • C Percentages of specific TCR delta J genes ⁇ TCRDJOl to 04) among total TCR alpha and delta J genes used in productive rearrangements according to A A (grey) and GG (black ) genotypes.
  • D Percentages of D V ( left panel ) DD (central panel ) and DJ (right panel) genes usages among TCRD productive rearrangements. Genes are ordered according to their genomic location (see Fig. 4B) and p values are obtained using the non-parametric Mann-Whilncy test.
  • Figure 9 Combined effects of sex, age and TCRA-TCRD genetic variation on thymic function.
  • B Scatter plots showing sjTRECs levels as a function of age, sex and genotype (SNP rs2204985). Regression lines were fitted using simple linear regression. Black indicates A A genotype, dark grey colour indicates AG genotype, and ligt grey colour indicates GG genotype.
  • C Representation of number of thymic age versus chronological age as a function of gender and SNP rs2204985 modalities.
  • Figure 11 Combined effects of sex, age and TCRA-TCRD genetic variation on thymic function.
  • rs2204985 genotypes were obtained by additional by-design genotyping in both the Milieu Interieur and MARTHA cohorts. Light grey indicates A A genotype, dark grey indicates GA genotype, and black indicates GG genotype.
  • C Proportions of variance of sjTREC levels explained by age, sex and TCRA-TCRD genetic variation. The surface area indicates the total variance explained by the multiple regression model, in Milieu Interieur (left) and MARTHA (right) cohorts, and the area and colour of sub -rectangles indicate proportions attributed to specific predictors (as measured by the R 2 of the regression model ).
  • D Difference between (chronological) age and thymic age as a function of sex and rs2204985 variant. Thymic age is predicted from our regression model, and AA men are assumed as the baseline of thymic function.
  • Metabolic syndrome was defined in the MI donors based on six criteria: increased abdominal circumference (>94cm European men, >80cm European women), elevated systolic blood pressure (>130mmHg), elevated diastolic blood pressure (>85mmHg), elevated triglyceride levels (>1.7mM), diminished levels of high density lipoprotein (HDL ⁇ lmM men, ⁇ 1.3mM women) and glucose concentration (>6.1mM).
  • Pasteur ID-RCB Number: 201 2-A00238-35 The protocol is registered under CiinicaiTriais.gov (study# NCT01699893). DNA extraction from human whole Mood
  • Blood was collected in 5ml sodium EDTA tube and was kept at room temperature (18-25°) until processing. DNA extraction was performed using the Nucleoli BACC3 kit (#RPN8512, GE-Healthcare). Upon arrival at the processing site, blood was transferred into a 50ml polypropylene tube. 20ml of sterile Reagent A Ix (lysis buffer) were added to the blood sample in aseptic conditions and mixed by rotation for 4 minutes at room temperature. After red blood cell lysis, the tube was centrifuged 1300g for 5m in and the supernatant was discarded. The cell pellet was resuspended with 40 ⁇ 1 of PBS IX, transferred to a 0.5ml 2D-cap tube and stored at -80°C before processing.
  • lysis buffer 20ml of sterile Reagent A Ix (lysis buffer) were added to the blood sample in aseptic conditions and mixed by rotation for 4 minutes at room temperature. After red blood cell lysis, the tube was centrifuged 1300g for 5m in and the super
  • the precipitated DNA was hooked out and placed into a clean 1 .5ml microcentrifugation tube. 1ml of cold 70% ethanol was added, the DNA was washed and the supernatant was discarded after centri i ligation at 4000g for 5min. After DNA pellet air dry for 10m in, 400 ⁇ of deionized water were added and the tube kept overnight at 4°C to complete the resuspension before DNA quantification.
  • TRECs T-cell receptor excision circles
  • sjTRECs and pTRECs are episomal circular DNAs generated during TCR a and ⁇ chain recombination, respectively ( Figures 1 A and IB).
  • the protocol is based on a quantitative PGR of genomic DNA extracted from whole blood, using the Biomark HI) system ( Fluidigm France, Paris, France).
  • genomic DNA 1 to 2 ⁇ g was preamplified for 3 min at 95 °C and then 1 8 cycles of 95 °C 1 5s, 60°C 30s and 68°C 30s, in a 50 ⁇ reaction that contained the primers listed in Table I, 200 ⁇ of each dNTP, 2.5 niM MgS0 4 and 1 .25 unit of Platinum Taq DNA pol High Fidelity (ThermoFisher Scientific. Courtaboeuf France) in1 x buffer.
  • sjTREC-LNA Locked Nucleic Acids
  • Immunophenotyping was conducted on whole blood from ail donors, and details on technical procedures and complete results are available in M. Hasan et al (201 5 ).
  • Ten 8-color flow cytometry panels were deveiopped (M. Hasan et al , Clin. Immunol. 201 5, 1 57, 261 -276), allowing for the measurement of 168 traits, including 76 cell counts, 89 Mean Fluorescence Intensity (MFI) and 3 ratios.
  • MFI Mean Fluorescence Intensity
  • Confidence intervals were constructed for these significant associations using the profile likelihood with likelihood ratio test based cutoffs.
  • the simultaneous confidence level for these intervals was chosen to be 0.05 and was calculated using the false coverage rate adjustment (Y. Benjamin! & D. Yekutieli, Journal of the American Statistical Association, 2005, 100, 71-81).
  • the batch variables i.e., the day of whole-blood sampling and the day of TREC processing, were included as random effects. Also plates used for TREC processing were included as a fixed effect. For PTRECs, the box used for processing was also included. Testing the effect of age and sex on the probability of having detectable amounts of PTRECs (using the binary variable described above) was done using logistic regression together with a Wald test. All tests were considered for association between the non-genetic treatment variables and the TREC response variables as one family of tests. The FDR was used as error rate and a significance cut-off of 0.05. A total of 120 models were fitted, and tests were performed. - DNA genotyping and imputation
  • the 1 ,000 subjects were genotyped at 719,665 SNPs by the HumanOmniExpress- 24 BeadChip (!llumina, California). To increase coverage of rare and potentially functional variation, 966 of the 1,000 donors were also genotyped at 245,766 exonic SNPs by the HumanExome-12 BeadChip ( lllumina, California). A total of 945,213 unique SNPs were thus genotyped. SNP quality-control filters yielded a total of 661 ,332 and 87,960 SNPs for the H umanOm ni Ex press and HumanExome BeadChips. respectively. The two datasets were then merged.
  • Average concordance rate for the 16,753 SNPs shared between the two genotyping platforms was 99.9925%.
  • the final dataset included 732.341 QC-filtered genotyped SNPs. Genotype imputation was performed by IMPUTE v.2, considering 1-Mb windows and a buffer region of I Mb. After quality-control filters, a total of 1 1 ,395,554 high-quality SNPs were obtained, which were further filtered for minor allele frequencies >5° o, yielding a final set of 5,699,237 SNPs for association analyses.
  • GWAS Univariate genome-wide association study
  • the interaction model used was a mixed model having logio sjTRECs as response variable and sex, age, plate used for T REC processing, rs2204985 genotypes, and the interaction between the rs2204985 genotypes and sex, as fixed effects, and ancestry (encoded by the genetic relatedness matrix), day of TREC processing and day of whole- blood sampling as random effects. Confidence intervals and tests based on this model was done using large-sample normal distribution approximations.
  • the effect of the rs2204985 variant on the immunophenotypes was tested using mixed models, with log-transformed immunophenotypes as response variables, the rs2204985 variant as treatment variable, and age, sex, CMV serostatus and smoking as fixed effects covariates, and blood sampling day as random effect.
  • the P-values were adjusted to control the false discovery rate at 5 % within this family of tests.
  • the replication cohort included 612 patients from the MARTHA cohort (Thrombophilia center of La Timone hospital, APHM, Marseille, France (M orange et ah, Blood, 201 1 , 117, 3692-3694). Donors are all of European descent, and were included between January 1994 and October 2005 for having suffered a single venous thrombosis event, without detectable cause. The study was approved by institutional ethic committee ("Departement Same de la Direction Generate de la mecanic et de ⁇ Innovation " ; Projects DC: 2008-880 & 09.576), and written informed consent was obtained from each subject. MARTHA biobank is hosted by the HEMOVASC bioresource center (CRB APHM).
  • Genotypes for candidate variants were obtained from the lllumina Human610-Quad SNP array (Morange et ah, Blood, 201 1 , 1 17, 3692- 3694) or probe-based genotyping, as described below.
  • Replication was tested with mixed models including age, sex and TREC processing plate as fixed effect covariates, and batch effects as random effects, using the lme4 R package.
  • Mixed effect models including the GRM were fitted using the Imekin function in the coxme R package.
  • Meta- analysis of the Milieu Interieur and MARTHA cohorts was conducted with the rna.mi function in the metafor R package
  • the FLEXsixTM Genotyping IFCs (Fluidigm) were loaded with l/50th dilution of the preampiified product.
  • 2X TakyonTM Low Rox Probe MM (Eurogentec) and 40 X TaqManTM Genotyping Assay (ThermoFisher Scienti fic) according to manufacturer's instructions.
  • H IS mice were generated in Balb/c Rag2 -/ Ti2rg -/" Sirpa NOD ( BRGS ) recipients using human fetal liver hematopoietic stem cells as previously described (Lopez-Lastra et al, Blood Advances, 201 7, 1, 601 -614). Briefly, newborn mice (3 to 5 clays of age) received sublethal irradiation (3 Gy) and were injected intrahcpatically with the equivalent of 2 X 1 () 5 CD34 CD38 " human fetal liver cells. A total of 92 H IS mice in 1 5 independent experiments (4- 10 mice per experiment) were analyzed at 8-29 weeks of age.
  • Thymocytes and spienocytes were mechanically dissociated using a Ceil Strainer ( ⁇ ⁇ nylon Falcon ® ). Ceils (5 X 10 5 ) were frozen as dry pellet. DNA was prepared using the Proteinase K method ( 54°C for 1 min, 95 °C for 10 min ).
  • Sexing of human donors was made by single amplification of the ZFX/ZFY genes in 25 ⁇ PGR using 200 nM of primers hSex2-F (AAGTGCCCTCTTGCACATA; SEQ ID NO: 44) and hSe.x2-R (CTCGACTTAAACTTCTTCCC; SEQ ID NO: 45), 200 ⁇ each dNTPs, 1.5 niM MgS04 and 1 unit of HiFi Taq Platinum (Thermo fisher). Cycling conditions were 94°C for 5 min and 40 cycles of 94°C for 30 sec, 56°C for 30 sec and 72°C for 2 min.
  • Cycling conditions were 94°C for 3 min and 35 cycles of : 94°C for 1 5 sec, 57°C for 15 sec and 72°C for 30 sec, and. 72°C for 5 min.
  • PCR product was subsequently loaded on a 1.5% agarose gel giving a 402 pb band for SRY and a 544 pb band for 11.3.
  • T -cell Receptor ICR
  • TREC quantification was adapted from Clave et ai (Taub et al, Immunol Rev
  • the samples were genotyped to the SNPs rs2204985 and rs 1087301 8 with 5 ⁇ containing 2 ⁇ of DNA (10 to 20ng of genomic DNA), 0.25 ⁇ of 2.x Takyon Low Rox
  • thymic age was estimated by non-genetic and genetic factors.
  • a simple linear regression model was fitted with logio sjTRECs as response and age, sex, and rs2204985 genotypes as predictor variables. This regression model defines expected values of logio sjTRECs as a function of age, sex and rs2204985 genotypes. Thymic age was then defined as the expected age when donors are A A homozygous men, which were assumed as the baseline of thymic function.
  • the contribution of rs2204985 genotypes, age and sex to the explained variance of logio sjTREC values was estimated by fitting linear regression models.
  • the proportion of variance explained by a particular predictor was estimated by averaging the sum of squares for that particular variable over different orderings in the regression model. The estimation was done using the relaimpo R package.
  • sjTRECs and (iTRECs were quantified in the Milieu Interieur cohort, which includes 500 men and 500 women of western European ancestry, stratified across five decades of age from 20 to 69 years-old (S. Thomas et al , Clin. Immunol. 157, 201 5. 277-293).
  • Log 10-trans formed levels of sjTRECs showed a normal distribution, with a mean of 2.4 +/- 0.03 (min to max range 0.2 to 4. 1 ).
  • the logio PTREC approximately followed a normal distribution with a mean of 1 .8 ⁇ 0.05 (min to max range 0.02 to 3. 1 ).
  • the number of intrathymic divisions was also normally distributed across the healthy donors, with a mean of 2.6 ⁇ 0.16 (min to max range -4.3 to 9.5).
  • Immune cell populations or parameters associated with logio sjTRECs and PTRECs, or with the number of intrathymic divisions were searched by taking advantage of the extensive flow cytometry based immunophenotyping performed on the 1 .000 Milieu Interieur healthy donors (M. Hasan et al, Clin. Immunol. 2015, 157, 261-276). Multiple regression analyses controlling for potential confounding and batch effects were performed, and threshold for significance was set at 5x10- .
  • sjTREC levels were measured in the independent MARTHA cohort, which includes 612 unrelated patients of European descent affected by deep venous thrombosis (Morange et al , Blood, 201 1 , 117, 3692-3694).
  • SNPs are located within a 25 kb region inside the TCRA- TCRD locus, and excised during I CR a chain recombination ( Figures 3B and 4B-C).
  • the 8 more informative SNPs of the cluster in the 1 .000 Milieu lnterieur donors (rs38 1 1 236, rs2 141988, rs2204984, rs8() 1 341 9, rs l 087301 8, rs12147006, rs2204985, and rs l 1 84471 5 ) were genotyped (Table II) and these data were combined with array-based or imputed genotype data from the MARTHA cohort.
  • the rs2204985 polymorphism had the same effect on the alternative 6Rec-J558 rearrangement than on sjTRECs, therefore excluding an effect of the SNP polymorphism on the .10 segment usage during primary TCRA rearrangements.
  • TCRDV and TCRDJ usage was quite different according to the genetic variation, with a preferential usage of gene segments close to the SNP region ( DJ and DV2, DV3) in rs2204985 A A individuals ( Figure 8B), translating in a higher frequency of T-cells carrying a productive TCRD rearrangement based on DJ vs. AJ usage frequencies ( Figure 8C).
  • Figure 8D A fine analysis of TCRD V and TCRDJ usages showed that DVl, DD2 and DJl segments were used preferentially in GG whereas DV2, DD3 and DJ3 were used preferentially in A A indiv iduals ( Figure 8D).
  • the effect of the rs2204985 variant on the immunophenotypes was tested using other mixed models, with iogio-transformed immunophenotypes as response variables, the rs2204985 variant as treatment variable, and age, sex, CMV serostatus and smoking as fixed effects covariates, and blood sampling day as random effect.
  • thymic age could be directly modeled approximated by sjTRECs values as a function of the rs2204985 SNP, and it was estimated that carrying the GG genotype is equiv alent to a 19-year difference in logio sjTRECs for women (CI: [ 1 5.3, 22.1]), and a 7-year difference in logio sjTRECs for men (CI: [4.8, 10.0]), relative to A A homozygous men ( Figures 1 I D and 9C).
  • thymopoiesis the only parameters defined in physiological conditions were age and sex, in contrast to the many pathological conditions affecting thymopoieisis, such as acute inflammation in sepsis (Venet et al, Nat Rev Nephrol, 201 8, 14, 1 2 1 - 1 37 ). obesity (Yang et al, Blood 2009, 1 14, 3803-3812) or endocrine dysfunction (Youm et al, Proc Natl Acad Sci U S A 2016, 1 1 3, 1 026- 1 03 1 : Ventevogel et al., Curr Opin Immunol, 2013, 25, 5 16-522 ).
  • naive CD8+ and CD4+ T cell age-related decreases were estimated at 1 .6% and 3.6% per year respectively, which can be compared to the 5% decrease in sjTRECs per year estimated here in the same cohort.
  • This reflects the long half-life of some naive T-cell populations in homeostatic conditions (Thome et al., Sci Immunol 2016, 1 ,). Collectiv ely, these studies show a stronger genetic association with naive rather than differentiated T-cells in the adaptive compartment. This engaged us to focus our search on a genetic contribution in T-cell generation using the TREC approach as the closest readout of TCR rearrangements.
  • TCRA-TCRD locus The most striking result of this study is the demonstration that sjTRECs levels are controlled by genetic variations at the TCRA- TCRD locus, within the genomic region that is excised during TCR alpha recombination and sjTRECs generation, which offers novel insights into the TCR locus function.
  • the TCRA-TCRD locus is organized in a single genetic locus contributing to 2 different TCR specificities, TCR /cS and TCRa(:k at 2 differential developmental stages, therefore requiring a complex program that regulates chromatin accessibility of TCRA and TCRD gene segments to the recombination machinery (Carico et al, Adv Immunol. 201 5, 128, 307-361).
  • the 4 SNPs identified are located in a short segment spanning 4kb within the DD2 and DD3 intergenic region, in a close 5 ' position to the TCR5 enhancer ( ⁇ ) ( Figure 4).
  • the best candidate variant. rs2204985 locates in an open-chromatin region that is a target for numerous transcription factors such as RUNX3 and ELF l , and for the RNA polymerase 11 (Consortium, Nature 2012, 489, 57-74).. This region regulates the expression of the TCRD enhancer ⁇ close by (R. E. Thurman et al, Nature, 201 2, 489, 75-82 ).
  • rs2204985 is also close to a CCCTC-binding factor (CTCF) binding element, mediating chromatin looping, and modulating the access of the recombination machinery to the chromatin (Z. Carico, M. S. Krangel, Adv . Immunol., 201 5, 1 28, 307-361 ; Chen et al., Nat Immunol 201 5, 1 6, 1085- 1093 ).
  • CCCTC-binding factor CCCTC-binding factor
  • TCR5 rearrangement is the first to occur at the earliest CD34+CD38-CDla- DN stage (Dik et al., J Exp Med, 2005, 201 , 1 71 5- 1 723 ) and is highly ordered in humans due to RUNX1 interaction with DD2, DD2-DD3 rearrangements occurring before DD2-DJI rearrangements (Cieslak et al., J Exp Med, 2014, 2 1 1 , 1 82 1 - 1 832 ). rearrangements measured in sjTRECs are first detected in immature single positive (ISP) cells and reach peak levels in SP thymocytes ( Dik et al.. J. Exp. Med., 2005.
  • ISP immature single positive
  • the ⁇ element is a major regulator of TCRD accessibility in DN thymocytes (Monroe et al., Immunity 1999, 10, 503-513), functioning over a limited chromosomal distance (Bassing et al., Proc Natl Acad Sci U S A, 2003, 100, 2598-2603). It has been suggested that ⁇ may require additional upstream elements to promote TCRD accessibility ( Monroe et al.. Immunity 1999, 10, 503-5 13 ).
  • MAR matrix attachment regions
  • the I CR genetic polymorphism could be linked to survival and/or thymocyte proliferation at the DN stage. Indeed, the lack of difference in TCRA V and TCRAJ usages according to the genotype is not in favor for a differential lifespan in DP thymocytes (Guo et al., Nat. Immunol.. 2002, 3, 469-476).
  • physiological DNA double-strand breaks generated in developing lymphocytes activate a broad transcriptional program (Bredemeyer et al.. Nature, 2008, 456, 819-823 ) some of them promoting lymphocyte survival as for instance the activation of p38MAPK in DN thymocytes (Pedraza-Aiva G.
  • CD4 lymphopenia may restore CD4 lymphopenia (Thiebaut et al., Clin Infect Dis, 2016, 62, 1 178-1 185) and response to vaccination in adults and in the elderly which has been associated with RTE numbers in elderly humans (Schulz et al., J Immunol, 2015, 195, 4699-471 1).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé d'évaluation de la fonction thymique chez un sujet, comprenant la détection d'un polymorphisme génétique dans le locus alpha du récepteur des lymphocytes T-delta du récepteur des lymphocytes T (TCRA-TCRD) associé au taux de production de lymphocytes T par le thymus. L'invention concerne également l'utilisation dudit procédé et du polymorphisme génétique pour le diagnostic, le pronostic, le traitement ou la surveillance d'états ou de situations cliniques où la thymopoïèse est affectée, ou qui sont affectés par l'efficacité et/ou la qualité de la thymopoïèse.
PCT/EP2018/055873 2017-03-10 2018-03-09 Variations génétiques communes au niveau du locus tcra-tcrd associé à la régulation de la fonction thymique chez les êtres humains WO2018162696A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP17305263 2017-03-10
EP17305263.0 2017-03-10

Publications (1)

Publication Number Publication Date
WO2018162696A1 true WO2018162696A1 (fr) 2018-09-13

Family

ID=58358529

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2018/055873 WO2018162696A1 (fr) 2017-03-10 2018-03-09 Variations génétiques communes au niveau du locus tcra-tcrd associé à la régulation de la fonction thymique chez les êtres humains

Country Status (1)

Country Link
WO (1) WO2018162696A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020111809A1 (fr) * 2018-11-29 2020-06-04 가톨릭대학교 산학협력단 Procédé fournissant des informations pour la prédiction du pronostic du cancer du sang après la transplantation de cellules souches hématopoïétiques
KR20200064891A (ko) * 2018-11-29 2020-06-08 가톨릭대학교 산학협력단 조혈모세포 이식 후 혈액암 예후 예측을 위한 정보 제공 방법
WO2020160342A1 (fr) * 2019-01-30 2020-08-06 Direct Biologics Llc Procédés et compositions pour développer des produits à base d'exosomes et de facteurs de croissance spécifiques d'une cible

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040229252A1 (en) * 2003-02-19 2004-11-18 Affmetrix, Inc. Genotyping the T cell receptor
EP2284280A1 (fr) * 2007-08-02 2011-02-16 Fundacion Reina Mercedes Para La Investigacion Sanitaria Amorces, procédé et ensemble d'outils pour déterminer la fonctionnalité du thymus humain
WO2016160721A1 (fr) * 2015-03-27 2016-10-06 President And Fellows Of Harvard College Cellules t modifiées, leurs procédés de préparation et utilisation

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040229252A1 (en) * 2003-02-19 2004-11-18 Affmetrix, Inc. Genotyping the T cell receptor
EP2284280A1 (fr) * 2007-08-02 2011-02-16 Fundacion Reina Mercedes Para La Investigacion Sanitaria Amorces, procédé et ensemble d'outils pour déterminer la fonctionnalité du thymus humain
WO2016160721A1 (fr) * 2015-03-27 2016-10-06 President And Fellows Of Harvard College Cellules t modifiées, leurs procédés de préparation et utilisation

Non-Patent Citations (104)

* Cited by examiner, † Cited by third party
Title
"NCBI", Database accession no. NC 000014.8
"NCBI", Database accession no. NC 000014.9
"NCBI", Database accession no. NC_000014.9
A KWAN ET AL., JAMA, vol. 312, 2014, pages 729 - 738
ABRAMSON ET AL., ANNU REV IMMUNOL, vol. 35, 2017, pages 85 - 118
AZEVEDO ET AL., BLOOD, vol. 113, 2009, pages 2999 - 3007
BASSING ET AL., PROC NATL ACAD SCI U S A, vol. 100, 2003, pages 2598 - 2603
BELLA ET AL., SEMIN CANCER BIOL, vol. 29, 2014, pages 32 - 39
BOEHM, J. B. SWANN, NAT. REV. IMMUNOL., vol. 13, 2013, pages 831 - 838
BOEHMER ET AL., IMMUNOL. REV., vol. 191, 2003, pages 62 - 78
BREDEMEYER ET AL., NATURE, vol. 456, 2008, pages 819 - 823
BRODIN ET AL., CELL, vol. 160, 2015, pages 37 - 47
C. L. MACKALL; R. E. GRESS, IMMUNOL. REV., vol. 160, 1997, pages 91 - 102
C.-C. WU ET AL: "Whole-genome detection of disease-associated deletions or excess homozygosity in a case-control study of rheumatoid arthritis", HUMAN MOLECULAR GENETICS, vol. 22, no. 6, 6 December 2012 (2012-12-06), gb, pages 1249 - 1261, XP055401313, ISSN: 0964-6906, DOI: 10.1093/hmg/dds512 *
CALDERON ET AL., CELL, vol. 149, 2012, pages 159 - 172
CARICO ET AL., ADV IMMUNOL, vol. 128, 2015, pages 307 - 361
CHEN ET AL., NAT IMMUNOL, vol. 16, 2015, pages 1085 - 1093
CIESLAK ET AL., J EXP MED, vol. 211, 2014, pages 1821 - 1832
CLAVE ET AL., BLOOD, vol. 113, 2009, pages 6477 - 6484
CONSORTIUM, NATURE, vol. 489, 2012, pages 57 - 74
CUNNINGHAM ET AL., J IMMUNOL, vol. 198, 2017, pages 4575 - 4580
D. C. DOUEK ET AL., NATURE, vol. 396, 1998, pages 690 - 695
D. K. SHAH; J. C. ZUNIGA-PFLUCKER, J. IMMUNOL., vol. 192, 2014, pages 4017 - 4023
D.D. TAUB; D. L. LONGO, IMMUNOL. REV., vol. 205, 2005, pages 72 - 93
DE VILLARTAY ET AL., NATURE, vol. 335, 1988, pages 170 - 174
DIK ET AL., J EXP MED, vol. 201, 2005, pages 1715 - 1723
DIK ET AL., J. EXP. MED., vol. 201, 2005, pages 1715 - 1723
DOUEK ET AL., NATURE, vol. 396, 1998, pages 690 - 695
E. CLAVE ET AL., BLOOD, vol. 113, 2009, pages 6477 - 6484
E. P. CONSORTIUM, NATURE, vol. 489, 2012, pages 57 - 74
EMBO J, vol. 25, 2006, pages 763 - 773
ENCODE PROJECT CONSORTIUM, NATURE, vol. 489, 2012, pages 57 - 74
FINK ET AL., NATURE REVIEWS. IMMUNOLOGY, vol. 11, 2011, pages 544 - 549
GUO ET AL., NAT. IMMUNOL., vol. 3, 2002, pages 469 - 476
H. YANG ET AL., BLOOD, vol. 114, 2009, pages 3803 - 3812
HALKIAS ET AL., IMMUNOL CELL BIOL, vol. 93, 2015, pages 716 - 726
HOZUMI ET AL., J EXP MED, vol. 205, 2008, pages 2507 - 2513
HUNTINGTON ET AL., EUR J IMMUNOL, vol. 41, 2011, pages 2883 - 2893
J. B. ACKMAN ET AL., RADIOLOGY, vol. 268, 2013, pages 245 - 253
J. G. MARKLE; E. N. FISH, TRENDS IMMUNOL., vol. 35, 2014, pages 97 - 104
J. P. DE VILLARTAY ET AL., NATURE, vol. 335, 1988, pages 170 - 174
JUNGE ET AL., EUR J IMMUNOL, vol. 37, 2007, pages 3270 - 3280
K. RUBTSOVA; P. MARRACK; A. V. RUBTSOV, J. CLIN. INVEST., vol. 125, 2015, pages 2187 - 2193
KIMMIG ET AL., J EXP MED, vol. 195, 2002, pages 789 - 794
KURD ET AL., IMMUNOL REV, vol. 271, 2016, pages 114 - 126
KYUNG-ROK YU ET AL: "Gene Editing of Human Hematopoietic Stem and Progenitor Cells: Promise and Potential Hurdles", HUMAN GENE THERAPY, vol. 27, no. 10, 1 October 2016 (2016-10-01), & CONFERENCE ON CHANGING THE FACE OF MODERN MEDICINE - STEM CELLS AND GENE THERAPY; FLORENCE, ITALY; OCTOBER 18 -21, 2016, pages 729 - 740, XP055470404, ISSN: 1043-0342, DOI: 10.1089/hum.2016.107 *
LE NOIR ET AL., BLOOD, vol. 120, 2012, pages 3298 - 3309
LOPES, EMBO MOL. MED., vol. 9, 2017, pages 835 - 851
LOPEZ-LASTRA ET AL., BLOOD ADVANCES, vol. 1, 2017, pages 601 - 614
M. DUMONT-LAGACE; C. ST-PIERRE; C. PERREAULT, SCI. REP., vol. 5, 2015, pages 12895
M. HASAN ET AL., CLIN. IMMUNOL., vol. 157, 2015, pages 261 - 276
M. HASAN ET AL., TEN 8-COLOR FLOW CYTOMETRY PANELS WERE DEVELOPPED, 2015
M. IRLA ET AL., IMMUNITY, vol. 29, 2008, pages 451 - 463
M. L. DION ET AL., IMMUNITY, vol. 21, 2004, pages 757 - 768
M. L. DION, IMMUNITY, vol. 21, 2004, pages 757 - 768
M. ROEDERER ET AL., CELL, vol. 161, 2015, pages 387 - 403
MARIE-LISE DION ET AL: "Estimating thymic function through quantification of T-cell receptor excision circles", ANTIBODY-DRUG CONJUGATES ( BOOK SERIE:METHODS IN MOLECULAR BIOLOGY), HUMANA PRESS, US, vol. 380, 1 June 2007 (2007-06-01), pages 197 - 213, XP008129980, ISSN: 1064-3745, ISBN: 978-1-62703-541-5 *
MARKLE ET AL., TRENDS IMMUNOL, vol. 35, 2014, pages 97 - 104
MATHIS ET AL., ANNU. REV. IMMUNOL., vol. 27, 2009, pages 287 - 31
MITCHELL WA; LANG PO; ASPINALL R, CLIN. EXP. IMMUNOL., vol. 161, 2010, pages 497 - 503
MONROE ET AL., IMMUNITY, vol. 10, 1999, pages 503 - 513
MORANGE ET AL., BLOOD, vol. 117, 2011, pages 3692 - 3694
N. DRAGIN ET AL., J CLIN INVEST, vol. 126, 2016, pages 1525 - 1537
N. MEINSHAUSEN; P. BUHLMANN, JOURNAL OF THE ROYAL STATISTICAL SOCIETY: SERIES B (STATISTICAL METHODOLOGY, vol. 72, 2010, pages 417 - 473
NIKOLICH-ZUGICH ET AL., CURR OPIN IMMUNOL, vol. 48, 2017, pages 23 - 30
PAIVA ET AL., PROC NATL ACAD SCI USA, vol. 110, 2013, pages 6494 - 6499
PALMER, FRONT IMMUNOL, vol. 4, 2013, pages 316
PALMER, FRONT. IMMUNOL., vol. 4, 2013, pages 316
PATIN ET AL., NAT IMMUNOL, 2017
PATIN ETIENNE ET AL: "Natural variation in the parameters of innate immune cells is preferentially driven by genetic factors", NATURE IMMUNOLOGY, NATURE PUBLISHING GROUP US, NEW YORK, vol. 19, no. 3, 23 February 2018 (2018-02-23), pages 302 - 314, XP036447832, ISSN: 1529-2908, [retrieved on 20180223], DOI: 10.1038/S41590-018-0049-7 *
PEDRAZA-ALVA G. PEDRAZA-ALVA ET AL.: "Activation of p38 MAP kinase by DNA double-strand breaks in V(D)J recombination induces a G2/M cell cycle checkpoint", EMBO J, vol. 25, 2006, pages 763 - 773
PERNET OLIVIER ET AL: "Stem cell-based therapies for HIV/AIDS", ADVANCED DRUG DELIVERY REVIEWS, ELSEVIER, AMSTERDAM, NL, vol. 103, 2 May 2016 (2016-05-02), pages 187 - 201, XP029632055, ISSN: 0169-409X, DOI: 10.1016/J.ADDR.2016.04.027 *
R. E. THURMAN ET AL., NATURE, vol. 489, 2012, pages 75 - 82
RODE ET AL., PROC NATL ACAD SCI U S A, vol. 109, 2012, pages 3463 - 3468
S. FERRANDO-MARTINEZ ET AL., AGE (DORDR, vol. 35, 2013, pages 251 - 259
S. THOMAS ET AL., CLIN. IMMUNOL., vol. 157, 2015, pages 277 - 293
SCHULZ ET AL., J IMMUNOL, vol. 195, 2015, pages 4699 - 4711
SHAH ET AL., J IMMUNOL, vol. 192, 2014, pages 4017 - 4023
STÉPHANIE THOMAS ET AL: "The Milieu Intérieur study - An integrative approach for study of human immunological variance", CLINICAL IMMUNOLOGY, vol. 157, no. 2, 1 April 2015 (2015-04-01), US, pages 277 - 293, XP055401310, ISSN: 1521-6616, DOI: 10.1016/j.clim.2014.12.004 *
T. BOEHM; J. B. SWANN, NAT. REV. IMMUNOL., vol. 13, 2013, pages 831 - 838
T. KRESLAVSKY ET AL., IMMUNITY, vol. 37, 2012, pages 840 - 853
TAUB ET AL., IMMUNOL REV, vol. 205, 2005, pages 72 - 93
THIEBAUT ET AL., CLIN INFECT DIS, vol. 62, 2016, pages 1178 - 1185
THOME ET AL., SCI IMMUNOL, 2016, pages 1
THURMAN ET AL., NATURE, vol. 489, 2012, pages 75 - 82
VENET ET AL., NAT REV NEPHROL, vol. 14, 2018, pages 121 - 137
VENTEVOGEL ET AL., CURR OPIN IMMUNOL, vol. 25, 2013, pages 516 - 522
VERSCHUREN ET AL., J IMMUNOL, vol. 158, 1997, pages 1208 - 1216
VIECHTBAUER, W., JOURNAL OF STATISTICAL SOFTWARE, vol. 36, 2010, pages 48
W. H. ORGANIZATION: "World report on ageing and health", WORLD HEALTH ORGANIZATION, 2015
W. KRENGER; B. R. BLAZAR; G. A. HOLLANDER, BLOOD, vol. 117, 2011, pages 6768 - 6776
W. VIECHTBAUER, CONDUCTING META-ANALYSES IN R WITH THE METAFOR PACKAGE, vol. 36, 2010, pages 48
W.A. MITCHELL ET AL., CLIN. EXP. IMMUNOL., vol. 161, 2010, pages 497 - 503
WERTHEIMER ET AL., SCI IMMUNOL, 2018, pages 3
X. ZHOU; M. STEPHENS, NAT. METHODS, vol. 11, 2014, pages 407 - 409
XIANFENG CHEN ET AL: "Novel Association Strategy with Copy Number Variation for Identifying New Risk Loci of Human Diseases", PLOS ONE, vol. 5, no. 8, 20 August 2010 (2010-08-20), pages e12185, XP055401315, DOI: 10.1371/journal.pone.0012185 *
Y. BENJAMINI; D. YEKUTIELI, JOURNAL OF THE AMERICAN STATISTICAL ASSOCIATION, vol. 100, 2005, pages 71 - 81
Y. H. YOUM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 113, 2016, pages 1026 - 1031
YANG ET AL., BLOOD, vol. 114, 2009, pages 3803 - 3812
YOUM ET AL., PROC NATL ACAD SCI USA, vol. 113, 2016, pages 1026 - 1031
Z. CARICO; M. S. KRANGEL, ADV. IMMUNOL., vol. 128, 2015, pages 307 - 361
ZHAO ET AL., J EXP MED, vol. 213, 2016, pages 1921 - 1936
ZHONG ET AL., PROC NATL ACAD SCI U S A, vol. 96, 1999, pages 11970 - 11975
ZUKLYS ET AL., NAT IMMUNOL, vol. 17, 2016, pages 1206 - 1215

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020111809A1 (fr) * 2018-11-29 2020-06-04 가톨릭대학교 산학협력단 Procédé fournissant des informations pour la prédiction du pronostic du cancer du sang après la transplantation de cellules souches hématopoïétiques
KR20200064891A (ko) * 2018-11-29 2020-06-08 가톨릭대학교 산학협력단 조혈모세포 이식 후 혈액암 예후 예측을 위한 정보 제공 방법
KR102236717B1 (ko) 2018-11-29 2021-04-06 가톨릭대학교 산학협력단 조혈모세포 이식 후 혈액암 예후 예측을 위한 정보 제공 방법
WO2020160342A1 (fr) * 2019-01-30 2020-08-06 Direct Biologics Llc Procédés et compositions pour développer des produits à base d'exosomes et de facteurs de croissance spécifiques d'une cible
JP2022535178A (ja) * 2019-01-30 2022-08-05 ダイレクト バイオロジクス エルエルシー 標的特異的エクソソームおよび増殖因子生成物を開発するための方法および組成物

Similar Documents

Publication Publication Date Title
US9334538B2 (en) Method for pre-screening and correlation of underlying SCARB1 gene variation to infertility in women and therapeutic use of progestational and other medications in treatment
Zanelli et al. The telomeric part of the HLA region predisposes to rheumatoid arthritis independently of the class II loci
WO2018162696A1 (fr) Variations génétiques communes au niveau du locus tcra-tcrd associé à la régulation de la fonction thymique chez les êtres humains
CN106536749B (zh) 用于预测硫代嘌呤诱导的白细胞减少症风险的组合物，所述组合物含有nudt15基因中的单核苷酸多态性标记
Liu et al. FCGR3A 158V/F polymorphism and response to frontline R-CHOP therapy in diffuse large B-cell lymphoma
Torbati et al. Association of CD58 polymorphism with multiple sclerosis and response to interferon ß therapy in a subset of Iranian population
CA3050896A1 (fr) Facteurs genetiques associes a un developpement d'inhibiteurs dans l'hemophilie a
Jang et al. Polymorphisms in tumor necrosis factor-alpha (− 863C> A,− 857C> T and+ 488G> A) are associated with idiopathic recurrent pregnancy loss in Korean women
Kang et al. Genetic variation of the E-cadherin gene is associated with primary infertility in patients with ovarian endometriosis
EP2286218B1 (fr) Polymorphismes de nucléotide unique (snp) et association avec une résistance à l induction de tolérance immunitaire
JP2014193155A (ja) アトピー性疾患の発症又は重症化リスクの評価法
US20080108077A1 (en) Genes associated with rheumatoid arthritis
JP4102301B2 (ja) 薬剤過敏症反応についてのスクリーニング方法
Kostiukova et al. CYP2C19* 2 gene variant (G681A, rs4244285) as a prognostic marker for the clinical course of multiple myeloma
JP6516128B2 (ja) 抗甲状腺薬誘発性無顆粒球症リスクを判定するための検査方法及び判定用キット
Clave et al. Paper II
EP3464620B1 (fr) Détermination de la prédisposition génétique au cancer agressif de la prostate
US20180363057A1 (en) Method for evaluating individual radiosensitivity and the risk of adverse effects
Xue et al. Chromosomal copy-number variation analysis of villous tissues using molecular karyotyping in early missed abortions
WO2007134386A1 (fr) Agents diagnostiques et leurs utilisations
EP2823054B1 (fr) Facteurs génétiques pour la pression sanguine
Cherciu et al. THE ASSOCIATION OF ERAP2 GENE POLYMORPHISMS WITH SERONEGATIVE SPONDYLOARTHROPATHIES IN HLA-B27 NEGATIVE ROMANIANS.
Gotovac et al. Pilot study of the association between the HLA region and testicular carcinoma among Croatian patients
Kang DNA Repair in Cancer
NZ748621B2 (en) Determination of genetic predisposition to aggressive prostate cancer

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18711864

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 18711864

Country of ref document: EP

Kind code of ref document: A1