WO2018135838A2

WO2018135838A2 - Method for identifying base editing off-target site by dna single strand break

Info

Publication number: WO2018135838A2
Application number: PCT/KR2018/000747
Authority: WO
Inventors: 김진수
Original assignee: 기초과학연구원
Priority date: 2017-01-17
Filing date: 2018-01-16
Publication date: 2018-07-26
Also published as: JP2020505062A; KR102084186B1; WO2018135838A3; KR20180084671A; CN110234770A; EP3572525A2; US20180258418A1; EP3572525A4

Abstract

Provided are a DNA single strand break composition comprising cytidine deaminase, inactivated target-specific endonuclease, and guide RNA, a method for producing a DNA single strand break, using the same, a DNA nucleotide sequencing method with base editing introduced thereto, and a method for identifying (or measuring or detecting) a base editing position, base editing efficiency on an on-target site and an off-target site, and/or target specificity.

Description

[Explanation of invention]

[Name of invention]

Base-correction non-target location method by DNA single-strand cutting

A composition for DNA single strand break, comprising cytidine deaminase, inactivated target specific endonuclease, and guide RNA, DNA using the same. Methods for generating single strand breaks, nucleic acid sequencing of DNA with base editing introduced, and base correction sites, base calibration efficiency at on-target sites, off-target sites ) And / or a method of identifying (or measuring or detecting) target specificity.

[Technique to become background of invention]

Base Editors (Programmable deaminases), including DNA binding modules and cytidine deaminases, target nucleotide substitutions or base modifications in the genome without generating DNA double-strand breaks. To make it possible. Unlike programmable 'nucleases, such as CRISPR-Cas9 and zinc-finger nucleases (ZFNs), which induce small insertions or indels at the target site,-programmable diaminases contain C within several ^' nucleotides at the target site. Convert to T (or C to G or A in lesser proportions). Base braces can correct point mutations that cause genetic disease in human cells, animals, and plants, or produce single-nucleotide polymorphisms (SNPs).

Four calibrators have been reported:

1) 5. A base straightener comprising a catalytically deficient Cas9 (dCas9) or D10A Cas9 kinase (nCas9) derived from 5. c e7 5 and rAPOBECl, a rat cytidine deaminase. Editors; BEs); 2) Target-AID comprising dCas9 or nCas9 and PmCDAl or human AID, which is act i vat ion-induced cytidine deaminase (AID) ortholog of sea lamprey; 3) CRISPR-X containing sgRNAs linked to MS2 RNA hairpins and clCas9 to recruit overactivated AID variants fused to MS2-binding proteins; and 4) zinc-finger proteins or transcriptional activator-like effectors (TALEs). Fused to cytidine diaminase. Despite widespread interest in base editing by base calibrators, no means have been developed to analyze target specificity for the entire genome of programmable diamines. Therefore, by analyzing the target specificity of the whole genome of the calibrator, it is possible to analyze the base calibration efficiency, off-target site, of f-target effect, etc. Need development

[Content of invention]

Problem to be solved

In the present specification, a means for analyzing target specificity of the entire genome of a braces, and a means for analyzing non-target sites, non-target effects, etc. of the braces are provided.

One example includes (a) a diaminase or a coding gene thereof (cDNA, rDNA, or mR A), (b) an inactivated target specific endonuclease or a coding gene thereof (cDNA, rDNA, or mRNA), and (c) A single DNA, comprising a guide RNA or a coding gene thereof. Provided are compositions for single strand breaks. The composition may be free of uracil-specific Excision Reagent (USER).

Other examples include (a) diaminase or its coding gene (cDNA, rDNA, or mRNA), and (b) a activated activated target specific endonuclease or its coding gene (cDNA, rDNA, or mRNA), And (c) introducing the guide RNA or a coding gene thereof into the cell or contacting the DNA isolated from the cell. The method may be one that does not include treating uracil-specific removal reagent (USER).

Another example is

(i) (a) diaminase or its cancerous gene (cDNA, rDNA, or mRNA), and (b) inactivated target specific endonuclease or its coding gene (cDNA, rDNA, or mRNA) And (c) introducing a guide RNA or a coding gene thereof into the cell or contacting DNA isolated from the cell to induce DNA single strand cleavage; And

(ii) analyzing the nucleic acid sequence of the single-stranded DNA fragment, providing a method for nucleic acid sequencing of DNA introduced with base editing by the deaminase. _. The method is uracil- It may not include treating the specific removal reagent (Uraci® Specific Excision Reagent; USER).

Another example is

(1) (a) diaminase or its coding gene (cDNA, rDNA, or mRNA), and (b) inactivated target specific endonuclease or its coding gene (cDNA, rDNA, or mRNA) and ( c) introducing a guide RNA or a coding gene thereof into the cell or contacting DNA isolated from the cell to induce DNA single strand break;

(ii) analyzing the nucleic acid sequence of the cleaved DNA fragment; And

(iii) identifying the single stranded cleavage site from the nucleic acid sequence data obtained by the analysis

To identify (or measure or detect) base calibration or single-stranded cleavage sites, base calibration efficiency at on-target sites, off-target sites, and / or target specificities, including, Provide a method. The method comprises, for example, after step (Π) and before, concurrently or after step (iii), (iii-1) base correction (eg, cytosine (a) in nucleic acid sequence data obtained by the assay. C) may further comprise determining whether to convert to uracil (U) or thymine (T). The method may not comprise the step of treating the uracil-specific removal reagent (USER) to generate a double cleavage in the DNA. In one example, the method (e.g., base calibration efficiency at an on-target site, off-target site identification method), after step (iii), (iv) the cleavage site is the target site If not (on—target site), it may further include the step of identifying (determining) off-target site.

[Measures of problem]

In the present specification, by modifying Digenome-seq in the human genome, a base straightener composed of Cas9 nickase and deaminase (eg,

Base Editor 3; BE3) was evaluated for specificity. Genomic DNA BE3 and Guide

Treatment in vitro with RNA confirmed that cleavage was produced on a single strand of the DNA double strand. Using the diamines provided herein

By DNA single strand cleavage method and nucleic acid sequencing method using the same,

BE3 nontarget sites can be identified computationally using full genome siege data. First, a technique is provided for generating double strand breaks in DNA using a diminase that does not cause double strand breaks in DNA.

One example may comprise (a) a diaminase or a coding gene thereof (cDNA, rDNA, or mRNA), (b) an inactivated target specific endonuclease or a coding gene thereof (cDNA, rDNA, or mRNA) And (c) provides a composition for DNA single strand breaks, comprising a guide RNA or a coding gene thereof. The composition may be free of uracil-specific Excision Reagent (USER).

Coding genes as used herein may be used in the form of cDNA, rDNA or recombinant vector comprising the same, or mRNA.

The deaminase may be cytidine deaminase. Cytidine deaminase converts cytosine (eg, cytosine present in double-stranded DNA or RNA), which is a base present in nucleotides, into uracil. (C-to ᅳ U conversion or C-to-U editing) means all enzymes having the activity of converting cytosine located on the strand where the PAM sequence of the target site sequence (target sequence) to uracil Let's do it. In one example, the cytidine deaminase may be derived from mammals such as humans, primates such as Wonseung, rats, rodents such as mice, but is not limited thereto. For example, the cytidan deaminase is an enzyme belonging to the family of APOBEC ("apolipoprotein B mRNA editing enzyme, catalytic polypeptide-1 ike"), AID (act i vat ion-induced cyt idine deaminase), CDA (cyt idine deaminase; For example, CDA1) and the like may be one or more selected from the group consisting of, for example, one or more selected from the group consisting of, but is not limited thereto:

APOBEC 1: Human Homo sapiens APOBEC 1 (Protein: GenBank Accession Nos. NP—001291495.1, NP_001635.2, NP_005880.2, etc .; Genes (describe the genes encoding them in the order of the proteins described above): GenBank Accession Nos. _001304566.1, li— 001644.4, NM_005889.3, etc.), mouse musculus) AP0BEC1 (protein: GenBank Accession Nos. NP—001127863.1, NP—112436.1); genes (describe the genes encoding them in the order of protein described above): GenBank Accession Nos. NM_001134391-1, NM_031159.3, etc.);

AP0BEC2: human AP0BEC2 (protein: GenBank Accession No. NP_006780.1, etc .; gene: GenBank Accession No. 丽 _006789.3, etc.), mouse AP0BEC2 (protein: GenBank Accession No. NP-033824.1, etc .; gene: GenBank Accession No.醒 _009694.3 and the like);

AP0BEC3B: Human AP0BEC3B (protein: GenBank Accession Nos. NP_001257340.1, NP_004891.4, etc .; gene (mRNA or cDNA, hereinafter identical) (describes genes encoding it in the order of proteins described above): GenBank Accession Nos. NM_001270411. 1, 醒 _00490 (). 4, etc.), mouse Uius musculus) AP0BEC3B (protein: GenBank Accession Nos. NP— 001153887.1, NP_001333970.1, NP — 084531.1, etc .; genes (describing genes encoding them in the order of proteins described above) GenBank Accession Nos. NM— 001160415.1, NM_001347041.1, Li_030255.3, etc.);

AP0BEC3C: human AP0BEC3C (protein: GenBank Accession No. NP-055323.2, etc .; gene: GenBank Accession No. 匪 _014508 · 2, etc.);

AP0BEC3D (including AP0BEC3E): human AP0BEC3D (protein: GenBank Accession No. NP_689639.2, etc .; gene: GenBank Accession No. # 152426.3, etc.);

AP0BEC3F: human AP0BEC3F (protein: GenBank Accession Nos. NP_660341.2, NP # 001006667.1, etc .; genes (describing genes encoding them in the order of proteins described above): 匪 _145298.5, 匪 _001006666.1, etc.);

AP0BEC3G: Human AP0BEC3G (protein: GenBank Accession Nos. NP_068594.1, NP_001336365.1, NP_001336366.1, NP— 001336367.1, etc .; genes (describe the genes encoding them in the order of proteins described above): NM — 021822.3. NM_001349436. 1, 匪 _001349437.1, NM_001349438.1 and the like);

AP0BEC3H: Human AP0BEC3H (Protein: GenBank Accession Nos. NP_001159474.2, NP— 001159475.2, NP_001159476.2, NP_861438.3, etc .; genes (describe the genes encoding them in the order of proteins described above): 匪 _001166002.2, 丽_001166003.2, NM ᅳ 001166004.2, NM_181773.4, etc.);

AP0BEC4 (including AP0BEC3E): human AP0BEC4 (protein: GenBank Accession No. NP-982279.1 and the like; gene: GenBank Accession No. NM_203454.2 and the like); Mouse AP0BEC4 (protein: GenBank Accession No. NP — 001074666.1, etc .; gene: GenBank Accession No. NM — 001081197.1, etc.);

Act i vat ion-induced cytidine deaminase (AICDA or AID): human AID (protein: GenBank Accession Nos. NP— 001317272.1, NP_065712.1, etc .; gene (listing genes encoding it in the order of proteins described above): GenBank Accession Nos. VII- 001330343.1, NM_020661.3 and the like); Mouse AID (protein: GenBank Accession No. NP — 033775.1, etc .; gene: GenBank Accession No. Lli— 009645.2, etc.); And

CDA (cytidine deaminase; EC number 3.5.4.5; for example CDA1): GenBank Accession Nos. NP_001776.1 (gene: NM_001785.2), CAA06460.1 (gene: AJ005261.1), ΝΡ_416648.1 (gene: NC_000913.3) and the like.

As used herein, target specific nucleases, also called progra 睡 able nucleases, collectively refer to all forms of endonucleases capable of recognizing and cleaving specific positions on the desired genomic DNA. do. For example, the target specific nuclease may be one or more selected from all nucleases that recognize a specific sequence of the target gene and have nucleotide cleavage activity that may result in insertion and / or deletion (Indel) in the target gene. Can be.

For example, the target specific nuclease may be one or more selected from the group consisting of RGEN (RNA-guided engineered nuclease; for example, Cas9, Cpfl, etc.) derived from the microbial immune system CRISPR, but is not limited thereto. no.

In one embodiment, the target specific nuclease is of a type such as Cas protein (eg, Cas9 protein (CRISPR (Clustered regularly interspaced short palindromic repeats) associated protein 9), Cpfl protein (CRISPR from Prevotel la and Francisella 1), etc.). And / or at least one member selected from the group consisting of endonucleases involved in the type V CRISPR system. In this case, the target specific nuclease may further comprise a target DNA specific guide RNA for guiding to the target site of the genomic DNA. The guide RNA may be transcr ibed in vitro, such as, but not limited to, oligonucleotide duplex or plasmid template. The target specific nuclease and guide RNA may be used in the form of ribonucleic acid protein (RNP), wherein the ribonucleic acid protein is a complex or a combination of a target specific nuclease or its coding gene and RNA or its coding gene It may be included in the form of a complex.

Cas9 protein is a major protein component of the CRISPR / Cas system, a protein that can function as an activated endonuclease or nickase.

Cas9 protein or genetic information can be obtained from known databases such as GenBank of the National Center for Biotechnology Informat ion (NCBI). For example, the Cas9 protein Strap Toe Caucasus sp. {Streptococcus sp.), Such as Cas9 protein from Streptococcus pyogenes (eg SwissProt Accession number Q99ZW2 (NP_269215.1) (coding gene: SEQ ID NO: 4));

Cas9 protein from the genus Campylobacter, such as, for example, Campylobacter jejuni;

Cas9 protein from the genus Streptococcus, such as Streptococcus thermophi les or Streptococcus aureus;

Cas9 protein from Neisseria meningitidis);

Cas9 protein from Pasteureella PasteureJ d, such as Pasteurella multocida;

For example Cas9 protein from the genus Francisla F mci sella), such as, for example, Franciscan la novicida.

It may be one or more selected from the group consisting of, but is not limited thereto.

The Cpfl protein is an endonuclease of the new CRISPR system that is distinct from the CRISPR / Cas system, which is relatively small in size compared to Cas9, does not require tracrRNA, and can act by a single guide RNA. It also recognizes a thymine-rich protospacer-adjacent motif (PAM) sequence and cuts the double chain of DNA to create a cohesive end (cohesive double-strand break).

For example, the Cpfl protein may be found in the genus Candida iCandidatus, Lachnospira, Butyrivibrio, Peregr ini bacteria, and axadominococus.

From the genus Ucidominococcus, the genus Porphyromcmas, the genus Prevotella, the genus Francisel la, the Candi iatus Methanoplas a, or the genus Eubacterium. For example, Parcubacter ia bacterium (GWC2011 ᅳ GWC2_44—17), Lachnospiraceae bacterium (MC2017), Butyri vibrio proteoclasi icus, Per egr in ibact er ia bacterium (GW2011_GWA_33_10), Acidaminococcus sp. (BV3L6), Porphyromona s macacae, Lachnospiraceae bacterium (ND2006), Porphyromonas crevi or / cam 's, Prevotel la disiens, Mo r axel J a bovocul i (237), Smi ihel la sp. (SC— K08D17), Leptospira inadai, Lachnospiraceae bacterium (MA2020), Francisel la novicida (U112), Candidatus Methanoplasma termitum, Candidatus Paceibacter, Eubacter ium eligens, and the like, but are not limited thereto. The target specific endonucleases may be isolated from microorganisms or artificially or non-naturally produced such as recombinant or synthetic methods. In one example, the target specific endonucleases (eg Cas9, Cpf l, etc.) may be recombinant proteins made by recombinant DNA. Recombinant DNA (rDNA) refers to DNA molecules artificially produced by genetic recombination methods such as molecular cloning to include heterologous or homologous genetic material obtained from various organisms. For example; When the recombinant DNA is expressed in an appropriate organism to produce a target specific endonuclease (Un vivo or in ro), the recombinant DNA selects a codon optimized for expression in the organism among the codons encoding the protein to be prepared. It may be one having a nucleotide sequence reconstructed.

The inactivated target specific endonuclease inactivated target specific endonuclease refers to a target specific endonuclease that has lost endonuclease activity that cleaves a DNA double strand, for example, an endonuclease. At least one selected from inactivated target specific endonucleases that have lost activity and have Nikase activity and inactivated target specific endonucleases that have lost both endonuclease activity and Nikase activity have. In one example, the inactivated target specific endonuclease may have a Nikase activity, in which case the cytosine is converted to uracil simultaneously or sequentially with the cytosine being converted to uracil Or ni ck is introduced at the opposite strand (such as the opposite strand) (e.g., at a position corresponding to the third and fourth nucleotides in the 5 ¹ terminal direction of the PAM sequence to the opposite strand of the strand where the PAM sequence is present). ck is introduced). Such modifications (mutations) of the target specific endonuclease are at least catalyzed aspartic acid residues (cat a lytic aspar t ate res i due; e.g., in the tenth position for a Streptococcus pyogenes-derived Cas9 protein). Aspartic acid (D10), Glutamic acid at position 762 (E762), Histidine at position 840 (H840), Asparagine at position 854 (N854), Asparagine at position 863 (N863), Aspartic acid at position 986 (D986) ) And at least one selected from the group consisting of the same) may include a mutation of Cas9 substituted with any other amino acid, and the other amino acid may be alanine (al an i ne), but is not limited thereto.

As used herein, the 'other amino acids' are alanine, isoleucine, leucine, methionine, phenylalanine, plinine, tryptophan, valine, aspartic acid, cysteine, glutamine, glycine, serine, threonine, tyrosine, aspartic acid, Glutamic acid, arginine, histidine, lysine, among all known variants of the amino acids, refers to an amino acid selected from among amino acids except for those that the wild type protein originally had at the mutation site.

In one embodiment, where the inactivated target specific endonuclease is a modified Cas9 protein, the modified Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes (eg, Swi ssProt Access i on number Q99ZW2 (NP_269215. 1) a mutation at the D10 or H840 position (e.g., substitution with another amino acid) is introduced, resulting in a modified Cas9, _ Streptococcus pyogenes having lost endonuclease activity and having Nikase activity ^' of the mutation in both D ^'10 and H840 position in Cas9 protein (e. g., substitution of a different amino acid) is introduced endonuclease activity and Zernike rise lost all the active strain Cas9 be at least one member selected from the group consisting of proteins, etc. have. For example, the mutation at the D10 position of the CAs9 protein means a D10A mutation (mutation in which D, the tenth amino acid of the amino acids of the Cas9 protein, is replaced by A; hereinafter, a mutation introduced into Cas9 is represented by the same method). And the mutation at the H840 position may be a H840A mutation. In one embodiment, the inactivated target specific endonuclease comprises a Nikase (eg, a D10A mutation having a D10A mutation in which D10 of Cas9 protein (SEQ ID NO: 4) from Streptococcus pyogenes (SEQ ID NO: 4) is substituted for A). , Encoded by SEQ ID NO: 11).

The cytidine deaminase and inactivated target specific endonucleases are fused proteins fused to each other directly or via a peptide linker (e.g., cytidine deaminase—inactivated from the N-terminus to the C-terminal direction). Target-specific endonucleases located in target-specific endonuclease sequence (ie, inactivated target-specific endonucleases are fused to the C-terminus of cytidine deaminase) or inactivated target-specific endonucleases—cities Can be positioned in the order of the din deaminase (ie, the cytidine deaminase is fused to the C-terminus of the inactivated target specific endonuclease) Used in the form (or included in the composition), or in the form of a purified cytidine deaminase or mRNA encoding it and an inactivated target specific endonuclease or a combination of mRNA encoding it (or the above In the composition, or in the form of one plasmid containing both a cytidine deaminase coding gene and an inactivated target specific endonuclease coding gene (eg, the two genes are included to encode the fusion protein described above). Target-specific endonuclease coding genes or inactivated (or included in the composition) or inactivated cytidine deaminase expression plasmids each contained in separate plasmids. Use in the form of a complex of a target specific endonuclease expression plasmid (or the composition above) On may be included). In one embodiment the fusion protein is located in the sequence N—terminal to C-terminal, in the order of cytidine deaminase-inactivated target specific endonuclease, or inactivated ^' target specific endonuclease- Located in the order of Citidine Diaminase. A fusion protein, or a cytidine deaminase coding gene and a target specific endonuclease coding gene inactivated to encode the fusion protein, may be used in the form included in one plasmid.

The plasmid may be any plasmid including an expression system capable of inserting the cytidine deaminase coding gene and / or inactivated target specific endonuclease coding gene and expressing it in a host cell. The plasmid contains elements for gene expression of interest, and may include a rep i cat ion or igin, a promoter, an operator, a transcription terminator, and the like. Appropriate enzyme sites (eg, restriction enzyme sites) for introduction into the genome of cells and / or selection markers to confirm successful introduction into the host cell and / or ribosomal binding sites for translation into proteins (r ibosome binding si te; RBS) and / or electronic control factors, and the like. The plasmids are plasmids used in the art such as pcDNA series, pSClOl, pGV1106, pACYC177, ColEl, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, _P IJ61, pLAFRl, pHV, pGEX series, pET Series, pUC19 may be one or more selected from the group consisting of, but is not limited thereto. The host cell is a cell (eukaryotic cell comprising a mammalian cell such as a human cell) or the cytidine to be subjected to base correction or double strand cleavage by the cytidine deaminase. Any cell capable of expressing a diaminease coding gene and / or an inactivated target specific endonuclease coding gene to express cytidine deaminase and an inactivated target specific endonuclease (eg, E coli, etc.).

The guide RNA serves to guide a mixture or fusion protein of the cytidine deaminase and the inactivated target specific endonuclease to the target site, and CRISPR _. It may be one or more selected from the group consisting of RNA (crRNA), iray75-act ivat ing crRNA (tracrRNA), and single guide RNA (sgRNA), specifically double-stranded crRNA in which crRNA and tracrRNA are bonded to each other: The tracrRNA complex, or crRNA or portion thereof, and the tracrRNA or portion thereof may be single stranded guide RNA (sgRNA) linked by an oligonucleotide linker.

The specific sequence of the guide RNA may be appropriately selected depending on the type of target specific endonuclease used or the microorganism derived therefrom, which is easily understood by those skilled in the art. .

When using a Cas9 protein from Streptococcus pyogenes as a target specific endonuclease, the crRNA can be expressed by the following general formula (1):

5 '-(N _cas9 ) i- (GUUUUAGAGCUA)-(X _cas9 ) _m -3' (Formula 1)

In the general formula 1,

N _cas9 is a targeting sequence, i.e., a site determined according to the sequence of the target site of the target gene (ie, the sequence can be hybridized with the sequence of the target site), and 1 is included in the targeting sequence. Indicative of the number of nucleotides formed, which may be an integer from 17 to 23 or 18 to 22, such as 20;

The site comprising 12 consecutive nucleotides (GUUUUAGAGCUA; SEQ ID NO: 1) located adjacent to the 3 'direction of the target sequence is an essential part of the crRNA,

X _cas9 is a site comprising m nucleotides located at the 3 'end of the crRNA (ie, located adjacent to the 3' direction of an essential part of the crRNA), where m is an integer from 8 to 12, such as 11 The m nucleotides may be the same as or different from each other, and may be independently selected from the group consisting of A, U, C, and G. In one example, the X _cas9 may include UGCUGUUUUG (SEQ ID NO: 2), but is not limited thereto.

In addition, the tracrRNA may be represented by the following general formula (2):

5 — (Ycas9) p 一

(Formula 2)

In the general formula 2,

60 nucleotides

(UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCMCUUGAAAAAGUGGCACCGAGUCGGUGC;

The site represented by SEQ ID NO: 3) is an integral part of the tracrRNA,

Y _caS 9 is a site comprising p nucleotides located adjacent to the 5 'end of the essential portion of the tracrRNA, p may be an integer of 6 to 20, such as an integer of 8 to 19, the p nucleotides are May be the same or different and may be independently selected from the group consisting of A, U, C and G, respectively.

In addition, the sgRNA is targeted to the crRNA.The crRNA portion comprising the sequence and the essential portion and the tracrRNA portion including the essential portion (60 nucleotides) of the tracrRNA form a hairpin structure through the oligonucleotide linker (stem-loop structure). (In this case, the ligonucleotide linker corresponds to the loop structure). More specifically, the sgRNA is a double-stranded RNA molecule in which a crRNA portion including a targeting sequence and an essential portion of the crRNA and a tracrRNA portion including an essential portion of the tracrRNA are bonded to each other. 'The terminal may have a hampin structure connected via a ligonucleotide linker.

In one example, the sgRNA can be represented by the following general formula 3:

5'—

(Oligonucleotide linker)-

(Formula 3)

In Formula 3, (Ncasg)! Is the same as described above in Formula 1 as the targeting sequence.

The ligonucleotide linker included in the sgRNA may be one containing 3 to 5, such as 4 nucleotides, The nucleotides may be the same or different from each other, and may be independently selected from the group consisting of A, U, (: and G).

The crRNA or sgRNA may further comprise 1-3 guanine (G) at the 5 'end (ie, the 5' end of the targeting sequence region of the crRNA).

The tracrRNA or sgRNA may further comprise a termination region comprising 5 to 7 uracils (U) at the 3 ′ end of the essential portion (60nt) of the tracrRNA.

The target sequence of the guide RNA is adjacent to 5 'of the PAM (Protospacer Adjacent Motif sequence (5.— NGG-3 ¹ (N is A, T, G, or C) for pyogenes Cas9)) on the target DNA. And from about 17 to about 23 or from about 18 to about 22, such as 20 contiguous nucleic acid sequences.

The targeting sequence of the guide RNA, which is capable of hybridizing with the target sequence of the guide RNA, is the DNA strand in which the target sequence is located (ie, the PAM sequence (5′— NGG-3 ′ (N is A, T, G, or C)). position nyukeul of the complementary strands of the DNA strands) to Leo tide sequence that is at least 50%, at least 60%, at least 70%, 80%, at least 90% or 95%, more than 99%, or 100% sequence ^" It means a nucleotide sequence having complementarity, it is possible to complementarily bind to the nucleotide sequence of the complementary strand.

In the present specification, the nucleic acid sequence of the target site is a PAM sequence of two DNA strands of the corresponding gene site of the target gene ^. The plaque is represented by the stranded nucleic acid sequence. At this time, since the DNA strand to which the guide RNA actually binds is the complementary strand of the strand where the PAM sequence is located, the targeting sequence included in the guide RNA is changed from T to U on the basis of RNA characteristics. It will have the same nucleic acid sequence as the sequence. Thus, in this specification, the targeting sequence of the guide RNA and the sequence of the target site (or the sequence of the cleavage site) are represented by the same nucleic acid sequence except that T and U are mutually altered.

The guide RNA may be used in the form of RNA (or included in the composition), or in the form of a plasmid containing DNA encoding the same (or in the composition).

The compositions and methods described herein can be characterized as including or not using uracil-specific removal reagents (USER). The uracil-specific removal reagent serves to remove uracil converted from cytosine by the cytidine deaminase and / or to introduce DNA cleavage at the position where the uracil is removed. It can include all materials.

In one embodiment, the uracil-specific removal reagent (USER) comprises uracil DNA glycosylase (UDG), endonuclease VIII, and combinations thereof. In one example, the uracil-specific removal reagent may comprise an endonuclease VIII or a combination of uracil DNA glycosylase and endonuclease VIII.

Uracil DNA glycosylase (UDG) is an enzyme that acts to prevent the mutagenesis of DNA by removing uracil (U) present in DNA, and by cutting the N-glycosylic bond of uracil, base—excision repair One or more of the enzymes that play a role in initiating the (BER) pathway can be selected. For example, the uracil DNA glycosylase is Escherichia coli uracil DNA glycosylase (eg, GenBank Accession Nos. ADX49788.1, ACT28166.1, EFN36865.1, BAA10923.1, ACA76764.1, ACX38762.1, EFU59768 .1, EFU53885.1, EFJ57281.1, EFU47398.1, EFK71412.1, EFJ92376.1, EFJ79936.1, EF059084..1, EFK47562.1, ΚΧΗΟ 1728.1, ESE25979.1 ESD99489.1, ESD73882.1, ESD69341.1, etc.), human uracil DNA glycosylase (such as GenBank Accession Nos. NP_003353.1, NP_550433.1, etc.), mouse uracil DNA glycosylase (such as GenBank Accession Nos. NP_001035781.1, NP_035807.2 Etc.) may be one or more selected from the group consisting of, but is not limited thereto.

The endonuclease VIII serves to remove the nucleotide from which the uracil has been removed, resulting from N-glycosylase activity that removes uracil damaged by the uracil DNA glycosylase from the double-stranded DNA and the damaged uracil removal. At least one may be selected from all enzymes having both AP-lyase activity that cleaves 3 'and 5' ends of an apurinic site (AP site). For example, the endonuclease VIII is human endonuclease VIII (eg, GenBank Accession Nos. BAC06476.1, ΝΡ_001339449.1, ΝΡ_001243481.1, ΝΡ_078884.2, ΝΡ_001339448.1, etc.), mouse endonuclease VIII (Eg, GenBank Accession Nos. BAC06477.1, NP-082623.1, etc.), Escherichia coli endonuclease VIII (eg, GenBank Accession Nos. OBZ49008.1, 0BZ43214.1, 0BZ42025.1, ANJ41661.1, KYL40995.1 , KMV55034.1, 丽 53379.1, 丽 50038.1, KMV40847.1, AQW72152.1, etc.), and the like. It is not.

Other examples include (a) deaminase or its coding gene (cDNA, rDNA, or mRNA), (b) inactivated target specific endonuclease or its coding gene (cDNA, rDNA, or mRNA), and (c) guide RNA or a coding gene thereof,

Provided is a method of creating a double strand break in DNA comprising introducing into or contacting DNA isolated from the cell. The method may be one that does not include treating uracil-specific Excision Reagent (USER).

Thus, by generating (or introducing) a single stranded break in the DNA, genomic DNA. Alternatively, at the target site of the DNA, the site where the base correction (base editing, ie, the conversion from C to U) occurs by the cytidine deaminase, or the location where the single-strand break is generated (introduced), and the base calibration efficiency can be analyzed. Through this, the base calibration efficiency at the .on-target site, the specificity of the on-target sequence, the off-target sequence, and the like can be identified (or measured).

Another example is

(i) (a) diaminase or its coding gene (cDNA, rDNA, or mRNA), (b) inactivated target specific endonuclease or its coding gene (cDNA, rDNA, .or mRNA), and (c) introducing a guide RNA or a coding gene thereof into the cell or contacting DNA isolated from the cell to induce DNA single strand break; And

(ii) analyzing the nucleic acid sequence of the single-stranded DNA fragment, provides a method for nucleic acid sequence analysis of DNA introduced with a base editing by a diminase. The method may not comprise the step of treating the uracil-specific removal reagent (USER) to generate a double strand break in the DNA.

Another example is

(i) (a) diaminase or its coding gene (cDNA, rDNA, or mRNA), and (b) inactivated target specific endonuclease or its coding gene (cDNA, rDNA, or mRNA) and ( c) introducing a guide RNA or a coding gene thereof into the cell or contacting DNA isolated from the cell to induce DNA single strand break;

(ii) analyzing the nucleic acid sequence of the cleaved DNA fragment; And (iii) identifying the single stranded cleavage site from the nucleic acid sequence data obtained by the analysis

Confirming (or measuring or detecting) base calibration sites, single-strand cleavage sites, on-target sites, base calibration efficiency, off-target sites, and / or target specificities, including, Provide a way to. The method, for example, after step (Π) and before, concurrently or after step (iii), (iii-1) base calibration (eg, cytosine (e.g., cytosine) in nucleic acid sequence data obtained by the analysis. C) may further comprise determining whether to convert to uracil (U) or thymine (T). The method may not comprise the step of treating the uracil-specific Excision Reagent (USER) to generate double strand breaks in the DNA.

In one example, the method (e.g., base calibration efficiency at an on-target site, a method of identifying off-target sites), wherein after step (iii), (iv) the cleavage site is a target site If not (on-target site), may further comprise the step of identifying (determining) the off-target site.

The deaminase, inactivated target specific endonuclease, guide RNA and uracil-specific ablation reagents are as described above.

The methods provided herein may be performed in cells or in vitro, for example, may be performed in vitro. More specifically, all steps of the method are carried out in vitro, or step (i) is performed intracellularly, and step (ii) and subsequent steps are performed in the cell where step (i) is performed. The extracted DNA (eg, genomic DNA) may be used to perform in vitro. Said step (i) comprises transfecting or extracting a deaminase (or a coding gene thereof) and an inactivated target specific endonuclease (or a coding gene thereof) and a guide RNA to the cell, or extracted from the cell. Contacting (eg, incubating with) DNA to induce base correction (base conversion, such as cytosine to urachal) and nick generation in a single strand of DNA within the target site targeted by the guide RNA. The cell may be selected from all eukaryotic cells intended to introduce base correction and / or single stranded cleavage by deaminase, eg, may be selected from mammalian cells, including human cells. The transfection is

(1) a combination of diamines, deactivated target specific endonucleases, and guide RNAs or complexes to which they are bound (ribonucleic acid protein; RNP),

(2) a combination of diaminase encoding _m RNA, inactivated target specific endonuclease encoding mRNA, and guide RNA, or

(3) a plasmid (recombinant vector) comprising a diaminase coding gene and a target specific endonuclease coding gene, respectively, or a plasmid comprising a guide RNA or guide RNA coding gene

It may be carried out by introducing into the cell by any conventional means, for example, the introduction may be performed by electroporation, lipofection, microinjection and the like, but is not limited thereto.

In one embodiment, said step (i) comprises the step of base correction (base correction site, base calibration efficiency, etc.) and / or single strand cleavage (cutting site, cleavage) by the cell (diaminase and inactivated endonuclease). DNA extracted from the cells to be confirmed (eg, efficiency, etc.) is subjected to a deaminase and an inactivated target specific endonuclease (e.g., a fusion protein comprising a satidine deaminase and an inactivated Cas9 protein) and a guide. By incubation with RNA {in vitro). DNA extracted from the cell may be a genomic DNA or a polymerase chain reaction (PCR) amplification product comprising a target gene or a target site.

Optionally, after performing (or completing) said step (i) and before performing step (Π), the deaminase, inactivated target specific endonuclease, and / or guide RNA used in step (1) are removed. It may further comprise a step. In addition, after performing (or completing) the step (i), before performing step (Π), the step of smoothing (or end repairing) the double-stranded DNA fragment in which the single-strand break may occur may be further included. The terminal smoothing step (b) removes the extended nucleotides on the 3 'side (complementary position with the 5 ¹ terminal side of the cleavage point of the cleaved strand) in the double stranded DNA fragment where the single strand cleavage occurred. A 3'-to_5 'trimming step (cutting), and / or (c) a double stranded DNA fragment in which a single strand break has occurred, 3' at the cleavage point of the strand where the break occurred It may further comprise a 5'-to-3 'DNA synthesis step that extends the terminal nucleotides (see figure in Example 1). Said 3'- to-5 'cleavage step is carried out using an appropriate conventional exonuclease. Can be done. The 5'-to-3 'DNA synthesis step can be carried out using any suitable conventional DNA polymerase.

In addition, optionally, to facilitate nucleic acid sequencing of the DNA fragment of step (ii) after performing (or completing) the step (i), the single stranded DNA fragment (DNA double strand) A contiguous 10-30 nt or 15-25 nt oligonucleotide comprising the cleavage site of the cleaved strand and / or a contiguous position comprising a (complementary) position corresponding to the cleavage position of the uncleaved strand 10 to 30nt or 15 to 25ht of oligonucleotide) may be further included. The single stranded DNA fragments used for nucleic acid sequencing in step (Π) above are not contiguous with 10 to 30 nt or 15 to 25 nt of ligonucleotides and / or cleavage, including the cleavage sites of the strands where the single strand cleavage has occurred. Contiguous 10-30nt or .15-25nt oligonucleotides comprising a (complementary) position opposite to the cleavage position of the strand; And / or amplification products of the oligonucleotides.

The deaminase and inactivated target specific endonucleases are used in conjunction with guide RNAs to have sequence specificity and thus act mostly on-target, but at target sites other than the target sequence. Depending on how much similar sequences are present, side effects may occur that affect off-target sites. As used herein, an off-target site is not a target site for deaminase and inactivated target specific endonuclease, but the deaminase and inactivated target specific endonuclease are active. Say a location with. In other words, it refers to a position other than the target position that is base corrected and / or cleaved by a deaminase and inactivated target specific endonuclease. In one example, the non-target position is to be used in a concept that includes not only the actual non-target position for the deaminase and inactivated target specific endonuclease, but also a potential non-target position that is likely to be a non-target position. Can be. The non-target position may mean any position other than the target position cleaved by the deaminase and inactivated target specific endonuclease in vitro, but not limited thereto.

The deaminase and inactivated target specific endonuclease having activity at a position other than the target position can be caused by various causes. For example, a nucleotide mismatch with a target sequence designed for a target site Because of the low level of (mi smatch), there is a possibility that deaminase and inactivated target specific endonucleases work for sequences other than the target sequence (non-target sequence) that have high sequence homology with the target sequence.

The non-target position may be, but is not limited to, a sequence region (gene region) that satisfies one or more of the following conditions:

2 or more, such as 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more;

In the double-stranded DNA fragment, the strand in which the cleavage occurred and the complementary strand comprise the PAM sequence;

Among the double-stranded DNA fragments, the strand in which the cleavage occurred and the complementary strand were not more than 15 or 10 or less, such as 1 _. 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 1 to Includes seven, one to six, one to five, one to four, one to three, one to two, or one mismatch nucleotide; And

Among the double-stranded DNA fragments, the cleaved and complementary strands contain base correction (conversion of one or more cytosines (C) to uracil (U) or thymine _. (T)).

^{The operation of} deaminase and inactivated target specific endonucleases at non-target positions can cause mutations of unwanted genes in the genome, which can cause serious problems. Therefore, the process of accurately detecting and analyzing non-target sequences as well as the activity at the target sites of the deaminase and inactivated target specific endonuclease can be very important and specific to the target sites without any known non-target effects. It may be useful to develop diaminase and inactivated target specific endonucleases that operate independently.

For the purposes of the present invention, the cytidine deaminase and the inactivated target specific endonuclease may have activity in vivo (Un vivo) and in vitro Un / ro), and therefore, in vitro (eg, genomes). DNA) can be used to detect non-target positions, which, when applied in vivo, are expected to have activity at the same position as the detected non-target position (genetic position (site) containing non-target sequence). Can be.

Step (ii) is a step of analyzing the nucleic acid sequence of the DNA fragment cut (single stranded) in step (i), all conventional nucleic acid sequence analysis It may be carried out by the method. For example, the separated used in step (1)

If the DNA is genomic DNA, the nucleic acid sequencing may be performed by whole genome sequencing. When performing whole genome sequencing, the ratio of cleavage by target specific nucleases substantially at the level of the entire genome is unlike the indirect method of looking for sequences that are homologous to the sequence of the target site and predicting that they are nontarget sites. Since the target position can be detected, the non-target position can be detected more accurately. As used herein, "whole genome sequencing (WGS)" is a method for reading a genome in multiples of 10x, 20x, 40x format for full-length genome sequencing by next generation sequencing. Means. "Next-generation sequencing" is a technology that fragments the full-length genome in chip-based and PCR-based paired end formats, and performs the sequencing of the fragments at high speed based on chemical hybridization. it means.

Step (iii) is a step of identifying (or determining) the position at which DNA is cleaved from the sequence read data obtained in step (ii), and analyzing the sequencing data to generate an on-target site. And off-target sites can be detected easily. Determining the specific location of DNA cleavage from the sequencing data can be performed by various approaches. The present specification provides various rational methods for determining the location. However, this is only an example included in the technical idea of the present invention and the scope of the present invention is not limited by these methods.

For example, as an example for determining the cleaved position, when the sequence data obtained through the entire genome sequencing is aligned according to the position on the genome, the position where the 5 'end is vertically aligned may mean the position where the DNA is cleaved. Can be. Sorting the sequence data according to the position on the genome may be performed using an analysis program (eg, BWA / GATK or ISAAC, etc.). As used herein, the term "vertical alignment" refers to the adjacent Watson st rand and the Crick strand, respectively, when analyzing the whole genome sequencing results by a program such as BWA / GATK or ISAAC. Refers to an arrangement in which the 5 'end of two or more nucleotide sequences data starts at the same nucleotide position on the genome. Due to this, the DNA fragments which are cut in step (ii) and have the same 5 'end appear in sequence.

That is, when the cleavage in step (1) occurs at the target position and the non-target position, when the sequence data are aligned, the commonly cleaved sites are vertically aligned because their positions each start at the 5 'end, but are not cleaved. Since the 5 'end is not present in the non-site, the alignment may be arranged in a staggered manner. Thus, the vertically aligned position can be seen as the cleaved site in step (i), which may mean a target position or non-target position cleaved by an inactivated target specific endonuclease.

The term "alignment" means mapping base sequence data to a reference genome and arranging bases having the same position in the genome according to each position. Any computer program can be used as long as it can be sorted, and it can be selected from programs known in the art, or programs designed for the purpose. However, it is not limited thereto.

As a result of the alignment, the position where the DNA is cleaved by the deaminase and the inactivated target specific endonuclease can be determined by a method such as finding a position where the 5 'end is vertically aligned as described above. If the location is not an on-target site, it can be determined as an off-target site. In other words, a sequence identical to the base sequence designed as the target position of the deaminase and inactivated target specific endonuclease is a target position, and a sequence not identical to the base sequence may be regarded as a non-target position. This is obvious by definition of the non-target location described above.

The method (eg, base calibration efficiency at on-target site, off-target site identification method) is such that after step (iii) the cleavage site is not an on-target site. In this case, the method may further include identifying (determining) the off-target se.

The cut strands in the DNA fragments cleaved by the braces (diaminase and inactivated target specific endonuclease) are vertically aligned at the 5 'end. DNA reads in which the 5 'end is vertically aligned (DNA read; as used herein, the 5' end is vertically aligned and the same nucleic acid sequence The number of cleavage sites can be determined according to the number of DNA fragments having the same or a population of the DNA fragments). For example, when the number of DNA reads vertically aligned at the 5 'end is 1, it can be confirmed that the cleavage occurs only at one position, that is, at the target position, by the braces. When the number of DNA reads vertically aligned at the 5 'end is 2 or more, for example, 3 or more, 4 or more, 5 or more, 6 or more, Ί or more, 8 or more, 9 or more, or 10 or more, cleavage at a plurality of locations It can be confirmed that this has occurred, which means that there is DNA cleavage at a position other than the target position (non-target position). In addition, one of the DNA reads whose vertical 5 'ends are not the target position (ie, having a nucleic acid sequence different from the nucleic acid sequence of the target position) may be identified (or determined) as a non-target position.

Thus, ^identifying the single-stranded cleavage position of step (iii) may comprise (a) identifying (or measuring) the number of DNA reads that are vertically aligned at the 5 'end. In this case, when the number of DNA reads vertically aligned at the 5 'end is 2 or more, for example, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 or more, the position other than the target position It can be confirmed (or determined) that DNA cleavage has occurred at the (non-target position). Also, in this case, the step of identifying as the non-target position of step (iv) may include (i v-1) having a nucleic acid sequence different from that of the target position in the DNA read in which the two or more 5 'ends are vertically aligned. Identifying (or determining) the DNA read to a non-target location.

In addition, it is confirmed whether the non-target position includes the PAM sequence (more specifically, DNA reads having a nucleic acid sequence different from that of the target position in the DNA read whose 5 ′ end is vertically aligned among the cut DNA fragments; By checking whether the complementary strand (strand with complementary sequence) contains the PAM sequence), thereby excluding the erroneously cleaved position rather than the target specific cleavage by the target specific endonuclease included in the calibrator This can further increase the accuracy of the non-target position. Thus, identifying the single stranded cleavage position of step (iii) comprises: (b) confirming whether the non-target position comprises a PAM sequence, e.g., in the truncated DNA fragment, the 5 'end is vertically aligned. DNA strands having a nucleic acid sequence different from the nucleic acid sequence at the target position among the DNA reads that are complementary strands (strands having complementary sequences) include a PAM sequence specific for the target-specific endonuclease included in the braces. It may further comprise the step of checking whether or not. In this case, to the non-target position of step (iv) (Iv-2) Among the truncated DNA fragments, the DNA read having a nucleic acid sequence different from the nucleic acid sequence at the position of the cut out of the DNA read whose vertical alignment of the 5 'end is complementary with the strand having the complementary sequence. ) Includes a PAM sequence specific for the target specific endonuclease included in the braces, it may comprise the step of identifying (or determining) the non-target position.

In addition, the non-target position may be composed of a sequence having homology with the sequence of the target position. More specifically, since the target position sequence is represented by the nucleic acid sequence of the strand including the P ′ sequence, the non-target position is determined by the nucleic acid sequence of the target position in the DNA read whose vertical 5 ′ is aligned in the truncated DNA fragment. Nucleic acid sequences of DNA reads with different nucleic acid sequences and complementary strands (strands with complementary sequences) have one or more nucleotide mismatches with the target position, more specifically with the target position (target sequence). Up to 10 or less, such as 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11 _ᅤ 1 to 10, 1 to 9, It may have 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 nucleotide match .

Thus, identifying the single stranded cleavage site of step (iii) comprises: (c) a DNA read having a nucleic acid sequence that is different from the nucleic acid sequence of the target position in the DNA read whose vertical 5 'end is aligned in the truncated DNA fragment; And complementary strands

(Identifying (or measuring) the number of mismatched nucleotides relative to the target position sequence of the strand with the complementary sequence). In this case, the number of mismatched nucleotides is 15 or less or 10 or less, for example, 1 to 15, 1 to 14, 1 to 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2 In individual cases, the DNA read can be identified (or determined) as DNA cleavage has occurred at a position other than the target position (non-target position). Also, in this case, the step of identifying the non-target position of step (IV) may be performed by (iv-3) a nucleic acid sequence different from the nucleic acid sequence of the target position in the DNA read whose vertical 5 'end is aligned in the cut DNA fragment. Up to 15 or 10 or less, such as 1 to 15, 1 to 14, 1 to 1, mismatched nucleotides to the target position sequence of the DNA read and the complementary strand (the strand with the complementary sequence) 13, 1 to 12, 1 to 11, 1 to 10, 1 to 9, 1 In the case of 8 to 1, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 to 2, identification (or determination) by non-target position It may include the step).

Step (iii) may comprise one or more of steps (a), (b), and (c) (eg, step (a) and one or more of (b) and (c)), wherein When two or more of (a), (b), and (c) are included, they may be performed simultaneously or sequentially in any order. Further, step (iv) may comprise at least one of steps (iv1 1), (iv-2), and (iv-3) (e.g., steps (iv-1) and (iv-2) and (iv-3) And at least two of steps (iv-1), (iv-2), and (iv-3), which are performed simultaneously or sequentially, regardless of order. It may be.

Confirming whether the step (iii-Ι) of the base correction (for example, the conversion of cytosine (C) to uracil (U) or thymine (T)), the 5 'end of the cut DNA fragments, vertical alignment Complementary strands (strands with complementary sequences) with DNA reads having a nucleic acid sequence different from the nucleic acid sequence at the target position among the DNA reads are subjected to nucleotide correction (uracil (U) or thymine (T) of one or more cytosines (C) It may be to include a step of determining (measure) whether or not). In this case, identifying the non-target position of step (iv) includes (iv-4) having a nucleic acid sequence different from the nucleic acid sequence of the target position in the DNA read whose vertical 5 'end of the truncated DNA fragment is vertically aligned. If the DNA read and the complementary strand (strand with complementary sequences) comprise base correction (conversion of one or more cytosines (C) to uracil (U) or thymine (T)), they are identified as non-target positions (or Determining) may be included.

In one embodiment, the single strand is cut by performing step (i) on the genomic DNA, followed by whole genome analysis (step (ii)), and then aligned with ISAAC to vertically aligned and not cut at the cut position. At the location, a pattern that is aligned in a staggered manner is identified, and when this is represented by a 5 'terminal plot, a unique pattern may appear at the cut site.

Further, but not limited to, Watson strand as a specific example

A non-target position may be determined as a position where two or more sequence reads corresponding to the Watson strand and the Crick strand are vertically aligned, respectively, and more than 20% of the sequence data. Are vertically aligned and have the same 5 'end at each Watson strand and Creek strand. It can be determined that the position where the number of the nucleotide sequence data is 10 or more is a non-target position, that is, a position to be cleaved.

In the above method, the process of steps (Π) and (iii) may be Digenome—seq (di ested-genome sequencing), and more details are described in Korean Patent Publication No. 10-2016-0058703 Incorporated herein by reference).

By the methods described above, the base calibration site and / or single strand cleavage site of the diminase, the base calibration efficiency or target specificity at the on—target site (ie, the base calibration or cleavage frequency at the on-target site) / [Total base calibration or cleavage frequency]), and / or non-target sites (off—target site; one that is identified as the base calibration site of the diminase but not on-target) can do.

Make the non-target position (detection) can be carried out by treating the non-specific deaminase, and an active target enemy endonuclease in vitro Un w ^'ro) in the dielectric DNA. Therefore, it can be confirmed whether the non-target effect is substantially observed in vivo with respect to the non-target position identified (detected) through the above method. However, since this is only an additional verification process, it is not an essential step in the scope of the present invention, but is only a step that may be additionally performed as necessary.

As used herein, the term "off-target effect"'can be used to mean the level at which base correction and / or double stranded cleavage occurs at off-target ^, site. The term “Insertion and / or deletion (Indel)” generically refers to variations in which some bases are inserted or deleted in the base sequence of DNA.

【Effects of the Invention】

The DNA single strand cleavage method using cytidine deaminase provided herein and nucleic acid sequencing techniques using the same can provide more accurate and more accurate detection of the base correction position, target specificity, and / or non-target position of the cytidine deaminase. It can be confirmed efficiently. ― 【Brief Description of Drawings】

1 is a representative IGV image showing C → U transformation and straight alignment at the target location of EMX1.

Figure 2 shows the sequence reads from only one strand obtained with Digenome-seq results. Shows the number of mcked sites with uniform alignment and the number of PAM-containing sites with a mismatch of 10 or less of these locations.

3A is a cleavage map of the rAP0BECl-XTEN-dCas9-NLS vector.

3B is a cleavage map of the rAP0BECl-XTEN-dCas9—UGI-NLS vector.

3C is a cleavage map of the rAP0BECl-XTEN-Cas9n-UGI-NLS vector.

4 is a cleavage map of the Cas9 expression plasmid.

5 is a cleavage map of the pET28b_BEl vector.

6 is a _P-BE3 delta ET28b a cleavage map of the UGI vector.

[Specific contents for implementation of the invention]

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

[Reference Example]

1. Cell Culture and Transfection

HEK293T cells (ATCC CRL-11268) were maintained in DMEM (Dulbecco Modified Eagle Medium) medium supplemented with 10¾ (w / v) FBS and l% (w / v) penicillin / Streptomycin (Welgene). HEK293T cells (1.5xl0 ⁵ ) were inoculated in 24-well plates, sgRNA plasmid (500 ng) and Lipofectamine 2000 (Invitrogen), and Base Editor ^' plasmid (Addgene plasmid # 73019 (Expresses BE1 with C— terminal NLS in) mammalian cells; rAPOBECl—XTEN 一 dCas9-NLS; FIG. 3A), # 73020 (Expresses BE2 in mammalian cells; rAPOBECl-XTEN-dCas9-UGI-NLS; FIG. 3B), # 73021 (Expresses BE3 in mammalian cells; rAP0BECl-XTEN -Cas9n-UGI-NLS; FIG. 3C)) (1.5 ^ g) or Cas9 expression plasmid (Addgene plasmid # 43945; FIG. 4) was transfected (at ˜80% confluency). Genomic DNA was isolated 72 hours after transfection using the DNeasy Blood & Tissue Kit (Qiagen). The cells were not tested for mycoplasma contamination.

The sgRNAs used in the Examples below are the PAM sequences (5'-NGG-3 ', where N is A, T) at the 5' end of the target site sequence (target sequence; EMX1 on—target sequence; GAGTCCGAGCAGAAGMGAAGGG (SEQ ID NO)). , G, or C)) was used as the targeting sequence '(N _cas9 ) r of the following general formula 3 in which T was replaced with U: 5 "-(N _cas g) _1- (GUUUUAGAGCUA SEQ ID NO: l)-(GAAA)-SEQ ID NO: 3) -3 '(formula 3; oligonucleotide linker: GAM).

2. Protein Purification

A plasmid encoding Hi _S 6-rAP0BECl-XTEN-dCas9 protein (pET28b-BE1; Expresses BE1 with N—terminal His6 tag in E. Col i; FIG. 5) was provided by David Liu (Addgene plasmid # 73018). His6-rAP0BECl-nCas9 protein (BE3 delta UGI; BE3 variant lacking the UGI domain) was substituted by H840 in the plasmid pET28b-BEl encoding His6-rAP0BECl-XTEN ᅳ dCas9 protein using site directed mutagenesis. Plasmid (pET28b-BE3 delta UGI; FIG. 6) was constructed.

Rosetta expressing cells (Novagen, catalog number: 70954-3CN) were transformed with pET28b-BEl or pET28b-BE3 delta UGI prepared above, Lur ia-Bertani containing 100 g / ml kanamycin and 50 mg / ml carbenici 1 in (LB) incubated overnight at 37 ^° C in brot. 10 ml of overnight cultures of Rosetta cells containing pET28b_BEl or pET28b—BE3 delta UGI were inoculated into 400 ml LB broth containing 100 / g / ml kanamycin and 50 mg / ml carbenici 1 in and OD600 reached 0.5-0.6. Incubate at 30 ^° C until. The cultured cells were cooled to 16 ^° C. for 1 hour, supplemented with 5 mM IPTGdsopropyl β_D— 1—thiogalactopyranoside) and incubated for 14-18 hours.

For protein purification, cells were harvested by centrifugation at 5000x _g for 10 min at 4 ^° C, lysozyme (Sigma) and protease inhibitors (Roche complete, EDTA—free) supplemented lysis buffer (50 mM NaH ₂ P0 ₄ , Solubilized in 5 ml of 300 mM NaCl, 1 mM DTT and 10 mM imidazole, pH 8.0). The obtained cell reaction product was centrifuged at 13,000 rpm for 30 minutes at 4 ^° C., and the soluble cell lysate obtained was incubated with Ni-NTA agarose resin (Qiagen) at 4 ^° C. for 1 hour. Cell lysate / Ni-NTA mixture was applied to the column and washed with buffer (50 mM NaH ₂ P0 ₄ , 300 mhl NaCl and 20 mM imidazole, pH 8.0). BE3 protein was eluted with elution buffer (50 mM NaH ₂ P0 ₄₎ 300 mM NaCl and 250 mM imidazole, pH 8.0). The eluted protein was stored by buffer replacement with storage buffer (20 mM HEPES-KOH (pH 7.5), 150 mM KC1, 1 mM DTT and 20% glycerol) and concentrated using a centrifugal filter unit (Millipore), rAP0BECl -nCas9 protein was purified. 3. Deamination of Genomic DNA

Genomic DNA was purified (extracted) from HEK293T cells using the DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer's instructions. Genomic DNA (10 ig) was buffered (100 mM NaCl, 40 mM for 8 hours at 37 ^° C with a reaction volume of 500 with rATOBECl—nCas9 protein (300 nM) and sgRNA (900 nM) purified in Reference Example 2 above. ) Hris-HCl, 10 mM MgC12, and 100 / g / ml BSA, pH 7.9).

The sgRNA used above was the PM sequence at the 5 'end of the target site sequence (target sequence; EMX1 on—target sequence; GAGTCCGAGCAGAAGAAGMGGG (SEQ ID NO: 14)) (5'-NGG-3' (N is A, T, G, or The sequence in which T was replaced with U in the sequence except for C) was used as the targeting sequence '(Nca ^ ¹⁾ of the following general formula 3:

5 ^1- (N _cas9 ),-(GUUUUAGAGCUA)-(GAM)-

(Formula 3; oligonucleotide linker: GAM).

Using RNase A (50 / g / mL). After removal of the sgRNA, uracil containing genomic DNA was purified by DNeasy Blood & Tissue Kit (Qiagen). Target sites were PCR amplified using SUN—PCR blends and Sanger sequencing to confirm BE3-mediated cytosine deamination and DNA cleavage.

4. Whole Genome and Di genome Sequencing

Genomic DNA (1) was fragmented in the 400-500 bp range using Covaris system (Life Technologies) and blunt-ended using End Repair Mix (Thermo Fischer). A library was generated by connecting fragmented DNA with an adapter, followed by Macrogen, and carried out hole genome sequencing (WGS) using HiSeq X Ten Sequencer (Illumina) (Kim, D., Kim, S. , Kim, S., Park, J. & Kim, JS Genome one wide target specificities of CRISPR ᅳ Cas9 nucleases revealed by multiplex Digenome- seq.Genome research 26, 406-415 (2016)).

5. Targeted deep sequencing

For deep sequencing library generation, targets and potential nontarget sites were amplified with a KAPA HiFi HotStart PCR kit (KAPA Biosystems # KK2501). Pooled PCR amplifications were sequenced using MiniSeq (II lumina) or Illumina Miseq (LAS Inc. Korea) equipped with TruSeq HT Dual Index System (Illumina). The primers used for the target deep sequencing are as follows:

EMX1

On— target sequence: GAGTCCGAGCAGAAGAAGAAGGG (SEQ ID NO:

1st PCR

Forward (5 ^{, →} 3 ') ：

AGTGTTGAGGCCCCAGTG (SEQ ID NO: 15);

Reverse (5 '→ 3') ：

ΟΤΟΑΟΤΟΟΑθπθΑΟΑΟΟΤΟΤΟΟΤΟΤΤΟΟΟΑΤΟΤΟΑαθΑΟΟΑΑΟΟΑΟΟΑΟΤΟΤ (SEQ ID NO:

16);

2nd PCR

Forward (5 '-→ 3') ：

ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGGCCTCCTGAGTTTCTCAT (SEQ ID NO

17);

Reverse (5 '→ 3')

GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCAGCAGCAAGCAGCACTCT (SEQ ID NO:

18).

Example 1 BE3 Non-Target Location Identification Using Digenome-seq

In vitro (i _n vitro), a complex of EMX1-specific sgRNA (see Reference 3; on target sequence: SEQ ID NO: 14) and rAP0BECl-nCas9 protein (BE3: purified in Reference Example 2) was formed in human genomic DNA. Treatment of ribonucleic acid proteins induces C → U conversion on one strand and nicking on the other strand at the on-target and off-target positions, with reference to Reference Example 4. Digenome-seq was performed. In this example, Uracil DNA glycosylase (UDG) and DNA glycosylase® lyase Endonuc lease VIII were not used. After end repair and adapter ligation, whole genome sequencing (WGS) was performed on BE3 treated genomic DNA.

The process is represented as follows: 5 '-GAGTCCGAGCAGAAGAAGAAGGG- 3'

3 '-CTCAGGCTCGTCTTCTTCTTCCC- 5'

rAPOBEC1-nCas9

-GAGTUUGAGC¾GAAG¾AG¾AGGG- 3 '

-CTCAGGCTCGTCTTCTTCTTCCC- 5 '

5 'GAGTUUGAGCAGAAGAAGAAGGG-3' 5 '-GAGTUUGAGCAGAAGAAGASGGG- 3'

3 'CTCAGGCTCGTCTTCTT CTTCCC- 5

.5 '3'A

End repair

3'-to-5 'Trimming 5'-to-3' FiWn by by exonuciease DNA polymerase

The homogeneous alignment of the sequence reads on one strand and the target and nontarget positions where c → u transformation occurred in the other strand were calculated.

The number of nicked sites (reads with vertical alignment at the 5 'end) and mismatches of 10 or less of these positions in only one strand obtained from the Digenome-seq results The number of PAMs having reads is shown in FIG. 2. Groups A and B are identified as having absolute numbers (n ≧ 5 or 10) and relative numbers (10% or 20%, respectively) having the same 5 ′ end and the number of positions homologous to the target sequence. Shows.

Absolute of sequence reads with identical 5 'ends throughout the human genome The number (n ≧ 5 or 10) and the relative number (10% or 20%, respectively) were counted to list all positions associated with a uniform alignment pattern in the dielectric. As a result, as shown in FIG. 2, 90, 496 or 1, 807 corresponding positions were secured, respectively. Single strand cutting. 34 (group A) or 142 (group B; including group A) of the positions with (ni ck) each have a PAM (5'— NGN ᅳ 3 'or downstream of the single-strand cut position; 5'-NNG-3 ') has 3 base pairs and homology with up to 10 mi smatches with an EMX1 target sequence with up to 10 mismatched bases.

Di genome—The Cas9 induced inde l frequency and the BE3 induced substitution frequency at the BE3 non-target position for EMX1 identified via seq were measured using in-depth sequencing in HEK293T cells (see Reference Example 5). Intact genomic DNA or rAPOBECl—generated DNA treated with nCas9 was used to determine whether C → T conversion occurred at each of these positions in the WGS data obtained.

DNA sequences cleaved by BE3 in EMX1 (1 target position + 141 non-target positions = 142 total) are summarized in Table 1 below (in Table 1 below, the base on on arget sequence and mi smat ch) In lowercase).

TABLE 1

Chr Pos i t i on .DNA seq at a n i ckage s i t es

EMX1-001

(on- t arget; chr2 73160998 GAGTCCGAGCAGAAGAAGAAGGG

SEQ ID NO: 14)

EMX 1-002 chr4 131662222 GAaTCCaAG-AGAAGAAGAATGG

EM 1-003 chr2 219845072 GAGgCCGAGCAGAAGAAagACGG

EMX 1-004 chr ll 62365273 GAaTCCaAGCAGAAGAAGAgAAG

EMX 1-005 chr 8 128801258 GAGTCC t AGCAGgAGAAGAAGAG

EMX 1-006 chr 15 44109763 GAGTCt aAGCAGAAGAAGAAGAG

EMX 1-007 chr 19 24 250 503 GAGTCCaAGCAG t AGAgGAAGGG

EMX 1-008 chr6 9118799 acGTCt GAGCAGMGAAGAATGG

EMX 1-009 chr 5 9227162 aAGTCt GAGCAcAAGAAGAATGG

EMX 1-010 chr 1 4515013 G t GTCC t AG-AGAAGAAGAAGGG

EMX1-011 chr5 45359067 GAGTt aGAGCAGAAGAAGAAAGG

EMX1-012 chr 13 96928092 GAGaCaGAG-AGAAGAAGAATGG

EMX 1-013 chr 18 34906762 GAGcC t GAGCgGAAGAgGAAAGG

EMX1-014 chr 1 184236243 aA t aCaGAGCAGAAGAAGAATGG

EMX1-015 ^" chr 18 1677040 agt cCaGAGCAaMtAAGAAGGG

EM 1-016 chr l 33606 480 GAGcCtGAGCAGAAGgAGAAGGG

EMX1-017 chr3 111296327 GAagaaGAGCAaAAGAAGAAGGG

EMX1-018 chr22 34716275 G t GaCaGAGCAaAAGAAGAAAGG

EMX1-019 chr3 37781974 GAagagGAGCAaAAGAAGAAGGG

EMX 1-020 chr20 6653999 aAGTCCagaCAGAAGAAGAAGGA

EM 1-021 chr 16 78848850 aAaTCCaAcCAGAAGAAGAAAGG

EMX 1-022 chr 6 92449690 Gt t caaGAGCAGgAGAAGAAGGG EM 1-023 chr4 87256692 GAGTaaGAGaAGMGMGAAGGG

EMX 1-024 chr l l 43747948 aAGcCCGAGCAaAgGAAGAAAGG

EMX 1-025 chr 5 160643032 cct at aGAGCAaAAGAAGAAAGG

EMX 1-026 chr ll 120873098 GAt caaGAGaAGAAGAAGAAGGG

EMX1-027 chr5 62692054 cAaaaaGAGCAaAAGAAGAACGG

EMX 1-028 chrX 3077291 tAcagtGAGCAaAAGAAGAAGGG

EMX 1-029 chr l4 98236084 Gt t caaGAGCAGgAGAAGAAGGG

EMX 1-030 chr2 205473563 t t cTCaGAGCAaAAGAAGAATGG

EMX 1-031 chr3 189633259 c t t TGCcAGGAGAAGgAcAtTGC

EMX1-032 chr lO 58498683 agGTt aGAGCAaAAGAAGAAAGG

EMX 1-033 chr 1 35818892 t A t aCgGAGCAGAAGAAG TGG

EMX 1-034 chr3 45605387 GAGTCCac aCAGAAGAAGAAAGA

EMX1-035 chr3 5031614 GAaTCCaAGCAGgAGAAGAAGGA

EMX 1-036 chr 12 106646090 aAGTCCat GCAGAAGAgGAAGGG

EMX 1-037 chr 1 23720618 aAGTCCGAGgAGAgGAAGAAAGG

EMX 1-038 chr l l 107812992 a AGTCCaAG t -GAAGAAGMAGG

EMX 1—039 chr4 169444372 GAGaaCGAGaAGAAagAGgAGAG

EMX 1-040 chr6 18327737 GAGagaGAGagagAGAgGgAGGG

EMX 1-041 chr2 230161576 c t GgCaGAGCAaAAGAAGAgGGG

EMX 1-042 chr3 95690186 t caTCCaAGCAGAAGAAGAAGAG

EMX 1-043 chr4 33321466 Gt acagGAGCAGgAGAAGAATGG

EMX 1-044 chi-22 49900715 aAGaagGAGaAGAAGAAGAAGGG

EM 1-045 chr 12 94591214 GAGagaGAGagagAGAgaAAGGG

EMX 1-046 chr5 146833190 GAGcCgGAGCAGAAGMGgAGGG

EMX 1-047 chr6 111509461 GAGggaGAGagGgAGAgagAAAG

EMX 1-048 chr l 26490 139 t t aTCt ccGagaAgGAAGAAGGG

EMX 1-049 chr6 31265461 GAtTCtGt cCcGAAt cAGAAGGG

EM 1-050 chr 14 30099303 atGcaaGAGaAGAAGAAGAAAGG

EMX 1-051 chr3 83057859 age aggGAGCAGAgGAAGAATGG

EMX 1-052 chr 15 35575311 GAGaagGAGaAGAAGAAGAAGGG

EMX 1-053 chr 1 55846672 ac t c t aGAGCAGAAaAAGAATGG

EMX 1-054 chr6 104384459 GAGgagGAGgAGgAGgAaggAGG

EMX 1-055 chr 19 9975831 aAagagGAGaAGAAGAAGAAGGG

E X1-056 chr 12 99525769 GgGgagGAGCAGAAGAAGAgAGG

EMX1-057 chr6 162280006 agGcCgagGCAGgAGAA t AgGAG

EMX 1-058 chr7 85359110 GAGaagGAGCAGAAaAAGAATGG

EMX 1-059 chr2 10462867 acagt aGAGCAGAAGMGAcTGG

EMX1-060 chr 3 18195303 at cca aGAGCAGgAGAAGAAGGG

EMX 1-061 chr2 57855994 a t aagaGAGCAaAAGAAGAAAGG

EMX 1-062 chr6 33957284 GAGagaGAGagagAGAgaAACGG

EMX 1-063 chr 22 37474903 GAGaagGAGaAGAAGgAGAAGAG

EMX 1-064 chr 8 141193983 aAGaagaAGaAGAAGAAGAAGAG

EMX 1-065 chr l 110038435 t t t cggGAGCAGAAGAAGAACAG

EMX 1-066 chr4 117483357 a t c aCaGAGCAGgAGAAGAAGGG

EMX1-067 chr4 6150362 a A a c agGAGCAGAgGAAGAAGGG

EMX 1-068 chr2 116142148 aAGaagagGaAGAgGAgGAAAAG

EM 1-069 chr 12 30794309 GAaat gGAGaAGAAGAAGAAGGG

EM 1-070 chr22 44527016 GAGagaGAaagaAAGAAaAAGGA

EMX 1-071 chr9 96189722 Gc t gtgGAGCAaAAGAAGAAAGG

EMX 1-072 chr8 113493465 GAGgagGAGCAGAAGAAGAAAAG

EMX 1-073 chr ll 46171476 tAaaagGAGCAGAAaAAGAAGGG

EMX 1—074 chrX 3075272 tAcct tGAGCAaAAGAAGAAGGG

EMX 1-075 chr5 56038567 aAGaagGAGaAGAAGAAGAAGGG EMX1-076 chr2 71789 100 GcaggaGAGCAGAAGAAGAAAGG

EMX 1-077 chr7 52389195 aAGagCGAGat tAAGAgGAATGG

EMX 1-078 chr 5 31088930 aAGaaaGgagAGgAGAgGAgAGG

EMX 1-079 chr l l 111680806 agt agtGAGCAGAAGAAGAtAGG

EM 1-080 chr20 51306677 aAGaagGAGaAGAAGAAGAAGAG

EMX1-081 chr l9 38433655 GAGagaGAGagagAGAgaAAGAG

EMX 1-082 chr8 60956107 GgccagGAGCAGgAGAAGAAGGG

EM 1-083 chr 16 26617803 agaggaGAGCAGAAGAAGgATGG

EMX 1-084 chr l2 52621931 aAGaagGAGaAGAAGAAGgAGGA

EMX 1-085 chr3 156028864 cAtTaaGAGCAGgAGAAGAAGGG

EMX 1-086 chr6 40280 504 cgcTga tAcagaAAGAAGAATGG

EM 1-087 chr l 35385601 GAagt gGAGCAGgAGAAGAAGGG

EM 1-088 chr 1 59299359 1 1 1 gt gGAGCAGAAaAAGAAAGG

EMX 1-089 chr 15 61646877 aAGTCaGAGgAGAAGAAGAAGGG

EMX 1-090 chr2 159685754 aAagCtGAGCAGAAaAAGAAGGG

E X1-091 chr 12 41494 108 GcagtgGAGCAGAAGAAGAtGGG

EMX 1-092 chr7 119831026 acaaaaGAGCAGAgGAAGAAAGG

EMX 1-093 chr l 234492864 GAagt aGAGCAGAAGAAGAAGCG

EMX 1-094 chr 14 104091588 aAagagGgagAGAAGAAGAAGGG

EMX 1-095 chr l 31954326 aAGaagGAGaAGAAGAAGAAGAG

EMX 1-096 chr8 120587501 aAGgCCaAGCAGAAGAgt AATGG

EMX 1-097 chr2 46020469 acacaaGAGCAGAAGAAGAAAGA

EMX1-098 chr2 219294645 Gccaa t GAGCAGgAGAAGAAGGG

EMX1-099 chr8 11924153 cAt at aGAGCAaAAGAAGAgAGG

EMX 1-100 chr6 54740531 GAGgt gGAGggGAAGAgGgAAGG

EMX 1- 101 chr 1 156786840 GAGagaGAGagagAGAgaAAGGG

EMX 1- 102 chr6 30791217 aAGgagGAGaAGAAGAAGAAGGG

EMX 1- 103 chr3 192777993 GAGggaGAGagagAGAgagAAAG

EMX 1-104 chr2 36207879 agt cggGAGCAGgAGAAGAAAGG

EMX1-105 chr 16 54831367 Gt t caaGAGCAGAAGAAGAATGG

EMX 1- 106 chr 6 160868147 t c t aaaGAGCAGAAaAAGAAAGG

EMX 1- 107 chr2 24438043 actgat GAGCAGAAGAAGAAAGG

EMX 1- 108 chr 22 37102243 aAGaagGAGaAGAAGAAGgAGGA

EM 1-109 chr l l 121786535 agGaaaagagAGAAGMGAAGGG

EMX 1- 110 chr 7 3337 380 GAGgagGAGaAGAAGAAGAAGGG

EMX l- 111 chr8 112924257 GAGagaGAGagagAGAgaAAGGG

EMX 1- 112 chr 16 69047289 GAGgCCGAagct gAGgtGggAGG

EM 1- 113 chr8 105 164 125 GAGcCCaAGaAGAAGAAGAAGGA

EMX 1-114 chr 13 83353702 t GTaCagagAGAAGAAGAAAGG

EMX1- 115 chr2 102929260 Gc cTt CagagAGAAGAAGAATGG

EMX 1- 116 chr 15 22366621 Ggagt aGAGCAGAgGAAGAAGGG

EM 1- 117 chr2 172374 203 GAagt aGAGCAGAAGAAGAAGCG

EMX 1-118 chr 8 31096390 Gct cCtGAGCAGAAGAAGAACAG

EMX 1- 119 chr2 66729772 agtTCaGAGCAGgAGAAGAATGG

EMX 1-120 chr2 14472327 atGaaCagagAGAAGAAGAATGG

EMX1-121 chr8 140468447 GAGagCGAGagagAGAgagAGGG

EMX 1- 122 chr7 52204863 aAaaagGAGCAGAAGAAGAAGGA

EMX 1-123 chr l 151027598 t t cTCCaAGCAGAAGAAGAAGAG

EM 1- 124 chr l 35590 719 GAGagaGAGagagAGAgaAAGGG

EMX1- 125 chr 1 106 744 880 t tGgaaagagAGAAGAAGAAGGG

EM 1- 126 chr 10 115484209 aAGaggaAGaAGAAGAAGAAGAG

EMX 1- 127 chr3 119686684 GAGagaGAGaAagAGAAagAGAG

EMX 1- 128 chr8 53295601 GAagaaGAGaAGMGAAGAAGGG EMX 1-129 chrl8 12032247 GAtTCtGAGaAaAttAAGAtGGG

EMX 1-130 chrl5 61383748 GgGctCcgGCAGAAGAtGccATG

EMX 1-131 chrl 209298672 GA t TCCaAGCA a t gGAgGAgGGG

EM 1-132 chr7 17446438 Gt ccaaGAGCAGgAGAAGAAGGG

EMX1-133 chrl3 74473871 a t cTggGAGCAGgAGAAGAAGGG

EMX 1-134 chr5 5141237 GAGgatccGagGAtGt AGAAGGG

EMX 1-135 chrl2 5041728 GAagaaGAagAaAgaAAGAAAGA

EMX 1-136 chr8 112756 160 cAGagaGAGaAtAAGtAGcATAG

EMX 1-137 chr8 17384135 tgaggaagagAGAAGAAGAAAGG

EMX 1-138 chrl2 4545932 cAagCa t gagAGAAGAAGAt GGG

EMX1-139 chrlO 58848728 GAGcaCGAGCAagAGAAGAAGGG

EMX 1-140 chrl4 48932119 GAGTCCcAGCAaMGAAGAAAAG

EMX1-141 chr3 145057362 GAGTCCct -CAGgAGAAGAAAGG

EMX 1-142 chr9 111348573 GAGTCCt tG-AGAAGAAGgAAGG

Count (number of sequence reads with the same 5 'end), count (number of sequence reads at a specific location),% (count / depth), and number of reads with C → T conversion measured at the cleavage sites listed in Table 1. Is shown in Table 2 below:

TABLE 2

L LOOO / 8lOZW ^ / 13d 8C8SCl / 8T0Z OAV 9C

LtL000 0ZW ^ / 13d 8C8SCT / 810Z ΟΛ \ EMX 1-135 6 59 10.2 NANA-V

EM 1-136 5 49 10.2 N.A. N.A. -V

EMX 1-137 7 69 10.1 N.A. N.A. -V

EMX 1-138 5 50 10.0 0 0-V

EM 1-139 5 50 10.0 0 0-V

EMX 1-140 7 44 15.9 0 0-V

EMX 1-141 5 40 12.5 1 0-V

EMX 1-142 6 49 12.2 1 0-V

(N.A .： not applicable because there are no cytosines to be deaminated at these sites)

As shown in Table 2 above, 16 of 142 Group B positions (BE-3 treated group) in WGS data obtained using BE-3 treated genomic DNA or intact (BE-3 untreated) genomic DNA ) Or C → T transformation was observed at one position (untreated BE-3 group), respectively. Seventy of these positions do not have cytosine at positions 4 to 8 (numbered 1 to 20 in the 5 'to 3' direction), which is a window of BE3—mediated delamination (indicated by NA in Table 2). ).

To identify off-target effects in some of the group A and group B sites identified by the digenome-seq, targeted deep sequencing was performed on HEK293T cells, and BE3—induced base calibration frequency and Cas9– Induction inciel frequency was measured and shown in Table 3 below:

TABLE 3

Val idat ion by NGS

Indel frequency (%) Base editing frequency (¾)

(-) (+) (-) (+)

Val idat ion Val idat ion Cas9 Cas9 BE3 BE3

EMX 1-001

0.15 61.59 Val idated 0.10 49.33 Val idated (on- target)

EMX 1—002 0.01 0.01 Inval idated 0.16 1.05 Val idated

EMX 1-003 0.00 7.94 Va I idated 0.24 4.04 Val idated

EMX 1-004 0.00 0.01 Val idated 0.16 0.93 Val idated

EMX 1-005 0.00 8.63 Val idated 0.05-2.47 Val idated

EMX 1-006 0.29 38.25 Val idated 0.04 15.59 Val idated

EM 1-007 0.01 0.01 Inval idated 0.08 0.13 Val idated

EMX 1-008 0.02 0.17 Val idated 0.03 0.62 Val idated

EMX1-009 0.10 3.45 Val idated 0.02 0.15 Val idated

EMX 1-010 0.08 0.08 Inval idated 0.07 0.70 Val idated

EMX 1-034 0.00 0.00 Inval idated 0.33 0.40 Inval idated

EM 1-035 0.46 0.89 Val idated 0.23 0.48 Val idated

EMX 1-036 0.01 0.02 Inval idated 0.09 0.31 Val idated

EMX 1-037 0.01 0.23 Val idated 0.20 0.23 Val idated

EMX 1-038 0.01 0.01 Inval idated 0.14 0.16 Val idated

EM 1-140 0.01 0.00 Inval idated 0.38 0.36 Inval idated

EMXl-141 0.00 0.00 Inval idated 0.30 0.37 Inval idated

EMX 1-142 0.01 0.01 Inval idated 0.19 0.17 Inval idated As shown in Table 3, a total of 18 sites were analyzed and point mutations caused by BE3 occurred at 14 sites including the EMX1 on-target site with frequency above noise level (0.002-0.38%) due to sequencing errors. (Validation ratio 78%). BE3 occurs at other BE3-related Digenome—positive sites with a frequency lower than the background noise level _. It is possible to induce mutations. Importantly, the method allows identification of BE3 nontarget sites where base calibration is detected at frequencies of 0.13% or less, indicating that Digenome—seq is a very sensitive method. Cas9 nuclease specific for EMX1 induces indels at 9 of 18 positions at frequencies above the noise level, demonstrating that BE3 and Cas9 non-target positions are often different. Taken together, these results show that BE3 nontarget locations can be identified using Digenome-seq data.

From the above description, those skilled in the art of the present invention will appreciate that the present invention can be implemented in other specific forms without changing the technical spirit or essential features. In this regard, the embodiments described above are to be understood in all respects as illustrative and not restrictive. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the following claims and equivalent concepts rather than the detailed description are included in the scope of the present invention.

Claims

[Patent Claims]

[Claim 1]

(i) DNA single by introducing cytidine deaminase or its coding gene, inactivated target specific endonuclease or its coding gene, and guide RNA or its coding gene into cells or contacting DNA isolated from the cell Inducing strand cleavage;

(ii) analyzing the nucleic acid sequence of said single stranded DNA fragment; And

Including

The inactivated target specific endonuclease is a Cas9 protein or Cpfl protein that has lost the endonuclease activity of cleaving DNA double strands, the off-target site of the cytidine deaminase.

[Claim 2]

(i) DNA single by introducing cytidine deaminase or its coding gene, inactivated target specific endonuclease or its coding gene, and guide RA or its coding gene into a cell or contacting DNA isolated from the cell Inducing strand cleavage; And

(ii) analyzing the nucleic acid sequence of said single stranded DNA fragment,

The inactivated target specific endonuclease is a Cas9 protein or a Cpfl protein that has lost endonuclease activity that cleaves DNA double strands. Sequence analysis method.

[Claim 3]

(i) DNA single by introducing cytidine diamerase or its coding gene, inactivated target specific endonuclease or its coding gene, and guide RNA or its coding gene into cells or contacting DNA isolated from the cell Inducing strand cleavage;

(iii) identifying the single stranded cleavage site from the nucleic acid sequence data obtained by the analysis Including

Said inactivated target specific endonuclease is Cas9 protein or Cpfl protein which lost the endonuclease activity which cut | disconnects DNA double strands, The base correcting position of the cytidine deaminase.

[Claim 4]

The method according to any one of claims 1 to 3, wherein the inactivated target specific endonuclease is selected from Cas9 protein derived from Streptococcus pyogenes.

(1) D10, H840, or D10 and H840;

(2) one or more selected from the group consisting of D1135, R1335, and T1337; or

(3) all of the amino acid residues of (1) and (2)

Is substituted with an amino acid different from the wild type.

[Claim 5]

5. The method of claim 1, wherein the guide RNA is a double RNA comprising a CRISPR RNA (crRNA) and an r s—act ivat ing crRNA (tracrRNA), or a single guide RNA (sgRNA). 6.

[Claim 6]

The method according to any one of claims 1 to 5, wherein the cytidine deaminase is APOBEC (apol ipoprotein B mRNA editing enzyme, catalytic polypept ide-1 ike), AID (act i vat ion-induced cyt idine deaminase) , CDA (cytidine deaminase), or a combination thereof.

[Claim 7]

The method according to any one of claims 1 to 6, wherein the cytidine deaminase and inactivated target specific endonuclease

Fusion protein form

A combination form of cytidine deaminase or mRNA encoding it and an inactivated target specific endonuclease or mRNA encoding it, or

Used in the form of a plasmid comprising each or together a cytidine deaminase coding gene and an inactivated target specific endonuclease coding gene.

[Claim 8]

8. A uracil-specific removal reagent according to any one of claims 1 to 7. (Uracil -Specific Excision Reagent; USER)

The uracil-specific removal reagent is uracil DNA glycosylase (Uracil

DNA glycosylase; UDG), endonuclease VIII, and combinations thereof,

Way.

[Claim 9]

The method according to any one of claims U to 8, which is carried out in vitro.

[Claim 10]

The method of any of claims U-9, wherein the DNA isolated from the cell is genomic DNA.

[Claim 11]

The method according to any one of claims U to 10,

DNA isolated from the cell of step (i) is genomic DNA,

The nucleic acid sequencing of step (ii) is performed by whole genome sequencing

[Claim 12]

The method according to claim 1, wherein after the step i i i,

(iv) the case where the cutting position is not a target position ^'(on eu target site), further including the step of determining a non-target position (off-target site),.

[Claim 13]

The method of claim 12, wherein step (iii) comprises identifying the number of DNA reads that are vertically aligned at the 5 ′ end.

[Claim 14]

The method of claim 13, wherein the non-target position is at least two DNA reads that are vertically aligned at the 5 ′ end.

[Claim 15]

The method of claim 14,

Wherein the non-target location corresponds to one or more of the following:

The strand where the cleavage occurred in the DNA fragment and the complementary strand comprises the PAM sequence;

The strand in which the cleavage in the DNA fragment and the complementary strand comprises up to 15 mismatched nucleotides with the sequence at the target position; And

Among the DNA fragments, the strands where the cleavage occurred and the complementary strands contain the conversion of one or more cytosines (C) to uracil (U) or thymine (T).