WO2018129540A1 - Hiv immunotherapy with no pre-immunization step - Google Patents

Hiv immunotherapy with no pre-immunization step Download PDF

Info

Publication number
WO2018129540A1
WO2018129540A1 PCT/US2018/012998 US2018012998W WO2018129540A1 WO 2018129540 A1 WO2018129540 A1 WO 2018129540A1 US 2018012998 W US2018012998 W US 2018012998W WO 2018129540 A1 WO2018129540 A1 WO 2018129540A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
hiv
seq
sequence
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2018/012998
Other languages
English (en)
French (fr)
Inventor
Haishan LI
Tyler LAHUSEN
Lingzhi Xiao
Charles David Pauza
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
American Gene Technologies International Inc
Original Assignee
American Gene Technologies International Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to KR1020197023287A priority Critical patent/KR102663972B1/ko
Priority to JP2019536901A priority patent/JP7260170B2/ja
Priority to AU2018205388A priority patent/AU2018205388A1/en
Priority to CN201880016715.2A priority patent/CN110462029B/zh
Priority to BR112019014082-4A priority patent/BR112019014082A2/pt
Priority to CN202410957212.2A priority patent/CN118931843A/zh
Priority to KR1020237020872A priority patent/KR20230093381A/ko
Priority to KR1020247004866A priority patent/KR20240023703A/ko
Priority to EP18736295.9A priority patent/EP3565564A4/en
Application filed by American Gene Technologies International Inc filed Critical American Gene Technologies International Inc
Priority to US16/476,529 priority patent/US20200384021A1/en
Priority to CA3048643A priority patent/CA3048643A1/en
Publication of WO2018129540A1 publication Critical patent/WO2018129540A1/en
Priority to IL267794A priority patent/IL267794A/en
Anticipated expiration legal-status Critical
Priority to JP2022189475A priority patent/JP2023015407A/ja
Priority to AU2024201392A priority patent/AU2024201392A1/en
Priority to JP2025051839A priority patent/JP2025098175A/ja
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0645Macrophages, e.g. Kuepfer cells in the liver; Monocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • A61K39/21Retroviridae, e.g. equine infectious anemia virus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/20Cellular immunotherapy characterised by the effect or the function of the cells
    • A61K40/24Antigen-presenting cells [APC]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/46Viral antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1132Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0634Cells from the blood or the immune system
    • C12N5/0636T lymphocytes
    • C12N5/0637Immunosuppressive T lymphocytes, e.g. regulatory T cells or Treg
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5047Cells of the immune system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2121/00Preparations for use in therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • C12N2310/141MicroRNAs, miRNAs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00Active agents used in cell culture processes, e.g. differentation
    • C12N2501/998Proteins not provided for elsewhere
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00Genetically modified cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011Details
    • C12N2710/24011Poxviridae
    • C12N2710/24111Orthopoxvirus, e.g. vaccinia virus, variola
    • C12N2710/24141Use of virus, viral particle or viral elements as a vector
    • C12N2710/24143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/15011Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16111Human Immunodeficiency Virus, HIV concerning HIV env
    • C12N2740/16134Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16211Human Immunodeficiency Virus, HIV concerning HIV gagpol
    • C12N2740/16234Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16311Human Immunodeficiency Virus, HIV concerning HIV regulatory proteins
    • C12N2740/16334Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/52Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis

Definitions

  • the present invention relates generally to the field of immunotherapy for the treatment and prevention of HIV.
  • the disclosed methods of treatment and prevention relate to the administration of viral vectors and systems for the delivery of genes and other therapeutic, diagnostic, or research uses without a pre-immunization step.
  • Combination antiretro viral therapy also known as Highly Active
  • Antiretro viral Therapy or HAART limits HIV-1 replication and retards disease progression, but drug toxicities and the emergence of drug-resistant viruses are challenges for long-term control in HIV-infected persons. Additionally, traditional anti-retroviral therapy, while successful at delaying the onset of AIDS or death, has yet to provide a functional cure. Alternative treatment strategies are needed.
  • Virus-specific T-helper cells which are critical to maintenance of cytolytic T cell (CTL) function, likely play a role.
  • Viremia is also influenced by neutralizing antibodies, but they are generally low in magnitude in HIV infection and do not keep up with evolving viral variants in vivo.
  • Viral vectors can be used to transduce genes into target cells owing to specific virus envelope-host cell receptor interactions and viral mechanisms for gene expression.
  • viral vectors have been used as vehicles for the transfer of genes into many different cell types including whole T cells or other immune cells as well as embryos, fertilized eggs, isolated tissue samples, tissue targets in situ and cultured cells. The ability to introduce and express foreign or altered genes in a cell is useful for therapeutic interventions such as gene therapy, somatic cell reprogramming of induced pluripotent stem cells, and various types of immunotherapy.
  • Gene therapy is one of the ripest areas of biomedical research with the potential to create new therapeutics that may involve the use of viral vectors.
  • an efficient means of delivering these genes is needed to fulfill the promise of gene therapy as a means of treating infectious and non-infectious diseases.
  • viral systems including murine retrovirus, adenovirus, parvovirus (adeno- associated virus), vaccinia virus, and herpes virus have been developed as therapeutic gene transfer vectors.
  • viral vectors There are many factors that must be considered when developing viral vectors, including tissue tropism, stability of virus preparations, stability and control of expression, genome packaging capacity, and construct-dependent vector stability. In addition, in vivo application of viral vectors is often limited by host immune responses against viral structural proteins and/or transduced gene products.
  • viral vectors e.g., adenovirus
  • adenovirus which co-transduce several viral genes together with one or more therapeutic gene(s) are particularly problematic.
  • lentiviral vectors do not generally induce cytotoxicity and do not elicit strong host immune responses
  • some lentiviral vectors such as HIV-1, which carry several immunostimulatory gene products, have the potential to cause cytotoxicity and induce strong immune responses in vivo.
  • this may not be a concern for lentiviral derived transducing vectors that do not encode multiple viral genes after transduction.
  • the purpose of the vector is to encode a protein that will provoke a clinically useful immune response.
  • Another important issue related to the use of lentiviral vectors is that of possible cytopathogenicity upon exposure to some cytotoxic viral proteins. Exposure to certain HIV-1 proteins may induce cell death or functional unresponsiveness in T cells. Likewise, the possibility of generating replication-competent, virulent virus by recombination is often a concern. Accordingly, there remains a need for improved treatments of HIV.
  • a method of treating HIV infection in a subject includes removing leukocytes from the subject and purifying peripheral blood mononuclear cells (PBMC).
  • the method further includes contacting the PBMC ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for at least 1 day.
  • the transduced PBMC may be cultured from about 1 to about 35 days.
  • the method may further involve infusing the transduced PBMC into a subject.
  • the subject may be a human.
  • the stimulatory agent may include a peptide or mixture of peptides.
  • the stimulatory agents include a gag peptide.
  • the stimulatory agent may include a vaccine.
  • the vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA/HIV62B vaccine or a variant thereof.
  • the viral delivery system includes a lentiviral particle.
  • the at least one genetic element may include a small RNA capable of inhibiting production of chemokine receptor CCR5 or at least one small RNA capable of targeting an HIV RNA sequence.
  • the at least one genetic element may include a small RNA capable of inhibiting production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence.
  • the HIV RNA sequence may include a HIV Vif sequence, a HIV Tat sequence, or a variant thereof.
  • the at least one genetic element may include a microRNA or a shRNA.
  • the at least one genetic element comprises a microRNA cluster.
  • the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1).
  • the at least one genetic element comprises: AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1).
  • the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with GGGCCTGGCTCGAGC AGGGGGCGAGGGATTCCGCTTCTTCCTGCC ATAGCGTGG TCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTC GTCG (SEQ ID NO: 3).
  • the at least one genetic element includes CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or
  • the microRNA cluster includes a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTTCCCGGGCATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCT GAACTTGTGTTGAATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGG TATCTTTCATCTGACCAGCTAGCGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCC GCTTCTTCCTGCCATAGCGTGGTCCCCCTATGGCAGGCAGAAGCGGCACCTT CCCTCCCAATGACCGCGTCTTCGTC (SEQ ID NO: 31).
  • the microRNA cluster includes:
  • a method of treating cells infected with HIV includes contacting peripheral blood mononuclear cells (PBMC) isolated from a subject infected with HIV with a therapeutically effective amount of a stimulatory agent, wherein the contacting is carried out ex vivo; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for at least 1 day.
  • the transduced PBMC may be cultured from about 1 to about 35 days.
  • the method may further involve infusing the transduced PBMC into a subject.
  • the subject may be a human.
  • the stimulatory agent may include a peptide or mixture of peptides, and in a preferred embodiment includes a gag peptide.
  • the stimulatory agent may include a vaccine.
  • the vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA/HIV62B vaccine or a variant thereof.
  • the viral delivery system includes a lentiviral particle.
  • the at least one genetic element may include a small RNA capable of inhibiting production of chemokine receptor CCR5 or at least one small RNA capable of targeting an HIV RNA sequence.
  • the at least one genetic element may include a small RNA capable of inhibiting production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence.
  • the HIV RNA sequence may include a HIV Vif sequence, a HIV Tat sequence, or a variant thereof.
  • the at least one genetic element may include a microRNA or a shRNA. In a preferred embodiment, the at least one genetic element comprises a microRNA cluster
  • the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1).
  • the at least one genetic element comprises:
  • the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with
  • the at least one genetic element includes CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or GGGCCTGGCTCGAGC AGGGGGCGAGGGATTCCGCTTCTTC
  • the microRNA cluster includes a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTTCCCGGGCATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCT GAACTTGTGTTGAATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGG TATCTTTCATCTGACCAGCTAGCGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCC GCTTCTTCCTGCCATAGCGTGGTCCCCCTATGGCAGGCAGAAGCGGCACCTT CCCTCCCAATGACCGCGTCTTCGTC (SEQ ID NO: 31).
  • the microRNA cluster includes:
  • a lentiviral vector in another aspect, includes at least one encoded genetic element, wherein the at least one encoded genetic element comprises a small RNA capable of inhibiting production of chemokine receptor CCR5 or at least one small RNA capable of targeting an HIV RNA sequence.
  • the at least one encoded genetic element comprises a small RNA capable of inhibiting production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence.
  • the HIV RNA sequence may include a HIV Vif sequence, a HIV Tat sequence, or a variant thereof.
  • the at least one encoded genetic element may include a microRNA or a shRNA.
  • the at least one encoded genetic element may include a microRNA cluster.
  • the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1).
  • the at least one genetic element comprises:
  • the at least one genetic element includes a microRNA having at least
  • the at least one genetic element includes CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or
  • the microRNA cluster includes a sequence having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTTCCCGGGCATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCT GAACTTGTGTTGAATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGG TATCTTTCATCTGACCAGCTAGCGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCC GCTTCTTCCTGCCATAGCGTGGTCCCCCTATGGCAGGCAGAAGCGGCACCTT CCCTCCCAATGACCGCGTCTTCGTC (SEQ ID NO: 31).
  • the microRNA cluster includes:
  • a lentiviral vector system for expressing a lentiviral particle.
  • the system includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, a lentiviral particle is produced by the packaging cell line, wherein the lentiviral particle is capable of inhibiting production of chemokine receptor CCR5 or targeting an HIV RNA sequence.
  • the system may further include a first helper plasmid for expressing the gag and pol genes, and a second plasmid for expressing the rev gene.
  • a lentiviral particle capable of infecting a cell includes an envelope protein optimized for infecting a cell, and a lentiviral vector as described herein.
  • the envelope protein may be optimized for infecting a T cell.
  • the envelope protein is optimized for infecting a CD4+ T cell.
  • a modified cell in another aspect, includes a CD4+ T cell, wherein the CD4+ T cell has been infected with a lentiviral particle as described herein.
  • the CD4+ T cell also recognizes an HIV antigen.
  • the HIV antigen includes a gag antigen.
  • the CD4+ T cell expresses a decreased level of CCR5 following infection with the lentiviral particle.
  • a method of selecting a subject for a therapeutic treatment regimen is disclosed.
  • the method includes removing leukocytes from the subject and purifying peripheral blood mononuclear cells (PBMC) and determining a first quantifiable measurement associated with at least one factor associated with the PBMC; contacting the PBMC ex vivo with a therapeutically effective amount of a second stimulatory agent, and determining a second measurement associated with the at least one factor associated with the PBMC, whereby when the second quantifiable measurement is higher than the first quantifiable measurement, the subject is selected for the treatment regimen.
  • the at least one factor may be T cell proliferation or IFN gamma production.
  • the methods disclosed herein include depleting at least one subset of cells from the PBMC.
  • the method includes depleting at least one subset of cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, ⁇ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes.
  • the depleting occurs after removing the leukocytes.
  • the depleting occurs at the same time as removing the leukocytes.
  • Figure 1 depicts a flow chart diagram of a particular clinical therapy strategy.
  • Figure 2 depicts diagrammatically how CD4+ T cells may be altered using gene therapy to prevent other cells from becoming infected and/or to prevent viral replication.
  • Figure 3 depicts an exemplary lentiviral vector system comprised of a therapeutic vector, a helper plasmid, and an envelope plasmid.
  • the therapeutic vector shown here is a preferred therapeutic vector, which is also referred to herein as AGT103, and contains miR30CCR5-miR21 Vif-miRl 85-Tat.
  • Figure 4 depicts an exemplary 3-vector lentiviral vector system in a circularized form.
  • Figure 5 depicts an exemplary 4-vector lentiviral vector system in a circularized form.
  • Figure 6 depicts exemplary vector sequences.
  • Positive (genomic) strand sequence of the promoter and miR cluster were developed for inhibiting the spread of CCR5 -tropic HIV strains. Sequences that are not underlined comprise the EF-1 alpha promoter of transcription that was selected as best for this miR cluster. Sequences that are underlined show the miR cluster consisting of miR30 CCR5 (a modification of the natural human miR30 that redirects to CCR5 mRNA), miR21 Vif (redirects to Vif RNA sequence) and miR185 Tat (redirects to Tat RNA sequence) (as shown collectively in SEQ ID NO: 33).
  • Figure 7 depicts exemplary lentiviral vector constructs according to aspects of the disclosure.
  • Figure 8 shows that knockdown of CCR5 by an experimental vector prevents R5- tropic HIV infection in AGTcl20 cells.
  • A shows CCR5 expression in AGTcl20 cells with or without AGT103 lentivirus vector.
  • B shows the sensitivity of transduced AGTcl20 cells to infection with a HIV BaL virus stock that was expressing green fluorescent protein (GFP) fused to the Nef gene of HIV.
  • GFP green fluorescent protein
  • Figure 9 depicts data demonstrating regulation of CCR5 expression by shRNA inhibitor sequences in a lentiviral vector.
  • A Screening data for potential candidates is shown.
  • B CCR5 knock-down data following transduction with CCR5 shRNA-1 (SEQ ID NO: 16) is shown.
  • Figure 10 depicts data demonstrating regulation of HIV components by shRNA inhibitor sequences in a lentiviral vector.
  • A Knock-down data for the Rev/Tat target gene is shown.
  • B Knock-down data for the Gag target gene is shown.
  • Figure 11 depicts data demonstrating that AGT103 reduces expression of Tat protein expression in cells transfected with an HIV expression plasmid, as described herein.
  • Figure 12 depicts data demonstrating regulation of HIV components by synthetic microRNA sequences in a lentiviral vector.
  • A Tat knock-down data is shown.
  • B Vif knockdown data is shown.
  • Figure 13 depicts data demonstrating regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector.
  • Figure 14 depicts data demonstrating regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector containing either a long or short WPRE sequence.
  • Figure 15 depicts data demonstrating regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector with or without a WPRE sequence.
  • Figure 16 depicts data demonstrating regulation of CCR5 expression by a CD4 promoter regulating synthetic microRNA sequences in a lentiviral vector.
  • Figure 17 depicts data demonstrating detection of HIV Gag-specific CD4 T cells.
  • Figure 18 depicts data demonstrating HIV-specific CD4 T cell expansion and lentivirus transduction.
  • A A schedule of treatment is shown.
  • B IFN-gamma production in CD4-gated T cells is shown, as described herein.
  • C IFN-gamma production and GFP expression in CD4-gated T cells is shown, as described herein.
  • D Frequency of HIV-specific CD4+ T cells is shown, as described herein, and importantly, pre- and post-vaccination.
  • E IFN-gamma production from PBMCs post-vaccination is shown, as described herein.
  • Figure 19 depicts data demonstrating a functional assay for a dose response of increasing AGT103-GFP and inhibition of CCR5 expression.
  • A Dose response data for increasing amounts of AGT103-GFP is shown.
  • B Normal distribution populations in terms of CCR5 expression are shown.
  • C Percentage inhibition of CCR5 expression with increasing doses of AGT103-GFP is shown.
  • Figure 20 depicts data demonstrating that that AGT103 efficiently transduces primary human CD4+ T cells.
  • A Frequency of transduced cells (GFP-positive) is shown by FACS, as described herein.
  • B Number of vector copies per cell is shown, as described herein.
  • Figure 21 depicts data demonstrating that AGT103 inhibits HIV replication in primary
  • CD4+ T cells as described herein.
  • Figure 22 depicts data demonstrating that AGT103 protects primary human CD4 + T cells from HIV-induced depletion.
  • Figure 23 depicts data demonstrating generation of a CD4+ T cell population that is highly enriched for HIV-specific, AGT103-transduced CD4 T cells.
  • A shows CD4 and CD 8 expression profiles for cell populations, as described herein.
  • B shows CD4 and CD 8 expression profiles for cell populations, as described herein.
  • C shows IFN-gamma and CD4 expression profiles for cell populations, as described herein.
  • D shows IFN-gamma and GFP expression profiles for cell populations, as described herein.
  • Figure 24 depicts a schematic of a CD8 depletion protocol.
  • Figure 25 depicts expansion of Gag-specific T cells by peptide stimulation, CD8 depletion and IL-7/IL-15 incubation.
  • Figure 26 depicts a schematic of a CD8/CD56/CD19 y5 depletion protocol.
  • Figure 27 depicts expansion of Gag-specific T cells by peptide stimulation, CD8/Y5/NK/B cell depletion and IL-7/IL-15 incubation.
  • Figure 28 depicts expansion and transduction of Gag-specific T cells by peptide stimulation, CDS/ ⁇ / ⁇ / ⁇ cell depletion and IL-7/IL-15 incubation. IFN- ⁇ positive, antigen- specific CD4+ T cells resulted in better transduction efficiency compared to other subsets in culture.
  • Figure 29 depicts a relationship between the percentage of transduced cells and the vector copy number.
  • a functional cure is defined as a condition resulting from the disclosed treatments and methods that reduces or eliminates the need for cART and may or may not require supporting adjuvant therapy.
  • the methods of the invention include gene delivery by integrating lentivirus, non-integrating lentivirus, and related viral vector technology as described below.
  • a strategy for treating HIV includes a first therapeutic immunization with vaccines intended to produce strong immune responses against HIV in HIV-infected patients with stable suppression of viremia due to daily administration of HAART, for the purpose of enriching the fraction of HIV-specific CD4 T cells.
  • the first therapeutic immunization may not be necessary.
  • the methods can be used to prevent new cells, such as CD4+ T cells, from becoming infected with HIV.
  • CCR5 expression can be targeted to prevent virus attachment.
  • destruction of any residual infecting viral RNA can also be targeted.
  • the methods can also be used to stop the HIV viral cycle in cells that have already become infected with HIV.
  • viral RNA produced by latently-infected cells such as latently-infected CD4+ T cells, can be targeted.
  • administering means providing an active agent of the invention to the subject in need of treatment in a form that can be introduced into that individual's body in a therapeutically useful form and therapeutically effective amount.
  • AGT103 refers to a particular embodiment of a lentiviral vector that contains a miR30-CCR5/miR21-Vif/miR185-Tat microRNA cluster sequence, as detailed herein.
  • AGT103T refers to a cell that has been transduced with a lentivirus or lentiviral particle that contains the AGT103 lentiviral vector.
  • engraftment refers to the ability for one skilled in the art to determine a quantitative level of sustained engraftment in a subject following infusion of a cellular source (see for e.g.: Rosenberg et al, N. Engl. J. Med. 323:570-578 (1990); Dudley el al., J. Immunother. 24:363-373 (2001); Yee et al, Curr. Opin. Immunol. 13: 141-146 (2001); Rooney et al, Blood 92: 1549-1555 (1998)).
  • expression refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently being translated into peptides, polypeptides, or proteins.
  • Expression may include splicing of the mRNA in a eukaryotic cell or other forms of post-transcriptional modification or post-translational modification.
  • the term "functional cure” refers to a state or condition wherein HIV+ individuals who previously required cART or HAART, may survive with low or undetectable virus replication using lower doses, intermittent doses, or discontinued dosing of cART or HAART. An individual may be said to have been “functionally cured” while still requiring adjunct therapy to maintain low level virus replication and slow or eliminate disease progression. A possible outcome of a functional cure is the eventual eradication of HIV to prevent all possibility of recurrence.
  • the term "HIV vaccine” encompasses immunogens plus vehicle plus adjuvant intended to elicit HIV-specific immune responses.
  • a "HIV vaccine” may include purified or whole inactivated virus particles that may be HIV or a recombinant virus vectors capable of expressing HIV proteins, protein fragments or peptides, glycoprotein fragments or glycopeptides, in addition to recombinant bacterial vectors, plasmid DNA or RNA capable of directing cells to producing HIV proteins, glycoproteins or protein fragments able to elicit specific immunity.
  • specific methods for immune stimulation including anti- CD3/CD28 beads, T cell receptor-specific antibodies, mitogens, superantigens and other chemical or biological stimuli may be used to activate dendritic, T or B cells for the purposes of enriching HIV-specific CD4 T cells prior to transduction or for in vitro assay of lentivirus- transduced CD4 T cells.
  • Activating substances may be soluble, polymeric assemblies, liposome or endosome-based or linked to beads.
  • Cytokines including interleukin-2, 6, 7, 12, 15, 23 or others may be added to improve cellular responses to stimuli and/or improve the survival of CD4 T cells throughout the culture and transduction intervals.
  • the term "HIV vaccine” encompasses the MV A/HIV 62B vaccine and variants thereof.
  • the MVA/HIV62B vaccine is a known highly attenuated double recombinant MVA vaccine.
  • the MV A/HIV 62B vaccine was constructed through the insertion of HIV-1 gag-pol and env sequences into the known MVA vector (see: for e.g. : Goepfert et al. (2014) J. Infect. Dis. 210(1): 99-110, and see WO2006026667, both of which are incorporated herein by reference).
  • the term "HIV vaccine” also includes any one or more vaccines provided in Table 1, below.
  • Ad5HVR48.ENVA.01 Ad5HVR48.ENVA.01
  • APL 400-003RX101 APL 400-003 GENEVAX-HIV
  • HVTN 057 VRC-HIVDNA009-00-VP
  • HVTN 086 SAAVI 103 SAAVI MVA-C HVTN 087 HIV-MAG
  • HVTN 502/Merck 023 (Step Study) MRKAd5 HIV-1 gag/pol/nef
  • HVTN 503 (Phambili) MRKAd5 HIV-1 gag/pol/nef
  • RV 124 ALVAC-HIV MN120TMG strain (vCP205)
  • RV 135 ALVAC-HIV vCP 1521
  • RV 138 B011 ALVAC-HIV MN120TMG strain (vCP205)
  • RV 156 VRC-HIVDNA009-00-VP
  • RV 305 ALVAC-HIV vCP 1521
  • RV 306 ALVAC-HIV vCP 1521 RV 328 AIDSVAX B/E
  • RV262 Pennvax-G
  • VAX 003 AIDSVAX B/E VAX 004 AIDSVAX B/B
  • VRC 004 (03-1-0022)
  • VRC 006 04-1-0172
  • VRC 007 (04-1-0254)
  • VRC 008 (05-1-0148) VRC-HIVDNAO 16-00-VP
  • VRC 009 (05-1-0081) VRC-HIVDNA009-00-VP
  • VRC 010 (05-1-0140)
  • VRC 012 (07-1-0167)
  • VRC 015 (08-1-0171)
  • Prime refers to the composition initially used as an immunological inoculant in a given clinical trial as referenced in Table 1 herein.
  • vivo refers to processes that occur in a living organism.
  • ex vivo refers to processes that occur outside of a living organism.
  • miRNA refers to a microRNA and also maybe referred to as "miR”.
  • packing cell line refers to any cell line that can be used to express a lentiviral particle.
  • percent identity in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection.
  • sequence comparison algorithms e.g., BLASTP and BLASTN or other algorithms available to persons of skill
  • the “percent identity” can exist over a region of the sequence being compared, e.g. , over a functional domain, or, altematively, exist over the full length of the two sequences to be compared.
  • sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).
  • BLAST algorithm One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information website.
  • the percent identity between two nucleotide sequences can be determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide or amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4: 11-17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J.
  • the nucleic acid and protein sequences of the present disclosure can further be used as a "query sequence" to perform a search against public databases to, for example, identify related sequences.
  • Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10.
  • Gapped BLAST can be utilized as described in Altschul et al , (1997) Nucleic Acids Res. 25(17):3389-3402.
  • the default parameters of the respective programs e.g., XBLAST and NBLAST
  • XBLAST and NBLAST See http://www.ncbi.nlm.nih.gov.
  • pharmaceutically acceptable refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues, organs, and/or bodily fluids of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit/risk ratio.
  • a "pharmaceutically acceptable carrier” refers to, and includes, any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible.
  • the compositions can include a pharmaceutically acceptable salt, e.g., an acid addition salt or a base addition salt (see, e.g., Berge et al. (1977) JPharm Sci 66: 1-19).
  • sequence ID NO is synonymous with the term “Sequence ID NO”.
  • small RNA refers to non-coding RNA that are generally less than about 200 nucleotides or less in length and possess a silencing or interference function. In other embodiments, the small RNA is about 175 nucleotides or less, about 150 nucleotides or less, about 125 nucleotides or less, about 100 nucleotides or less, or about 75 nucleotides or less in length.
  • RNAs include microRNA (miRNA), small interfering RNA (siRNA), double stranded RNA (dsRNA), and short hairpin RNA (shRNA).
  • miRNA microRNA
  • siRNA small interfering RNA
  • dsRNA double stranded RNA
  • shRNA short hairpin RNA
  • the term “stimulatory agent” refers to any exogenous agent that can stimulate a leukocyte.
  • the term “subject” includes a human patient but also includes other mammals.
  • the terms “subject,” “individual,” “host,” and “patient” may be used interchangeably herein.
  • target cell generally refers to a CD4+ T cell that responds to stimulation with protein or peptide fragments representing HIV gene sequences, and includes a CD4+ T cell that has been transduced with the lentivirus vectors detailed herein rendering it less sensitive to HIV.
  • therapeutically effective amount refers to a sufficient quantity of the active agents of the present invention, in a suitable composition, and in a suitable dosage form to treat or prevent the symptoms, progression, or onset of the complications seen in patients suffering from a given ailment, injury, disease, or condition.
  • the therapeutically effective amount will vary depending on the state of the patient's condition or its severity, and the age, weight, etc., of the subject to be treated.
  • a therapeutically effective amount can vary, depending on any of a number of factors, including, e.g., the route of administration, the condition of the subject, as well as other factors understood by those in the art.
  • the term "therapeutic vector” is synonymous with a lentiviral vector such as the AGT103 vector.
  • treatment generally refers to an intervention in an attempt to alter the natural course of the subject being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects include, but are not limited to, preventing occurrence or recurrence of disease, alleviating symptoms, suppressing, diminishing or inhibiting any direct or indirect pathological consequences of the disease, ameliorating or palliating the disease state, and causing remission or improved prognosis.
  • a method of treating HIV infection in a subject includes removing leukocytes from the subject and purifying peripheral blood mononuclear cells (PBMC).
  • the method further includes contacting the PBMC ex vivo with a therapeutically effective amount of a stimulatory agent; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for at least 1 day.
  • the method may further include further enrichment of the PBMC, for example, by preferably enriching the PBMC for CD4+ T cells.
  • the transduced PBMC may be cultured from about 1 to about 35 days.
  • the method may further involve infusing the transduced PBMC into a subject.
  • the subject may be a human.
  • the stimulatory agent may include a peptide or mixture of peptides.
  • the stimulatory agent includes a gag peptide.
  • the stimulatory agent may include a vaccine.
  • the vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA/HIV62B vaccine or a variant thereof.
  • the viral delivery system includes a lentiviral particle.
  • the at least one genetic element may include a small RNA capable of inhibiting production of chemokine receptor CCR5 or at least one small RNA capable of targeting an HIV RNA sequence.
  • the at least one genetic element may include a small RNA capable of inhibiting production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence.
  • the HIV RNA sequence may include a HIV Vif sequence, a HIV Tat sequence, or a variant thereof.
  • the at least one genetic element may include a microRNA or a shRNA. In a preferred embodiment, the at least one genetic element comprises a microRNA cluster.
  • the at least one genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1).
  • the at least one genetic element comprises:
  • the at least one genetic element includes a microRNA having at least 80%, or at least 85%, or at least 90%, or at least 95% percent identity with CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with GGGCCTGGCTCGAGCAGGGGGCGAGGGATTCCGCTTCTTCCTGCCATAGCGTGG TCCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTC GTCG (SEQ ID NO: 3).
  • the at least one genetic element includes CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or
  • the microRNA cluster includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with
  • the microRNA cluster includes:
  • a method of treating cells infected with HIV includes contacting peripheral blood mononuclear cells (PBMC) isolated from a subject infected with HIV with a therapeutically effective amount of a stimulatory agent, wherein the contacting is carried out ex vivo; transducing the PBMC ex vivo with a viral delivery system encoding at least one genetic element; and culturing the transduced PBMC for at least 1 day.
  • the transduced PBMC may be cultured from about 1 to about 35 days.
  • the method may further involve infusing the transduced PBMC into a subject.
  • the subject may be a human.
  • the stimulatory agent may include a peptide or mixture of peptides, and in a preferred embodiment includes a gag peptide.
  • the stimulatory agent may include a vaccine.
  • the vaccine may be a HIV vaccine, and in a preferred embodiment, the HIV vaccine is a MVA/HIV62B vaccine or a variant thereof.
  • the viral delivery system includes a lentiviral particle.
  • the at least one genetic element may include a small RNA capable of inhibiting production of chemokine receptor CCR5 or at least one small RNA capable of targeting an HIV RNA sequence.
  • the at least one genetic element may include a small RNA capable of inhibiting production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence.
  • the HIV RNA sequence may include a HIV Vif sequence, a HIV Tat sequence, or a variant thereof.
  • the at least one genetic element may include a microRNA or a shRNA. In a preferred embodiment, the at least one genetic element comprises a microRNA cluster
  • the at least one genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1).
  • the at least one genetic element comprises:
  • the at least one genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with GGGCCTGGCTCGAGCAG
  • the at least one genetic element includes CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or GGGCCTGGCTCGAGC AGGGGGCGAGGGATTCCGCTTCTTC
  • the microRNA cluster includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with
  • the microRNA cluster includes: AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTTCCCGGGCATCTCCATGGCTGTACCACCTTGTCGGGATGTGTACTTCT GAACTTGTGTTGAATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGG TATCTTTCATCTGACCAGCTAGCGGGCCTGGCTCGAGCAGGGGGCGAGGGATTCC GCTTCTTCCTGCCATAGCGTGGTCCCCCTATGGCAGGCAGAAGCGGCACCTT CCCTCCCAATGACCGCGTCTTCGTC (SEQ ID NO: 31).
  • the microRNA cluster includes: AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCT
  • a lentiviral vector in another aspect, includes at least one encoded genetic element, wherein the at least one encoded genetic element comprises a small RNA capable of inhibiting production of chemokine receptor CCR5 or at least one small RNA capable of targeting an HIV RNA sequence.
  • a lentiviral vector in the at least one encoded genetic element comprises a small RNA capable of inhibiting production of chemokine receptor CCR5 and at least one small RNA capable of targeting an HIV RNA sequence.
  • the HIV RNA sequence may include a HIV Vif sequence, a HIV Tat sequence, or a variant thereof.
  • the at least one encoded genetic element may include a microRNA or a shRNA.
  • the at least one encoded genetic element may include a microRNA cluster.
  • the at least one genetic element includes a microRNA having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with AGGTATATTGCTGTTGACAGTGAGCGACTGTAAACTGAGCTTGCTCTACTGTGAAG CCACAGATGGGTAGAGCAAGCACAGTTTACCGCTGCCTACTGCCTCGGACTTCAA GGGGCTT (SEQ ID NO: 1).
  • the at least one genetic element comprises:
  • the at least one genetic element includes a microRNA having at least
  • the at least one genetic element includes CATCTCCATGGCTGTACCACCTTGTCGGGGGATGTGTACTTCTGAACTTGTGTTGA ATCTCATGGAGTTCAGAAGAACACATCCGCACTGACATTTTGGTATCTTTCATCTG ACCA (SEQ ID NO: 2); or
  • the microRNA cluster includes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more percent identity with
  • the microRNA cluster includes:
  • a lentiviral vector system for expressing a lentiviral particle includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, a lentiviral particle is produced by the packaging cell line, wherein the lentiviral particle is capable of inhibiting production of chemokine receptor CCR5 or targeting an HIV RNA sequence.
  • a lentiviral particle capable of infecting a cell includes an envelope protein optimized for infecting a cell, and a lentiviral vector as described herein.
  • the envelope protein may be optimized for infecting a T cell.
  • the envelope protein is optimized for infecting a CD4+ T cell.
  • a modified cell in another aspect, includes a CD4+ T cell, wherein the CD4+ T cell has been infected with a lentiviral particle as described herein.
  • the CD4+ T cell also recognizes an HIV antigen.
  • the HIV antigen includes a gag antigen.
  • the CD4+ T cell expresses a decreased level of CCR5 following infection with the lentiviral particle.
  • a method of selecting a subject for a therapeutic treatment regimen includes removing leukocytes from the subject and purifying peripheral blood mononuclear cells (PBMC) and determining a first quantifiable measurement associated with at least one factor associated with the PBMC; contacting the PBMC ex vivo with a therapeutically effective amount of a second stimulatory agent, and determining a second measurement associated with the at least one factor associated with the PBMC, whereby when the second quantifiable measurement is higher than the first quantifiable measurement, the subject is selected for the treatment regimen.
  • the at least one factor may be T cell proliferation or IFN gamma production.
  • any of the methods comprising treating cells infected with HIV described herein further comprise depleting at least one subset of cells from the PBMC.
  • the method includes depleting at least one subset of cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, ⁇ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes.
  • the depleting occurs after removing the leukocytes.
  • the depleting occurs at the same time as removing the leukocytes.
  • any of the methods comprising treating HIV in a subject described herein further comprise depleting at least one subset of cells from the PBMC.
  • the method includes depleting at least one subset of cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, ⁇ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes.
  • the depleting occurs after removing the leukocytes.
  • the depleting occurs at the same time as removing the leukocytes.
  • any of the methods comprising selected a subject for a therapeutic regimen described herein further comprise depleting at least one subset of cells from the PBMC.
  • the method includes depleting at least one subset of cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, ⁇ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes.
  • the depleting occurs after removing the leukocytes.
  • the depleting occurs at the same time as removing the leukocytes.
  • any of the methods described herein further comprise depleting at least one subset of immune cells from the PBMC, wherein the at least one subset of cells comprises any one or more of CD8+ T cells, ⁇ cells, NK cells, B cells, neutrophils, basophils, eosinophils, T regulatory cells, NKT cells, and erythrocytes.
  • the cells depleted from the PBMC are CD8+ T cells.
  • the cells depleted from the PBMC are ⁇ cells.
  • the cells depleted from the PBMC are NK cells.
  • the cells depleted from the PBMC are B cells.
  • the cells depleted from the PBMC are T regulatory cells.
  • the cells depleted from the PBMC are NKT cells. In embodiments, the cells depleted from the PBMC are erythrocytes. In embodiments, the cells depleted from the PBMC are CD8+ T cells and ⁇ cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, ⁇ cells, and NK cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, ⁇ cells, NK cells, and B cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, ⁇ cells, NK cells, B cells, and T regulatory cells.
  • the cells depleted from the PBMC are CD8+ T cells, ⁇ cells, NK cells, B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, ⁇ cells, NK cells, B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are ⁇ cells and NK cells. In embodiments, the cells depleted from the PBMC are ⁇ cells, NK cells, and B cells. In embodiments, the cells depleted from the PBMC are ⁇ cells, NK cells, B cells, and T regulatory cells.
  • the cells depleted from the PBMC are ⁇ cells, NK cells, B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are ⁇ cells, NK cells, B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are NK cells and B cells. In embodiments, the cells depleted from the PBMC are NK cells, B cells, and T regulatory cells. In embodiments, the cells depleted from the PBMC are NK cells, B cells, T regulatory cells, and NKT cells.
  • the cells depleted from the PBMC are NK cells, B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are B cells and T regulatory cells. In embodiments, the cells depleted from the PBMC are B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are T regulatory cells and NKT cells. In embodiments, the cells depleted from the PBMC are T regulatory cells, NKT cells, and erythrocytes.
  • the cells depleted from the PBMC are NKT cells and erythrocytes. In embodiments, the cells depleted from the PBMC are CD8+ T cells and NK cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, NK cells, and B cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, NK Cells, B cells, and T regulatory cells. In embodiments, the cells depleted from the PBMC are CD8+ T cells, NK Cells, B cells, T regulatory cells, and NKT cells.
  • the cells depleted from the PBMC are CD8+ T cells, NK Cells, B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are ⁇ and B cells. In embodiments, the cells depleted from the PBMC are ⁇ , B cells, and T regulatory cells. In embodiments, the cells depleted from the PBMC are ⁇ , B cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are ⁇ , B cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are NK cells and T regulatory cells.
  • the cells depleted from the PBMC are NK cells, T regulatory cells, and NKT cells. In embodiments, the cells depleted from the PBMC are NK cells, T regulatory cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are B cells and NKT cells. In embodiments, the cells depleted from the PBMC are B cells, NKT cells, and erythrocytes. In embodiments, the cells depleted from the PBMC are T regulatory cells and erythrocytes. In embodiments, the cells depleted from the PBMC, as described herein, include any one or any combination of neutrophils, basophils, and eosinophils.
  • CD8+ T cells are depleted at the beginning of cell expansion to improve CD4+ T cell expansion.
  • the cell depletion is performed after peptide stimulation and before lentivirus transduction, when cells are better able to withstand mechanical stress.
  • the cells are placed in culture medium for approximately 24 hours.
  • the cells are placed in culture for less than 24 hours, for example, less than 20 hours, less than 16 hours, less than 8 hours, or less than 4 hours.
  • the cells are placed in culture for greater than 24 hours, for example, greater than 30 hours, greater than 36 hours, greater than 42 hours, or greater than 48 hours.
  • the culture medium comprises IL-7. In embodiments, the culture medium comprises IL-15. In embodiments, the culture medium comprises IL-7 and IL-15. In embodiments, the cell depletion is performed before peptide stimulation. In embodiments, a gag protein is used to cause peptide stimulation. In embodiments, a HIV vaccine is used to cause peptide stimulation. In embodiments, the vaccine is a MVA/HIV62B vaccine, which is used to cause peptide stimulation. In embodiments, CD8+ T cells are depleted with a PE anti-human CD8 antibody and anti-PE microbeads. In embodiments, the CD8 antibody is an anti-rat antibody. In embodiments, the CD8 antibody is an anti-mouse antibody.
  • the CD8 antibody is an anti-rabbit antibody. In embodiments, the CD8 antibody is an anti-goat antibody.
  • the cells after cell depletion and peptide stimulation, the cells are transduced. In embodiments, the cells are transduced with a lentivirus. In embodiments, the lentivirus carries GFP. In embodiments, the lentivirus carries RFP. In embodiments, the lentivirus carries EGFP. In embodiments, the cells are placed in culture after transduction. In embodiments, the culture medium comprises IL-7. In embodiments, the culture medium comprises IL-15. In embodiments, the culture medium comprises IL-7 and IL-15. In embodiments, the cells are cultured for approximately 2 days to allow for CD4+ T cell expansion.
  • the cells are cultured approximately 3 days to allow for CD4+ T cell expansion.
  • the cells are cultured for less than 2 days, for example, less than 42 hours, less than 36 hours, less than 30 hours, less than 24 hours, less than 18 hours, less than 12 hours, or less than 6 hours.
  • the cells are cultured for greater than 3 days, for example, greater than 4 days, greater than 5 days, greater than 6 days, greater than 7 days, greater than 8 days, greater than 9 days, or greater than 10 days.
  • the cells are cultured between 2 and 3 days, for example, approximately 30 hours, approximately 36 hours, or approximately 42 hours.
  • CD8+, ⁇ , NK, or B cells are depleted to improve CD4+ T cell expansion.
  • any two or more of CD8+, ⁇ , NK, and B cells are depleted to improve CD4+ T cell expansion.
  • CD8+, ⁇ , NK, B, T regulatory, NKT, or erythrocyte cells are depleted to improve CD4+ T cell expansion.
  • any two or more of CD8+, ⁇ , NK, B, T regulatory, NKT, and erythrocyte cells are depleted to improve CD4+ T cell expansion.
  • cell depletion is performed after peptide stimulation and before lentivirus transduction.
  • the cells after cell depletion, are placed in culture medium for -24 hours. In embodiments, after cell depletion, the cells are placed in culture for less than 24 hours, for example, less than 20 hours, less than 16 hours, less than 8 hours, or less than 4 hours. In embodiments, after CD8+ T cell depletion, the cells are placed in culture for greater than 24 hours, for example, greater than 30 hours, greater than 36 hours, greater than 42 hours, or greater than 48 hours.
  • the culture medium comprises IL-7. In embodiments, the culture medium comprises IL-15. In embodiments, the culture medium comprises IL-7 and IL-15. In embodiments, cell depletion is performed before peptide stimulation. In embodiments, a gag protein is used to cause peptide stimulation.
  • a HIV vaccine is used to cause peptide stimulation.
  • the MV A/HIV 62B vaccine is used to cause peptide stimulation.
  • CD8+ T, ⁇ , NK, and/or B cells are depleted with PE labeled specific antibodies and anti-PE microbeads.
  • the antibody used is an anti-human antibody.
  • the antibody used was an anti-rat antibody.
  • the antibody used is an anti-mouse antibody.
  • the antibody used is an anti-goat antibody.
  • the cells after cell depletion and peptide stimulation, the cells are transduced. In embodiments, the cells are transduced with a lentivirus.
  • the lentivirus carries GFP. In embodiments, the lentivirus carries RFP. In embodiments, the lentivirus carries EGFP. In embodiments, the cells are placed in culture after transduction. In embodiments, the culture medium comprises IL-7. In embodiments, the culture medium comprises IL-15. In embodiments, the culture medium comprises IL-7 and IL-15. In embodiments, the cells are cultured for approximately 2 days to allow for CD4+ T cell expansion. In embodiments, the cells are cultured ⁇ 3 days to allow for CD4+ T cell expansion.
  • the cells are cultured for less than 2 days, for example, less than 42 hours, less than 36 hours, less than 30 hours, less than 24 hours, less than 18 hours, less than 12 hours, or less than 6 hours. In embodiments, the cells are cultured for greater than 3 days, for example, greater than 4 days, greater than 5 days, greater than 6 days, greater than 7 days, greater than 8 days, greater than 9 days, or greater than 10 days. In embodiments, the cells are cultured between 2 and 3 days, for example, -30 hours, -36 hours, or -42 hours.
  • a lentivirus in another aspect, includes GFP, which is used to measure transduction efficiency.
  • the lentivirus includes RFP.
  • the lentivirus is carrying EGFP.
  • a cytokine capture system is used to identify antigen-specific CD4+ T cells with GFP positive cells.
  • GFP is used to identify the transduced cell subsets.
  • RFP is used to identify the transduced cell subsets.
  • EGFP is used to identify the transduced cell subsets.
  • any of the transduction methods described herein can be used to measure transduction efficiency.
  • any of the depletion methods described herein can be used to deplete any one or more of CD8+ T, ⁇ , NK, B, neutrophils, basophils, eosinophils, T regulatory, NKT, and erythrocyte cells.
  • transduction efficiency is measured by detecting vector copy number (VCN) by qPCR.
  • VCN vector copy number
  • the percentage of transduced cells based on VCN in the final cell product can be estimated by establishing the relationship between transduced cells and VCN.
  • a lentivirus carrying GFP is used to determine the percentage of the cells transduced.
  • a lentivirus carrying RFP is used to determine the percentage of cells transduced.
  • a lentivirus carrying EGFP is used to determine the percentage of cells transduced.
  • any of the transduction methods described herein can be used to measure transduction efficiency.
  • any of the depletion methods described herein can be used to deplete any one or more of CD8+ T, ⁇ , NK, B cells.
  • HIV Human Immunodeficiency Virus
  • HIV Human Immunodeficiency Virus
  • AIDS is a retrovirus that causes acquired immunodeficiency syndrome (AIDS) in humans.
  • AIDS is a condition in which progressive failure of the immune system allows life-threatening opportunistic infections and cancers to thrive. Without treatment, average survival time after infection with HIV is estimated to be 9 to 11 years, depending upon the HIV subtype.
  • Infection with HIV occurs by the transfer of bodily fluids, including but not limited to blood, semen, vaginal fluid, pre-ejaculate, saliva, tears, lymph or cerebro-spinal fluid, or breast milk. HIV may be present in an infected individual as both free virus particles and within infected immune cells.
  • HIV infects vital cells in the human immune system such as helper T cells, although tropism can vary among HIV subtypes.
  • Immune cells that may be specifically susceptible to HIV infection include but are not limited to CD4+ T cells, macrophages, and dendritic cells. HIV infection leads to low levels of CD4+ T cells through a number of mechanisms, including but not limited to apoptosis of uninfected bystander cells, direct viral killing of infected cells, and killing of infected CD4+ T cells by CD8 cytotoxic lymphocytes that recognize infected cells.
  • CD4+ T cell numbers decline below a critical level, cell-mediated immunity is lost, and the body becomes progressively more susceptible to opportunistic infections and cancer.
  • RNA genome consists of at least seven structural landmarks (LTR, TAR, RRE, PE, SLIP, CRS, and INS), and at least nine genes (gag, pol, env, tat, rev, nef, vif, vpr, vpu, and sometimes a tenth tev, which is a fusion of tat, env and rev), encoding 19 proteins.
  • LTR structural landmarks
  • TAR structural landmarks
  • RRE structural landmarks
  • HIV replicates primarily in CD4 T cells, and causes cellular destruction or dysregulation to reduce host immunity. Because HIV establishes infection as an integrated provirus and may enter a state of latency wherein virus expression in a particular cell decreases below the level for cytopathology affecting that cell or detection by the host immune system, HIV is difficult to treat and has not been eradicated even after prolonged intervals of highly active antiretro viral therapy (HAART). In the vast majority of cases, HIV infection causes fatal disease although survival may be prolonged by HAART.
  • HAART highly active antiretro viral therapy
  • CCR5 chemokine receptor
  • a functional cure is defined as a state or condition wherein HIV+ individuals who previously required HAART, may survive with low or undetectable virus replication and using lower or intermittent doses of HAART, or are potentially able to discontinue HAART altogether.
  • a functional cure may still possibly require adjunct therapy to maintain low level virus replication and slow or eliminate disease progression.
  • a possible outcome of a functional cure is the eventual eradication of HIV to prevent all possibility of recurrence.
  • Virus infection deletes CD4 T cells that are critical for nearly all immune functions. Most importantly, HIV infection and depletion of CD4 T cells requires activation of individual cells. Activation is a specific mechanism for individual CD4 T cell clones that recognize pathogens or other molecules, using a rearranged T cell receptor.
  • HIV HIV-specific T cells
  • the capacity for HIV-specific T cell responses is rebuilt during prolonged HAART; however, when HAART is interrupted the rebounding virus infection repeats the process and again deletes the virus- specific cells, resetting the clock on disease progression.
  • aspects of the disclosure provide methods and compositions for enhancing host immunity against HIV to provide a functional cure without the need for prior immunization.
  • Viral vectors are used to deliver genetic constructs to host cells for the purposes of disease therapy or prevention.
  • Genetic constructs can include, but are not limited to, functional genes or portions of genes to correct or complement existing defects, DNA sequences encoding regulatory proteins, DNA sequences encoding regulatory RNA molecules including antisense, short homology RNA, long non-coding RNA, small interfering RNA or others, and decoy sequences encoding either RNA or proteins designed to compete for critical cellular factors to alter a disease state. Gene therapy involves delivering these therapeutic genetic constructs to target cells to provide treatment or alleviation of a particular disease.
  • Lentivirus-delivered nucleases or other mechanisms for gene del etion/modifi cation may be used to lower the overall expression of CCR5 and/or help to lower HIV replication.
  • At least one study has reported having success in treating the disease when lentivirus was administered in patients with a genetic background of CCR5delta32. However, this was only one example of success, and many other patients without the CCR5delta32 genotype have not been treated as successfully. Consequently, there is a substantial need to improve the performance of viral genetic therapy against HIV, both in terms of performance for the individual viral vector construct and for improved use of the vector through a strategy for achieving functional HIV cure.
  • some existing therapies rely on zinc finger nucleases to delete a portion of CCR5 in an attempt to render cells resistant to HIV infection.
  • some existing therapies rely on zinc finger nucleases to delete a portion of CCR5 in an attempt to render cells resistant to HIV infection.
  • 30% of T cells had been modified by the nuclease at all, and of those that were modified, only 10% of the total CD4 T cell population had been modified in a way that would prevent HIV infection.
  • the disclosed methods result in virtually every cell carrying a lentivirus transgene having a reduction in CCR5 expression below the level needed to allow HIV infection. This can result in successful treatment of HIV even without a prior immunization step to increase the number of the initial CD4+ T cell pool.
  • gene therapy can include, but is not limited to, affinity-enhanced T cell receptors, chimeric antigen receptors on CD4 T cells (or alternatively on CD8 T cells), modification of signal transduction pathways to avoid cell death cause by viral proteins, increased expression of HIV restriction elements including TREX, SAMHD1, MxA or MxB proteins, APOBEC complexes, TRIM5-alpha complexes, tetherin (BST2), and similar proteins identified as being capable of reducing HIV replication in mammalian cells.
  • affinity-enhanced T cell receptors include, but is not limited to, affinity-enhanced T cell receptors, chimeric antigen receptors on CD4 T cells (or alternatively on CD8 T cells), modification of signal transduction pathways to avoid cell death cause by viral proteins, increased expression of HIV restriction elements including TREX, SAMHD1, MxA or MxB proteins, APOBEC complexes, TRIM5-alpha complexes, tetherin (BST2), and similar proteins identified
  • HIV virus has unique ways of evading the immune system, and the human body seems incapable of mounting an effective immune response against it. As a result, scientists do not have a clear picture of what is needed to provide protection against HIV.
  • Immunotherapy also called biologic therapy, is a type of treatment designed to boost the body's natural defenses to fight infections or cancer. It uses materials either made by the body or in a laboratory to improve, target, or restore immune system function.
  • immunotherapeutic approaches may be used to enrich a population of HIV-specific CD4 T cells for the purpose of increasing the host's anti-HIV immunity.
  • integrating or non-integrating lentivirus vectors may be used to transduce a host's immune cells for the purposes of increasing the host's anti-HIV immunity.
  • a vaccine comprising HIV proteins including but not limited to a killed particle, a virus-like particle, HIV peptides or peptide fragments, a recombinant viral vector, a recombinant bacterial vector, a purified subunit or plasmid DNA combined with a suitable vehicle and/or biological or chemical adjuvants to increase a host's immune responses may be used to enrich the population of virus-specific T cells or antibodies, and these methods may be further enhanced through the use of HIV -targeted genetic therapy using lentivirus or other viral vector.
  • the disclosure provides methods for using viral vectors to achieve a functional cure for HIV disease.
  • the methods may include immunotherapy to enrich the proportion of HIV-specific CD4 T cells, followed by lentivirus transduction to deliver inhibitors of HIV and CCR5 and CXCR4 as required.
  • enrichment for HIV- specific CD4 T cells and lentiviral transduction can be effective even without a prior immunization step.
  • the methods include therapeutic immunization as a method for enriching the proportion of HIV-specific CD4 T cells, wherein the immunization occurs simultaneously with or after infusion of stimulated cells into a subject.
  • Therapeutic immunization can include purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, peptides or peptide fragments, virus-like particles (VLPs), biological or chemical adjuvants including cytokines and/or chemokines, vehicles, and methods for immunization.
  • VLPs virus-like particles
  • Therapeutic vaccines can include one or more HIV protein with protein sequences representing the predominant viral types of the geographic region where treatment is occurring.
  • Therapeutic vaccines will include purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, peptides or peptide fragments, virus-like particles (VLPs), biological or chemical adjuvants including cytokines and/or chemokines, vehicles, and methods for immunization.
  • Vaccinations may be administered according to standard methods known in the art and HIV patients may continue antiretroviral therapy during the interval of immunization and subsequent ex vivo lymphocyte culture including lentivirus transduction.
  • HIV+ patients can be immunized with an HIV vaccine, increasing the frequency of HIV-specific CD4 T cells by about 2, about 25, about 250, about 500, about 750, about 1000, about 1250, or about 1500-fold (or any amount in between these values).
  • the vaccine may be any clinically utilized or experimental HIV vaccine, including the disclosed lentiviral, other viral vectors or other bacterial vectors used as vaccine delivery systems.
  • the vectors can encode virus-like particles (VLPs) to induce higher titers of neutralizing antibodies and stronger HIV-specific T cell responses.
  • VLPs virus-like particles
  • the vectors can encode peptides or peptide fragments associated with HIV including but not limited to gag, pol, and env, tat, rev, nef, vif, vpr, vpu, and tev, as well as LTR, TAR, RRE, PE, SLIP, CRS, and INS.
  • the HIV vaccine used in the disclosed methods may comprise purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, peptides or peptide fragments, virus-like particles (VLPs), or biological or chemical adjuvants including cytokines and/or chemokines.
  • VLPs virus-like particles
  • peripheral blood mononuclear cells can be obtained by leukapheresis and treated ex vivo to obtain about lxl 0 10 CD4 T cells of which about 0.1%, about 1%, about 5% or about 10% or about 30% are both HIV-specific in terms of antigen responses, and HIV-resistant by virtue of carrying the therapeutic transgene delivered by the disclosed lentivirus vector.
  • PBMCs peripheral blood mononuclear cells
  • about lxlO 7 , about lxlO 8 , about lxlO 9 , about 1 xlO 10 , about lxlO 11 , or about lxlO 12 CD4 T cells may be isolated for re-stimulation.
  • any suitable amount of CD4 T cells can be isolated for ex vivo re-stimulation.
  • the isolated CD4 T cells can be cultured in appropriate medium throughout re- stimulation with HIV vaccine antigens, which may or may not include antigens present in the prior therapeutic vaccination.
  • Antiretroviral therapeutic drugs including inhibitors of reverse transcriptase, protease or integrase may be added to prevent virus re-emergence during prolonged ex vivo culture.
  • CD4 T cell re-stimulation can be used to enrich the proportion of HIV-specific CD4 T cells in culture. The same procedure may also be used for analytical objectives wherein smaller blood volumes with peripheral blood mononuclear cells obtained by purification, are used to identify HIV-specific T cells and measure the frequency of this sub-population.
  • the PBMC fraction may be enriched for HIV-specific CD4 T cells by contacting the cells with HIV proteins matching or complementary to the components of the vaccine previously used for in vivo immunization.
  • Ex vivo re-stimulation can increase the relative frequency of HIV-specific CD4 T cells by about 5, about 10, about 25, about 50, about 75, about 100, about 125, about 150, about 175, or about 200-fold.
  • Ex vivo re-stimulation can increase the relative frequency of HIV-specific CD4 T cells regardless of whether there has been a pre-immunization step.
  • the methods detailed herein can include ex vivo re-stimulation of CD4 T cells with ex vivo lentiviral transduction and culturing.
  • the methods detailed herein can also include ex vivo re-stimulation of CD4 T cells with ex vivo lentiviral transduction and culturing without a pre- immunization step.
  • the re-stimulated PBMC fraction that has been enriched for HIV-specific CD4 T cells can be transduced with therapeutic anti-HIV lentivirus or other vectors and maintained in culture about 1 to about 21 days or up to about 35 days.
  • the cells may be cultured for about 1- about 18 days, about 1- about 15 days, about 1- about 12 days, about 1- about 9 days, or about 3- about 7 days.
  • the transduced cells may be cultured for about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 days.
  • transduced CD4 T cells are infused back into the original patient.
  • Infusion can be performed using various machines and methods known in the art.
  • infusion may be accompanied by pre- treatment with cyclophosphamide or similar compounds to increase the efficiency of re- engraftment.
  • a CCR5-targeted therapy may be added to a subject's antiretroviral therapy regimen, which was continued throughout the treatment process.
  • CCR5-targeted therapies include but are not limited to Maraviroc (a CCR5 antagonist) or Rapamycin (immunosuppressive agent that lowers CCR5).
  • the antiretroviral therapy may be ceased and the subject can be tested for virus rebound. If no rebound occurs, adjuvant therapy can also be removed and the subject can be tested again for virus rebound. Continued virus suppression with reduced or no antiretroviral therapy including cART or HAART, and reduced or no adjuvant therapy for about 26 weeks can be considered a functional cure for HIV. Other definitions of a functional cure are described herein.
  • the lentiviral and other vectors used in the disclosed methods may encode at least one, at least two, at least three, at least four, or at least five genes, or at least six genes, or at least seven genes, or at least eight genes, or at least nine genes, or at least ten genes, or at least eleven genes, or at least twelve genes of interest.
  • a viral vector of the invention may encode genes or nucleic acid sequences that include but are not limited to (i) an antibody directed to an antigen associated with an infectious disease or a toxin produced by the infectious pathogen, (ii) cytokines including interleukins that are required for immune cell growth or function and may be therapeutic for immune dysregulation encountered in HIV and other chronic or acute human viral or bacterial pathogens, (iii) factors that suppress the growth of HIV in vivo including CD8 suppressor factors, (iv) mutations or deletions of chemokine receptor CCR5, mutations or deletions of chemokine receptor CXCR4, or mutations or deletions of chemokine receptor CXCR5, (v) antisense DNA or RNA against specific receptors or peptides associated with HIV or host protein associated with HIV, (vi) small interfering RNA against specific receptors or peptides associated with HIV or host protein associated with HIV, or (vii) a variety of other therapeutically
  • HIV -targeted gene therapy examples include, but are not limited to, affinity-enhanced T cell receptors, chimeric antigen receptors on CD4 T cells (or altematively on CD8 T cells), modification of signal transduction pathways to avoid cell death cause by viral proteins, increased expression of HIV restriction elements including TREX, SAMHD1, MxA or MxB proteins, APOBEC complexes, TRIM5- alpha complexes, tetherin (BST2), and similar proteins identified as being capable of reducing HIV replication in mammalian cells.
  • affinity-enhanced T cell receptors include, but are not limited to, affinity-enhanced T cell receptors, chimeric antigen receptors on CD4 T cells (or altematively on CD8 T cells), modification of signal transduction pathways to avoid cell death cause by viral proteins, increased expression of HIV restriction elements including TREX, SAMHD1, MxA or MxB proteins, APOBEC complexes, TRIM5- alpha complexes, tetherin (
  • a patient may be undergoing cART or HAART concurrently while being treated according to the methods of the invention.
  • a patient may undergo cART or HAART before or after being treated according to the methods of the invention.
  • cART or HAART is maintained throughout treatment according to the methods of the invention and the patient may be monitored for HIV viral burden in blood and frequency of lenti virus -transduced CD4 T cells in blood.
  • a patient receiving cART or HAART prior to being treated according to the methods of the invention is able to discontinue or reduce cART or HAART following treatment according to the methods of the invention.
  • the frequency of transduced, HIV-specific CD4 T cells which is a novel surrogate marker for gene therapy effects, may be determined, as discussed in more detail herein.
  • the disclosed invention provides lentiviral vectors capable of delivering genetic constructs to inhibit HIV penetration of susceptible cells.
  • one mechanism of action is to reduce mRNA levels for CCR5 and/or CXCR4 chemokine receptors and thus reduce the rates for viral entry into susceptible cells.
  • the disclosed lentiviral vectors may be capable of inhibiting the formation of HIV-infected cells by reducing the stability of incoming HIV genomic RNA.
  • the disclosed lentivirus vectors are capable of preventing HIV production from a latently infected cell, wherein the mechanism of action is to cause instability of viral RNA sequences through the action of inhibitory RNA including short-homology, small-interfering or other regulatory RNA species.
  • the therapeutic lentiviruses disclosed in this application generally comprise at least one of two types of genetic cargo.
  • the lentiviruses may encode genetic elements that direct expression of small RNA capable of inhibiting the production of chemokine receptors CCR5 and/or CXCR4 that are important for HIV penetration of susceptible cells.
  • the second type of genetic cargo includes constructs capable of expressing small RNA molecules targeting HIV RNA sequences for the purpose of preventing reverse transcription, RNA splicing, RNA translation to produce proteins, or packaging of viral genomic RNA for particle production and spreading infection.
  • An exemplary structure is diagrammed in Figure 3.
  • an exemplary construct may comprise numerous sections or components.
  • an exemplary LV construct may comprise the following sections or components:
  • ⁇ 5'LTR - a portion of an HIV long terminal repeat that can be truncated to prevent replication of the vector after chromosomal integration
  • Psi - a packaging signal that allows for incorporation of the vector RNA genome into viral particles during packaging
  • RRE - a Rev Responsive element can be added to improve expression from the transgene by mobilizing RNA out of the nucleus and into the cytoplasm of cells;
  • Promoter - a promoter initiates RNA transcription from the integrated transgene to express micro-RNA clusters (or other genetic elements of the construct), and in some embodiments, the vectors may use an EF-1 promoter;
  • Anti-Rev/Tat - a micro RNA targeting HIV genomic or messenger RNA at the junction between HIV Rev and Tat coding regions, which is sometimes designated miRNA Tat or given a similar description in this application;
  • WPRE - a woodchuck hepatitis virus post-transcriptional regulatory element is an additional vector component that can be used to facilitate RNA transport of the nucleus
  • deltaU3 3'LTR - a modified version of a HIV 3' long terminal repeat where a portion of the U3 region has been deleted to improve safety of the vector.
  • Vectors of the invention may include either or both of the types of genetic cargo discussed above (i.e., genetic elements that direct expression of a gene or small RNAs, such as siRNA, shRNA, or miRNA that can prevent translation or transcription), and the vectors of the invention may also encode additionally useful products for the purpose of treatment or diagnosis of HIV. For instance, in some embodiments, these vectors may also encode green fluorescent protein (GFP) for the purpose of tracking the vectors or antibiotic resistance genes for the purposes of selectively maintaining genetically-modified cells in vivo.
  • GFP green fluorescent protein
  • a vector may encode a single small RNA, two small RNAs, three small RNA, four small RNAs, five small RNAs, six small RNAs, seven small RNAs, eight small RNAs, nine small RNAs, or ten small RNAs, or eleven small RNAs, or twelve small RNAs.
  • Such vectors may additionally encode other genetic elements to function in concert with the small RNAs to prevent expression and infection of HIV.
  • the therapeutic lentivirus may substitute alternate sequences for the promoter region, targeting of regulatory RNA, and types of regulatory RNA.
  • the therapeutic lentivirus of the disclosure may comprise changes in the plasmids used for packaging the lentivirus particles; these changes are required to increase levels of production in vitro. Lentiviral Vector System
  • a lentiviral virion is expressed by a vector system encoding the necessary viral proteins to produce a virion (viral particle).
  • a vector system encoding the necessary viral proteins to produce a virion (viral particle).
  • the pol proteins are expressed by multiple vectors.
  • this gag nucleic acid sequence is on a separate vector than at least some of the pol nucleic acid sequence.
  • the gag nucleic acid is on a separate vector from all the pol nucleic acid sequences that encode pol proteins.
  • vectors which are used to create the particles to further minimize the chance of obtaining wild type revertants. These include, but are not limited to deletions of the U3 region of the LTR, tat deletions and matrix (MA) deletions.
  • gag, pol and env vector(s) do not contain nucleotides from the lentiviral genome that package lentiviral RNA, referred to as the lentiviral packaging sequence.
  • the vector(s) forming the particle preferably do not contain a nucleic acid sequence from the lentiviral genome that expresses an envelope protein.
  • a separate vector that contains a nucleic acid sequence encoding an envelope protein operably linked to a promoter is used.
  • This env vector also does not contain a lentiviral packaging sequence.
  • the env nucleic acid sequence encodes a lentiviral envelope protein.
  • the envelope protein is not from, the lentivirus, but from a different virus.
  • the resultant particle is referred to as a pseudotyped particle.
  • an env gene that encodes an envelope protein that targets an endocytic compartment such as that of the influenza virus, VSV-G, alpha viruses (Semliki forest vims, Sindbis virus), arenaviruses (lymphocytic choriomeningitis virus), flaviviruses (tick-borne encephalitis virus, Dengue virus, hepatitis C virus, GB virus), rhabdoviruses (vesicular stomatitis virus, rabies virus), paramyxoviruses (mumps or measles) and orthomyxoviruses (influenza virus).
  • envelopes that can preferably be used include those from Moloney Leukemia Virus such as MLV-E, MLV- A and GALV. These latter envelopes are particularly preferred where the host cell is a primary cell.
  • Other envelope proteins can be selected depending upon the desired host ceil. For example, targeting specific receptors such as a dopamine receptor can be used for brain delivery. Another target can be vascular endothelium. These cells can be targeted using a filovirus envelope. For example, the GP of Ebola, which by post-transcriptional modification become the GP, and GP? glycoproteins.
  • a SHIV pseudotyped vector can readily be used in animal models such as monkeys.
  • a lentiviral vector system typically includes at least one helper plasmid comprising at least one of a gag, pol, or rev gene.
  • Each of the gag, pol and rev genes may be provided on individual plasmids, or one or more genes may be provided together on the same plasmid.
  • the gag, pol, and rev genes are provided on the same plasmid (e.g., Figure 4).
  • the gag and pol genes are provided on a first plasmid and the rev gene is provided on a second plasmid (e.g., Figure 5). Accordingly, both 3- vector and 4-vector systems can be used to produce a lentivims as described in the Examples section and elsewhere herein.
  • the therapeutic vector, the envelope plasmid and at least one helper plasmid are transfected into a packaging cell line.
  • a non-limiting example of a packaging cell line is the 293T/17 HEK cell line.
  • a lentiviral vector system for expressing a lentiviral particle includes a lentiviral vector as described herein; an envelope plasmid for expressing an envelope protein optimized for infecting a cell; and at least one helper plasmid for expressing gag, pol, and rev genes, wherein when the lentiviral vector, the envelope plasmid, and the at least one helper plasmid are transfected into a packaging cell line, a lentiviral particle is produced by the packaging cell line, wherein the lentiviral particle is capable of inhibiting production of chemokine receptor CCR5 or targeting an HIV RNA sequence.
  • the lentiviral vector which is also referred to herein as a therapeutic vector, can include the following elements: hybrid 5' long terminal repeat (RSV/5' LTR) (SEQ ID NOS: 34-35), Psi sequence (RNA packaging site) (SEQ ID NO: 36), RRE (Rev-response element) (SEQ ID NO: 37), cPPT (polypurine tract) (SEQ ID NO: 38), EF-la promoter (SEQ ID NO: 4), miR30CCR5 (SEQ ID NO: 1), miR21Vif (SEQ ID NO: 2), miR185Tat (SEQ ID NO: 3), Woodchuck Post-Transcriptional Regulatory Element (WPRE) (SEQ ID NOS: 32 or 80), and AU3 3' LTR (SEQ ID NO: 39).
  • sequence variation by way of substitution, deletion, or addition can be used to modify the above-referenced sequences.
  • helper plasmid has been designed to include the following elements: CAG promoter (SEQ ID NO: 41); HIV component gag (SEQ ID NO: 43); HIV component pol (SEQ ID NO: 44); HIV Int (SEQ ID NO: 45); HIV RRE (SEQ ID NO: 46); and HIV Rev (SEQ ID NO: 47).
  • the helper plasmid may be modified to include a first helper plasmid for expressing the gag and pol genes, and a second and separate plasmid for expressing the rev gene.
  • sequence variation by way of substitution, deletion, or addition can be used to modify the above-referenced sequences.
  • an envelope plasmid has been designed to include the following elements being from left to right: RNA polymerase II promoter (CMV) (SEQ ID NO: 60) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 62).
  • CMV RNA polymerase II promoter
  • VSV-G vesicular stomatitis virus G glycoprotein
  • sequence variation by way of substitution, deletion, or addition can be used to modify the above-referenced sequences.
  • the plasmids used for lentiviral packaging can be modified with similar elements and the intron sequences could potentially be removed without loss of vector function.
  • the following elements can replace similar elements in the plasmids that comprise the packaging system: Elongation Factor-1 (EF-1), phosphoglycerate kinase (PGK), and ubiquitin C (UbC) promoters can replace the CMV or CAG promoter.
  • EF-1 Elongation Factor-1
  • PGK phosphoglycerate kinase
  • UbC ubiquitin C
  • SV40 poly A and bGH poly A can replace the rabbit beta globin poly A.
  • the HIV sequences in the helper plasmid can be constructed from different HIV strains or clades.
  • the VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD114), gibbon ape leukemia virus (GALV), Rabies (FUG), lymphocytic choriomeningitis virus (LCMV), influenza A fowl plague virus (FPV), Ross River alphavirus (RRV), murine leukemia virus 10A1 (MLV), or Ebola virus (EboV).
  • RD114 feline endogenous virus
  • GALV gibbon ape leukemia virus
  • FUG Rabies
  • LCMV lymphocytic choriomeningitis virus
  • influenza A fowl plague virus FV
  • RRV Ross River alphavirus
  • MMV murine leukemia virus 10A1
  • Ebola virus Ebola virus
  • lentiviral packaging systems can be acquired commercially (e.g., Lenti-vpak packaging kit from OriGene Technologies, Inc., Rockville, MD), and can also be designed as described herein. Moreover, it is within the skill of a person skilled in the art to substitute or modify aspects of a lentiviral packaging system to improve any number of relevant factors, including the production efficiency of a lentiviral particle.
  • the present invention includes bioassays for determining the success of HIV treatment for achieving a functional cure. These assays will provide a method for measuring the efficacy of the disclosed methods by measuring the frequency of transduced, HIV specific CD4 T cells in a patient. HIV-specific CD4 T cells are recognizable because they proliferate, change the composition of cell surface markers, induce signaling pathways including phosphorylation, or express specific marker proteins that may be cytokines, chemokines, caspases, phosphorylated signaling molecules or other cytoplasmic and/or nuclear components.
  • Specific responding CD4 T cells are recognized for example, using labeled monoclonal antibodies or specific in situ amplification of mRNA sequences, that allow sorting of HIV-specific cells using flow cytometry sorting, magnetic bead separation or other recognized methods for antigen-specific CD4 T cell isolation.
  • the isolated CD4 T cells are tested to determine the frequency of cells carrying integrated therapeutic lentivirus.
  • Single cell testing methods may also be used including microfluidic separation of individual cells that are coupled with mass spectrometry, PCR, ELISA or antibody staining to confirm responsiveness to HIV and presence of integrated therapeutic lentivirus.
  • a treatment according to the invention e.g., (a) no immunization, (b) ex vivo lymphocyte culture; (c) re-stimulation with purified proteins, inactivated viruses, virally vectored proteins, bacterially vectored proteins, biological or chemical adjuvants including cytokines and/or chemokines, vehicles; and (d) infusion of the enriched, transduced T cells
  • a patient may be subsequently assayed to determine the efficacy of the treatment.
  • a threshold value of target T cells in the cell product for infusion may be established to measure a functional cure at, for instance, about lxlO 8 HIV- specific CD4 T cells bearing genetic modification from therapeutic lentivirus.
  • the threshold value may be about lxlO 5 , about lxlO 6 , about lxlO 7 , about lxlO 8 , about lxlO 9 , or about lxlO 10 CD4 T cells in the body of the patient.
  • HIV-specific CD4 T cells bearing genetic modification from therapeutic lentivirus can be determined using any suitable method, such as but not limited to flow cytometry, cell sorting, FACS analysis, DNA cloning, PCR, RT-PCR or Q-PCR, ELISA, FISH, western blotting, southern blotting, high throughput sequencing, RNA sequencing, oligonucleotide primer extension, or other methods known in the art.
  • suitable method such as but not limited to flow cytometry, cell sorting, FACS analysis, DNA cloning, PCR, RT-PCR or Q-PCR, ELISA, FISH, western blotting, southern blotting, high throughput sequencing, RNA sequencing, oligonucleotide primer extension, or other methods known in the art.
  • dosing regimens may vary based upon the condition of the patient and the method of administration.
  • HIV-specific vaccines may be administered simultaneously with infusion or after infusion of stimulated cells into a subject.
  • HIV-specific vaccines may be administered to a subject in need in varying doses.
  • vaccines delivered by intramuscular injection include about 10 ⁇ g to about 300 ⁇ g, about 25 ⁇ g to about 275 ⁇ g, about 50 ⁇ g to about 250 ⁇ g, about 75 ⁇ g to about 225, or about 100 ⁇ g to about 200 ⁇ g of HIV protein, either total virus protein prepared from inactivated virus particles, virus-like particles or purified virus protein from recombinant systems or purified from virus preparations.
  • Recombinant viral or bacterial vectors may be administered by any and all of the routes described.
  • Intramuscular vaccines will include about 1 ⁇ g to about 100 ⁇ g, about 10 ⁇ g to about 90 ⁇ g, about 20 ⁇ g to about 80 ⁇ g, about 30 ⁇ g to about 70 ⁇ g, about 40 ⁇ g to about 60 ⁇ g, or about 50 ⁇ g of suitable adjuvant molecules and be suspended in oil, saline, buffer or water in volumes of 0.1 to 5 ml per injection dose, and may be soluble or emulsion preparations.
  • Vaccines delivered orally, rectally, buccally, at genital mucosal or intranasally may contain higher amounts of virus protein and adjuvant.
  • Dermal, sub-dermal or subcutaneous vaccines utilize protein and adjuvant amounts more similar to oral, rectal or intranasal-delivered vaccines.
  • vaccination may be repeated 1-5 times using the same or alternate routes for delivery. Intervals may be of 2-24 weeks between immunizations.
  • Immune responses to vaccination are measured by testing HIV-specific antibodies in serum, plasma, vaginal secretions, rectal secretions, saliva or bronchoalveolar lavage fluids, using ELISA or similar methodology.
  • Cellular immune responses are tested by in vitro stimulation with vaccine antigens followed by staining for intracellular cytokine accumulation followed by flow cytometry or similar methods including lymphoproliferation, expression of phosphorylated signaling proteins or changes in cell surface activation markers.
  • Upper limits of dosing may be determined based on the individual patient and will depend on toxi city/safety profiles for each individual product or product lot.
  • Immunization may occur once, twice, three times, or repeatedly.
  • an agent for HIV immunization may be administered to a subject in need once a week, once every other week, once every three weeks, once a month, every other month, every three months, every six months, every nine months, once a year, every eighteen months, every two years, every 36 months, or every three years.
  • immunization may occur once, twice, three times, or more after ex vivo lymphocyte culture/re-stimulation and infusion.
  • HIV-vaccines for immunization are administered as a pharmaceutical composition.
  • the pharmaceutical composition comprising an HIV vaccine can be formulated in a wide variety of nasal, pulmonary, oral, topical, or parenteral dosage forms for clinical application.
  • Each of the dosage forms can comprise various disintegrating agents, surfactants, fillers, thickeners, binders, diluents such as wetting agents or other pharmaceutically acceptable excipients.
  • the pharmaceutical composition comprising an HIV vaccine can also be formulated for injection.
  • HIV vaccine compositions for the purpose of immunization can be administered using any pharmaceutically acceptable method, such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenously, intradermally, intramuscularly, subcutaneously, intracisternally, intraperitoneally), pulmonary, intravaginal, locally administered, topically administered, topically administered after scarification, mucosally administered, via an aerosol, or via a buccal or nasal spray formulation.
  • any pharmaceutically acceptable method such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenously, intradermally, intramuscularly, subcutaneously, intracisternally, intraperitoneally), pulmonary, intravaginal, locally administered, topically administered, topically administered after scarification, mucosally administered, via an aerosol, or via a buccal or nasal spray formulation.
  • the HIV vaccine compositions can be formulated into any pharmaceutically acceptable dosage form, such as a solid dosage form, tablet, pill, lozenge, capsule, liquid dispersion, gel, aerosol, pulmonary aerosol, nasal aerosol, ointment, cream, semi-solid dosage form, and a suspension.
  • the composition may be a controlled release formulation, sustained release formulation, immediate release formulation, or any combination thereof.
  • the composition may be a transdermal delivery system.
  • the pharmaceutical composition comprising an HIV vaccine can be formulated in a solid dosage form for oral administration, and the solid dosage form can be powders, granules, capsules, tablets or pills.
  • the solid dosage form can include one or more excipients such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose or gelatin.
  • the solid dosage form can include, in addition to the excipients, a lubricant such as talc or magnesium stearate.
  • the oral dosage form can be immediate release or a modified release form. Modified release dosage forms include controlled or extended release, enteric release, and the like. The excipients used in the modified release dosage forms are commonly known to a person of ordinary skill in the art.
  • the pharmaceutical composition comprising a HIV vaccine can be formulated as a sublingual or buccal dosage form.
  • dosage forms comprise sublingual tablets or solution compositions that are administered under the tongue and buccal tablets that are placed between the cheek and gum.
  • the pharmaceutical composition comprising an HIV vaccine can be formulated as a nasal dosage form.
  • Such dosage forms of the present invention comprise solution, suspension, and gel compositions for nasal delivery.
  • the pharmaceutical composition can be formulated in a liquid dosage form for oral administration, such as suspensions, emulsions or syrups.
  • the liquid dosage form can include, in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as humectants, sweeteners, aromatics or preservatives.
  • the composition comprising HIV vaccine or a pharmaceutically acceptable salt thereof can be formulated to be suitable for administration to a pediatric patient.
  • the pharmaceutical composition can be formulated in a dosage form for parenteral administration, such as sterile aqueous solutions, suspensions, emulsions, non-aqueous solutions or suppositories.
  • the non-aqueous solutions or suspensions can include propyleneglycol, polyethyleneglycol, vegetable oils such as olive oil or injectable esters such as ethyl oleate.
  • vegetable oils such as olive oil or injectable esters such as ethyl oleate.
  • injectable esters such as ethyl oleate.
  • suppositories witepsol, macrogol, tween 61 , cacao oil, laurin oil or glycerinated gelatin can be used.
  • the dosage of the pharmaceutical composition can vary depending on the patient's weight, age, gender, administration time and mode, excretion rate, and the severity of disease.
  • lymphocytes, PBMC, and/or CD4 T cells are removed from a patient and isolated for stimulation and culturing.
  • the isolated cells may be contacted with the same HIV vaccine or activating agent used for immunization or a different HIV vaccine or activating agent.
  • the isolated cells are contacted with about 10 ng to 5 ⁇ g of an HIV vaccine or activating agent per about 106 cells in culture (or any other suitable amount).
  • the isolated cells may be contacted with about 50 ng, about 100 ng, about 200 ng, about 300 ng, about 400 ng, about 500 ng, about 600 ng, about 700 ng, about 800 ng, about 900 ng, about 1 ⁇ g, about 1.5 ⁇ g, about 2 ⁇ g, about 2.5 ⁇ g, about 3 ⁇ g, about 3.5 ⁇ g, about 4 ⁇ g, about 4.5 ⁇ g, or about 5 ⁇ g of an HIV vaccine or activating agent per about 106 cells in culture.
  • Activating agents or vaccines are generally used once for each in vitro cell culture but may be repeated after intervals of about 15 to about 35 days. For example, a repeat dosing could occur at about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, or about 35 days.
  • the cells may be transduced with lentiviral vectors or with other known vector systems as disclosed herein.
  • the cells being transduced may be contacted with about 1 -1,000 viral genomes (measured by RT-PCR assay of culture fluids containing lentivirus vector) per target cell in culture (or any other suitable amount).
  • Lentivirus transduction may be repeated 1 -5 times using the same range of 1 -1,000 viral genomes per target cell in culture.
  • cells such as T cells may be obtained from an HIV infected patient and cultured in multi-well plates in a culture medium comprising conditioned media ('"CM”).
  • conditioned media '
  • p24 gag p24 gag
  • viral RNA levels may be assessed by standard means.
  • Those patients whose CM-cultured ceils have peak p24 supernatant levels of less than 1 ng/ml may be suitable patients for large-scale T-cell expansion in CM with or without the use of additional anti-viral agents.
  • different drugs or drug combinations of interest may be added to different wells and the impact on virus levels in the sample may be assessed by standard means. Those drug combinations providing adequate viral suppression are therapeutically useful combinations.
  • CM allows the culture of T cells for periods of over two months, thereby providing an effective system in which to assay long term drug effectiveness.
  • CM4 This approach allows the inhibition of gene expression driven by the HIV LTR promoter region in a cell population by the culture of cells in a medium comprising the CM.
  • Culture in CM4 likely inhibits HIV LTR driven gene expression by altering one or more interactions between transcription mediating proteins and HIV gene expression regulatory elements.
  • Transcription-mediating proteins of interest include host cell encoded proteins such as AP-1, NFkappaB, NF-AT, IRF, LEF-1 and Spl, and the HIV encoded protein Tat.
  • HIV gene expression regulatory elements of interest include binding sites for AP-1, NFkappaB, NF- AT, IRF, LEF-1 and Spl, as well as the transacting responsive element ("TAR") which interacts with Tat.
  • TAR transacting responsive element
  • the HIV infected cells are obtained from a subject with susceptible transcription mediating protein sequences and susceptible HIV regulator ' element sequences. In a more preferred embodiment, the HIV infected cells are obtained from a subject having wild-type transcription-mediating protein sequences and wild-type HIV regulatory sequences.
  • Another method of enriching T cells utilizes immunoaffinity-based selection. Tins approach may involve the simultaneous enrichment or selection of a first and second population of cells, such as a CD4+ and CD8+ cell population.
  • Cells containing primary human T cells are contacted with a first immunoaffinity reagent that specifically binds to CD4 and a second immunoaffinity reagent that specifically binds to CD8 in an incubation composition, under conditions whereby the immunoaffinity reagents specifically bind to CD4 and CDS molecules, respectively, on the surface of cells in the sample.
  • Cells bound to the first and/or the second immunoaffinity reagent are recovered, thereby generating an enriched composition comprising ( DA cells and CD8+ cells.
  • This approach may include incubation of the composition with a concentration of the first and/or second immunoaffinity reagent that is at a sub-optimal yield concentration.
  • transduced cells are a mixed T cell population, and in other embodiments transduced cells are not a mixed T cell population.
  • immunoaffinity-based selection is used where the solid support is a sphere, such as a bead, such as a microbead or nanobead.
  • the bead can be a magnetic bead
  • the antibody contains one or more binding partners capable of forming a reversible bond with a binding reagent immobilized on the solid surface, such as a sphere or chromatography matrix, wherein the antibody is reversibly mobilized to the solid surface.
  • cells expressing a cell surface marker bound by the antibody on said solid surface are capable of being recovered from the matrix by disruption of the reversible binding between the binding reagent and binding partner.
  • the binding reagent is streptavidin or is a streptavidin analog or mutant.
  • Stable transduction of primary cells of the hematopoietic system and/or hematopoietic stem cells may be obtained by contacting, in vitro or ex vivo, the surface of the cells with both a lentiviral vector and at least one molecule which binds the cell surface.
  • the cells may be cultured in a ventilated vessel comprising two or more layers under conditions conducive to growth and/or proliferation. In some embodiments, this approach may be used in conj unction with non-CD4+ T cell depletion and/or broad polyclonal expansion.
  • PBMC are stimulated with a peptide and enriched for cells secreting a cytokine, such as interferon-gamma.
  • a cytokine such as interferon-gamma.
  • This approach generally involves stimulating a mixture of cells containing T cells with antigen, and effecting a separation of antigen-stimulated cells according to the degree to which they are labeled with the product.
  • Antigen stimulation is achieved by exposing the cells to at least one antigen under conditions effective to elicit antigen-specific stimulation of at least one T cell.
  • Labeling with the product is achieved by modifying the surface of the cells to contain at least one capture moiety, culturing the cells under conditions in which the product is secreted, released and specifically bound ("captured” or “entrapped' " ) to said capture moiety; and labeling the captured product with a label moiety, where the labeled cells are not iysed as part of the labeling procedure or as part of the separation procedure.
  • the capture moiety may incorporate detection of ceil surface glycoproteins CDS or CD4 to refine the enrichment step and increase the proportion of antigen-specific T ceils in general, of CD4+ T cells in specific.
  • a lentiviral vector system was developed as summarized in Figure 3 (linear form) and Figure 4 (circularized form).
  • a representative therapeutic vector has been designed and produced with the following elements being from left to right: hybrid 5' long terminal repeat (RSV/5' LTR) (SEQ ID NOS: 34-35), Psi sequence (RNA packaging site) (SEQ ID NO: 36), RRE (Rev-response element) (SEQ ID NO: 37), cPPT (polypurine tract) (SEQ ID NO: 38), EF-la promoter (SEQ ID NO: 4), miR30CCR5 (SEQ ID NO: 1), miR21Vif (SEQ ID NO: 2), miR185Tat (SEQ ID NO: 3), Woodchuck Post- Transcriptional Regulatory Element (WPRE) (SEQ ID NOS: 32 or 80), and AU3 3' LTR (SEQ ID NO: 39).
  • the therapeutic vector detailed in Figure 3 is also referred to herein as AGT
  • helper plasmid has been designed and produced with the following elements being from left to right: CAG promoter (SEQ ID NO: 41); HIV component gag (SEQ ID NO: 43); HIV component pol (SEQ ID NO: 44); HIV Int (SEQ ID NO: 45); HIV RRE (SEQ ID NO: 46); and HIV Rev (SEQ ID NO: 47).
  • an envelope plasmid has been designed and produced with the following elements being from left to right: RNA polymerase II promoter (CMV) (SEQ ID NO: 60) and vesicular stomatitis virus G glycoprotein (VSV-G) (SEQ ID NO: 62).
  • CMV RNA polymerase II promoter
  • VSV-G vesicular stomatitis virus G glycoprotein
  • Lentiviral particles were produced in 293T/17 HEK cells (purchased from American Type Culture Collection, Manassas, VA) following transfection with the therapeutic vector, the envelope plasmid, and the helper plasmid (as shown in Figure 3).
  • PEI reagent Poly (ethylenimine)
  • the plasmids and DNA were initially added separately in culture medium without serum in a ratio of 3: 1 (mass ratio of PEI to DNA).
  • cell medium was collected and lentiviral particles were purified by high-speed centrifugation and/or filtration followed by ani on-exchange chromatography.
  • the concentration of lentiviral particles can be expressed in terms of transducing units/ml (TU/ml).
  • the determination of TU was accomplished by measuring HIV p24 levels in culture fluids (p24 protein is incorporated into lentiviral particles), measuring the number of viral DNA copies per cell by quantitative PCR, or by infecting cells and using light (if the vectors encode luciferase or fluorescent protein markers).
  • a 3-vector system i.e., a 2-vector lentiviral packaging system
  • a 3-vector system was designed for the production of lentiviral particles.
  • a schematic of the 3-vector system is shown in Figure 4.
  • the schematic of Figure 4 is a circularized version of the linear system previously described in Figure 3.
  • the top-most vector is a helper plasmid, which, in this case, includes Rev.
  • the vector appearing in the middle of Figure 4 is the envelope plasmid.
  • the bottom-most vector is the previously described therapeutic vector.
  • the Helper plus Rev plasmid includes a CAG enhancer (SEQ ID NO: 40); a CAG promoter (SEQ ID NO: 41); a chicken beta actin intron (SEQ ID NO: 42); a HIV gag (SEQ ID NO: 43); a HIV Pol (SEQ ID NO: 44); a HIV Int (SEQ ID NO: 45); a HIV RRE (SEQ ID NO: 46); a HIV Rev (SEQ ID NO: 47); and a rabbit beta globin poly A (SEQ ID NO: 48).
  • the Envelope plasmid includes a CMV promoter (SEQ ID NO: 60); a beta globin intron (SEQ ID NO: 61); a VSV-G (SEQ ID NO: 62); and a rabbit beta globin poly A (SEQ ID NO: 63). Synthesis of a 2-vector lentiviral packaging system including Helper (plus Rev) and
  • helper plasmid was constructed by initial PCR amplification of a DNA fragment from the pNL4-3 HIV plasmid (NIH Aids Reagent Program) containing Gag, Pol, and Integrase genes. Primers were designed to amplify the fragment with EcoRI and NotI restriction sites which could be used to insert at the same sites in the pCDNA3 plasmid (Invitrogen).
  • the forward primer was (5'-TAAGCAGAATTC ATGAATTTGCC AGGAAGAT-3 ') (SEQ ID NO: 81) and reverse primer was (5'- CCATACAATGAATGGACACTAGGCGGCCGCACGAAT-3') (SEQ ID NO: 82).
  • the sequence for the Gag, Pol, Integrase fragment was as follows:
  • the CMV promoter of pCDNA3.1 was replaced with the CAG enhancer/promoter plus a chicken beta actin intron sequence.
  • a DNA fragment containing the CAG enhancer/promoter/intron sequence with Mlul and EcoRI flanking restriction sites was synthesized by MWG Operon. The DNA fragment was then inserted into the plasmid at the Mlul and EcoRI restriction sites.
  • the DNA sequence was as follows:
  • VSV-G vesicular stomatitis Indiana virus glycoprotein
  • a 4-vector system (i.e., a 3 -vector lenti viral packaging system) has also been designed and produced using the methods and materials described herein.
  • a schematic of the 4-vector system is shown in Figure 5.
  • the top-most vector is a helper plasmid, which, in this case, does not include Rev.
  • the vector second from the top is a separate Rev plasmid.
  • the vector second from the bottom is the envelope plasmid.
  • the bottom-most vector is the previously described therapeutic vector.
  • the Helper plasmid includes a CAG enhancer (SEQ ID NO: 49); a CAG promoter (SEQ ID NO: 50); a chicken beta actin intron (SEQ ID NO: 51); a HIV gag (SEQ ID NO: 52); a HIV Pol (SEQ ID NO: 53); a HIV Int (SEQ ID NO: 54); a HIV RRE (SEQ ID NO: 55); and a rabbit beta globin poly A (SEQ ID NO: 56).
  • a CAG enhancer SEQ ID NO: 49
  • a CAG promoter SEQ ID NO: 50
  • a chicken beta actin intron SEQ ID NO: 51
  • a HIV gag SEQ ID NO: 52
  • a HIV Pol SEQ ID NO: 53
  • a HIV Int SEQ ID NO: 54
  • a HIV RRE SEQ ID NO: 55
  • a rabbit beta globin poly A SEQ ID NO: 56.
  • the Rev plasmid includes a RSV promoter (SEQ ID NO: 57); a HIV Rev (SEQ ID NO: 58); and a rabbit beta globin poly A (SEQ ID NO: 59).
  • the Envelope plasmid includes a CMV promoter (SEQ ID NO: 60); a beta globin intron (SEQ ID NO: 61); a VSV-G (SEQ ID NO: 62); and a rabbit beta globin poly A (SEQ ID NO: 63).
  • the Helper plasmid without Rev was constructed by inserting a DNA fragment containing the RRE and rabbit beta globin poly A sequence. This sequence was synthesized by MWG Operon with flanking Xbal and Xmal restriction sites. The RRE/rabbit poly A beta globin sequence was then inserted into the Helper plasmid at the Xbal and Xmal restriction sites.
  • the DNA sequence is as follows:
  • the RSV promoter and HIV Rev sequence was synthesized as a single DNA fragment by MWG Operon with flanking Mfel and Xbal restriction sites. The DNA fragment was then inserted into the pCDNA3.1 plasmid (Invitrogen) at the Mfel and Xbal restriction sites in which the CMV promoter is replaced with the RSV promoter.
  • the DNA sequence was as follows:
  • the plasmids for the 2-vector and 3-vector packaging systems could be modified with similar elements and the intron sequences could potentially be removed without loss of vector function.
  • the following elements could replace similar elements in the 2-vector and 3-vector packaging system:
  • Elongation Factor-1 (EF-1) (SEQ ID NO: 64), phosphogly cerate kinase
  • PGK SEQ ID NO: 65
  • UbC ubiquitin C
  • Poly A sequences: SV40 poly A (SEQ ID NO: 67) and bGH poly A (SEQ ID NO: 68) can replace the rabbit beta globin poly A (SEQ ID NO: 48).
  • HIV Gag, Pol, and Integrase sequences The HIV sequences in the Helper plasmid can be constructed from different HIV strains or clades.
  • HIV Gag SEQ ID NO: 69
  • HIV Gag SEQ ID NO: 69
  • HIV Pol SEQ ID NO: 70
  • HIV Int SEQ ID NO: 71
  • VSV-G glycoprotein can be substituted with membrane glycoproteins from feline endogenous virus (RD114) (SEQ ID NO: 72), gibbon ape leukemia virus (GALV)
  • RRV River alphavirus
  • MMV murine leukemia virus 10A1
  • Ebola virus (EboV) (SEQ ID NO: 79). Sequences for these envelopes are identified in the sequence portion herein.
  • the 3-vector versus 4-vector systems can be compared and contrasted as follows.
  • the 3-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag, Pol,
  • Envelope plasmid VSV-G/FUG envelope
  • Therapeutic vector RSV 5'LTR, Psi Packaging Signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3'delta LTR.
  • the 4-vector lentiviral vector system contains: 1. Helper plasmid: HIV Gag,
  • Rev plasmid Rev
  • Envelope plasmid VSV-G/FUG envelope
  • Therapeutic vector RSV 5'LTR, Psi Packaging Signal, Gag fragment, RRE, Env fragment, cPPT, WPRE, and 3'delta LTR. Sequences corresponding with the above elements are identified in the sequence listings portion herein.
  • the purpose of this example was to develop an anti-HIV lentivirus vector.
  • RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from the Broad Institute or the BLOCK-iT RNAi Designer from Thermo Scientific. Individual selected shRNA sequences were inserted into lentiviral vectors immediately 3' to a RNA polymerase III promoter such as HI, U6, or 7SK to regulate shRNA expression. These lentivirus-shRNA constructs were used to transduce cells and measure the change in specific mRNA levels.
  • the shRNA most potent for reducing mRNA levels were embedded individually within a microRNA backbone to allow for expression by either the CMV or EF-1 alpha RNA polymerase II promoters.
  • the microRNA backbone was selected from mirbase.org.
  • RNA sequences were also synthesized as synthetic siRNA oligonucleotides and introduced directly into cells without using a lentiviral vector.
  • the genomic sequence of Bal strain of human immunodeficiency virus type 1 (HIV-1 85US_BaL, accession number AY713409) was used to search for potential siRNA or shRNA candidates to knockdown HIV replication levels in human cells. Based on sequence homology and experience, the search focused on regions of the Tat and Vif genes of HIV although an individual of skill in the art will understand that use of these regions is non-limiting and other potential targets might be selected. Importantly, highly conserved regions of Gag or Polymerase genes could not be targeted by shRNA because these same sequences were present in the packaging system complementation plasmids needed for vector manufacturing.
  • a RNA polymerase III promoter such as HI, U6, or 7SK
  • lentivirus-shRNA constructs were used to transduce cells and measure the change in specific mRNA levels.
  • the shRNA most potent for reducing mRNA levels were embedded individually within a microRNA backbone to allow for expression by either the CMV or EF-1 alpha RNA polymerase II promoters.
  • oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by Eurofins MWG Operon, LLC. Overlapping sense and antisense oligonucleotide sequences were mixed and annealed during cooling from 70 degrees Celsius to room temperature.
  • the lentiviral vector was digested with the restriction enzymes BamHI and EcoRI for one hour at 37 degrees Celsius.
  • the digested lentiviral vector was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit from Invitrogen. The DNA concentrations were determined and vector to oligo (3: 1 ratio) were mixed, allowed to anneal, and ligated.
  • the ligation reaction was performed with T4 DNA ligase for 30 minutes at room temperature. 2.5 microliters of the ligation mix were added to 25 microliters of STBL3 competent bacterial cells. Transformation was achieved after heat-shock at 42 degrees Celsius. Bacterial cells were spread on agar plates containing ampicillin and drug-resistant colonies (indicating the presence of ampicillin-resistance plasmids) were recovered, purified and expanded in LB broth. To check for insertion of the oligo sequences, plasmid DNA were extracted from harvested bacteria cultures with the Invitrogen DNA mini prep kit. Insertion of the shRNA sequence in the lentiviral vector was verified by DNA sequencing using a specific primer for the promoter used to regulate shRNA expression.
  • shRNA sequences with the highest activity against CCR5, Tat or Vif gene expression were then assembled into a microRNA (miR) cluster under control of the EF-1 alpha promoter.
  • miR microRNA
  • Vector 1 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a HI element (SEQ ID NO: 101); a shCCR5 (SEQ ID NOS: 16, 18, 20, 22, or 24); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).
  • LTR long terminal repeat
  • HI element SEQ ID NO: 101
  • shCCR5 SEQ ID NOS: 16, 18, 20, 22, or 24
  • WPRE posttranscriptional regulatory element of woodchuck hepatitis virus
  • SEQ ID NO: 102 a long terminal repeat portion
  • Vector 2 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a HI element (SEQ ID NO: 101); a shRev/Tat (SEQ ID NO: 10); a HI element (SEQ ID NO: 101); a shCCR5 (SEQ ID NOS: 16, 18, 20, 22, or 24); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).
  • LTR long terminal repeat
  • Vector 3 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a HI element (SEQ ID NO: 101); a shGag (SEQ ID NO: 12); a HI element (SEQ ID NO: 101); a shCCR5 (SEQ ID NOS: 16, 18, 20, 22, or 24); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).
  • LTR long terminal repeat
  • Vector 4 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a 7SK element (SEQ ID NO: 103); a shRev/Tat (SEQ ID NO: 10); a HI element (SEQ ID NO: 101); a shCCR5 (SEQ ID NOS: 16, 18, 20, 22, or 24); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).
  • LTR long terminal repeat
  • 7SK element SEQ ID NO: 103
  • a shRev/Tat SEQ ID NO: 10
  • HI element SEQ ID NO: 101
  • shCCR5 SEQ ID NOS: 16, 18, 20, 22, or 24
  • WPRE posttranscriptional regulatory element of woodchuck hepatitis virus
  • Vector 5 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a EFl element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).
  • LTR long terminal repeat
  • SEQ ID NO: 4 a EFl element
  • miR30CCR5 SEQ ID NO: 1
  • MiR21Vif SEQ ID NO: 2
  • miR185Tat SEQ ID NO: 3
  • WPRE woodchuck hepatitis virus
  • Vector 6 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a EFl element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR155Tat (SEQ ID NO: 104); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).
  • LTR long terminal repeat
  • WPRE woodchuck hepatitis virus
  • Vector 7 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a EFl element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).
  • LTR long terminal repeat
  • SEQ ID NO: 4 a EFl element
  • miR30CCR5 SEQ ID NO: 1
  • MiR21Vif SEQ ID NO: 2
  • miR185Tat SEQ ID NO: 3
  • WPRE woodchuck hepatitis virus
  • Vector 8 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a EFl element (SEQ ID NO: 4); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); and a long terminal repeat portion (SEQ ID NO: 102).
  • LTR long terminal repeat
  • Vector 9 was developed and contains, from left to right: a long terminal repeat (LTR) portion (SEQ ID NO: 35); a CD4 element (SEQ ID NO: 30); miR30CCR5 (SEQ ID NO: 1); MiR21Vif (SEQ ID NO: 2); miR185Tat (SEQ ID NO: 3); a posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE) (SEQ ID NOS: 32, 80); and a long terminal repeat portion (SEQ ID NO: 102).
  • LTR long terminal repeat
  • CD4 element SEQ ID NO: 30
  • miR30CCR5 SEQ ID NO: 1
  • MiR21Vif SEQ ID NO: 2
  • miR185Tat SEQ ID NO: 3
  • WPRE woodchuck hepatitis virus
  • a lentivirus vector against HIV might include three main components: 1) inhibitory RNA to reduce the level of HIV binding proteins (receptors) on the target cell surface to block initial virus attachment and penetration; 2) overexpression of the HIV TAR sequence that will sequester viral Tat protein and decrease its ability to transactivate viral gene expression; and 3) inhibitory RNA that attack important and conserved sequences within the HIV genome.
  • a key cell surface HIV binding protein is the chemokine receptor CCR5.
  • HIV particles attach to susceptible T cells by binding to the CD4 and CCR5 cell surface proteins.
  • CD4 is an essential glycoprotein on the cell surface that is important for the immunological function of T cells, this was not chosen as a target to manipulate its expression levels.
  • people born homozygous for null mutations in the CCR5 gene and completely lacking receptor expression live normal lives save for enhanced susceptibility to a few infectious diseases and the possibility of developing rare autoimmunity.
  • CD4+ T cells are genetically modified to reduce CCR5 expression, and CD4+ T cells needed for pathogen immunity or control of autoimmunity are unlikely to be among the modified cells.
  • modulating CCR5 was determined to be a relatively safe approach and was a primary target in the development of anti-HIV lentivirus vectors.
  • the viral TAR sequence is a highly structured region of HIV genomic RNA that binds tightly to viral Tat protein.
  • the Tat: TAR complex is important for efficient generation of viral RNA. Over-expression of the TAR region was envisioned as a decoy molecule that would sequester Tat protein and decrease the levels of viral RNA. However, TAR proved toxic to most mammalian cells including cells used for manufacturing lentivirus particles. Further, TAR was inefficient for inhibiting viral gene expression in other laboratories and has been discarded as a viable component in HIV gene therapy.
  • viral gene sequences have been identified that meet 3 criteria: i) Sequences are reasonably conserved across a range of HIV isolates representative of the epidemic in a geographic region of interest; ii) reduction in RNA levels due to the activity of an inhibitory RNA in a viral vector will reduce the corresponding protein levels by an amount sufficient to meaningfully reduce HIV replication; and iii) the viral gene sequence(s) targeted by inhibitory RNA are not present in the genes required for packaging and assembling viral vector particles during manufacturing. The lattermost point is important as it would be completely disadvantageous to have an inhibitory RNA that targets genes necessary for effective functioning of the viral particles themselves.
  • a sequence at the junction of HIV Tat and Rev genes and a second sequence within the HIV Vif gene have been targeted by inhibitory RNA.
  • the Tat/Rev targeting has an additional benefit of reducing HIV envelope glycoprotein expression because this region overlaps with the envelope gene in the HIV genome.
  • the strategy for vector development and testing relies first on identifying suitable targets (as described herein) followed by constructing plasmid DNAs expressing individual or multiple inhibitory RNA species for testing in cell models, and finally constructing lentivirus vectors containing inhibitory RNA with proven anti-HIV function.
  • the lentivirus vectors are tested for toxicity, yield during in vitro production, and effectiveness against HIV in terms of reducing CCR5 expression levels or lowering viral gene products to inhibit virus replication.
  • shRNA short homology RNA
  • Plasmids 1-4 tested shRNA sequences against Gag, Pol and RT genes of HIV. While each shRNA was active for suppressing viral protein expression in a cell model, there were two important problems that prevented further development. First, the sequences were targeted to a laboratory isolate of HIV that was not representative of Clade B HIV strains currently circulating in North America and Europe. Second, these shRNA targeted critical components in the lentivirus vector packaging system and would severely reduce vector yield during manufacturing. Plasmid 5, as detailed in Table 2, was selected to target CCR5 and provided a lead candidate sequence. Plasmids 6, 7, 8, 9, 10, and 11, as detailed in Table 2, incorporated the TAR sequence and it was found they produced unacceptable toxicity for mammalian cells including cells used for lentivirus vector manufacturing.
  • Plasmid 2 identified a lead shRNA sequence capable of reducing Tat RNA expression.
  • Plasmid 12, as detailed in Table 2 demonstrated the effectiveness of shCCR5 expressed as a microRNA (miR) in a lentiviral vector and confirmed it should be in the final product.
  • Plasmid 13, as detailed in Table 2 demonstrated the effectiveness of a shVif expressed as a microRNA (miR) in a lentiviral vector and confirmed it should be in the final product.
  • Plasmid 14, as detailed in Table 2 demonstrated the effectiveness of shTat expressed as a microRNA (miR) in a lentiviral vector and confirmed it should be in the final product.
  • Plasmid 15 contained the miR CCR5, miR Tat and miR Vif in the form of a miR cluster expressed from a single promoter. These miR do not target critical components in the lentivirus vector packaging system and proved to have negligible toxicity for mammalian cells. The miR within the cluster was equally effective to individual miR that were tested previously, and the overall impact was a substantial reduction in replication of a CCR5-tropic HIV BaL strain.
  • SIH-Hl-shRT43 was superior to SIH-Hl-shRT-1,3 in terms of reducing mRNA levels in the Luciferase assay system. This indicates potent inhibitory activity of the shRT43 sequence and it was selected as a lead candidate for further development.
  • SIH-H1- Lentiviral shRNA Inhibits Gag Abandon shGag-1 vector construct for expression but will
  • Gag shRNA oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by MWG Operon. A Gag target sequence was tested for their ability to decrease Gag mRNA expression.
  • the Gag target sequence is (5'- GAAGAAATGATGACAGCAT -3') (SEQ ID NO: 11) and shRNA sequence is (5'- GAAGAAATGATGACAGCATTTCAAGAGAATGCTGTCATCATTTCTTCTTTTT-3') (SEQ ID NO: 12).
  • Oligonucleotide sequences were inserted into the pSIH lentiviral vector (System Biosciences).
  • This shRNA sequence is potent against HIV Gag expression but was abandoned.
  • the lentivirus packaging system requires production of Gag from the helper plasmid and shRNA inhibition of Gag will reduce lentivirus vector yield.
  • This shRNA sequence could be used as an oligonucleotide inhibitor of HIV or incorporated into an alternate viral vector packaging system that uses a different vector genome or is modified to resist inhibition by this shRNA.
  • a Pol shRNA was constructed with oligonucleotide sequences containing BamHI and EcoRI restriction sites that were synthesized by MWG Operon.
  • a Pol target sequence was tested for its ability to decrease Pol mRNA expression.
  • the Pol target sequence is (5'- CAGGAGCAGATGATACAG -3') (SEQ ID NO: 13) and shRNA sequence is (5'- C AGGAGATGATAC AGTTC AAGAGACTGTATC ATCTGCTCCTGTTTTT-3 ' ) (SEQ ID NO: 14).
  • Oligonucleotide sequences were inserted into the pSIH lentiviral vector (System Biosciences).
  • This shRNA sequence is potent against HIV Pol expression but was abandoned.
  • the lentivirus packaging system requires production of Pol from the helper plasmid and shRNA inhibition of Pol will reduce lentivirus vector yield.
  • This shRNA sequence could be used as an oligonucleotide inhibitor of HIV or incorporated into an alternate viral vector packaging system that uses a different vector genome or is modified to resist inhibition by this shRNA.
  • a CCR5 shRNA was constructed with oligonucleotide sequences containing BamHI and EcoRI restriction sites that were synthesized by MWG Operon.
  • the CCR5 target sequence #1 which focuses on CCR5 gene sequence 1 (SEQ ID NO: 25), is (5 '-GTGTCAAGTCCAATCTATG-3 ') (SEQ ID NO: 15) and the shRNA sequence is (5'- GTGTC AAGTCC AATCTATGTTC AAGAGAC ATAGATTGGACTTGAC ACTTTTT-3 ' ) (SEQ ID NO: 16).
  • the CCR5 target sequence #2 which focuses on CCR5 gene sequence 2 (SEQ ID NO: 26), is (5'-GAGCATGACTGACATCTAC-3') (SEQ ID NO: 17) and the shRNA sequence is (5'--
  • the CCR5 target sequence #3 which focuses on CCR5 gene sequence 3 (SEQ ID NO: 27), is (5 ' -GTAGCTCTAAC AGGTTGGA-3 ' ) (SEQ ID NO: 19) and the shRNA sequence is (5'-
  • the CCR5 target sequence #4 which focuses on CCR5 gene sequence 4 (SEQ ID NO: 28, is (5 ' -GTTC AGAAACTACCTCTTA-3 ' ) (SEQ ID NO: 21) and the shRNA sequence is (5'-
  • the CCR5 target sequence #5 which focuses on CCR5 gene sequence 5 (SEQ ID NO: 29), is (5' -GAGC AAGCTC AGTTT AC ACC-3') (SEQ ID NO: 23) and the shRNA sequence is (5'-
  • a TAR decoy sequence containing lanking Kpnl restriction sites was synthesized by MWG operon and inserted into the pSIH lentiviral vector (System Biosciences) at the Kpnl site.
  • TAR expression is regulated by the U6 promoter.
  • the TAR decoy sequence is (5'-
  • TTACTGAGC AAGAAA-3 ' (SEQ ID NO: 8).
  • Expression of the TAR decoy sequence was determined by qPCR analysis using specific primers for the TAR sequence. Additional vectors were constructed also containing the TAR sequence. The HI promoter and shRT sequence was inserted in this vector in the Xhol site. The HI shRT sequence is (5'-
  • TT-3' (SEQ ID NO: 91).
  • This vector could express TAR and knockdown RT.
  • the 7SK promoter was also substituted for the HI promoter to regulate shRT expression.
  • Another vector was constructed containing U6 TAR, HI shRT, and HI shCCR5.
  • the HI shCCR5 sequence was inserted into the Spel site of the plasmid containing U6 TAR and HI shRT.
  • the HI CCR5 sequence is (5'-
  • a CCR5 microRNA was constructed with oligonucleotide sequences containing BsrGI and Notl restriction sites that were synthesized by MWG Operon.
  • Oligonucleotide sequences were inserted into the pCDH lentiviral vector (System 1)
  • the EF-1 promoter was substituted for a CMV promoter that was used in the plasmid construct Test Material 5.
  • the EF-1 promoter was synthesized by MWG Operon containing flanking Clal and BsrGI restriction sites and inserted into the pCDH vector containing shCCR5-l.
  • the EF-1 promoter sequence is (5'-
  • the ability of the miR CCR5 sequences to knock-down CCR5 expression was determined by transducing CEM-CCR5 T cells and measuring cell surface CCR5 expression after staining with a fluorescently-labeled monoclonal antibody against CCR5 and measuring the intensity of staining, that is directly proportional to the number of cell surface CCR5 molecules, by analytical flow cytometry.
  • the most effective shRNA sequence for targeting CCR5 was CCR5 shRNA sequence #1.
  • the most effective CCR5 targeting sequence for constructing the synthetic microRNA sequence was overlapping with CCR5 sequence #5; this conclusion was based on sequence alignments and experience with miRNA construction.
  • the miR30 hairpin sequence was used to construct the synthetic miR30 CCR5 sequence which is (5'-
  • the miR CCR5 target sequence is (5'- GAGCAAGCTCAGTTTACA-3') (SEQ ID NO: 5).
  • CCR5 expression levels were reduce by > 90% indicating potent inhibition of CCR5 mRNA by the miR30CCR5 micro RNA construct in a lentivirus vector.
  • the miR30CCR5 construct is potent for reducing CCR5 cell surface expression and is a lead candidate for a therapeutic lentivirus for HIV.
  • Vif microRNA was constructed with oligonucleotide sequences containing BsrGI and Notl restriction sites that were synthesized by MWG Operon.
  • Oligonucleotide sequences were inserted into the pCDH lentiviral vector (System Biosciences) containing an EF-1 promoter. Based on sequence alignments and experience with constructing synthetic miRNA, the miR21 hairpin sequence was used to construct the synthetic miR21 Vif sequence which is (5'-
  • the miR Vif target sequence is (5'- GGGATGTGTACTTCTGAACTT-3 ' ) (SEQ ID NO: 6).
  • a Tat m croRNA was constructe w t o gonuc eot e sequences containing BsrGI and Notl restriction sites that were synthesized by MWG Operon.
  • the microRNA cluster was inserted into the pCDH lentiviral vector (System Biosciences) containing an EF-1 promoter. Based on sequence alignments and experience in the construction of synthetic miRNA, the miR185 hairpin sequence was selected for constructing a synthetic miR185 Tat sequence which is (5'-
  • the miR Tat target sequence is (5'- TCCGCTTCTTCCTGCCATAG-3') (SEQ ID NO: 7).
  • the miR185Tat was approximately twice as potent for reducing Tat mRNA compare to miR155Tat, and was selected as the lead candidate for our therapeutic lentivirus.
  • a miR30CCR5 miR21Vif miR185Tat microRNA cluster sequence was constructed with a synthetic DNA fragment containing BsrGI and Notl restriction sites that was synthesized by MWG Operon. The DNA fragment was inserted into the pCDH lentiviral vector (System Biosciences) containing the EF-1 promoter.
  • the miR cluster sequence is (5'-
  • the AGT 103 vector was tested for potency against CCR5 using the assay for reduction in cell surface CCR5 expression (Test Material 12).
  • the AGT103 vector was tested for potency against Vif using the assay for reduction in cell surface Vif expression (Test Material 13).
  • the AGT103 vector was tested for potency against Tat using the assay for reduction in cell surface Tat expression (Test Material 14).
  • lentivirus vectors containing CCR5, Tat or Vif shRNA sequences and, for experimental purposes, expressing green fluorescent protein (GFP) under control of the CMV Immediate Early Promoter, and designated AGT103/CMV-GFP were tested for their ability to knockdown CCR5, Tat or Vif expression.
  • Mammalian cells were transduced with lentiviral particles either in the presence or absence of Polybrene. Cells were collected after 2-4 days; protein and RNA were analyzed for CCR5, Tat or Vif expression. Protein levels were tested by Western blot assay or by labeling cells with specific fluorescent antibodies (CCR5 assay), followed by analytical flow cytometry comparing modified and unmodified cell fluorescence using either the CCR5-specific or isotype control antibodies.
  • CCR5 assay specific fluorescent antibodies
  • T cell culture medium was made using RPMI 1640 supplemented with 10% FBS and 1% penicillin-streptomycin.
  • Cytokine stocks of IL2 10,000 units/ml, IL-12 ⁇ g/ml, IL-7 ⁇ g/ml, IL-15 ⁇ g/ml were also prepared in advance.
  • an infectious viral titer was determined and used to calculate the amount of virus to add for the proper multiplicity of infection (MOI).
  • cryopreserved PBMC were thawed, washed with 10 ml 37 ° C medium at 1200 rpm for 10 minutes and resuspended at a concentration of 2xl0 6 /ml in 37 ° C medium.
  • the cells were cultured at 0.5 ml/well in a 24-well plate at 37 ° C in 5% C02. To define the optimal stimulation conditions, cells were stimulated with combinations of reagents as listed in Table 3 below:
  • Day 12-24 non-specific expansion and lentivirus transduction.
  • the stimulated cells were removed from the plate by pipetting and resuspended in fresh T cell culture medium at a concentration of lxl06/ml.
  • the resuspended cells were transferred to T25 culture flasks and stimulated with DYNABEADS® Human T-Activator CD3/CD28 following the manufacturer's instruction plus cytokine as listed above; flasks were incubated in the vertical position.
  • AGT103/CMV-GFP was added at MOI 20 and cultures were returned to the incubator for 2 days. At this time, cells were recovered by pipetting, collected by centrifugation at 1300 rpm for 10 minutes, resuspended in the same volume of fresh medium, and centrifuged again to form a loose cell pellet. That cell pellet was resuspended in fresh medium with the same cytokines used in previous steps, with cells at 0.5xl0 6 viable cells per ml.
  • the cells were collected and the beads were removed from the cells. To remove the beads, cells were transferred to a suitable tube that was placed in the sorting magnet for 2 minutes. Supernatant containing the cells was transferred to a new tube. Cells were then cultured for 1 day in fresh medium at 1x10 /ml. Assays were performed to determine the frequencies of antigen-specific T cells and lentivirus transduced cells.
  • amprenavir 0.5 ng/ml
  • saquinavir 0.5 ng/ml
  • another suitable protease or integrase inhibitor was added to the cultures on the first day of stimulation and every other day during the culture.
  • Lentivirus transduction rate was determined by the frequency of GFP+ cells.
  • the transduced antigen-specific T cells are determined by the frequency of CD3+CD4+GFP+IFN gamma + cells; tests for CD3+CD8+GFP+IFN gamma + cells are included as a control.
  • CD4 T cells the target T cell population
  • lentiviruses that are designed to specifically knock down the expression of HlV-specific proteins, thus producing an expandable population of T cells that are immune to the virus.
  • This example serves as a proof of concept indicating that the disclosed lentiviral constructs can be used to produce a functional cure in HIV patients.
  • Example 4 CCR5 Knockdown with Experimental Vectors
  • AGTcl20 is a Hela cell line that stably expresses large amounts of CD4 and CCR5.
  • AGTcl20 was transduced with or without LV-CMV-mCherry (the red fluorescent protein mCherry expressed under control of the CMV Immediate Early Promoter) or AGT103/CMV- mCherry. Gene expression of the mCherry fluorescent protein was controlled by a CMV (cytomegalovirus immediate early promoter) expression cassette.
  • the LV-CMV-mCherry vector lacked a microRNA cluster, while AGT103/CMV-mCherry expressed therapeutic miRNA against CCR5, Vif, and Tat. As shown in Figure 8A, transduction efficiency was >90%.
  • Figure 8B shows the relative insensitivity of transfected AGTcl20 cells to infection with HIV.
  • the lentivirus vectors express mCherry protein and a transduced cell that was also infected with HIV (expressing GFP) would appear as a double positive cell in the upper right quadrant of the false color flow cytometry dot plots.
  • When cells were transduced with the therapeutic AGT103/CMV-mCherry vector only 0.83% of cells appeared in the double positive quadrant indicating they were transduced and infected.
  • RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from the Broad Institute or the BLOCK-IT RNA iDesigner from Thermo Scientific.
  • a shRNA sequence may be inserted into a plasmid immediately after a RNA polymerase III promoter such as HI, U6, or 7SK to regulate shRNA expression.
  • the shRNA sequence may also be inserted into a lentiviral vector using similar promoters or embedded within a microRNA backbone to allow for expression by an RNA polymerase II promoter such as CMV or EF-1 alpha.
  • the RNA sequence may also be synthesized as a siRNA oligonucleotide and utilized independently of a plasmid or lentiviral vector.
  • oligonucleotide sequences containing BamHI and EcoRI restriction sites were synthesized by MWG Operon. Oligonucleotide sequences were annealed by incubating at 70°C then cooled to room temperature. Annealed oligonucleotides were digested with the restriction enzymes BamHI and EcoRI for one hour at 37°C, then the enzymes were inactivated at 70°C for 20 minutes. In parallel, plasmid DNA was digested with the restriction enzymes BamHI and EcoRI for one hour at 37°C.
  • the digested plasmid DNA was purified by agarose gel electrophoresis and extracted from the gel using a DNA gel extraction kit from Invitrogen. The DNA concentration was determined and the plasma to oligonucleotide sequence was ligated in the ratio 3: 1 insert to vector. The ligation reaction was done with T4 DNA ligase for 30 minutes at room temperature. 2.5 of the ligation mix were added to 25 of STBL3 competent bacterial cells. Transformation required heat shock at 42°C. Bacterial cells were spread on agar plates containing ampicillin and colonies were expanded in L broth. To check for insertion of the oligo sequences, plasmid DNA was extracted from harvested bacterial cultures using the Invitrogen DNA Miniprep kit and tested by restriction enzyme digestion. Insertion of the shRNA sequence into the plasmid was verified by DNA sequencing using a primer specific for the promoter used to regulate shRNA expression.
  • the assay for inhibition of CCR5 expression required co-transfection of two plasmids.
  • the first plasmid contains one of five different shRNA sequences directed against CCR5 mRNA.
  • the second plasmid contains the cDNA sequence for human CCR5 gene. Plasmids were co-transfected into 293T cells. After 48 hours, cells were lysed and RNA was extracted using the RNeasy kit from Qiagen. cDNA was synthesized from RNA using a Super Script Kit from Invitrogen. The samples were then analyzed by quantitative RT-PCR using an Applied Biosystems Step One PCR machine.
  • CCR5 expression was detected with SYBR Green from Invitrogen using the forward primer (5'- AGGAATTGATGGCGAGAAGG-3') (SEQ ID NO: 93) and reverse primer (5'- CCCCAAAGAAGGTCAAGGTAATCA-3') (SEQ ID NO: 94) with standard conditions for polymerase chain reaction analysis.
  • the samples were normalized to the mRNA for beta actin gene expression using the forward primer (5 ' - AGC GCGGCT AC AGCTTC A-3 ' ) (SEQ ID NO: 95) and reverse primer (5 ' -GGCGACGTAGC AC AGCTTCT-3 ') (SEQ ID NO: 96) with standard conditions for polymerase chain reaction analysis.
  • the relative expression of CCR5 mRNA was determined by its Ct value normalized to the level of actin messenger RNA for each sample. The results are shown in Figure 9.
  • CCR5 knock-down was tested in 293T cells by co-transfection of the CCR5 shRNA construct and a CCR5 -expressing plasmid. Control samples were transfected with a scrambled shRNA sequence that did not target any human gene and the CCR5-expressing plasmid. After 60 hours post-transfection, samples were harvested and CCR5 mRNA levels were measured by quantitative PCR. Further, as shown in Figure 9B, CCR5 knock-down after transduction with lentivirus expressing CCR5 shRNA- 1 (SEQ ID NO: 16).
  • HIV type 1 Rev/Tat (5'- GCGGAGACAGCGACGAAGAGC-3') (SEQ ID NO: 9) and Gag (5 ' -GAAGAAATGATGAC AGC AT-3 ' ) (SEQ ID NO: 11) were used to design:
  • Rev/Tat or Gag target sequences were inserted into the 3'UTR (untranslated region) of the firefly luciferase gene used commonly as a reporter of gene expression in cells or tissues. Additionally, one plasmid was constructed to express the Rev/Tat shRNA and a second plasmid was constructed to express the Gag shRNA. Plasmid constructions were as described above. Functional assay for shRNA targeting of Rev/Tat or Gag mRNA: Using plasmid co- transfection we tested whether a shRNA plasmid was capable of degrading luciferase messenger RNA and decreasing the intensity of light emission in co-transfected cells.
  • a shRNA control was used to establish the maximum yield of light from luciferase transfected cells.
  • the luciferase construct containing a Rev/Tat target sequence inserted into the 3'-UTR (untranslated region of the mRNA) was co-transfected with the Rev/Tat shRNA sequence there was nearly a 90% reduction in light emission indicating strong function of the shRNA sequence.
  • a similar result was obtained when a luciferase construct containing a Gag target sequence in the 3'-UTR was co-transfected with the Gag shRNA sequence.
  • Example 7 AGT103 decreases expression of Tat and Vif
  • AGT103/CMV-GFP exemplary vectors
  • AGT103 and other exemplary vectors are defined in Table 3 below.
  • miR185Tat - synthetic micro RNA capable of reducing levels of HIV RNA and Tat protein expression
  • a T lymphoblastoid cell line (CEM; CCRF-CEM; American Type Culture Collection Catalogue number CCL119) was transduced with AGT103/CMV-GFP. 48 hours later the cells were transfected with an HIV expression plasmid encoding the entire viral sequence. After 24 hours, RNA was extracted from cells and tested for levels of intact Tat sequences using reverse transcriptase polymerase chain reaction. Relative expression levels for intact Tat RNA were reduced from approximately 850 in the presence of control lentivirus vector, to approximately 200 in the presence of AGT103/CMV-GFP for a total reduction of > 4 fold, as shown in Figure 11.
  • RNA interference sequences were chosen from candidates selected by siRNA or shRNA design programs such as from the Broad Institute or the BLOCK-IT RNA iDesigner from Thermo Scientific.
  • the selected shRNA sequences most potent for Tat or Vif knockdown were embedded within a microRNA backbone to allow for expression by an RNA polymerase II promoter such as CMV or EF-I alpha.
  • the RNA sequence may also be synthesized as a siRNA oligonucleotide and used independently of a plasmid or lentiviral vector.
  • the Tat target sequence (5 '-TCCGCTTCTTCCTGCCAT AGS') (SEQ ID NO: 7) was incorporated into the miR185 backbone to create a Tat miRNA (5'- GGGCCTGGCTCGAGCAGGGGGCGAGGGATTCCGCTTCTTCCTGCCATAGCGTGGT CCCCTCCCCTATGGCAGGCAGAAGCGGCACCTTCCCTCCCAATGACCGCGTCTTCG TCG-3') (SEQ ID NO: 3) that was inserted into a lentivirus vector and expressed under control of the EF-1 alpha promoter.
  • the Vif target sequence (5'- GGGATGTGTACTTCTGAACTT-3 ' ) (SEQ ID NO: 6) was incorporated into the miR21 backbone to create a Vif miRNA (5'-
  • Vif/Tat miRNA-expressing lentivirus vectors were produced in 293T cells using a lentiviral vector packaging system.
  • the Vif and Tat miRNA were embedded into a microRNA cluster consisting of miR CCR5, miR Vif, and miR Tat all expressed under control of the EF-1 promoter.
  • a lentivirus vector expressing miR185 Tat (LV-EFl-miR-CCR5-Vif-Tat) was used at a multiplicity of infection equal to 5 for transducing 293T cells. 24 hours after transduction the cells were transfected with a plasmid expressing HIV strain NL4-3 (pNL4-3) using Lipofectamine2000 under standard conditions. 24 hours later RNA was extracted and levels of Tat messenger RNA were tested by RT-PCR using Tat-specific primers and compared to actin mRNA levels for a control.
  • a lentivirus vector expressing miR21 Vif (LV-EFl-miR-CCR5-Vif-Tat) was used at a multiplicity of infection equal to 5 for transducing 293T cells. 24 hours after transduction, the cells were transfected with a plasmid expressing HIV strain NL4-3 (pNL4-3) using Lipofectamine2000. 24 hours later cells were lysed and total soluble protein was tested to measure the content of Vif protein. Cell lysates were separated by SDS-PAGE according to established techniques. The separated proteins were transferred to nylon membranes and probed with a Vif-specific monoclonal antibody or actin control antibody.
  • Tat knock-down was tested in 293T cells transduced with either a control lentiviral vector or a lentiviral vector expressing either synthetic miR185 Tat or miR155 Tat microRNA. After 24 hours, the HIV vector pNL4-3 was transfected with Lipofectamine2000 for 24 hours and then RNA was extracted for qPCR analysis with primers for Tat. As shown in Figure 12B, Vif knock-down was tested in 293T cells transduced with either a control lentiviral vector or a lentiviral vector expressing a synthetic miR21 Vif microRNA.
  • HIV vector pNL4-3 was transfected with Lipofectamine2000 for 24 hours and then protein was extracted for immunoblot analysis with an antibody for HIV Vif.
  • Example 9 Regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector
  • CEM-CCR5 cells were transduced with a lentiviral vector containing a synthetic miR30 sequence for CCR5 (AGT103: TGTAAACTGAGCTTGCTCTA (SEQ ID NO: 97), AGT103- R5-1 : TGTAAACTGAGCTTGCTCGC (SEQ ID NO: 98), or AGT103-R5-2: CATAGATTGGACTTGACAC (SEQ ID NO: 99).
  • CCR5 expression was determined by FACS analysis with an APC-conjugated CCR5 antibody and quantified by mean fluorescence intensity (MFI).
  • MFI mean fluorescence intensity
  • the target sequence of AGT103 and AGT103-R5-1 is in the same region as CCR5 target sequence #5.
  • the target sequence of AGT103-R5-2 is the same as CCR5 target sequence #1.
  • AGT103 (2% of total CCR5) is most effective at reducing CCR5 levels as compared with AGT103-R5-1 (39% of total CCR5) and AGT103-R5-2 which does not reduce CCR5 levels. The data is demonstrated in Figure 13 herein.
  • Example 10 Regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector containing either a long or short WPRE sequence.
  • RNA regulatory element for optimal expression of therapeutic genes or genetic constructs.
  • a common choice is to use the Woodchuck hepatitis virus post transcriptional regulatory element (WPRE).
  • WPRE Woodchuck hepatitis virus post transcriptional regulatory element
  • AGT103 that contains a full-length WPRE: (5 ' AATC AAC CTCTGATTAC AAAATTTGTGAA AGATTGACTGGTATTCTT AACTATG TTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTG CTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTA TGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTG ACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACT TTCGCTTTCCCTATTGCCACGGCGGAACTCATCGCCCTCCCTATTGCCACGGCGGAACTCATCGCCCTCCCTATT
  • AGT103 containing long or short WPRE elements were used for transducing CEM-CCR5 T cells a multiplicity of infection equal to 5.
  • Six days after transduction cells were collected and stained with a monoclonal antibody capable of detecting cell surface CCR5 protein.
  • the antibody was conjugated to a fluorescent marker and the intensity of staining is directly proportional to the level of CCR5 on the cell surface.
  • a control lentivirus had no effect on cell surface CCR5 levels resulting in a single population with a mean fluorescence intensity of 73.6 units.
  • the conventional AGT103 with a long WPRE element reduced CCR5 expression to a mean fluorescence intensity level of 11 units.
  • AGT103 modified to incorporate a short WPRE element resulted in a single population of cells with mean fluorescence intensity of 13 units. Accordingly, substituting a short WPRE element had little or no effect on the capacity for AGT103 to reduce cell surface CCR5 expression.
  • CEM-CCR5 cells were transduced with AGT103 containing either a long or short WPRE sequence.
  • CCR5 expression was determined by FACS analysis with an APC-conjugated CCR5 antibody and quantified as mean fluorescence intensity (MFI).
  • MFI mean fluorescence intensity
  • CCR5 levels were expressed as % CCR5 with LV-Control set at 100%. The reduction in CCR5 levels was similar for AGT103 with either the short (5.5% of total CCR5) or long (2.3% of total CCR5) WPRE sequence.
  • Example 11 Regulation of CCR5 expression by synthetic microRNA sequences in a lentiviral vector with or without a WPRE sequence
  • Functional assay for modulating cell surface CCR5 expression as a function of including or not including a long WPRE element in the AGT103 vector In order to test whether WPRE was required for AGT103 modulation of CCR5 expression levels we transduced CEM-CCR5 T cells with AGT103 or a modified vector lacking WPRE using a multiplicity of infection equal to 5. Six days after transduction cells were collected and stained with a monoclonal antibody capable of recognizing cell surface CCR5 protein. The monoclonal antibody was directly conjugated to a fluorescent marker and the intensity of staining is directly proportional to the number of CCR5 molecules per cell surface.
  • a lentivirus control vector had no effect on cell surface CCR5 levels resulting in a uniform population with mean fluorescence intensity of 164.
  • the lentivirus vector (AGT103 with a long WPRE and also expressing GFP marker protein), AGT103 lacking GFP but containing a long WPRE element, or AGT103 lacking both GFP and WPRE all were similarly effective for modulating cell surface CCR5 expression. After removing GFP, AGT103 with or without WPRE elements were indistinguishable in terms of their capacity for modulating cell surface CCR5 expression.
  • CEM-CCR5 cells were transduced with AGT103 with or without GFP and WPRE.
  • CCR5 expression was determined by FACS analysis with an APC-conjugated CCR5 antibody and quantified as mean fluorescence intensity (MFI).
  • CCR5 levels were expressed as % CCR5 with LV-Control set at 100%. The reduction in CCR5 levels was similar for AGT103 with (0% of total CCR5) or without (0% of total CCR5) the WPRE sequence. This data is demonstrated in Figure 15.
  • Example 12 Regulation of CCR5 expression by a CD4 promoter regulating synthetic microRNA sequences in a lentiviral vector.
  • a modified version of AGT103 was constructed to test the effect of substituting alternate promoters for expressing the microRNA cluster that suppresses CCR5, Vif and Tat gene expression.
  • alternate promoters for expressing the microRNA cluster that suppresses CCR5, Vif and Tat gene expression.
  • T cell-specific promoter for CD4 glycoprotein expression using the sequence:
  • AGT103 modified by substituting the CD4 gene promoter for the normal EF-1 promoter was used for transducing CEM-CCR5 T cells.
  • Six days after transduction cells were collected and stained with a monoclonal antibody capable of recognizing cell surface CCR5 protein.
  • the monoclonal antibody was conjugated to a fluorescent marker and staining intensity is directly proportional to the level of cell surface CCR5 protein.
  • a control lentivirus transduction resulted in a population of CEM-CCR5 T cells that were stained with a CCR5-specific monoclonal antibody and produced a mean fluorescence intensity of 81.7 units.
  • the modified AGT103 using a CD4 gene promoter in place of the EF-1 promoter for expressing microRNA showed a broad distribution of staining with a mean fluorescence intensity roughly equal to 17.3 units. Based on this result, the EF-1 promoter is at least similar and likely superior to the CD4 gene promoter for microRNA expression.
  • the EF-1 promoter is universally active in all cell types and the CD4 promoter is only active in T-lymphocytes.
  • CEM-CCR5 cells were transduced with a lentiviral vector containing a CD4 promoter regulating a synthetic microRNA sequence for CCR5, Vif, and Tat (AGT103). After 6 days, CCR5 expression was determined by FACS analysis with an APC-conjugated CCR5 antibody and quantified as mean fluorescence intensity (MFI). CCR5 levels were expressed as % CCR5 with LV-Control set at 100%. In cells transduced with LV-CD4-AGT103, CCR5 levels were 11% of total CCR5. This is comparable to that observed for LV-AGT103 which contains the EF1 promoter. This data is demonstrated in Figure 16.
  • Example 13 Detecting HIV Gag-Specific CD4 T Cells
  • PBMC peripheral blood mononuclear cells
  • peptides represent major immunogenic regions of the HIV Gag poly protein and are designed for average coverage of 57.8% among known HIV strains.
  • Peptide sequences are based on the HIV sequence database from the Los Alamos National Laboratory (http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html). Peptides are provided as dried trifluoroacetate salts, 25 micrograms per peptide, and are dissolved in approximately 40 microliters of DMSO then diluted with PBS to final concentration.
  • Monoclonal antibodies for detecting CD4 and cytoplasmic IFN-gamma were obtained from commercial sources and intracellular staining was done with the BD Pharmingen Intracellular Staining Kit for interferon-gamma. Peptides were resuspended in DMSO and we include a DMSO only control condition.
  • PBMCs from a HIV-positive patient before or after vaccination were stimulated with DMSO (control), recombinant MVA expressing HIV Gag from GeoVax (MVA GeoVax), Gag peptide from GeoVax (Pep GeoVax, also referred to herein as Gag peptide pool 1) or Gag peptides from JPT (HIV (GAG) Ultra peptide mixture, also referred to herein as Gag peptide pool 2) for 20 hours.
  • IFNg production was detected by intracellular staining and flow cytometry using standard protocols. Flow cytometry data were gated on CD4 T cells. Numbers captured in boxes are the percentage of total CD4 T cells designated "HIV- specific" on the basis of cytokine response to antigen-specific stimulation.
  • Example 14 HlV-specific CD4 T cell expansion and lentivirus transduction
  • PBMC peripheral blood mononuclear cells
  • AGT103 AGT103T
  • the protocol was designed for ex vivo culture of PBMC (peripheral blood mononuclear cells) from HIV-positive patients who had received a therapeutic HIV vaccine.
  • the therapeutic vaccine consisted of three doses of plasmid DNA expressing HIV Gag, Pol and Env genes followed by two doses of MVA 62-B (modified vaccinia Ankara number 62-B) expressing the same HIV Gag, Pol, and Env genes.
  • the protocol is not specific for a vaccine product and only requires a sufficient level of HlV-specific CD4+ T cells after immunization.
  • Venous blood was collected and PBMC were purified by Ficoll-Paque density gradient centrifugation. Alternately, PBMC or defined cellular tractions can be prepared by positive or negative selection methods using antibody cocktails and fluorescence activated or magnetic bead sorting.
  • the purified PBMC are washed and cultured in standard medium containing supplements, antibiotics and fetal bovine serum. To these cultures, a pool of synthetic peptides was added representing possible T cell epitopes within the HIV Gag polyprotein.
  • Cultures are supplemented by adding cytokines interleukin-2 and interleukin-12 that were selected after testing combinations of interleukin-2 and interleukin-12, interleukin 2 and interleukin-7, interleukin 2 and interleukin- 15.
  • Peptide stimulation is followed by a culture interval of approximately 12 days. During the 12 days culture, fresh medium and fresh cytokine supplements were added approximately once every four days.
  • the peptide stimulation interval is designed to increase the frequency of HIV-specific CD4 T cells in the PBMC culture. These HIV-specific CD4 T cells were activated by prior therapeutic immunization and can be re-stimulated and caused to proliferate by synthetic peptide exposure. Our goal is to achieve greater than or equal to 1% of total CD4 T cells being HIV-specific by end of the peptide stimulation culture period.
  • the lentivirus transduction is performed on approximately day 13 of culture and uses a multiplicity of infection between 1 and 5. After transduction cells are washed to remove residual lentivirus vector and cultured in media containing interleukin-2 and interleukin-12 with fresh medium and cytokines added approximately once every four days until approximately day 24 of culture.
  • the antiretroviral drug Saquinavir is added at a concentration of approximately 100 nM to suppress any possible outgrowth of HIV.
  • Potency of the cell product is tested in one of two alternate potency assays.
  • Potency assay 1 tests for the average number of genome copies (integrated AGT103 vector sequences) per CD4 T cell. The minimum potency is approximately 0.5 genome copies per CD4 T cell in order to release the product.
  • the assay is performed by positive selection of CD3 positive/CD4 positive T cells using magnetic bead labeled monoclonal antibodies, extracting total cellular DNA and using a quantitative PCR reaction to detect sequences unique to the AGT103 vector.
  • Potency assay 2 tests for the average number of genome copies of integrated AGT103 within the subpopulation of HIV-specific CD4 T cells. This essay is accomplished by first stimulating the PBMC with the pool of synthetic peptides representing HIV Gag protein.
  • CD4 positive/interferon-gamma positive cells are captured by magnetic bead selection, total cellular DNA is prepared, and the number of genome copies of AGT103 per cell is determined with a quantitative PCR reaction. Release criterion based on potency using Assay 2 require that greater than or equal to 0.5 genome copies per HIV-specific CD4 T-cell are present in the AGT103 cell product.
  • Figure 18 Panel D shows the frequency of HIV- specific CD4 T cells in 4 vaccine trial participants comparing their pre-and post-vaccination specimens. Importantly, in three cases, the post-vaccination specimens show a value of HIV- specific CD4 T cells that was greater than or equal to 0.076% of total CD4 T cells.
  • Panel A describes the schedule of treatment.
  • Panel B demonstrates that PBMCs were stimulated with Gag peptide or DMSO control for 20 hours. IFN gamma production was detected by intracellular staining by FACS. CD4 + T cells were gated for analysis.
  • Panel C demonstrates CD4 + T cells were expanded and transduced with AGT103-GFP using the method as shown in Panel A. Expanded CD4 + T cells were rested in fresh medium without any cytokine for 2 days and re-stimulated with Gag peptide or DMSO control for 20 hours. IFN gamma production and GFP expression was detected by FACS. CD4 + T cells were gated for analysis.
  • Panel D demonstrates frequency of HIV-specific CD4 T cells (IFN gamma positive, pre- and post-vaccination) were detected from 4 patients as discussed herein.
  • Panel E demonstrates Post-vaccination PBMCs from 4 patients were expanded and HIV-specific CD4 + T cells were examined.
  • a modified version of AGT103 was constructed to test the dose response for increasing AGT103 and its effects on cell surface CCR5 levels.
  • the AGT103 was modified to include a green fluorescent protein (GFP) expression cassette under control of the CMV promoter. Transduced cells expression the miR30CCR5 miR21Vif miR185Tat micro RNA cluster and emit green light due to expressing GFP.
  • GFP green fluorescent protein
  • CEM-CCR5 T cells were transduced with AGT103-GFP using multiplicity of infection per cell from 0 to 5.
  • Transduced cells were stained with a fluorescently conjugated (APC) monoclonal antibody specific for cell surface CCR5.
  • APC fluorescently conjugated
  • the intensity of staining is proportional to the number of CCR5 molecules per cell surface.
  • the intensity of green fluorescence is proportional to the number of integrated AGT103-GFP copies per cell.
  • Panel A demonstrates the dose response for increasing AGT103-GFP and its effects on cell surface CCR5 expression. At multiplicity of infection equal to 0.4 only 1.04% of cells are both green (indicating transduction) and showing significantly reduced CCR5 expression.
  • Example 16 AGT103 efficiently transduces primary human CD4 + T cells
  • AGT103 lentivirus vector Transducing primary CD4 T cells with AGT103 lentivirus vector.
  • a modified AGT103 vector containing the green fluorescence protein marker (GFP) was used at multiplicities of infection between 0.2 and 5 for transducing purified, primary human CD4 T cells.
  • GFP green fluorescence protein marker
  • CD4 T cells were isolated from human PBMC (HIV-negative donor) using magnetic bead labeled antibodies and standard procedures. The purified CD4 T cells were stimulated ex vivo with CD3/CD28 beads and cultured in media containing interleukin-2 for 1 day before AGT103 transduction.
  • the relationship between lentivirus vector dose (the multiplicity of infection) and transduction efficiency is demonstrated in Figure 20, Panel A showing that multiplicity of infection equal to 0.2 resulted in 9.27% of CD4 positive T cells being transduced by AGT103 and that value was increased to 63.1% of CD4 positive T cells being transduced by AGT103 with a multiplicity of infection equal to 5.
  • Example 17 AGT103 inhibits HIV replication in primary CD4 + T cells
  • Protecting primary human CD4 positive T cells from HIV infection by transducing cells with AGT 103 Therapeutic lentivirus AGT103 was used for transducing primary human CD4 positive T cells at multiplicities of infection between 0.2 and 5 per cell. The transduced cells were then challenged with a CXCR4-tropic HIV strain NL4.3 that does not require cell surface CCR5 for penetration. This assay tests the potency of microRNA against Vif and Tat genes of HIV in terms of preventing productive infection in primary CD4 positive T cells, but uses an indirect method to detect the amount of HIV released from infected, primary human CD4 T cells.
  • CD4 T cells were isolated from human PBMC (HIV- negative donor) using magnetic bead labeled antibodies and standard procedures. The purified CD4 T cells were stimulated ex vivo with CD3/CD28 beads and cultured in media containing interleukin-2 for 1 day before AGT103 transduction using multiplicities of infection between 0.2 and 5. Two days after transduction the CD4 positive T cell cultures were challenged with HIV strain NL4.3 that was engineered to express the green fluorescent protein (GFP). The transduced and HIV-exposed primary CD4 T cell cultures were maintained for 7 days before collecting cell-free culture fluids containing HIV.
  • GFP green fluorescent protein
  • the cell-free culture fluids were used to infect a highly permissive T cell line C8166 for 2 days.
  • the proportion of HIV-infected C8166 cells was determined by flow cytometry detecting GFP fluorescence.
  • the dose of 0.1 multiplicity of infection for NL4.3 HIV resulted in an amount of HIV being released into culture fluids that was capable of establishing productive infection in 15.4% of C8166 T cells.
  • the dose 0.2 multiplicity of infection for AGT103 this value for HIV infection of C8166 cells is reduced to 5.3% and multiplicity of infection equal to 1 for AGT103 resulted in only 3.19% of C8166 T cells being infected by HIV.
  • C8166 infection was reduced further to 0.62% after AGT103 transduction using a multiplicity of infection equal to 5.
  • Example 18 AGT103 protects primary human CD4 + T cells from HIV-induced depletion
  • AGT103 transduction of primary human CD4 T cells to protect against HIV-mediated cytopathology and cell depletion PBMC were obtained from healthy, HIV -negative donors and stimulated with CD3/CD28 beads then cultured for 1 day in medium containing interleukin-2 before AGT103 transduction using multiplicities of infection between 0.2 and 5.
  • AGT103-transduced primary human CD4 T cells were infected with HIV NL 4.3 strain (CXCR4-tropic) that does not require CCR5 for cellular entry.
  • CXCR4-tropic NL 4.3 HIV NL 4.3 strain
  • the dose of HIV NL 4.3 was 0.1 multiplicity of infection.
  • CD4 T cells were collected every three days during a 14-day culture then stained with a monoclonal antibody that was specific for CD4 and directly conjugated to a fluorescent marker to allow measurement of the proportion of CD4 positive T cells in PBMC.
  • Untreated CD4 T cells or CD4 T cells transduced with the control lentivirus vector were highly susceptible to HIV challenge and the proportion of CD4 positive T cells in PBMC fell below 10% by day 14 culture. In contrast, there was a dose-dependent effect of AGT103 on preventing cell depletion by HIV challenge.
  • AGT103 dose of 0.2 multiplicity of infection more than 20% of PBMC were CD4 T cells by day 14 of culture and this value increased to more than 50% of PBMC being CD4 positive T cells by day 14 of culture with a AGT103 dose of multiplicity of infection equal to 5. Again, there is a clear dose response effect of AGT103 on HIV cytopathogenicity in human PBMC.
  • PBMCs were stimulated with CD3/CD28 beads plus IL-2 for 1 day and transduced with AGT103 at various concentrations (MOI). After 2 days, beads were removed and cells were infected with 0.1 MOI of HIV NL4.3. 24 hours later, cells were washed 3 times with PBS and cultured with IL-2 (30U/ml). Cells were collected every 3 days and the frequency of CD4 + T cells were analyzed by FACS. After 14 days of exposure to HIV, there was an 87% reduction in CD4 + T cells transduced with LV-Control, a 60% reduction with AGT103 MOI 0.2, a 37% reduction with AGT103 MOI 1, and a 17% reduction with AGT103 MOI 5.
  • Example 19 Generating a Population of CD4+ T cells enriched for HlV-Specificity and transduced with AGT 103/ CM V-GFP
  • CD4 T cell population is shown in the upper left quadrant of the analytical flow cytometry dot plots, and changes from 52% to 57% of total T cells after the vaccination series.
  • Peripheral blood mononuclear cells from a participant in an HIV therapeutic vaccine trial were cultured for 12 days in medium +/- interleukin-2/interleukin-12 or +/- interleukin- 7/interleukin-15. Some cultures were stimulated with overlapping peptides representing the entire p55 Gag protein of HIV- 1 (HIV (GAG) Ultra peptide mixture) as a source of epitope peptides for T cell stimulation. These peptides are 10-20 amino acids in length and overlap by 20-50% of their length to represent the entire Gag precursor protein (p55) from HIV-1 BaL strain.
  • composition and sequence of individual peptides can be adjusted to compensate for regional variations in the predominant circulating HIV sequences or when detailed sequence information is available for an individual patient receiving this therapy.
  • cells were recovered and stained with anti-CD4 or anti-CD8 monoclonal antibodies and the CD3+ population was gated and displayed here.
  • the HIV (GAG) Ultra peptide mixture stimulation for either pre- or post-vaccination samples was similar to the medium control indicating that HIV (GAG) Ultra peptide mixture was not toxic to cells and was not acting as a polyclonal mitogen. The results of this analysis can be found in Figure 23B.
  • HIV (GAG) Ultra peptide mixture and interleukin-2/interleukin-12 provided for optimal expansion of antigen-specific CD4 T cells.
  • cytokine interferon-gamma
  • cytokine secreting cells increased from 0.43 to 0.69% as a result of exposure to antigenic peptides.
  • post-vaccination samples showed an increase of cytokine secreting cells from 0.62 to 1.76% of total CD4 T cells as a result of peptide stimulation.
  • AGT103/CMV-GFP transduction of antigen-expanded CD4 T cells produced HIV-specific and HIV-resistant helper CD4 T cells that are needed for infusion into patients as part of a functional cure for HIV (in accordance with other various aspects and embodiments, AGT103 alone is used; for example, clinical embodiments may not include the CMV-GFP segment).
  • the upper panels of Figure 23C show the results of analyzing the CD4+ T cell population in culture.
  • the x axis of Figure 23C shows Green Fluorescent Protein (GFP) emission indicating that individual cells were transduced with the AGT103/CMV-GFP.
  • GFP Green Fluorescent Protein
  • Table 4 shows the results of the ex vivo production of HIV-specific and HIV- resistant CD4 T cells using the disclosed vectors and methods.
  • AGT103T is a genetically modified autologous PBMC containing > 5 x 10 7 HIV- specific CD4 T cells that are also transduced with AGT103 lentivirus vector
  • a Phase I clinical trial will test the safety and feasibility of infusing ex vivo modified autologous CD4 T cells (AGT103T) in adult research participants with confirmed HIV infection, CD4+ T-cell counts >600 cells per mm 3 of blood and stable virus suppression below 200 copies per ml of plasma while on cART. All study participants will continue receiving their standard antiretro viral medications throughout the Phase I clinical trial. Study participants are screened by submitting a blood for in vitro testing to measure the frequency of CD4+ T- cells that respond to stimulation with a pool of overlapping, synthetic peptides representing the HIV-1 Gag polyprotein.
  • CD4 T cells designated as Gag- specific CD4 T cells are enrolled in the gene therapy study and undergo leukapheresis followed by purification of PBMC (using Ficoll density gradient centrifugation or negative selection with antibodies) that are cultured ex vivo and stimulated with HIV Gag peptides plus interleukin-2 and interleukin-12 for 12 days, then stimulated again with beads decorated with CD3/CD28 bispecific antibody.
  • the antiretroviral drug Saquinavir is included at 100 nM to prevent emergence of autologous HIV during ex vivo culture.
  • CD3/CD28 stimulation cells are transduced with AGT103 at multiplicity of infection between 1 and 10.
  • the transduced cells are cultured for an additional 7-14 days during which time they expand by polyclonal proliferation.
  • the culture period is ended by harvesting and washing cells, setting aside aliquots for potency and safety release assays, and resuspending the remaining cells in cryopreservation medium.
  • a single dose is ⁇ lxlO 10 autologous PBMC.
  • the potency assay measures the frequency of CD4 T cells that respond to peptide stimulation by expressing interferon-gamma.
  • Other release criteria include the product must include > 0.5 x 10 7 HIV- specific CD4 T cells that are also transduced with AGT103.
  • Another release criterion is that the number of AGT103 genome copies per cell must not exceed 3. Five days before infusion with AGT103T subjects receive one dose of busulfuram (or Cytoxan or fludarabine or suitable drug combinations) conditioning regimen followed by infusion of ⁇ 1 xlO PBMC containing genetically modified CD4 T cells.
  • Phase II study will evaluate efficacy of AGT103T cell therapy.
  • Phase II study participants include individuals enrolled previously in our Phase I study who were judged to have successful and stable engraftment of genetically modified, autologous, HIV-specific CD4 T cells and clinical responses defined as positive changes in parameters monitored as described in efficacy assessments (1.3.) ⁇
  • Study participants will be asked to add Maraviroc to their existing regimen of antiretroviral medication.
  • Maraviroc is a CCR5 antagonist that will enhance the effectiveness of genetic therapy directed at reducing CCR5 levels. Once the Maraviroc regimen is in place subjects will be asked to discontinue the previous antiretroviral drug regimen and only maintain Maraviroc monotherapy for 28 days or until plasma viral RNA levels exceed 10,000 per ml on 2 sequential weekly blood draws. Persistently high viremia requires participants to return to their original antiretroviral drug regimen with or without Maraviroc according to recommendations of their HIV care physician.
  • Example 21 Generating a Population of CD4+ T cells through Depletion of CD8+ T cells Prior to Peptide Stimulation
  • CD8+ T cell overgrowth significantly impacted the expansion of target CD4+ T cells
  • CD8+ T cells were depleted at the beginning of cell expansion to determine whether it would improve CD4+ T cell expansion.
  • Current CD8+ T cell depletion methods require that cells are passed through a magnetic column. To avoid possible impacts of that procedure on antigen presenting cells and CD4+ T cells, the cell depletion was performed after peptide stimulation and before lentivirus transduction when cells were better able to withstand the mechanical stresses.
  • PBMCs were separated with Ficoll-Paque PLUS (GE Healthcare, Cat: 17-1440-02). Fresh separated PBMCs (lxl 0 7 ) were stimulated with PepMixTM HIV (GAG) Ultra (Cat: PM-HIV-GAG, JPT Peptide Technologies, Berlin, Germany) in lmL medium in a 24-well plate for 18 hours.
  • CD8+ T cells were depleted with PE anti -human CD8 antibody and anti-PE microbeads.
  • the negatively selected cells were cultured at 2xl0 6 /mL in TexMACS GMP medium (Cat: 170-076-309, Miltenyi Biotech, Bergisch Gladbach, Germany) containing IL-7 (170-076-111, Miltenyi Biotech, Bergisch Gladbach, Germany), IL-15 (170-076-114, Miltenyi Biotech, Bergisch Gladbach, Germany) and Saquinavir (Cat: 4658, NIH AIDS Reagent Program, Germantown, MD).
  • Lentivirus AGT103 was added 24 hours later at MOI 5.
  • Fresh medium containing IL-7, IL-15 and Saquinavir were added every 2-3 days during the expansion. The final concentration of IL-7/IL-15 was lOng/mL.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 44.5%, 55.5%, 0.032%, and 0%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 44.2%, 55.3%, 0.48%, and 0.053%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 79.8%, 20.1%, 0.12%, and 0.018%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 58.9%, 19.2%, 21.2%, and 0.69%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 64.4%, 35.0%, 0.44%, and 0.14%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 61.9%, 32.9%, 3.47%, and 1.70%, respectively.
  • gating data was also produced using CD4 and CD8 as variables.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant had a fluorescence intensity of 45.5%/45.3%, 44.9%, 9.26%, and 0.35%, respectively.
  • gating data was produced using V51 and V52 as variables.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant had a fluorescence intensity of 16.9%, 82.8%, 0.14%, and 0.12%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 33.6%, 66.4%, 5.9E-4%, and 1.78E-3, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 33.7%, 66.3%, 0.011%, and 0.016%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 78.4%, 21.2%, 0.30%, and 0.018%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 76.3%, 20.2%, 2.95%, and 0.61%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 50.9%, 48.7%, 0.36%, and 0.10%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 51.6%, 44.4%, 0.43%, and 3.60%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 65.4%, 34.5%, 0.096%, and 7.71E-4, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 65.4%, 34.3%, 0.20%, and 0.10%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 87.9%, 12.1%, 0.028%, and 6.24E-3%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 82.3%, 12.1%, 5.38%, and 0.23%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 87.8%, 12.0%, 0.22%, and 0.013%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 87.8%, 11.1%, 0.30%, and 0.78%, respectively.
  • gating data was also produced using the variables CD3 and CD4, which showed a fluorescence intensity of 83.1% in the region indicated.
  • gating data was produced using the variables CD56 and CD4, which showed a fluorescence intensity of 65.7% in the region indicated.
  • Example 22 Generating a Population of CD4+ T cells through Depletion of CD8+, ⁇ , NK, and B Cells Prior to Peptide Stimulation
  • CD8+ T cells were depleted, ⁇ or NK cell overgrowth was observed in multiple patients. Consequently, CD8, ⁇ , NK or B cells were depleted to test whether it would improve CD4+ T cell expansion.
  • Cell depletion was performed after peptide stimulation and before lentivirus transduction. HIV positive human peripheral blood was obtained.
  • PBMCs were separated with Ficoll-Paque PLUS (GE Healthcare, Cat: 17-1440-02). Fresh separated PBMCs (lxlO 7 ) were stimulated with PepMixTM HIV (GAG) Ultra (Cat: PM-HIV-GAG, JPT Peptide Technologies, Berlin, Germany) in lmL medium in a 24-well plate for 18 hours.
  • GAG PepMixTM HIV
  • CD8+ T, ⁇ , NK, or B cells were depleted with PE labeled specific antibodies and anti-PE microbeads.
  • the negative selected cells were cultured at 2xl0 6 /mL in TexMACS GMP medium (Cat: 170-076-309, Miltenyi Biotech, Bergisch Gladbach, Germany) containing IL-7 (170-076-111, Miltenyi Biotech, Bergisch Gladbach, Germany), IL-15 (170-076-114, Miltenyi Biotech, Bergisch Gladbach, Germany) and Saquinavir (Cat: 4658, NIH AIDS Reagent Program, Germantown, MD).
  • Lentivirus AGT103 was added 24 hours later at MOI 5.
  • HIV Gag-specific CD4 T cells were expanded to higher levels (Figure 27A-B).
  • the overgrowth of CD8, ⁇ , or NK cells appears to inhibit CD4 T cell growth or kill lentivirus-transduced antigen-specific CD4 T cells. This optimized protocol is suitable for scale-up and cell manufacturing.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 56.4%, 43.5%, 0.034%, and 7.44E-4%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 54.8%, 44.8%, 0.30%, and 0.055%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 83.9%, 16.0%, 0.061%, and 0.027%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 77.6%, 15.4%, 6.39%, and 0.54%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 41.9%, 57.9%, 0.094%, and 0.099%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 43.3%, 50.7%, 3.00%, and 2.98%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 40.4%, 59.3%, 0.12%, and 0.13%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 38.3%, 54.7%, 3.14%, and 3.86%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 46.2%, 53.6%, 0.13%, and 0.080%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 42.1%, 48.5%, 4.28%, and 5.06%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 42.6%, 57.4%, 2.71E-3%, and 0.0%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 42.5%, 57.4%, 0.031%, and 0.048%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 79.5%, 20.5%, 0.017%, and 9.73E-3%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 78.9%, 19.5%, 0.93%, and 0.65%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the control had a fluorescence intensity of 51.4%, 48.4%, 0.11%, and 0.063%, respectively.
  • the lower left quadrant, the lower right quadrant, the upper left quadrant, and the upper right quadrant of the GagPepMix had a fluorescence intensity of 51.7%, 43.0%, 0.22%, and 5.03%, respectively.
  • the target cell is lentivirus AGT103- transduced, antigen-specific CD4+ T cells.
  • a lentivirus carrying GFP was used to measure transduction efficiency. Because intracellular staining causes significant GFP signal loss, CCS was used to identify antigen-specific CD4+ T cells and GFP positive cells were used to identify the transduced cell subsets.
  • lxlO 7 PBMCs from HIV positive patients were stimulated with PepMixTM HIV (GAG) Ultra (Cat: PM-HIV-GAG, JPT Peptide Technologies, Berlin, Germany) in ImL medium in a 24-well plate for 18 hours.
  • GAG PepMixTM HIV
  • CD8, ⁇ , NK or B cells were depleted with PE labeled specific antibodies and anti-PE microbeads.
  • the negative selected cells were cultured at 2xl0 6 /mL in TexMACS GMP medium (Cat: 170-076-309, Miltenyi Biotech, Bergisch Gladbach, Germany) containing IL-7 (170-076-111, Miltenyi Biotech, Bergisch Gladbach, Germany), IL-15 (170- 076-114, Miltenyi Biotech, Bergisch Gladbach, Germany) and Saquinavir (Cat: 4658, NIH AIDS Reagent Program, Germantown, MD). Lentivirus carrying GFP was added 24 hours later at MOI 5. Fresh medium containing IL-7, IL-15 and Saquinavir were added every 3 days during the expansion. The final concentration of IL-7/IL-15 was lOng/mL.
  • IFN- ⁇ positive, antigen-specific CD4+ T cells showed much better transduction efficiency compared to other cell subsets in the culture ( Figure 28). It is reasonable given that antigen-specific CD4+ T cells received TCR stimulation, proliferated faster, and were more easily infected by lentivirus. As shown in Figure 28, the lower right quadrant (68.6% fluorescence) and upper right quadrant (12.6% fluorescence), had a GFP transduction efficiency of 41.5%, and 67.8%, respectively. This is in contrast to the lower left quadrant (9.75% fluorescence) and the upper left quadrant (2.46% fluorescence), which had a GFP transduction efficiency of 35.6% and 43.3%, respectively.
  • the target cell is AGT103 lentivirus transduced, HIV-specific CD4 T cells, it is important to know how many target cells are included in the final cell product. However, there are no detectable markers included in the clinical grade AGT103 lentivirus. As a result, transduction efficiency was measured by detecting vector copy number (VCN) by qPCR. By establishing the relationship between percentage of transduced cells and VCN using a lentivirus carrying GFP, the percentage of transduced cells based on VCN in the final cell product can be estimated.
  • VCN vector copy number
  • Lentivirus carrying GFP was added 24 hours later at MOI 5.
  • Fresh medium containing IL-7, IL-15 and Saquinavir were added every 3 days during the expansion.
  • the final concentration of IL-7/IL-15 was lOng/mL.
  • the final concentration of Saquinavir was ⁇ .
  • Peptide restimulation and CCS assay was performed to evaluate antigen-specific CD4+ T cells and transduction efficiency with GFP signaling.
  • QPCR was performed to detect vector copy number. All experiments were performed following manufacturer's instructions.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Epidemiology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • AIDS & HIV (AREA)
  • Communicable Diseases (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Urology & Nephrology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
PCT/US2018/012998 2017-01-09 2018-01-09 Hiv immunotherapy with no pre-immunization step Ceased WO2018129540A1 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
EP18736295.9A EP3565564A4 (en) 2017-01-09 2018-01-09 HIV IMMUNOTHERAPY WITHOUT PRE-IMMUNIZATION STEP
AU2018205388A AU2018205388A1 (en) 2017-01-09 2018-01-09 HIV immunotherapy with no pre-immunization step
US16/476,529 US20200384021A1 (en) 2017-01-09 2018-01-09 Hiv immunotherapy with no pre-immunization step
BR112019014082-4A BR112019014082A2 (pt) 2017-01-09 2018-01-09 Imunoterapia para hiv sem etapa de pré-imunização
CN202410957212.2A CN118931843A (zh) 2017-01-09 2018-01-09 无预先免疫步骤的hiv免疫疗法
KR1020237020872A KR20230093381A (ko) 2017-01-09 2018-01-09 예비-면역화 단계가 없는 hiv 면역요법
KR1020247004866A KR20240023703A (ko) 2017-01-09 2018-01-09 예비-면역화 단계가 없는 hiv 면역요법
KR1020197023287A KR102663972B1 (ko) 2017-01-09 2018-01-09 예비-면역화 단계가 없는 hiv 면역요법
CN201880016715.2A CN110462029B (zh) 2017-01-09 2018-01-09 无预先免疫步骤的hiv免疫疗法
JP2019536901A JP7260170B2 (ja) 2017-01-09 2018-01-09 事前の免疫化ステップのないhiv免疫療法
CA3048643A CA3048643A1 (en) 2017-01-09 2018-01-09 Hiv immunotherapy with no pre-immunization step
IL267794A IL267794A (en) 2017-01-09 2019-07-02 HIV immunotherapy without a pre-immune phase
JP2022189475A JP2023015407A (ja) 2017-01-09 2022-11-28 事前の免疫化ステップのないhiv免疫療法
AU2024201392A AU2024201392A1 (en) 2017-01-09 2024-03-01 HIV immunotherapy with no pre-immunization step
JP2025051839A JP2025098175A (ja) 2017-01-09 2025-03-26 事前の免疫化ステップのないhiv免疫療法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201762444147P 2017-01-09 2017-01-09
US62/444,147 2017-01-09

Publications (1)

Publication Number Publication Date
WO2018129540A1 true WO2018129540A1 (en) 2018-07-12

Family

ID=62790837

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/012998 Ceased WO2018129540A1 (en) 2017-01-09 2018-01-09 Hiv immunotherapy with no pre-immunization step

Country Status (10)

Country Link
US (1) US20200384021A1 (https=)
EP (1) EP3565564A4 (https=)
JP (3) JP7260170B2 (https=)
KR (3) KR20240023703A (https=)
CN (2) CN118931843A (https=)
AU (2) AU2018205388A1 (https=)
BR (1) BR112019014082A2 (https=)
CA (1) CA3048643A1 (https=)
IL (1) IL267794A (https=)
WO (1) WO2018129540A1 (https=)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10233464B2 (en) 2016-07-08 2019-03-19 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10420789B2 (en) 2016-01-15 2019-09-24 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10428350B2 (en) 2016-01-15 2019-10-01 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10548914B2 (en) 2008-10-17 2020-02-04 American Gene Technologies International Inc. Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
US10767183B2 (en) 2016-03-09 2020-09-08 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
US10888613B2 (en) 2016-02-08 2021-01-12 American Gene Technologies International Inc. Method of producing cells resistant to HIV infection
CN115551532A (zh) * 2020-03-03 2022-12-30 美国基因技术国际有限公司 在淋巴细胞中按需表达外源性因子以治疗hiv
US11583562B2 (en) 2016-07-21 2023-02-21 American Gene Technologies International Inc. Viral vectors for treating Parkinson's disease
US11820999B2 (en) 2017-04-03 2023-11-21 American Gene Technologies International Inc. Compositions and methods for treating phenylketonuria
US11976292B2 (en) 2016-06-08 2024-05-07 American Gene Technologies International Inc. Non-integrating viral delivery system and methods related thereto
US11980663B2 (en) 2015-07-08 2024-05-14 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US12241086B2 (en) 2020-04-15 2025-03-04 Amgen Inc. Process for generating genetically engineered autologous T cells
US12378521B2 (en) 2020-04-15 2025-08-05 Amgen Inc. Method for enhancing production of genetically engineered autologous T cells
US12559769B2 (en) 2017-06-16 2026-02-24 American Gene Technologies International Inc. Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200135852A (ko) * 2018-03-27 2020-12-03 아메리칸 진 테크놀로지스 인터내셔널 인코포레이티드 유전자 변형 림프구의 제조 방법
JP2024110682A (ja) 2023-02-03 2024-08-16 帝人株式会社 ポリオレフィン微多孔膜

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120053223A1 (en) * 2008-11-26 2012-03-01 Centre National De La Recherche Scientifique (C.N.R.S) Compositions and methods for treating retrovirus infections
US20130078276A1 (en) * 2010-02-18 2013-03-28 Harriet L. Robinson Vectors expressing hiv antigens and gm-csf and related methods of generating an immune response
US20160243169A1 (en) * 2009-07-15 2016-08-25 Calimmune, Inc. Dual vector for inhibition of human immunodeficiency virus

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT904392E (pt) * 1996-10-17 2001-06-29 Oxford Biomedica Ltd Vectores retrovirais
RU2305708C2 (ru) * 2001-10-02 2007-09-10 Энститю Клейтон Де Ля Решерш Рекомбинантный лентивирусный вектор, клетка-хозяин, трансдуцированная лентивирусным вектором, способ ее трансдукции и применение
CN1738648A (zh) * 2003-01-17 2006-02-22 佛罗里达大学研究基金会有限公司 小干扰rna基因治疗
WO2005028634A2 (en) 2003-09-18 2005-03-31 Emory University Improved mva vaccines
CN101160055A (zh) * 2005-02-16 2008-04-09 莱蒂恩公司 慢病毒载体及其用途
WO2010051521A1 (en) * 2008-10-31 2010-05-06 Lentigen Corporation Cell therapy product for the treatment of hiv infection
WO2010127166A2 (en) 2009-04-30 2010-11-04 The Regents Of The University Of California Combination anti-hiv vectors, targeting vectors, and methods of use
CN107405357B (zh) * 2014-10-14 2021-12-31 德克萨斯科技大学系统 多重shRNAs及其应用
EP3319631A4 (en) * 2015-07-08 2019-01-09 American Gene Technologies International Inc. HIV PREMUNICATION AND IMMUNOTHERAPY
WO2017139065A1 (en) * 2016-02-08 2017-08-17 American Gene Technologies International Inc. Hiv vaccination and immunotherapy
AU2017292582C1 (en) * 2016-07-08 2021-11-11 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120053223A1 (en) * 2008-11-26 2012-03-01 Centre National De La Recherche Scientifique (C.N.R.S) Compositions and methods for treating retrovirus infections
US20160243169A1 (en) * 2009-07-15 2016-08-25 Calimmune, Inc. Dual vector for inhibition of human immunodeficiency virus
US20130078276A1 (en) * 2010-02-18 2013-03-28 Harriet L. Robinson Vectors expressing hiv antigens and gm-csf and related methods of generating an immune response

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10548914B2 (en) 2008-10-17 2020-02-04 American Gene Technologies International Inc. Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
US11007209B2 (en) 2008-10-17 2021-05-18 American Gene Technologies International Inc. Safe lentiviral vectors for targeted delivery of multiple therapeutic molecules
US11980663B2 (en) 2015-07-08 2024-05-14 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US11519006B2 (en) 2016-01-15 2022-12-06 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10420789B2 (en) 2016-01-15 2019-09-24 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10428350B2 (en) 2016-01-15 2019-10-01 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10472649B2 (en) 2016-01-15 2019-11-12 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US12410446B2 (en) 2016-01-15 2025-09-09 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US10772905B2 (en) 2016-01-15 2020-09-15 American Gene Technologies International Inc. Methods and compositions for the activation of gamma-delta T-cells
US12090200B2 (en) 2016-02-08 2024-09-17 American Gene Technologies International Inc. Methods of producing cells resistant to HIV infection
US10888613B2 (en) 2016-02-08 2021-01-12 American Gene Technologies International Inc. Method of producing cells resistant to HIV infection
US10767183B2 (en) 2016-03-09 2020-09-08 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
US10975374B2 (en) 2016-03-09 2021-04-13 American Gene Technologies International Inc. Combination vectors and methods for treating cancer
US11976292B2 (en) 2016-06-08 2024-05-07 American Gene Technologies International Inc. Non-integrating viral delivery system and methods related thereto
US12370253B2 (en) 2016-07-08 2025-07-29 American Gene Technologies International Inc. Pre-immunization and immunotherapy
US11090379B2 (en) 2016-07-08 2021-08-17 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US11911458B2 (en) 2016-07-08 2024-02-27 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10494647B2 (en) 2016-07-08 2019-12-03 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US10233464B2 (en) 2016-07-08 2019-03-19 American Gene Technologies International Inc. HIV pre-immunization and immunotherapy
US11583562B2 (en) 2016-07-21 2023-02-21 American Gene Technologies International Inc. Viral vectors for treating Parkinson's disease
US11820999B2 (en) 2017-04-03 2023-11-21 American Gene Technologies International Inc. Compositions and methods for treating phenylketonuria
US12559769B2 (en) 2017-06-16 2026-02-24 American Gene Technologies International Inc. Methods and compositions for the activation of tumor cytotoxicity via human gamma-delta t-cells
JP2023516685A (ja) * 2020-03-03 2023-04-20 アメリカン ジーン テクノロジーズ インターナショナル インコーポレイテッド Hivを処置するためのリンパ球における外因性因子のオンデマンド発現
EP4114439A4 (en) * 2020-03-03 2024-04-17 American Gene Technologies International Inc. ON-DEMAND EXPRESSION OF EXOGENOUS FACTORS IN LYMPHOCYTES FOR THE TREATMENT OF HIV
CN115551532A (zh) * 2020-03-03 2022-12-30 美国基因技术国际有限公司 在淋巴细胞中按需表达外源性因子以治疗hiv
US12241086B2 (en) 2020-04-15 2025-03-04 Amgen Inc. Process for generating genetically engineered autologous T cells
US12378521B2 (en) 2020-04-15 2025-08-05 Amgen Inc. Method for enhancing production of genetically engineered autologous T cells

Also Published As

Publication number Publication date
CA3048643A1 (en) 2018-07-12
US20200384021A1 (en) 2020-12-10
JP2020515234A (ja) 2020-05-28
EP3565564A1 (en) 2019-11-13
CN110462029A (zh) 2019-11-15
EP3565564A4 (en) 2020-09-23
CN118931843A (zh) 2024-11-12
AU2018205388A1 (en) 2019-07-18
IL267794A (en) 2019-09-26
KR20240023703A (ko) 2024-02-22
CN110462029B (zh) 2024-07-26
JP7260170B2 (ja) 2023-04-18
JP2023015407A (ja) 2023-01-31
KR20190104586A (ko) 2019-09-10
BR112019014082A2 (pt) 2020-03-03
KR20230093381A (ko) 2023-06-27
JP2025098175A (ja) 2025-07-01
AU2024201392A1 (en) 2024-04-04
KR102663972B1 (ko) 2024-05-23

Similar Documents

Publication Publication Date Title
US12370253B2 (en) Pre-immunization and immunotherapy
US20250121050A1 (en) Methods of producing cells resistant to hiv infection
US20200384021A1 (en) Hiv immunotherapy with no pre-immunization step
WO2025050047A1 (en) Combination immunotherapy and antiviral treatment

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 18736295

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3048643

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 2019536901

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019014082

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2018205388

Country of ref document: AU

Date of ref document: 20180109

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 20197023287

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2018736295

Country of ref document: EP

Effective date: 20190809

ENP Entry into the national phase

Ref document number: 112019014082

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190708

WWW Wipo information: withdrawn in national office

Ref document number: 267794

Country of ref document: IL