WO2018123467A1 - Novel indoloquinazoline compound and method for producing same - Google Patents

Abstract

An indoloquinazoline compound represented by a specific structure. Clones having exceptional AI activity were detected by metagenomic analysis, and a novel indoloquinazoline compound synthase was identified from the clones. The novel indoloquinazoline compound has high resistance to decomposition by microorganisms and has AI activity. The novel indoloquinazoline compound can be used to control the QS mechanism in the fermentation field. This compound can be synthesized biologically and chemically.

Description

Novel indoloquinazoline type compound and process for producing the same

The present invention relates to a novel indoloquinazoline type compound and a method for producing the same.

Bacteria produce signal molecules called auto-inducers (hereinafter also referred to as AI) to communicate between cells, adjust the cell density, and control the expression of various genes depending on the cell density Is known. A mechanism for controlling gene expression according to the number of cells using AI is called bacterial quorum sensing (hereinafter also referred to as QS). Conventionally, acyl homoserine lactones (N-acyl-L-homoserine lactones, hereinafter also referred to as AHL), furanosylboronic acid diesters, and cyclic peptides are known as AI, and there are reports that indole has AI activity (non-patented). Reference 1).

There is Pseudomonas aeruginosa as a microorganism having an AHL compound as AI. The QS mechanism of Pseudomonas aeruginosa is composed of three genes: an I-gene, an R-gene, and a target gene. The I-gene encodes an AHL synthase and the R-gene encodes a transcriptional activator. AHL compounds synthesized by AHL synthase can cross the bacterial outer membrane. As the bacterial density in the environment increases due to bacterial growth, the concentration of AHL compounds inside and outside the bacteria also increases. When the concentration of the AHL compound reaches a certain threshold, the binding between the AHL compound and the R-gene product (transcription activator) is accelerated to form a complex. This complex binds to the promoter of the target gene to increase or decrease the transcription activity, and target genes such as various pathogenic factors are expressed. The AI biosynthesis gene is also a target gene, and its transcription is activated by AI itself. The above is not limited to Pseudomonas aeruginosa, but is a feature common to other AIs.

Pseudomonas aeruginosa is expressed by the expression of the target gene, in addition to pyocyanin and other pigments, exopolysaccharides important for biofilm formation, as well as various exotoxins (elastase, protease, Producing exotoxins). If the QS mechanism can be inhibited by an AI antagonist or AI degrading enzyme, production of toxins and the like can be suppressed without killing beneficial bacteria such as enteric bacteria, and side effects can be reduced. AHL compounds and the like are also known to function as signaling substances in mammalian cells, which are hosts for Pseudomonas aeruginosa. When N- (3-oxododecanoyl) -L-homoserine lactone, an AHL compound, is administered to the skin, the remaining hair follicles are activated and new hair follicle regeneration is induced, and hair follicle activation and hair follicle regeneration are performed. It can be used as a pharmaceutical for induction (Patent Document 1).

JP 2012-188395 A

On the other hand, the AHL compound is basically a compound in which a fatty acid is bound to an acid amide on a lactone ring, and is easily degraded by enzymes inside and outside the bacteria. The above-mentioned furanosyl borate diester and cyclic peptidic compounds are also common in that they are easily decomposed by esterase or peptidase. In order to enable use beyond the conventional range, development of a novel compound that is more stable than conventional AI is desired. Furthermore, if such a novel compound can be produced efficiently, the application can be further expanded. When the new compound has resistance to microbial degradation, it can be used beyond the conventional range in the field of fermentation and the like.

In view of the above-mentioned present situation, an object of the present invention is to provide a novel indoloquinazoline type compound.

Another object of the present invention is to provide a novel indoloquinazoline type compound synthase, a nucleic acid encoding the synthase, a transformant transformed with a vector containing the nucleic acid, and the like.

Furthermore, it aims at providing the manufacturing method of an efficient new indoloquinazoline type compound.

As a result of intensive research to solve the above problems, a metagenomic analysis was performed on a complex microorganism obtained from activated sludge. As a result, a nucleic acid encoding a synthase of a novel compound having a higher AI activity than an AHL compound was included. The inventors have found that a novel compound synthesized by this nucleic acid is an indoloquinazoline type compound (hereinafter referred to as IQ type compound) having an indoroquinazoline skeleton, and completed the present invention.

That is, the present invention provides a novel IQ type compound represented by the following formula (I).

(In the formula, R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ may be the same or different from each other, hydrogen atom, hydroxyl group, carboxyl group, amino group, halogen atom. , An alkyl group (—R), an alkylamino group (—NRR ′), an alkoxy group (—OR), an acyl group (—COR), a carboxylic acid derivative (—COOR, —CONRR ′), or an alkylsilyl group (—SiRR) 'R "), and / or any two of R ¹ to R ⁴ and / or R ⁵ to R ⁸ are ring structures that include carbon atoms and / or atoms other than carbon and are bonded to each other. ^There, R ^{9, R 10} are optionally hydrogen atoms optionally the same as or different from each other, a hydroxyl group, a carboxyl group, an amino group, an alkyl group (-R), an alkylamino group (-NRR '), an alkoxy group (-O ), An acyl group (-COR), a or a carboxylic acid derivative (-COOR, -CONRR ^{'), R 11} represents a hydrogen atom, an alkyl group (-R), an acyl group (-COR), a or alkylsilyl group ( -SiRR′R ″), wherein R, R ′ and R ″ may be the same or different and each may contain an unsaturated bond and / or a substituent, and may be an alkyl group having 1 to 22 carbon atoms. .)

The present invention also provides (a) an amino acid sequence represented by SEQ ID NO: 1,
(B) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1, or (c) at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1. The present invention provides a novel IQ type compound synthase comprising an amino acid sequence having the above and having a synthetic activity of a novel IQ type compound represented by the above formula (I).

The present invention also provides a nucleic acid encoding the novel IQ type compound synthase.

The present invention also provides (a) a base sequence represented by SEQ ID NO: 9,
(B) a base sequence that hybridizes with a complementary sequence of the base sequence shown in SEQ ID NO: 9 under stringent conditions, or
(C) contains any base sequence shown in the base sequence having at least 90% identity with the base sequence shown in SEQ ID NO: 9, and has a synthetic activity of the novel IQ type compound shown in the above formula (I) Nucleic acids encoding proteins are provided.

The present invention also provides a vector containing the nucleic acid.

The present invention also provides a transformant containing the vector.

The present invention also provides a method for producing a novel IQ type compound synthase characterized by culturing the transformant and collecting the novel IQ type compound synthase represented by the above formula (I) from the obtained culture. It is to provide.

The present invention also provides a method for producing a novel IQ-type compound represented by the above formula (I), comprising culturing a transformant containing a vector containing a nucleic acid encoding an indole oxidase. .

Furthermore, the present invention provides a method for controlling the QS mechanism using the novel IQ type compound represented by the above formula (I).

In addition, the present invention provides a dehydrated condensate by dehydrating and condensing an isatin compound represented by formula (IV) and an isatinic acid compound represented by formula (V), and the dehydrated condensate is represented by formula (VI). The manufacturing method of the said novel IQ type compound including the process of adding is provided.

(Wherein R ¹ , R ² , R ³ and R ⁴ may be the same or different from each other, hydrogen atom, hydroxyl group, carboxyl group, amino group, halogen atom, alkyl group (—R), alkylamino group ( —NRR ′), alkoxy group (—OR), acyl group (—COR), carboxylic acid derivative (—COOR, —CONRR ′), or alkylsilyl group (—SiRR′R ″), and / or R ¹ to Any two of R ⁴ are ring structures formed by bonding to each other including a carbon atom and / or an atom other than carbon, and R ⁹ and R ¹⁰ may be the same or different hydrogen atoms, Hydroxyl group, carboxyl group, amino group, alkyl group (—R), alkylamino group (—NRR ′), alkoxy group (—OR), acyl group (—COR), or carboxylic acid derivative (—C OR, —CONRR ′), wherein R, R ′, and R ″ may be the same or different and each may contain an unsaturated bond and / or a substituent, and may be an alkyl group having 1 to 22 carbon atoms. .)

In addition, the present invention comprises adding an isatin compound represented by the above formula (IV), an isatinic acid compound represented by the above formula (V) and an amine compound represented by the above formula (VI), and reacting them at a temperature of 10 to 50 ° C. The present invention provides a method for producing the novel IQ type compound.

Furthermore, the present invention provides a method for producing a novel IQ compound represented by the above formula (II), characterized in that indigo is heated in dimethyl sulfoxide to a temperature of 60 to 140 ° C.

According to the present invention, a novel IQ type compound, a novel IQ type compound synthase, a gene encoding the synthase, and the like are provided.

It is a figure explaining an example of the path | route by which a novel IQ type compound is synthesize | combined from indole. 2 is a ¹ H-NMR chart of a compound prepared in Example 5. FIG. In the figure, the horizontal axis represents ppm. 6 is a ¹³ C-NMR chart of the compound prepared in Example 5. FIG. In the figure, the horizontal axis represents ppm. 6 is a mass spectrometry chart of the compound prepared in Example 5 using an ESI-TOF mass spectrometer. FIG. 5 (A) is a chart showing the results of LC-MS analysis of the compound prepared in Example 4, and FIG. 5 (B) shows the results of LC-MS analysis of the compound prepared in Example 5. It is a chart. It is a figure which shows the result of Example 8 and shows the result of AI activity of the colon_bacillus | E._coli clone containing the various nucleic acid which codes indole oxidase. It is a figure which shows the result of having compared the AI activity of the novel IQ type compound obtained in Example 5, and AHL compound (3-oxo-homoserine lactone) with the luminescence intensity of the microorganism sensor. FIG. 6 is a graph showing the results of comparing the biofilm forming ability of the novel IQ type compound obtained in Example 5 and the AHL compound (3-oxo-homoserine lactone). It is a figure which shows the result of having evaluated the decomposition | disassembly tolerance by Bacillus cereus of the novel IQ type compound and AHL compound (3-oxo-homoserine lactone) which were obtained in Example 5.

(1) Novel IQ type compound The novel IQ type compound of the present invention is represented by the following formula (I).

In the formula, R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ may be the same or different from each other, hydrogen atom (—H), hydroxyl group (—OH), carboxyl Group (—COOH), amino group (—NH ₂ ), halogen atom, alkyl group (—R), alkylamino group (—NRR ′), alkoxy group (—OR), acyl group (—COR), carboxylic acid derivative (—COOR, —CONRR ′) or an alkylsilyl group (—SiRR′R ″). The R, R ′ and R ″ may be the same or different, and each may be an unsaturated bond and / or a substituent. A linear or branched alkyl having 1 to 22 carbon atoms, preferably 1 to 18 carbon atoms, more preferably 1 to 12 carbon atoms, and particularly preferably 1 to 8 carbon atoms. It is a group. Examples of the substituent include a hydroxyl group (—OH), a carboxyl group (—COOH), a carboxylic acid derivative (—COOR, —CONHR, wherein R is an alkyl group having 1 to 5 carbon atoms), a halogen atom, and an amino group. (—NRR ′, wherein R and R ′ are a hydrogen atom or an alkyl group having 1 to 3 carbon atoms). In addition, any two of R ¹ to R ⁴ and / or any two of R ⁵ to R ⁸ include a carbon atom and / or an atom other than carbon and are bonded to each other to form a ring structure. You may do it. The ring structure may be a cycloalkane having 3 to 12 carbon atoms, a bicycloalkane, a benzene ring containing an unsaturated bond, a naphthalene ring, an anthracene ring, a heterocyclic ring containing a heteroatom such as nitrogen, sulfur or oxygen.
R ⁹ and R ¹⁰ may be the same or different from each other, and may be a hydrogen atom (—H), a hydroxyl group (—OH), a carboxyl group (—COOH), an amino group (—NH ₂ ), an alkyl group (— R), an alkylamino group (—NRR ′), an alkoxy group (—OR), an acyl group (—COR), and a carboxylic acid derivative (—COOR, —CONRR ′), wherein R and R ′ are the same. However, it may be different and may contain an unsaturated bond and / or a substituent. The carbon number is 1 to 22, preferably 1 to 18, more preferably 1 to 12, and particularly preferably 1 carbon. An alkyl group having 8 to 8 linear or branched groups; Examples of the substituent include a hydroxyl group (—OH), a carboxyl group (—COOH), a carboxylic acid derivative (—COOR, —CONHR, wherein R is an alkyl group having 1 to 5 carbon atoms), a halogen atom, an amino group ( -NRR ', wherein R and R' are hydrogen atoms or alkyl groups having 1 to 3 carbon atoms.
R ¹¹ is a hydrogen atom (—H), an alkyl group (—R), an acyl group (—COR), or an alkylsilyl group (—SiRR′R ″), and the R, R ′ and R ″ are , Which may be the same or different and may contain an unsaturated bond and / or a substituent, have 1 to 22 carbon atoms, preferably 1 to 18 carbon atoms, more preferably 1 to 12 carbon atoms, and particularly preferably An alkyl group having 1 to 8 carbon atoms which may be linear or branched. Examples of the substituent include a hydroxyl group (—OH), a carboxyl group (—COOH), a carboxylic acid derivative (—COOR, —CONHR, wherein R is an alkyl group having 1 to 5 carbon atoms), a halogen atom, an amino group ( -NRR ', wherein R and R' are hydrogen atoms or alkyl groups having 1 to 3 carbon atoms.
Preferably, R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ , R ⁹ , R ¹⁰ , and R ¹¹ are compounds represented by the following formula (II), which are hydrogen atoms It is.

 

As shown in the examples described later, the discovery of the compound represented by the formula (II) is derived from a gene detected by metagenomic analysis. This gene was detected by expression of GFP using E. coli with pJBA132 plasmid containing AHL receptor gene (LuxR), AHL synthase gene promoter (LuxI) and green fluorescent protein (GFP) gene as a microbial sensor. The expression of GFP is premised on the binding of the AHL receptor produced by LuxR and the AI compound. Therefore, it was estimated that the structure of the compound detected by the microbial sensor was similar to the structure of the AHL compound. Surprisingly, however, the protein encoded by the gene was a synthase of a novel IQ-type compound represented by formula (II) containing an indoloquinazoline skeleton. The novel IQ type compound produced by this synthesizing enzyme has a luminescence intensity more than twice that of 3-oxohexanoyl-homoserine lactone, which is a conventionally known AHL compound, It was shown to have high AI activity. In the QS mechanism controlled by AI, the AI biosynthetic gene is also a target gene, and its transcription is activated by AI itself. The novel IQ type compound has a high emission intensity and is excellent in the production efficiency of the novel IQ type compound by microorganisms.

The novel IQ type compound acts as an AI against gram-negative bacteria. Therefore, the QS mechanism can be controlled in the same way as conventional AHL compounds, and it can be used as AI for controlling biofilm formation, hair-growth effect on mammals, and wound treatment. Moreover, as shown in the examples described later, it was also found that the novel IQ type compound is excellent in resistance to microbial degradation. For this reason, the QS mechanism can be controlled over a long period of time in a microbial environment such as fermented food production or environmental purification. Conventionally, AI having an indoloquinazoline skeleton has not been known. Therefore, it can be used as a reagent for analyzing the QS mechanism or as a research reagent for the development of AI antagonists. Thus, novel IQ type compounds can be used in the fields of medicine, research, chemical product development, research reagents, food production, and probiotics utilizing AI activity. It has been reported that indoloquinazoline, which is a nitrogen-containing heterocyclic compound, has an action of promoting differentiation into myocardial cells. Cardiomyocytes themselves cannot be regenerated, but if universal cells can be differentiated by indoloquinazoline, cardiomyocytes can be regenerated, which is expected to serve as a clue for the treatment of patients with severe heart disease. Since the novel IQ type compound also has an indoloquinazoline skeleton, it can be used as such a pharmaceutical raw material. Furthermore, the novel IQ type compound is a yellow compound and can be used as a dye or a precursor thereof.

(2) Chemical production method of novel IQ type compound The novel IQ type compound can be chemically synthesized using isatin as a raw material. Isatin can also be produced from indole or indigo. For convenience, FIG. 1 shows an example of a synthetic route from indole. Indole (1) becomes indoxyl (2) by oxidation (step A) and indigo (3) by oxidation of indoxyl (2) (step B). Indigo (3) produces isatin (4) by oxidation (step C), and isatinic acid (5) is produced when isatin (4) is hydrolyzed (step D). When isatin (4) and isatinic acid (5) are subjected to dehydration condensation (step E), a precursor (6) having an indoloquinazoline skeleton is formed, and when this is aminated by adding ammonia (step F) (II) ) To form a novel IQ compound.

The air oxidation reaction in process A to process C is slight and there are many by-products. Therefore, it is preferable to chemically synthesize a novel IQ type compound using isatin (4) as a raw material. The isatin (4) solution is hydrolyzed by adding an alkali such as sodium hydroxide to produce isatinic acid (5). When a concentrated ammonia solution is added thereto, a novel IQ type compound represented by the above formula (II) is obtained. Can be manufactured. This reaction is preferably performed at a temperature of 10 to 50 ° C., more preferably at room temperature (temperature 25 ± 7 ° C.). Concentrated ammonia means an ammonia solution having a concentration of 20 to 30 w / w%.

Since isatinic acid (5) is produced by hydrolysis of isatin (4) (step D), the above formula (II) is obtained using isatin (4) as a raw material without adding isatinic acid (5) to the reaction system. ) Can be produced. The hydrolysis in Step D proceeds at room temperature by adding ammonia, sodium hydroxide, potassium hydroxide or other alkali. When ammonia is added to isatin (4), a part of isatin (4) becomes isatinic acid (5), and isatin (4) and isatinic acid (5) are subjected to dehydration condensation (step E) to form a precursor (6). And the precursor (6) is aminated (step F) to produce a novel IQ type compound represented by the above formula (II). This means that when ammonia is added to isatin (4), a novel IQ type compound represented by the above formula (II) can be produced at a temperature of 10 to 50 ° C., for example, room temperature (temperature 25 ± 7 ° C.).

Moreover, when isatinic acid (5) is heated to a temperature of 60 ° C. or higher, ammonia may be released (step G). When this detached ammonia is contained in the reaction system, the novel IQ type compound shown in the above (II) can be produced without separately adding ammonia to isatin (4) or isatinic acid (5).

Further, indigo (3) is heated in dimethyl sulfoxide (DMSO) at a temperature of 60 to 140 ° C., preferably 60 to 120 ° C., particularly 80 to 90 ° C. for 12 hours to 10 days, preferably 1 to 8 days. It was also found that a novel IQ type compound represented by the above formula (II) can be produced. Indigo (3), isatin (4) and isatinic acid (5) are all nitrogen-containing compounds and may release ammonia in DMSO. Further, as described above, ammonia is also released by heating the isatinic acid (5). As a result, since ammonia is mixed in the reaction system, a novel IQ type compound represented by the above formula (II) can be produced without adding ammonia separately.

When these derivatives are used in place of isatin (4) or isatinic acid (5), Step E to Step F proceed to produce a novel IQ type compound other than the above formula (II). That is, an isatin compound represented by the following formula (IV) and an isatinic acid compound represented by the following formula (V) are dehydrated to obtain a dehydrated condensate, and an amine compound represented by the following formula (VI) is added to the dehydrated condensate. Through the step of adding, a novel IQ type compound represented by the above formula (I) can be produced.

In the formula, each of R ¹ , R ² , R ³ , and R ⁴ may be the same or different and each represents a hydrogen atom (—H), a hydroxyl group (—OH), a carboxyl group (—COOH), an amino group (—NH ₂ ). ), Halogen atom, alkyl group (—R), alkylamino group (—NRR ′), alkoxy group (—OR), acyl group (—COR), carboxylic acid derivative (—COOR, —CONRR ′), or alkylsilyl A group (—SiRR′R ″). The R, R ′ and R ″ may be the same or different and each have 1 to 22 carbon atoms which may contain an unsaturated bond and / or a substituent, Preferably, it is an alkyl group having 1 to 18 carbon atoms, more preferably 1 to 12 carbon atoms, and particularly preferably 1 to 8 carbon atoms, which may be linear or branched. Examples of the substituent include a hydroxyl group (—OH), a carboxyl group (—COOH), a carboxylic acid derivative (—COOR, —CONHR, wherein R is an alkyl group having 1 to 5 carbon atoms), a halogen atom, and an amino group. (—NRR ′, wherein R and R ′ are a hydrogen atom or an alkyl group having 1 to 3 carbon atoms). Further, any two of R ¹ to R ⁴ may contain a carbon atom and / or an atom other than carbon and may be bonded to each other to form a ring structure. The ring structure may be a cycloalkane having 3 to 12 carbon atoms, a bicycloalkane, a benzene ring containing an unsaturated bond, a naphthalene ring, an anthracene ring, a heterocyclic ring containing a heteroatom such as nitrogen, sulfur or oxygen.
R ⁹ and R ¹⁰ may be the same or different and each represents a hydrogen atom (—H), a hydroxyl group (—OH), a carboxyl group (—COOH), an amino group (—NH ₂ ), an alkyl group (—R). , Alkylamino group (—NRR ′), alkoxy group (—OR), acyl group (—COR), carboxylic acid derivative (—COOR, —CONRR ′), and R and R ′ are the same or different May have an unsaturated bond and / or a substituent, may have 1 to 22 carbon atoms, preferably 1 to 18 carbon atoms, more preferably 1 to 12 carbon atoms, and particularly preferably 1 to 8 carbon atoms. Or an alkyl group which may have a straight chain or a branched chain. Examples of the substituent include a hydroxyl group (—OH), a carboxyl group (—COOH), a carboxylic acid derivative (—COOR, —CONHR, wherein R is an alkyl group having 1 to 5 carbon atoms), a halogen atom, an amino group ( -NRR ', wherein R and R' are hydrogen atoms or alkyl groups having 1 to 3 carbon atoms.

In the isatin compound represented by formula (IV) and the isatinic acid compound represented by formula (V) used in the synthesis reaction, the groups represented by R ¹ to R ⁴ may be the same or different. For example, in the isatin compound represented by the formula (IV), R ¹ , R ² , R ⁴ are hydrogen atoms, R ³ is a methoxy group, and R ¹ , R ² , R ³ represented by the formula (V) are A hydrogen atom and an isatinic acid compound in which R ⁴ is an amino group can be reacted. For example, an alkali such as sodium hydroxide is added to a 5-methoxyisatin solution and hydrolyzed to obtain 5-methoxyisatinic acid. When 4-aminoisatin and concentrated ammonia solution are added thereto, a novel IQ type compound in which R ^{7 in the} above formula (I) is a methoxy group and R ⁴ is an amino group can be synthesized. Since isatin produces the corresponding isatinic acid by hydrolysis, the isatinic compound represented by the formula (V) is produced using two molecules of the isatin compound represented by the formula (IV) as a raw material, and this is used. Thus, a novel IQ type compound can also be synthesized.

In addition, if an amine compound (NHR ⁹ R ¹⁰ ) represented by the above formula (VI) is used instead of ammonia used in Step F of FIG. 1, a new IQ type compound in which R ⁹ and R ¹⁰ are other than hydrogen atoms can be obtained. It can also be synthesized. When an amine compound other than ammonia is used, the precursor (6) carboxylic acid having an indoloquinazoline skeleton shown in FIG. 1 is activated with a dehydrating condensing agent such as dicyclohexylcarbodiimide (DCC) or 1-hydroxybenzotriazole (HOBt). Then, the amidation reaction with the amine compound proceeds smoothly. That is, dissolved precursor (6) and having the Indian Loki mystery phosphorus backbone previously prepared ^precursor R 1 ~ ^{R 8} is ^R 1 ~ ^{R 8} indicated by the formula (I) to (6) in dichloromethane, At room temperature, equimolar amounts of DCC and HOBt were added and stirred, and an amine compound (NHR ⁹ R ¹⁰ ) represented by the formula (VI) other than ammonia was added in an equimolar amount and stirred, whereby R ⁹ and R ¹⁰ were Novel IQ type compounds other than hydrogen atoms can be produced.

A novel IQ type compound in which R ¹¹ is other than a hydrogen atom can be synthesized by modifying R ¹¹ after obtaining a novel IQ type compound in which R ¹¹ is a hydrogen atom in advance. For example, when synthesizing a novel IQ type compound in which R ¹¹ is an acyl group, a previously prepared novel IQ type compound in which R ¹¹ is a hydrogen atom is dissolved in a solvent such as dichloromethane, and a catalytic amount of N, N-dimethyl is synthesized. Add -4-aminopyridine, add the corresponding acid chloride or acid anhydride and stir. Thereby, a novel IQ type compound in which R ¹¹ is an acyl group can be produced. If any of R ¹ to R ⁸ , R ⁹ and R ¹⁰ is a reactive substituent, it may be protected in advance.

Further, when synthesizing a novel IQ type compound in which R ¹¹ is a silyl group, a previously prepared novel IQ type compound in which R ¹¹ is a hydrogen atom is dissolved in a solvent such as dimethylformamide, and a catalytic amount of N, N-dimethyl is synthesized. Add -4-aminopyridine, add the corresponding silyl chloride and stir. Thereby, a novel IQ type compound in which R ¹¹ is a silyl group can be produced. If any of R ¹ to R ⁸ , R ⁹ and R ¹⁰ is a reactive substituent, it may be protected in advance.

In addition, when synthesizing a new IQ type compound in which R ¹¹ is an alkyl group, a previously prepared new IQ type compound in which R ¹¹ is a hydrogen atom is dissolved in a solvent such as dimethylformamide, and an equimolar amount of sodium hydride is added. In addition, the corresponding alkyl halide is added and stirred. Thereby, the novel IQ type compound whose R < ¹¹ > is an alkyl group can be manufactured. If any of R ¹ to R ⁸ , R ⁹ and R ¹⁰ is a reactive substituent, it may be protected in advance.

As described above, isatinic acid (5) is produced from isatin (4) under alkaline conditions. Similarly, an isatinic acid compound represented by formula (V) is produced from an isatin compound represented by formula (IV). Therefore, by using the isatin compound represented by formula (IV), a mixture of the isatin compound represented by formula (IV) and the isatinic compound represented by formula (V) without adding the isatinic compound represented by formula (V) Is obtained. Therefore, in the present invention, “the isatin compound represented by the formula (IV) and the isatinic acid compound represented by the formula (V)” are used together with the isatin compound represented by the formula (IV) and the isatinic compound represented by the formula (V). In addition to the case, the case where only the isatin compound represented by the formula (IV) is used without adding the isatinic acid compound represented by the formula (V) is included.

In addition to the above, it is also possible to prepare a compound represented by the above formula (II) by using a known compound (methylisatoid) shown in the following (III) as a raw material and introducing an amino group instead of a methoxy group.

 

(3) Biosynthesis of a novel IQ-type compound by a microorganism The novel IQ-type compound represented by the formula (II) contains a nucleic acid encoding an indole or an indole derivative oxidase (hereinafter simply referred to as an indole oxidase). It can be biosynthesized from the transformant transformed with. As shown in FIG. 1, the novel IQ type compound comprises dehydration condensation (step E) of isatin (4) and isatinic acid (5) produced by controlling indole under oxidizing conditions, and dehydration condensate (6 ) Amination (step F). Therefore, an indole oxidase capable of oxidizing the third position of indole becomes a novel IQ type compound synthase. Since indole is produced as a degradation product of tryptophan in a microorganism, a novel IQ type compound can be biosynthesized by using a microorganism capable of expressing an indole oxidase. As such a microorganism, a transformant transformed with a vector containing an indole oxidase gene can be used. The indole derivative means an indole compound in which the hydrogen atom of the benzene ring of indole is R ¹ to R ⁴ represented by the above formula (I).

As the novel IQ type compound synthase, an enzyme protein consisting of the amino acid sequence shown in SEQ ID NO: 1 can be preferably used. It may be a protein having an enzymatic activity capable of synthesizing a novel IQ type compound consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1. Here, “1 or several” means 1 to 85, preferably 1 to 64, more preferably 1 to 42. Further, it may be a partial sequence of the novel IQ type compound synthase shown in SEQ ID NO: 1 under the condition that it has the ability to synthesize a novel IQ type compound. % Or more, preferably 85% or more, more preferably 90% amino acid sequence protein having homology. These proteins are called novel IQ type compound synthases because they have the ability to synthesize new IQ type compounds.

Indole oxidase can be used as a novel IQ type compound synthase. As such enzymes, in addition to the above, MG79-12 (SEQ ID NO: 2), MG79-15 (SEQ ID NO: 3), MG79-16 (SEQ ID NO: 4), MG79-20 (SEQ ID NO: 5) derived from marine environment samples ), MG92-5 (SEQ ID NO: 6), MG92-6 (SEQ ID NO: 7), MoxY (SEQ ID NO: 8) derived from insect symbiosis. It should be noted that the present invention is not limited to the above indole oxidases, provided that a novel IQ type compound can be synthesized.

(4) Nucleic acid encoding a novel IQ type compound synthase (qssA)
As a novel IQ type compound synthase, there is a novel IQ type compound synthase shown in SEQ ID NO: 1 found by a metagenomic analysis and a microbial sensor that detects AI activity. This novel IQ type compound synthase is called QssA, and there is a gene represented by SEQ ID NO: 9 as a nucleic acid encoding QssA, which is called qssA. In addition, it hybridizes under stringent conditions with a complementary sequence of the base sequence shown in SEQ ID NO: 9 under the condition that it encodes a protein having the synthetic activity of the novel IQ type compound represented by the above formula (I). The base sequence may be any base sequence shown in the base sequence shown in SEQ ID NO: 9 or the base sequence having at least 90%, preferably 95% identity. Here, stringent conditions refer to conditions in which a specific hybrid is formed and a non-specific hybrid is not formed. For example, it refers to conditions under which DNA having high homology (identity 90% or more) hybridizes. Examples of such “stringent conditions” include heating in a solution of 2 × SSC, 0.1% SDS and 50% formamide at 25 ° C., then 0.1 × SSC, 0.1% The conditions for washing at 68 ° C. in a solution of SDS. However, factors affecting the stringency of hybridization include a plurality of factors such as temperature and salt concentration, and the same stringency can be realized by appropriately selecting these factors.

(5) Method for preparing gene qssA The gene qssA is prepared using a metagenomic library derived from microorganisms contained in an activated sludge environment. DNA derived from complex microorganisms is extracted from activated sludge, and a DNA fraction of about 40 kb is collected. Each of these DNAs is introduced into a fosmid vector, and this vector is introduced into a host such as Escherichia coli to construct a metagenomic library consisting of clones of each DNA. Using an appropriate microorganism sensor, an E. coli clone having AI activity is selected. As the microorganism sensor, for example, E. coli into which a plasmid containing an AHL receptor gene (LuxR), an AHL synthase gene promoter (LuxI), and a green fluorescent protein (GFP) gene has been introduced can be used. When a clone of the metagenomic library expresses a novel IQ type compound synthase and has AI activity, it emits GFP green fluorescence, and thus a clone having AI activity can be detected. In order to identify a gene sequence having AI activity from about 40 kb of DNA contained in a clone emitting green fluorescence, a mutant of this clone may be used. As such mutants, for example, a plurality of mutant groups in which a transposon is introduced at an arbitrary position of DNA of a clone emitting green fluorescence are prepared. These are cultured with the microorganism sensor, and clones that do not emit green fluorescence are detected. The transposon introduction position of this clone can be estimated as a gene region of a novel IQ type compound synthase. One of the gene regions thus detected is qssA. QssA detected by the above can be amplified by a known method such as PCR using an appropriate primer.

(6) Preparation Method of Indole Oxidase Gene Derived from Marine Environment Sample MG79-12 (SEQ ID NO: 2), MG79-15 (SEQ ID NO: 3), MG79-16 (SEQ ID NO: 4), MG79-20 (SEQ ID NO: 5) ), MG92-5 (SEQ ID NO: 6) and MG92-6 (SEQ ID NO: 7) are encoded by SEQ ID NO: 13 (MG79-12 DNA sequence), SEQ ID NO: 14 (MG79-15 DNA sequence), SEQ ID NO: 15 (DNA sequence of MG79-16), SEQ ID NO: 16 (DNA sequence of MG79-20), SEQ ID NO: 17 (DNA sequence of MG92-5), SEQ ID NO: 18 (DNA sequence of MG92-6) Can do. These can be prepared using a metagenomic library derived from microorganisms contained in the marine environment or marine invertebrates as an indicator of indigo production ability.

For example, DNA derived from complex microorganisms is extracted from marine benthic invertebrates such as seawater, seabed sediment, tidal flat sand mud, sponges and sea squirts, and a DNA fraction of about 40 kb is collected. Similar to the method for preparing the gene qssA, each of these DNAs is introduced into a fosmid vector or the like, and this vector is introduced into a host such as Escherichia coli to construct a metagenomic library composed of clones of each DNA. Next, this is selected using the indole oxidation activity as an index. Specifically, the indigo production ability in which the colony is dark blue is used as an index. The following method is used to identify a gene sequence related to indole oxidation from about 40 kb of DNA contained in a clone showing dark blue. The fosmid DNA is randomly fragmented to about 3 kb with the restriction enzyme Sau3AI, then subcloned into a plasmid, and a subclone having indigo production ability is selected. The sequence of the DNA integrated into the indigo-producing subclone is determined, and the gene region is estimated. The gene detected by the above can be amplified by a known method such as PCR using an appropriate primer. In addition, the clone finally produced by PCR amplification can confirm the production of AI active substance using the microorganism sensor used for the detection of AI active substance in the preparation of the gene qssA.

(7) Transformant having ability to produce novel IQ type compound synthase A novel IQ type compound synthase gene expression vector (hereinafter simply referred to as a recombinant vector) is prepared by linking qssA to an appropriate vector. be able to. QssA is a novel IQ type compound synthase and is an indole oxidase. Therefore, on the condition that a novel IQ type compound can be synthesized, a recombinant vector can be prepared using a nucleic acid encoding another indole oxidase in the same manner as qssA. Examples of such indole oxidase genes include MG79-12 (SEQ ID NO: 2), MG79-15 (SEQ ID NO: 3), MG79-16 (SEQ ID NO: 4), MG79-20 (SEQ ID NO: 5), MG92- The genes encoding 5 (SEQ ID NO: 6) and MG92-6 (SEQ ID NO: 7) are SEQ ID NO: 13 (DNA sequence of MG79-12), SEQ ID NO: 14 (DNA sequence of MG79-15), SEQ ID NO: 15 ( MG79-16 DNA sequence), SEQ ID NO: 16 (MG79-20 DNA sequence), SEQ ID NO: 17 (MG92-5 DNA sequence), and SEQ ID NO: 18 (MG92-6 DNA sequence). The vector is not particularly limited as long as it can replicate in a host, such as a plasmid, cosmid, or bacteriophage. The host is not particularly limited as long as the recombinant vector functions, and Escherichia coli, actinomycetes, and the like can also be used. The direction and sequence of the gene to be introduced into the vector may be any sequence and selection as long as the gene is expressed and the expressed protein can function as a novel IQ type compound synthase.

A transformant can be prepared by introducing the above recombinant vector into a host and transforming it. As a method for introducing a recombinant vector into a host when preparing a transformant, a conventionally known method such as an electroporation method, a protoplast method, or a calcium chloride method (a spheroplast method) can be used. Moreover, when producing a transformant, a vector to be used, a host, an induction substrate that induces high expression, a promoter, an operator, an enhancer, and the like can be appropriately selected and used. In general, a novel IQ type compound synthase gene is incorporated into an expression plasmid vector and introduced into E. coli, but is not limited thereto.

(8) Preparation method of novel IQ type compound synthase The novel IQ type compound synthase can be obtained by culturing the transformant and collecting it from the culture. “Culture” means any of culture supernatant, cultured cells, or disrupted cells. Culturing is performed according to a conventional method used for culturing a host into which a recombinant vector has been introduced. As a medium for culturing microorganisms such as actinomycetes and bacteria, any medium that contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by the microorganism and that can efficiently culture microorganisms can be used. Any of synthetic media may be used. For example, when the transformant is Escherichia coli, it is cultured in a nutrient medium usually used in this research field, and an inducer such as IPTG (Isopropyl-β-D-1-thiogalactopyranoside) which is a lac promoter inducer is added as necessary. In addition, the enzyme can be highly expressed in a nutrient medium in which E. coli can grow. Under normal culture conditions, pre-cultured at 37 ° C. for 8-12 hours in an LB medium (1.0% peptone, 0.5% dry yeast extract, 1.0% NaCl) appropriately added with antibiotics, Using the sufficiently grown cells as seeds, inoculated in a fresh LB medium at a volume ratio of 1 to 5%, main culture at 37 ° C. for 2 to 4 hours, added with IPTG, and further cultured at 30 ° C. for 2 to 4 hours. In the case of other transformants, the cells are cultured in a medium suitable for each host cell. When the transformant is cultured in suspension, the suspension concentration is preferably 1 to 2 at a turbidity of 600 nm, and can be increased or decreased as necessary.

When the transformant produces a novel IQ type compound synthase, a novel IQ type compound is also contained in the culture solution. Therefore, by confirming the AI activity of the compound, it can be confirmed whether or not the transformant is producing a novel IQ type compound synthase. After confirming the production of the enzyme, a novel IQ type compound synthase is extracted from the culture solution. When the novel IQ type compound synthase is produced outside the cells, the cells are removed from the culture solution, and the novel IQ type compound synthase is extracted. On the other hand, when a novel IQ type compound synthase is produced in the cells, the novel IQ type compound synthase is extracted by crushing the cells. Then, using a general biochemical method used for protein isolation and purification, such as ammonium sulfate precipitation, gel chromatography, ion exchange chromatography, affinity chromatography, etc. alone or in combination, a novel IQ type compound synthase Is isolated.

(9) Preparation of novel IQ type compound by transformant A new IQ type compound is produced by a novel IQ type compound synthase using indole as a substrate. When a novel IQ type compound synthase oxidizes indole, isatin and isatinic acid are produced in the microorganism, these are dehydrated and condensed, and the hydroxyl group at the 13-position is substituted with an amino group to produce a new IQ type compound. Since indole is produced by the decomposition of tryptophan in a microorganism, indole is produced when tryptophan is contained in the culture solution. As shown in FIG. 1, the precursor (6) having an indoloquinazoline skeleton is aminated (step F) to produce a new IQ type compound represented by the above formula (II), so that ammonia is supplied. It is necessary to However, as shown in the Examples described later, when the transformant is cultured, a novel IQ type compound represented by the above formula (II) is produced directly in the culture solution without supplying ammonia to the culture solution.

The novel IQ type compound is extracted from the cultured cells of the transformant, the culture supernatant, or the enzyme reaction solution using an organic solvent or the like. In order to purify a novel IQ type compound, ion exchange chromatography, gel chromatography, reverse phase chromatography, normal phase chromatography and the like can be used alone or in combination.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these.

(Example 1) Preparation of novel IQ type compound synthase gene DNA derived from complex microorganisms was extracted from activated sludge used for wastewater treatment, and DNA having a size of about 40 kb was collected by gel electrophoresis. Using a fosmid vector pCC1Fos as a vector and Escherichia coli EPI300 as a host, a metagenomic library comprising the fractionated DNA clones was constructed. This was cultured in an LB (Luria-bertani) liquid medium supplemented with an antibiotic (chloramphenicol), and the AHL receptor gene (LuxR), the AHL synthase gene promoter (LuxI) and the green fluorescent protein (GFP) gene were Escherichia coli having the pJBA132 plasmid contained therein was used as a microorganism sensor, and a clone in which the microorganism sensor emitted GFP fluorescence was obtained. This is referred to as metagenomic clone N43.

Next, a novel IQ type compound synthase gene was identified from the genes encoded by the metagenomic DNA contained in the metagenomic clone N43. Specifically, a plurality of mutants of the metagenomic clone N43 strain were prepared by randomly inserting the transposon represented by SEQ ID NO: 10 into the metagenomic DNA of the metagenomic clone N43 strain. For the preparation of a mutant using a transposon, EZ-Tn5TM <KAN-2> Tnp Transsome ^™ Kit manufactured by EPICENTRE was used. For these mutants, clones that did not emit GFP fluorescence were obtained using the microorganism sensor. The gene into which the transposon was inserted was identified by determining the base sequence of the metagenomic DNA of this clone, and this gene was designated as a novel IQ type compound synthase gene. This gene is referred to as qssA, and its sequence is shown in SEQ ID NO: 9.

(Example 2) Preparation of transformant by novel IQ type compound synthase gene The novel IQ type compound synthase gene qssA (SEQ ID NO: 9) isolated in Example 1 was amplified by PCR. The sequence of the primer set used for PCR is as follows.
Fwd: 5'- GGAATTCCATATGAACATCAGAAAGAACCCT TTA-3 '(SEQ ID NO: 11)
Rvs: 5'- CGGGATCCTTAGTCGCGTTCGCCCTCGTTGTAT-3 '(SEQ ID NO: 12)
PCR was carried out using fN DNA pN43 as a template and ExTaq DNA polymerase (manufactured by Takara Bio Inc.) under the following reaction conditions. First, heating was performed at 94 ° C. for 30 seconds, and then 94 ° C. for 10 seconds, 55 ° C. for 30 seconds, and 72 ° C. for 1 minute were repeated 30 times. For the PCR reaction, a thermal cycler (manufactured by Takara Bio Inc.) was used. The PCR product was purified with QIAquick PCR purification kit (250) (Qiagen), introduced into pT7 Blue T-vector (Novagen), and Escherichia coli DH5alpha was constructed using the plasmid vector thus constructed. The transformant was inoculated into an LB agar plate medium containing 50 μg / ml ampicillin to obtain a transformant.

(Example 3) Fermentative preparation of novel IQ type compound The transformant obtained in Example 2 was inoculated into 10 ml of LB medium containing 50 µg / ml of ampicillin, and precultured by shaking overnight at 37 ° C. . The pre-cultured transformant was inoculated into LB medium containing 1 L of 50 μg / ml ampicillin and 0.1 mM IPTG, and further cultured at 37 ° C. for 24 hours. The supernatant was placed in a 500 ml culture tube and centrifuged at 8,000 rpm for 5 minutes. A total of 160 L of this was prepared.

(Example 4) Isolation of novel IQ type compound 0.6L of ethyl acetate per 1.6L of the supernatant obtained in Example 3 was extracted three times. The ethyl acetate extract was dissolved in 20% methanol, and the compound was separated using reverse-phase chromatography (“Cosmosil 75C18-PREP” manufactured by Nacalai Tesque) using water-containing methanol as an eluent. The active fraction whose AI activity was confirmed by the microorganism sensor used in Example 1 was subjected to gel filtration chromatography (“Sephadex LH-20” manufactured by GE Healthcare), and the compound was separated using methanol as an eluent. Subsequently, the obtained active fraction was subjected to gel filtration chromatography (“Sephadex LH-20” manufactured by GE Healthcare), and the compound was separated using 50% aqueous methanol as an eluent. The obtained active fraction was fractionated by the reverse phase high performance liquid chromatogram of the following conditions 1, 2 and 3 to obtain a novel IQ type compound.

The conditions of the reversed phase high performance liquid chromatogram are as follows.
Condition 1:
Column: Shodex GS-320 HQ (manufactured by Showa Denko, inner diameter 7.6 mm, length 30 cm),
Elution conditions: 60% to 100% methanol (0.2 v / v% acetic acid)
Flow rate: 0.6 mL / min,
Analysis time: 40 minutes
Detection wavelength: 254 nm,
Holding time: 33-35min

Condition 2:
Column: Cosmosil πNAP (manufactured by Nacalai Tesque, inner diameter 10 mm, length 25 cm)
Elution conditions: 10% to 100% methanol (0.2 v / v% acetic acid),
Flow rate: 2 mL / min,
Analysis time: 30 minutes
Detection wavelength: 254 nm,
Holding time: 22-24min

Condition 3:
Column: Cosmosil 5C18-MS-II (manufactured by Nacalai Tesque, inner diameter 10 mm, length 25 cm),
Elution conditions: 20% to 100% methanol (0.2 v / v% acetic acid),
Flow rate: 2 mL / min,
Analysis time: 40 minutes
Detection wavelength: 254 nm,
Holding time: 17.5min

Example 5 Chemical Synthesis of Novel IQ Type Compound-1
63 L of indigo in dimethyl sulfoxide (DMSO) (1 mg / mL) was kept at 80 ° C. for 3 to 7 days. Two times the amount of water was added thereto, and solid phase extraction was performed using a C18 carrier (manufactured by Nacalai Tesque, “Cosmosil 75C18-PREP”). The adsorbed fraction was eluted with methanol, concentrated, subjected to gel filtration column chromatography (GE Sephadex LH-20, manufactured by GE Healthcare), and the microorganism used in Example 1 using 50% aqueous methanol as an eluent. The fraction having AI activity was collected by a sensor. The obtained active fraction was subjected to silica gel column chromatography (“Wakogel-C200E” manufactured by Wako Pure Chemical Industries, Ltd.) using an hexane-ethyl acetate mixed solvent (1: 3) as an eluent. Subsequently, the obtained active fraction was purified by high performance liquid chromatography under the following conditions 1 and 2 to obtain a novel IQ type compound.

The conditions of the high performance liquid chromatogram are as follows.
Condition 1:
Column: Cosmosil πNAP (manufactured by Nacalai Tesque, inner diameter 10 mm, length 25 cm)
Elution conditions: 30% to 90% methanol (0.2 v / v% acetic acid),
Flow rate: 2 mL / min,
Analysis time: 40 minutes
Detection wavelength: 254 nm, 453 nm,
Holding time: 27.5 min

Condition 2:
Column: Develosil C30-UG5 (Nomura Chemical, inner diameter 10 mm, length 25 cm)
Elution conditions: 25% to 65% methanol,
Flow rate: 2 mL / min,
Analysis time: 40 minutes
Detection wavelength: 254 nm, 453 nm,
Holding time: 17.5min

Example 6 Chemical Synthesis of Novel IQ Type Compound-2
20 g of isatin was suspended in 2 L of water, 30 mL of 28% aqueous ammonia was added, and the mixture was reacted at room temperature for 3 hours. When isatin reacted completely and became a dark red solution, 30 mL of acetic acid was added for neutralization, and solid phase extraction was performed using a C18 carrier (manufactured by Nacalai Tesque, “Cosmosil 75C18-PREP”). Then, it operated like Example 5 and the novel IQ type compound was obtained.

Example 7 Chemical Synthesis of Novel IQ Type Compound-3
3 g of isatin was suspended in 30 mL of water, 200 μL of 1N aqueous sodium hydroxide solution was added, and the mixture was reacted at room temperature for 30 minutes. When isatin completely reacted and became a dark red solution, 1 mL of acetic acid was added to neutralize. A solution obtained by separately dissolving 3 g of isatin in 30 mL of methanol was added thereto, and the mixture was allowed to stand overnight at room temperature. 3 mL of 28% aqueous ammonia solution was added to the mixed solution, and the mixture was further allowed to stand at room temperature for 24 hours. Thereafter, 3 mL of acetic acid was added, and the mixture was concentrated to about 20 mL with an evaporator, and solid phase extraction was performed using a C18 carrier (manufactured by Nacalai Tesque, “Cosmosil 75C18-PREP”). Then, it operated like Example 5 and the novel IQ type compound was obtained.

(Example 8) Structure determination of novel IQ type compound The novel IQ type compound obtained in Example 5 was subjected to DMSO (d-) using a nuclear magnetic resonance apparatus (NMR) (manufactured by JEOL RESONANCE, "JNM-ECZS 400"). 6) Nuclear magnetic resonance spectra were obtained. The results of ¹ H-NMR are shown in FIG. 2 and Table 1, and the results of ¹³ C-NMR are shown in FIG. 3 and Table 1. In the lower part of Table 1, the basic skeleton and position number of the compound are shown. Further, mass analysis was performed using a high-resolution ESI-TOF mass spectrometer (ESI-TOF-MS) (manufactured by AB SCIEX, “TripleTOF 5600+”), and the molecular formula was determined as C ₁₆ H ₁₁ N ₃ O ₃ . The results are shown in FIG. From the chemical synthesis route of the new IQ type compound, the results of NMR, and the results of mass spectrometry, it was presumed to have a structure similar to methyl isotoid, which is a known compound. Therefore, referring to NMR of methyl isotoid, etc., various other two-dimensional NMR were measured (results not shown), and the structure of the novel IQ type compound finally obtained in Example 5 was 6-oxo-12-hydroxy- It was identified as 6,12-dihydroindolo [2,1-b] quinazoline-12-carboxamide.

The compounds obtained in Example 6 and Example 7 were also the same 6-oxo-12-hydroxy-6,12-dihydroindolo [2,1-b] quinazoline-12-carboxamide as the compound obtained in Example 5. I confirmed that there was.

Example 9
LC-MS analysis was performed on the novel IQ type compound prepared by fermentation of the transformant in Example 4. The results are shown in FIG. In addition, from the results of HPLC and TLC analysis (results not shown), it was confirmed that the compound obtained in Example 4 and the novel IQ type compound obtained in Example 5 had the same structure. Note that FIG. 5B shows the result of LC-MS analysis of the novel IQ compound obtained in Example 5.

(Example 10) Preparation of novel IQ type compound synthase gene derived from marine environment DNA derived from complex microorganisms is extracted from marine benthic invertebrates such as seawater, marine sediment, mudflat sand mud, sponge and sea squirt, and gel DNA having a size of about 40 kb was collected by electrophoresis. Using a fosmid vector pCC1Fos as a vector and Escherichia coli EPI300 as a host, a metagenomic library comprising the fractionated DNA clones was constructed. The fosmid DNA was randomly fragmented to about 3 kb with the restriction enzyme Sau3AI, then subcloned into a plasmid, and a subclone capable of producing indigo with a colony dark blue color was selected. Subsequently, the sequence of the DNA integrated into the indigo-producing subclone was determined, and the gene region was identified. Thus, the base sequence of MG79-12 (SEQ ID NO: 13), the base sequence of MG79-15 (SEQ ID NO: 14), the base sequence of MG79-16 (SEQ ID NO: 15), the base sequence of MG79-20 (SEQ ID NO: 16) Indole oxidase genes represented by the base sequence of MG92-5 (SEQ ID NO: 17) and the base sequence of MG92-6 (SEQ ID NO: 18) were prepared. These genes are derived from indigo-producing clones and are all genes that can produce indigo.

Example 11
Instead of the metagenomic library clone used in Example 1, the base sequence of MG79-12 (SEQ ID NO: 13), the base sequence of MG79-15 (SEQ ID NO: 14), and the base of MG79-16 prepared in Example 10 Of the indole oxidase represented by the sequence (SEQ ID NO: 15), the base sequence of MG79-20 (SEQ ID NO: 16), the base sequence of MG92-5 (SEQ ID NO: 17), and the base sequence of MG92-6 (SEQ ID NO: 18) Genes were introduced into plasmid vectors, and clones of each indole oxidase were prepared using Escherichia coli NEB-10β strain as a host. This was cultured with a microorganism sensor in the same manner as in Example 1, and the fluorescence intensity was measured at ex: 485 nm and em: 538 nm to evaluate AI activity. The results of AI activity of QssA, MG79-15, MG79-16, MG79-20, MG92-5, MG92-6 and the plasmid are shown in FIG. As shown in FIG. 6, AI activity was also observed by indole oxidases other than QssA. Although not shown, AI activity was also observed in MG79-12.

(Example 12)
The novel IQ type compound obtained in Example 5 was charged in sterile water at a concentration of 1.0 mg / ml, and diluted with compound concentrations of 0.1 ng / ml, 1 ng / ml, 10 ng / ml, 100 ng / ml, 1 μg / ml. Was prepared. The microorganism sensor used in Example 1 was added in a 9-fold amount together with the culture solution, cultured at 30 ° C. for 12 hours, and the luminescence intensity after the culture was measured at 480 nm. For comparison, the AHL compound 3-oxo-hexanoyl-homoserine lactone was used instead of the new IQ type compound, and the emission intensity was measured at 480 nm in the same manner. did. The results are shown in FIG. As shown in FIG. 7, the new IQ type compound had twice the emission intensity as compared with the AHL compound at final concentrations of 10 ng / ml and 100 ng / ml.

(Example 13)
The novel IQ type compound obtained in Example 5 was added to the culture solution of the marine microorganism Vibrio harveri so that the final concentrations were 0.1, 1, 10, 100 and 1000 ng / ml, and biofilm was added. The ability to form was evaluated. For comparison, the same treatment was performed using 3-oxohexanoyl-homoserine lactone, which is an AHL compound, instead of the novel IQ type compound. The culture was performed by standing at 25 ° C. for 24 hours. After incubation, staining and destaining were performed, and absorbance was measured at 595 nm. The results are shown in FIG. In FIG. 8, 0 ng / ml is the result of not adding a new IQ type compound. As shown in FIG. 8, the novel IQ type compound exhibited the ability to form a biofilm in the same manner as the AHL compound (3-oxohexanoyl-homoserine lactone).

(Example 14)
To the culture solution of Bacillus cereus, the novel IQ type compound obtained in Example 5 was added so as to have a final concentration of 1 μg / ml, and cultured at 30 ° C. for 12 hours. The supernatant was centrifuged, and the luminescence intensity of the supernatant was measured at 480 nm using the microorganism sensor used in Example 1. For comparison, an AHL compound (3-oxohexanoyl-homoserine lactone) was used instead of the novel IQ type compound, and the same operation was performed. The results are shown in FIG. 9 together with the results of the microorganism sensor, Bacillus cereus, the novel IQ type compound and the AHL compound alone. The novel IQ-type compound showed high luminescence intensity similar to that of the novel IQ-type compound alone after culturing with Bacillus cereus, and was shown to have high resistance to degradation by Bacillus cereus.

The present invention is capable of various embodiments and modifications without departing from the broad spirit and scope of the present invention. The above-described embodiments are for explaining the present invention and do not limit the scope of the present invention. In other words, the scope of the present invention is shown not by the embodiments but by the claims. Various modifications within the scope of the claims and within the scope of the equivalent invention are considered to be within the scope of the present invention.

The present invention is based on Japanese Patent Application No. 2016-252554 filed on Dec. 27, 2016. The specification, claims, and entire drawings of Japanese Patent Application No. 2016-252554 are incorporated herein by reference.

According to the present invention, there is provided a novel IQ type compound in which the action of regulating the pathogenic expression of microorganisms by the QS mechanism is noted. This compound is resistant to the biodegradability of microorganisms and is useful for controlling the QS mechanism in the fermentation field. Moreover, since it can be produced chemically or biologically, it can be supplied stably and is useful in various industrial fields.

Claims (14)

1. A novel indoloquinazoline type compound represented by the following formula (I).
   

   

   
   
   (In the formula, R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ may be the same or different from each other, hydrogen atom, hydroxyl group, carboxyl group, amino group, halogen atom. , An alkyl group (—R), an alkylamino group (—NRR ′), an alkoxy group (—OR), an acyl group (—COR), a carboxylic acid derivative (—COOR, —CONRR ′), or an alkylsilyl group (—SiRR) 'R "), and / or any two of R ¹ to R ⁴ and / or R ⁵ to R ⁸ are ring structures that include carbon atoms and / or atoms other than carbon and are bonded to each other. ^There, R ^{9, R 10} are optionally hydrogen atoms optionally the same as or different from each other, a hydroxyl group, a carboxyl group, an amino group, an alkyl group (-R), an alkylamino group (-NRR '), an alkoxy group (-O ), An acyl group (-COR), a or a carboxylic acid derivative (-COOR, -CONRR ^{'), R 11} represents a hydrogen atom, an alkyl group (-R), an acyl group (-COR), a or alkylsilyl group ( -SiRR′R ″), wherein R, R ′ and R ″ may be the same or different and each may contain an unsaturated bond and / or a substituent, and may be an alkyl group having 1 to 22 carbon atoms. .)
2. The novel indoloquinazoline-type compound according to claim 1, wherein the compound represented by the formula (I) is a compound represented by the following formula (II).
   

   
3. (A) the amino acid sequence shown in SEQ ID NO: 1,
   (B) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1, or (c) at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1. A novel indoloquinazoline-type compound synthase having a synthetic activity of a novel indoloquinazoline-type compound represented by the following formula (I):
   

   

   
   
   (In the formula, R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ may be the same or different from each other, hydrogen atom, hydroxyl group, carboxyl group, amino group, halogen atom. , An alkyl group (—R), an alkylamino group (—NRR ′), an alkoxy group (—OR), an acyl group (—COR), a carboxylic acid derivative (—COOR, —CONRR ′), or an alkylsilyl group (—SiRR) 'R "), and / or any two of R ¹ to R ⁴ and / or R ⁵ to R ⁸ are ring structures that include carbon atoms and / or atoms other than carbon and are bonded to each other. ^There, R ^{9, R 10} are optionally hydrogen atoms optionally the same as or different from each other, a hydroxyl group, a carboxyl group, an amino group, an alkyl group (-R), an alkylamino group (-NRR '), an alkoxy group (-O ), An acyl group (-COR), a or a carboxylic acid derivative (-COOR, -CONRR ^{'), R 11} represents a hydrogen atom, an alkyl group (-R), an acyl group (-COR), a or alkylsilyl group ( -SiRR′R ″), wherein R, R ′ and R ″ may be the same or different and each may contain an unsaturated bond and / or a substituent, and may be an alkyl group having 1 to 22 carbon atoms. .)
4. A nucleic acid encoding the novel indoloquinazoline-type compound synthase according to claim 3.
5. (A) the base sequence shown in SEQ ID NO: 9,
   (B) a base sequence that hybridizes with a complementary sequence of the base sequence shown in SEQ ID NO: 9 under stringent conditions, or
   (C) Synthetic activity of a novel indoloquinazoline type compound represented by the following formula (I), which includes any one of the nucleotide sequences represented by the nucleotide sequence shown in SEQ ID NO: 9 and having at least 90% identity A nucleic acid encoding a protein having
   

   

   
   
   (In the formula, R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ may be the same or different from each other, hydrogen atom, hydroxyl group, carboxyl group, amino group, halogen atom. , An alkyl group (—R), an alkylamino group (—NRR ′), an alkoxy group (—OR), an acyl group (—COR), a carboxylic acid derivative (—COOR, —CONRR ′), or an alkylsilyl group (—SiRR) 'R "), and / or any two of R ¹ to R ⁴ and / or R ⁵ to R ⁸ are ring structures that include carbon atoms and / or atoms other than carbon and are bonded to each other. ^There, R ^{9, R 10} are optionally hydrogen atoms optionally the same as or different from each other, a hydroxyl group, a carboxyl group, an amino group, an alkyl group (-R), an alkylamino group (-NRR '), an alkoxy group (-O ), An acyl group (-COR), a or a carboxylic acid derivative (-COOR, -CONRR ^{'), R 11} represents a hydrogen atom, an alkyl group (-R), an acyl group (-COR), a or alkylsilyl group ( -SiRR′R ″), wherein R, R ′ and R ″ may be the same or different and each may contain an unsaturated bond and / or a substituent, and may be an alkyl group having 1 to 22 carbon atoms. .)
6. A vector comprising the nucleic acid according to claim 4 or 5.
7. A transformant comprising the vector according to claim 6.
8. A novel indoloquinazoline-type compound, which comprises culturing the transformant according to claim 7 and collecting an enzyme that synthesizes a novel indoloquinazoline-type compound represented by the following formula (I) from the obtained culture: A method for producing a synthetic enzyme.
   

   

   
   
   (In the formula, R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ may be the same or different from each other, hydrogen atom, hydroxyl group, carboxyl group, amino group, halogen atom. , An alkyl group (—R), an alkylamino group (—NRR ′), an alkoxy group (—OR), an acyl group (—COR), a carboxylic acid derivative (—COOR, —CONRR ′), or an alkylsilyl group (—SiRR) 'R "), and / or any two of R ¹ to R ⁴ and / or R ⁵ to R ⁸ are ring structures that include carbon atoms and / or atoms other than carbon and are bonded to each other. ^There, R ^{9, R 10} are optionally hydrogen atoms optionally the same as or different from each other, a hydroxyl group, a carboxyl group, an amino group, an alkyl group (-R), an alkylamino group (-NRR '), an alkoxy group (-O ), An acyl group (-COR), a or a carboxylic acid derivative (-COOR, -CONRR ^{'), R 11} represents a hydrogen atom, an alkyl group (-R), an acyl group (-COR), a or alkylsilyl group ( -SiRR′R ″), wherein R, R ′ and R ″ may be the same or different and each may contain an unsaturated bond and / or a substituent, and may be an alkyl group having 1 to 22 carbon atoms. .)
9. A method for producing a novel indoloquinazoline-type compound represented by the following formula (I), wherein a transformant containing a vector containing a nucleic acid encoding an indole oxidase is cultured.
   

   

   
   
   (In the formula, R ¹ , R ² , R ³ , R ⁴ , R ⁵ , R ⁶ , R ⁷ , R ⁸ may be the same or different from each other, hydrogen atom, hydroxyl group, carboxyl group, amino group, halogen atom. , An alkyl group (—R), an alkylamino group (—NRR ′), an alkoxy group (—OR), an acyl group (—COR), a carboxylic acid derivative (—COOR, —CONRR ′), or an alkylsilyl group (—SiRR) 'R "), and / or any two of R ¹ to R ⁴ and / or R ⁵ to R ⁸ are ring structures that include carbon atoms and / or atoms other than carbon and are bonded to each other. ^There, R ^{9, R 10} are optionally hydrogen atoms optionally the same as or different from each other, a hydroxyl group, a carboxyl group, an amino group, an alkyl group (-R), an alkylamino group (-NRR '), an alkoxy group (-O ), An acyl group (-COR), a or a carboxylic acid derivative (-COOR, -CONRR ^{'), R 11} represents a hydrogen atom, an alkyl group (-R), an acyl group (-COR), a or alkylsilyl group ( -SiRR′R ″), wherein R, R ′ and R ″ may be the same or different and each may contain an unsaturated bond and / or a substituent, and may be an alkyl group having 1 to 22 carbon atoms. .)
10. 10. The production method according to claim 9, wherein the transformant is Escherichia coli transformed with a vector containing the nucleic acid according to claim 4 or 5.
11. A method for controlling a QS mechanism using the novel indoloquinazoline type compound according to claim 1.
12. Including a step of dehydrating and condensing an isatin compound represented by formula (IV) and an isatinic acid compound represented by formula (V) to obtain a dehydrated condensate, and adding an amine compound represented by formula (VI) to the dehydrated condensate The manufacturing method of the novel indoloquinazoline type compound of Claim 1.
    

    

    
    
    (Wherein R ¹ , R ² , R ³ and R ⁴ may be the same or different from each other, hydrogen atom, hydroxyl group, carboxyl group, amino group, halogen atom, alkyl group (—R), alkylamino group ( —NRR ′), alkoxy group (—OR), acyl group (—COR), carboxylic acid derivative (—COOR, —CONRR ′), or alkylsilyl group (—SiRR′R ″), and / or R ¹ to Any two of R ⁴ are ring structures formed by bonding to each other including a carbon atom and / or an atom other than carbon, and R ⁹ and R ¹⁰ may be the same or different hydrogen atoms, Hydroxyl group, carboxyl group, amino group, alkyl group (—R), alkylamino group (—NRR ′), alkoxy group (—OR), acyl group (—COR), or carboxylic acid derivative (—C OR, —CONRR ′), wherein R, R ′, and R ″ may be the same or different and each may contain an unsaturated bond and / or a substituent, and may be an alkyl group having 1 to 22 carbon atoms. .)
13. The isatin compound represented by the formula (IV), the isatinic acid compound represented by the formula (V) and the amine compound represented by the formula (VI) are added and reacted at a temperature of 10 to 50 ° C. A method for producing a novel indoloquinazoline type compound.
    

    
14. A method for producing a novel indoloquinazoline type compound represented by the following formula (II), wherein indigo is heated in dimethyl sulfoxide to a temperature of 60 to 140 ° C.
    

    

Images