WO2018119343A1 - Method for the microbial production of 8-methyl nonanoic acid - Google Patents
Method for the microbial production of 8-methyl nonanoic acid Download PDFInfo
- Publication number
- WO2018119343A1 WO2018119343A1 PCT/US2017/068085 US2017068085W WO2018119343A1 WO 2018119343 A1 WO2018119343 A1 WO 2018119343A1 US 2017068085 W US2017068085 W US 2017068085W WO 2018119343 A1 WO2018119343 A1 WO 2018119343A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- biosynthetic method
- cellular system
- biosynthetic
- seq
- transformed cellular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/32—Nucleotides having a condensed ring system containing a six-membered ring having two N-atoms in the same ring, e.g. purine nucleotides, nicotineamide-adenine dinucleotide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
- C12P7/6409—Fatty acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/02—Thioester hydrolases (3.1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y602/00—Ligases forming carbon-sulfur bonds (6.2)
- C12Y602/01—Acid-Thiol Ligases (6.2.1)
- C12Y602/01001—Acetate-CoA ligase (6.2.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
- C12Y208/03—CoA-transferases (2.8.3)
- C12Y208/03001—Propionate CoA-transferase (2.8.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
- C12Y208/03—CoA-transferases (2.8.3)
- C12Y208/03008—Acetate CoA-transferase (2.8.3.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/02—Thioester hydrolases (3.1.2)
- C12Y301/02014—Oleoyl-[acyl-carrier-protein] hydrolase (3.1.2.14), i.e. ACP-thioesterase
Definitions
- the field of the invention relates to methods and processes useful in the microbial production of 8-methyl nonanoic acid (CAS No. 5963-14-4) (hereinafter "8M"), an immediate precursor to capsaicin.
- 8M 8-methyl nonanoic acid
- the current disclosure provides a method to produce 8M in yields not possible in plant-based systems and the sequence for the FatB2 protein.
- the present disclosure provides a genetically modified E. coli strain that has been modified to biosynthesize 8M, a method of producing the genetically modified microorganism to produce 8M, and a production method to produce 8M in high yield and purity levels starting from a specific starting material.
- the KASIIIa, KASIIIb, FatB, and FatB2 genes were identified and characterized, including their involvement in the biosynthesis of 8M.
- the present disclosure is directed, in some embodiments, to a method for modifying a microbial strain to produce 8-methyl nonanoic acid (also known as "isocapric acid”), a desirable branched medium chain fatty acid compound in high yield, using a glucose or isobutyric acid as a feeding source depending on different pathways exploited for isobutryl-CoA formation for the microbial production strain.
- 8-methyl nonanoic acid also known as "isocapric acid”
- isocapric acid a desirable branched medium chain fatty acid compound in high yield
- Capsaicinoid compounds are the "spicy" components of hot peppers, and may be effective for preventing a number of pathologies by promoting energy metabolism, stimulating the central nervous system and helping in weight loss via activating lipolytic enzymes. In addition, these compounds can act to sterilize the Gastrointestinal tract, improve immunity when consumed and are also effective for activating immunity and relieving fatigue.
- the 8M compound is an essential intermediate and degradation product of CP (FIG. 1).
- Spiciness or pungency is a unique characteristic of hot peppers in the Capsicum genus that produce alkaloids called capsaicinoids. In nature, it is believed that capsaicinoids are present in plants to deter mammals from consuming their fruits and destroying seeds. Humans can sense capsaicinoids via a receptor structurally related to members of the transient receptor potential channels (or "TRP" family of ion channels).
- TRP transient receptor potential channels
- TRPV1 also referred to as the vanilloid TRP, vanilloid 1 Receptor or the TRPV1
- TRPV1 the capsaicin receptor
- This phenomenon may partially explain why humans can tolerate and even enjoy spicy foods, as pain sensors may be turned off after extensive exposure.
- Capsaicin (CP), 8-methyl-N-vanillyl-trans-6-nonenamide, and dihydrocapsaicin (DHCP)
- 8-methyl-N-vanillylnonanamide are the two major capsaicinoids typically found in plants together they are responsible for up to 90% of the pungency (Garces-Claver et al., 2007) of the pepper family. Relative to the current disclosure 8M is an immediate biosynthetic precursor to CP but is generally only available in vanishingly small amounts when sourced from plant-based materials.
- the capsaicin content of chili peppers ranges from 0.1 to 1% w/w (Govindarajan and Sathyanarayana 1991) and for many uses requires that methods be used to concentrate the CP and/or DHCP compounds for any industrial or commercial use. As for 8M, it significantly increases the yield of capsaicin when added to immobilized and freely suspended cells of C. frutescens but is almost impossible to extract in appreciable amounts from plant-based sources.
- capsaicinoids In addition to their primary use in food as an ingredient or minor additive, capsaicinoids have many pharmaceutical and medical uses. They have been found to exert a series of physiological and pharmacological effects, including analgesia, anticancer, anti-inflammatory, anti-oxidative and anti-obesity activities and are used as the main components of ointments, patches, oils and creams designed to relieve pain caused by several diseases such as vasomotor rhinitis, osteoarthritis and rheumatoid arthritis (Aza-Gonzalez et al., 2011). Capsaicinoids are currently used as the main active ingredient in self -protection aerosol sprays on the market (Reilly et al., 2001 popularly called "pepper spray").
- Capsicum genus includes over 20 species of peppers, from which C. annuum, C. frutescens, C. chinense, C. baccatum, and C. pubescens have been domesticated (Walsh and Hoot, 2001). There is wide genetic variation in pungency or spiciness levels across the various peppers, from which C. annuum, C. frutescens, C. chinense, C. baccatum, and C. pubescens have been domesticated (Walsh and Hoot, 2001). There is wide genetic variation in pungency or spiciness levels across the various
- Capsicum species due to varying levels and types of capsaicinoids present due to varying levels and types of capsaicinoids present.
- the non-pungent sweet bell pepper from C. annuum scored 0.0 SHU (Scoville Heat Unit; a scale that indicates the amount of capsaicin)
- the "Bhut Jolokia” or ghost chili is a hybrid between C. chinense and C. frutescens from Northeastern India, scored up to 1,001,304 SHUs (Bosland and Baral, 2007) (see Table 1).
- Table 1 Table 1
- capsaicin is synthesized by capsaicin synthase (CS/AT3/Punl), an acyltransferase that transfers the 8-methyl nonenoyl moiety from 8-methylnonenoyl-CoA to vanillylamine to form an amide conjugate (FIG. 1, Chen et al. 2015 and Ogawa et al. 2015).
- Vanillylamine is formed from the phenylpropanoid pathway whereas the branched-chain fatty acid is derived from a branched-chain amino acid, e.g. valine (Curry et al., 1999; Stewart et al. 2007; Mazourek et al., 2009).
- capsaicins Limitations in the production and use of capsaicins primarily stems from the prior need to extract it from plants. Typically, pure CP extracted from plants typically rates at approximately 16,000,000 Scoville units on the heat index and in this concentration can sell for over $5000 USD per gram (Batchelor, 2000)(see Table 1). However, the content of capsaicinoids actually present in hot peppers is generally very low and can be greatly affected by environmental and growth conditions leading to problems of sustainability and consistency.
- the production of 8M can help solve this issue through its use as a capsaicin content enhancer when incubated with intact C. frutescens cells as well as its direct use in various pharmacological and commercial formulations. According to the current disclosure, in some embodiments, the identification of genes related to the biosynthesis of 8M will help to increase capsaicinoid production through bioconversion in modified microbes.
- capsaicin extract is priced at about $5,000 per kilogram in the current international market with 1,200 tons of global annual production.
- the microbial fermentation and production methods of the current disclosure provide compounds produced by modified microbial strains that have the capability to produce products biologically in quantities useful for a variety of industries and research while doing so in a more natural fashion than organic chemical synthesis.
- the current disclosure provides for the production a medium chain (C8-C14) branched chain fatty acids which, if produced in volume, would provide a base for enhanced biofuels along with the other benefits provided herein.
- a component of the current disclosure is in the focus on microbial fatty acid biosynthesis with the aim to produce medium-chain fatty acids or derivatives thereof for use in the production of diesel.
- E. coli As an industrially important organism and with the best studied microbial fatty acid biosynthesis, E. coli has often been the organism of choice for studies into fatty acid biosynthesis. Plant-based production of fatty acids for fuel use is available but as world population grows a debate concerning the social and environmental consequences of the use of food and agricultural land for biofuel production has also grown. Relative to plant-based biofuel production the methods herein, in some embodiments, provide for the microbial production of medium chain (C8-C14) free fatty acids (FFA) useful in the production of biofuels. Such production would be beneficial for the quick production time and renewable nature. They also would avoid using agricultural land that could be otherwise occupied growing food for an increasing population.
- C8-C14 medium chain free fatty acids
- the current disclosure provides, in some embodiments, methods to produce 8M from a fermentation process in commercially relevant amounts.
- the present disclosure encompasses improved methods of producing 8-methyl nonanoic acid.
- the current disclosure provides, in some embodiments, a method to produce 8-methyl nonanoic acid in modified microbes that comprise a cellular system, such as yeast or bacteria.
- a microbial fermentation process is provided that synthesizes 8M.
- the cultures of the disclosure can produce 8M when the modified microbial strains are fed from natural precursors such as glucose or isobutyric acid.
- the identification of genes related to 8M production e. g. FatB and KASIII is also an essential part of this disclosure.
- an acyl-ACP thioesterase controls the chain length of fatty acid and is one of the key enzymes in 8M biosynthetic pathway.
- 8M-specific thioesterase has not been characterized thus far.
- Aluru et al. (2003), using a differential expression technique isolated a FatA gene (GenBank: AF318288.1) from pepper fruits and it was theorized that this thioesterase could be involved in 8M biosynthesis (FIG. 1, Stewart et al. 2007).
- Aluru et al. did not provide the biochemical activity of FatA and no study since has reported on this feature of FatA.
- FatB Another acyl-ACP thioesterase, FatB (GenBank: EU616562) from hot peppers. Likewise, FatB has not been previously characterized thus far and its role in 8M biosynthesis is still unknown. In this application, we reported the identification of a third acyl-ACP thioesterase gene from the genome of C. annuum L_Zunla-l (Qin et al. 2014) and named it FatB2 (NCBI Reference Sequence:
- FatB2 has 372 aa which contains 64 aa of signal peptide that designate it as chloroplast targeted. (See SEQ IDS NOs 1 through 5).
- the current method provides an approach for the development of a bacterial strain that can produce significant volumes of 8-methyl nonanoic acid by genetic modification and targeted feeding of specific starting molecules that are more cost effective and easier to obtain.
- the production of isobutyryl-CoA is the key intermediate. Once it is produced, KASIIIa/KASIIIb are involved in its elongation, the thioesterase (FatB/FatB2) controls the length of elongated fatty acids. 8M is produced after 3 rounds of elongation with the cutting by FatB/FatB2. (See SEQ IDS NOs 6 through 9). Additional rounds can be included to further elongate the fatty acids produced hereby.
- An embodiment of the present disclosure is a biosynthetic method of developing 8-methyl nonanoic acid by making isobutyryl-CoA from glucose or isobutyric acid.
- isobutyryl-CoA 1) de novo from glucose/pyruvate; 2) from ACS (AAE, acyl-CoA synthetase); and, 3) from PCT (propionate CoA-transferase).
- this intermediate is itself key to producing 8M microbially.
- the feeding of glucose to the cellular system comprises expressing the genes for de novo biosynthesis of isobutyryl-CoA in the cellular system, the feeding of isobutyric acid to the cellular system expressing a isobutyryl-CoA synthetase (ACS) gene or a propionate/isobutyrate-CoA transferase (PCT) gene.
- ACS isobutyryl-CoA synthetase
- PCT propionate/isobutyrate-CoA transferase
- the current disclosure provides, in part, three pathways for isobutyryl-CoA formation (see the publications cited below for additional pathway information) and thereafter the production of branched medium-chain fatty acids in engineered microbes:
- products containing capsaicin or close analogs such as 8M on the market in the United States and can be used in everything from analgesics to pest repellents as well as in foods and as an exercise supplement.
- Products containing 8M can be aerosols, liquids, or granular formulations.
- medium chain (C8 through C14) branched-chain fatty acids can be produced for use in biofuel production.
- These molecules are important in the development of biofuels as they enhance the operating temperature range of the fuel, especially with regard to developing fuels that have superior cold-flow properties.
- Single chain fatty acids (SCFAs) by contrast appear much easier to produce via microbial bioconversion.
- Cellular synthesis of both SCFAs and BCFAs requires the FabH enzyme that can catalyze condensation reactions between malonyl-ACP and a short-chain acyl- CoA.
- the disclosure provides a biosynthetic method of making the capsaicinoid 8-methyl nonanoic acid (8M) comprising (a) expressing KASIIIa, KASIIIb and a thioesterase in a transformed cellular system; (b) producing isobutryl-CoA in the transformed cellular system; and, (c) producing 8-methyl nonanoic acid.
- the thioesterase is FATB or FATB2.
- the KASIIIa is cloned from a plant of the Capsicum genus (e.g., ghost chili).
- the KASIIIb is cloned from a plant of the Capsicum genus (e.g., ghost chili).
- the thioesterase is FATB2 and it is cloned from a plant of the Capsicum genus (e.g., ghost chili).
- the thioesterase is FATB and it is cloned from a plant of the
- Capsicum genus e.g., ghost chili.
- the cellular system also comprises a glucose medium for the transformed cellular system. In some embodiments of the method, the cellular system also comprises a pyruvate medium for the transformed cellular system. In some embodiments of the method, the transformed cellular system further comprises acyl-CoA synthetase. In some embodiments of the method, the transformed cellular system further comprises propionate CoA transferase.
- the transformed cellular system is selected from the group including yeast, non-capsaicinoid producing plants, algae and bacteria.
- the cellular system is E. Coli. In some embodiments of the method, the cellular system is selected from the group consisting of bacteria, yeast, plant cells, animal cells, an in vitro translation system and a combination thereof. In some embodiments of the method, the transformed cellular system is a microbe culture of yeast or bacteria.
- the 8M is purified. In some embodiments of the method, the 8M is greater than 70% (e.g., greater than 70%, greater than 80%, greater than 90%, greater than 95%, greater than 98%, or greater than 99%) pure. In some embodiments of the method, the 8M content is greater than about 85% (e.g., greater than about 85%, greater than about 90%, greater than about 95%, greater than about 98%, greater than about 99%) by weight on a dry basis.
- step c) comprises: i) purifying crude product; and, ii) removing solvents under vacuum to provide a concentrated capsaicinoid product.
- the crude product is purified by column chromatography.
- the crude product is purified by acid-base extraction.
- the crude product is purified by vacuum distillation.
- the crude product is purified by semi-preparative HPLC.
- the disclosure provides a thioesterase gene having the nucleic acid sequence of SEQ ID NO. 5 or a nucleic acid sequence that is at least 80% (e.g., at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%) identical to SEQ ID NO. 5.
- the gene is in a host cell (e.g., a bacteria cell, a yeast cell, a plant cell, or an animal cell).
- the gene is in an E. coli cell.
- the disclosure provides a modified KasIIIa gene having the nucleic acid sequence of SEQ ID NO. 6 or a nucleic acid sequence that is at least 80% (e.g., at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%) identical to SEQ ID NO. 6.
- the gene is in a host cell (e.g., a bacteria cell, a yeast cell, a plant cell, or an animal cell).
- the gene is in an E. coli cell.
- the disclosure provides a modified KasIIIb gene having the nucleic acid sequence of SEQ ID NO. 7 or a nucleic acid sequence that is at least 80% (e.g., at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%) identical to SEQ ID NO. 7.
- the gene is in a host cell (e.g., a bacteria cell, a yeast cell, a plant cell, or an animal cell).
- the gene is in an E. coli cell.
- the disclosure provides a modified CCL4 gene having the nucleic acid sequence of SEQ ID NO. 8 or a nucleic acid sequence that is at least 80% (e.g., at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%) identical to SEQ ID NO. 8.
- the gene is in a host cell (e.g., a bacteria cell, a yeast cell, a plant cell, or an animal cell).
- the gene is in an E. coli cell.
- the disclosure provides a modified PCT gene having the nucleic acid sequence of SEQ ID NO. 9 or a nucleic acid sequence that is at least 80% (e.g., at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%) identical to SEQ ID NO. 9.
- the gene is in a host cell (e.g., a bacteria cell, a yeast cell, a plant cell, or an animal cell).
- the gene is in an E. coli cell.
- the disclosure provides a Fat2B protein having the amino acid sequence of SEQ ID NO. 2 or an amino acid sequence that is at least 80% (e.g., at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%) identical to SEQ ID NO. 2.
- the protein is in a host cell (e.g., a bacteria cell, a yeast cell, a plant cell, or an animal cell).
- the protein is in an E. coli cell.
- the disclosure provides a protein comprising an amino acid sequence derived from the translation the nucleic acid sequence of SEQ ID NO. 5.
- the protein is in a host cell (e.g., a bacteria cell, a yeast cell, a plant cell, or an animal cell).
- the protein is in an E. coli cell.
- the disclosure provides a biosynthetic method of making a medium chain
- BCFA branched-chain fatty acid
- branched chain fatty acid comprising (a) expressing KASIIIa, KASIIIb and a thioesterase in a transformed cellular system; (b) producing isobutryl-CoA in the transformed cellular system; and, (c) producing a C8 to C14 branched chain fatty acid.
- the branched chain fatty acid produced is used for biofuel production.
- the branched chain fatty acid produced is used in biofuel production and has enhanced cold flow properties.
- the method further comprises the use of FabH and isobuytyl-CoA to produce a fatty acid synthase (FAS) system for elongation of branched chain fatty acids.
- the method further comprises the feeding of a-ketoisovalerate or a sodium salt thereof to the transformed cellular system to express 8M.
- the method further comprises expressing bkd in the transformed cellular system.
- the method further comprises the feeding of isobutyric acid and/or salts thereof to the transformed cellular system to express 8M.
- the method further comprises expressing CCL4 in the transformed cellular system.
- the method further comprises the feeding of isobutyric acid and/or salts thereof to the transformed cellular system to express 8M. In some embodiments of the method, the method further comprises expressing PCT in the transformed cellular system. In some embodiments of the method, the method further comprises the feeding of isobutyric acid and/or salts thereof to the transformed cellular system to express 8M. In some embodiments of the method, the method further comprises expressing alsS, ilvC, ilvD and bkd in the transformed cellular system.
- the transformed cellular system is selected from the group including yeast, non-capsaicinoid producing plants, algae and bacteria.
- the cellular system is E. Coli. In some embodiments of the method, the cellular system is selected from the group consisting of bacteria, yeast, plant cells, animal cells, an in vitro translation system and a combination thereof. In some embodiments of the method, the transformed cellular system is a microbe culture of yeast or bacteria.
- the branched chain fatty acid and/or 8M is purified.
- the branched chain fatty acid and/or 8M is greater than 70% (e.g., greater than 70%, greater than 80%, greater than 90%, greater than 95%, greater than 98%, or greater than 99%) pure. In some embodiments of the method, the branched chain fatty acid and/or 8M content is greater than about 85% (e.g., greater than about 85%, greater than about 90%, greater than about 95%, greater than about 98%, greater than about 99%) by weight on a dry basis.
- step c) comprises: i) purifying crude product; and, ii) removing solvents under vacuum to provide a concentrated branched chain fatty acid and/or 8M product.
- the crude product is purified by column chromatography.
- the crude product is purified by acid-base extraction.
- the crude product is purified by vacuum distillation.
- the crude product is purified by semi- preparative HPLC.
- the cellular system in some embodiments, it is selected from the group consisting of bacteria, yeast, and a combination thereof, or any cellular system that would allow the genetic transformation with the selected genes and thereafter the biosynthetic production of the desired 8- methyl nonanoic acid from a feeding of glucose (de novo pathway) or isobutyric acid (ACS or PCT pathway) precursors.
- glucose de novo pathway
- ACS isobutyric acid
- E. coli is used to produce the desired 8M. While the disclosure is susceptible to various modifications and alternative forms, specific embodiments thereof are shown by way of example in the drawings and will herein be described in detail.
- FIG. 1 The Capsaicinoid Biosynthetic Pathway.
- the aminotransferase (pAMT) catalyzes the formation of vanillyamine from vanillin.
- Pal phenylalanine ammonia lyase
- Ca4H cinnamic acid 4-hydroxylase
- 4CL 4-coumarate CoA ligase
- HCT hydroxycinnamoyl transferase
- C3H coumaroyl shikimate/quinate 3-hydroxylase
- COMT caffeic acid O-methyltransferase
- pAMT aminotransferase
- BCAT branched-chain amino acid transferase
- Kas 3-keto-acyl ACP synthase
- ACL acyl carrier protein
- Fat acyl-ACP thioesterase
- ACS acyl-CoA synthetase
- CS capsaicin synthase (Stewart C et al. 2007, J. Exp
- FIG. 2 The activities of purified FatA (TE1, left bar of each pair of bars) and FatB (TE2, right bar of each pair of bars) proteins against various acyl-CoAs.
- Acyl-CoAs were purchased from Sigma (St Louis, MO).
- the activity of thioesterase (TE) was assayed in 100 mM Tris buffer, pH7.5 containing 100 mg/L of acyl-CoA and 5 ⁇ of purified enzyme at 30°C. Free CoA and acyl- CoAs were analyzed by HPLC. HPLC was performed with Dionex - UltiMate® 3000 LC
- the gradient elution procedure was as follows: 0 to 5 min, 5% of B; 5 to 9 min, a linear gradient from 5 to 80% of B; 9 to 1 1 min, 80% of B; 1 1 to 12 min, 5% of B.
- the flow rate was 0.6 ml/min.
- the diode array detector collected data in the 200- to 400-nm range. For detection and quantification of substrate and products, peak areas were measured at 257 nm. Due to the unavailability of commercial acyl-ACPs, various acyl-CoAs from Sigma were used as the substrates of thioesterases.
- FIG. 3 GC/MS analysis of supernatants from IPTG-induced BL21(DE3) cultures.
- GC/MS analysis of supernatants from IPTG-induced BL21(DE3) cultures CK, BL21(DE3) with the empty vector; TEl, FatA; TE2, FatB; TE3, FatB2.
- the cultures were grown at 16°C after the induction by 1 mM IPTG and one day later, fatty acids were extracted from the supernatants.
- FIG. 4 Cis-5-dodecenoic acid (CAS No. 2430-94-6).
- FIG. 5 Production of 8M in strains with different FabH genes.
- KBsB and KSaB are two positive controls (Jiang et al. 2015). The experiment was performed in triplicate.
- FIG. 6. MS spectra of putative 8M peak and 8M standard and GC profile of 8M Standard. The lower spectrum is the library match.
- FIG. 7. Production of 8M in strains with CCL4, FaB2 and different FabH genes. BBA,
- KAS Illb KAS Illb
- ABA KAS Ilia
- BsBAl FabH2 from Bacillus subtilis 168
- SaBA FabH from
- Staphylococcus aureus The experiment was performed in triplicate.
- FIG. 8 De Novo production of 8M in E. coli.
- Colored genes are those engineered ones. alsS and bkd are from Bacillus subtilis 168; ilvC and ilvD are from E. coli; KAS IIIa/KAS Illb and FatB/FatB2 are from hot peppers. This figure was adapted from FIG. 1 of Jiang et al. (2015). (See SEQ IDS NOs 1 through 7).
- Capsaicin or CP is a colorless irritant phenolic amide C 18 H 27 NO 3 and is one of a series of phenolic amides found in various Capsicum species and hybrids thereof that gives hot peppers their hotness or pungency and that is used for food, medicine, and security applications.
- Pure CP is a volatile, hydrophobic, colorless, odorless, crystalline to waxy compound.
- Capsaicinoid as used herein this refers to a class of irritant compounds, related to
- Capsaicin that are responsible for the heat of chili peppers. They are irritants for mammals, including humans, and produce a sensation of burning in any tissue with which they come into contact.
- the capsaicinoids including 8M are produced as secondary metabolites by chili peppers, probably as deterrents against certain mammals and fungi.
- Cellular system is any cells that provide for the expression of ectopic proteins. It includes bacteria, yeast, plant cells and animal cells. It includes both prokaryotic and eukaryotic cells. It also includes the in vitro expression of proteins based on cellular components, such as ribosomes. Fatty Acids, C8-C14. According to the current disclosure a variety of fatty acids can be used as starting source materials.
- the source materials include vanillin, vanillylamine or their derivatives with modifications at the aromatic ring such as methylation, ethylation, or glycosylation; and more particularly 8-14 carbon straight chain or branched chain fatty acids or their derivatives such as hydroxy fatty acids (Ex: Octanoic acid; Nonanoic acid; Decanoic acid; Undecanoic acid; and, Dodecanoic acid) can be straight chain fatty acids or branched chain fatty acids and be used to make the 8-methyl nonanoic acid of the current disclosure.
- Growing the Cellular System includes providing an appropriate medium that would allow cells to multiply and divide. It also includes providing resources so that cells or cellular components can translate and make recombinant proteins.
- Protein production can occur after gene expression. It consists of the stages after DNA has been transcribed to messenger RNA (mRNA). The mRNA is then translated into polypeptide chains, which are ultimately folded into proteins. DNA is present in the cells through transfection - a process of deliberately introducing nucleic acids into cells.
- the term is often used for non-viral methods in eukaryotic cells. It may also refer to other methods and cell types, although other terms are preferred: "transformation" is more often used to describe non-viral DNA transfer in bacteria, non-animal eukaryotic cells, including plant cells. In animal cells, transfection is the preferred term as transformation is also used to refer to progression to a cancerous state (carcinogenesis) in these cells. Transduction is often used to describe virus- mediated DNA transfer. Transformation, transduction, and viral infection are included under the definition of transfection for this application.
- yeast as claimed herein are eukaryotic, single- celled microorganisms classified as members of the fungus kingdom. Yeast are unicellular organisms which evolved from multicellular ancestors but with some species useful for the current disclosure being those that can develop multicellular characteristics by forming strings of connected budding cells known as pseudo hyphae or false hyphae.
- COMT caffeic acid O-methyltransferase
- AMT aminotransferase
- ACL acyl carrier protein
- the present disclosure provides, in part, a microbial fermentation system for the production of 8M.
- an acyl-ACP thioesterase controls the chain length of fatty acid and is one of the key enzymes in 8M biosynthetic pathway.
- 8M-spectic thioesterase has not been characterized so far.
- Aluru et al. (2003), based on differential expression, once isolated FatA gene (GenBank: AF318288.1) from pepper fruits and people tend to believe this thioesterase is involved in 8M biosynthesis (FIG. 1, Stewart et al. 2007).
- the biochemical activity of FatA has not been reported so far. Using bioinformatics tools, Mazourek et al.
- FatB Another acyl-ACP thioesterase, FatB (GenBank: EU616562) from hot peppers.
- FatB has not been characterized so far and its role in 8M biosynthesis is still unknown.
- FatB2 NCBI Reference Sequence: XM_016708605.1.
- FatB2 has 372 aa which contains 64 aa of signal peptide for chloroplast targeting. (See SEQ IDS NOs 1 through 5).
- the 8M produced herein was synthesized in modified E. coli cultures that were modified to carry the KASIIIa/KASIIIb and FatB/FatB2 genes from hot peppers and other genes related to the production of isobutyryl-CoA. (See SEQ IDS NOs 1 through 6). Isobutyryl-CoA could be generated de novo from glucose by the overexpression of alsS, ilvC, ilvD and bkd genes.
- isobutyryl-CoA could be produced from fed isobutyric acid by the overexpression of an ACS (isobutyryl-CoA synthetase) or a PCT (propionate CoA-transferase) gene. These genes allowed the properly fed selected strains to synthesize the 8-methyl nonanoic acid (FIG. 8).
- Capsaicinoids have long been used as an experimental tool because of their selective action on the small diameter afferent nerve fibers C-fibers and A-delta fibers that are believed to signal pain. From studies in animals, capsaicinoids appears to trigger C-fiber membrane depolarization by opening cation channels permeable to calcium and sodium. Recently one of the receptors for capsaicinoid effects has been cloned.
- vanillylamine is formed from phenylalanine via ferulic acid, vanillin and related compounds, and capsaicinoid is produced from vanillyamine and branched chain fatty acid by capsaicin synthase (FIG. 1).
- Exemplary capsaicinoids include, but are not limited to: nonivamide, N- vanillylnonanamides, N-vanillylsulfonamides, N-vanillylureas, N-vanillylcarbamates,
- phenyl)methyl]alkanamides N[(substituted phenyl)methyl]-cis-monosaturated alkenamides, N[(substituted phenyl)methyl]diunsaturated amides, 8M, 3-hydroxyacetanilide,
- hydroxyphenylacetamides pseudocapsaicin, dihydrocapsaicin, nordihydrocapsaicin, homocapsaicin, homodihydrocapsaicin I, anandamide, piperine, zingerone, warburganal, polygodial, aframodial, cinnamodial, cinnamosmolide, cinnamolide, civamde, nonivamide, olvanil, N-oleyl-homovanillamidia, isovelleral, scalaradial, ancistrodial, and any combinations or mixtures thereof.
- Nucleic acid hybridization is a technique well known to those of skill in the art of DNA manipulation.
- the hybridization properties of a given pair of nucleic acids are an indication of their similarity or identity.
- hybridization refers generally to the ability of nucleic acid molecules to join via complementary base strand pairing. Such hybridization may occur when nucleic acid molecules are contacted under appropriate conditions. "Specifically hybridizes” refers to the ability of two nucleic acid molecules to form an anti-parallel, double- stranded nucleic acid structure. A nucleic acid molecule is said to be the "complement” of another nucleic acid molecule if they exhibit “complete complementarity,” i.e., each nucleotide in one sequence is complementary to its base pairing partner nucleotide in another sequence.
- Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional "low- stringency” conditions. Similarly, the molecules are said to be “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional "high-stringency” conditions.
- Nucleic acid molecules that hybridize to other nucleic acid molecules, e.g., at least under low stringency conditions are said to be “hybridizable cognates" of the other nucleic acid molecules. Conventional low stringency and high stringency conditions are described herein and by Sambrook et al., MOLECULAR CLONING, A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Press, Cold Spring Harbor, New York (1989) and by
- Low stringency conditions may be used to select nucleic acid sequences with lower sequence identities to a target nucleic acid sequence.
- High stringency conditions may be used to select for nucleic acid sequences with higher degrees of identity to the disclosed nucleic acid sequences (Sambrook et al., 1989).
- High stringency conditions typically involve nucleic acid hybridization in about 2X to about 10X SSC (diluted from a 20X SSC stock solution containing 3 M sodium chloride and 0.3 M sodium citrate, pH 7.0 in distilled water), about 2.5X to about 5X Denhardt's solution (diluted from a 50X stock solution containing 1% (w/v) bovine serum albumin, 1% (w/v) ficoll, and 1% (w/v) polyvinylpyrrolidone in distilled water), about 10 mg/mL to about 100 mg/mL fish sperm DNA, and about 0.02% (w/v) to about 0.1% (w/v) SDS, with an incubation at about 50°C to about 70°C for several hours to overnight.
- 10X SSC diluted from a 20X SSC stock solution containing 3 M sodium chloride and 0.3 M sodium citrate, pH 7.0 in distilled water
- about 2.5X to about 5X Denhardt's solution diluted from a 50X stock solution containing
- High stringency conditions are preferably provided by 6X SSC, 5X Denhardt's solution, 100 mg/mL fish sperm DNA, and 0.1% (w/v) SDS, with an incubation at 55°C for several hours. Hybridization is generally followed by several wash steps.
- the wash compositions generally comprise 0.5X to about 10X SSC, and 0.01% (w/v) to about 0.5% (w/v) SDS with a 15 minute incubation at about 20°C to about 70°C.
- the nucleic acid segments remain hybridized after washing at least one time in 0.1X SSC at 65°C.
- sequence identity refers to the extent to which two optimally aligned polynucleotide or peptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids.
- An "identity fraction" for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence.
- percent sequence identity refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (“query”) polynucleotide molecule (or its complementary strand) as compared to a test ("subject”) polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the window of comparison).
- Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and preferably by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG® Wisconsin Package® (Accelrys Inc., Burlington, MA).
- An "identity fraction" for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence.
- Percent sequence identity is represented as the identity fraction multiplied by 100.
- the comparison of one or more polynucleotide sequences may be to a full-length polynucleotide sequence or a portion thereof, or to a longer polynucleotide sequence.
- percent identity may also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.
- the percent of sequence identity is preferably determined using the "Best Fit” or "Gap” program of the Sequence Analysis Software PackageTM (Version 10; Genetics Computer Group, Inc., Madison, WI). "Gap” utilizes the algorithm of Needleman and Wunsch (Needleman and Wunsch, JOURNAL OF MOLECULAR BIOLOGY 48:443-453, 1970) to find the alignment of two sequences that maximizes the number of matches and minimizes the number of gaps.
- “BestFit” performs an optimal alignment of the best segment of similarity between two sequences and inserts gaps to maximize the number of matches using the local homology algorithm of Smith and Waterman (Smith and Waterman, ADVANCES IN APPLIED MATHEMATICS, 2:482-489, 1981, Smith et al., NUCLEIC ACIDS RESEARCH 11:2205-2220, 1983). The percent identity is most preferably determined using the "Best Fit” program.
- BLAST Basic Local Alignment Search Tool
- the term "substantial percent sequence identity” refers to a percent sequence identity of at least about 70% sequence identity, at least about 80% sequence identity, at least about 85% identity, at least about 90% sequence identity, or even greater sequence identity, such as about 98% or about 99% sequence identity.
- one embodiment of the disclosure is a polynucleotide molecule that has at least about 70% sequence identity, at least about 80% sequence identity, at least about 85% identity, at least about 90% sequence identity, or even greater sequence identity, such as about 98% or about 99% sequence identity with a
- Polynucleotide molecules that have the activity of the ACS and CS genes of the current disclosure are capable of directing the production of a variety of capsaicinoids and have a substantial percent sequence identity to the polynucleotide sequences provided herein and are encompassed within the scope of this disclosure.
- Homology refers to the level of similarity between two or more nucleic acid or amino acid sequences in terms of percent of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of similar functional properties among different nucleic acids or proteins.
- the nucleic acid molecule comprises a nucleic acid sequence that exhibits 70% or greater identity, and more preferably at least 80 or greater, 85 or greater, 87 or greater, 88 or greater, 89 or greater, 90 or greater, 91 or greater, 92 or greater, 93 or greater, 94 or greater, 95 or greater, 96 or greater, 97 or greater, 98 or greater, or 99% or greater identity to a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1 through and SEQ ID NO: 9 or any other nucleic acid sequence described herein, any complements thereof, any fragments thereof, or any cis elements thereof.
- the nucleic acid molecule preferably comprises a nucleic acid sequence that exhibits a 75% or greater sequence identity with a polynucleotide selected from the group consisting of SEQ ID NO: 1 through and SEQ ID NO: 9 or any other nucleic acid sequence described herein, any complements thereof, any fragments thereof, or any cis elements thereof.
- the nucleic acid molecule more preferably comprises a nucleic acid sequence that exhibits an 80% or greater sequence identity with a polynucleotide selected from the group consisting of SEQ ID NO: 1 through SEQ ID NO: 9 or any other nucleic acid sequence described herein, any complements thereof, any fragments thereof, or any cis elements thereof.
- the nucleic acid molecule most preferably comprises a nucleic acid sequence that exhibits an 85% or greater sequence identity with a polynucleotide selected from the group consisting of SEQ ID NO: 1 through SEQ ID NO: 9 or any other nucleic acid sequence described herein, any complements thereof, any fragments thereof, or any cis elements thereof.
- percent identity may also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences.
- the presently disclosed corn genomic promoter sequences comprise nucleic acid molecules or fragments having a BLAST score of more than 200, preferably a BLAST score of more than 300, and even more preferably a BLAST score of more than 400 with their respective homologues.
- the efficiency of heterologous protein production in a microbial system can be enhanced by codon changes that alter the DNA sequences to one that may be preferred by the cellular system being used for expression but that varies from the original gene source organism without changing the eventual polypeptide produced.
- Approaches normally used to overcome this problem include targeted mutagenesis to remove rare codons or the addition of rare codon tRNAs in specific cell lines to move towards a codon sequence preferred by a host organism that will produce the polypeptide of interest.
- Identity is the fraction of amino acids that are the same between a pair of sequences after an alignment of the sequences (which can be done using only sequence information or structural information or some other information, but usually it is based on sequence information alone), and similarity is the score assigned based on an alignment using some similarity matrix.
- the similarity index can be any one of the following BLOSUM62, PAM250, or GONNET, or any matrix used by one skilled in the art for the sequence alignment of proteins.
- Identity is the degree of correspondence between two sub-sequences (no gaps between the sequences). An identity of 25% or higher implies similarity of function, while 18- 25% implies similarity of structure or function. Keep in mind that two completely unrelated or random sequences (that are greater than 100 residues) can have higher than 20% identity. Similarity is the degree of resemblance between two sequences when they are compared. This is dependent on their identity.
- FatA (TE1 in FIG. 2) is a long chain acyl-CoA thioesterase whereas FatB prefers medium chain acyl-CoAs (TE2 in FIG. 2). It seems that FatB rather than FatA is involved in 8M biosynthesis. This conclusion is supported by the analysis of fatty acid composition in cell cultures (FIG. 3). Peak 1 was identified as cis-5 dodecenoic acid (FIG. 4) by the comparison of this retention time and mass spectrum with that of cis-5 dodecenoic acid standard from Sigma. As shown in FIG. 3, cis-5-dodecenoic acid is produced by FatB and FatB2 confirming involvement in 8M production.
- KAS III ⁇ -ketoacyl-ACP synthase III, FabH catalyzes the condensation of acetyl-CoA and malonyl-CoA, an initial step in fatty acid biosynthetic pathway whereas KAS I is involved in fatty acid elongation.
- a KAS III enzyme In 8M biosynthetic pathway, a KAS III enzyme must be able to accept isobutyryl-CoA as a substrate (FIG. 1).
- such an enzyme has not been identified in the plant kingdom although the bacterial KASIII enzymes using isobutyryl-CoA as a substrate have been well characterized (Howard et al. 2013; Suner et al. 2014; Jiang et al. 2015; Tao et al. 2015; Bentley et al. 2016).
- the synthesized genes were cloned into pRSFDuet-1 vector (Kan+) and transformed into BL21(DE3) containing pCDFDuet-FatB or pCDFDuet-FatB2 for in vivo studies.
- CCL4 gene (GenBank: AGA17921.1) from Humulus lupulus was synthesized with codon optimization against E. coli genome.
- CCL4 encodes an isobutyryl-CoA synthetase which converts isobutyric acid into isobutyryl-CoA (Xu et al., 2013).
- CCL4 was cloned into pETDuet-1 vector (AMP+) and CCL4 was co-expressed with KAS IIIa/KAS Illb and FatB/FatB2 in BL21(DE3). After IPTG-induction, upon the feeding of lg/L of isobutyric acid, 8M was produced (FIG. 7).
- the SEQ IDS NOs 6 and 7 represent optimized KAS nucleic acid sequences from hot peppers.
- KAS Ilia (EU616569) and KAS Illb (EU616570) are genes from hot peppers.
- PCT gene (NCBI Reference Sequence: WP_014015705.1) from Megasphaera elsdenii was synthesized with codon optimization against E. coli genome.
- PCT encodes an acetate CoA-transferase which converts isobutyric acid and acetyl-CoA into isobutyryl-CoA and acetate (McMahon and Prather, 2014).
- PCT was cloned into pETDuet-1 vector (AMP+) and PCT was co-expressed with KAS IIIa/KAS Illb and FatB/FatB2 in
- isobutyryl-CoA As described above, to produce 8M, applicants first used three methods to make isobutyryl-CoA namely, de novo, ACS (AAE) or PCT pathways. Then isobutyryl-CoA was used by KAS Ilia or KAS Illb for entering fatty acid elongation cycles of microbial host e.g. E. coli. After three rounds of elongation, 8M was released by FatB or FatB2.
- pRSFDuet-1 was used to express KAS Ilia or KAS Illb; pCDFDuet-1 was used to express FatB or FatB2; pETDuet-1 was used to express ACS (AAE) or PCT; pACYCDuet was used to express ilvC and ilvD; pETDuet to express bkd; pRSFDuet-1 to express alsS and KAS Ilia. (See SEQ IDS Nos 1 through 9).
- the transformed culture in BL21star(DE3) was induced by IPTG.
- lg/L of isobutyric acid was fed into the culture. Fatty acids were extracted with ethyl acetate and methylated with 2.5% sulfuric acid in methanol. Methyl esters of fatty acids were extracted with hexanes and analyzed by GC/MS.
- GC/MS was used to analyze fatty acid composition after the methylation.
- GC/MS analysis was conducted on Shimadzu GC-2010 system, which with GCMS-QP2010S detector analytical column is: SHRXI-5MS (Thickness 0.25um; length30m; diameter0.25mm), injection temperature 265 0 C. Injection mode was split, furnace temperature 50 0 C, the temperature gradient: 0-4 min 50 0 C; 4-7.3 min 50 0 C -100 0 C, a gradient of 15; 7.3-15.3 min, 100 0 C -260 0 C, a gradient of 20.
- the identity and presence of the 8M compound in the fermentation product was confirmed by comparing its retention time and mass spectrum with those of an 8M standard purchased from Cayman Chemical (Ann Arbor, MI). They were identical.
- the culture system had a titer of ca. 1 mg/L.
- cultures from glycerol stock of the E. coli BL21(DE3) strain overexpressing ACS or PCT, KASIIIa or KASIIIb, and FatB or FatB2 were streaked on LB (AMP+Kan+Spect+) plates and incubated at 37° C overnight. Single colonies were picked to inoculate 5 ml of LB (AMP+Kan+Spect+) liquid medium and the cultures were shaken at 250 rpm at 37 0 C overnight. 20 ml of LB
- AMP+Kan+Spect+ liquid medium were inoculated with 2% of overnight culture and the culture were shaken at 250 rpm at 37 0 C until OD600 reached 0.6 (usually 3 hours). Then the cultures were cooled down to 30 0 C and 1 mM IPTG was added to induce protein expression. Three hours later, 1 g/L of isobutyric acid was added and samples were taken for 8M analysis.
- 0.5 ml culture was extracted with 0.5 ml ethyl acetate with shaking for 30 minutes. After centrifugation at 14,000 rpm for 10 min, 100 ⁇ of ethyl acetate phase were transfer to a glass tube and dried over nitrogen gas. 1ml of 2.5% sulfuric acid in methonal and the tube was incubated in a 65°C water bath for 60 min. Then 2 ml of 0.9% NaCl and 2 ml of hexanes were added to extract methyl esters of fatty acids. After centrifugation at 2500 rpm for 10 min, the hexane phase was injected into GC/MS for the analysis of 8M concentrations as described above.
- This disclosure has applicability in the food, medicinal, and pharmacological industries.
- This disclosure relates generally to a method for the biosynthetic production of 8-methyl nonanoic acid via a modified microbial strain.
- FatB2 -TP CGTTCTTACGAAATTGGTCCGGACAAAACCGCGACGATGGAAACCAT
- PRODUCTS 59: 425-26.
- Flagan S .F. Utilization of capsaicin and vanillylamine as growth substrates by Capsicum (hot pepper)-associated bacteria, ENV. MICROBIOLOGY 8(3) 560-65 (2006).
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- Oil, Petroleum & Natural Gas (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Botany (AREA)
- Nutrition Science (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2019534344A JP6986084B2 (ja) | 2016-12-22 | 2017-12-22 | 8−メチルノナン酸の微生物生成方法 |
| CN201780079774.XA CN110291194B (zh) | 2016-12-22 | 2017-12-22 | 用于微生物生产8-甲基壬酸的方法 |
| EP17882749.9A EP3559219A4 (en) | 2016-12-22 | 2017-12-22 | PROCESS FOR THE MICROBIAL PRODUCTION OF 8-METHYL NONANOIC ACID |
| US16/444,305 US10793881B2 (en) | 2016-12-22 | 2019-06-18 | Method for the microbial production of 8-methyl nonanoic acid |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662437792P | 2016-12-22 | 2016-12-22 | |
| US62/437,792 | 2016-12-22 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/444,305 Continuation US10793881B2 (en) | 2016-12-22 | 2019-06-18 | Method for the microbial production of 8-methyl nonanoic acid |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2018119343A1 true WO2018119343A1 (en) | 2018-06-28 |
Family
ID=62627726
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/068085 Ceased WO2018119343A1 (en) | 2016-12-22 | 2017-12-22 | Method for the microbial production of 8-methyl nonanoic acid |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US10793881B2 (https=) |
| EP (1) | EP3559219A4 (https=) |
| JP (1) | JP6986084B2 (https=) |
| CN (1) | CN110291194B (https=) |
| WO (1) | WO2018119343A1 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10655150B2 (en) | 2016-01-07 | 2020-05-19 | Conagen Inc. | Methods of making capsinoids by biosynthetic processes |
| US11459591B2 (en) | 2016-07-19 | 2022-10-04 | Conagen Inc. | Method for the microbial production of specific natural capsaicinoids |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317555B (zh) * | 2021-12-29 | 2024-06-28 | 衡阳市蔬菜研究所 | 三樟黄贡椒叶绿体基因组及其应用 |
| CN115960736B (zh) * | 2023-03-01 | 2024-05-28 | 石河子大学 | 一种产香草胺和辣椒碱的酿酒酵母工程菌及其构建方法与应用 |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4493848A (en) | 1983-07-14 | 1985-01-15 | The Procter & Gamble Company | Compositions and methods useful for producing analgesia |
| US5094782A (en) | 1990-12-24 | 1992-03-10 | National Science Council Of Republic Of China | Synthesis of capsacin derivatives and their use as an analgesic drug and vessel dilation drug |
| US20030145350A1 (en) * | 2000-01-12 | 2003-07-31 | Friedrich Spener | Method for increasing the content of fatty acids in plants and micro-organisms |
| US20130005003A1 (en) * | 2007-12-11 | 2013-01-03 | Synthetic Genomics, Inc. | Secretion of Fatty Acids by Photosynthetic Microorganisms |
| US20130029387A1 (en) * | 2011-07-27 | 2013-01-31 | Iowa State University Research Foundation, Inc. | Materials and methods for using an acyl-acyl carrier protein thioesterase and mutants and chimeras thereof in fatty acid synthesis |
| US20160138061A1 (en) * | 2014-11-17 | 2016-05-19 | Evonik Degussa Gmbh | Fatty acid and derivatives production |
| US20160168603A1 (en) * | 2013-01-23 | 2016-06-16 | Omegachea Biorenewables Llc | Materials and methods for production of bi-functional fatty acids in recombinant bacteria |
| US9371549B2 (en) * | 2012-07-13 | 2016-06-21 | Calysta, Inc. | Biorefinery system, methods and compositions thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105705650A (zh) * | 2013-08-28 | 2016-06-22 | 英威达技术有限责任公司 | 用于生物合成异丁烯酸盐的方法 |
| CN104404059B (zh) * | 2014-11-05 | 2017-05-24 | 中国科学院遗传与发育生物学研究所 | 用于制备β‑苦味酸的基因及其应用 |
-
2017
- 2017-12-22 WO PCT/US2017/068085 patent/WO2018119343A1/en not_active Ceased
- 2017-12-22 CN CN201780079774.XA patent/CN110291194B/zh active Active
- 2017-12-22 JP JP2019534344A patent/JP6986084B2/ja active Active
- 2017-12-22 EP EP17882749.9A patent/EP3559219A4/en active Pending
-
2019
- 2019-06-18 US US16/444,305 patent/US10793881B2/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4493848A (en) | 1983-07-14 | 1985-01-15 | The Procter & Gamble Company | Compositions and methods useful for producing analgesia |
| US5094782A (en) | 1990-12-24 | 1992-03-10 | National Science Council Of Republic Of China | Synthesis of capsacin derivatives and their use as an analgesic drug and vessel dilation drug |
| US20030145350A1 (en) * | 2000-01-12 | 2003-07-31 | Friedrich Spener | Method for increasing the content of fatty acids in plants and micro-organisms |
| US20130005003A1 (en) * | 2007-12-11 | 2013-01-03 | Synthetic Genomics, Inc. | Secretion of Fatty Acids by Photosynthetic Microorganisms |
| US20130029387A1 (en) * | 2011-07-27 | 2013-01-31 | Iowa State University Research Foundation, Inc. | Materials and methods for using an acyl-acyl carrier protein thioesterase and mutants and chimeras thereof in fatty acid synthesis |
| US9371549B2 (en) * | 2012-07-13 | 2016-06-21 | Calysta, Inc. | Biorefinery system, methods and compositions thereof |
| US20160168603A1 (en) * | 2013-01-23 | 2016-06-16 | Omegachea Biorenewables Llc | Materials and methods for production of bi-functional fatty acids in recombinant bacteria |
| US20160138061A1 (en) * | 2014-11-17 | 2016-05-19 | Evonik Degussa Gmbh | Fatty acid and derivatives production |
Non-Patent Citations (15)
| Title |
|---|
| ALURU M. ET AL.: "Differential expression of fatty acid synthase genes, Acl, Fat and Kas, in Capsicum fruit", J EXPBOT., vol. 54, no. 388, 2003, pages 1655 - 64 |
| ANONYMOUS: "S.O.C. Medium - Catalog No. 15544-034", INVITROGEN , 2002, pages 1, XP009515419 * |
| ASHRAFI, H ET AL.: "De novo assembly of the pepper transcriptome (Capsicum annuum): a benchmark for in silico discovery of SNPs, SSRs and candidate genes", BMC GENOMICS, vol. 13, no. 571, 30 October 2012 (2012-10-30), pages 1 - 15, XP021134724, ISSN: 1471-2164, DOI: 10.1186/1471-2164-13-571 * |
| AZA-GONZALEZ C.: "Molecular biology of capsaicinoid biosynthesis in chili pepper (Capsicum spp.)", PLANT CELL REP, vol. 30, 2011, pages 695 - 706, XP055336530, DOI: 10.1007/s00299-010-0968-8 |
| BELZA A, JESSEN AB: "Bioactive food stimulants of sympathetic activity: effect on 24-h energy expenditure and fat oxidation", EMT J CLIN NUTR., vol. 59, 2005, pages 733 - 41, XP037766329, DOI: 10.1038/sj.ejcn.1602121 |
| BENTLEY G.J. ET AL.: "Engineering Escherichia coli to produce branchedchain fatty acids in high percentages", METAB ENG, vol. 38, 2016, pages 148 - 58, XP055557153, DOI: 10.1016/j.ymben.2016.07.003 |
| KOZIK, A ET AL.: "CLPY5434.b1_C15.ab1 CLP(XYZ) lettuce perennis Lactuca perennis cDNA clone CLPY5434, mRNA sequence", 6 October 2006 (2006-10-06), XP055612260, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/nuccore/DW094259.1?report=gbwithparts&log$=seqview> * |
| MAZOUREK, M ET AL.: "A Dynamic Interface for Capsaicinoid Systems Biology", BIOINFORMATICS, vol. 150, no. 4, 1 August 2009 (2009-08-01), pages 1806 - 1821, XP055016385, ISSN: 0032-0889, DOI: 10.1104/pp.109.136549 * |
| QIN, C ET AL.: "Whole-genome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE USA., vol. 111, no. 14, 8 April 2014 (2014-04-08), pages 5135 - 5140, XP055446995, ISSN: 0027-8424, DOI: 10.1073/pnas.1400975111 * |
| See also references of EP3559219A4 |
| SIMBAQUEBA, J ET AL.: "Development and Characterization of Microsatellite Markers for the Cape Gooseberry Physalis peruvian a", PLOS ONE, vol. 6, no. 10, e26719, 21 October 2011 (2011-10-21), pages 2, XP055612263, DOI: 10.1371/journal.pone.0026719 * |
| STEWART C ET AL., J. EXP. BOT., vol. 58, 2007, pages 979 - 991 |
| YAO: "Supercritical carbon dioxide extraction of Scotch Bonnet (Capsicum annuum) and quantification of capsaicin and dihydrocapsaicin", J. AGR. FOOD CHEM., vol. 42, 1994, pages 1303 - 05, XP000453336, DOI: 10.1021/jf00042a010 |
| ZHANG ET AL., METABOLIC ENGINEERING, vol. 13, 2011, pages 713 - 722 |
| ZHANG: "Efficient free fatty acid production in Escherichia coli using plant acyl-ACP thioesterases", METABOLIC. ENG., vol. 13, pages 713 - 722 |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10655150B2 (en) | 2016-01-07 | 2020-05-19 | Conagen Inc. | Methods of making capsinoids by biosynthetic processes |
| US11459591B2 (en) | 2016-07-19 | 2022-10-04 | Conagen Inc. | Method for the microbial production of specific natural capsaicinoids |
| US11946083B2 (en) | 2016-07-19 | 2024-04-02 | Conagen Inc. | Method for the microbial production of specific natural capsaicinoids |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3559219A4 (en) | 2020-09-09 |
| US10793881B2 (en) | 2020-10-06 |
| JP2020503024A (ja) | 2020-01-30 |
| JP6986084B2 (ja) | 2021-12-22 |
| CN110291194B (zh) | 2024-11-22 |
| CN110291194A (zh) | 2019-09-27 |
| EP3559219A1 (en) | 2019-10-30 |
| US20190390231A1 (en) | 2019-12-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11946083B2 (en) | Method for the microbial production of specific natural capsaicinoids | |
| US10793881B2 (en) | Method for the microbial production of 8-methyl nonanoic acid | |
| Alber et al. | Study of an alternate glyoxylate cycle for acetate assimilation by Rhodobacter sphaeroides | |
| Xu et al. | Characterization of the formation of branched short-chain fatty acid: CoAs for bitter acid biosynthesis in hop glandular trichomes | |
| CN106456588B (zh) | 使用辣椒素合酶用于辣椒素类物质微生物生产的方法 | |
| Liang et al. | A novel process for obtaining pinosylvin using combinatorial bioengineering in Escherichia coli | |
| Wang et al. | Enhanced production of β-alanine through co-expressing two different subtypes of l-aspartate-α-decarboxylase | |
| Yan et al. | Functional characterization and catalytic activity improvement of BAHD acyltransferase from Celastrus angulatus Maxim | |
| US11142756B2 (en) | Acetyl-CoA carboxylase variants | |
| CN111094558A (zh) | 对产生中链脂肪酸衍生物具有改善的活性的硫酯酶变体 | |
| US20120015414A1 (en) | Production of organic compounds | |
| Haghighat Kashani | Evaluating E. coli as a Chassis for the Production of Capsaicinoids and Capsinoids | |
| HK1232126B (zh) | 使用辣椒素合酶用於辣椒素类物质微生物生产的方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17882749 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2019534344 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2017882749 Country of ref document: EP Effective date: 20190722 |