WO2018115885A1 - Anticorps contre les caroténoïdes - Google Patents

Anticorps contre les caroténoïdes Download PDF

Info

Publication number
WO2018115885A1
WO2018115885A1 PCT/GB2017/053860 GB2017053860W WO2018115885A1 WO 2018115885 A1 WO2018115885 A1 WO 2018115885A1 GB 2017053860 W GB2017053860 W GB 2017053860W WO 2018115885 A1 WO2018115885 A1 WO 2018115885A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
carotenoid
lycopene
carotene
binding fragment
Prior art date
Application number
PCT/GB2017/053860
Other languages
English (en)
Inventor
Ivan M Petyaev
Valery TSYBEZOV
Nailya ZIGANGIROVA
Yuriy Bashmakov
Original Assignee
Ip Science Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB1622197.0A external-priority patent/GB201622197D0/en
Priority claimed from GBGB1714644.0A external-priority patent/GB201714644D0/en
Application filed by Ip Science Limited filed Critical Ip Science Limited
Publication of WO2018115885A1 publication Critical patent/WO2018115885A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/01—Hydrocarbons
    • A61K31/015—Hydrocarbons carbocyclic
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/01—Hydrocarbons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/065—Diphenyl-substituted acyclic alcohols
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/12—Ketones
    • A61K31/122—Ketones having the oxygen directly attached to a ring, e.g. quinones, vitamin K1, anthralin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/16—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from plants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • the present invention relates to antibodies against carotenoids, particularly against carotenes such as lycopene or xanthophylls such as lutein.
  • the invention also relates to assays for carotenoids, particularly against carotenes such as lycopene or xanthophylls such as lutein, wherein the assays employ the use of such antibodies.
  • the invention also relates to immunocomplexes comprising carotenoids and antibodies, and the use of such immunocomplexes in facilitating the delivery of carotenoids and/or cargo molecules to a specific cell, cell compartment or tissue and/or increasing the activity or bioavailability of bioactive molecules, agents or drugs.
  • Carotenoids are a class of tetraterpenoids which contain long polyene chains.
  • Carotenoids include carotenes, such as beta-carotene, alpha-carotene, zeto-carotene, and lycopene and related molecules.
  • Carotenoids also include xanthophylls such as lutein, meso-zeaxanthin, zeaxanthin and astaxanthin.
  • lycopene Unlike plants, animals are mostly incapable of synthesizing carotenoids, and must obtain them through their diet. For example, some carotenes such as lycopene are categorized as non-essential nutrients, but their dietary intake is important at all stages of human life. In particular, decreased plasma levels of lycopene are associated with the progression of and poor clinical outcomes for cardiovascular disease, diabetes and various types of cancer. There is also evidence that even excessive consumption of lycopene-containing food products may be insufficient to achieve high plasma lycopene levels due to the poor bioavailability of lycopene, especially in people with metabolic syndrome and those who are over approximately 50 years old. This may explain why the plasma level of lycopene has a higher prognostic value for health status than lycopene representation in the diet.
  • the invention relates to the development of new antibodies, particularly monoclonal antibodies, against carotenoids.
  • the invention relates to the development of new antibodies, particularly monoclonal antibodies, against xanthophylls such as lutein, meso-zeaxanthin or zeaxanthin.
  • xanthophylls such as lutein, meso-zeaxanthin or zeaxanthin.
  • the invention relates to the development of new antibodies, particularly monoclonal antibodies, against carotenes such as lycopene, beta carotene or alpha carotene.
  • the development of the antibodies of the invention has allowed the development of new analytic and diagnostic tools for the quantification of carotenoids in biological specimens. Moreover, use of these antibodies in new diagnostic and, in particular, point of care tests, allows more effective prevention and correction of carotenoid deficiencies.
  • the development of the antibodies of the invention has allowed the development of immunocomplexes of carotenoids and antibodies, which can be used to increase the activity or bioavailability and/or facilitate the delivery of carotenoids and/or cargo molecules to a specific cell, cell compartment or tissue.
  • the antibodies initiate or stimulate (i.e. increase) the intracellular activity of the carotenoid.
  • the antibodies of the invention and related methods are therefore important tools for personalized nutrition in support of, for example, the cardiovascular system, cancer prevention and healthy ageing, and treatment of conditions and diseases associated with carotenoid deficiencies.
  • the invention provides: - An antibody against a carotenoid or an antigen binding fragment of such an antibody.
  • a method of detecting a carotenoid in a sample comprising: (a) contacting a sample to be tested with an antibody against the carotenoid or an antigen binding fragment of such an antibody; and
  • a method of diagnosing or monitoring a carotenoid deficiency or condition associated with the carotenoid deficiency in an individual comprising detecting or measuring a carotenoid in a sample from the individual by any method described herein.
  • a method of treating or preventing a carotenoid deficiency in an individual in need thereof comprising (i) detecting or measuring a carotenoid in a sample from the individual by any method described herein, and (ii), if suitable, administering a composition comprising the carotenoid to the individual and thereby treating or preventing the carotenoid deficiency.
  • An immunoassay plate comprising present on the plate any antibody or antigen- binding fragment as defined herein.
  • a cell line producing an antibody against a carotenoid.
  • a method of producing an antibody against a carotenoid comprising culturing any cell line as defined herein under conditions allowing for production of the antibody and recovering the antibody.
  • a kit for detecting or measuring a carotenoid where the kit comprises any antibody or antigen-binding fragment as defined herein.
  • An immunocomplex comprising a carotenoid or derivative thereof and an
  • An immunocomplex as defined herein for use in a method of facilitating the delivery of a carotenoid or derivative thereof and/or a cargo molecule to a specific cell, cell compartment or tissue.
  • An immunocomplex as defined herein for use in a method of specific tissue and cellular delivery and/or increasing the activity or bioavailability of bioactive molecules, agents and drugs.
  • An immunocomplex as defined herein for use in a method of treating or preventing an inherited or acquired pathology or disease.
  • An immunocomplex as defined herein for use in a method of initiating or stimulating intracellular activity of a carotenoid for use in a method of initiating or stimulating intracellular activity of a carotenoid.
  • Figure 1 shows the antibody titer in immunized mice (#1, #2 and #3) belonging to the 5 th immunization group of Table 1.
  • One of the immunized mice (#3) had a distinctive antibody titer (1 : 1600) and was used for the subsequent fusion procedure.
  • an alternating immunization schedule which includes injection of both
  • Figure 2 shows the comparison of ascitic fluids from the 6B9, 4F10, 4A3 and 3B12 clones by ELISA.
  • the 6B9 and 4A3 clones had the best ability to produce Mab against lycopene.
  • Figure 3 shows that lycopene, but not lutein, is specifically detected by 6B9
  • Figure 6 Difference in character and intensity of the staining by in antibody based lycopene detection assay between a control glass slide and one covered with lycopene.
  • Figure 7 Illustration of the score system (1, 2, 3 or 4) to quantify lycopene in material collected from the surface of a skin of an individual.
  • Panel A sebum or intercellular space.
  • Panel B skin exfoliated cells.
  • Figure 10 The full amino acid (AA) sequence of both the light (238 AA) and heavy (634AA) chains of the lycopene-specific monoclonal antibody 6B9 with variable (V-region, underlined) and constant (C-region, not underlined).
  • Figure 11 The amino acid composition pattern of the light and heavy chains of the lycopene-specific monoclonal antibody 6B9.
  • Figure 13 The position of disulfide bonds in the 6B9 heavy chain.
  • Figure 14 Clustal W alignment of the light chain of the 6B9 and A43 lycopene- specific monoclonal antibodies.
  • Figure 15 Clustal W alignment of the heavy chain of the 6B9 and A43 lycopene-specific monoclonal antibodies.
  • Figure 16 The predicted amino acid composition pattern of the light and heavy chains of the lycopene-specific monoclonal antibody A43, based on sequence homology with the lycopene-specific monoclonal antibody 6B9 with variable (V-region, underlined) and constant (C-region, not underlined).
  • FIG. 18 A. Propeller-shaped carotenoid molecule.
  • the propeller 13 molecule contains a benzene ring hub and three C30-carotenoid molecules as blades.
  • B. A typical dendrimer structure, comprising a central core and radially branched dendrons.
  • FIG. 19 Phospholipid-carotenoid complexes. A - phospholipid molecule, B - carotenoid molecule.
  • FIG. 20 Immunofluorescent staining of McCoy cells infected with C.
  • B10.MLM cells after 40 hours Left hand panel - lycopene only. Right hand panel - immunocomplex of lycopene and antibody.
  • B10.MLM cells after 40 hours Upper left panel - control. Upper right panel - +anti- lycopene antibodies. Lower left panel - + lycopene. Lower right panel - +lycopene- antibody complex.
  • a and/or B is to be taken as specific disclosure of each of (i) A, (ii) B and (iii) A and B, just as if each is set out individually herein. Anywhere herein where a compound is referred to, if a salt of such compound may also be employed, that is also encompassed in the invention, particularly the use of such physiological acceptable salts. Where a given entity is referred to herein for use in a particular method, the method itself is also provided as is use of the entity in the manufacture of a medicament for use in such a method. All documents mentioned herein are incorporated by reference in their entirety and also in the specific context they are being discussed herein.
  • the present invention is based on the provision of antibodies against carotenoids.
  • the invention provides antibodies, particularly monoclonal antibodies, against xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin.
  • the invention provides antibodies, particularly monoclonal antibodies, against carotenes such as lycopene.
  • the invention also provides an assay for carotenoids, particularly an assay for carotenes such as lycopene or an assay for xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin.
  • the assay of the invention employs the use of the antibodies of the invention.
  • the assays of the invention are more cost-effective, faster and significantly more affordable than the conventionally employed High Performance Liquid Chromatography Mass Spectroscopy (HPLC-MS).
  • HPLC-MS High Performance Liquid Chromatography Mass Spectroscopy
  • high performance liquid chromatography remains the preserve of specialized laboratories, whereas antibody-based assays may readily be performed and are far more accessible.
  • the provision of antibody based tests of the invention means the detection of
  • carotenoids is far more affordable and easily performed, and therefore may no longer need to rely on expensive and time-consuming HPLC-MS based analysis.
  • carotenoids, particularly carotenes such as lycopene do not elicit any immunogenic specific response on their own. Immunization without adjuvant therefore resulted in very low titers of antibodies against the carotenoid, particularly against carotenes such as lycopene.
  • carotenes such as lycopene do not contain any polar groups, so no charged or radical group can serve as a chemical anchor for binding to any conjugate protein, without disrupting the specific structure of the carotene.
  • any increase in dosage of the adjuvant immunogen in such immunization experiments to try to increase the titer of antibodies resulted in early death of the test animals, before they could be used for further development of the antibodies.
  • the inventors developed nonstandard immunization protocols and found a particular regimen to be particularly effective. Instead of using protein-bound conjugates for immunization, the inventors managed to absorb carotenoids, particularly carotenes such as lycopene or xanthophylls such as lutein, onto the surface of gold colloid particles, leaving the structure of the carotenoids intact.
  • an immunization schedule further involving the alternating use of adjuvant.
  • an immunization schedule including only a single injection of (i) the carotenoid, particularly the carotene such as lycopene, absorbed to the surface of gold colloid particles, and (ii) the adjuvant in particular was found to allow the isolation of mice positive for the anti -carotenoid, particular the anti-carotene such as anti-lycopene antibodies.
  • Hybridomas were selected at an early stage of immunization for the fusion reaction, and clones were identified which produced antibodies against the carotenoid, particularly against the carotene such as lycopene. Of these, all antibodies were IgM, likely due to the selection at an early stage of immunization. Clones producing IgM antibodies are often unstable. However, despite this, using their approach the inventors managed to maintain hybridoma cell lines. Of these, the inventors have identified hybridoma produced antibodies that are both highly stable and highly specific for only one carotenoid and in particular for only one carotene such as lycopene.
  • the inventors have employed lycopene as an illustrative example of the approach provided for a carotene.
  • the inventors have also employed lutein as an illustrative example of the approach provided for a xanthophyll.
  • the methods of the invention are generally applicable to any carotenoid, particularly any other carotene such as beta carotene or alpha carotene or any other xanthophyll such as astaxanthin, meso-zeaxanthin or zeaxanthin.
  • the antibodies produced have high analytical value in the detection of specific carotenoids, and in particular high analytical value in the detection of specific carotenes such as lycopene, beta carotene or alpha carotene or specific xanthophyll s such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin.
  • the inventors have also surprisingly demonstrated it is possible to isolate a hybridoma giving rise to antibodies with a particularly useful ability to further visualize the distribution of specific carotenoids in situ within cells and tissues in vitro or in vivo.
  • the inventors have demonstrated the intracellular localization of carotenoids, particularly carotenes such as lycopene, in intact cells using such antibodies.
  • the development of such antibodies has allowed, for example, the development of further diagnostic tests for carotenoid deficiency, particularly carotene deficiency such as lycopene deficiency and associated conditions, as well as other assays for carotenoids, particularly carotenes such as lycopene, which are far more accessible, simpler and cheaper than conventional HPLC approaches.
  • Such an approach may be employed for any carotenoid, particularly any carotene or any xanthophyll such as lutein, meso-zeaxanthin, astaxanthin or zeaxanthin.
  • the use of the antibodies of the invention has also allowed new analytical and diagnostic tools or assays which simply cannot be performed by HPLC approaches.
  • the antibodies of the invention allow the immunochemical or immuno-histological detection and quantification of specific carotenoids, particularly specific carotenes such as lycopene or specific xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, in situ within cells and tissues.
  • the antibodies of the invention allow the localisation and distribution of a specific carotenoid to be visualized and/or quantified, particularly a specific carotene such as lycopene or specific xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, within its natural setting within cells and/or tissue.
  • a specific carotene such as lycopene or specific xanthophyll
  • lutein astaxanthin
  • meso-zeaxanthin or zeaxanthin within its natural setting within cells and/or tissue.
  • chemical analysis techniques such as HPLC
  • biological samples need to be treated by organic solvents in order to extract carotenoids. This procedure would inevitable destroy the structural architecture of the cells and tissues being analysed.
  • Chemical analysis techniques such as HPLC are therefore not suitable for immunochemical or immuno-histological analysis.
  • the sensitivity of immunochemical assays such as immunofluorescence is typically 100 to 1000 fold higher than chemical analysis techniques such as HPLC.
  • the amount of sample required for the measurement of carotenoids, particularly carotenes such as lycopene or xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, using the antibodies of the invention may be significantly less than the amount that is required for any chemical analysis.
  • chemical analysis techniques are not suitable for non-invasive procedures where only a small amount of sample is obtained such as the collection of material from the surface of the skin or from swabs.
  • the antibodies of the invention have allowed the detection and quantification of carotenoids, particularly carotenes such as lycopene, in tissue prints.
  • Such tissue prints may be collected non-invasively by the mere pressing of, for example, a slide against the skin of an individual.
  • the development of the antibodies of the invention has opened up new applications where existing techniques cannot be used, such as the non-invasive diagnosis of carotenoid deficiency or associated conditions, or the non-invasive determination of the efficacy of treatment of carotenoid deficiency or associated conditions.
  • the invention provides antibodies against any one or more carotenoids.
  • Carotenoids are a class of tetraterpenoids which contain long polyene chains.
  • the invention provides antibodies, particularly monoclonal antibodies, against one or more xanthophylls.
  • the xanthophyll is lutein, astaxanthin, meso-zeaxanthin, zeaxanthin or astaxanthin.
  • the invention provides antibodies, particularly monoclonal antibodies, against one or more carotenes.
  • the carotene is beta-carotene, alpha-carotene, zeto-carotene or lycopene or a related molecule, including l-HO-3', 4'-didehydrolycopene, 3, ⁇ -( ⁇ )2 -gamma- carotene, l, l'-(HO)2-3, 4, 3', 4'-tetradehydrolycopene, 1, l'-(HO)2-3, 4- didehydrolycopene.
  • Carotenes are typically defined by the absence of oxygen atoms.
  • carotenoid compounds include hydrocarbons, such as lycopersene
  • glycosides such as oscillaxanthin (2,2'-bis(P-l-rhamnopyranosyloxy)-3,4,3',4'- tetradehydro-l,2, ,2'-tetrahydro-Y,Y-carotene-l, l'-diol), and phleixanthophyll (1'-( ⁇ - ⁇ - glucopyranosyloxy)-3',4'-didehydro- ,2'-dihydro-P,Y-caroten-2'-ol); ethers, such as rhodovibrin ( 1 '-methoxy-3 ',4'-didehydro- 1,2,1 ',2'-tetrahydro-Y,Y-caroten- 1 -ol) and spheroidene (l-methoxy-3,4-didehydro-l,2,7',8'-tetrahydro-Y,Y-carotene
  • mutatoxanthin citroxanthin, zeaxanthin (furanoxide 5,8-epoxy-5,8-dihydro-P,P- carotene-3,3'-diol), neochrome (5',8'-epoxy-6,7-didehydro-5,6,5',8'-tetrahydro-P,P- carotene-3,5,3'-triol), foliachrome, trollichrome, and vaucheriaxanthin (5',6'-epoxy-6,7- didehydro-5,6,5',6'-tetrahydro-P,P-carotene-3,5,19,3'-tetrol); aldehydes, such as rhodopinal, wamingone ( 13 -ci s- 1 -hydroxy- 1 ,2-dihy dro-Y,Y-caroten-20-al),
  • tomlarhodinaldehyde (3',4'-didehydro-P,Y-caroten-16'-al); acids and acid esters, such as torularhodin (3',4'-didehydro-P,Y-caroten-16'-oic acid) and torularhodin methyl ester (methyl 3',4'-didehydro-P,Y-caroten-16'-oate); ketones, such as astaxanthin,
  • canthaxanthin (aka aphanicin), chlorellaxanthin (P,P-carotene-4,4'-dione), capsanthin ((3r,3's,5'r)-3,3'-dihydroxy-P,K-caroten-6'-one), capsorubin ((3s,5r,3's,5'r)-3,3'- dihydroxy-K,K-carotene-6,6'-dione), cryptocapsin ((3'r,5'r)-3'-hydroxy-P,K-caroten-6'- one), 2,2'-diketospirilloxanthin (1,1 '-dimethoxy-3 ,4,3 ',4'-tetradehydro- 1 ,2, ⁇ ,2'- tetrahydro-Y,Y-carotene-2,2'-dione), flexixanthin (3, -dihydroxy-3',4'-didehydro- ,2'- di
  • decaprenoxanthin (2,2'-bis(4-hydroxy-3-methyl-2-butenyl)-e,e-carotene), c.p. 450 (2-[4- hydroxy-3-(hydroxymethyl)-2-butenyl]-2'-(3-methyl-2-butenyl)-b,b-carotene), c.p.
  • the antibody of the invention may be against any one or more carotenoids, particularly against any one or more
  • xanthophylls typically lutein, astaxanthin, meso-zeaxanthin or zeaxanthin.
  • the antibody of the invention is against any one or more carotenes, typically lycopene.
  • the antibodies of the invention specifically bind to a single carotenoid, i.e. one type of carotenoid only or preferentially bind to a single carotenoid, such as with, for instance, ten, twenty, one hundred or one thousand fold greater affinity for the specific carotenoid than others.
  • an antibody against lutein binds specifically to any lutein, but does not specifically bind to any other carotenoid such as astaxanthin, meso- zeaxanthin, zeaxanthin, lycopene, beta-carotene, alpha-carotene or zeto-carotene.
  • an antibody against astaxanthin binds specifically to any astaxanthin, but does not specifically bind to any other carotenoid such as lutein, meso-zeaxanthin, zeaxanthin, lycopene, beta-carotene, alpha-carotene or zeto-carotene.
  • an antibody against meso-zeaxanthin binds specifically to any meso-zeaxanthin, but does not specifically bind to any other carotenoid such as lutein, astaxanthin, zeaxanthin, lycopene, beta-carotene, alpha- carotene or zeto-carotene.
  • an antibody against zeaxanthin binds specifically to any zeaxanthin, but does not specifically bind to any other carotenoid such as lutein, meso-zeaxanthin, astaxanthin, lycopene, beta-carotene, alpha-carotene or zeto-carotene.
  • the antibody is against lycopene.
  • An antibody against lycopene preferably specifically binds to any lycopene, but does not specifically bind to any other carotenoid such as beta-carotene, alpha-carotene, zeto- carotene, lutein, meso-zeaxanthin, astaxanthin or zeaxanthin.
  • Lycopene is an open-chain unsaturated C40 carotenoid of structure I (Chemical Abstracts Service Registry Number 502-65-8).
  • Lycopene occurs naturally in plants such as tomatoes, guava, rosehip, watermelon and pink grapefruit. Lycopene as described herein may comprise one or more different isomers. For example, lycopene may comprise at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%), or at least 95% (Z)-isomers, (all-E)-isomers, or cz ' s-isomers, such as 5-cis- or 9-cis- or 13-c/s-isomers, which have improved bioavailability relative to trans isomers. Trans isomers may isomerise into cis forms in vivo, or during storage and processing. As discussed below, the antibodies of the invention are highly specific for both cis and trans forms of lycopene.
  • Lycopene may be natural i.e., obtained from a natural source, for example, extracted from a plant, such as a tomato or melon.
  • a natural source for example, extracted from a plant, such as a tomato or melon.
  • a range of methods for extracting, concentrating and/or purifying lycopene from plants are known in the art. For example, solvent extraction using ethanol, DMSO, ethyl acetate, hexane, acetone, soya or other vegetable oil, or non-vegetable oils may be employed.
  • Lycopene may be isolated i.e. free or substantially free of other molecules found in its natural source or environment.
  • the antibodies of the invention are highly specific for natural forms of lycopene.
  • Lycopene as described herein may be synthetic i.e. produced by artificial means, for example, by chemical synthesis or fermentation.
  • a range of methods for chemical synthesis of lycopene are known in the art.
  • a three-stage chemical synthesis based on the standard Wittig olefination reaction scheme for carotenoid synthesis may be employed, in which an organic solution of C 15 phosphonium
  • DCM dichlorom ethane
  • Cio dialdehyde in toluene an organic solution of Cio dialdehyde in toluene
  • the crude lycopene may then be purified using routine techniques, for example by adding glacial acetic acid and deionized water to the mixture, stirring vigorously, allowing the aqueous and organic phases to separate, and extracting the organic phase containing DCM and crude lycopene with water.
  • Methanol is added to the organic phase and the DCM removed via distillation under reduced pressure.
  • the crude methanolic lycopene solution is then be heated and cooled to crystalline slurry that is filtered and washed with methanol.
  • the lycopene crystals may then be reciystallized and dried under heated nitrogen.
  • Synthetic lycopene is also available from commercial suppliers (e.g. BASF Corp, NJ USA, DSM Nutritional Products, Basel, CH).
  • Synthetic lycopene may comprise an increased proportion of cis isomers relative to natural lycopene.
  • synthetic forms of lycopene may be up to 25% 5-cis, 1% 9-cis, 1% 13-cis, and 3% other cis isomers, whilst natural forms of lycopene produced by tomatoes, may be 3-5% 5-cis, 0-1% 9-cis, 1% 13-cis, and ⁇ 1% other cis isomers. Since cis-lycopene has increased bioavailability relative to trans- lycopene, synthetic lycopene may be preferred in some embodiments.
  • lycopene as described above may be produced by chemical synthesis analogous to the synthesis described above; by chemical modification of natural carotenoids extracted from plant material or by microbial, yeast, algal, or fungal fermentation.
  • lycopene may be produced by fermentation of the fungus Blakeslea trispora (e.g. LyconatTM, Vitatene SA).
  • the antibodies of the invention are also highly specific for synthetic forms of lycopene.
  • an antibody of the invention specifically binds lycopene, for instance binds trans lycopene and preferably cis lycopene as well.
  • the antibody preferably binds lycopene, but not other carotenoids, for example an antibody of the invention may preferably bind lycopene, but not lutein.
  • an antibody of the invention may, for instance, bind lycopene, but not beta- carotene and preferably does not bind beta-carotene or lutein.
  • the present invention provides antibodies against any carotenoid.
  • the invention provides antibodies against xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin.
  • the invention provides antibodies against carotenes such as lycopene, beta carotene or alpha carotene.
  • Any suitable anti -carotenoid antibody may be employed in the present invention.
  • antibody refers to an intact antibody, or a binding fragment thereof.
  • An antibody may comprise a complete antibody (immunoglobulin) molecule (including polyclonal, monoclonal, chimeric, humanized, and/or human versions having full length heavy and/or light chains), or comprise an antigen binding fragment thereof.
  • Antibody fragments include F(ab')2, Fab, Fab', Fv, Fc, and Fd fragments, and can be incorporated into single domain antibodies (e.g., nanobodies), single-chain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology, 23(9): 1126-1136 (2005)).
  • An antibody fragment may be any synthetic or genetically engineered protein.
  • antibody fragments include isolated fragments consisting of the light chain variable region, "Fv" fragments consisting of the variable regions of the heavy and light chains, and recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker (scFv proteins).
  • the antibody may be any class of antibody such as IgG, IgM, IgA, IgD or IgE, particularly IgM or an IgG antibody, but in a preferred instance the antibody is an IgM antibody.
  • the antibody may be, in some instance, an IgGl, IgG2, IgG3, or IgG4 class antibody. It will be appreciated by the skilled person that an antibody of one class can be converted to that of another by changing the constant regions to those of the desired antibody class.
  • CDRs complementarity determining regions
  • Another form of an antibody fragment is a peptide comprising one or more complementarity determining regions (CDRs) of an antibody.
  • CDRs also termed “minimal recognition units” or “hypervariable region”
  • Such polynucleotides are prepared, for example, by using the polymerase chain reaction to synthesize the variable region using mRNA of antibody-producing cells as a template (see, for example, Larrick et al., Methods: A Companion to Methods in Enzymology, 2: 106 (1991); Courtenay-Luck, "Genetic Manipulation of Monoclonal Antibodies," in Monoclonal Antibodies
  • Anti-carotenoid antibodies may, for instance, bind to carotenoids, particularly xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or carotenes such as lycopene or naturally occurring variants thereof, with an affinity (Kd) of less than or equal to 1 x 10 "7 M, less than or equal to 1 x 10 "8 M, less than or equal to 1 x 10 "9 M, less than or equal to 1 x 10 "10 M, less than or equal to 1 x 10 "11 M, or less than or equal to 1 x 10 M.
  • Kd affinity
  • the antibodies bind to carotenoids, particularly xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or carotenes such as lycopene, with an affinity (Kd) of between about 1 x 10 "8 M and 0.5 x 10 "9 M.
  • affinity may be determined using a variety of techniques, an example of which is an affinity ELISA assay. In various embodiments, affinity is determined by a
  • affinity is determined by a kinetic method. In various embodiments, affinity is determined by an equilibrium/solution method.
  • U.S. Patent Publication No. 20070110747 contains additional description of affinity assays suitable for determining the affinity (Kd) of an antibody for carotenoids.
  • an anti-carotenoid antibody of the invention particularly an anti-xanthophyll antibody such as anti-lutein, anti-astaxanthin, anti-meso-zeaxanthin or anti-zeaxanthin or anti-carotene antibody such as anti-lycopene, cross-blocks the binding of at least one other antibody to the same carotenoid.
  • an antibody of the invention may cross-block an antibody produced by one or more of the hybridomas discussed herein.
  • cross-block means the ability of an antibody to interfere with the binding of other antibodies to the same carotenoid, for instance the same xanthophyll such as lutein, astaxanthin, meso- zeaxanthin or zeaxanthin or carotene such as lycopene.
  • the extent to which an antibody is able to interfere with the binding of another antibody to a carotenoid, and therefore whether it can be said to cross-block can be determined using competition binding assays.
  • a cross-blocking antibody or fragment thereof reduces binding of a reference antibody to a carotenoid, particularly to a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or a carotene such as lycopene, by between about 40% and about 100%, such as about 60% and about 100%, specifically between 70% and 100%, and more specifically between 80% and 100%.
  • a particularly suitable quantitative assay for detecting cross-blocking uses a Biacore machine which measures the extent of interactions using surface plasmon resonance technology.
  • Another suitable quantitative cross-blocking assay uses an ELISA-based approach to measure competition between antibodies in terms of their binding to carotenoids.
  • a routine cross- blocking assay such as that described Antibodies, Harlow and Lane (Cold Spring Harbor Press, Cold Spring Harb., NY) can be performed.
  • Other methods include alanine scanning mutants, peptide blots (Reineke (2004) Methods Mol Biol 248:443-63) (herein specifically incorporated by reference in its entirety), or peptide cleavage analysis.
  • methods such as epitope excision, epitope extraction and chemical
  • an antibody of the invention will bind the same epitope of a carotenoid such as any of those referred to herein, particularly a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or particularly a carotene such as lycopene as that of any of the antibodies discussed herein.
  • a carotenoid such as any of those referred to herein, particularly a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or particularly a carotene such as lycopene as that of any of the antibodies discussed herein.
  • an antibody of the invention cross-blocks the 6B9 antibody disclosed herein, typically between about 40% and about 100%, such as about 60% and about 100%, specifically between 70% and 100%, and more specifically between 80% and 100%.
  • an antibody of the invention cross-blocks the 4A3 antibody disclosed herein, typically between about 40% and about 100%, such as about 60%) and about 100%, specifically between 70% and 100%, and more specifically between 80% and 100%.
  • an antibody of the invention cross-blocks the 2F3, 6H8 or 6C3 antibodies disclosed herein, typically between about 40% and about 100%, such as about 60% and about 100%, specifically between 70% and 100%, and more specifically between 80% and 100%.
  • antigen -binding fragment of an antibody refers to one or more fragments or portions of an antibody that retain the ability to specifically bind to a carotenoid, particularly a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or a carotene such as lycopene. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.
  • binding fragments encompassed within the term "antigen-binding fragment" of an antibody include a Fab fragment, a F(ab')2 fragment, a Fab' fragment, a Fd fragment, a Fv fragment, a dAb fragment and an isolated complementarity determining region (CDR).
  • Single chain antibodies such as scFv antibodies are also antibodies within the meaning of the invention. These antibody fragments may be obtained using conventional techniques known to those of skill in the art, and the fragments may be screened for utility in the same manner as intact antibodies.
  • the amino acid sequence of the antibody may be identified by methods known in the art.
  • the genes encoding the antibody can be cloned, for example using degenerate primers.
  • the monoclonal antibody can then be recombinantly produced by routine methods.
  • the present invention also provides a cell line expressing an antibody of the invention.
  • the cell line may, for instance, be a hybridoma, it may be cell line into which the nucleic acid sequences encoding the antibody of the invention are introduced.
  • the cell line is a CHO cell line into which a sequence, or sequences, encoding an antibody of the invention has been introduced.
  • the antibody employed will be the 4A3 or 6B9 antibody against lycopene, in particular the antibody produced by the hybridoma 4A3 or 6B9.
  • the antibody employed will be the 6B9 antibody, in particular the antibody produced by the hybridoma 6B9.
  • the hybridomas are also named after the antibodies they produce, so, for instance, the 6B9 antibody is produced by the 6B9 hybridoma.
  • Hybridomas capable of producing the 4A3 or 6B9 antibodies have been deposited by IP Science Ltd on 12 December 2016 at the Russian National Collection of Industrial Microorganisms (VKPM) Depositary, FGUP GosNII Genetika, Russia 117545, Moscow, 1 Dorozhny proezd 1 under Accession Numbers VKPM H-171 and VKPM H-172 respectively.
  • the invention provides hybridomas capable of producing the 4A3 or 6B9 antibodies.
  • the present invention provides the VKPM H-171 or VKPM H- 172 hybridomas, as well as equivalent hybridomas and derivative hybridomas of VKPM H-171 and VKPM H-172.
  • Such derivative hybridomas will be capable of producing one of the antibodies as defined herein, and preferably the 4A3 or 6B9 antibodies.
  • the antibody employed will be the 2F3, 6H8 or 6C3 antibody against lutein, in particular the antibody produced by the hybridoma 2F3, 6H8 or 6C3.
  • the hybridomas are also named after the antibodies they produce, so, for instance, the 2F3 antibody is produced by the 2F3 hybridoma.
  • a hybridoma capable of producing the 6H8 antibody has been deposited by IP Science Ltd on 18 October 2017 at the Russian National Collection of Industrial Microorganisms (VKPM) Depositary, FGUP GosNII Genetika, Russia 117545,
  • an antibody of the invention will have the same heavy and light chain variable sequences as that of any of the antibodies herein, such as the 4 A3, 6B9, 2F3, 6H8 or 6C3 antibody, but may differ in the constant region, for instance the antibody may be of a different class, such as IgG.
  • the antibody employed in the invention may be one whose heavy and/or light chain variable regions have at least 70%, preferably at least 75%, more preferably at least 80% and even more preferably at least 85%) sequence identity to those of the 4A3 or 6B9 antibodies.
  • the level of sequence identity may be at least 85%>, preferably at least 90%, more preferably 95% and still more preferably at least 96, 97, 98 or 99% sequence identity.
  • the antibody of the invention comprises a heavy chain variable region of the 6B9 antibody having a sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% identical to
  • the antibody comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 1. In a further embodiment the antibody comprises a heavy chain variable region having a sequence at least 98% identical to SEQ ID NO: 1. In one embodiment the antibody comprises a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 2.
  • the antibody comprises a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 2. In a further embodiment the antibody comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 1 and a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 2. In a preferred embodiment the antibody comprises a heavy chain variable region having a sequence at least 98% identical to SEQ ID NO: 1 and a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 2.
  • the antibody of the invention comprises a heavy chain variable region of the 4A3 antibody having a sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% identical to
  • the antibody comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 3. In a further embodiment the antibody comprises a heavy chain variable region having a sequence at least 98% identical to SEQ ID NO: 3. In one embodiment the antibody comprises a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 4.
  • the antibody comprises a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 4. In a further embodiment the antibody comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 3 and a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 4. In a preferred embodiment the antibody comprises a heavy chain variable region having a sequence at least 98% identical to SEQ ID NO: 3 and a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 4.
  • the antibody of the invention comprises a heavy chain variable region of the 6H8 antibody having a sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% identical to
  • the antibody comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 5. In a further embodiment the antibody comprises a heavy chain variable region having a sequence at least 98% identical to SEQ ID NO: 5. In one embodiment the antibody comprises a light chain variable region having a sequence at least 95% identical to SEQ ID NO: 6. In a further embodiment the antibody comprises a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 6. In a further embodiment the antibody comprises a heavy chain variable region having a sequence at least 95% identical to SEQ ID NO: 5 and a light chain variable region having a sequence at least 95% identical to SEQ ID NO:6. In a preferred embodiment the antibody comprises a heavy chain variable region having a sequence at least 98% identical to SEQ ID NO: 5 and a light chain variable region having a sequence at least 98% identical to SEQ ID NO: 6.
  • anti-lycopene antibodies and fragments thereof include antibodies and antibody fragments having one or more of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of the 4A3 or 6B9 antibodies.
  • the anti- lycopene antibody can comprise at least one CDR sequence having at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identity or more to a CDR of the 4A3 or 6B9 antibodies.
  • Such levels of sequence identity may be, for instance, over just the CDRs or over the entire variable regions or over the entire heavy or light chains.
  • anti-lutein antibodies and fragments thereof include antibodies and antibody fragments having one or more of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of the 2F3, 6H8 or 6C3 antibodies.
  • the anti-lutein antibody can comprise at least one CDR sequence having at least 75%, at least 80%), at least 85%, at least 90% or at least 95% identity or more to a CDR of the 2F3, 6H8 or 6C3 antibodies.
  • Such levels of sequence identity may be, for instance, over just the CDRs or over the entire variable regions or over the entire heavy or light chains.
  • the antibody employed will have at least three, preferably at least four, more preferably at least five and still more preferably all six of the CDRs from the 4A3, 6B9 or 6H8 antibody.
  • the antibody may have a CDR that has one of the above specified levels of sequence identity to one of the CDRs of the 4A3,6B9 or 6H8 antibody.
  • the antibody employed may have at least three, preferably at least four, more preferably five such CDRs.
  • the antibody may have six CDRs which all have one of the above levels of sequence identity to the corresponding CDRs from the 4A3, 6B9 or 6H8 antibody.
  • the antibody employed may be one of the types of the types of antibody fragments referred to herein, which has the above- specified CDRs.
  • the antibody employed has the framework regions from the 4 A3, 6B9 or 6H8 antibody, or framework regions with one of the above- specified levels of sequence identity to the framework regions of the 4A3, 6B9 or 6H8 antibody.
  • such framework regions are employed with the above- specified CDRs.
  • the entire heavy and/or light chain variable sequence from the 4A3, 6B9 or 6H8 antibody is employed.
  • the variable regions have one of the above specified levels of sequence identity to the variable region of the light and/or heavy chains of the 4A3, 6B9 or 6H8 antibody.
  • the antibody employed may have the entire sequence of the variable regions of the heavy and/or light chains of the 4A3, 6B9 or 6H8 antibody, except for up to 50 amino acid substitutions, preferably up to 40 substitutions, more preferably only up to 30 such substitutions and even more preferably only up to 20 such substitutions.
  • the antibody has up to 15, preferably up to 10, more preferably up to 5 substitutions.
  • the sequence may only have, in some instances, 4, 3, 2 or 1 such changes.
  • the substitutions will be conservative. Conservative substitutions may be made, for example according to the following Table. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other.
  • an antibody of the invention will retain the ability to bind to a carotenoid such as lycopene or lutein.
  • an antibody may have the same, or substantially similar, binding ability as the 4A3 , 6B9 or 6H8 antibody, such as the same binding affinity.
  • a variant may have a KA value within two or one order of magnitude to the specific antibody.
  • a variety of programs may be used to calculate percentage homology and sequence identity.
  • the UWGCG Package provides the BESTFIT program which can be used to calculate homology (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395).
  • the PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al (1990) J Mol Biol 215:403-10.
  • HSPs high scoring sequence pair
  • Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787.
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • the antibodies employed will be able to bind to a carotenoid, particularly a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or a carotene such as lycopene.
  • the antibodies will be able to bind with at least the same affinity as the 4A3 or 6B9 antibody to lycopene.
  • the antibody employed may display the ability to cross-block any of the antibodies disclosed herein, such as to cross-block the 4A3 or 6B9 antibody binding to lycopene.
  • the antibody employed may bind the same epitope, or an overlapping epitope, as the 4 A3 or 6B9 antibody.
  • An antibody of the invention may be one raised with an immunogen disclosed herein.
  • An antibody of the invention may be one raised using any of the methods discussed herein.
  • telomere binding peptide As used herein, “specifically binds” refers to an antigen binding peptide, such as an antibody, binding to a predetermined antigen.
  • the antigen binding peptide such as an antibody, binds with an affinity corresponding to a KD of about 10 "6 M , 10 "7 M or less, such as about 10 "8 M or less, such as about 10 "9 M or less, about 10 "10 M or less, or about 10 "U M or even less when determined by surface plasm on resonance (SPR) technology in a BIAcore 3000 instrument using a carotenoid, particularly a xanthophyll such as lutein, meso-zeaxanthin or zeaxanthin or a carotene such as lycopene, as the ligand and the antibody as the analyte.
  • SPR surface plasm on resonance
  • the antigen binding peptide may bind to a carotenoid, particularly a xanthophyll such as lutein, meso-zeaxanthin or zeaxanthin or a carotene such as lycopene, with an affinity corresponding to a KD that is at least ten-fold lower, such as at least 100 fold lower, for instance at least 1000 fold lower, such as at least 10,000 fold lower than its affinity for binding to another carotenoid other than the predetermined antigen or a closely-related antigen.
  • a carotenoid particularly a xanthophyll such as lutein, meso-zeaxanthin or zeaxanthin or a carotene such as lycopene
  • the amount with which the affinity is lower is dependent on the KD of the antigen binding peptide, so that when the KD of the antigen binding peptide is very low (that is, the antigen binding peptide is highly specific), then the amount with which the affinity for the antigen is lower than the affinity for a non-specific antigen may be at least 10,000 fold.
  • the invention also provides a bispecific antibody where one of the specificities of the antibody is against a carotenoid, particularly a xanthophyll such as lutein, meso- zeaxanthin or zeaxanthin or a carotene such as lycopene, and the other specificity is against a different antigen.
  • the invention further provides a bispecific antibody where each of the two antibody specificities is against a different carotenoid. Any of the antibodies discussed herein may be employed to generate bispecific antibodies, including the specific antibodies generated by the hybridomas discussed herein.
  • the invention also provides a nucleic acid molecule encoding a light chain and/or heavy chain of an antibody of the invention.
  • the invention provides a vector comprising such a nucleic acid sequence.
  • the invention also provides a pair of vectors, one encoding a heavy chain of an antibody of the invention, the other a light chain of an antibody of the invention.
  • Nucleic acids and vectors of the invention may also comprise promoters, polyadenylation sequences and other sequences necessary for expression of the antibody encoding sequences operably linked to those coding sequences.
  • the invention also provides a method for expression of an antibody of the invention comprising introducing a nucleic acid(s) or vector(s) encoding an antibody of the invention into a host cell, culturing the cell under conditions suitable for expression of the antibody and recovering the expressed antibody.
  • the invention also provides methods of producing antibodies against any antigen as the method is applicable to both carotenoids and other antigens.
  • the antigen is a hydrocarbon compound, typically a hydrocarbon belonging to the tetraterpene group.
  • the antigen is an antioxidant.
  • the antigen has an unsaturated or highly unsaturated chemical structure that allows it to react with other substances containing or generating singlet molecular oxygen such as peroxyl radicals, hydrogen peroxide and hypochlorite. Molecular associations between the antigen and oxidized proteins or carbohydrates may confer on the antigen hapten properties that are capable of elucidating an immune response.
  • the temporary association of antigen with macromolecules required to initiate the immune response is promoted by colloidal gold (i.e., gold nanoparticles).
  • the antigen is a carotenoid. Any carotenoid as described herein may be employed in methods of producing antibodies of the invention.
  • the antigen is a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin. More typically, the antigen is a carotene, preferably lycopene.
  • the method of producing an antibody of the invention comprises immunizing a non-human mammal with an immunogen.
  • the non-human mammal is a mouse, rat, goat, rabbit, rat, mouse, guinea pig, chicken, sheep or horse.
  • the preferred animal system for preparing hybridomas is the murine system.
  • an immunogen employed will comprise an antigen associated with, in particular absorbed to, the surface of metal particles.
  • the immunogen typically comprises an antigen absorbed to the surface of gold particles, particularly gold colloid particles.
  • the antigen absorbed to the surface of gold particles is a carotenoid, particularly a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or especially a carotene such as lycopene.
  • gold colloid particles may be used interchangeably with the term “gold nanoparticles (G Ps)".
  • the gold colloid particles are about 5nm to about 60 nm in diameter. More typically, the gold colloid particles are about 15nm to about 30nm in diameter. The gold colloid particles are typically 15nm or 30nm.
  • the mean size of the gold colloid particles may vary for each preparation. Typically, the size distribution for each preparation is less than 20% of the standard deviation shown.
  • the antigen is not conjugated to a carrier, for instance it is associated with gold particles without conjugation.
  • the gold colloid particles may be any shape. Typically, the gold colloid particles are spherical or substantially spherical in shape. More typically, the gold colloid particles are coated with polyether compounds such as polyethylene glycol (PEG).
  • PEG polyethylene glycol
  • the gold colloid particles may synthesized by known methods such as sodium citrate reduction [2].
  • gold colloid particles may be made by reflux of a lOOmL aliquot of 0.01% chloroauric acid (HAuCU 4H 2 0) solution. 0.8, 1.3, and 5mL of 1%) sodium citrate solution may then be added to the boiling solution. Reduction of gold ions by the citrate ions is complete after 5 minutes, and the solution may then be boiled for a further 30 minutes and left to cool to room temperature. This method yields spherical particles with an average diameter of about 10, 30, and 60 nm. The small-sized gold colloid particles of 5nm may be reduced by NaBFLt. Subsequently, PEG-SH (Sigma- Aldrich, St Louis, MO) 1 mg may be mixed with the gold colloid particles and stirred for 1 hour to modify the surface of the gold colloid particles covalently with
  • the resulting PEG-coated gold colloid particles may be collected by centrifugation at 16,000 rpm for 30 minutes and washed twice with distilled water.
  • the solution of PEG-coated gold colloid particles may be stored at 4°C in order to prevent aggregation.
  • the antigen is dissolved in ethanol and then mixed with the colloid gold, then administered, for instance in a 5% ratio of colloidal gold to the antigen.
  • the immunogen comprising an antigen, absorbed to the surface of gold colloid particles is typically injected into the non-human mammal.
  • the antigen that is injected is a carotenoid, particularly a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or especially a carotene such as lycopene.
  • the non-human mammal is a rodent, particularly a mouse.
  • the injection is an intraperitoneal injection.
  • the immunogen is typically injected more than once as part of an immunization schedule.
  • the immunogen may be injected up to 2 times, up to 3 times, up to 4 times, up to 5 times or more.
  • the immunogen is injected 5 times.
  • the number of injections may be in a range with any two of the above values as end points.
  • the immunogen may further comprise an adjuvant.
  • Any adjuvant that enhances the immunological reaction to the antigen absorbed to the surface of gold colloid particles may be used in the methods of the invention.
  • an adjuvant is used when the antigen is a carotenoid, particularly a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene.
  • the adjuvant increases the intensity and/or duration of the antibody response to the antigen absorbed to the surface of gold colloid particles.
  • the adjuvant is Freund's complete adjuvant (cAF).
  • the immunogen comprising the antigen absorbed to the surface of gold colloid particles is injected separately to the adjuvant.
  • the immunogen comprising the antigen absorbed to the surface of gold colloid particles is mixed with the adjuvant and injected into the non-human mammal such as a mouse.
  • the immunogen may vary in composition between injections.
  • an immunization schedule involving alternating use of adjuvant is used.
  • an alternating immunization schedule of Freund's complete and Freund's incomplete (iAF) Adjuvant is used.
  • Freund's Complete Adjuvant is composed of inactivated and dried mycobacteria (usually M tuberculosis), whereas Freund's incomplete adjuvant lacks the mycobacterial components (hence just the water in oil emulsion).
  • the antigen is dissolved in ethanol.
  • the immunogen used for a first injection may consist of a carotenoid, particularly a carotene such as lycopene absorbed to the surface of gold colloid particles.
  • a carotenoid particularly a carotene such as lycopene absorbed to the surface of gold colloid particles.
  • the carotenoid particularly a carotene such as lycopene
  • the carotenoid, particularly a carotene such as lycopene is typically administered at 5 ⁇ g, 10, 15, 20, 25, 30 or more per mouse or may be administered in an amount in a range comprising any two of those values as end points.
  • the carotenoid, particularly a carotene such as lycopene is administered at 25 ⁇ g per mouse.
  • the immunogen used for any second injection may also consist of carotenoid, particularly a carotene such as lycopene, absorbed to the surface of gold colloid particles.
  • carotenoid particularly a carotene such as lycopene
  • the amount of carotenoid that is administered in a second injection is approximately twice the amount of carotenoid that is administered in a first injection.
  • the non-human mammal is a mouse
  • the carotenoid is typically administered at 10 ⁇ g, 20, 30, 40, 50, 60 or more per mouse or a range of any two of those values.
  • the carotenoid is administered at 50 ⁇ g per mouse.
  • the immunogen used for any third injection may also consist of carotenoid, particularly a carotene such as lycopene, absorbed to the surface of gold colloid particles.
  • the amount of carotenoid that is administered in a third injection is approximately twice the amount of carotenoid as that administered in the first injection, and/or approximately the same amount of carotenoid as that administered in the second injection.
  • the carotenoid is typically administered at 10 ⁇ g, 20, 30, 40, 50, 60 or more per mouse or a range of any two of those values.
  • the carotenoid is administered at 50 ⁇ g per mouse.
  • the immunogen used for any fourth injection may consist of carotenoid, particularly a carotene such as lycopene, absorbed to the surface of gold colloid particles and an adjuvant, preferably Freund's complete adjuvant.
  • the amount of carotenoid that is administered in the fourth injection is approximately the same amount of carotenoid as that administered in the first injection, and/or approximately half the amount of carotenoid as that administered in the second or third injection.
  • the non-human mammal is a mouse
  • the carotenoid is typically administered at 5 ⁇ g, 10, 15, 20, 25, 30 or more per mouse or in a range with any two of those values as end points.
  • the carotenoid is administered at 25 ⁇ g per mouse.
  • the immunogen used for any fifth injection may consist of (i) carotenoid, particularly a carotene such as lycopene, absorbed to the surface of gold colloid particles or (ii) carotenoid, particularly a carotene such as lycopene, absorbed to the surface of gold colloid particles and Freund's incomplete adjuvant.
  • carotenoid particularly a carotene such as lycopene
  • the amount of carotenoid that is administered in the fifth injection is approximately the same amount of carotenoid as that administered in the fourth inj ection.
  • an immunization schedule comprising only a single injection of an immunogen consisting of an antigen absorbed to the surface of gold colloid particles and an adjuvant, preferably Freund's complete adjuvant, negates the toxic effect from the immunogen in the non-human mammal, whilst still inducing a strong antibody response.
  • lycopene is described, but the approach is generally applicable to any carotenoid, particularly any other carotene or any
  • xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin.
  • the method of producing an antibody of the invention may further comprise obtaining an antibody preparation from the non -human mammal. Any method of obtaining said antibody preparation from said mammal may be used.
  • antibodies of the invention are purified by standard techniques known in the art, such as affinity chromatography.
  • the antibody preparation comprise IgM antibodies.
  • a method of the invention may further comprise generating hybridomas from the immunized non-human animal.
  • a method may further comprise screening for hybridomas secreting antibodies that can bind to antigen as defined herein.
  • a method of the invention may also comprise identifying the sequences encoding the heavy and light chain variable region sequences of an antibody as defined herein.
  • a method of the invention may further comprise introducing sequence(s) encoding an antibody of the invention into a cell line. Such a cell line may then be, for instance, cultured under conditions allowing production of an antibody of the invention and may also comprise the recovery of the antibody.
  • the present invention provides a method of producing an antibody of the invention, comprising: (a) immunizing a non-human mammal with an immunogen comprising an antigen absorbed to the surface of gold colloid particles; and (b) obtaining an antibody preparation from said non-human mammal and deriving therefrom monoclonal antibodies that specifically recognize the antigen.
  • the antigen is typically a carotenoid, more typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene.
  • the mean average of the gold colloid particles is about 15nm to 30nm in
  • the gold colloid particles are coated with a polyether compound such as
  • PEG polyethylene glycol
  • the non-human mammal is a mouse
  • the immunogen further comprises an adjuvant.
  • the immunogen is one consisting of (i) an antigen, typically a carotenoid, more typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene absorbed to the surface of gold colloid particles and (ii) adjuvant is injected only once into the non-human mammal;
  • the adjuvant is Freund's complete adjuvant
  • the method consists of: (i) one or more injections of an antigen, typically a
  • carotenoid more typically a xanthophyll such as lutein, astaxanthin, meso- zeaxanthin or zeaxanthin, or especially a carotene such as lycopene absorbed to the surface of gold colloid particles into the non-human mammal; and (ii) one injection of an antigen typically a carotenoid, more typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene absorbed to the surface of gold colloid particles and Freund's complete adjuvant; and (iii) one or more injections of an antigen typically a carotenoid, more typically a xanthophyll such as lutein, astaxanthin, meso- zeaxanthin or zeaxanthin, or especially a carotene such as lycopene absorbed to the surface of
  • IgM antibodies are obtained and/or hybridomas that produce IgM.
  • the invention also provides use of the antibodies of the invention to detect carotenoids.
  • the antibodies of the invention are used to detect xanthophylls such as lycopene, astaxanthin, lutein or meso-zeaxanthin, or especially carotenes such as lycopene, beta carotene or alpha carotene.
  • the invention further provides a method of detecting carotenoids, typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene, beta carotene or alpha carotene, wherein the method comprises (a) contacting a sample to be tested with a monoclonal antibody against the carotenoid; and (b) detecting or measuring any carotenoids bound by the antibody or antibody fragment.
  • carotenoids typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin
  • a carotene such as lycopene, beta carotene or alpha carotene
  • the step of contacting a sample to be tested with a monoclonal antibody may performed under any condition that allows the binding of the antibody to carotenoids.
  • Such methods may be used to quantify carotenoids by determining the amount of binding of the antibody to carotenoids.
  • a method of the invention may simply detect the presence or absence of carotenoids but in a preferred instance the method is quantitative.
  • the invention provides an immunoassay for carotenoids, typically xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially carotenes such as lycopene.
  • xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially carotenes such as lycopene.
  • the method of the invention may be any suitable antibody based assay, for example: a radioimmunoassay (RIA), a magnetic immunoassay, a fluorescent or luminescent immunoassay, a redox based assay or other electric current or electric signal generating detection assays.
  • a radioimmunoassay RIA
  • magnetic immunoassay a magnetic immunoassay
  • fluorescent or luminescent immunoassay a fluorescent or luminescent immunoassay
  • a redox based assay or other electric current or electric signal generating detection assays.
  • the antibodies of the invention may be employed in an ELISA (Enzyme-linked immunosorbent assay).
  • ELISA Enzyme-linked immunosorbent assay
  • the invention provides an immunoassay for carotenoids and in particular an ELISA for carotenoids.
  • ELISA is typically a heterogeneous, solid phase assay that requires the separation of reagents.
  • the ELISA may, for instance, be an indirect ELISA.
  • the ELISA may be a sandwich ELISA or a competitive ELISA.
  • the ELISA may be a rapid ELISA.
  • the sandwich technique requires two antibodies against carotenoids. The first specifically binds carotenoids and is bound to a solid support.
  • the binding of carotenoids by the first antibody may then be detected with a second antibody against carotenoids which recognizes the carotenoids bound to the first antibody.
  • the binding of the second antibody may be detected by any suitable means.
  • the second antibody may be conjugated to an enzyme allowing its detection.
  • the second antigen may be able to bind the enzyme, for instance because the antibody is biotinylated and the enzyme is conjugated with streptavidin.
  • the antibody itself may be labelled.
  • the second antibody may be recognized by a further antibody, allowing detecting through that binding, for instance because the third antibody is labelled or can bind to an enzyme.
  • the first and second antibody may be the same antibody against carotenoids or they may be different antibody against carotenoids.
  • the assay of the invention may be a competitive assay, for instance, a competitive ELISA.
  • Labelled carotenoids may be added to compete with any un-labelled carotenoids present in the sample and hence reduction in binding of the labelled carotenoids to the antibody of the support allows the amount of unlabeled carotenoids to be quantified.
  • Antibodies of the invention may also be used in flow cytometry, for instance antibodies of the invention conjugated to a label such as a fluorochrome may be employed in methods of the invention and may, for instance, be employed in flow cytometry. Antibodies of the invention may also be employed in immunohistochemistry.
  • the antibodies of the invention may also be used in any other
  • the antibodies of the invention may not only be used to analyze clinical or research samples, but also any agricultural, food, beverage or other nutritional samples and products.
  • any suitable solid surface may be used as a support in the assays of the invention.
  • it may comprise, or consist essentially of, a polyvinylidene difluoride (PVDF) membrane.
  • the support of the invention may be selected from polystyrene, PVC, Perspex or Lucite.
  • antibody immobilized on the support will be distributed evenly over the area it is present on.
  • the surface may be the base of a well, such as a well of a microtiter plate.
  • the plate may be suitable for automation of the assay.
  • the support may, for instance, be a microtiter plate.
  • the microtiter plate may, for instance, contain 24, 48 or 96 wells and in particular 96 wells.
  • the invention also provides a support with an antibody of the invention immobilized on it, such as any of the support types discussed herein, particularly a support suitable for use in an assay of the invention.
  • Conditions suitable for coating the surface of the support with antibodies are well known in the art.
  • an antibody may be bound to the surface by contacting the surface with the antibody under conditions suitable for antibody binding and washing to remove unbound antibodies.
  • the surface may be "blocked" prior to addition of the cells.
  • Suitable blocking agents are well known in the art and include bovine serum albumin (BSA), casein or fetal calf serum.
  • BSA bovine serum albumin
  • the aim of blocking is typically to saturate the binding capacity of the surface in order to minimize binding of the secondary detection reagents and thereby preventing background.
  • blocking is an optional step and in some instances, the method may not involve a blocking step.
  • any suitable means of detecting binding of the antibody to the carotenoids typically xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially carotenes such as lycopene, alpha carotene or beta carotene may be employed.
  • the antibody bound to carotenoids may be detected directly or indirectly.
  • the antibody may be conjugated with a label. Suitable labels are well known in the art.
  • the assays of the invention may, for instance, use a fluorogenic or luminogenic substrates for the enzyme conjugated to the antibody.
  • the antibody itself may be directly labelled with a fluorescent or luminescent molecule.
  • the antibody may be labelled with, for example, an enzyme, a fluorochrome or a
  • radioisotope hence allowing detection of the antibody.
  • enzymes that may be employed, for instance via conjugation to an antibody in the assays of the invention, include alkaline phosphatase and horseradish peroxidase.
  • fluorochromes that may be employed include fluoroscein (particularly Oregon green) and rhodamine (particularly texas red).
  • a streptavidin conjugated moiety may be used to detect the antibody, for instance a streptavidin conjugated enzyme, including any of those mentioned above.
  • the antibody may be detected using a further antibody. In all detection steps, it is desirable to include an agent to minimize non-specific binding of the antigen.
  • bovine serum albumin BSA
  • FCS fetal calf serum
  • the invention also provides an antibody described herein conjugated to another moiety, for instance an antibody of the invention conjugated to a label, such as for example any of those disclosed herein.
  • the invention also provides an antibody of the invention conjugated to a therapeutic moiety.
  • suitable agents for forming immunoconjugates are known in the art, see for example, WO 05/103081.
  • Antibodies of the invention are also provided conjugated to a detectable label or reporter molecule can be a radioisotope, such as 3 H, 14 C, 32 P, 35 S, or 125 I; a fluorescent or chemiluminescent moiety such as fluorescein isothiocyanate, or rhodamine; or an enzyme such as alkaline phosphatase, ⁇ - galactosidase, horseradish peroxidase, or luciferase.
  • a detectable label or reporter molecule can be a radioisotope, such as 3 H, 14 C, 32 P, 35 S, or 125 I; a fluorescent or chemiluminescent moiety such as fluorescein isothiocyanate, or rhodamine; or an enzyme such as alkaline phosphatase, ⁇ - galactosidase, horseradish peroxidase, or luciferase.
  • conjugates may, for instance, be employed in EL
  • Additional exemplary labeling moieties generally include, but are not limited to spin-labeled molecules and other labeling moieties of diagnostic value.
  • fluorescent compounds such as fluorescein, fluorescein isothiocyanate, rhodamine, 5-dimethylamine-l- napthalenesulfonyl chloride, lanthanide phosphors, and the like.
  • suitable fluorescent labels include a 125 Eu label, an isothiocyanate label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label, a fluorescamine label, etc.
  • chemiluminescent labels include luminal labels, isoluminal labels, aromatic acridinium ester labels, imidazole labels, acridinium salt labels, oxalate ester labels, a luciferin labels, luciferase labels, aequorin labels, etc.
  • the assays of the invention may comprise washing after particular steps, for instance after the immobilization, after incubation with the test sample, after addition of a second antibody and so on.
  • the assay of the invention may comprise: (i) contacting a sample to be tested with an antibody against carotenoids such as lycopene; and (ii) detecting any binding of the antibody to carotenoids such as lycopene.
  • Step (i) may comprise an incubation step, which may be followed by a washing step.
  • Positive and negative controls may be performed with the assays of the invention. For instance, a positive control known to contain carotenoids such as lycopene may be employed.
  • Samples with known amounts of carotenoids such as lycopene may be used to help quantify carotenoids such as lycopene via the assay of the invention. Such samples may be used to produce a standard curve. Negative controls which are known to lack carotenoids such as lycopene may also be used. Such controls may be provided with the kits of the invention.
  • the kit of the invention may include a solution of carotenoids such as lycopene of known concentration to use as a standard.
  • the assays of the invention may be automated.
  • the assays of the invention may include steps such as pipetting, incubation, washing, transferring microplates between activities, reading and data analysis and any, or indeed all, of such steps may be automated. Automation may, for instance, be used for any of sample distribution, dilution, incubation at specific temperatures, washing, enzyme conjugate addition, reagent addition, reaction stopping and the analysis of results.
  • the assay of the invention may be performed using a biochip, comprising an antibody of the invention.
  • the assays of the invention may be used to produce scales for carotenoid such as lycopene content.
  • the assay of the invention may be used to detect or measure carotenoids, typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene, in situ within tissues and/or cells.
  • the antibody is typically conjugated to a fluorescent label.
  • the carotenoids are detected or measured in situ by immunofluorescence.
  • the invention also provides a sample stained with an antibody of the invention, for instance an isolated tissue sample stained with an antibody of the invention.
  • the invention may be used to detect or measure carotenoids, typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene, in any suitable sample from an individual.
  • the individual may be any individual organism, a vertebrate, a mammal, or a human.
  • the invention is applied to a human.
  • the invention may, for instance, also be applied to non-human animals, such a pets or commercial animals. Such animals include, for instance, dogs, cats, cattle, pigs and sheep.
  • the individual may be elderly, for instance over 50, 55, 60, 65, 70, 75 or 80 years of age.
  • the subject may be male or female. In some instances, the subject is pregnant.
  • the individual may have, or is suspected of having, carotenoid deficiency or associated condition, typically a carotene deficiency such as lycopene deficiency or associated condition.
  • the method is carried out on a sample from the individual of interest.
  • the sample may be from any tissue or bodily fluid.
  • the sample typically comprises a body fluid and/or cells of the individual and may, for example, be obtained using a needle.
  • the sample may be, or be derived from, plasma, serum or whole blood from the individual.
  • Such samples are typically processed prior to being assayed, for example by centrifugation or by passage through a membrane that filters out unwanted molecules or cells, such as red blood cells.
  • the sample may be, or be derived from, sebum, corneocyte and/or cerumen. Such samples are typically used to detect or measure carotenoid in situ within tissues and/or cells. The sample may be measured immediately upon being taken. The sample may also be stored prior to assay, preferably below -70°C.
  • the sample to be tested is collected non-invasively from an individual.
  • the sample to be tested used in the methods of the invention may collected from the surface of the skin of an individual or from a swab taken from the individual such as a mouth or ear swab.
  • a slide is pressed against the surface of the skin to obtain a tissue print.
  • the tissue print may then be contacted with an antibody against carotenoid or an antigen binding fragment of such an antibody, and any carotenoid bound by the antibody or antibody fragment may then be detected, preferably wherein the detection of carotenoid comprises visualizing and/or quantifying carotenoid.
  • the carotenoid is typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene.
  • the invention provides a slide comprising (i) a sample to be tested such as a tissue print and (ii) an antibody or antibody fragment of the invention.
  • the invention also provides a method of detecting carotenoids in a sample, comprising (a) contacting a slide comprising a sample to be tested such as a tissue print with an antibody against carotenoids or an antigen binding fragment of such an antibody, and (b) detecting any carotenoids bound by the antibody or antigen binding fragment.
  • the detection of carotenoids comprises visualizing and/or quantifying the carotenoids.
  • the carotenoid is typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene.
  • the invention also provides a method of producing a slide comprising a tissue print and an antibody or antibody fragment of the invention, comprising (a) pressing a slide against the surface of the skin of an individual to obtain a tissue print; and (b) contacting the slide comprising the tissue print with an antibody against carotenoids or an antigen binding fragment of such an antibody.
  • the carotenoid is typically a xanthophyll such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin, or especially a carotene such as lycopene.
  • the invention further provides a method of diagnosing carotenoid deficiency or associated conditions in an individual.
  • carotenoid deficiency is understood to encompass any carotenoid deficiency.
  • a carotenoid deficiency is a carotene deficiency, more typically a lycopene deficiency.
  • lycopene deficiency is understood to encompass any lycopene deficiency.
  • the term "lycopene deficiency” encompasses lycopene deficiency resulting from the accelerated depletion of lycopene in an individual.
  • Methods of diagnosing carotenoid deficiency comprise detecting or measuring carotenoids in a sample from the individual, using any assay as described herein.
  • the individual may be any individual as discussed above.
  • the individual is typically suspected of having a carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency.
  • the carotenoid deficiency particularly a carotene deficiency such as a lycopene deficiency
  • Carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency may result from the accelerated depletion of the carotenoid in an individual.
  • the accelerated depletion of lycopene may occur as a result of the accelerated decomposition of lycopene by activated oxidative damaging and/or inflammatory processes in the body of an individual.
  • the individual may also be suspected of having a condition associated with carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency.
  • conditions associated with carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency include coronary heart disease (CHD), coronary vascular disease (CVD), diabetes, cancer, infection such as obligate intracellular infection, metabolic syndrome, fatty liver, steatohepatitis, atherosclerosis, cardiovascular pathology, cerebrovascular pathology, neurodegenerative conditions, arthritis and osteoporosis, skeletal muscle wasting conditions and/or sarcopenia.
  • CHD coronary heart disease
  • CVD coronary vascular disease
  • diabetes cancer
  • infection such as obligate intracellular infection
  • metabolic syndrome fatty liver, steatohepatitis, atherosclerosis, cardiovascular pathology, cerebrovascular pathology, neurodegenerative conditions, arthritis and osteoporosis
  • Any individual may have a functional carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency, or associated condition.
  • a functional carotenoid deficiency particularly a carotene deficiency such as a lycopene deficiency, or associated condition.
  • lipoprotein metabolism may be compromised by ageing, and individuals older than approximately 50 years may lose the ability to assemble new lipoproteins. This may lead to functional lycopene deficiency and/or the onset of related conditions.
  • lycopene deficiency may lead to age-associated subclinical inflammation and oxidation, especially in cells such as enterocytes and hepatocytes and associated tissues where these processes occur.
  • An individual with lycopene deficiency or an associated condition may be elderly, for instance over 50, 55, 60, 65, 70, 75 or 80 years of age. The subject being assessed may be of such an age or, for instance have an age falling in
  • the amount of carotenoid, in particular carotene such as lycopene in the sample of interest may be compared to a standard scale, chart or score for such carotenoid.
  • the amount of carotenoid, particularly carotene such as lycopene in the sample of interest may be compared to the amount of the carotenoid in a control sample, typically taken from another individual.
  • a substantially similar amount or level of carotenoid in a sample of interest as compared to a standard scale, chart or score for carotenoid and/or a control sample may indicate that the individual does not have or is unlikely to have a carotenoid deficiency.
  • a significantly low amount or level of carotenoid in a sample of interest as compared to a standard scale, chart or score for the carotenoid and/or a control sample may indicate that the individual does have or is likely to develop a carotenoid deficiency.
  • the distribution of the carotenoid in the sample is detected.
  • the distribution of carotenoid, particularly carotene such as lycopene in the sample of interest may be compared to a standard chart for the carotenoid, such as the score point system described below.
  • the distribution of carotenoid in the sample of interest may be compared to the distribution of the carotenoid in a control sample, typically taken from another individual.
  • a substantially similar distribution of carotenoid in a sample of interest as compared to a standard chart for carotenoid and/or a control sample may indicate that the individual does not have or is unlikely to have a carotenoid deficiency.
  • a significantly different distribution of carotenoid in a sample of interest as compared to a standard scale, chart or score for carotenoid and/or a control sample i.e., no longer within the cytoplasm of a cell
  • serum carotenoids particularly serum carotenes such as lycopene are measured using an antibody of the invention.
  • the invention further provides a method of monitoring carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency, or an associated condition in an individual.
  • Methods of monitoring carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency, or associated conditions comprise detecting or measuring the carotenoid in a sample from the individual, using any assay as described herein.
  • the individual may be any individual as discussed above.
  • the individual is known to have carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency, and is undergoing treatment or
  • a method of the invention may involve supplementing, or modifying, the diet of the subject to include more carotenoids, especially carotenes such as lycopene and then monitoring the carotenoid levels.
  • the amount of the carotenoid in the sample of interest may be compared to a standard scale, chart or score for carotenoid.
  • the amount of carotenoid in the sample of interest may be compared to the amount of carotenoid in a control sample.
  • the control sample may be taken from a different individual. Alternatively, the control sample may be from the same individual, prior to or at an earlier stage of treatment with the carotenoid in question.
  • a significant increase in the amount of carotenoid in the samples of interest over time may indicate that the individual is responding to treatment or supplementation with the carotenoid. Conversely, no significant change in the level of the carotenoid in the samples of interest over time may indicate that the individual is not responding to treatment or supplementation with the carotenoid.
  • the distribution of the carotenoid in the sample may be detected.
  • the distribution of carotenoid in the samples of interest may be compared over time. A change in the distribution of carotenoid in the samples of interest over time may indicate that the individual is responding to treatment or supplementation with the carotenoid. Conversely, no significant change in the distribution of the carotenoid in the samples of interest over time may indicate that the individual is not responding to treatment or supplementation with the carotenoid.
  • the carotenoid is typically a carotene such as lycopene.
  • the invention also relates to a method of treating or preventing carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency, or an associated condition in an individual in need thereof.
  • the carotenoid deficiency may be in relation to any of the carotenoids mentioned herein.
  • the method comprises detecting or measuring the carotenoid in a sample from the individual, using any method as described herein.
  • the method comprises administering to the individual an effective amount of a composition comprising the carotenoid and thereby treating or preventing the carotenoid deficiency or associated condition, for instance so the levels of carotenoid in the subject approach those in a healthy subject or are at least increased compared to the initial carotenoid level in the subject.
  • conditions associated with carotenoid deficiency include any of those discussed above, namely CHD, CVD, diabetes, cancer, infection such as obligate intracellular infection, metabolic syndrome, fatty liver, steatohepatitis, atherosclerosis, cardiovascular pathology, cerebrovascular pathology, neurodegenerative conditions, arthritis, osteoporosis, skeletal muscle wasting conditions and/or sarcopenia.
  • Strenuous physical exercises and/or other physical and/or stress challenges may also be associated with carotenoid deficiency, particularly a carotene deficiency such as a lycopene deficiency.
  • compositions as described herein comprise, for instance, one or more pharmaceutically or nutraceutically acceptable carriers, excipients, buffers, adjuvants, stabilizers, or other materials, as described herein.
  • pharmaceutically acceptable typically pertains to compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgement, suitable for use in contact with the tissues of a subject (e.g., human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • Each carrier, excipient, etc. must also be “acceptable” in the sense of being compatible with the other ingredients of the formulation. Suitable carriers, excipients, etc. can be found in standard pharmaceutical texts, for example, Remington's Pharmaceutical Sciences, 18th edition, Mack Publishing Company, Easton, Pa., 1990.
  • GRAS Generally Recognized as Safe
  • formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy, food science or nutrition. Such methods include the step of incorporating a carrier which may constitute one or more accessory ingredients.
  • Formulations may be in the form of food products, beverages, liquids, solutions, suspensions, emulsions, elixirs, syrups, tablets, lozenges, granules, powders, capsules, cachets, pills, ampoules, ointments, gels, pastes, creams, sprays, mists, foams, lotions, oils, boluses, electuaries, or aerosols.
  • a composition of the invention may be preferably in a form which is suitable for administration orally for delivery via the gastro-intestinal tract.
  • Formulations suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active compound; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion; as a bolus; as an electuary; or as a paste.
  • a formulation of the invention may be provided in a capsule, hence the present invention provides a capsule comprising a composition of the invention.
  • Formulations of the invention will, in particular, be suitable for oral administration. Oral administration is the most preferred route of administration for the invention.
  • a tablet may be made by conventional means, e.g. , compression or molding, optionally with one or more accessory ingredients.
  • Compressed tablets may be prepared by compressing in a suitable machine the active compound in a free-flowing form such as a powder or granules, optionally mixed with one or more binders (e.g., povidone, gelatin, acacia, sorbitol, tragacanth, hydroxypropylmethyl cellulose); fillers or diluents (e.g., lactose, microcrystalline cellulose, calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc, silica); disintegrants (e.g., sodium starch glycolate, cross- linked povidone, cross-linked sodium carboxymethyl cellulose); surface-active or dispersing or wetting agents (e.g., sodium lauryl sulfate); and preservatives (e.g., methyl p-hydroxybenzoate, propy
  • Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
  • the tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active compound therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile.
  • Compositions for oral administration may further comprise sweeteners, texture modifiers, colorings and flavorings.
  • compositions or “nutritional supplements.”
  • any of the compositions described herein may be provided as a nutritional composition or supplement.
  • a composition of the invention may be a "nutraceutical” and that term may include: food products, foodstuffs, dietary supplements, nutritional supplements or a supplement composition for a food product or a foodstuff.
  • composition as defined herein may be provided in an enteric soft capsule shell.
  • the shell of a capsule may be, for instance, made of naturally occurring ingredients.
  • the composition of the invention may be taken by an individual after a meal.
  • a composition of the invention may be, for instance, given on a daily basis, for examples after meals, or for instance at any appropriate intervals such as at weekly, fortnightly or monthly intervals.
  • a composition as defined herein may be one that does not need to be prescribed by a doctor to be administered.
  • a composition as defined herein is a supplement. It may be that the composition is one sold as an over the counter medicine. It may be that the composition is a nutraceutical.
  • a composition is not one that requires regulatory approval prior to marketing. However, the invention may be also applied to pharmaceutical products, such as those that have to be prescribed.
  • a composition may be one with an active agent such as that the composition requires regulatory approval.
  • the term "effective amount” refers to a quantity sufficient to achieve a desired effect and in particular a desired therapeutic and/or prophylactic effect.
  • a “therapeutically effective amount” may be, for instance, the amount needed to reduce or eliminate the presence, frequency, or severity of one or more signs, or symptoms of the conditions mentioned herein.
  • the amount of a formulation administered to the subject will depend on the type, degree, and severity of the disease and on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs. The skilled person will be able to determine appropriate dosages depending on these and other factors.
  • an oral pharmaceutical dosage form comprising any of the compositions described herein, particular a capsule comprising one of the compositions described herein, particularly a capsule provided a daily dose of the composition as described herein.
  • compositions as defined herein may be administered.
  • the carotenoid especially a carotene such as lycopene, may be
  • a composition provides at least about 7mg of a carotenoid, especially a carotene such as lycopene.
  • a composition of the invention may be in unit dose form, and so provide the recommended daily amount of a carotenoid, especially a carotene such as lycopene.
  • the invention also provides a pharmaceutical composition comprising an antibody of the invention.
  • kits for performing the assays of the invention will comprise an antibody of the invention.
  • an antibody of the invention is used to detect carotenoids, especially xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or carotenes such as lycopene, bound to an immobilized antibody of the invention, the antibody may be labelled as discussed herein or be able to bind a label as discussed herein.
  • the kits may also comprise a support for performing the assay of the invention and any of those discussed herein.
  • the kit may comprise a support with the antibody of the invention already immobilized on it or in some instances the two may be separate allowing the user to immobilize the antibody and in such instances the kit may also comprise means for immobilizing the antibody on the support.
  • a kit of the invention may also comprise a standard solution of carotenoid, especially xanthophylls such as lutein, astaxanthin meso-zeaxanthin or zeaxanthin or carotenes such as lycopene, for use as a calibration or as a positive control.
  • the present invention also provides immunocomplexes comprising one or more carotenoid(s) or derivative(s) thereof and one or more antibodies.
  • the one or more carotenoid(s) or derivative(s) thereof may be directly or indirectly joined (i.e., conjugated) to the one or more antibodies.
  • the antibody of the immunocomplex may be any antibody.
  • the antibody may comprise a complete antibody (immunoglobulin) molecule (including polyclonal, monoclonal, chimeric, humanized, and/or human versions having full length heavy and/or light chains), or comprise an antigen binding fragment thereof.
  • Antibody fragments include F(ab') 2 , Fab, Fab', Fv, Fc, and Fd fragments, and can be incorporated into single domain antibodies (e.g., nanobodies), single-chain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, Nature Biotechnology, 23(9): 1126-1136 (2005).
  • the antibody fragment may be any synthetic or genetically engineered protein.
  • antibody fragments include isolated fragments consisting of the light chain variable region, "Fv” fragments consisting of the variable regions of the heavy and light chains, and recombinant single chain polypeptide molecules in which light and heavy variable regions are connected by a peptide linker (scFv proteins).
  • the antibody may be any class of antibody such as IgG, IgM, IgA, IgD or IgE, particularly IgM or an IgG antibody, but in a preferred instance the antibody is an IgM antibody.
  • the antibody may be, in some instance, an IgGl, IgG2, IgG3, or IgG4 class antibody.
  • the antibody is against a carotenoid or an antigen binding fragment of such an antibody.
  • the antibody is against xanthophylls such as lutein, astaxanthin, meso-zeaxanthin or zeaxanthin or against carotenes such as lycopene, beta carotene or alpha carotene.
  • the antibody or antigen-binding fragment binds specifically to the carotenoid(s) or derivative(s) thereof.
  • the antibody or antigen-binding fragment binds specifically to one type of carotenoid only in the immunocomplex or preferentially binds to a single carotenoid in the immunocomplex, such as with, for instance, ten, twenty, one hundred or one thousand fold greater affinity for the specific carotenoid than others.
  • an antibody against lutein of the immunocomplex binds specifically to any lutein, but does not specifically bind to any other carotenoid such as astaxanthin, meso-zeaxanthin, zeaxanthin, lycopene, beta-carotene, alpha-carotene or zeto- carotene;
  • an antibody against astaxanthin of the immunocomplex binds specifically to any astaxanthin, but does not specifically bind to any other carotenoid such as lutein, meso-zeaxanthin, zeaxanthin, lycopene, beta-carotene, alpha-carotene or zeto- carotene;
  • an antibody against meso-zeaxanthin of the immunocomplex binds specifically to any meso-zeaxanthin, but does not specifically bind to any other carotenoid such as lutein, astaxanthin, zeaxanthin, lycopene,
  • the antibody is a monoclonal antibody or an antigen binding fragment of such a monoclonal antibody.
  • the antibody or antigen binding fragment of the immunocomplex is a monoclonal antibody or an antigen binding fragment of such a monoclonal antibody.
  • the antibody or antigen binding fragment of the immunocomplex is a monoclonal antibody or an antigen binding fragment of such a monoclonal antibody.
  • the antibody or antigen binding fragment of the immunocomplex is a monoclonal antibody or an antigen binding fragment of such a monoclonal antibody.
  • (b) is one that binds the same epitope of an antibody or antigen binding fragment of (a);
  • (c) is one that cross-blocks an antibody of (a);
  • (d) comprises a heavy chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 1;
  • (e) comprises a light chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 2;
  • (f) comprises a heavy chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 3;
  • (g) comprises a light chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 4;
  • (h) comprises a heavy chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 5;
  • (i) comprises a light chain variable region having a sequence at least 85%, 90%, 95%, 98%, 99% or 100% identical to SEQ ID NO: 6.
  • the carotenoid or derivative of the immunocomplex may be any carotenoid or derivative as discussed above.
  • the carotenoid may be any carotene including but not limited to lycopene, beta carotene or alpha carotene.
  • the carotenoid may be any xanthophyll including but not limited to lutein, astaxanthin, meso- zeaxanthin.
  • the carotenoid is typically a carotene (such as lycopene).
  • the anti-carotene antibody (such as an anti- lycopene antibody) preferably specifically binds to a carotene (such as lycopene) but does not bind specifically to any other carotenoid.
  • the antibody of the immunocomplex is an anti -xanthophyll antibody (such as an anti-lutein antibody)
  • the carotenoid is typically a xanthophyll (such as lutein).
  • the anti- xanthophyll antibody (such as an anti-lutein antibody) preferably specifically binds to a xanthophyll (such as lutein) but does not bind specifically to any other carotenoid.
  • the carotenoid is lycopene and the antibody or antigen-binding fragment is an anti-lycopene antibody as defined above.
  • the carotenoid of the composition may be lutein and the antibody or antigen-binding fragment of the composition is an anti-lutein antibody as defined above.
  • the antibody or antigen-binding fragment of the invention (such as an anti-lycopene antibody or anti-lutein antibody) forms a direct immune complex with the one or more carotenoids (such as lycopene or lutein).
  • the carotenoid or derivative thereof of the carotenoid or derivative thereof of the carotenoid
  • the immunocomplex is itself a cargo molecule, i.e., the agent of interest that is being delivered to a specific cell, cell compartment or tissue of interest.
  • the immunocomplex comprises one or more (further) cargo molecules.
  • the immunocomplex of antibody and carotenoid may be used to facilitate the delivery of one or more (further) cargo molecules of interest.
  • the (further) cargo molecules may be any compound, agent, drug or other product or combination thereof to be delivered to the blood stream or a target cell, cell compartment or tissue.
  • the cargo molecule will be a therapeutic or nutritional compound, such as a pharmaceutical, nutraceutical or a dietary or nutritional supplement.
  • Cargo molecules which are labile in the gastro-intestinal tract or poorly absorbed by the gastro-intestinal tract are especially suitable for incorporation into carotenoid particles.
  • Suitable cargo molecules include products of the fermentation, oxidation, processing or degradation of foods such as meat, fish, dairy, grain, bean, honey, tea or other foodstuffs or beverages.
  • Products may include whey protein or peptides, carbohydrates, such as poly- or oligosaccharides, lipids, flavones, and other food derived bioactive molecules.
  • Bioactive molecules may, for example, include antimicrobial peptides, defensins, cathelidins, whey acid proteins, bioactive fragments of food proteins; and peptides which display one or more of protease inhibiting, bactericidic, metabolic, anti -inflammatory, immune-stimulating, coagulation, angiogenesis and proliferation control activities, or exert a beneficial effect on neurotransmitters, angiotensin, hormones and/or other signaling pathways.
  • Suitable cargo molecules also include products of probiotic bacteria, yeast or other microbial metabolism, or the metabolism of fungi or molds, in particular organisms which are used in food and beverage manufacturing or are associated therewith. Examples include bacteria such as Lactobacilli spp. for example L. acidophilus, L. casei, L. lactis, L.
  • Lactococci such as L. raffinolactis
  • Bifidobacteria such as B. animalis, B. breve and B. longu
  • E. coli such as E. coliM-17, E. coli Nissle 1917
  • Enterococci such as
  • soyae A. sojae, A. niger, A. terreus, A. tamari and A.flavus
  • Monascus spp such as M. pupureus, M. ruber, and M. pilosus
  • Penicillium spp such as P. chrysogenum, P.roqueforti, P. glaucum, P.candidum, P.camemberti, P.paneum, P.geotrichum, P.solitum, P.nalgiovense, P. ses, P.olsonii,
  • Rhizopus spp such as R. artocarpi, R. nigricans, R. oligosporus, R. oryzae and R. stolonifer;
  • Neurospora spp such as N. sitophilia and N. intermedia; and Fusarium venenatum.
  • Suitable cargo molecules include lecithin, carbohydrates; amino acids; flavones, such as luteolin, apigenin, and tangeritin; flavonols, such as quercetin, rutin, kaempferol, myricetin, fisetin, isorhamnetin, pachypodol and rhamnazin; flavanones, such as hesperetin, naringenin, eriodictyol and homoeriodictyol; flavanonols, such as taxifolin (or dihydroquercetin), and dihydrokaempferol; isoflavones, such as genistein, daidzein and glycitein; catechins, gallocatechin, catechin 3-gallate, gallocatechin 3- gallate, epicatechins, epigallocatechin, epicatechin 3-gallate, flavon-3-ols such as epigallocatechin 3-gallate; proanthocyanidins,
  • vitamins such as niacin (vitamin B3), folic acid (vitamin B9), ascorbic acid (vitamin C), riboflavin (vitamin B2), thiamine (vitamin B l), calciferol (vitamin D), cobalamins (vitamin 12), vitamin K such as phylloquinone (vitamin Kl) or K2, pantothenic acid (vitamin B5), biotin (vitamin B7) and pyridoxine (vitamin B6), minerals, such as calcium, selenium, chromium, magnesium, iron, zinc, copper and other metal ions; penicillins, cephalosporins, cardapenems, sulphonamides, quinolones, oxazodinones, macrolides and other antibiotics, anti-viral, anti-fungi,and anti-parasite drugs, in particular drugs targeting liver and other organs which express carotenoid receptors, such as liver, adrenal
  • the immunocomplex of the invention is formed by the carotenoids or derivatives thereof binding to (i) the antibody or antigen-binding fragment, and (ii) the one or more cargo molecules.
  • the immune complex is formed by (i) the carotenoids or derivatives thereof binding to the antibody or antigen-binding fragment and (ii) the antibody or antigen-binding fragment binding to the one or more cargo molecules.
  • the immunocomplex of the invention includes one or more additional chaperone and/or other molecules.
  • the immunocomplex of the invention may further comprise one or more phospholipids.
  • the phospholipid is phosphatidylcholine.
  • the ratio of carotenoid to phospholipid is about 1 : 1, about 2: 1, about 3 : 1, about 4: 1, about 5: 1 or more.
  • the ratio of carotenoid to phospholipid is about 3 : 1 or more.
  • the carotenoid is lycopene, lutein, alpha carotene, beta carotene, astaxanthin, meso-zeaxanthin or zeaxanthin at a ratio of about 3 : 1 or more with a phospholipid such as phosphatidylcholine.
  • the carotenoid is lycopene, lutein, alpha carotene, beta carotene, astaxanthin, meso-zeaxanthin or zeaxanthin at a ratio of about 3 : 1 or more with a phospholipid such as phosphatidyl
  • phospholipids interact with the carotenoids to form stable carotenoid-phospholipid complexes.
  • the immunocomplex of the invention comprises: - any carotene, any anti-carotene antibody and phosphatidylcholine, typically wherein the ratio of carotene to phosphatidylcholine is about 3 : 1 or more;
  • any xanthophyll any anti-xanthophyll antibody and phosphatidylcholine, typically wherein the ratio of xanthophyll to phosphatidylcholine is about 3 : 1 or more;
  • any anti-lycopene antibody and phosphatidylcholine typically wherein the ratio of lycopene to phosphatidylcholine is about 3 : 1 or more;
  • any anti- beta carotene antibody and phosphatidylcholine typically wherein the ratio of lycopene to beta carotene is about 3 : 1 or more;
  • any anti- alpha carotene antibody and phosphatidylcholine typically wherein the ratio of alpha carotene to phosphatidylcholine is about 3 : 1 or more;
  • any anti- lutein antibody and phosphatidylcholine typically wherein the ratio of lutein to phosphatidylcholine is about 3 : 1 or more;
  • any anti astaxanthin antibody and phosphatidylcholine typically wherein the ratio of astaxanthin to phosphatidylcholine is about 3 : 1 or more;
  • any anti-meso-zeaxanthin antibody and phosphatidylcholine typically wherein the ratio of meso-zeaxanthin to phosphatidylcholine is about 3 : 1 or more;
  • any anti-zeaxanthin antibody and phosphatidylcholine typically wherein the ratio of zeaxanthin to phosphatidylcholine is about 3 : 1 or more.
  • the immunocomplex of the invention may also comprise benzene and/or one or more carboxylic acids.
  • the immunocomplex of the invention comprises one or more aromatic carboxylic acids such as benzoic acid, salicylic acid, gallic acid, toluic acid, phtalic acid, isophthalic acid or terephtalic acid.
  • the immunocomplex of the invention may comprise one or more alcohols.
  • the immunocomplex of the invention comprises one or more alcohols selected from methanol, ethanol, propanol or butanol.
  • the ratio of core molecules to carotenoid is about 1 :5, about 1 :6, about 1 :7, about 1 :8, about 1 :9, about 1 : 10 or more. In preferred embodiments, the ratio of core molecules to carotenoid is about 1 : 10 or more. In other words, there is preferably a molar excess of the one or more carotenoids as compared to the one or more cargo molecules.
  • the immunocomplex of the invention comprises: - lycopene, an anti-lycopene antibody and aromatic carboxylic acids and/or alcohol, typically wherein the ratio of aromatic carboxylic acids and/or alcohol to lycopene is 1 : 10 or more;
  • -beta carotene an anti-beta carotene antibody
  • aromatic carboxylic acids and/or alcohol typically wherein the ratio of aromatic carboxylic acids and/or alcohol to beta carotene is 1 : 10 or more;
  • alpha carotene an anti-alpha carotene antibody and aromatic carboxylic acids and/or alcohol, typically wherein the ratio of aromatic carboxylic acids and/or alcohol to alpha carotene is 1 : 10 or more;
  • - lutein an anti -lutein antibody and aromatic carboxylic acids and/or alcohol, typically wherein the ratio of aromatic carboxylic acids and/or alcohol to lutein is 1 : 10 or more;
  • an anti-astaxanthin antibody typically wherein the ratio of aromatic carboxylic acids and/or alcohol to astaxanthin is 1 : 10 or more;
  • - meso-zeaxanthin an anti-meso-zeaxanthin antibody and aromatic carboxylic acids and/or alcohol, typically wherein the ratio of aromatic carboxylic acids and/or alcohol to meso-zeaxanthin is 1 : 10 or more;
  • -zeaxanthin an anti-zeaxanthin antibody and aromatic carboxylic acids and/or alcohol, typically wherein the ratio of aromatic carboxylic acids and/or alcohol to zeaxanthin is 1 : 10 or more.
  • the immunocomplex of the invention preferably further comprises a phospholipid such as phosphatidylcholine, typically wherein the ratio of carotenoid to phosphatidylcholine is about 3 : 1 or more.
  • a phospholipid such as phosphatidylcholine, typically wherein the ratio of carotenoid to phosphatidylcholine is about 3 : 1 or more.
  • the carotenoids or derivatives thereof encapsulate the cargo molecules.
  • an outer layer of carotenoids typically surrounds or substantially surrounds an inner layer of the one or more cargo molecules.
  • the carotenoids or derivatives thereof and phospholipids such as phosphatidylcholine encapsulate the cargo molecules.
  • an outer layer of carotenoids and phospholipids such as phosphatidylcholine surround or substantially surround an inner layer of the one or more cargo molecules.
  • the carotenoids or derivatives thereof form a dendrimer or dendrimer-like structure.
  • a dendrimer or dendrimer-like structure comprises a dendrimer core, an interior structure (comprising the branches) and an exterior surface with functional surface groups.
  • Dendrimers can be synthesized to have different functionality of each of the core, interior structure and exterior surface to control properties such solubility, thermal solubility and/or attachment of cargo molecules for any particular application.
  • dendrimers are unimolecular architectural nano or micro-particle entities which can accommodate various cargo molecules (i.e., nutraceuticals and pharmaceuticals) between their branches (dendrons) and provide targeted delivery of biomimetics into different tissues upon addition of functionalized groups to the dendrimer' s surface.
  • cargo molecules i.e., nutraceuticals and pharmaceuticals
  • branches dendrons
  • Covalent binding, hydrogen bonds and electrostatic interactions between dendrimer-composing molecules are known to form and stabilize dendrimer structure.
  • dendrimers of the invention comprise:
  • a dendrimer core typically comprising alky-diamines, polyethylene glycol, thiophosphorly chloride or hexachlorocyclotriphosphazene;
  • an interior structure of radially branched dendrons i.e., branched or hyper- branched arms
  • an exterior surface which is typically conjugated to the antibodies to form the immunocomplex.
  • the dendrimers of the invention can also accommodate any cargo molecule as listed above.
  • one or more cargo molecules are incorporated between the radially branched dendrons.
  • Figure 18C depicts a typical dendrimer structure including the dendrimer core, as well as radially branched dendrons (i.e., peripheral chains with aromatic rings).
  • the one or more cargo molecules of the invention (as depicted in Figure 18C as black dots) are preferably incorporated between the dendrons. Hyper-branching promotes the capacity of dendrimers to accommodate such cargo molecules.
  • the cargo molecule acts to stabilize the dendrimer structure during controlled and/or spontaneous dendrimer assembly.
  • the dendrimers of the invention may be of any size, depending on the density of the dendrons and their length.
  • the dendrimers of the invention may also be of any shape, but are typically spherical or globular.
  • the dendrimers of the invention typically have a structure such as that depicted in Figure 18B, with a dendrimer core (i.e., central part), as well as radially branched dendrons (i.e., radially expanding peripheral chains with aromatic rings).
  • dendrons may include an exterior surface with functional groups predetermining the binding capacity of dendrimers.
  • the dendrimers of the invention also comprise one or more chaperones.
  • the chaperones are phospholipids such as phosphatidylcholine.
  • the phospholipids may form a complex with the one or more carotenoids as depicted in Figure 19.
  • the chaperone molecule (such as phosphatidylcholine) acts to stabilize the dendrimer structure during controlled and/or spontaneous dendrimer assembly. Hyper-branching promotes the capacity of dendrimers to accommodate chaperones such as phosphatidylcholine.
  • the molecular assembly of dendrimers may readily be performed in a step-wise manner.
  • the active groups of core molecule(s) may interact with functional or quiescent groups of monomer molecules which results in the formation of the first generation dendrimer.
  • terminal molecules of the branches may engage in electrostatic or covalent association with free monomer molecules leading to progressive dendron extension and the formation of higher generation dendrimers.
  • the dendron extension process resembles to some degree a cascade reaction taking place during 'in vitro' peptide synthesis.
  • the skilled person would understand appropriate conditions for the self-assembly or controlled assembly of the dendrimers of the invention, depending on the particular carotenoids used.
  • methods of producing dendrimers of the invention comprise:
  • carotenoid dendrimers may be synthesized using mono-esters of carotenoids such as lycopene or lutein. Esterification reactions (such as stegler esterification) may be performed for example at room temperature using dicyclohexylcarbomide as a coupling agent and 4-dimeihylaminopyridine as catalyst. Hydroxy-carotenoids may then be reacted with succinic anhydride and resulting monoesters used for dimer synthesis. First generation dendrimers may then be synthesized by conjugation of carotenoid diesters with aromatic carboxylic acids and alcohols. The molar ratio between such core-forming molecules and lycopene is preferably approximately 1 : 10, suggesting that excess of carotenoid is required for the efficient formation of covalent bonds.
  • the first-generation dendrimers produced by such methods may then be purified by any techniques such as high-performance liquid chromatography and extended in the presence of the carotenoid (such as lycopene or lutein) and phosphatidylcholine, typically added to reaction mixture at a ratio of approximately 1 :3 respectively. Any techniques such as mechanical dispersion, sonication and/or solvent evaporation may then be used for dendrimer extension.
  • carotenoid such as lycopene or lutein
  • phosphatidylcholine typically added to reaction mixture at a ratio of approximately 1 :3 respectively.
  • Any techniques such as mechanical dispersion, sonication and/or solvent evaporation may then be used for dendrimer extension.
  • the higher level dendrimers produced by such methods may be conjugated to any antibody by any method known in the art.
  • passive non-covalent conjugation of carotenoid-containing dendrimers with an antibody specific for the carotenoid may be performed to produce an immunocomplex of the invention.
  • polar carotenoids such as astaxanthin or lutein
  • chaperone assisted non-polar carotenoids such as lycopene or beta-carotene
  • the dendrimers of the invention may act to increase the activity and/or bioavailability of the one or more further cargo molecules, and can be effectively used for optimized delivery of biologically active compounds in a subject.
  • the antibody or antigen-binding fragment of the immunocomplex binds to Fc receptors expressed in the specific cell, cell compartment or tissue that the carotenoids or derivatives thereof (and/or cargo molecules) are being delivered.
  • the carotenoids or derivatives thereof of the composition bind to carotenoid receptors expressed in the specific cell, cell compartment or tissue that the carotenoids or derivatives thereof (and/or cargo molecules) are being delivered.
  • the immunocomplex of the invention is capable of the targeted delivery of carotenoids or derivatives (and/or any further cargo molecules of interest) to specific cells, cell compartments or tissue.
  • the present invention provides any immunocomplex as defined above for use in a method of increasing the bioavailability and/or activity of a carotenoid or derivative thereof and/or a cargo molecule.
  • increasing bioavailability may be used as a way to: (i) increase the amount of the cargo molecules (i.e., active agents) reaching the preferred target; and/or (ii) reduce the amount of cargo molecules (i.e. active agents) that need to be administered in the first place, for instance to achieve a given effect.
  • It may be administration of a composition of the invention increases bioavailability by, for instance, at least 10%, at least 25%, at least 50% or at least 100%. In some instances, the invention may bring about at least a doubling of bioavailability.
  • the level of increase may be, for instance, at least three, four, five, six or seven fold.
  • the level of bioavailability may be increased, for example, at least ten-fold.
  • the level of increase may be, for instance, between any pair of the above mentioned values, for instance from 10% to ten -fold, from 25% to five-fold and so on.
  • Bioavailability may be, for instance, measured in terms of the proportion of cargo molecules that enter the systemic circulation and in particular the portion in the systemic circulation which is able to have a physiological effect.
  • An increase in bioavailability may be taken as the amount of cargo molecules (i.e., active agents) that enter the systemic circulation compared to the amount when the cargo molecules are administered in a composition which lacks the antibodies present in the composition. So, for instance, the comparison may be between an immunocomplex of the invention comprising antibodies and the equivalent composition lacking the antibodies and administered via the same route.
  • An equivalent composition may also be referred to as a reference composition. In preferred embodiments the composition of the invention is administered orally.
  • bioavailability is assessed by measuring the amount of the cargo molecules in the systemic circulation following administration of an immunocomplex of the invention.
  • bioavailability is assessed by measuring the serum concentration of a cargo molecule of interest following oral administration. It may be that such measurement is performed at several time points, for instance once a day or once a week to assess the level of agent, for example in the blood stream.
  • serum concentration may be compared before oral consumption of a composition of the invention and then after 1, 2, 3 or 4 weeks, particularly after 2 and/or 4 weeks and in particular after 2 weeks.
  • the level of bioavailability may be that measured hours after
  • administration for instance after 1, 2, 3, 4, 5 or 6 hours after administration.
  • the present invention also provides an immunocomplex for use in a method of facilitating the delivery of a carotenoid or derivative thereof and/or a cargo molecule to a specific cell, cell compartment or tissue.
  • the composition enhances cellular uptake.
  • the composition leads to the accumulation and/or increased stability of the carotenoid and/or cargo molecule in specific cells, cell compartments or tissue.
  • the immunocomplexes of the invention may prevent the one or more cargo molecules being targeted by membrane-associated P-glycoprotein, which is a major factor of drug resistance in tumor cells.
  • compositions of the invention may incorporate mAb fragments with higher binding capacity to the membrane receptors and higher affinity to the target molecule to increase the bioavailability of "cargo" molecules being transported so open new doors in nano-delivery technologies.
  • the specific cell, cell compartment or tissue may be, for instance a cell or tissue of the liver, prostate, adrenal glands, brain, blood, skin, skeletal muscles, nerves, spinal cord, heart, liver, kidneys, stomach, small intestine, duodenum, muscles, lung, pancreas, intestine, bladder, reproductive organs, bones, tendons, or other internal organs.
  • the specific cell, cell compartment or tissue is a cell or tissue of the liver.
  • the specific cell, cell compartment or tissue is of the prostate or adrenal glands.
  • the composition increases the amount of cargo molecules (such as carotenoids or any further cargo molecules) reaching cells or tissue where the expression of carotenoid-binding receptors is highest.
  • the immunocomplex increases the amount of cargo molecules (such as carotenoids or cargo molecules) reaching hepatic cells, adrenal gland cells or prostate cells.
  • the immunocomplex is used for organ- specific delivery of pharmaceuticals or nutraceuticals in patients with pathologies affecting the liver, prostate and adrenal glands.
  • the antibody or antigen-binding fragment binds to the carotenoid or derivative thereof and/or cargo molecule after being administered to the subject.
  • the carotenoids such as lycopene or lutein
  • cargo molecules may already be present in a medium such as circulating plasma of the subject.
  • the antibody or antigen-binding fragment binds to the carotenoid or derivative thereof and/or cargo molecule prior to being administered to the subject.
  • carotenoids such as lycopene or lutein
  • cargo molecules may not be present or only be present in low levels in a medium such as circulating plasma of the subject.
  • the immunocomplex of the invention may be used in medicine.
  • the immunocomplex of the invention may be used to treat or prevent any inherited or acquired pathology or disease.
  • the invention provides a method of treating or preventing an obligate intracellular bacterial infection in an individual, comprising administering a therapeutically or prophylactically effective amount of an immunocomplex of the invention comprising lycopene, and thereby treating or preventing the infection.
  • the invention provides a method of treating or preventing any bacterial infection wherein the bacteria cannot reproduce outside it's host cell, meaning that it's reproduction is entirely reliant on intracellular resources.
  • the bacterial infection is caused by Chlamydiae, Rickettsia, Ehrlichia and/or Coxiella.
  • Obligate intracellular bacterial infections such as Chlamydia and/or conditions associated with obligate intracellular bacterial infections are also associated with tissue hypoxia, impaired microcirculation, pre-tension and/or hypertension in the infected individual.
  • the administration of a therapeutically or prophylactically effective amount of a composition of the invention may reduce or inhibit tissue hypoxia, impaired microcirculation, pre-tension and/or hypertension, thereby restoring such parameters to their physiological norm.
  • the invention also provides a method of treating or preventing a functional carotenoid deficiency in an individual, comprising administering a therapeutically or prophylactically effective amount of the immunocomplex of the invention, and thereby treating or preventing the functional carotenoid deficiency.
  • Any individual may have a functional carotenoid deficiency.
  • lipoprotein metabolism may be compromised by ageing, and individuals older than approximately 50 years may lose the ability to assemble new lipoproteins. This may lead to functional carotenoid deficiency, leading to age-associated subclinical inflammation and oxidation, especially in cells such as enterocytes and hepatocytes and associated tissues where these processes occur.
  • the invention therefore provides a method of increasing the bioavailability of carotenoids by administering a therapeutically or prophylactic effective amount of the immunocomplex of the invention.
  • the individual having a functional carotenoid deficiency is at least approximately 50, at least approximately 55, at least approximately 60, at least approximately 65, at least approximately 70 years in age or more.
  • the individual having a functional carotenoid deficiency is not infected with an obligate intracellular bacteria and/or the individual does not display any symptoms of the bacterial infection.
  • the individual having a functional carotenoid deficiency is infected with an obligate intracellular bacteria and/or the individual displays symptoms of the bacterial infection.
  • an individual who is infected with an obligate intracellular bacteria and/or who displays symptoms of the bacterial infection has increased serum titer of antibodies against the bacterial infection, as compared to one or more control serum samples.
  • anti -carotenoid antibodies, or their fragments can be associated with antibodies, or their fragments, with specificity against other targets on the cellular membrane, intra-cellular targets, or inter-cellular tissues, rather than carotenoid or Fc receptors. This would allow these chimeric antibody-carotenoid complexes to be delivered to the specific cells and tissues where carotenoids can physiological support or necessary treatment.
  • anti -carotenoid antibodies, or their fragments can be associated with antibodies, or their fragments, with specificity against other bioactive molecules, agents or drugs. This would allow carotenoid-antibody complexes to be used as a delivery vehicle for these active molecules, agents and drugs to cells and tissues with carotenoid and / or Fc receptors.
  • immunocomplex of the invention as described above may be administered in the methods described herein.
  • the immunocomplexes of the invention are employed as supplements, such as nutritional supplements or
  • the individual may be a healthy individual.
  • immunocomplexes of the invention may be used
  • treatment may include, for instance, elimination of a condition or reducing the severity of the condition. It may, for instance, involve elimination or reduction of a symptom or symptoms of the condition. Treatment may include bringing about regression of a disorder.
  • the effect of administering a carotenoid (such as lycopene) and an antibody is a synergistic effect than if the same amount of a composition was administered by adding a carotenoid (such as lycopene) or antibody individually.
  • the immunocomplex of the invention comprises lycopene and the disease or pathology that is treated affects the liver, prostate or adrenal glands.
  • the immunocomplex comprises resveratrol and the disease or pathology is elevated cholesterol and/or triglycerides, diabetes, cardio- and cerebro- vascular disease, cancer, acute and chronic bacterial, fungal and viral infections, neurodegenerative diseases, gastrointestinal tract disease, connective tissue disease, arthritis, or an inflammatory condition.
  • the immunocomplex comprises whey protein and the disease or pathology is elevated serum cholesterol, elevated serum triglyceride or infections.
  • the composition comprises statin and the disease or pathology is cardiovascular disease, dementia, hypertension, cancer, cataracts or elevated serum cholesterol levels.
  • the immunocomplex comprises isoflavone and the disease or pathology is elevated cholesterol and/or triglycerides, diabetes, cardio- and cerebro- vascular disease, cancer, neurodegenerative disease, connective tissue disease, and inflammatory condition.
  • the invention may be applied to any suitable individual.
  • the individual may be an individual organism, a vertebrate, a mammal, or a human.
  • the invention is applied to a human.
  • the invention may, for instance, also be applied to non-human animals, such a pets or commercial animals.
  • Such animals include, for instance, dogs, cats, cattle, pigs and sheep.
  • the individual may be elderly, for instance over 50, 55, 60, 65, 70, 75 or 80 years of age.
  • the subject may be male or female. In some instances, the subject is pregnant.
  • Example 1 The generation of antibodies against carotenoids
  • Lycopene-Gold Conjugate Lycopene-Gold Conjugate.
  • Lycopene-gold conjugate was used for the immunization protocol.
  • Colloidal gold nanoparticles (G Ps) with a size of 15 or 30 nm (G P15 or G P30 respectively) were prepared as described [2, 3, 4]. Briefly, 0.5 ml of 1% HAuC14 was added to 48.0 ml of boiling water and stirred for 2 minutes. Addition of a 1% solution of sodium citrate was made immediately. To achieve the formation of particles with a size of 15 nm, 1.5ml of sodium citrate was added. Particles with a size of 30 nm were obtained by addition of 0.72 ml of sodium citrate. The reaction mixture was boiled for 20 minutes and cooled down to room temperature.
  • the GNPs solution was mixed with lycopene-EtOH at a ratio 5: 1 (v/v) and kept at room temperature for 20 minutes.
  • the conjugate obtained was immediately used for immunization injections.
  • Serum evaluation Serum specimens from the immunised mice were routinely screened using indirect ELISA after the second round of immunisation.
  • ELISA microplates (Greiner Bio-One 96-well) were coated at room temperature for 2 h and at 4°C overnight, with t-LC ( ⁇ per well of 10 mg/mL in ethanol). Plates were washed 3 times with PBST. Control sera from non-immunized mice and sera from immunized mice were diluted with PBST supplemented with 1 mg/mL BSA. 100 mL serial dilutions ranging from 1 : 1000 to 1 : 128,000 were pipetted into the wells of the ELISA plates, with further incubation of the plates at 37°C for 1 hour. After three washes with PBST, addition of peroxidase-labeled goat antibody against mouse IgG was made.
  • TMB tetramethylbenzidine
  • Hybridoma construction After 72 hours following the final intravenous boost, the spleens of anesthetized mice (positive responders) were removed and dispersed and the resulting splenocytes were fused with Sp-2 cells and incubated in HAT medium according to the conventional protocol [3]. Positive wells were inspected microscopically for cluster formation and the supernatants were tested for antibody presence by indirect ELISA. Positive clones were sub-cloned by limiting dilution protocol using spleen feeders. Antibodies were isotyped with a mouse monoclonal antibody isotyping reagent (Sigma-Aldrich, USA). The hybridoma cell lines were submitted and deposited at the Institute of Genetics and Selection of Genetics and Selection of Industrial Microorganisms (VKPM H-171 and H-172).
  • the competitor and primary antibody were co-incubated for 1 hour at 37°C with occasional gentle shaking of the plate.
  • the further processing of the plates included washing and addition of TMB as described above.
  • a competition assay for each serum specimen was done in duplicate. The readings were used to calculate the inhibition value (Cinh) according to:
  • Cinh 100 - [(A450 + ,-LC / A450 - , -LC) ⁇ 100];
  • A450 + MX is the optical density at 450 nm in the wells with t-LC added versus the well with no addition of t-LC (A450 - MX).
  • a similar format of indirect competitive ELISA was used for the evaluation of IgG produced by hybridoma clones.
  • Standard curve generation t-LC with colloidal gold was used as a coating agent for an indirect competitive ELISA as described above. Serum specimens obtained from immunized mice were used as a source of primary antibody. Increasing concentrations of non-conjugated t-LC mixed with aliquots of sera were pre-incubated on ice for 1 hour before inoculation into the wells of the ELISA microplate. All ELISA reactions for standard curve generation were performed in duplicate and were repeated three times. The mean values for the calibration curve within the linear range were fitted using linear regression analysis.
  • Validation of f-LC-specific antibody was also performed by immunofluorescence analysis in cultured cells incubated with oil- formulated lycopene.
  • Stock oil solutions of lycopene (15%) were purchased from LycoRed (Basel, Switzerland) and kept at - 20°C.
  • the stock solution was dissolved in DMSO at concentrations of 0.75, 1.5 and 3.0 ⁇ / ⁇ 1.
  • C B10.MLM a cell line of alveolar macrophages, was obtained from Prof. AS Apt (Institute of Tuberculosis, Moscow, Russian Federation). Cells were grown in 5% C0 2 in DMEM supplemented with 2 mM glutamine and 10% FCS.
  • B10.MLM cells grown on coverslips were incubated with lycopene for 46 hours. Cells were then washed with PBS twice, fixed with 3% formaldehyde/ 0.025% glutaraldehyde at room temperature for 20 minutes and permeabilised with 0.3% saponin. After blocking with 3% BSA for 30 minutes, cells were stained with the primary anti- lycopene antibodies (6B9) and FITC— conjugated anti-mouse IgM ( ⁇ -chain specific-FITC). Cells were visualized using a Nikon Eclipse 50i fluorescence microscope at ⁇ 1000 magnification.
  • Lycopene immunizations carried out with complete and incomplete Freund' s adjuvant were accompanied by the appearance of LC-specific antibodies in serum beginning the second week after immunization in the range of 1 :800 to 1 : 1000 in the first group and 1 :400 in the second (Table 1). After the 3 rd immunizing injection mice from groups #1 and #2 became sick and died, suggesting a toxic effect from gold- conjugated lycopene injected with Freund's adjuvant.
  • the fusion protocol allowed over 500 primary hybridoma clones selected in HAT medium to be obtained. Screening of culture medium for the presence of LC- specific antibodies was conducted from day 8 of clone cultivation and led to the establishment of 24 hybridoma clones producing antibody specifically recognizing LC. After sub-cloning, four hybridoma cell lines producing LC-specific IgM antibodies established. Clone characteristics are shown in Table 2.
  • Figure 3 shows that the 6B9 Mab is highly specific for lycopene, but does not recognize other carotenoids such as lutein.
  • the invention is directed to the first description of the successful raising of monoclonal antibodies against a specific carotenoid, particularly against a specific carotene such as lycopene. As shown above, these antibodies bind specifically to lycopene in the ELISA test. This interaction was inhibited by pre-incubation of antibody with lycopene. All four hybridoma clones established synthetize Mabs which recognize both lycopene stereo isomers (cis and trans) but do not bind to beta-carotene, which is an end product of lycopene biotransformation from mevalonate [4]. Moreover, Mab 6B9 has a unique ability to recognize lycopene inclusions in the settings of indirect immunofluorescence experiments.
  • Mab 6B9 could not only detect but also visualize lycopene distribution within cultured human hepatocytes and alveolar macrophages which were pre-incubated with this carotenoid for 48 hours. These results, demonstrate for the first time intracellular localization of lycopene in intact cells, predominantly in their cytoplasm. Moreover, these antibodies were able to recognize and measure changes in t-LC concentration in sebum and corneocytes from the skin of volunteers [5] after supplementation with lycopene nutraceutical for 4 weeks.
  • Lycopene is a hydrocarbon compound of relatively low molecular weight (536.89 g-mol -1 ) belonging to the tetraterpene group. It has eleven conjugated double bonds mediating its antioxidant activities . Lycopene is one of the most powerful antioxidants whose anti-radical activity exceeds the antioxidant potential of tocopherol, beta-carotene and ascorbic acid [6]. The highly unsaturated chemical structure of lycopene predetermines its ability to react with many substances containing or generating singlet molecular oxygen such as peroxyl radicals, hydrogen peroxide and hypochlorite [6].
  • molecular associations between lycopene and oxidized proteins or carbohydrates may confer on the lycopene molecule hapten properties capable of elucidating the immune response.
  • Colloidal gold may therefore promote such temporary associations of lycopene with macromolecules required for the initiation of immune response.
  • Example 2 The analysis of carotenoid in cell culture
  • Lycopene was purchased from LycoRed (Switzerland) and kept in oxygen-free containers at -80°C until used in the experiments.
  • Stock oil solutions of lycopene (15%) was prepared using olive-oil and kept at - 20 °C.
  • DMSO DMSO
  • concentrations 0.75, 1.5 and 3.0 mg/ml DMSO
  • Water dispersible microencapsulated lycopene was from BASF. Its 10%) suspension was mixed with DMEM at final concentration of 5 mg/ml.
  • HL human lung
  • B10.MLM a cell line of alveolar macrophages, was obtained from Prof. A.S. Apt (Institute of Tuberculosis, Moscow, Russian Federation). McCoy cells were obtained from the European Collection of Cell Cultures (Salisbury, UK). Cells were grown in 5% CO2 in DMEM supplemented with 2 mM glutamine and 10% FCS.
  • Lycopene toxicity verification Lycopene toxicity was controlled in MTT test (BioVision, USA) in 24 hours after lycopene addition using 96 well dishes.
  • Lycopene incubation and measurement Oil solution of lycopene diluted with DMSO was tested at the final concentration of lycopene of 3.0 ⁇ g/mL in medium. Lycopene microencapsulated in dextran was added in medium up to the final concentration of lycopene of 0.5 mg/ml of DMEM. Control cells received additions of solvents or microencapsulating substances (DMSO, olive oil or cyclodextrin) as singular ingredients. B10.MLM or McCoy cells grown on coverslips were incubated with lycopene for 24 and 42 hours.
  • DMSO solvents or microencapsulating substances
  • Material collected from the surface of the skin, or skin print directly to the slide glass may be kept at room temperature in a dry, light protected storage for few months before analysis.
  • the procedure for the collection of such samples does not require any professionally trained personnel and can be performed by any person after receiving simple instructions.
  • the remarkable stability of collected and stored material makes it possible for the samples to be posted to a specialized laboratory for their further analysis.
  • the first step of the analysis involves treatment of the samples with
  • the concentration of lycopene in MCSS of two groups of volunteers assembled by different age was evaluated.
  • the first group consisted of 12 persons, 8 men and 4 women, of 22-27 years old, and the second group consisted of 10 persons, 4 men and 6 women, of 55-78 years old. All participants in both groups had a similar level of dietary lycopene intake.
  • Skin surface material and blood samples were collected in the morning of the visit by volunteers to the clinic before they had their breakfast. Then their blood was centrifuged, serum was separated from the clot, collected, aliquoted and stored under -80°C until analysis.
  • the lycopene concentration in all serum samples were measured in duplicate by a high-performance liquid chromatography [7], with modifications.
  • lycopene concentrations in serum samples was calculate on the basis of the standard concentrations.
  • Analytical Standard (Lycopene from tomato, Sigma L9879) was used in the assay.
  • Spectrophotometric determination of lycopene in the lycopene standard solution was preforming according to the method of [8] for correction of purity. Results of this study are presented in Table 3. They show that the concentration of lycopene in the serum of the younger volunteers was significantly higher than in the other older group, by almost 50%. There was also a similar trend in differences between these groups in lycopene concentration in both components of the MCSS. It was also significantly lower in the older group of volunteers, but this time the difference was more profound, by 8 to 10 fold.
  • lycopene deficiency such as the accelerated depletion of lycopene
  • the first group comprised of 10 clinically healthy volunteers, 6 women and 4 men, of 55 to 78 years old.
  • the second group comprised of 10 patients with diagnosed with CHD, 3 women and 7 men, of 44 to 65 years old. Both groups were given oral treatment with a nutraceutical lycopene preparation with a daily dose of 7 mg. The duration of the treatment was for 4 weeks. Blood and MCSS samples were taken at the baseline before the treatment and at the end of the intervention period. Collection and analysis of the samples were as described above.
  • the non-invasiveness and simplicity in collected the sample material from the surface of the skin could be a foundation of a range of diagnostic or therapeutic tests in the laboratory or even point- of care tests at the doctor's surgery or self-monitoring point of care tests, to assess, correct and optimize treatment of lycopene deficiencies (such as accelerated depletion) and/or associated conditions.
  • Table 4 Effect of the treatment on the serum lycopene and its concentration in MCSS in healthy older persons and in patients with CHD.
  • the hybridoma cells were washed tree times with ice-cold PBS by resuspension and centrifugation (4°C at 3000 g) and lysed with 1.0 ml of TRIZOL Reagent (Invitrogen, USA) by passing through syringe and needle.
  • the lysed cells were allowed to remain at room temperature for 5 minutes, after which 0.2 ml of chloroform was added to the tubes and the specimens were vortexed for 1 minute.
  • the samples were centrifuged at 14,000 g for 10 minutes at 4°C and the upper phase was carefully transferred to new tubes for further analysis.
  • RNA concentration was measured.
  • RNA sample preparation was performed using a MINT cDNA kit (Evrogen) in accordance with manufacturer's instructions. Briefly, 1 ⁇ g of pre-heated RNA specimens were mixed with 3 ⁇ of water, 1 ⁇ of primer and 1 ⁇ PlugOligo adapter, overlaid with mineral oil and incubated at 70°C for 2 minutes. Samples were then cooled down to 42°C and mixed with the second part of the reaction mixture containing revertase. cDNA synthesis was performed at 42°C.
  • Figure 10 shows the full amino acid (AA) sequence of both the light (238 AA) and heavy (634 AA) chains of the lycopene-specific monoclonal antibody 6B9 with variable (V-region, highlighted in red and underlined) and constant (C-region, highlighted in yellow and not underlined).
  • Figure 11 shows the AA composition pattern of both molecules.
  • Serine, threonine and leucine were the most abundant AA in the structure of the light chain with proportions of 12.6, 9.4 and 8.4 % respectively.
  • Histidine, methionine and cysteine formed the minority of AA in the light chain (proportions between 1.2 and 1.6%).
  • the predominant AA in the heavy chain of IgM 6B9 was serine (9.9%) followed by leucine (9.6%) and threonine (9.3%).
  • Methionine, histidine and tryptophan were represented at a much smaller percentage (1.4-2.0 %).
  • Figure 12 shows the overall alignment of the 6B9 IgM light and heavy chain molecules.
  • the amino terminus in both molecules starts with short protein binding signal (AA 1-2, defined with red rhomb) followed by a helical region.
  • This region was slightly larger in the light chain (AA 4-20, shown beneath the scale as a brown segment) as compared to the heavy chain (AA 4-15).
  • the remaining part of both molecules contains multiple stranded regions (shown in blue).
  • there is a region with potential polynucleotide binding capacity in the light chain of IgM (AA 42-46, shown by flags with yellow circles) which was absent in the structure of the heavy chain.
  • This region was followed by three protein binding regions - between AA 53-68, 112-128 and 212-214 in the light chain of IgM (shown in the figure by flags with red rhombs).
  • the heavy chain contains almost the same number of potential protein binding sites, mostly associated with the amino-terminal area.
  • Glutamate is another important amino acid for post-translational modification.
  • Polyglutamylation is a reversible modification of antibody originating from the successive covalent attachment of glutamic acid (up to 20 residues) to an internal glutamate residue of the heavy and light chains of immunoglobulins leading to changes in antibody affinity and other biological properties of Ig molecules.
  • Polyglutamate regions were identified in the light chain of 6B9 between residues AA 124-127 and at AA 154-155.
  • the heavy chain of 6B9 is characterized by more abundant representation of glutamate. As can be seen from Table 2, glutamate rich regions were located between residues AA 120-131 and AA 548-604. The latter contained 7 glutamate residues.
  • the invention is directed to the first description of the successful raising of monoclonal antibodies against a specific carotenoid, particularly against a specific carotene such as lycopene. As shown above, these antibodies bind specifically to lycopene in the ELISA test. This interaction was inhibited by pre-incubation of antibody with lycopene. All four hybridoma clones established synthetize Mabs which recognize both lycopene stereo isomers (cis and trans) but do not bind to beta-carotene, which is an end product of lycopene biotransformation from mevalonate [4]. Moreover, Mab 6B9 has a unique ability to recognize lycopene inclusions in the settings of indirect immunofluorescence experiments.
  • Mab 6B9 could not only detect but also visualize lycopene distribution within cultured human hepatocytes and alveolar macrophages which were pre-incubated with this carotenoid for 48 hours. These results, demonstrate for the first time intracellular localization of lycopene in intact cells, predominantly in their cytoplasm. Moreover, these antibodies were able to recognize and measure changes in t-LC concentration in sebum and corneocytes from the skin of volunteers [5] after supplementation with lycopene nutraceutical for 4 weeks.
  • Lycopene is a hydrocarbon compound of relatively low molecular weight (536.89 g-mol -1 ) belonging to the tetraterpene group. It has eleven conjugated double bonds mediating its antioxidant activities . Lycopene is one of the most powerful antioxidants whose anti-radical activity exceeds the antioxidant potential of tocopherol, beta-carotene and ascorbic acid [6]. The highly unsaturated chemical structure of lycopene predetermines its ability to react with many substances containing or generating singlet molecular oxygen such as peroxyl radicals, hydrogen peroxide and hypochlorite [6].
  • molecular associations between lycopene and oxidized proteins or carbohydrates may confer on the lycopene molecule hapten properties capable of elucidating the immune response.
  • Colloidal gold may therefore promote such temporary associations of lycopene with macromolecules required for the initiation of immune response.
  • the sequencing and cloning of immunoglobulin genes is the first and often success-limiting step in the design and preparation of chimeric and/or modified immunotherapeutic antibodies.
  • the information obtained is essential for preparing immunotherapeutic and artificially designed antibody-ligand complexes, which can be constructed with lycopene- specific antibodies and/or their fragments.
  • Lycopene is a carotenoid-phytochemical with extremely poor intestinal absorption rate and low ability to pass through biological membranes (9, 10).
  • the mechanisms behind trans-membrane transport of lycopene remain unknown and require detailed investigation.
  • Lycopene is known (11) to be distributed around the organs and tissues of the human body by lipoproteins (low density and very low density lipoproteins) and to pass through membranes of hepatocytes and other LDL-receptor expressing cells via mechanisms of receptor-mediated uptake.
  • lipoproteins low density and very low density lipoproteins
  • LDL-receptor expressing cells via mechanisms of receptor-mediated uptake.
  • cells and tissues not expressing LDL-receptor or structural elements separated from the systemic circulation by histo-hematic barriers are deprived of lycopene influx mediated by lipoprotein transport and uptake (10).
  • Most tumor cells are known to be deficient in LDL-receptor expression and are subject to constant antioxidant deprivation (12, 13).
  • antioxidants and lycopene in particular, are extremely potent antineoplastic agents and are capable of inhibiting cancerous cell growth under in vitro conditions. Such an effect was observed and reported in numerous cell lines including prostate cancer cells, brain tumor and lung cancer cells (14, 15).
  • lycopene treatment in a clinical setting have produced negative or highly questionable results due to poor bioavailability and low penetration capability of lycopene in cell membranes of cancer cells (16).
  • lycopene intake by cancer cells might be highly limited by glycoprotein P, which is a major gate-keeper for xenobiotic entry to neoplastic cells (17, 18).
  • Conjugation of lycopene to the whole mAb 6B9 molecule or its fragments can be done by exploiting the intrinsic affinity of mAb 6B9 for lycopene or by coupling mAb 6B9 to lycopene via free thiol groups generated by either partial reduction methods or cysteine residues in the antibody sequence reported above.
  • Implementation of lycopene chimeric constructs composed of lycopene and mAb 6B9 could open new possibilities in the treatment of cancer.
  • Example 6 The generation of antibodies against lutein, carotenoid class xanthophyll.
  • Lutein-gold conjugate was used for the immunization protocol.
  • Colloidal gold nanoparticles (G Ps) with a size of 15 nm were prepared as described above [2, 3, 4].
  • Lutein was dissolved in EtOH (0.5 mg/ml) and the solution was heated to 80°C until the crystals were completely dissolved.
  • the GNPs solution was mixed with lutein- EtOH at a ratio 5: 1 (v/v) and kept at room temperature for 20 minutes. The conjugate obtained was immediately used for immunization injections.
  • mice Three days after the booster injection spleens of anesthetized mice (positive responders) were removed and dispersed and the resulting splenocytes were fused with Sp-2/0-Ag-14 cells, without gene GGFRT, not producing own immunoglobulins.
  • Myeloma cells were resistant to 20 ⁇ g/ml of 8-azaguanidin, and sensitive to HAT medium.
  • the solution of PEG/DMSO was used ("Sigma" USA).
  • For hybridization a conventional standard protocol was used [3].
  • Spleen and myeloma cells were mixed in ratio 5: 1. After fusion cells were resuspended in selective medium HAT, then 1.5 X 10 5 cells per well in 0.1 ml (6 plates in total) were introduced into 96-plate with feeder layer of peritoneal mice macrophages (5 X 10 6 cells/ml, 50 ⁇ /well). The plates were incubated at 37°C in atmosphere of 5% C0 2 .
  • Total incubation period was 12 days.
  • the medium was changed every 2-3 days. From the 8 th days of the incubation the cell medium was tested on the presence of antibodies against lutein. For this purpose a hard-phase ELISA was used and only when Hybridoma cells were covering at least 50% of the surface of the well. Activities of the positive clones were titrated twice.
  • PBST+0.5% BSA and 100 ⁇ HRP conjugated antibodies against mouse IgG or IgM were added to the wells ("Sigma", Cat#A-4416). After incubation at dark for 1 hour at 37°C the wells were rinsed with
  • RNA extraction and cDNA preparation were performed as described above.
  • the full cDNA sequence for light and heavy chains of IgM against lutein was obtained by implementation of Step-out RACE Technology as described above.
  • the primer for cDNA synthesis IgM-syntl 5'- ACAACACTGAAGTCATCCAG and primer for PCR amplification (RACE)
  • Step-Out RACE In order to sequence the light chain coding regions, the same adapter primer and kappa-class specific primer mIGKC/out-R 5'- CATCTTCCCACCATCC was used for Step-Out RACE. A detailed description of the protocol for Step-Out RACE is given elsewhere (Matz 1999). Sequence analysis was also performed as described above.
  • Example 8 Use of carotenoid antibodies as a delivery vector.
  • Formula 1 - anti -carotenoid antibody, or its fragments as a vector to deliver or facilitate delivery of carotenoids to cells or tissues, to promote their interaction with cell membranes and their intracellular internalization; this vector could be in a form of an immune complex, or a dendrimer, or other structures or particles, which either already bound to a carotenoid or which can acquire carotenoid already present in a medium or circulating in the plasma.
  • this vector could be in a form of an immune complex, or a dendrimer, or other structures or particles, which either already bound to a carotenoid or which can acquire carotenoid already present in a medium or circulating in the plasma.
  • Formula 4 any of the formula above, from 1 to 3, where a carotenoid molecule is on the one hand bound to a drug, or a nutraceutical, or another agent, and on another hand it is also bound to its specific antibody in its native or chimeric forms; this vector could be in a form of an immune complex, or a dendrimer, or other structures or particles.
  • an anti-carotenoid antibody is a vector, in a form of immune complex, or a dendrimer, or other structures or particles, to deliver carotenoids to cells, tissues, organs where Fc receptors are expressed.
  • Formula 6 - carotenoid is a vector itself in a form of an immune complex, or a dendrimer, or other structures or particles, where its specific antibody, or its fragment, is a bridge, for example in a form of a chimer antibodies, one part of which binds a carotenoid, and another part binds a drug, or a nutraceutical or other agent, and / or has an affinity towards a specific cellular or tissue target(s), which can be delivered to cells, tissues, organs where carotenoid receptors are expressed.
  • carotenoids In general, the ability of carotenoids to form dendrimer complexes reflects their chemical nature as organic compounds. Most of the carotenoids are tetraterpenes containing 40 carbon atoms originating from four condensed terpene units and contain multiple double hydrogen bonds (19). The majority of carotenoids are hydrophobic substances with a low level of polarity. Astaxanthin, cryptoxanthin and lutein, belonging to the xanthophyll group, have a considerable level of polarity, whereas beta-carotene and lycopene are highly non-polar molecules (10, 20).
  • the same authors reported formation of "propeller - shaped" carotenoid molecules which can serve as a prototype for dendrimer complexes ( Figure 18).
  • the propeller 13 molecule contains a benzene ring hub and three C30- carotenoid molecules as blades.
  • carotenoid dendrimer formation can take place on the basis of sterically induced stoichiometric principles and interaction of carotenoids with phospholipids, in particular phosphatidylcholine. All carotenoids have a unique ability to interact with phospholipids and form stable carotenoid-phospholipid complexes (25) schematically represented in Figure 19.
  • Carotenoid dendrimers represent a class of functionalized complexes or microparticles capable of targeted delivery of cargo molecules. Upon ingestion, carotenoid dendrimers (as defined above) can penetrate the gastrointestinal barrier and enter the systemic circulation.
  • the presence of carotenoids in the dendrimers may promote carotenoid- specific tissue distribution of the bioactive molecules associated with the dendrimers (18, 27-30).
  • lycopene-containing dendrimers may have a tendency to accumulate in the hepatic cells, adrenal gland cells and prostate, where the expression of carotenoid- binding receptors is highest (10).
  • Such a pattern of potential tissue distribution for lycosome dendrimers allows us to assume that carotenoid dendrimers could be successfully used for organ-specific delivery of pharmaceuticals in patients with pathologies affecting liver, prostate and adrenal glands.
  • Conjugation of nanoparticles and antibodies is a new biotechnological approach which may lead to the creation of outstanding new hybrid products with enhanced biomimetic properties combining the versatility and unique properties of immunoglobulins and microparticles for in vivo and in vitro biomedical applications.
  • hybridization of antibodies and nanoparticles may lead to enhanced cellular uptake and better stability of nanoparticles in cells, tissues and even in the gastro-intestinal lumen (31).
  • Wise selection of antibody type as well as a smartly designed nanoparticle surface may result in multi-fold enhancement of particle cellular uptake and selective delivery (32).
  • Lycopene oleoresin (LycoRed, Switzerland) was dissolved in DMSO at concentrations of 0.75 ⁇ g/ml.
  • Thermo Fisher Scientific kit was used to purify IgM from the ascite of 6B9 hybridoma. Immune complexes of lycopene and IgM was made when the concentration of the former was 0.75 ⁇ g/ml and the latter 270 ⁇ g/ml, which provided molar ratio between the antigen and the antibody 10: 1.
  • Lycopene was purchased from LycoRed (London, UK) and kept in oxygen-free containers at -80°C until used in the experiments.
  • First generation of dendrimers was synthetized using mono-esters of carotenoids (Lycopene or Lutein). Steglich esterification was performed at room temperature using dicyclohexylcarbomide as a coupling agent and 4-dimethylaminopyridine as catalyst. Hydroxy-carotenoids were reacted with succinic anhydride and resulting monoesters were used for dimer synthesis.
  • First generation of dendrimers can be synthetized by conjugation carotenoid diesters with aromatic carboxylic acids and alcohols. The molar ratio between core-forming molecule and lycopene was 1 : 10, suggesting that excess of carotenoids is required for efficient formation of covalent bonds.
  • C. trachomatis was initially propagated in McCoy cells and in HL cells and elementary bodies (EB) purified by Renografin gradient centrifugation as described above. Chlamydial titers were determined by infecting McCoy or HL cells with 10-fold dilutions of thawed stock suspension. Purified elementary bodies (EB) of known titer were suspended in sucrose-phosphate-glutamic acid buffer (SPG) and used as inoculums for McCoy cells.
  • SPG sucrose-phosphate-glutamic acid buffer
  • Cells were grown in 24-well plates until a confluence rate of 80% was reached. Then they were infected with C. trachomatis at multiplicity of infection (MOI) of 30 in DMEM with 5% FBS without cycloheximide and centrifuged for 0.5 hour at 1500$. After 1 hour of incubation at 37oC, the cell monolayers were washed with DMEM and lycopene additions were made. Lycopene diluted with DMSO was tested at the final concentration of lycopene of 0.5 ⁇ g/mL in medium.
  • MOI multiplicity of infection
  • IF immunofluorescence
  • FITC conjugated species-specific monoclonal antibody against the major outer-membrane protein of C. trachomatis (Bio-Rad)
  • FITC conjugated monoclonal antibody against chlamydial lipopolysaccharide
  • Example 10 Antibodies as a vehicle for intracellular delivery of carotenoids
  • Lycopene oleoresin (LycoRed, Switzerland) was dissolved in DMSO at concentrations of 0.75 ⁇ g/ml.
  • Thermo Fisher Scientific kit was used to purify IgM from the ascite of the 6B9 hybridoma. Immune complexes of lycopene and IgM were made when the concentration of the former was 0.75 ⁇ g/ml and the latter 270 ⁇ g/ml, which provided a molar ratio between the antigen and the antibody of 10: 1.
  • lycopene can stimulate the intracellular formation of lipid droplets, LDs. These droplets are important for the activation of certain metabolic reactions, like mitochondrial respiration and cellular defense.
  • lycopene antibodies in a form of an immune complex with lycopene, can facilitate its intracellular delivery and affect the process of formation of LDs.
  • B10.MLM cells were grown in 24-well plates until a confluence rate of 80% was reached. Then they were incubated with lycopene antibody immune complex diluted with DMSO, which was tested at the final concentration of lycopene of 1.5 ⁇ g/mL in medium. Similar concentrations of lycopene (1.5 ⁇ g/mL) were used for addition of lycopene alone, or lycopene-antibody complexes. Control cells received additions DMSO or matching solvents as singular ingredients.
  • B10.MLM monolayers were grown for 1, 4, 20 and 40 hours and fixed with methanol. Permeabilized cells were stained for direct immunofluorescence (IF) using FITC— conjugated species-specific monoclonal antibody against lycopene. Intracellular LDs containing lycopene were visualized using a Nikon Eclipse 50i fluorescence microscope at A ⁇ 200 and A ⁇ 1000 magnification. The results of these experiments are presented in Fig 21. They show that there is a significant boost of the LDs growth with presence of lycopene immune complexes in comparison of the experiment when the cells incubated with lycopene alone. Incubation with antibodies themselves did not result in any appearance of LD within these cells. We have also established that the effect of lycopene on the formation of LDs within the cells is dose-dependent. Therefore, these results indicate that lycopene antibodies facilitate the intracellular delivery of this carotenoid.
  • C. trachomatis was initially propagated in B10.MLM cells and in HL cells and elementary bodies (EB) purified by Renografin gradient centrifugation as described above. Chlamydial titers were determined by infecting McCoy or HL cells with 10-fold dilutions of thawed stock suspension. Purified elementary bodies (EB) of known titer were suspended in sucrose-phosphate-glutamic acid buffer (SPG) and used as inoculums for B10.MLM cells.
  • SPG sucrose-phosphate-glutamic acid buffer
  • Cells were grown in 24-well plates until a confluence rate of 80% was reached. Then they were infected with C. trachomatis at multiplicity of infection (MOI) of 30 in DMEM with 5% FBS without cycloheximide and centrifuged for 1.5 hour at 1500$. After 1 hour of incubation at 37oC, the cell monolayers were washed with DMEM and lycopene additions were made. Lycopene diluted with DMSO was tested at the final concentration of lycopene of 1.5 ⁇ g/mL in medium. Similar concentrations of lycopene (1.5 ⁇ g/mL) were used for addition of its complexes with antibodies. Control cells received additions of anti-lycopene antibodies alone, or DMSO or matching solvents as singular ingredients. Control cells received additions of the solvents used.
  • MOI multiplicity of infection
  • Inclusion-containing cells were visualized using a Nikon Eclipse 50i fluorescence microscope at A ⁇ 200 and A ⁇ 1000 magnification.
  • Vasseur S, Guillaumond F. LDL Receptor An open route to feed pancreatic tumor cells. Molecular & Cellular Oncology. 2016;3(l):el033586.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Botany (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Selon la présente invention, les procédés classiques de mesure des caroténoïdes sont des approches basées sur la HPLC, lesquelles sont laborieuses, coûteuses et peu facilement accessibles. De plus, ces procédés ne peuvent pas être appliqués lorsque seule une petite quantité d'échantillon biologique est obtenue à partir de procédures non invasives telles que le prélèvement de matériel à partir de la surface de la peau ou par écouvillonnage. Les présents inventeurs ont surmonté un certain nombre de difficultés techniques pour produire avec succès, pour la première fois, des anticorps contre les caroténoïdes, en particulier contre les carotènes tels que le lycopène ou les xanthophylles tels que la lutéine. Par conséquent, la présente invention concerne de tels anticorps contre les caroténoïdes, ainsi que des tests de dosages des caroténoïdes utilisant de tels anticorps. La reconnaissance de l'importance des caroténoïdes allant croissant, l'assurance d'un accès à de tels anticorps et tests de dosages permet une mesure des caroténoïdes plus rapide, moins coûteuse et plus accessible, y compris dans le diagnostic et l'assistance de sujets atteints d'une déficience en caroténoïdes. De plus, la disponibilité d'anticorps contre des caroténoïdes, des molécules naturelles, offre une opportunité de créer une gamme de nouveaux véhicules thérapeutiques non seulement pour amplifier le transport des caroténoïdes vers des cellules et des tissus, mais aussi pour une administration ciblée d'agents pharmaceutiques, nutraceutiques et autres.
PCT/GB2017/053860 2016-12-23 2017-12-21 Anticorps contre les caroténoïdes WO2018115885A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GBGB1622197.0A GB201622197D0 (en) 2016-12-23 2016-12-23 Antibodies
GB1622197.0 2016-12-23
GBGB1714644.0A GB201714644D0 (en) 2017-09-12 2017-09-12 Carotenoid Antibiotics
GB1714644.0 2017-09-12

Publications (1)

Publication Number Publication Date
WO2018115885A1 true WO2018115885A1 (fr) 2018-06-28

Family

ID=60888541

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2017/053860 WO2018115885A1 (fr) 2016-12-23 2017-12-21 Anticorps contre les caroténoïdes

Country Status (1)

Country Link
WO (1) WO2018115885A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111333719A (zh) * 2020-03-16 2020-06-26 西南大学 抗hpv16e7蛋白单抗69a6、杂交瘤细胞及其制备方法和应用
CN114133326A (zh) * 2022-01-20 2022-03-04 中国科学院成都生物研究所 一种斑蝥黄胶体金侧向流免疫层析卡的制备及其应用
WO2022086620A1 (fr) * 2020-10-20 2022-04-28 The Methodist Hospital System Immunothérapies ciblées par psma pour des cancers

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2743699A1 (fr) * 2011-08-12 2014-06-18 National Institute of Infectious Diseases Méthode pour le test, la prévention et le traitement d'une maladie infectieuse par aspergillus fumigatus, et composition

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2743699A1 (fr) * 2011-08-12 2014-06-18 National Institute of Infectious Diseases Méthode pour le test, la prévention et le traitement d'une maladie infectieuse par aspergillus fumigatus, et composition

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
IVAN M. PETYAEV ET AL: "Structural Organization of 6B9 Molecule, a Monoclonal Antibody Against Lycopene", MONOCLONAL ANTIBODIES IN IMMUNODIAGNOSIS AND IMMUNOTHERAPY, vol. 36, no. 6, 1 December 2017 (2017-12-01), pages 259 - 263, XP055446666, DOI: 10.1089/mab.2017.0041 *
PENG DAPENG ET AL: "Development a monoclonal antibody-based enzyme-linked immunosorbent assay for screening carotenoids in eggs", FOOD CHEMISTRY, ELSEVIER LTD, NL, vol. 202, 28 January 2016 (2016-01-28), pages 141 - 148, XP029440269, ISSN: 0308-8146, DOI: 10.1016/J.FOODCHEM.2016.01.123 *
VALERIY V. TSIBEZOV ET AL: "Generation and Application of Monoclonal Antibody Against Lycopene", MONOCLONAL ANTIBODIES IN IMMUNODIAGNOSIS AND IMMUNOTHERAPY, vol. 36, no. 2, 1 April 2017 (2017-04-01), pages 62 - 67, XP055446665, DOI: 10.1089/mab.2016.0046 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111333719A (zh) * 2020-03-16 2020-06-26 西南大学 抗hpv16e7蛋白单抗69a6、杂交瘤细胞及其制备方法和应用
CN111333719B (zh) * 2020-03-16 2021-10-01 西南大学 抗hpv16e7蛋白单抗69a6、杂交瘤细胞及其制备方法和应用
WO2022086620A1 (fr) * 2020-10-20 2022-04-28 The Methodist Hospital System Immunothérapies ciblées par psma pour des cancers
CN114133326A (zh) * 2022-01-20 2022-03-04 中国科学院成都生物研究所 一种斑蝥黄胶体金侧向流免疫层析卡的制备及其应用

Similar Documents

Publication Publication Date Title
US9737602B2 (en) Carotenoid particles and uses thereof
JP7161731B2 (ja) 疾患及び障害の処置及び予防のための短鎖脂肪酸の使用
JP7304346B2 (ja) ホモバニリルアルコール（ｈｖａ）、ｈｖａ異性体、このような化合物を含む組成物の作製方法、及びこのような化合物を使用する方法
CA2850296C (fr) Nanoparticules, leur procede de preparation et leur utilisation comme support pour des molecules amphipatiques ou hydrophobes dans des domaines de la medecine, comprenant le traitement du cancer et des composes alimentaires
WO2018115885A1 (fr) Anticorps contre les caroténoïdes
WO2020205579A1 (fr) Exosomes génétiquement modifiés pour la modulation immunitaire
WO2017173454A1 (fr) Extraits de raisin et procédés associés
CN117222432A (zh) 具有改善的生物利用度的多酚组合物
AU2023204082B2 (en) Compounds, compositions, kits, and methods for activating immune cells and/or an immune system response
Tsibezov et al. Generation and application of monoclonal antibody against lycopene
Yamanaka et al. Effect of polymeric caffeic acid on antitumour activity and natural killer cell activity in mice
Matsushima et al. Effects of acute and chronic boysenberry intake on blood pressure and endothelial function in spontaneous hypertensive rats
WO2013111770A1 (fr) Nouvel agent antitumeur maligne
Arshad et al. Enhanced immunosuppressive effects of 3, 5-bis [4 (diethoxymethyl) benzylidene]-1-methyl-piperidin-4-one, an α, β-unsaturated carbonyl-based compound as PLGA-b-PEG nanoparticles
JP2007145741A (ja) ＩｇＥ捕捉剤、並びに抗アレルギー性の医薬組成物、化粧料組成物、食料組成物、飲料組成物及び飼料組成物
US20240024504A1 (en) SITE-SELECTIVE LYSINE ACETYLATION OF HUMAN IMMUNOGLOBULIN G AND IgG-RELATED PRODUCTS FOR IMMUNOTHERAPY
WO2018078399A1 (fr) Compositions comprenant des caroténoïdes et de la phosphatidylcholine
US20240252577A1 (en) Composition for inhibiting proliferation of tumor comprising rubus coreanus extract as effective component
WO2022215658A1 (fr) Composition pharmaceutique
CN118344484A (zh) 可激活th2细胞的纳米佐剂制备及其在zen单克隆抗体制备中的应用
Petrescu Deciphering endoplasmic reticulum associated protein degradation: EDEM proteins.
Tang Effect of Temperature on Molecular Conformation and Immunoreactivity of Soybean Lectin
Mudd Prevention and treatment of familial adenomatous polyposis and colorectal cancer by bilberry-derived anthocyanidins.
JP2007169207A (ja) 抗体、マツタケ由来成分検出方法、並びにキット
JP2006232725A (ja) 食品または医薬組成物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17822761

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17822761

Country of ref document: EP

Kind code of ref document: A1