WO2018097681A1 - Composition for treating dermatitis comprising extracts and fractions of aerial parts of arachis hypogaea l. and use thereof - Google Patents

Abstract

The present invention relates to a composition for improving dermatitis or secondary diseases caused thereby comprising extracts of aerial parts of Arachis hypogaea L., or fractions thereof, as an active ingredient, and a method for preparing the same.

Description

Composition for the treatment of dermatitis comprising peanut ground extract and fractions and use thereof

A composition for improving dermatitis comprising peanut ground extract, or a fraction thereof, and a use thereof.

The immune response is necessary to protect the body, but if the immune response is hypersensitive, it is an abnormal immune response to something that is not harmful to our body, which is a kind of immune disorder that destroys tissue.

Immune diseases are caused by dysfunction of the immune system, and include autoimmune diseases, immunodeficiency, allergies, etc. Among these, allergies are caused by a combination of genetic and environmental factors. Atopy refers to one of hypersensitivity that abnormally responds to external stimuli, and is used interchangeably with allergy.

Atopic disease refers to clinical symptoms caused by atopy and includes atopic dermatitis, asthma, allergic rhinitis, allergic conjunctivitis and the like. Although atopic dermatitis is used as atopic dermatitis, the definitions of the two terms are clearly different medically, and atopic dermatitis is described as an allergic march because of its tendency to manifest simultaneously and in time. . (American Academy of Allergy Asthma & Immunology). An allergy march is a phenomenon in which young infants develop allergic diseases in the order of atopic dermatitis, food allergy, asthma and allergic rhinitis, and are associated with the progression of sensitization to allergens. The etiology of atopic dermatitis is largely divided into the pathophysiology associated with skin barriers and the pathophysiology associated with abnormal immune responses, and requires integration of genetic and environmental factors.

Currently used atopic disease treatments are concentrated on steroids and antihistamines, which have the effect of inhibiting histamine secretion or inhibiting the inflammatory response, which is one of allergic symptoms, and some immunomodulators and phototherapy are used. Existing treatments are effective for allergy symptoms but are not a fundamental treatment, and there is a risk of reducing the efficacy of the drug and the occurrence of various side effects in the long term use. Side effects of steroids include obesity, diabetes, high blood pressure and depression. Side effects of antihistamines include depression, concentration disorders, lethargy, drowsiness and sexual dysfunction. Side effects of immunosuppressants include local irritation, hypertension, and renal toxicity. have. In this regard, there is a need to develop a new concept of therapeutic material that can replace existing drugs or have fewer side effects in long-term use.

Peanut Arachis hypogaea L. is a herbaceous herbaceous herb that is a herbaceous herb and is 50 ~ 60cm high. Leaves are alternate, one-time even feather-shaped double leaf, long lobe, 4 leaflets, round egg-shaped or egg-shaped, rounded at end, short projection, base at bottom, large leaf, long pointed. Flower is yellow, blooms in July ~ September, hanged one by one on axil, without flower, and it looks like a stem of phalaenopsis, and it has calyx tube and petals and petals and stamens at the end. There is one ovary inside the calyx tube, and a thready pistil comes out, and when fertilized, the base of the ovary grows long and the ovary enters the ground. Fruits are long, oval-shaped, ripen in October. Thick, hard, yellowish white with a net-like vein on the outside, containing 1 ~ 3 seeds. Seeds are oval or long oval, and the seed shell is reddish brown. Since the main branch splits at the bottom and grows obliquely to the side, it spreads all around, hairy, and grows in the sandy land (National Species Knowledge Information System).

 Peanut is a very important oily crop for vegetable oils and protein sources, and is used in various ways such as direct cooking, butter, margarine and cooking oil (Lee et al., 2004). Peanut is known to contain a large amount of resveratrol, a natural polyphenol compound. Peanut sprouts are rich in functional nutrients, have high moisture content, excellent taste, and have a wide range of use as food materials. These peanut sprouts are known for their efficacy and effects such as cancer, diabetes, heart disease prevention, antioxidant activity, inflammation inhibition, anti-aging, arteriosclerosis, lowering blood cholesterol and memory. Especially, resveratrol is contained in red grapes, peanuts, and mulberry. Various pharmacological effects have been reported.

However, research on peanut grounds is poor.

One aspect is peanuts ( Arachis hypogaea L.) Provides a composition for improving dermatitis or a secondary disease resulting therefrom comprising an extract of the ground portion, or a fraction thereof.

Another aspect provides a method of making a peanut ground extract comprising contacting the peanut ground with water, C1 to C6 alcohol or a mixture thereof under ultrasonic irradiation.

Another aspect provides a method of ameliorating a dermatitis or a secondary disease resulting from a subject comprising administering the composition to the subject in an amount effective to ameliorate dermatitis or a secondary disease resulting therefrom.

One aspect is peanuts ( Arachis hypogaea L.) Provides a composition for improving dermatitis or a secondary disease resulting therefrom comprising an extract of the ground portion, or a fraction thereof.

The peanut ground portion may be a leaf, a flower, a stem, a bud, or a combination thereof, or may be dried.

Atopic dermatitis is recognized as the first disease that causes an allergic march and is used as an index to predict the occurrence of atopic disease. If you do not control the immune response during atopic dermatitis, allergic march is estimated to accelerate, so it is necessary to control atopic dermatitis to prevent asthma and rhinitis. Thus, the secondary disease may be asthma or rhinitis.

In one embodiment, the extract may be extracted as a hydrophilic solvent, the hydrophilic solvent may be water, alcohol of C1 to C6 or a mixture thereof. The alcohol may be a compound having one or more -OH groups of C1 to C6 or C1 to C4. The alcohol may be methanol, ethanol, n-propanol, isopropanol, n-butanol, sec-butanol, isobutanol, tert-butanol or mixtures thereof.

The peanut ground extract may be crude extract, fraction, or a combination thereof. The crude extract is obtained by contacting the ground portion of the peanut with an extraction solvent and contains no specific components. The fraction refers to a fraction containing a specific component with respect to the crude extract. The separation can be separation, chromatography or filtration using an organic solvent. The chromatography may be ion exchange chromatography, affinity chromatography, size exclusion chromatography, HPLC, or a combination thereof.

The extraction may be to incubate and add the peanut ground portion in the extraction solvent. The peanut ground portion may be chopped or crushed to have the form of micronized particles. The peanut ground portion may be dried or washed. The incubation may be performed at room temperature to reflux temperature with or without stirring. Incubation temperature may be appropriately selected depending on the solvent selected. For example, it may be room temperature to reflux temperature, 30 to reflux temperature, 40 to reflux temperature, 50 to reflux temperature, 60 to reflux temperature, or 65 to reflux temperature. The extraction time can be appropriately selected according to the extraction conditions. The extraction time may be 2 to 4 hours, for example 2.5 to 3.5 hours. The extraction solvent may be 5 to 15 times, for example 5 to 13 times, 5 to 11 times, 8 to 15 times, 8 to 13 times, 8 to 11 times, or 9 to 11 times the peanut ground portion. The extraction may be one or more times, for example, 1 to 5 times, 1 to 4 times, 1 to 3 times, 2 to 5 times, or 2 to 4 times. The crude extract obtained can be filtered, concentrated and dried. The drying may be dried under reduced pressure.

In one embodiment, the extract may be extracted under ultrasonic irradiation. The ultrasonic irradiation is at room temperature, 10 to 25 ℃, 10 to 30 ℃, 10 to 40 ℃, 10 to 45 ℃, 10 to 50 ℃, 10 to 55 ℃, 10 to 60 ℃, 10 to 65 ℃, or 10 to 70 It may be carried out at ℃. The ultrasonic irradiation time is 10 to 30 minutes. 10 minutes to 1 hour, 10 minutes to 2 hours, 10 minutes to 3 hours, 10 minutes to 4 hours, 10 minutes to 5 hours, 10 minutes to 6 hours, 10 minutes to 9 hours, 10 minutes to 12 hours, 10 minutes To be performed for 24 hours. The ultrasonic irradiation may be performed in a sealed container.

In one embodiment, the extract may be additionally extracted using an organic solvent. The further extraction may be for fractionation. The organic solvent may be ethyl acetate (EtOAc), hexane, methylene chloride (CH ₂ Cl ₂ ), butanol, acetone, acetonitrile or a combination thereof. Extraction by the organic solvent may include incubating the extract by adding the extract to the organic solvent. The extraction conditions may be appropriately selected depending on the solvent selected, and the incubation may be performed without stirring or stirring at room temperature to reflux temperature. The incubation temperature may be appropriately selected depending on the solvent selected, for example, room temperature to reflux temperature, 30 ° C to reflux temperature, 40 ° C to reflux temperature, 50 ° C to reflux temperature, 60 ° C to reflux temperature, or 65 And reflux temperature. The extraction time can be appropriately selected according to the extraction conditions. The extraction time may be 2 to 4 hours, for example 2.5 to 3.5 hours. The extraction solvent may be 5 to 15 times, for example 5 to 13 times, 5 to 11 times, 8 to 15 times, 8 to 13 times, 8 to 11 times, or 9 to 11 times the peanut ground portion. The extraction may be one or more times, for example, 1 to 5 times, 1 to 4 times, 1 to 3 times, 2 to 5 times, or 2 to 4 times. The obtained extract can be filtered, concentrated and dried. The drying may be dried under reduced pressure.

The extraction may further comprise HPLC of the crude extract, or fractions thereof. The HPLC can be semi-preparative HPLC.

In one embodiment, the composition may be to include the fraction obtained by fractionating the peanut ground extract as an active ingredient. The fraction was obtained by suspending the peanut ground extract in water and then extracting methylene chloride (CH ₂ Cl ₂ ), ethyl acetate (EtOAc) or butanol ( n- BuOH) as a fractionation solvent. Depending on the fractionation solvent, it may be a methylene chloride fraction, an ethyl acetate fraction, a butanol fraction, or a water fraction, respectively. Preferably the fraction may be a methylene chloride fraction, an ethyl acetate fraction or a water fraction. Methylene chloride is more likely to cause cytotoxicity, more preferably ethyl acetate or water fraction.

In one embodiment the peanut ground extract or fractions thereof inhibits overactivation of immune cells to stabilize or restore immune function, or cause dermatitis by inhibiting the expression of Interleukin-4 (IL-4) It may be to prevent, ameliorate or treat a secondary disease.

The dermatitis may be selected from the group consisting of skin pruritus, seborrheic dermatitis, contact dermatitis, atopic dermatitis, diabetic dermatitis, folliculitis, acne, allergic dermatitis and neurodermatitis.

Thus, the peanut ground extract or fractions thereof in the composition may be used to inhibit the expression of IL-4 in cells, to improve dermatitis, in particular to improve atopic dermatitis, or to improve secondary diseases resulting therefrom. May be included in an effective amount. The effective amount may be appropriately selected by those skilled in the art according to the cell or individual to be selected. The effective amount is 0.1 mg to 1,000 mg, for example 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1,000 mg, 1 mg to 500 per said composition. mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg To 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg. The composition may be for inhibiting the expression of IL-4 in vitro or in cells in a subject. The cells in the individual may be located at, for example, a site where dermatitis is progressed due to increased IL-4 expression, or a site where the inflammation is excessively progressed due to the deposition of IL-4 and exhibits dermatitis symptoms externally. The dermatitis may be atopic dermatitis, and the secondary disease may be a skin infection due to impaired skin barrier function.

The composition may further comprise a cosmetic, pharmaceutically, or food acceptable excipient or carrier. The composition may be a pharmaceutical, food or cosmetic composition, or may be a composition added as an active ingredient of pharmaceutical, food or cosmetics.

The food composition may be used peanut ground extract or fractions thereof alone or in combination with other foods or food ingredients, and may be suitably used according to conventional methods. The mixed amount of the active ingredient can be determined suitably according to the purpose of use (prevention, health or therapeutic treatment). In general, in the manufacture of food or beverages, the pharmaceutical compositions of the present invention may be added in an amount of up to 15 parts by weight, preferably up to 10 parts by weight based on the raw materials. However, in the case of long-term intake for health and hygiene or health control purposes, the amount may be below the above range, and the active ingredient may be used in an amount above the above range because there is no problem in terms of safety.

There is no particular limitation on the kind of food. Examples of the food to which the substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, drinks, Alcoholic beverages and vitamin complexes, and the like and include all foods in a conventional sense.

The beverage composition of the present invention may contain various flavors, natural carbohydrates, and the like as additional components, as in general beverages. The above-mentioned natural carbohydrates are glucose, monosaccharides such as fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetening agent, natural sweetening agents such as tautin and stevia extract, synthetic sweetening agents such as saccharin and aspartame, and the like can be used.

The food composition is also used in nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonated beverages Carbonizing agent, or a combination thereof. The food composition may also contain flesh, or combinations thereof, for the production of natural fruit juices, fruit juice drinks, vegetable drinks. Such additives may be selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition.

The composition may be formulated in an oral or parenteral dosage form. Oral dosage forms may be granules, powders, solutions, tablets, capsules, dry syrups, or combinations thereof. Oral dosage forms may be injections or external skin preparations. The external dermal agent may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal patch, drug containing bandage, lotion, or a combination thereof.

The external skin preparations are commonly used in external preparations for cosmetics and medicines, such as aqueous components, oily ingredients, powder components, alcohols, humectants, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, flavoring agents, and colorants. Various skin nutrients can be suitably blended as needed.

The external skin preparations include metal blockers such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, belafamil, licorice extract, glablidine, and caline. Fruit hot water extract, various herbal medicines, drugs such as tocopherol acetate, glytilinic acid, tranexamic acid and derivatives thereof or salts thereof, vitamin C, magnesium ascorbic acid phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can also be mix | blended suitably.

The composition may comprise a pharmaceutically acceptable diluent or carrier. The carrier may be an excipient, a disintegrant, a binder, a lubricant, or a combination thereof. The excipient may be microcrystalline cellulose, lactose, low-substituted hydroxycellulose, or a combination thereof. The disintegrant may be sodium starch glycolate, calcium dihydrogen phosphate anhydride, or a combination thereof. The binder may be polyvinylpyrrolidone, low-substituted hydroxypropylcellulose, hydroxypropylcellulose, or a combination thereof. The lubricant may be magnesium stearate, silicon dioxide, talc, or a combination thereof.

The composition may be a cosmetic composition for preventing or treating dermatitis or a secondary disease caused therefrom.

The composition may be a food composition for preventing or treating dermatitis or a secondary disease caused therefrom.

Another aspect provides a method of making a peanut ground extract comprising contacting the peanut ground with water, C1 to C6 alcohol or a mixture thereof under ultrasonic irradiation.

The method may further include fractionating the extract into methylene chloride, ethyl acetate, butanol or a combination thereof after suspending the extract in water.

Another aspect provides a method of ameliorating a dermatitis or a secondary disease resulting from a subject comprising administering the composition to the subject.

Administration can be by any method known in the art. Administration can be administered directly to the subject by any means, for example, by intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal or subcutaneous administration. Can be. The administration can be administered systemically or locally. The administration may be to be administered locally to the site where the wound is present.

The composition may be administered in combination with drugs such as steroids, anti-inflammatory agents, antihistamines, antibiotics, and antifungal agents to efficiently ameliorate dermatitis or a secondary disease resulting from the subject, the combination administration being sequential and simultaneous. Or may be administered to an individual individually.

The subject may be a mammal, for example a human, a cow, a horse, a pig, a dog, a sheep, a goat, or a cat. The subject may be a subject in need of improvement of atopic dermatitis.

The administration can be carried out using peanut ground extract or a fraction thereof from 0.1 mg to 1,000 mg per person per day, for example 0.1 mg to 500 mg, 0.1 mg to 100 mg, 0.1 mg to 50 mg, 0.1 mg to 25 mg, 1 mg to 1,000 mg, 1 mg to 500 mg, 1 mg to 100 mg, 1 mg to 50 mg, 1 mg to 25 mg, 5 mg to 1,000 mg, 5 mg to 500 mg, 5 mg to 100 mg, 5 mg to 50 mg, 5 mg to 25 mg, 10 mg to 1,000 mg, 10 mg to 500 mg, 10 mg to 100 mg, 10 mg to 50 mg, or 10 mg to 25 mg.

Peanut according to one aspect ( Arachis hypogaea L.) A composition for improving dermatitis or a secondary disease caused therefrom in an individual comprising an extract of the above-ground part, or a fraction thereof, as an active ingredient, inhibiting the expression of IL-4 to cause atopic dermatitis or secondary It can be used to improve disease.

According to a method for preparing a peanut ground extract, which comprises contacting the peanut ground portion with water, C1 to C6 alcohol or a mixture thereof under ultrasonic irradiation according to another aspect, efficiently extracts an extract of peanut ground portion, or a fraction thereof. can do.

According to another aspect of the present invention, there is provided a method for improving dermatitis or a secondary disease resulting from a subject comprising administering to the subject an amount effective to ameliorate dermatitis or a secondary disease resulting therefrom. It can be administered to a subject with a secondary disease resulting therefrom, which can effectively ameliorate the disease in the subject.

1 is a measure of IL-4 expression after processing peanut ground extract (MeOH) and fractions in RBL-H23 cells.

Figure 2 shows the results of HPLC analysis of peanut ground portion.

Figure 3 shows the results of measuring the transdermal water loss (TEWL) over time after the peanut ground extract treatment in hairless mice.

Figure 4 shows the results of measuring the moisture content (hydration) of the skin after the peanut ground extract in the hairless mouse.

Figure 5 shows a comparison photo of the skin phenotype after the peanut ground extract in hairless mice.

Figure 6A shows the result of measuring the amount of IgE in serum after the peanut ground extract in hairless mice, and Figure 6B shows the result of measuring the amount of IL-4.

Figure 7A shows a picture of H & E tissue staining after the peanut ground extract in hairless mice, Figure 7B shows the result of measuring the epidermal thickness.

Figure 8A shows the toluidine blue tissue staining picture after the peanut ground extract in hairless mice, Figure 8B shows the result of measuring the mast cell number.

9 is a photograph showing the expression of Kallikrein 5 and Desmocollin 1, Filaggrin after the peanut ground extract in hairless mice.

Figure 10A shows a photograph of the ear phenotype after the peanut ground extract in Balb / c mice, Figure 10B shows the results of measuring the ear thickness, and Figure 10C shows the epidermal thickness.

Figure 11A shows the results of measuring the expression of TSLP in serum, Figure 11B is the expression of IgE, and Figure 11C is the expression of IL-4 after the peanut ground extract in Balb / c mice.

Figure 12A shows the toluidine blue tissue staining picture after the peanut ground extract in Balb / c mice, Figure 12B shows the result of measuring the mast cell number.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example 1 Preparation of Peanut Ground Extract and Fractions thereof and Identification of Their Effects

In this embodiment, the ground extract of peanut ground and its fractions were prepared, and the effect of the extract and its fractions on atopic dermatitis improvement was confirmed.

1. Peanut ground extract and its Fraction  Produce

(1) Preparation of Peanut Ground Extract

Peanut ground portion used in the present example was used to grow the harvested peanuts and harvest the remaining ground directly from Yeongju, Gyeongsangbuk-do, Korea, and dried.

(1-1) Preparation of Peanut Ground-Methanol Extract

Cut 1.2 kg ground peanut outpost and cut BANDELIN electronic GmbH & Co. Soaked in 6.1 L of 99% methanol in water in a bath of BANDELIN SONOREX Ultrasonic baths, an ultrasonic instrument manufactured by KG, was irradiated for 3 hours. The extraction was repeated three times. The extract was dried under reduced pressure and concentrated to give 67.0 g of concentrate (hereinafter referred to as 'peanut ground-methanol extract').

(1-2) Preparation of Peanut Ground-Ethanol Extract

480 g of peanut ground outpost and 20.4 g of peanut ground-ethanol extract were obtained by the same procedure except that 12 L of 95% ethanol was used.

(1-3) Preparation of Fractions of Peanut Ground Extract

67.0 g of peanut ground-methanol extract prepared in Example (1-1) were suspended in 670 ml of distilled water, and the same amount of methylene chloride (CH ₂ Cl ₂ ), ethyl acetate (EtOAc) and butanol was prepared according to the systematic fractionation method. ( n -BuOH) was extracted three times and fractionated and concentrated under reduced pressure to obtain 19.4 g of methylene chloride layer, 1.44 g of ethyl acetate layer, 1.44 g of butane part, and 23.7 g of water layer to obtain CH ₂ Cl ₂ fraction, EtOAc. Fraction, n- BuOH fraction and water fraction.

2. Effects of Ground Peanut Extract and Fractions thereof on IL-4 Expression

The rat basophilic leukemia cells, RBL-2H3 cells, used in this experiment were used by the Korea Cell Line Bank (Seoul, Korea).

DBL containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin was inoculated into each well of a 6-well plate by injecting RBL-2H3 cells at a concentration of ⁵ × 10 ⁵ per well. (Dulecco 'Modified Eagle Medium) incubated in an incubator at 37 ° C., 5% CO ₂ condition in 16 hours, 1 μM cyclosporine A and the sample was added at a concentration of 10 μg / ml and incubated for 1 hour Pretreatment. The sample is a peanut ground extract or a fraction thereof prepared in Example (1). Next, 50 ng / ml of phorbol 12-myristate 13-acetate (PMA) and 1 μM of ionomycin were added and incubated for 9 hours under the same conditions. PMA and ionomycin are used to stimulate intracellular production of cytokines such as interferon, perforin, IL-2, and IL-4.

Cells were extracted by RNA mounted on a QIAsymphony or QIAQube (Qiagen) instrument using the RNeasy mini kit (Qiagen). The extracted RNA was confirmed for robustness (integrity) using Agilent 2100 BioAnalyzer (Agilent Technologies, Santa Clara, CA, USA). cDNA was synthesized 1 c of RNA into cDNA using the ImProm-II Reverse Transcription System (Promega, Madison, WI, USA). PCR was performed using GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA, USA).

PCR reactions were 0.02 μl Ex taq polymerase (TAKARA, Otsu, Shiga, Japan), 2 μl Ex taq polymerase buffer, 1.6 μl dNTP (10 mM), 2 μl forward primer (20 uM), 2 μl reverse primer (20 uM), PCR was performed on a total of 20 μl of the reaction mixture with 11.38 μl nuclease free water and 1 μl of synthesized first-strand cDNA.

PCR conditions for IL-4 were 4 minutes (1 cycle) at 94 ° C, 30 seconds at 94 ° C, 30 seconds at 60 ° C and 30 seconds (72 cycles) at 72 ° C, and 5 minutes (1 cycle) at 72 ° C. Beta-actin conditions were 4 minutes (1 cycle) at 94 ° C, 30 seconds at 94 ° C, 30 seconds at 55 ° C and 30 seconds (72 cycles) at 72 ° C, and 5 minutes (1 cycle) at 72 ° C. RT-PCR results were measured for band intensities using a QIAxcel advanced (Qiagen) instrument. The efficacy analysis was determined by comparing the ratio of the [PMA + ionomycin] (PI) treated group to 100. Primers used for RT-PCR are shown in Table 1.

	Forward sequence	Reverse sequence
IL-4	CCACCTTGCTGTCACCCTGTTCTGCT	GTGTTGTGAGCGTGGACTCATTCACG
β-actin	ACCGTGAAAAGATGACCCAG	TGTCAGCTGTGGTGGTGAAG

Table 2 shows the extent to which IL-4 is inhibited in the ratio of the ground extract and fractions of the peanut ground extract to the PI treated group as 100.

sample	IL-4 expression (%)
No treatment group	35.4
PI	100.0
PI + CsA	24.4
PI + Peanut Ground Extract	15.7
PI + Peanut Ground CHCl 2 Fraction	6.8
PI + Peanut Ground EtOAc Fraction	0.0
PI + Peanut Ground n -BuOH Fraction	54.2
PI + Peanut H 2 O Fraction	13.3

In Table 2, CsAs represents cyclosporin A as a positive control.

As shown in Table 2 and Figure 1, peanut ground extracts and fractions inhibited the expression of IL-4 in RBL-2H3 cells. This is a result showing that peanut ground extract and fractions may be helpful in relieving atopic symptoms.

In addition, each fraction is CHCl ₂ 〈 It is highly polar in order of EtOAc < n -BuOH <water. Referring to Table 2 was found to be got having a significant difference in the inhibitory degree of each of IL-4 expression for each fraction, in particular, CHCl _2, showed to have EtOAc and water fraction remarkable effect, the degree was excellent than the positive control .

3. HPLC Component Pattern Analysis of Ground Peanuts

HPLC analysis of peanut ground fractions was performed to analyze specific components of the peanut ground fraction. Specifically, 10 μl of sample was injected and a reversed phase column (YMC triart C18 (4.6 × 150 mm, 5 μm) was used using an Agilent 1200 Series HPLC system / DAD. The temperature of the column was maintained at 40 ° C., As the elution solvent, A is water and B is acetonitrile as gradient solvent system, starting with 5% A and 95% B at a flow rate of 1 ml / min, and increasing the volume of elution solvent B by 90% (3 minutes). , 10% (23 minutes), and 10% (25 minutes), with each component separated from the column being detected at 280 nm using an ultraviolet detector.

Under the above conditions, the longer the detection time, the more nonpolar, and the later, the closer the polar component is detected. Referring to FIG. 2, a number of strong intensity peaks were detected, and it was observed that the peak times were detected as being in various compartments.

4. Peanut Ground-Methanol Extract On DNCB  Effect on atopic dermatitis induced hairless mouse

(1) Identify the impact on skin barrier

Stimulation of the back skin using DNCB (2,4-dinitrochlorobenzen) and acetone in hairless mice can induce delayed allergic reactions in irritated localized areas, cause abnormal immune function and disrupt skin barriers. In this way, DNCB can be used to create a model similar to atopic dermatitis and to create an in vivo model related to the skin barrier function and immune function of the individual. Transdermal moisture loss (TEWL) and pH in mice with atopic dermatitis induced by DNCB increase and hydration decreases.

In balb / c mice, oxazolone (4-ethoxymethylene-2-phenyloxazolone) and acetone are applied to the ears of the mouse, resulting in atopic-like lesions. Oxazolone-atopic dermatitis-induced ears cause redness, thickening of the ear when compared with the abnormal immune response and control. An oxazolone model can be constructed to perform in vivo experiments related to the skin barrier function and immune function of the individual.

If there is a substance that induces lesions such as atopic dermatitis with DNCB and oxazolone and then works the skin barrier function, ear thickness and immunological function, it can be a good candidate for the treatment or prevention of atopic dermatitis. will be.

Six week old (female, 23-27 g) hairless mice (purchased from Orient Bio) were separated into three groups: untreated group (n = 2), 2,4-dinitrochlorobenzene (2,4- vehicle treated group (n = 4) after induction of dinitrochlorobenzene (DNCB), peanut ground extract group (n = 4) after DNCB induction. DNCB used a solution of 99% acetone in water and olive oil in a volume ratio of 3: 1. Vehicle was a mixture of propylene glycol and ethanol at 7: 3 by volume. 200 μl of 1 (v / v /)% DNCB solution was applied once a day for 7 days after group separation. A total of 0.1 (v / v)% DNCB solution was applied in the same manner as above 7 times at a interval of 2 days after a week without treatment for one week after the last application. Apply a 0.1 (v / v)% DNCB solution and apply 200μl each of the mouse ground peanut extract 1 (v / v)% solution with vehicle for 14 days and the vehicle divided into AM and PM twice a day. It was.

For epidermal water loss (TEWL, Trans Epidermal Water Loss) was measured using AquaFlux (Biox, London, UK), and the skin moisture content (Hydration) of skin-O-Mat (COSMOMEP, Berlin, Germany). Before induction of atopic dermatitis by DNCB for the first time, 7 days after induction, 14 days and 21 days after induction.

As a result, as shown in Figure 3 showing the difference in the transdermal water loss (TEWL) with time after the peanut ground portion extract treatment in hairless mice, the peanut ground portion extract in the hairless mice compared to the control vehicle vehicle group You can see that it is lowered to a similar level. Therefore, it can be seen that peanut ground extract significantly enhances skin barrier function compared to vehicle in hairless mice.

In addition, as shown in Figure 4, it can be seen that the groundnut extract from the groundnut extract increases the water content (hydration) compared to the control vehicle in the hairless mouse, and thus the groundnut extract enhances the skin barrier function compared to the vehicle in the hairless mouse It can be seen that.

Figure 5 shows a comparison of the skin phenotype over time after peanut ground extract treatment in hairless mice. As can be seen in FIG. 5, the peanut ground extract was better skin condition than the vehicle group as a control group from 7 days after DNCB-atopic dermatitis induction in hairless mice. Inducing DNCB-atopic dermatitis, keratin occurs severely and the skin is keratinized. When the 1% peanut ground extract is treated, it can be seen that the amount of keratin and keratin decreases. Thus, it can be seen that peanut ground extract significantly enhances skin barrier function.

(2) Confirmation of the effect on the immune system

The amount of immunoglobulin E (IgE), which is one of the most important factors in atopic dermatitis, and interleukin-4 (IL-4), which is one of the cytokines of immune cells, is used as a marker of atopic dermatitis in the blood plasma. It was measured by.

IL-4, IL-5, and IL-13, which cause T cell overactivation, are secreted by Th2 cells and are known to play an important role in initiating atopic dermatitis by regulating the synthesis of IgE.

Langerhans cells and inflammatory dendritic epidermal cells (IDECs) convert naïve T cells to the Th2 type and play an important role in initiating an allergic immune response. It is known to play a role. Langerhans has a receptor for IgE on the cell surface and binds to food and air allergens and microorganism superantigens to secrete inflammatory signals and trigger allergic immune responses. Th2 cytokines (IL-4, IL-5, IL-13) mediate isotype switching to produce IgE and enhance the expression of endothelial adhesion molecules.

In the skin, IL-4 has been shown to induce a disproportionate increase in Th2 cells, a characteristic pathology of T cell types, especially atopic dermatitis, while simultaneously stimulating B cells to increase IgE production, leading to histamine induced by mast cells. It is a key cytokine that stimulates secretion and triggers atopic reactions such as erythema, redness and itching. Therefore, the present inventors expected that a substance capable of simultaneously inhibiting the production of IL-4 and excessive proliferation of T cells, which is the final result of the reaction, may provide more suitable efficacy for the treatment of atopic dermatitis than a general immunosuppressive substance. .

In addition, IL-4 in the skin also significantly reduced the expression of caspase-14, a protease required for the conversion of filaggrin to natural moisturizing factor (NMF) (Hvid et al., Exp. Dermatol. 20). , 633-636 (2011)), promote the expression of klk7 peptidase, which degrades collagen proteins such as desmoglein 1 to induce exfoliation of the epidermis and increase transdermal moisture loss.

Therefore, the present inventors observed the change of these factors, and tried to confirm the effect of the peanut ground extract.

Specifically, after anesthesia, blood was collected from the abdominal aorta using a syringe containing 30 μl of 0.18 M EDTA. The collected blood was centrifuged at 4 ° C. and 8000 rpm for 15 minutes using a centrifuge to separate plasma and blood cells. Plasma IgE and IL-4 were detected using the mouse IgE ELISA quantitation kit (Bethy Laboratories, Montgomery, TX, USA) and the mouse IL-4 ELISA quantitation kit (Bethy Laboratories, Montgomery, TX, USA). .

As a result, as shown in Figs. 6A and 6B, the peanut ground extract was significantly reduced in the amount of IgE and IL-4 in plasma compared to the control vehicle in hairless mice.

Figure 7A shows a picture of H & E stained skin tissue after peanut ground extract treatment in hairless mice, Figure 7B shows the thickness of the epidermal layer. As can be seen in Figures 7A and 7B, the experimental group treated with peanut ground extract can be seen that the thickness of the epidermis was reduced compared to the control vehicle.

Figure 8A shows a toluidine blue stained tissue photograph after peanut ground extract treatment in hairless mice, Figure 8B shows the mast cell number. As can be seen in Figures 8A and 8B, in the experimental group treated with peanut ground extract it can be seen that the mast cells are reduced compared to the control vehicle.

Figure 9 shows the immunochemical staining tissue pictures after peanut ground extract treatment in hairless mice. As can be seen in Figure 9, the experimental group treated with peanut ground extract can be seen that the expression of Kallikrein 5 and Desmocollin 1 and Filaggrin increased compared to the control vehicle.

5. Atopy Dermatitis Induced by Oxazolone (4-ethoxymethylene-2-phenyloxazolone) Balb / c effect on abnormal immunological function in mice

(5-1). Induction and Phenotypic Measurement of Atopic Dermatitis in Balb / c Mice

Six week-old (female, 17-20 g) hairless mice (purchased from Orient Bio) were divided into three groups: untreated group (n = 2), vehicle treated group after induction of oxazolone-atopic dermatitis (n =). 4), peanut ground ethanol extract treatment group after induction of oxazolone-atopic dermatitis (n = 4). Oxazolone used 99% acetone in water as the solvent. Vehicle was a mixture of propylene glycol and ethanol at 7: 3 by volume.

On the first day after group separation, 15 μl of 1 (v / v)% oxazolone solution was applied to both ears of the mouse once. After incubation for a week, a total of 11 times 0.1% oxazolone solution was applied in the same manner as described above at 2 days intervals to induce lesions such as atopic dermatitis. A 0.1% oxazolone solution was applied and a 1% peanut ground extract solution using a vehicle as a solvent and the vehicle were divided into am and pm for 15 days to each mouse's ears. Ear thickness was measured weekly after the first measurement before derivation using a digital ruler. Mice were dissected on the 28th day of induction with the first 1% oxazolone solution to collect ear tissue, blood, and spleen and photographed.

As a result, as can be seen in Figure 10A, 10B, and 10C showing the difference in ear phenotype and ear thickness 21 days after peanut ground portion in BALB / c mice, the control group in BALB / c mice treated with peanut ground extract Compared to the invehicle, the erythema is reduced and it can be seen that keratin was also removed. When the oxazolone is applied to the ears of the mouse, the thickness and the epidermal layer of the ear are thickened due to an abnormal immune response, and keratin occurs. In the experimental group treated with peanut ground extract, the ear thickness was reduced compared to the control vehicle. Therefore, peanut ground extract can be seen that atopic skin barrier function can be enhanced.

(5-2) Changes in Plasma IgE and IL-4 in Animal Models of Atopic Dermatitis

 The protein amount of immunoglobulin E (IgE), which is one of the most important factors in atopic dermatitis, and interleukin-4 (IL-4), which is one of the most important factors in atopic dermatitis, is measured by ELISA test. It measured using.

Specifically, after anesthesia, blood was collected from the abdominal aorta using a syringe containing 30 μl of 0.18 M EDTA. The collected blood was centrifuged at 4 ° C. and 8000 rpm for 15 minutes using a centrifuge to separate plasma and blood cells. Plasma IgE and IL-4 were detected using the mouse IgE ELISA quantitation kit (Bethy Laboratories, Montgomery, TX, USA) and the mouse IL-4 ELISA quantitation kit (Bethy Laboratories, Montgomery, TX, USA). .

As a result, as shown in Figs. 11A, 11B, and 11C, the peanut ground extract did not change the amount of IgE in plasma compared to the control vehicle in BALB / c mice, but the amount of IL-4 and TSLP decreased significantly. Confirmed.

12A shows the toluidine blue stained tissue photograph after peanut ground extract treatment in BALB / c mice, and FIG. 12B shows the result of measuring mast cell numbers. As can be seen in Figures 12A and 12B, the experimental group treated with peanut ground extract can be seen that the mast cells are reduced compared to the control vehicle.

Claims (15)

1. Peanut ( Arachis hypogaea L.) A composition for improving dermatitis or a secondary disease resulting therefrom comprising an extract of the above-ground part, or a fraction thereof.
2. The composition of claim 1, wherein the peanut ground portion is dried.
3. The composition of claim 1, wherein the extract is extracted with a hydrophilic solvent.
4. The composition of claim 3, wherein the hydrophilic solvent is water, an alcohol of C1 to C6 or a mixture thereof.
5. The composition of claim 4, wherein the alcohol is methanol, ethanol, n-propanol, isopropanol, n-butanol, sec-butanol, isobutanol, tert-butanol or mixtures thereof.
6. The composition of claim 1, wherein the extract is extracted under ultrasonic irradiation.
7. The methylene chloride of claim 1, wherein the fraction is obtained by suspending the peanut ground extract in water and then extracting the mixture with methylene chloride (CH ₂ Cl ₂ ), ethyl acetate (EtOAc) or butanol ( n- BuOH). The composition is a read fraction, ethyl acetate fraction, butanol fraction, or water fraction.
8. The composition of claim 1, wherein the extract stabilizes immune function.
9. The composition of claim 1, wherein the extract inhibits the expression of IL-4.
10. The composition of claim 1, wherein the dermatitis is selected from the group consisting of skin pruritus, seborrheic dermatitis, contact dermatitis, atopic dermatitis, diabetic dermatitis, folliculitis, acne, allergic dermatitis and neurodermatitis.
11. The composition of claim 1, further comprising a cosmetic, pharmaceutically, or food acceptable excipient or carrier.
12. The composition of claim 1, wherein the composition is added as an active ingredient of pharmaceutical, food or cosmetics.
13. A method for producing a peanut ground extract, comprising contacting the peanut ground with water, C1 to C6 alcohol or a mixture thereof under ultrasonic irradiation.
14. The method of claim 13, wherein the method further comprises fractionating the extract into water followed by methylene chloride, ethyl acetate, butanol or a combination thereof.
15. A method of improving dermatitis or a secondary disease resulting from an individual comprising administering to a subject an amount of the composition of any one of claims 1 to 14 in an amount effective to ameliorate dermatitis or a secondary disease resulting therefrom.

Images