WO2018097598A2 - Mam 특이적 형광 표지 물질 및 이의 용도 - Google Patents
Mam 특이적 형광 표지 물질 및 이의 용도 Download PDFInfo
- Publication number
- WO2018097598A2 WO2018097598A2 PCT/KR2017/013351 KR2017013351W WO2018097598A2 WO 2018097598 A2 WO2018097598 A2 WO 2018097598A2 KR 2017013351 W KR2017013351 W KR 2017013351W WO 2018097598 A2 WO2018097598 A2 WO 2018097598A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- fluorescent
- mam
- fragment
- complementarity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/645—Specially adapted constructive features of fluorimeters
- G01N21/6456—Spatial resolved fluorescence measurements; Imaging
- G01N21/6458—Fluorescence microscopy
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
- G01N2021/6439—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes" with indicators, stains, dyes, tags, labels, marks
- G01N2021/6441—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes" with indicators, stains, dyes, tags, labels, marks with two or more labels
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2458/00—Labels used in chemical analysis of biological material
Definitions
- the present invention relates to bimolecular fluorescence complementarity systems for MAM (Mitochondria-Associated endoplasmic reticulum Membrane) specific targeting, and use thereof.
- MAM Mitochondria-Associated endoplasmic reticulum Membrane
- MAM Mitochondria-Associated endoplasmic reticulum Membrane
- MAM is responsible for immune response, stress response, apoptosis signal regulation, neurodeegenerative disease.
- the importance has been reported in connection with cancer diseases (Biochimica et Biophysica Acta 1843 (2014) 2253-2262).
- MAM corresponds to the junction of ER and mitochondria, so the compartments are not clear, and thus physical characteristics are difficult to observe experimentally. Because of these physical limitations, little is known about MAM compared to its biological significance and ongoing research interest.
- BiFC Bimolecular Fluorescence Complement
- BiFC Bimolecular Fluorescence Complement
- the fluorescence can only fluoresce when the fragments, which do not generate fluorescence under normal circumstances, approach a very close distance. to be.
- BiFC is used in combination with two or more proteins, and is mainly used to determine whether these proteins bound to BiFC interact with each other by approaching proximity to each other.
- the present inventors can more easily and accurately prove MAM specificity by using the physical properties of MAM formed by ER and mitochondria at a distance of 10 nm to 25 nm, and in vivo ( in vivo)
- the present invention has been devised as a result of intensive studies on MAM-specific fluorescent labeling substances that can be used in
- an object of the present invention is (a) a first fluorescent complementarity structure in which a linker peptide and a fluorescent protein are linked to an ER (Endoplasmic Reticulum) target protein, and (b) a linker peptide and a fluorescent protein to a mitochondria target protein. It is to provide a bimolecular fluorescence complementarity system for MAM specific targeting, which in turn comprises a second fluorescence complementarity structure bound thereto.
- the present invention provides a bi-molecule fluorescence complementarity system for MAM (Mitochondria-Associated endoplasmic reticulum Membrane) specific targeting, comprising the following structure.
- MAM Mitochondria-Associated endoplasmic reticulum Membrane
- the ER target protein is characterized in that SAC1 (suppressor of actin 1).
- the fragment of the SAC1 protein is characterized in that consisting of the 587 th amino acid from the 521 th amino acid of the full-length protein SAC1.
- the mitochondrial target protein is characterized in that AKAP1 (A Kinase Anchoring Protein 1).
- the fragment of AKAP1 protein is characterized in that consisting of the 63rd amino acid from the 34th amino acid of the AKAP1 full-length protein.
- the mitochondrial target protein is characterized in that MFN1 (Mitofusin 1).
- the fragment of the SAC1 protein is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1.
- the fragment of AKAP1 protein is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2.
- the MFN1 protein is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3.
- the linker peptide is characterized in that the base sequence of SEQ ID NO: 4 is encoded by a polynucleotide is repeated 1 to 8 times.
- the linker peptide is characterized in that the base sequence of SEQ ID NO: 4 is encoded by a polynucleotide is repeated 2 to 4 times.
- the fluorescent protein is characterized in that the Venus (Venus) protein.
- the Venus protein fragment is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5.
- the Venus protein fragment is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6.
- the Venus protein fragment is characterized by being encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7.
- the present invention also provides an expression vector comprising a polynucleotide encoding the first fluorescent complementarity construct.
- the present invention also provides an expression vector comprising a polynucleotide encoding the second fluorescent complementarity construct.
- the present invention also provides a MAM-specific fluorescence labeling method using the two-molecule fluorescence complementarity system for MAM-specific targeting.
- MAM centrifugation technology used to prove MAM specificity, it can be used in vivo, and the specificity of MAM using ER and mitochondrial fluorescent labels, respectively. It is much simpler and more accurate than the method of indirect verification, and it has the advantage of being more versatile because it can apply all the existing genetic techniques for selection of expression tissue or selection of expression time.
- the present invention in addition to targeting the ER and mitochondria, respectively, using a minimal targeting gene sequence without a separate function, a linker without a biological action domain, and a fluorescent label without side effects, By manufacturing, it is possible to provide a fluorescent material that can specifically label MAM without artificially affecting the cells, which has the advantage of being safer than any known method.
- Figure 1a is a schematic diagram of the recombinant nucleic acid molecule for the MAM specific fluorescent label of the present invention
- Figure 1b is a schematic diagram showing the principle of operation of the two-molecule fluorescent complementarity system for MAM specific targeting of the present invention.
- FIG. 2 is a schematic diagram showing the difference between the MAM specific targeting bi-molecular fluorescent complementarity system of the present invention and the conventional scheme.
- 3A and 3B show recombinant expression vectors for the MAM specific fluorescent label of the invention.
- FIG. 4 shows the conventional ER / mitochondria by confocal fluorescence microscopy of subcellular localization of the ER targeting sequence and mitochondrial targeting sequence used in the present invention. Compared with fluorescent labeling results.
- Figure 5a is a result of observing the fluorescent pattern in the cell to confirm the effectiveness of the MAM specific fluorescent label of the present invention compared with the conventional ER / mitochondrial fluorescent label
- Figure 5b is its co-localization coefficient (Mander's Coefficients )
- FIG. 5C shows the result of fluorescence line analysis thereof.
- Figure 6 shows the results confirming the optimal repeating unit of the linker sequence in the MAM specific fluorescent labeling material of the present invention.
- the present invention relates to (a) a first fluorescent complementarity structure in which a linker peptide and a fragment of a fluorescent protein are sequentially linked to a fragment of an ER target protein, and (b) a linker peptide and a fragment of the fluorescent protein are sequentially linked to a fragment of a mitochondrial target protein.
- a bimolecular fluorescence complementarity (BiFC) system for targeting Mitochondria-Associated endoplasmic reticulum Membrane (MAMbrane) specific targeting is provided, comprising a second fluorescent complementarity construct (see FIGS. 1A and 1B).
- the bi-molecule fluorescence complementarity (BiFC) system is applied to the protein fragment complementation (protein fragment complementation) to the fluorescent protein by dividing the fluorescent protein into fragments and then expressed with the two proteins to examine the interaction, respectively
- the present invention uses the BiFC technique for MAM specific targeting / fluorescence labeling. It was introduced for the first time.
- the ER target protein constituting the first fluorescent complementarity construct is not particularly limited as long as it can specifically target ER, for example, Calnexin, IP3R (inositol 1,4,5-triphosphate receptor), and the like. It may be used but is preferably SAC1 (suppressor of actin 1).
- the fragment of the SAC1 protein may be composed of the 587 th amino acid from the 521 th amino acid of the SAC1 full-length protein, the base sequence of SEQ ID NO: 1, or 60%, 70%, 80%, 90%, 95% or more of the phase It can be encoded by a polynucleotide consisting of a nucleotide sequence having the same identity.
- the mitochondrial target protein constituting the second fluorescent complementarity structure is not particularly limited as long as it can specifically target mitochondria, for example, a translocase of outer mitochondrial membrane 20 (TOM20) and a voltage dependent anion channel (VDAC1). 1) and the like, but preferably AKAP1 (A Kinase Anchoring Protein 1) or MFN1 (Mitofusin 1).
- the fragment of AKAP1 protein may be composed of the 63rd amino acid from the 34th amino acid of the AKAP1 full-length protein, the base sequence of SEQ ID NO: 2, or 60%, 70%, 80%, 90%, 95% or more of the phase It can be encoded by a polynucleotide consisting of a nucleotide sequence having the same identity.
- the MFN1 protein may be encoded by a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3 or a base sequence having 60%, 70%, 80%, 90%, 95% or more homology thereto.
- the linker peptide is not limited as long as it can connect the target protein to the fluorescent protein, for example, the nucleotide sequence of SEQ ID NO: 4, or 60%, 70%, 80%, 90%, 95%
- the base sequence having the above homology may be encoded by a polynucleotide which is repeated 1 to 8 times, preferably 2 to 4 times.
- percent sequence homology means the degree of identity between any given sequence and the subject sequence.
- the fluorescent protein is a fluorescent protein that can be used in a BiFC assay for analyzing protein-protein interaction, and dimerization or oligomerization in a cell, and introduced into a cell If it can measure the kind is not particularly limited.
- the fluorescent protein is Venus protein, green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), cyan fluorescent protein (cyan fluorescent protein (CFP), blue fluorescent protein (BFP), ECFP, TagCFP, DsRed, mCherry, etc. can be selected in various sizes depending on the type, characteristics, stability, fluorescence intensity of the protein.
- the fluorescent protein is a Venus protein fragment encoded by a polynucleotide consisting of the nucleotide sequences of SEQ ID NOs: 5, 6 or 7.
- Venus protein is a fluorescent protein consisting of mutations of F46L, F64L, S65G, V68L, S72A, M153T, V163A, S175G, T203Y in enhanced GFP.
- the present invention also provides a recombinant expression vector for expressing an ER or mitochondrial target protein in the form of a fluorescent protein and a fusion protein through a linker peptide.
- a "vector” may be any substance capable of delivering and expressing a nucleic acid molecule in a host cell or subject.
- the vector can be a replicon, such as a plasmid, phage, or cosmid, into which a PCR product or any nucleic acid fragment that is introduced into the cell and integrated into the cell genome can be inserted.
- vectors can be replicated when combined with suitable control elements.
- Vector backbones suitable for use in the present invention may be prepared to be expressed by a promoter that exhibits high expression efficiency in mammalian cells, and may include, for example, a CMV promoter.
- the pEGFP-N1 and pEGFP-C3 vectors disclosed in FIGS. 3A and 3B can be used as the backbone.
- the method for producing a fusion gene by cloning the desired gene in the vector backbone for example, blunt-ended termini or stagger-ended termini for ligation. Restriction enzyme cleavage to provide appropriate ends, filling of cohesive ends as needed, alkaline phosphatase treatment to avoid undesirable binding, and enzyme ligation can be used.
- the target protein-linker peptide is expressed in the form of a fusion protein expressed as one polypeptide through peptide bonds with the N-terminal region or C-terminal region of the fluorescent protein, and the linker peptide is C-terminus or N of the fluorescent protein.
- - can be bound to both ends, and can be expressed in the form of a (fluoroprotein end region) -linker or a linker- (fluoroprotein end region).
- the recombinant expression vector of the present invention can be transformed into cells and cultured to express proteins in the cells and measure fluorescence in the cells, thereby targeting specific positions in the cells and accurately analyzing protein-protein interactions. I could confirm that.
- the fluorescence can be measured using a fluorescence microscope or a confocal microscope.
- a 90 base pair gene sequence corresponding to the mitochondrial targeting sequence (34-63 amino acid sequence) of the mouse Akap1 gene (A kinase (PRKA) anchor protein 1, Mus musculus, Gene ID: 11640) ) was amplified and inserted as the mitochondrial targeting sequence of the recombinant gene.
- a kinase (PRKA) anchor protein 1, Mus musculus, Gene ID: 11640) was amplified and inserted as the mitochondrial targeting sequence of the recombinant gene.
- a mouse cDNA library was used as a template, and PCR was performed using primers having the following sequences.
- AKAP1- (34aa-63aa) forward primer
- the amplified DNA was treated with Nhe I and Xho I restriction enzymes and then inserted into pEGFP-N1 vector cut with Nhe I and Xho I restriction enzymes using T4 ligase to prepare pEGFP-N1-AKAP1 (34aa-63aa) vector.
- PCR was performed using the following primers as a template for a gene encoding Venus, a fluorescent protein consisting of mutations of F46L, F64L, S65G, V68L, S72A, M153T, V163A, S175G, and T203Y.
- the amplified DNA was treated with BamHI and NotI restriction enzymes and inserted into pEGFP-N1-AKAP1 (34aa-63aa) vector, which was digested with BamHI and NotI restriction enzymes using T4 ligase, and the EGFP gene was converted into BiFC gene.
- a substituted pVenus (155-C) -N1-AKAP1 (34aa-63aa) vector was constructed.
- the synthesized oligo DNA was treated with Xho I, Sal I restriction enzyme and then treated with Xho I restriction enzyme using T4 ligase, pVenus (155-C) -N1-AKAP1 ( PVenus (155-C) -linker-AKAP1 (34aa-63aa) vector was prepared by inserting into the 34aa-63aa) vector (see FIG. 3A).
- linker oligo DNA 5'-ccgctcgag
- mitochondrial targeting vector was constructed by amplifying the mouse Mfn1 gene (mitofusin 1, Mus musculus, Gene ID: 67414).
- PCR was performed using primers having the following sequence using the mouse cDNA library as a template.
- MFN1 forward primer 5'-ccggaattctggcagaaacggtatctccactgaag-3 '
- MFN1 reverse primer 5'-cgcggatccttaggattctccactgctcggg-3 '
- the amplified DNA was treated with EcoR I and BamH I restriction enzymes and then inserted into pEGFP-C3 vector cut with Eco R I and Bam H I restriction enzymes using T4 ligase to prepare pEGFP-C3-MFN1 vector.
- PCR was performed using the following primers as a template of the Venus gene.
- the amplified DNA was treated with AgeI and BglII restriction enzymes, and then inserted into pEGFP-C3-MFN1 vector, in which the EGFP gene fragment was cut out with AgeI and BglII restriction enzymes using T4 ligase, and pVenus (N where the EGFP genes were substituted with BiFC genes). -172) -C3-MFN1 vector was constructed.
- Example 1-3 a linker sequence of 60 bp in length was used alone or repeatedly as needed. Oligo DNA synthesized in the same manner as in Example 1-3 was treated with Xho I and Sal I restriction enzymes. Then, pVenus (N-172) -linker-MFN1 vector was prepared by inserting into the pVenus (N-172) -C3-MFN1 vector treated with XhoI restriction enzyme using T4 ligase (see FIG. 3B).
- 204 base corresponding to the ER targeting sequence of the mouse Sac1 gene (SAC1; suppressor of actin mutations 1-like (yeast), Mus musculus, Gene ID: 83493) pair of gene sequences) were amplified and inserted as the ER targeting sequence of the recombinant gene.
- a mouse cDNA library was used as a template, and PCR was performed using primers having the following sequences.
- the amplified DNA was treated with Kpn I and BamH I restriction enzymes and then inserted into pEGFP-C3 vectors cut with Kpn I and Bam H I restriction enzymes using T4 ligase to prepare pEGFP-C3-SAC1 (521aa-587aa) vectors.
- PCR was performed using the following primers as a template of the Venus gene.
- the amplified DNA was treated with AgeI and BglII restriction enzymes, and then inserted into pEGFP-C3-SAC1 (521aa-587aa) vector, which was obtained by cutting the EGFP gene with AgeI and BglII restriction enzymes using T4 ligase.
- a substituted pVenus (149-C) -C3-SAC1 (521aa-587aa) vector was constructed.
- PCR was performed using the following primers as a template of the Venus gene.
- the amplified DNA was treated with AgeI and BglII restriction enzymes, and then inserted into pEGFP-C3-SAC1 (521aa-587aa) vector, which was obtained by cutting the EGFP gene with AgeI and BglII restriction enzymes using T4 ligase.
- a substituted pVenus (N-172) -C3-SAC1 (521aa-587aa) vector was constructed.
- Example 1-3 a linker sequence of 60 bp in length was used alone or repeatedly as needed. Oligo DNA synthesized in the same manner as in Example 1-3 was treated with Xho I and Sal I restriction enzymes. Subsequently, pVenus (149-C) -C3-SAC1 (521aa-587aa) vector and pVenus (N-172) -C3-SAC1 (521aa-587aa) vector treated with XhoI restriction enzyme using T4 ligase were inserted into pVenus. A (149-C) -linker-SAC1 (521aa-587aa) vector and a pVenus (N-172) -linker-SAC1 (521aa-587aa) vector were prepared (see FIG. 3B).
- pEGFP-N1-AKAP1 34aa-63aa vector (mitochondrial targeting) prepared in Examples 1-1, 2-1, and 3-1
- pEGFP-C3-MFN1 vector mitochondrial targeting
- pEGFP-C3-SAC1 pEGFP-C3-SAC1 (521aa-587aa) vector (ER targeting) were transfected into HEK293 cells incubated with mitochondrial fluorescent label gene vector and ER fluorescent label gene vector, respectively. .
- the fluorescent label gene used was a mitochondrial fluorescent label in which N-terminal 29aa of human COXVIII was linked to the mCherry gene and an ER fluorescent label (Plasmid # 38770) registered in Addgene. It was used according to the protocol of.
- HEK293 cells transfected in Example 4-1 were incubated for 24 hours at 37 ° C., 5% CO 2 using DMEM culture medium containing 10% of FBS (Fetal Bovine Serum). Thereafter, the culture solution was washed with PBS and treated with 4% para-formaldehyde cell fixation solution for 10 minutes to fix cells. After sufficiently washing the cell fixation solution using PBS, a microscope sample was prepared by fixing the cover glass on the slide glass using the mounting solution.
- FBS Fetal Bovine Serum
- PVenus (155-C) -linker-AKAP1 (34aa-) prepared in Examples 1-3, 2-3, and 3-3 to verify MAM targeting of the bimolecular MAM-specific fluorescent labeling material prepared in the present invention.
- microscopic samples were prepared after transfection of HEK293 cells with a mitochondrial fluorescent label gene vector and an ER fluorescent label gene vector.
- MAM-specific bi-molecule fluorescent labeling material using these targeting sequences in the cell selectively selects the junction (ER) of ER and mitochondria It was confirmed that it was labeled.
- the fluorescence of the two-molecule-type MAM-specific fluorescent labeling material is extracted by extracting the overlapping fluorescence of the ER-labeled fluorescent material and the mitochondrial-labeled fluorescent material, respectively, which label the ER substrate and the mitochondrial substrate, according to the method used in the existing MAM research.
- Co-localization coefficients with patterns were analyzed.
- the mitochondria and ER fluorescence overlap the overlapped portions of the mitochondria and ER in all irradiated cells. It was confirmed that they were overlapping to a higher level.
- the MAM-specific di-molecule fluorescence of the present invention is obtained by the MAM present at the boundary between the mitochondria (blue fluorescence) and the ER (red fluorescence) (where the solid line of the graph intersects, indicated by an arrow). It was confirmed that the labeling substance labeled very accurately.
- a linker having various repetitions was prepared by repeatedly inserting a 60 bp linker sequence (SEQ ID NO: 4) as one unit and observing a fluorescent pattern specific to MAM. .
- MAM inhibitor methyl- ⁇ -cyclodextrin, known as MAM inhibitor
- MAM-specific targeting bi-molecular fluorescence complementarity system can accurately and safely label only MAM in vivo, which is a functional study of MAM, various intracellular reactions related thereto, and degenerative brain disease or It may be widely used in the study of related diseases such as cancer.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Urology & Nephrology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Food Science & Technology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Optics & Photonics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
본 발명은, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 표적화용 이분자 형광 상보성 시스템, 및 이의 용도에 관한 것이다. 본 발명의 시스템에 의하면, MAM 특이성을 증명하기 위해 기존에 사용되던 전자 현미경 관측, MAM 원심분리기술과는 달리 생체 조건에서의 활용이 가능하고, ER과 미토콘드리아 형광표지물질을 각각 사용하여 간접적으로 MAM의 특이성을 간접적으로 증명하는 방법보다 훨씬 간편하고 정확하며, 발현 조직의 선택이나 발현 시기 선택 등을 위한 기존의 유전학 기술을 모두 적용할 수 있어 보다 활용도가 높다는 장점이 있다.
Description
본 발명은, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 표적화용 이분자 형광 상보성 시스템, 및 이의 용도에 관한 것이다.
진핵세포에서 ER(Endoplasmic Reticulum)과 미토콘드리아는 상호 10∼25nm의 근접 거리에서 MAM(Mitochondria-Associated endoplasmic reticulum Membrane)이라는 미세 접합부를 형성하는데, 이러한 미세 구조체를 통하여 지질(lipid), 칼슘 이온 등의 대사 물질을 교환함으로써 MAM이 대사 조절, 칼슘 신호전달 조절과정에서 중요한 역할을 한다고 알려져 있다.
뿐만 아니라, 최근에는 전자 현미경, 형광 라이브 셀 이미징(live cell fluorescent imaging) 등의 실험기술을 활용한 연구에서, MAM이 면역 반응, 스트레스 반응, 세포사멸 신호 조절, 나아가 퇴행성 뇌질환(neurodegenerative disease), 암(cancer) 질환과 관련되어 그 중요성이 지속적으로 보고되고 있다(Biochimica et Biophysica Acta 1843 (2014) 2253-2262).
ER, 미토콘드리아 등의 기존 세포소기관은 그 구획이 명확히 구분되어 관찰이 용이한데 반하여, MAM은 ER과 미토콘드리아의 접합부에 해당하므로 구획이 명확하지 않아 실험적으로 관찰이 어려운 물리적인 특성이 있다. 이러한 물리적 한계로 인하여, MAM이 갖는 생물학적 중요성과 지속적인 연구 관심도에 비해 MAM에 대해 밝혀진 정보는 많지 않다.
즉, MAM과 관련하여 IP3 receptor, VDAC1 등 주요 칼슘 채널 물질 등이 밝혀져 있지만 아직까지 MAM의 구조에 대해 연구 그룹마다 차이가 있고, MAM의 형성과 조절에 대한 기작이 밝혀지지 않은 상태이며, MAM 특이적 실험 기술의 부족 등의 문제로 MAM에 관한 연구는 아직 초기 단계에 머물러 있는 실정이다.
한편, BiFC(Bimolecular Fluorescence Complement) 기술은 형광물질을 둘 이상의 조각으로 split한 후, 일반적인 상황에서는 형광을 만들어 내지 못하는 이 조각들이 매우 근접한 거리에 접근했을 때에만 형광을 나타낼 수 있다는 작동원리에 근거한 기술이다. 일반적으로 BiFC는 둘 이상의 단백질에 결합시켜 사용되며, BiFC와 결합된 이들 단백질이 서로 근접거리(proximity)에 접근하여 상호작용(interaction) 하는지를 판별하는 데에 주로 사용된다.
이에, 본 발명자들은 ER과 미토콘드리아가 10nm∼25nm 거리로 근접하여 형성되는 MAM의 물리적인 특성을 이용하여, 보다 간편하고도 정확하게 MAM 특이성을 증명할 수 있으며, 기존의 방법으로 불가능했던 생체 조건(in
vivo)에서의 활용이 가능한 MAM 특이적 형광 표지 물질에 대하여 예의 연구한 결과, 본 발명을 고안하게 되었다.
따라서, 본 발명의 목적은, (a) ER(Endoplasmic Reticulum) 표적 단백질에 링커 펩티드와 형광단백질이 차례로 결합된 제 1 형광 상보성 구조체, 및 (b) 미토콘드리아(Mitochondria) 표적 단백질에 링커 펩티드와 형광단백질이 차례로 결합된 제 2 형광 상보성 구조체를 포함하는, MAM 특이적 표적화용 이분자 형광 상보성 시스템을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
본 발명은, 하기의 구조체를 포함하는, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 표적화용 이분자 형광 상보성 시스템을 제공한다.
(a) ER(Endoplasmic Reticulum) 표적 단백질의 단편에 링커 펩티드와 형광단백질의 단편이 차례로 결합된 제 1 형광 상보성 구조체, 및
(b) 미토콘드리아(Mitochondria) 표적 단백질의 단편에 링커 펩티드와 형광단백질의 단편이 차례로 결합된 제 2 형광 상보성 구조체.
본 발명의 일 구체예로서, 상기 ER 표적 단백질은 SAC1(suppressor of actin 1)인 것을 특징으로 한다.
본 발명의 다른 구체예로서, 상기 SAC1 단백질의 단편은 SAC1 전장 단백질의 521번째 아미노산에서 587번째 아미노산으로 이루어진 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 미토콘드리아 표적 단백질은 AKAP1(A Kinase Anchoring Protein 1)인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 AKAP1 단백질의 단편은 AKAP1 전장 단백질의 34번째 아미노산에서 63번째 아미노산으로 이루어진 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 미토콘드리아 표적 단백질은 MFN1(Mitofusin 1)인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 SAC1 단백질의 단편은 서열번호 1의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 AKAP1 단백질의 단편은 서열번호 2의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 MFN1 단백질은 서열번호 3의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 링커 펩티드는 서열번호 4의 염기서열이 1 내지 8번 반복되어 있는 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 링커 펩티드는 서열번호 4의 염기서열이 2 내지 4번 반복되어 있는 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 형광단백질은 비너스(Venus) 단백질인 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 비너스 단백질 단편은 서열번호 5의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 비너스 단백질 단편은 서열번호 6의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
본 발명의 또 다른 구체예로서, 상기 비너스 단백질 단편은 서열번호 7의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 한다.
또한, 본 발명은 상기 제 1 형광 상보성 구조체를 암호화하는 폴리뉴클레오티드를 포함하는, 발현 벡터를 제공한다.
또한, 본 발명은 상기 제 2 형광 상보성 구조체를 암호화하는 폴리뉴클레오티드를 포함하는, 발현 벡터를 제공한다.
또한, 본 발명은 상기 MAM 특이적 표적화용 이분자 형광 상보성 시스템을 이용한, MAM 특이적 형광표지 방법을 제공한다.
본 발명의 시스템에 의하면, MAM 특이성을 증명하기 위해 기존에 사용되던 전자 현미경 관측, MAM 원심분리기술과는 달리 생체 조건에서의 활용이 가능하고, ER과 미토콘드리아 형광표지물질을 각각 사용하여 MAM의 특이성을 간접적으로 증명하는 방법보다 훨씬 간편하고 정확하며, 발현 조직의 선택이나 발현 시기 선택 등을 위한 기존의 유전학 기술을 모두 적용할 수 있어 보다 활용도가 높다는 장점이 있다.
또한, 본 발명은 ER과 미토콘드리아로 각각 표적화하는 것 이외에 별도의 기능성이 없는 최소한의 표적화 유전자 서열, 생물학적 작용 도메인이 없는 링커(linker), 부작용 없는 형광 표지물질만을 이용하여 MAM 특이적 형광 표지물질을 제조함으로써, 세포에 인위적인 영향을 미치지 않고 MAM만을 특정하게 표지할 수 있는 형광 물질을 제공할 수 있는 바, 기존에 알려진 그 어떠한 방법보다 안전하다는 장점이 있다.
도 1a는 본 발명의 MAM 특이적 형광 표지물질에 대한 재조합 핵산분자의 모식도이고, 도 1b는 본 발명의 MAM 특이적 표적화용 이분자 형광 상보성 시스템의 작동원리를 나타낸 모식도이다.
도 2는 본 발명의 MAM 특이적 표적화용 이분자 형광 상보성 시스템과 기존 방식의 차이를 나타낸 모식도이다.
도 3a 및 3b는 본 발명의 MAM 특이적 형광 표지물질에 대한 재조합 발현 벡터를 나타낸 것이다.
도 4는 본 발명에 사용된 ER 표적화 서열과 미토콘드리아 표적화 서열이 세포 내에서 정상적으로 작동하는지 확인하기 위해 그 세포 내 위치(subcellular localization)를 공초점 현광 현미경 관측법(Confocal Fluorescence Microscopy)으로 기존의 ER/미토콘드리아 형광 표지물질과 비교한 결과이다.
도 5a는 본 발명의 MAM 특이적 형광 표지물질의 유효성을 확인하기 위해 세포 내 형광 패턴을 관찰하여 기존의 ER/미토콘드리아 형광 표지 물질과 비교한 결과이고, 도 5b는 이의 co-localization coefficient(Mander's Coefficients)를 분석한 결과이고, 도 5c는 이의 형광 line analysis를 수행한 결과이다.
도 6은 본 발명의 MAM 특이적 형광 표지물질에 있어서 링커 서열의 최적의 반복단위를 확인한 결과이다.
도 7은 약물(MAM 저해제)을 이용한 본 발명의 형광 표지물질의 MAM 특이성을 검증한 결과이다.
본 발명은, (a) ER 표적 단백질의 단편에 링커 펩티드와 형광단백질의 단편이 차례로 결합된 제 1 형광 상보성 구조체, 및 (b) 미토콘드리아 표적 단백질의 단편에 링커 펩티드와 형광단백질의 단편이 차례로 결합된 제 2 형광 상보성 구조체를 포함하는, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 표적화용 이분자 형광 상보성(BiFC) 시스템을 제공한다(도 1a 및 도 1b 참조).
종래, 세포 소기관의 경우 특정하게 표적화 되는 형광 표지 물질이 유용한 실험 기술로 널리 사용되고 있는데 반하여, 아직까지 ER과 미토콘드리아의 접합부인 MAM에만 특정하게 표적화되는 표지 물질은 보고된 바가 없다. 이에, 대다수의 MAM 연구에서는 IGEM(Immuno-Gold Electronic Microscopy), MAM 원심분리기술(MAM fractionation), ER과 미토콘드리아의 개별 형광 표지들의 접합부 현미경 사진 재구성(도 2 참조) 등의 방법을 통하여 특정 유전자의 MAM 내 존재 여부를 확인하고 있으나, 이들 방법은 모두 생체 조건(in
vivo)에서 사용할 수 없는 시험관 조건(in vitro)의 실험이거나, MAM을 간접적인 방법으로 관찰하는 방법이기 때문에, MAM에서 일어나는 생체 현상을 증명하기 위하여 단독으로는 사용되지 못하고 있는 실정이다. 따라서, 종래의 방법들은 결국 1) 간접적인 증명이기 때문에 정확성이 떨어지며 2) 많은 노력과 자원이 들기 때문에 비효율적이다.
다만, 보다 효율적인 MAM 특이적 방법의 개발을 위하여 ER과 MAM을 연결하는 형광물질을 이용한 보고가 있으나, 이들 연구는 다이나믹하게 조절되어야 하는 MAM 구조를 영구적으로 고정시키거나 약물을 이용하여 인위적인 조작으로 모두 돌이킬 수 없는 변화를 일으키므로, MAM 특이성을 증명하기 위한 생체 조건의 연구에 적합한 기술이라고 할 수 없다.
본 발명에서, 이분자 형광 상보성(BiFC) 시스템은 단백질 절편의 상보작용(protein fragment complementation)을 형광 단백질에 적용시켜 형광 단백질을 절편으로 나눈 후 상호작용을 알아보고자 하는 두 단백질과 함께 각각 발현되게 한 다음, 두 단백질이 상호작용을 하기 위해 가까워질 경우 형광단백질의 두 절편이 합쳐져 온전한 형광단백질이 형성될 때 나타나는 형광을 분석하는 툴로서, 본 발명에서는 MAM 특이적 표적화/형광 표지를 위하여 이러한 BiFC 기법을 처음으로 도입하였다.
본 발명에서, 제 1 형광 상보성 구조체를 구성하는 ER 표적 단백질은 ER에 특이적으로 표적화할 수 있는 것이면 특별한 제한은 없으며, 예를 들면 Calnexin, IP3R(inositol 1,4,5-triphosphate receptor) 등을 이용할 수 있으나, 바람직하게는 SAC1(suppressor of actin 1)이다.
이때, 상기 SAC1 단백질의 단편은 SAC1 전장 단백질의 521번째 아미노산에서 587번째 아미노산으로 이루어진 것일 수 있으며, 서열번호 1의 염기서열, 또는 이와 60%, 70%, 80%, 90%, 95% 이상의 상동성을 갖는 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩될 수 있다.
본 발명에서, 제 2 형광 상보성 구조체를 구성하는 미토콘드리아 표적 단백질은 미토콘드리아에 특이적으로 표적화할 수 있는 것이면 특별한 제한은 없으며, 예를 들면 TOM20(translocase of outer mitochondrial membrane 20), VDAC1(voltage dependent anion channel 1) 등을 이용할 수 있으나, 바람직하게는 AKAP1(A Kinase Anchoring Protein 1) 또는 MFN1(Mitofusin 1)이다.
이때, 상기 AKAP1 단백질의 단편은 AKAP1 전장 단백질의 34번째 아미노산에서 63번째 아미노산으로 이루어진 것일 수 있으며, 서열번호 2의 염기서열, 또는 이와 60%, 70%, 80%, 90%, 95% 이상의 상동성을 갖는 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩될 수 있다. 또한, 상기 MFN1 단백질은 서열번호 3의 염기서열, 또는 이와 60%, 70%, 80%, 90%, 95% 이상의 상동성을 갖는 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩될 수 있다.
본 발명에서, 상기 링커 펩티드는 상기 표적 단백질을 상기 형광 단백질에 연결할 수 있는 것이면 제한이 없으며, 예를 들면 서열번호 4의 염기서열, 또는 이와 60%, 70%, 80%, 90%, 95% 이상의 상동성을 갖는 염기서열이 1 내지 8번, 바람직하게는 2 내지 4번 반복되어 있는 폴리뉴클레오티드에 의해 코딩될 수 있다.
이때, "서열 상동성 퍼센트"는 임의의 주어진 서열과 대상 서열 사이의 동일성의 정도를 의미한다.
본 발명에서, 상기 형광 단백질은 세포에서 단백질-단백질 상호작용(interaction), 및 다이머화(dimerization) 또는 올리고머화(oligomerization)를 분석하기 위한 BiFC 분석법에 사용될 수 있는 형광 단백질로서, 세포내로 도입하여 형광을 측정할 수 있는 것이라면 그 종류는 특별히 제한되지 않는다. 바람직하게는 상기 형광 단백질은 비너스(Venus) 단백질, 녹색형광단백질(green fluorescent protein, GFP), 황색형광단백질(yellow fluorescent protein, YFP), 적색형광단백질(red fluorescent protein, RFP), 시안형광단백질(cyan fluorescent protein CFP), 청색형광단백질(blue fluorescent protein, BFP), ECFP, TagCFP, DsRed, mCherry 등에서 선택될 수 있으며, 단백질의 종류, 특성, 안정성, 형광 강도에 따라 다양한 크기로 디자인될 수 있다.
더욱 바람직하게는, 상기 형광 단백질은 서열번호 5, 6 또는 7의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 비너스(Venus) 단백질 단편이다. 비너스 단백질은 enhanced GFP에서 F46L, F64L, S65G, V68L, S72A, M153T, V163A, S175G, T203Y의 돌연변이로 이루어진 형광 단백질이다.
또한, 본 발명에서는 ER 또는 미토콘드리아 표적 단백질을 링커 펩티드를 통하여 형광 단백질과 융합 단백질 형태로 발현시키는 재조합 발현 벡터를 제공한다.
본 발명에서 "벡터"는 숙주 세포 또는 피검체 내에서 핵산 분자를 전달하고 발현할 수 있는 임의의 물질일 수 있다. 따라서, 벡터는 세포내로 도입되고 세포 유전체에 통합되는 PCR 생성물 또는 임의의 핵산 조각이 삽입될 수 있는, 레플리콘(replicon), 예컨대, 플라스미드, 파아지, 또는 코스미드일 수 있다. 일반적으로, 벡터는 적합한 조절 엘리먼트와 결합된 경우 복제될 수 있다. 본 발명에서 이용에 적합한 벡터 백본은, 포유동물의 세포에서 높은 발현 효율을 보이는 프로모터에 의해 발현되도록 제조될 수 있으며, 예를 들면 CMV 프로모터를 포함할 수 있다. 바람직하게는, 도 3a 및 도 3b에 개시된 pEGFP-N1 및 pEGFP-C3 벡터를 백본으로 이용할 수 있다.
본 발명에서 상기 벡터 백본에 원하는 유전자를 클로닝하여 융합 유전자를 제조하는 방법에 제한은 없으며, 예를 들면 라이게이션을 위한 평활-말단(blunt-ended termini) 또는 스태거-말단(stagger-ended termini), 적절한 말단을 제공하기 위한 제한 효소 절단, 필요에 따라 코헤시브 말단(cohesive ends)의 채움, 바람직하지 않은 결합을 회피하기 위한 알카라인 포스파타아제 처리, 및 효소 라이게이션을 이용할 수 있다.
본 발명에서 상기 표적 단백질-링커 펩티드는 형광 단백질의 N 말단 영역 또는 C 말단 영역과 펩타이드 결합을 통하여 하나의 폴리펩타이드로 발현되는 융합 단백질 형태로 발현되며, 링커 펩티드는 형광 단백질의 C-말단 또는 N-말단 모두에 결합될 수 있으므로, (형광단백질 말단 영역)-링커 또는 링커-(형광단백질 말단 영역)의 형태로 발현될 수 있다.
본 발명에서는, 본 발명의 재조합 발현 벡터를 세포에 형질전환하여 배양하여 단백질을 세포 내에서 발현시키고 세포에서의 형광을 측정함으로써, 세포 내 특정 위치를 표적화 하고, 단백질-단백질 상호작용을 정확하게 분석 가능하다는 것을 확인할 수 있었다. 이때, 형광은 형광 현미경 또는 공초점 현미경 등을 이용하여 측정할 수 있다.
또한, 본 발명에 의하면 상기 MAM 특이적 표적화용 이분자 형광 상보성 시스템을 이용함으로써, MAM 특이적 형광표지 방법을 제공할 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[실시예]
실시예 1. AKAP1을 이용한 미토콘드리아 표적화 재조합 핵산 분자 제작
1-1. 미토콘드리아
표적화
서열의 삽입
pEGFP-N1 벡터를 기반으로, mouse Akap1 유전자(A kinase (PRKA) anchor protein 1, Mus musculus, Gene ID: 11640)의 미토콘드리아 표적화 서열(34번째∼63번째 아미노산 서열에 해당하는 90 base pair의 유전자 서열)를 증폭하여, 이를 재조합 유전자의 미토콘드리아 표적화 서열(mitochondrial targeting sequence)로서 삽입하였다. 이를 위해 template로 mouse cDNA library를 사용하였고, 다음과 같은 서열의 프라이머를 사용하여 PCR을 수행하였다.
AKAP1-(34aa-63aa) forward primer:
5'-ctagctagccaccatggcaatccagttgcgttcg-3'
AKAP1-(34aa-63aa) reverse primer:
5'-ccgctcgagttttttacgagagaaaaaccaccaccagcc-3'
증폭된 DNA는 NheⅠ, XhoⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 NheⅠ, XhoⅠ 제한효소로 잘라낸 pEGFP-N1 벡터에 삽입하여 pEGFP-N1-AKAP1(34aa-63aa) vector를 제작하였다.
1-2. 형광단백질 유전자의 교체
enhanced GFP에서 F46L, F64L, S65G, V68L, S72A, M153T, V163A, S175G, T203Y의 돌연변이로 이루어진 형광 단백질인 Venus를 코딩하는 유전자를 template로 다음의 프라이머를 사용하여 PCR을 수행하였다.
Venus155-N1 forward primer:
5'-cgcggatcccaccatgaagcagaagaacggcatcaag-3'
Venus155-N1 reverse primer:
5'-aaatatgcggccgctttacttgtacagctcgtccatgc-3'
증폭된 DNA는 BamHⅠ, NotⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 BamHⅠ, NotⅠ 제한효소로 EGFP 유전자 부분을 잘라낸 pEGFP-N1-AKAP1(34aa-63aa) vector에 삽입하여, EGFP 유전자가 BiFC 유전자로 치환된 pVenus(155-C)-N1-AKAP1(34aa-63aa) vector를 제작하였다.
1-3. 링커 서열의 삽입
본 실시예에서는 다음과 같이 60bp 길이의 링커 서열을 단독으로, 혹은 필요에 따라 반복하여 사용하였다.
linker sequence:
5'-gacccaaccaggtcagcgaattctggagcaggagcaggagcaggagcaatactctcccgt-3'
구체적으로, 다음 서열의 링커 서열을 합성한 후, 합성된 올리고 DNA는 XhoⅠ, SalⅠ 제한효소로 처리한 후, T4 ligase를 이용하여 XhoⅠ 제한효소를 처리한 pVenus(155-C)-N1-AKAP1(34aa-63aa) vector에 삽입하여 pVenus(155-C)-linker-AKAP1(34aa-63aa) vector를 제작하였다(도 3a 참조).
linker oligo DNA: 5'-ccgctcgag
(gacccaaccaggtcagcgaattctggagcaggagcaggagcaggagcaatactctcccgt)n gtcgac-3'
실시예 2. MFN1을 이용한 미토콘드리아 표적화 재조합 핵산 분자 제작
2-1. 미토콘드리아
표적화
서열의 삽입
pEGFP-C3 벡터를 기반으로, mouse Mfn1 유전자(mitofusin 1, Mus musculus, Gene ID: 67414)를 증폭하여 또 다른 미토콘드리아 표적화 vector를 제작하였다.
이를 위해 template로 mouse cDNA library를 사용하여 다음과 같은 서열의 프라이머로 PCR을 수행하였다.
MFN1 forward primer: 5'-ccggaattctggcagaaacggtatctccactgaag-3'
MFN1 reverse primer: 5'-cgcggatccttaggattctccactgctcggg-3'
증폭된 DNA는 EcoRⅠ, BamHⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 EcoRⅠ, BamHⅠ 제한효소로 잘라낸 pEGFP-C3 벡터에 삽입하여 pEGFP-C3-MFN1 vector를 제작하였다.
2-2. 형광단백질 유전자의 교체
Venus 유전자를 template로 다음의 프라이머를 사용하여 PCR을 수행하였다.
VenusN172-C3 forward primer:
5'-gggaccggtgccaccatggtgagcaagggcgag-3'
VenusN172-C3 reverse primer:
5'-ggaagatctgactcgatgttgtggcggatc-3’
증폭된 DNA는 AgeⅠ, BglⅡ 제한효소로 처리한 후 T4 ligase를 이용하여 AgeⅠ, BglⅡ 제한효소로 EGFP 유전자 부분을 잘라낸 pEGFP-C3-MFN1 vector에 삽입하여, EGFP 유전자가 BiFC 유전자로 치환된 pVenus(N-172)-C3-MFN1 vector를 제작하였다.
2-3. 링커 서열의 삽입
실시예 1-3에서와 마찬가지로 60 bp 길이의 링커 서열이 단독으로, 혹은 필요에 따라 반복되어 사용되었으며, 실시예 1-3에서와 동일한 방법으로 합성된 올리고 DNA는 XhoⅠ, SalⅠ 제한효소로 처리한 후, T4 ligase를 이용하여 XhoⅠ 제한효소를 처리한 pVenus(N-172)-C3-MFN1 vector에 삽입하여 pVenus(N-172)-linker-MFN1 vector를 제작하였다(도 3b 참조).
실시예 3. SAC1을 이용한 ER 표적화 재조합 핵산 분자 제작
3-1. ER
표적화
서열의 삽입
pEGFP-C3 벡터를 기반으로, mouse Sac1 유전자(SAC1; suppressor of actin mutations 1-like (yeast), Mus musculus, Gene ID: 83493)의 ER 표적화 서열(521번째∼587번째 아미노산 서열에 해당하는 204 base pair의 유전자 서열)를 증폭하여 이를 재조합 유전자의 ER 표적화 서열(ER targeting sequence)로서 삽입하였다.
이를 위해 template로 mouse cDNA library를 사용하였고, 다음과 같은 서열의 프라이머를 사용하여 PCR을 수행하였다.
SAC1-(521aa-587aa) forward primer:
5'-cggggtaccgttcctggcgttgcctatcatc-3'
SAC1-(521aa-587aa) reverse primer:
5'-cgcggatcctcagtctatcttttctttctggaccag-3'
증폭된 DNA는 KpnⅠ, BamHⅠ 제한효소로 처리한 후 T4 ligase를 이용하여 KpnⅠ, BamHⅠ 제한효소로 잘라낸 pEGFP-C3 벡터에 삽입하여 pEGFP-C3-SAC1(521aa-587aa) vector를 제작하였다.
3-2. 형광단백질 유전자의 교체
Venus 유전자를 template로 다음의 프라이머를 사용하여 PCR을 수행하였다.
Venus149C-C3 forward primer:
5'-gggaccggtgccaccatgaacgtctatatcaccgccgac-3'
Venus149C-C3 reverse primer:
5'-ggaagatctgacttgtacagctcgtccatgcc-3'
증폭된 DNA는 AgeⅠ, BglⅡ 제한효소로 처리한 후 T4 ligase를 이용하여 AgeⅠ, BglⅡ 제한효소로 EGFP 유전자 부분을 잘라낸 pEGFP-C3-SAC1(521aa-587aa) vector에 삽입하여, EGFP 유전자가 BiFC 유전자로 치환된 pVenus(149-C)-C3-SAC1(521aa-587aa) vector를 제작하였다.
마찬가지로 Venus 유전자를 template로 다음의 프라이머를 사용하여 PCR을 수행하였다.
VenusN172-C3 forward primer: 5'-gggaccggtgccaccatggtgagcaagggcgag-3'
VenusN172-C3 reverse primer: 5'-ggaagatctgactcgatgttgtggcggatc-3'
증폭된 DNA는 AgeⅠ, BglⅡ 제한효소로 처리한 후 T4 ligase를 이용하여 AgeⅠ, BglⅡ 제한효소로 EGFP 유전자 부분을 잘라낸 pEGFP-C3-SAC1(521aa-587aa) vector에 삽입하여, EGFP 유전자가 BiFC 유전자로 치환된 pVenus(N-172)-C3-SAC1(521aa-587aa) vector를 제작하였다.
3-3. 링커 서열의 삽입
실시예 1-3에서와 마찬가지로 60 bp 길이의 링커 서열이 단독으로, 혹은 필요에 따라 반복되어 사용되었으며, 실시예 1-3에서와 동일한 방법으로 합성된 올리고 DNA는 XhoⅠ, SalⅠ 제한효소로 처리한 후, T4 ligase를 이용하여 XhoⅠ 제한효소를 처리한 pVenus(149-C)-C3-SAC1(521aa-587aa) vector, pVenus(N-172)-C3-SAC1(521aa-587aa) vector에 삽입하여 pVenus(149-C)-linker-SAC1(521aa-587aa) vector, pVenus(N-172)-linker-SAC1(521aa-587aa) vector를 제작하였다(도 3b 참조).
실시예 4. ER/미토콘드리아 표적화 검증
상기 실시예 1 내지 3에서 제조된 ER/미토콘드리아 표적화 서열이 실제로 세포 내에서 ER/미토콘드리아 특이적인 표적화에 유효한지 확인하기 위해 다음과 같은 실험을 수행하였다.
4-1. 재조합 벡터의 transfection
HEK293 세포를 poly-D-lysine으로 코팅한 cover glass위에 12시간 배양한 후, 실시예 1-1, 2-1, 3-1에서 제작된 pEGFP-N1-AKAP1(34aa-63aa) vector(미토콘드리아 표적화), pEGFP-C3-MFN1 vector(미토콘드리아 표적화), pEGFP-C3-SAC1(521aa-587aa) vector (ER 표적화)를 각각 미토콘드리아 형광 표지 유전자 vector, ER 형광 표지 유전자 vector와 함께 배양된 HEK293 세포에 transfection하였다.
이때, 사용한 형광 표지 유전자는 human COXVIII의 N-말단 29aa가 mCherry 유전자에 연결된 미토콘드리아 형광 표지와 Addgene에 등록된 ER 형광 표지(Plasmid #38770) 물질을 사용하였으며, Transfection reagent로는 invitrogen사의 lipofectamine 2000 reagent를 제조사의 프로토콜에 따라 사용하였다.
4-2. 현미경 샘플의 제작 및 관찰
실시예 4-1에서 transfection한 HEK293 세포를 FBS(Fetal Bovine Serum) 10%를 포함하는 DMEM 배양액을 사용하여 37℃, 5% CO2의 배양 조건에서 24시간 배양하였다. 이후, PBS로 배양용액을 씻어낸 뒤 4% para-formaldehyde 세포 고정 용액에 10분 처리하여 세포를 고정시켰다. PBS를 이용하여 세포 고정 용액을 충분히 씻어낸 후, mounting solution을 이용하여 cover glass를 slide glass 위에 고정시켜 현미경 샘플을 제작하였다.
이후, 형광 현미경을 이용하여 세포내 형광 패턴을 관찰하여 colocalization 수준을 분석한 결과, 도 4에 나타낸 바와 같이, ER 표지 형광 물질, 미토콘드리아 표지 형광 물질의 형광 패턴과 비교하여 SAC1(521aa-587aa), MFN1 서열이 각각 ER 표적화 서열, 미토콘드리아 표적화 서열로써 유효하다는 것을 실험적으로 입증하였다.
실시예 5. MAM 표적화 검증
5-1. 현미경 샘플의 제작 및 관찰
본 발명에서 제작된 이분자형 MAM 특이적 형광 표지 물질의 MAM 표적화를 검증하기 위하여, 실시예 1-3, 2-3, 3-3에서 제작된 pVenus(155-C)-linker-AKAP1(34aa-63aa) vector, pVenus(N-172)-linker-MFN1 vector, pVenus(149-C)-linker-SAC1(521aa-587aa) vector, pVenus(N-172)-linker-SAC1(521aa-587aa) vector를 실시예 4와 같은 방법으로 미토콘드리아 형광 표지 유전자 vector, ER 형광 표지 유전자 vector와 함께 HEK293 세포에 transfection한 뒤 현미경 샘플을 제작하였다.
이후, 형광 현미경을 이용하여 세포내 형광 패턴을 관찰한 결과, 도 5a에 나타낸 바와 같이, 세포 내에서 이들 표적화 서열을 이용한 MAM 특이적 이분자 형광 표지 물질이 ER과 미토콘드리아의 접합부 (MAM)를 선택적으로 표지하고 있음을 확인하였다.
5-2. MAM 표적화 분석
본 발명에서 제작된 이분자형 MAM 특이적 형광 표지 물질의 MAM 표적화 수준을 분석하기 위하여, 실시예 5-1에서 제작한 현미경 샘플을 이용하여 촬영한 형광 사진들을 NIH에서 배포한 범용 이미지 분석 프로그램 Image J를 이용하여 분석하였다.
먼저, 기존의 MAM 연구에서 사용된 방법대로 각각 ER의 기질과 미토콘드리아 기질을 표지하는 ER 표지 형광 물질, 미토콘드리아 표지 형광 물질의 형광이 겹쳐지는 부분을 추출하여, 이분자형 MAM 특이적 형광 표지 물질의 형광 패턴과의 co-localization coefficient(Mander's Coefficients)를 분석하였다.
그 결과, 도 5b에 나타낸 바와 같이, 본 발명의 이분자형 MAM 특이적 형광 표지 물질의 경우, 조사된 모든 세포에서 미토콘드리아, ER 각자의 형광 표지보다 미토콘드리아와 ER의 형광이 겹쳐지는 부분(overlapped)에 더 높은 수준으로 겹쳐지고 있음을 확인하였다.
또한, MAM 특이적 형광 표지 신호가 나타나는 구간에서 MAM 특이적 형광 표지 물질과 ER 형광 표지 물질, 미토콘드리아 형광 표지 물질의 패턴을 분석하기 위해 line analysis를 수행하였다.
그 결과, 도 5c에 나타낸 바와 같이, 미토콘드리아(파란색 형광)와 ER(붉은색 형광)의 경계(그래프의 실선이 교차하는 부분, 화살표로 표시)에 존재하는 MAM을 본 발명의 MAM 특이적 이분자 형광 표지 물질이 매우 정확하게 표지하고 있음을 확인하였다.
실시예 6. 링커 서열의 최적 반복단위 확인
링커 서열의 최적의 반복수를 확인하기 위하여, 60bp 길이의 링커 서열(서열번호 4)을 하나의 단위로 반복 삽입하여 다양한 반복수를 갖는 링커를 제작한 후, MAM에 특이적인 형광 패턴을 관찰하였다.
그 결과, 도 6에 나타낸 바와 같이, 다양한 길이의 링커 서열 삽입 유전자 물질 중 미토콘드리아 표적화 서열에 링커 2개 단위가 삽입된 vector(pVenus(155-C)-2*linker-AKAP1(34aa-63aa))와 ER 표적화 서열에 링커 2개 단위가 삽입된 vector(pVenus(149-C)-2*linker-SAC1(521aa-587aa)) 조합에서 MAM에 가장 특이적인 형광 패턴을 확인할 수 있었다.
즉, 링커 서열이 너무 짧은 경우 세포가 비정상적인 형태의 형광을 나타냈으며, 링커 서열이 너무 긴 경우 미토콘드리아 외막 주변을 전부 형광으로 뒤덮는 형태로 MAM 특이성이 감소하는 현상을 확인하였다.
실시예 7. 약물을 이용한 본 발명의 형광 표지 물질의 MAM 특이성 검증
상기 실시예 5-1과 같은 방식으로 MAM 특이적 이분자 형광 표지 물질을 HEK293 세포에 transfection 시킨 후, MAM 저해 물질로 알려진 methyl-β-cyclodextrin을 150μM 농도로 세포 배양액에 첨가한 다음, 3시간 혹은 24시간 세포 배양 조건에서 배양한 뒤 현미경 샘플을 제작하고 형광 현미경을 이용하여 관찰하였다.
그 결과, 도 7에 나타낸 바와 같이, methyl-β-cyclodextrin을 처리하여 MAM 구조를 흩트려 저해한 경우, 본 발명의 MAM 특이적 형광 표지 물질의 형광 수준도 현저하게 감소되는 것을 확인하였다. 이를 통해 본 발명에서 제작된 MAM 특이적 형광 표지 물질이 이미 형성된 MAM 구조의 표지 뿐 아니라, 세포 내에서 다이나믹하게 일어나는 MAM 구조의 변화를 측정하는 데에도 유효하다는 것을 입증하였다.
상기 진술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명에 따른 MAM 특이적 표적화용 이분자 형광 상보성 시스템은 종래 기술과는 달리 생체 내에서 정확하고 안전하게 MAM만을 표지할 수 있는바, MAM의 기능 연구, 이와 관련된 다양한 세포 내 반응, 및 퇴행성 뇌질환 또는 암과 같은 관련 질병의 연구에 폭넓게 활용될 수 있을 것이다.
Claims (18)
- 하기의 구조체를 포함하는, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 표적화용 이분자 형광 상보성 시스템:(a) ER(Endoplasmic Reticulum) 표적 단백질의 단편에 링커 펩티드와 형광 단백질의 단편이 차례로 결합된 제 1 형광 상보성 구조체, 및(b) 미토콘드리아(Mitochondria) 표적 단백질의 단편에 링커 펩티드와 형광 단백질의 단편이 차례로 결합된 제 2 형광 상보성 구조체.
- 제 1 항에 있어서, 상기 ER 표적 단백질은 SAC1(suppressor of actin 1)인 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 2 항에 있어서, 상기 SAC1 단백질의 단편은 SAC1 전장 단백질의 521번째 아미노산에서 587번째 아미노산으로 이루어진 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 1 항에 있어서, 상기 미토콘드리아 표적 단백질은 AKAP1(A Kinase Anchoring Protein 1)인 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 4 항에 있어서, 상기 AKAP1 단백질의 단편은 AKAP1 전장 단백질의 34번째 아미노산에서 63번째 아미노산으로 이루어진 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 1 항에 있어서, 상기 미토콘드리아 표적 단백질은 MFN1(Mitofusin 1)인 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 3 항에 있어서, 상기 SAC1 단백질의 단편은 서열번호 1의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 5 항에 있어서, 상기 AKAP1 단백질의 단편은 서열번호 2의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 6 항에 있어서, 상기 MFN1 단백질은 서열번호 3의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 1 항에 있어서, 상기 링커 펩티드는 서열번호 4의 염기서열이 1 내지 8번 반복되어 있는 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 10 항에 있어서, 상기 링커 펩티드는 서열번호 4의 염기서열이 2 내지 4번 반복되어 있는 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 1 항에 있어서, 상기 형광단백질은 비너스(Venus) 단백질 단편인 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 12 항에 있어서, 상기 비너스 단백질 단편은 서열번호 5의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 12 항에 있어서, 상기 비너스 단백질 단편은 서열번호 6의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 12 항에 있어서, 상기 비너스 단백질 단편은 서열번호 7의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것을 특징으로 하는, 이분자 형광 상보성 시스템.
- 제 1 항의 제 1 형광 상보성 구조체를 암호화하는 폴리뉴클레오티드를 포함하는, 발현 벡터.
- 제 1 항의 제 2 형광 상보성 구조체를 암호화하는 폴리뉴클레오티드를 포함하는, 발현 벡터.
- 제 1 항의 시스템을 이용한, MAM(Mitochondria-Associated endoplasmic reticulum Membrane) 특이적 형광표지 방법.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/316,076 US20230204598A1 (en) | 2016-11-25 | 2017-11-22 | Mam-specific fluorescence marker and use thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020160157951A KR101864958B1 (ko) | 2016-11-25 | 2016-11-25 | Mam 특이적 형광 표지 물질 및 이의 용도 |
| KR10-2016-0157951 | 2016-11-25 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2018097598A2 true WO2018097598A2 (ko) | 2018-05-31 |
| WO2018097598A3 WO2018097598A3 (ko) | 2018-08-09 |
Family
ID=62195294
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2017/013351 Ceased WO2018097598A2 (ko) | 2016-11-25 | 2017-11-22 | Mam 특이적 형광 표지 물질 및 이의 용도 |
Country Status (3)
| Country | Link |
|---|---|
| US (1) | US20230204598A1 (ko) |
| KR (1) | KR101864958B1 (ko) |
| WO (1) | WO2018097598A2 (ko) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009158148A1 (en) * | 2008-05-30 | 2009-12-30 | The Trustees Of Columbia University In The City Of New York | Methods for diagnosis and treatment of neurodegenerative diseases or disorders |
| CA2838330C (en) * | 2010-08-23 | 2021-01-26 | President And Fellows Of Harvard College | Optogenetic probes for measuring membrane potential |
-
2016
- 2016-11-25 KR KR1020160157951A patent/KR101864958B1/ko active Active
-
2017
- 2017-11-22 WO PCT/KR2017/013351 patent/WO2018097598A2/ko not_active Ceased
- 2017-11-22 US US16/316,076 patent/US20230204598A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| KR101864958B1 (ko) | 2018-06-05 |
| WO2018097598A3 (ko) | 2018-08-09 |
| US20230204598A1 (en) | 2023-06-29 |
| KR20180058963A (ko) | 2018-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hase et al. | Direct interaction with nup153 mediates binding of Tpr to the periphery of the nuclear pore complex | |
| Caplan et al. | A tubular EHD1‐containing compartment involved in the recycling of major histocompatibility complex class I molecules to the plasma membrane | |
| Darboux et al. | The structure‐function relationships in Drosophila neurotactin show that cholinesterasic domains may have adhesive properties. | |
| Bradley et al. | The pro region of Toxoplasma ROP1 is a rhoptry-targeting signal | |
| JP6876628B2 (ja) | 細胞表面上にペプチドを提示するためのシステム | |
| Bubeck et al. | Ligand recruitment by vinculin domains in transfected cells | |
| Sakamaki et al. | Dysregulation of a potassium channel, THIK-1, targeted by caspase-8 accelerates cell shrinkage | |
| Zaremba-Czogalla et al. | The different function of single phosphorylation sites of Drosophila melanogaster lamin Dm and lamin C | |
| WO2017135568A1 (ko) | 가역적으로 활성화 가능한 항체 유사체 및 그의 용도 | |
| Streit et al. | Optimized genetic code expansion technology for time‐dependent induction of adhesion GPCR‐ligand engagement | |
| WO2018097598A2 (ko) | Mam 특이적 형광 표지 물질 및 이의 용도 | |
| WO2019209073A1 (ko) | 세포의 자성 비드 부착을 통한 자성 기반 바이오 패닝 방법 | |
| Beqollari et al. | Rem uncouples excitation–contraction coupling in adult skeletal muscle fibers | |
| EP3172563B1 (en) | Methods for detecting interactions in eukaryotic cells using microtubule structures and dynamics | |
| Jakob et al. | Targeting of transmembrane protein shrew-1 to adherens junctions is controlled by cytoplasmic sorting motifs | |
| Weixel et al. | Analysis of CFTR endocytosis by cell surface biotinylation | |
| KR102074590B1 (ko) | 자가포식체 탐침용 프로브 및 이를 이용한 탐침 방법 | |
| Michel et al. | Nuclear localization of the Hermes transposase depends on basic amino acid residues at the N‐terminus of the protein | |
| Takubo et al. | Expression of non-muscle type myosin heavy polypeptide 9 (MYH9) in mammalian cells | |
| Sheridan et al. | A faster way to make GFP-based biosensors: two new transposons for creating multicolored libraries of fluorescent fusion proteins | |
| WO2017160118A2 (ko) | 목적 단백질의 발현 효율을 증진시키기 위한 신규한 펩타이드 및 이를 포함하는 융합 단백질 | |
| Ono et al. | Improvement of probe peptides for coiled‐coil labeling by introducing phosphoserines | |
| WO2023229328A1 (ko) | 바이러스 뉴클레오캡시드를 이용한 목적 단백질 발현 플랫폼 | |
| KR101963502B1 (ko) | 살아있는 세포 기반 바이오센서 및 이를 이용한 외부자극물질 또는 생체신호물질 센싱 방법 | |
| WO2025264069A1 (ko) | Tead 이성체 및 yap/taz의 상호작용 검출용 형광공명에너지전달 바이오센서 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17873371 Country of ref document: EP Kind code of ref document: A2 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17873371 Country of ref document: EP Kind code of ref document: A2 |