WO2018092974A1 - Nouvelle souche de lawsonia intracellularis et utilisation correspondante - Google Patents

Nouvelle souche de lawsonia intracellularis et utilisation correspondante Download PDF

Info

Publication number
WO2018092974A1
WO2018092974A1 PCT/KR2016/014814 KR2016014814W WO2018092974A1 WO 2018092974 A1 WO2018092974 A1 WO 2018092974A1 KR 2016014814 W KR2016014814 W KR 2016014814W WO 2018092974 A1 WO2018092974 A1 WO 2018092974A1
Authority
WO
WIPO (PCT)
Prior art keywords
strain
intracellularis
lawsonia
present
vaccine
Prior art date
Application number
PCT/KR2016/014814
Other languages
English (en)
Korean (ko)
Inventor
황정민
김성재
손동현
문형준
한상윤
고대웅
김종만
강보규
예정용
Original Assignee
녹십자수의약품(주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 녹십자수의약품(주) filed Critical 녹십자수의약품(주)
Publication of WO2018092974A1 publication Critical patent/WO2018092974A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/105—Delta proteobacteriales, e.g. Lawsonia; Epsilon proteobacteriales, e.g. campylobacter, helicobacter
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales

Definitions

  • the present invention relates to a novel Lawsonia intracellular strain and its use.
  • Porcine proliferative enteritis also known as ileitis, intestinal adenomatosis, hemorrhagic enteropathy, or necrotic enteritis, is present in pigs after young adulthood. It is a naturally occurring disease that affects.
  • Swine proliferative ileitis is a major problem in the swine industry in Korea and around the world, and many pig farmers are suffering economic damage from pig proliferative ileitis, but the research on the causative organism is difficult to separate and culture. to be.
  • research on the Lawsonia intracellularis (L. intracellularis ) the causative agent of proliferative ileitis ( L. intracellularis ) in the laboratory has been successful, but research is actively underway. It is an absolute intracellular bacterium that cannot be cultured by normal bacterial methods on cell culture and requires epithelial cells to attach to grow. This prior culture method requires a lot of effort and is not suitable for large-scale culture.
  • the present inventors made diligent efforts to develop novel vaccines against swine ileitis. As a result, attenuated the secured ileitis strain was produced a novel strain, and the present invention was completed by confirming the excellent immunogenic effect using the strain as a vaccine.
  • an object of the present invention is to provide a novel Lawsonia intracellularis strain.
  • Another object of the present invention is to provide a vaccine composition for preventing or treating proliferative enteritis.
  • Another object of the present invention is to provide a method for preventing or treating proliferative enteritis.
  • Still another object of the present invention is to provide a novel Lawsonia Intracellulose. intracellularis ) strains are provided.
  • the novel Lawsonia intracellular lass strain of the present invention is attenuated through passage of 100 times of passage, and has excellent safety and stability, and has high immunogenicity and high therapeutic efficiency when administered to a subject. Can be effectively used.
  • Figure 1 shows the IHC results of CV-1 cell monolayer (left) and uninfected CV-1 cell monolayer (right) infected with Lawsonia intracellularis.
  • Figure 3 shows the results of intestinal gross lesions confirmed pathogenicity of the attenuated strain in hamsters.
  • Figure 4 shows the pathological results of the ileum confirmed the pathogenicity of the present attenuated strain in hamsters.
  • Figure 5 shows the results of gross lesions of the ileum confirmed pathogenicity of the present attenuated pigs.
  • Figure 6 shows the pathological results of the ileum confirmed the pathogenicity of the present attenuated pigs.
  • Figure 7 shows the results of confirming the protective effect of the present attenuated strains against challenge after inoculating pigs with attenuated strains.
  • Figure 8 shows the change in the average body weight of the test pigs for challenge vaccination after attenuated pigs.
  • Figure 9 shows the results of confirming the antibody response of the present attenuated strain to the challenge after inoculating the attenuated strain pig.
  • Figure 10 shows the results of confirming the histological changes in the target organ of the present attenuated strain for challenge after inoculating the attenuated pig in the pig.
  • the invention is a novel Lawsonia intracellulase deposited with accession number KCTC13152BP. intracellularis ) strain.
  • the strain is Lawsonia intrasolaris ( Lawsonia) an intracellularis ) attenuated strain attenuated or inactivated through CV-1 cell infection and passage, which has the 16S rRNA sequence of SEQ ID NO: 1.
  • Lawonia intracellular lass ( Lawsonia) intracellularis L. intracellularis
  • L. intracellularis L. intracellularis
  • the attenuation may be performed by a method known in the art.
  • the attenuated strain may be attenuated by chemical treatment, for example formalin treatment, or attenuated by ultraviolet irradiation or passage.
  • the term “attenuated” refers to a toxicity that is capable of inducing an immune response in a subject but not lethal enough to be used as a vaccine in the subject.
  • attenuation is used interchangeably with "inactivation”. The attenuation includes not only the weakening ability of the strain but also the complete loss of the growth ability.
  • the attenuation is a continuous passage of 5 generations to 200 generations, more preferably 80 generations to 120 generations, most preferably 100 generations of continuous passage culture.
  • the novel Lawsonia intracellularis strain deposited with Accession No. KCTC13152BP according to the present invention is a novel strain, which has a different base sequence at a specific site compared to known strains. More specifically, a novel Lawsonia intracellularis strain deposited with known Lawsonia Intracellularis (NC_008011.1) and Accession No. KCTC13152BP of the present invention obtained through the serial passage culture and its parent strain The differences in sequence of in Lawsonia intracellular isolates were analyzed.
  • the novel Lawsonia Intracellulose deposited with accession number KCTC13152BP of the present invention (lawsonia) Intracellularis strains were obtained by separating Lawsonia intracellularis isolates from subjects with proliferative enteritis and serial passage to CV-1 cells for up to 100 generations.
  • the strain has the characteristics of high immunogenicity and no pathogenicity.
  • immunity was induced even when the strain was orally administered to pigs and hamsters.
  • the present invention provides Lawsonia Intracellulitis deposited with accession number KCTC13152BP, which comprises the following steps. intracellularis strains are provided:
  • step (b) inoculating the isolate of step (a) with CV-1 (ATCC CCL-70) cells;
  • step (c) attenuating the infected cells of step (b) by successive passage of 5th generation to 200 generations.
  • the term "isolator” refers to Lawsonia isolated from L. intracellularis- positive specimen intestinal tissue pathologically borne by the Green Cross Veterinary Research Institute in 2010. intracellularis ), and may be used interchangeably with “separation line” in the present invention.
  • the method of the present invention is to collect positive specimen intestinal tissue for proliferative ileitis to confirm the presence of Rossonia intracellularis, the causative agent of proliferative ileitis by immunohistochemical staining and / or PCR; Inoculating the CV-1 cells obtained from the intestinal tissue with CV-1 cells, and then infecting the CV-1 cells with an inoculation comprising the Lawsonia intracellular isolate in anaerobic conditions; Incubating the infected CV-1 cells for 2 to 5 hours and then replacing them with medium containing antibiotics; At 1-6 days after the inoculation, the infected cells were ruptured using 0.1% potassium chloride solution and a syringe, and the supernatant from which the nucleus was removed was inoculated into fresh CV-1 cells by attenuating at least 100 times.
  • New Lawsonia Intracellularis by Obtaining CV-1 Cells Infected with Lawsonia Intracellulose intracellularis ) method for producing strains.
  • the passage of the Rossonia intracellular isolate strain disrupts the infected CV-1 cells by using a potassium chloride solution and a syringe, and removes the supernatant containing the Lawsonia intracellularis strain from which the cell nuclei are removed. Inoculation is carried out.
  • the inoculum may be intestinal debris prepared by scraping a mucosa from a culture of Lawsonia intracellularis obtained from an infected subject or from a ileum of a subject infected with Lawsonia intracellularis.
  • the ileal portion chosen for culture should exhibit severe lesions with thickened whole intestines. Since the bacteria are inherently drug, the samples should preferably be stored at -70 ° C as soon as possible after necropsy.
  • Lawsoni is preferably added to the inoculum by adding a member of an aminoglycoside group antibiotic, including vancomycin, amphotericin B, or gentamycin and neomycin, to which antibiotics resistant to Lawsonia intracellulose are resistant, such as Proliferate intracellular lice.
  • an aminoglycoside group antibiotic including vancomycin, amphotericin B, or gentamycin and neomycin, to which antibiotics resistant to Lawsonia intracellulose are resistant, such as Proliferate intracellular lice.
  • the bacterial and / or inoculated cultured cells are then cultured under reduced O 2 dissolved concentration. At dissolved oxygen concentrations above 10%, Lawsonia intracellulose proliferation is below optimal and ultimately stops proliferation at oxygen concentrations outside of this range.
  • the bacterial and / or inoculated cultured cells are cultured at dissolved oxygen concentrations ranging from 0.1% to 10%.
  • the bacteria and / or cells are cultured at an oxygen concentration in the range of 0.1% to 8% and in the range of 5.0-7.0%. Oxygen concentration is most preferred.
  • Suitable concentrations of carbon dioxide are also el. Important for proper proliferation of intracellularis. At carbon dioxide concentrations in the range of 0% to 4%, they proliferate non-optimally and eventually stop growth at carbon dioxide concentrations outside this range. Preferably, carbon dioxide concentrations range from 6% to 10%, with carbon dioxide concentrations ranging from 7.5-9% being most preferred.
  • the cells are preferably cultured in the hydrogen concentration range of 73% to 96%. Nitrogen may be used in place of some or all of the hydrogen present. Most preferably, the cells are cultured in O 2 , 8.8% CO 2 in the range of 0.1-8.0%.
  • Inoculated cells may be cultured in a binary gas incubator or other gas chamber containing appropriate hydrogen, oxygen and carbon dioxide concentrations and suspending the cells during the culture.
  • the chamber must include a means for maintaining suspension of cultured cells and a source for supplying and maintaining a gas monitor and appropriate gas concentration.
  • the incubation temperature should be in the range 30 ° C. to 45 ° C. and more preferably in the range 36 ° C. to 38 ° C. Most preferably, the temperature is 37 ° C.
  • Essential equipment for culturing and attenuation can be readily purchased by those skilled in the art as taught herein.
  • each individual cell By maintaining the inoculated cells suspended during incubation, each individual cell has increased exposure to proliferation medium and a suitable mixture of hydrogen, oxygen, and carbon dioxide and thus cells. Intracellularis proliferates maximally.
  • the invention is Lawsonia Lawsonia deposited with accession number KCTC13152BP described above intracellularis) provides a proliferative ileitis vaccine composition for prevention or treatment of (proliferative enteritis) comprising a strain as an effective ingredient.
  • An attenuated vaccine and a sterile Lawsonia intracellularis vaccine can be produced using the Lawsonia intracellularis strain produced by the above-described method of the present invention. That is, when the strain isolated and cultured by the method of the present invention is passaged sufficiently many times, the strains having weakened toxicity or the weakening of the toxicity by chemical methods, when the inoculation to the subject does not appear or weaken symptoms of ileitis This weakened strain is provided to provide a vaccine composition using a therapeutically effective amount of attenuated strain as a vaccine.
  • Lawsonia intracellular attenuated liquor of the present invention can be sterilized by heat treatment or the like to be used as a vaccine.
  • the attenuated and sterile vaccines may contain pharmaceutically acceptable stabilizers, diluents, adjuvants and the like.
  • the dosage of the composition is 10 5 to 10 10 TCID 50 , preferably 10 5 to 10 7 TCID 50 per subject head.
  • the composition may be in the form of solutions, injections, tablets, and capsules, but is not limited thereto.
  • compositions of the present invention may additionally include a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier one or two or more kinds of conventional excipients, disintegrants, binders and glidants may be selectively used.
  • excipients microcrystalline cellulose, lactose, low-substituted hydroxycellulose, etc.
  • disintegrant as a binder, such as sodium starch glycolate, calcium monohydrogen phosphate, polyvinylpyrrolidone, a low-substituted hydroxypropyl cellulose, hydroxypropyl cellulose, etc.
  • a lubricant magnesium stearate, silicon dioxide, talc, etc. are mentioned. You can choose to use it.
  • the present invention provides a method for preventing or treating proliferative enteritis comprising administering the above-mentioned vaccine composition to a subject.
  • the subject is selected from the group consisting of pigs, humans, rabbits, marten, hamsters, foxes, horses, ostriches and emus, preferably selected from the group consisting of pigs, humans, rabbits, marten and hamsters, and most preferably It's a pig.
  • the invention provides a method for diagnosing proliferative enteritis comprising the following steps:
  • the step of detecting the strain is to confirm the level of the PCR product by performing PCR amplification using a primer set.
  • the level of the PCR product is high compared to the normal level, it can be determined that the infection with Lawsonia intracellularis (Lawsonia intracellularis).
  • the PCR execution and determination method may be any method known in the art as long as it can be carried out using a known primer set.
  • the sample is separated from the subject, and any sample can be used as long as it can confirm the detection of the Lawsonia intracellularis strain of the present invention.
  • the method of the present invention is to detect the above-mentioned strains, the common content is omitted in order to avoid excessive complexity of the present specification according to the repeated description.
  • the present inventors isolated and cultured Lawsonia intracellularis (L. intracellularis), a causative agent of ileitis, for the production of a novel Lawsonia intracellularis strain.
  • the primers of Table 1 [LI A forward primer (SEQ ID NO: 2); TATGGCTGTCAAACACTCCG, LI B reverse primer (SEQ ID NO: 3); TGAAGGTATTGGTATTCTCC, Lint-146 Forward Primer (SEQ ID NO: 4); GATAATCTACCTTCGAGACGG, Lint-745 reverse primer (SEQ ID NO: 5); TGACCTCAGTGTCAGTTATCGT] was used to amplify 16S rDNA and PCR to confirm that it is positive for Lawsonia intracellularis (Fig. 2a), and it was found to be 99% consistent with the homology with that registered in NCBI GenBank. It was confirmed that this is a novel strain that is not known as an isolate of the cellulase strain (FIG. 2B).
  • CV-1 ATCC CCL-70 cells were used for infection of Lawsonia intracellularis.
  • the medium used for cell culture was D-MEM containing 1-10% FBS (Fetal bovine serum), 0.1-5% L-glutamine and amphotericin B.
  • FBS Fetal bovine serum
  • L-glutamine Lithicillin-N-phosphate
  • amphotericin B was carried out in a 37 ° C. incubator fed with 2-10% CO 2 .
  • Cells were subcultured with EDTA-Trypsin at 4-5 day intervals and transferred to a new tissue culture flask with a concentration of 5 X 10 5 cells per ml.
  • the inoculated flask monolayer was rotated using a centrifugal force of 1000 ⁇ 2,000g after the inoculation flask was anaerobic culture vessel Moved to.
  • the gas in the anaerobic culture vessel was degassed at a pressure of 500 mmHg, replaced with hydrogen gas of medical purity, and again degassed at a pressure of 500 mmHg, followed by a mixed gas incubator of 5-10% O 2 and 5-10% CO 2 . After culturing at 37 ° C.
  • antibiotics such as neomycin, gentamicin, and vancomycin were replaced with a medium containing 50 to 300 ppm in the same cell culture medium composition.
  • cell lysate with 0.1% KCl solution was used at a ratio of 1: 3.
  • Tissue culture flask supernatants were harvested once week after infection.
  • 0.1% KCl solution was applied to the cell monolayer surface from which the supernatant was removed, and reacted for 10 minutes.
  • 0.1% KCl solution was removed, and cells at the bottom of the tissue culture flask were collected using a cell scraper and SPG solution to which 10% FBS was added.
  • the harvested cells were physically ruptured 10 times through 20 gauge emulsification needles. Cell nuclei generated in this process were removed by centrifugation at 100 g for 5 minutes, and the supernatant obtained was used to inoculate freshly prepared CV-1 cells.
  • CV-1 cells infected with Lawsonia intracellularis were passaged by the method at 6-7 day intervals.
  • one tissue culture flask was passaged at a ratio of 1: 3 to be three tissue culture flasks in the next passage.
  • the known rosoni ah intra-cell-less (NC_008011.1) and novel rosoni the successive passages in the deposit accession number KCTC13152BP of the present invention obtained through the culture ah intra-cell-less (Lawsonia The intracellularis strain and its parent strain, Rossonia intracellular isolate isolates, were compared and analyzed for sequence differences.
  • the present inventors orally inoculated the attenuated liquor prepared in Example 4 to hamsters and pigs, which are the target animals and susceptible animals, to confirm pathogenic loss.
  • the inventors inoculated the attenuated strain prepared in Example 4 and observed the clinical symptoms thereby.
  • the present inventors inoculated the attenuated wine prepared in Example 4 and observed the macroscopic lesion thereby.
  • the inventors inoculated the attenuated strain prepared in Example 4 and observed histopathological condition thereby.
  • vaccine group A using 100 generation subcultured isolate (Accession No .: KCTC13152BP) as an antigen, while the ileal bacillus was not confirmed as normal small intestine tissue
  • Vaccine group B using antigens from five subcultured cells showed prominent proliferation and inflammatory cell infiltration of the epithelial cells in the mucosal layer, macrophage and infiltrated macrophage of the epithelial cells.
  • the ileal bacillus was confirmed in the cytoplasm of.
  • the negative control group was not confirmed as ileal infection with normal small intestine tissue.
  • vaccine group A using the 100 generation subcultured isolate (Accession Number: KCTC13152BP) as an antigen, while the ileal bacillus was not confirmed as normal small intestine tissue
  • Vaccine group B using antigens from the five subcultured isolates showed a decrease in the length of the small intestinal villi, proliferation of umbilical and epithelial cells, and local abscesses filled with inflammatory cells such as neutrophils in the umbilical and lumen.
  • the negative control group was not confirmed as ileal infection with normal small intestine tissue.
  • the hamster group inoculated with antigen B (5 generations) was significantly thickened and congested compared to the intestinal wall of the hamster group inoculated with antigen A (100 generations). ) was significantly shorter than the small intestine of the hamsters inoculated.
  • isolates cultured in 100 passages in CV-1 cells according to the present invention (Accession Number: KCTC13152BP) was confirmed that the attenuated can be used as a vaccine.
  • the present inventors compared with the vaccinated group before the vaccination, after 1 week, after 2 weeks, after 3 weeks (vaccination), after 4 weeks, after 5 weeks, and after 6 weeks. Serum was isolated from all the controls and serum was separated and inactivated (56 ° C., 30 minutes). The antibody titer was measured by an indirect fluorescent antibody (IFA) test method.
  • IFA indirect fluorescent antibody
  • the IFA test method is as follows: Incubate cells at a concentration of 5 X 10 3 in each well of a 96 well tissue culture plate for 24 hours, followed by 10 5 Lawsonia. Intracellularis was infected. The tissue culture plate was incubated for 5 days at 37 ° C. under anaerobic conditions (8.8% CO 2 , 8% O 2 ), and then the supernatant was removed and the infected cell monolayer was diluted using a 50:50 solution of acetone and methanol. Was fixed. The serum was separated from the collected blood, and diluted with a binary method, starting with diluted serum of the first 1:30 concentration, and applied to the infected cell plate for 30 minutes at 37 ° C.
  • the antibody titers per cycle of the vaccinated pigs showed a steady increase from the 21st day after inoculation to all the vaccine group individuals until the end of the experiment.
  • the control pigs were all negative, it was confirmed that the test vaccine of the present invention has a satisfactory level of immunogenicity.
  • the inventors used pigs disclosed by the antibody for testing as a protective test pig. That is, three weeks after vaccination, in order to confirm the protective effect against the causative agent of ileitis ( L. intracellularis ), three cultures of L. intracellularis cultured with two pathogenic bacteria and two control groups (10 7.7 TCID 50 / dose). ) 2ml was administered orally, and the other two control groups were treated in no way and examined for clinical symptoms such as diarrhea, anorexia and mortality for 3 weeks. In addition, it was periodically checked whether the inoculation of the inoculation bacteria through feces for 21 days after challenge vaccination. At the end of the observation period, autopsies were performed to investigate the pathologic findings and to detect L. intracellularis in the ileum and other specimens. In addition, the increase rate of test pigs during the protective effect test period was confirmed.
  • PHE Proliferative Hemorrhagic Enteropathy
  • Fecal samples were analyzed by PCR.
  • the p100 high titer refers to the vaccinated group of the present invention (10 9.3 TCID 50 / dose).
  • the p100 low titer refers to the vaccination group (10 6.0 TCID 50 / dose) of the present invention.
  • the Boehringer vaccine refers to the comparative vaccination group (low potency, 10 6.0 TCID 50 / dose).
  • Challenge cont. refers to the non-vaccine control group.
  • Serum of each experimental group was analyzed by ELISA.
  • the inventors have tested the vaccine of the invention (GCVP; 10 6.0 TCID 50 / dose) and conventional vaccine Boehringer vaccines that are commercially available (BI; 10 6.0 TCID 50 / dose) the purpose of 2ml each animal, the piglets (more than 3 weeks of age 3 weeks after vaccination, oral inoculation (2 ml of pathogenic L. intracellularis culture (10 7.7 TCID 50 / dose) orally) resulted in bacterial shedding duration, antibody response and histopathological changes. It was further confirmed.
  • GCVP 10 6.0 TCID 50 / dose
  • BI 10 TCID 50 / dose
  • the bacterial release period for each experimental group was analyzed.
  • Antibody responses were analyzed for each experimental group.
  • the vaccine containing the novel Lawsonia intracellularis strain according to the present invention exhibits effective and safe vaccine efficacy compared to the existing vaccine control.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne une nouvelle souche de Lawsonia intracellularis et une utilisation correspondante. Plus particulièrement, l'invention concerne une souche de Lawsonia intracellularis déposée sous le numéro d'enregistrement KCTC13152BP, un procédé de préparation de la souche, une composition de vaccin qui est destinée à prévenir ou à traiter l'entérite proliférative et qui comprend la souche en tant que constituant actif et un procédé de prévention ou de traitement de l'entérite proliférative. Selon la présente invention, la souche selon la présente invention peut être effectivement utilisée dans la préparation d'un vaccin atténué qui est hautement sûr, hautement stable, présente une immunogénicité élevée et présente une efficacité de traitement élevée lorsqu'elle est administrée à un sujet.
PCT/KR2016/014814 2016-11-18 2016-12-16 Nouvelle souche de lawsonia intracellularis et utilisation correspondante WO2018092974A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2016-0153857 2016-11-18
KR1020160153857A KR20180062468A (ko) 2016-11-18 2016-11-18 신규한 로소니아 인트라셀룰라리스 균주 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2018092974A1 true WO2018092974A1 (fr) 2018-05-24

Family

ID=62146458

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/014814 WO2018092974A1 (fr) 2016-11-18 2016-12-16 Nouvelle souche de lawsonia intracellularis et utilisation correspondante

Country Status (2)

Country Link
KR (1) KR20180062468A (fr)
WO (1) WO2018092974A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20240057458A (ko) 2022-10-21 2024-05-03 전북대학교산학협력단 증식성 회장염 감염 돼지로부터 분리된 신규 로소니아 인트라셀룰라리스 균주 및 이를 포함하는 돼지 증식성 회장염 예방용 백신 조성물

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050046741A (ko) * 1995-06-05 2005-05-18 베링거 인겔하임/노블 래보라토리즈, 인코포레이티드 라우소니아 인트라셀룰라리스의 배양, 항-라우소니아 인트라셀룰라리스 백신 및 진단시약
KR20060028913A (ko) * 2004-09-30 2006-04-04 건국대학교 산학협력단 돼지 증식성 회장염 감염돈에서 로소니아인트라셀룰라리스 균을 분리하는 방법

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8398994B2 (en) * 2005-07-15 2013-03-19 Boehringer Ingelheim Vetmedica, Inc. Lawsonia vaccine and methods of use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050046741A (ko) * 1995-06-05 2005-05-18 베링거 인겔하임/노블 래보라토리즈, 인코포레이티드 라우소니아 인트라셀룰라리스의 배양, 항-라우소니아 인트라셀룰라리스 백신 및 진단시약
KR20060028913A (ko) * 2004-09-30 2006-04-04 건국대학교 산학협력단 돼지 증식성 회장염 감염돈에서 로소니아인트라셀룰라리스 균을 분리하는 방법

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE NCBI Genbank; 14 January 2008 (2008-01-14), ANONYMUS, Database accession no. EU348664.1 *
HWANG, JEONG MIN: "Stability of isolated lawsonia intracellularis live vaccin in Korea", 2015 KASV ANNUAL SEMINAR, VETERINARIAN ASKS VETERINARIAN ABOUT DIRECTION 2 (KOREA ASSOCIATION OF SWINE VETERINARIANS, 20 November 2015 (2015-11-20), Daejon, Korea, pages 61 - 62 *
JEH, JY: "Isolation of Lawsonia intracellularis in Korea and reproduction of proliferative enteropathy in pigs and hamsters.", J VET MED SCI, vol. 68, no. 5, May 2006 (2006-05-01), pages 499 - 501, XP055621006, DOI: 10.1292/jvms.68.499 *
YEH, JUNG-YONG ET AL.: "Antimicrobial Susceptibility Testing of Two Lawsonia intracellularis Isolates Associated with Proliferative Hemorrhagic Enteropathy and Porcine Intestinal Adenomatosis in South Korea", ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, vol. 55, no. 9, 20 June 2011 (2011-06-20), pages 4451 - 4453, XP055620978, DOI: 10.1128/AAC.00408-11 *

Also Published As

Publication number Publication date
KR20180062468A (ko) 2018-06-11

Similar Documents

Publication Publication Date Title
WO2014148738A1 (fr) Nouveau virus du syndrome reproducteur et respiratoire porcin (prrs) de type coréen
JP4263212B2 (ja) ローソニア・イントラセルラリスの培養、抗−ローソニア・イントラセルラリスワクチン及び診断薬
WO2010064772A1 (fr) Nouveau bactériophage et composition antibactérienne le contenant
WO2013042964A2 (fr) Bactériophage inédit et composition antibactérienne en contenant
RU2006105715A (ru) Lawsonia intracellularis европейского происхождения и вакцины, диагностические агенты на ее основе и способы их применения
WO2014133323A1 (fr) Nouveau bactériophage et composition antibactérienne le comprenant
Lalsiamthara et al. Intermediate rough Brucella abortus S19Δper mutant is DIVA enable, safe to pregnant guinea pigs and confers protection to mice
WO2014133322A1 (fr) Nouveau bactériophage et composition antibactérienne comprenant celui-ci
Okamura et al. Comparative evaluation of a bivalent killed Salmonella vaccine to prevent egg contamination with Salmonella enterica serovars Enteritidis, Typhimurium, and Gallinarum biovar Pullorum, using 4 different challenge models
Xu et al. Characterization of emergent Avibacterium paragallinarum strains and the protection conferred by infectious coryza vaccines against them in China
WO2017073851A1 (fr) Souche atténuée et composition vaccinale inactivée de virus de la diarrhée épidémique porcine, et composition vaccinale pour administration orale l'utilisant
WO2017179766A1 (fr) Méthode de préparation de fantômes de bactéries gram positif par traitement à l'acide chlorhydrique
WO2018092974A1 (fr) Nouvelle souche de lawsonia intracellularis et utilisation correspondante
WO2012036391A2 (fr) Vecteur d'expression superficielle du gène du circovirus porcin de type 2 (pcv2) et souche vaccinale de salmonella transformée au moyen dudit vecteur
WO2018030878A1 (fr) COMPOSITION VACCINALE DESTINÉE À PRÉVENIR L'INFECTION PAR LES MYCOPLASMES PORCINS COMPRENANT UNE PROTÉINE RECOMBINÉE<i />
WO2011025344A2 (fr) Mutants de salmonelle atténués dans lesquels l'adhésine de escherichia coli pathogène bovin des transformée et composition vaccinale contenant ces mutants utilisée pour empêcher et traiter la colibacillose et la salmonellose bovines
WO2013165190A1 (fr) Vaccin pour la prévention de la septicémie hémorragique virale des poissons plats
WO2020116815A1 (fr) Protéine antigénique de parvovirus porcin recombinante et son utilisation
WO2017116177A2 (fr) Souche pour vaccin marqueur de virus vivant atténué de la peste porcine et composition de vaccin pour administration orale l'utilisant
Tamura et al. Isolation of Orientia tsutsugamushi from Leptotrombidium fuji and its characterization
WO2023204559A1 (fr) Génotype 5 du virus de l'encéphalite japonaise à titre élevé et son utilisation
WO2016099226A1 (fr) Nouveau virus de la diarrhée épidémique porcine et son utilisation
WO2010035954A2 (fr) Composition de vaccin pour prévenir ou traiter les infections à pneumocoques comprenant une souche mutante de streptococus pneumonia activée par l’opéron vncr／s ou par un peptide pep27
WO2021153873A1 (fr) Souche de vaccin vivant atténué pour le virus de la diarrhée épidémique porcine, composition la comprenant et son procédé de préparation
Nicholas et al. Mycoplasmas in adult cattle: Bugs worth bothering about?

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16921458

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16921458

Country of ref document: EP

Kind code of ref document: A1