WO2018066969A1

WO2018066969A1 - Pharmaceutical composition comprising arazyme as effective ingredient for prevention or treatment of metabolic disease

Info

Publication number: WO2018066969A1
Application number: PCT/KR2017/011095
Authority: WO
Inventors: 박호용; 정태숙; 신동하
Original assignee: 주식회사 인섹트 바이오텍
Priority date: 2016-10-06
Filing date: 2017-10-02
Publication date: 2018-04-12
Also published as: KR101963439B1; KR20180038201A

Abstract

The present invention relates to a pharmaceutical composition comprising arazyme as an effective ingredient for prevention or treatment of metabolic diseases. In detail, arazyme produced by Aranicola proteolyticus is found to reduce levels of glycated hemoglobin (HbA1c), total cholesterol, triglyceride, and non-esterified fatty acid (NEFA) in mouse plasma, improve glucose tolerance in a high-fat diet-fed animal model under a glucose load, stimulate insulin release and synthesis in pancreatic beta cells, alleviate insulin resistance in hepatic cells, and suppress lipid accumulation and hepatic fibrosis. Therefore, the arazyme of the present invention can be effectively used in a composition for prevention or treatment of metabolic diseases.

Description

Pharmaceutical composition for the prevention or treatment of metabolic diseases containing arazyme as an active ingredient

The present invention relates to a pharmaceutical composition for preventing or treating metabolic diseases containing arazyme as an active ingredient.

Diabetes mellitus is a metabolic disease, such as insufficient insulin secretion or normal functioning. Diabetes mellitus is characterized by high blood sugar, which increases the concentration of glucose in the blood. And release glucose into the urine.

Diabetes is one of the most important adult diseases in the world. In Korea, the prevalence of diabetes reaches 10%, and the number of diabetics is over 240 million worldwide, and increased to 380 million worldwide by 2025. Of these, 60 percent will occur in Asia, according to the 2009 American Medical Association (JAMA).

According to the '2012 Korean Diabetes Research Report (November 8, 2012)' published by the Korean Diabetes Association, 1 out of 10 adults aged 30 or older (10.1%) in Korea were diabetic patients. The number of people aged 65 and over reached 22.7%, and the number of diabetic patients in Korea is estimated to be about 3.2 million. The prevalence of diabetes among all adults was 8.6% in 2001 and 9.1% in 2005.However, the recent increase is expected to reach 4.42 million in 2020 and 5.91 million in 2050. Combined with fasting blood glucose disorders, also called prediabetes, half (47.4%) of the elderly population are diabetic or diabetic. This means that 10 million Korean adults do not have diabetes. In particular, according to the statistics of the National Health Insurance Corporation in 2011, the prevalence of pediatric diabetes is 6 times higher than adolescents, and gestational diabetes is steadily increasing.

The main cause of type 2 diabetes, which accounts for 90% of the diabetic patients in Korea, is the dietary habits of high calorie, high fat and high protein according to the westernization of diet. The prevalence of diabetes continues to increase due to fast food intake and lack of exercise. Diabetes mellitus in Korea is constitutionally 'dry obesity', and most of the patients have a normal range of body weight, but most of them have abdominal obesity. In recent years, however, three out of four diabetics are overweight or obese. In particular, glycemic control is mainly achieved by insulin secreted from the pancreas. Currently, the abdominal obesity rate of diabetics in Korea is about 56% for women and 41% for men (2016, Korea Centers for Disease Control and Prevention). They may eat insulin or reduce their activity. Compared with westerners, Koreans have lower insulin secretion ability, have higher complications such as hypertension, hyperlipidemia, and diabetic nephropathy, and have low compliance with medications. There is a need for a comprehensive screening project to reduce the incidence of complications for early detection of diabetes and the risk of diabetes.

In addition, diabetes is causing social problems because of serious complications, the anti-diabetic drug currently being developed and marketed, although there is a difference in degree, most of the side effects due to use restrictions. For example, interstitial pneumonia (Nesina tablet (Takeda) and Ek a tablet (Novatis)) and intestinal obstruction related side effects (Nesina tablet and Tragenta) that can not deny the causal relationship with drugs in DPP-4 inhibitors that are growing rapidly as the next generation diabetes treatment As Boinger Ingelheim (Japan) developed, the Ministry of Health, Labor and Welfare of the Ministry of Health, Food and Welfare and the Ministry of Health, Safety, and Welfare instructed the use of these side effects to be added. In addition, among the functional natural products of diabetes prevention and treatment, especially plants contain anti-diabetic functional materials, exist in various structures such as polyphenols, terpenes, polypeptides, glycosides, these are mainly hormones involved in glucose metabolism , Enzymes and insulin signaling system. To date, relatively many studies on antidiabetic polysaccharides and dietary fiber have been conducted, but most of them are related to blood glucose control through smooth bowel activity using indigestible polysaccharides or proliferation of enteric beneficial bacteria. Daily doses are in excess from several grams to tens of grams. Thus, a breakthrough product has yet to be developed that has clearly identified the mechanism of antidiabetic polysaccharide.

Fatty liver refers to a condition in which abnormal fat is accumulated in liver cells, and a medical condition refers to a pathological condition in which the neutral lipid content exceeds 5% of the total liver weight. In general, fatty liver is characterized by alcoholic fatty liver disease (ALD) caused by persistent and excessive drinking and nonalcoholic fatty liver disease (NAFLD), which has little alcohol intake but similar liver tissue findings to alcoholic fatty liver. It can be divided into two.

In particular, unlike alcoholic fatty liver due to excessive alcohol consumption, non-alcoholic fatty liver disease (NAFLD) can be caused by the causes of obesity, diabetes, hyperlipidemia, drugs, etc., regardless of drinking Non-alcoholic steatohepatitis (NASH), advanced fibrosis and cirrhosis, which show simple steatosis and hepatocellular inflammation that do not accompany the inflammatory response over time. It means a wide range of diseases up to and including.

There are two types of treatments currently used for non-alcoholic fatty liver patients. Firstly, orlistat, insulin resistance drugs (metformin, pioglitazone, rosiglitazone), and hyperlipidemia, which are drugs that treat and improve fatty liver by correcting risk factors. Independently of therapeutic agents (clofibrate, gemfibrozil, bezafibrate, atorvastatin, simvastatin), and secondly from the correction of risk factors for fatty liver, hepatoprotective agents (ursodeoxycholic acid and taurine), antioxidants vitamine E) and nutritional supporters (lectin, betaine, N-acetylcystein).

However, since the existing therapeutic agents are drugs used as symptomatic agents rather than essential therapeutic agents in terms of efficacy, they cannot be seen as target effects. In addition, the drug approved by the Ministry of Food and Drug Safety for the efficacy of non-alcoholic fatty liver treatment is currently only one item in Korea, and the market size of this drug has been decreasing since 2008, which indicates that the effect of the drug is insufficient. It is believed to be due to a fundamental problem. Therefore, until now, there is almost no pharmacological agent capable of treating nonalcoholic fatty liver, and thus there is an urgent need to develop an appropriate therapeutic agent having no side effects and excellent safety even for long-term administration.

On the other hand, the inventors of the Korean shaman spider ( Nephila clavata) from Ara Nicolas proteosome utility kusu (Aranicola proteolyticus) HY-3 strain (accession number: KCTC 0268BP; WO 01/57222 was to remove the arc), a separation of the Arazyme (Arazyme) a protease from the strain bar have. Arazyme not only showed stable proteolytic activity at low temperature and high salt concentration, but also showed the highest activity at human body temperature of 37 ℃ and stable activity over a wide pH range.

Thus, the inventors have found that Aranicola When arazyme derived from the proteolyticus strain was administered to a nonalcoholic fatty liver animal model, it was confirmed that plasma glycated hemoglobin (HbA1c), total cholesterol, triglycerides and non-esterified fatty acids (NEFA) were reduced. In the model to improve glucose-load glucose tolerance, promote insulin secretion and synthesis in pancreatic beta cells, improve insulin resistance in hepatocytes, inhibit lipid accumulation or hepatic fibrosis, thereby preventing or treating the arazyme of the present invention. The present invention has been completed by revealing that it can be usefully used as a composition.

An object of the present invention to provide a pharmaceutical composition for the prevention or treatment of metabolic diseases containing arazyme (Arazyme) as an active ingredient.

In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention or treatment of metabolic diseases containing arazyme (Arazyme) as an active ingredient.

The present invention also provides a health functional food for improving metabolic diseases containing arazyme (Arazyme) as an active ingredient.

The present invention also provides a method for preventing or treating metabolic disease, comprising administering to a subject a pharmaceutically effective amount of arazyme.

The present invention also provides arazyme (Arazyme) for use as a composition for preventing or treating metabolic diseases.

In addition, the present invention provides arazyme (Arazyme) for use as a dietary supplement for preventing or improving metabolic diseases.

Aranicolaa proteoritis of the present invention ( Aranicola Arazyme produced by proteolyticus reduces plasma glycated hemoglobin (HbA1c), total cholesterol, triglycerides and non-esterified fatty acids (NEFA) in animal models and improves glucose-loaded glucose tolerance in high-fat dietary animal models In addition, it promotes insulin secretion and synthesis in pancreatic beta cells and at the same time improves insulin resistance in hepatocytes and inhibits lipid accumulation and liver fibrosis, and thus may be useful as a pharmaceutical composition for preventing or treating metabolic diseases.

1 is a diagram showing the expression changes of PCSK1 / 3 and PCSK2 genes that regulate the synthesis of Ins1 and Ins2 insulin genes and insulin proteins in palmitic acid (PA) -induced MIN6 pancreatic beta cells.

Figure 2 is a diagram showing the expression change of phosphorylated AKT protein reduced by palmitic acid in hepG2 cells, hepatocytes.

Figure 3 is a diagram showing the degree of fibrosis in liver tissue through sirius red staining in the liver of a high-fat diet-induced nonalcoholic fatty liver mouse model.

Figure 4 is a diagram showing the change in the size of the pancreatic islet (pancreatic islet) in the pancreatic tissue of the high fat diet-induced non-alcoholic fatty liver mouse model.

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for the prevention or treatment of metabolic diseases containing arazyme (Arazyme) as an active ingredient.

The arazyme is preferably a polypeptide consisting of an amino acid sequence set forth in SEQ ID NO: 1, Aranicola proteoritis ( Aranicola proteolyticus ) strain may be preferred, but is not limited thereto.

The metabolic disease is preferably any one selected from the group consisting of type 2 diabetes, dyslipidemia, insulin resistance, and nonalcoholic fatty liver, but is not limited thereto.

The arazyme preferably increases the expression of the insulin gene or increases the secretion of insulin, and the insulin gene is preferably Ins1 or Ins2, but is not limited thereto.

The arazyme preferably increases the expression of PCSK1 / 3 or PCSK2 gene and phosphorylation of AKT protein, but is not limited thereto.

The metabolic disease is most preferably type 2 diabetes with nonalcoholic fatty liver disease (NAFLD), but is not limited thereto.

Preferably, the arazyme reduces the levels of AST and ALT, which are indicators of hepatotoxicity in the blood, but is not limited thereto. The arazyme preferably inhibits fibrosis and an increase in the size of pancreatic islets. Do not.

Arazyme of the present invention comprises the steps of 1) obtaining a culture by culturing the aranicola proteoricicus strain; 2) filtering the culture solution to obtain a supernatant; And 3) purifying the arazyme contained in the supernatant using a resin (WO 01/57222).

It is preferable to use Aranicola proteolyticus strain as a microorganism to produce arazyme, and Aranicola proteorium of Accession No. KCTC 0268BP, deposited on July 29, 1996 with the Korea Biotechnology Research Institute Gene Bank. It is more preferable to use Cous HY-3, but is not limited thereto.

Aranicola Proteoricicus HY-3 strain is an aerobic Gram-negative bacterium isolated from the intestine of the spider's intestine, and has a spherical and motility of 0.5 to 0.8 mm in size, positive for catalase, and negative for oxidase. Reaction (Korean Patent No. 0220091). In the present invention, arazyme obtained by the above method was used.

In the present invention, it is preferable to use arazyme obtained by the above method, and more preferably, but not limited to using arazyme produced by the following method.

The raw material used for the cultivation of the Aranicola proteoricicus strain is preferably at the level of medicines that are more comfortable than pure purified products and capable of producing high-purity results. After cultivation, ammonium sulfate precipitation (or acetone precipitation) is performed. After such ammonium sulfate or acetone precipitation, only arazyme is recovered by centrifugation and filtration. This is because most other proteins produced by microorganisms use different arazyme and precipitation concentrations. After recovering arazyme, a high-concentration arazyme in the form of a solution obtained by purification of primary impurities using membrane filtration and finally pure separation and purification using an ultrafilter is used in powder form through a freeze dryer.

Arazyme obtained by the above production method may be included as long as the protein is substantially purified according to any purification method of the protein.

The purified protein may be appropriately selected or combined with column chromatography, filters, ultrafiltration, salting out, solvent precipitation, solvent extraction, distillation, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, isoelectric point electrophoresis, dialysis or recrystallization. It is preferred that the protein is substantially purified, but is not limited thereto.

In addition, arazyme encoded from the DNA may be obtained using a protein expression system well known to those skilled in the art, and may be recovered and purified from a culture of cells expressing arazyme.

In addition, the aranicola proteoritis HY-3 strain (KCTC 0268BP) for the production of arazyme can be produced in a variety of industrial media, and the culture broth produced can also be isolated and purified by various methods.

In specific examples and experimental examples of the present invention, when arazyme produced by Aranicola proteolyticus was treated to pancreatic beta cells (MIN6), it was confirmed that insulin secretion is promoted. In Table 1, the expression of Ins1 and Ins2, which are intracellular insulin genes, was increased, and the expression of the PCSK1 / 3 and PCSK2 genes, which are known to regulate the synthesis of insulin proteins, was also significantly increased (Fig. 1). One). In addition, when arazyme (Arazyme) treated with hepatocytes (HepG2), it was confirmed that the accumulation of triacylglycerol (TG) is inhibited (Table 3), increasing the phosphorylation of AKT protein to improve resistance to insulin 2, the fasting blood glucose, glycated hemoglobin (HbA1c), insulin resistance index, free fatty acid, triglyceride, and total cholesterol in the non-alcoholic fatty liver animal model were significantly increased when ingested arazyme. It was confirmed that the decrease in AST and ALT, which is an indicator of hepatotoxicity in the blood (Table 4). In addition, it was confirmed that lipid content such as triglyceride (TG) and total cholesterol (TC) is decreased in liver tissue of the animal model ingested arazyme (Table 5), and the degree of fibrosis in liver tissue is suppressed. (FIG. 3), it was confirmed that an increase in pancreatic islet size in the pancreatic tissue was suppressed.

Therefore, the pharmaceutical composition containing arazyme of the present invention can be usefully used for the prevention and treatment of metabolic diseases.

In addition to the arazyme of the present invention, it may contain one or more active ingredients exhibiting the same or similar functions. For administration, it may be prepared further comprising one or more pharmaceutically acceptable carriers. Pharmaceutically acceptable carriers may be used in combination with saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and one or more of these components, as necessary, including antioxidants, buffers, Other conventional additives such as bacteriostatic agents can be added. In addition, diluents, dispersants, surfactants, binders and lubricants may be additionally added to formulate main formulations, powders, tablets, capsules, pills, granules or injections, such as aqueous solutions, suspensions, emulsions and the like. Furthermore, it may be preferably formulated according to each disease or component by a suitable method in the art or using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton PA, 18th, 1990).

Pharmaceutical compositions for the prophylaxis and treatment of metabolic diseases of the present invention can be administered parenterally (eg, intravenously, subcutaneously, intraperitoneally or topically) or orally, depending on the desired method. The range varies depending on body weight, age, sex, health condition, diet, administration time, administration method, excretion rate and severity of disease. The daily dose of arazyme according to the present invention is 0.01 to 5000 mg / kg, preferably 0.01 to 10 mg / kg, and more preferably administered once to several times a day.

The present invention also provides arazyme (Arazyme) for use as a dietary supplement for preventing or improving metabolic diseases.

The arazyme is preferably a polypeptide consisting of an amino acid sequence set forth in SEQ ID NO: 1.

In addition, the present invention provides a dietary supplement for improving metabolic diseases containing arazyme as an active ingredient.

The metabolic disease is preferably type 2 diabetes with nonalcoholic fatty liver disease (NAFLD), but is not limited thereto.

When the arazyme of the present invention is used as a food additive, the arazyme may be added as it is or may be used together with other foods or food ingredients, and may be appropriately used according to a conventional method. Arazyme is obtained and used in the same manner as described above. The mixed amount of the active ingredient may be appropriately determined depending on the purpose of use (prevention, health or therapeutic treatment). In general, in the preparation of food or beverage, the arazyme of the present invention is added in an amount of 0.01 to 10 parts by weight, preferably 0.05 to 1 part by weight based on the raw materials. However, in the case of long-term intake for health and hygiene or health control, the amount may be below the above range, and the active ingredient may be used in an amount above the above range because there is no problem in terms of safety. .

There is no particular limitation on the kind of food. Examples of the food to which the substance may be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, dairy products including other noodles, gum, ice cream, various soups, beverages, tea, drink, Alcoholic beverages and vitamin complexes, etc., includes all the health functional foods in the conventional sense.

The health beverage composition of the present invention may contain various flavors or natural carbohydrates, etc. as additional components, as in the general beverage. Natural carbohydrates described above are glucose, monosaccharides such as fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin, cyclodextrin, sugar alcohols such as xylitol, sorbitol, and erythritol. As the sweetener, natural sweeteners such as tautin and stevia extract, synthetic sweeteners such as saccharin, aspartame, and the like can be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 ml of the beverage composition of the present invention.

In addition to the above, arazyme contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohols, carbonated drinks It can be added to a carbonation agent etc. used for. Arazyme may also be added to the flesh for the production of natural fruit juices, fruit juice drinks and vegetable drinks. These components can be used independently or in combination. The proportion of such additives is not critical but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of arazyme of the present invention.

Hereinafter, the present invention will be described in detail by examples and experimental examples.

However, the following Examples and Experimental Examples are only illustrative of the present invention, and the content of the present invention is not limited by the following Examples and Experimental Examples.

<< 실시예Example 1> 1> 아라자임(Arazyme)의Of arazyme 제조 Produce

In order to prepare arazyme (Arazyme), the active ingredient of the present invention, Aranicola proteoricicus HY-3 strain (KCTC 0268BP) was cultured in a medium (bacto tryptone 0.5%, yeast extract 0.5%, sodium chloride 0.1%, 0.05% potassium chloride, 0.02% calcium chloride and 0.02% magnesium sulfate) were incubated at 22 ° C. for 18 hours. The culture solution was separated from the cells and the supernatant using 2 μm membrane filtration, and the separated supernatant was concentrated using membrane filtration of 10 kDa. Since the arazyme of the present invention basically has anion properties, the ion exchange resin and the ion exchange resin using DEAE-cellulose, which have been pretreated with 50 mM tris-hydrochloric acid buffer (pH 7.6), and 20 mM Purification was carried out using a gel filtration exchange resin using Sephadex G-75 pretreated with Tris-HCl buffer (pH 7.6). The purified enzyme solution was subjected to electrophoresis with 10% SDS-PAGE (Sodium dodecyl sulfate-polyacrylamide gel) to confirm the band tendency. As a result, the arazyme of the present invention was about 51.5 as a monomer having no subunit. It was confirmed that a band having a molecular weight of kDa was shown.

<< 실시예Example 2> 세포의 배양(culture) 2> Cell Culture

<2-1> 췌장 베타세포(MIN6)의 배양<2-1> Culture of Pancreatic Beta Cells (MIN6)

MIN6 pancreatic beta cells, a mouse pancreatic beta (β) cell line, were treated with 5% CO at 37 ° C. using DMEM (Hyclone) medium containing 15% FBS (Hyclone), 100 units / ml penicillin and 100 μg / ml streptomycin. ₂ culture was incubated .

<2-2> HepG2 간세포의 배양<2-2> Culture of HepG2 Hepatocytes

HepG2 cells, a human hepatocellular carcinoma cell line, were treated with low concentration of glucose DMEM (5 mM, Hyclone) medium containing 10% FBS (Hyclone), 100 units / ml penicillin, and 100 ㎍ / ml streptomycin. ₂ culture was incubated .

<< 실시예Example 3> 비알코올성 지방간( 3> non-alcoholic fatty liver ( NAFLDNAFLD ; Non-alcoholic fatty liver disease) 동물모델의 제조; Non-alcoholic fatty liver disease

<3-1> 동물의 사육 및 실험<3-1> Animal Breeding and Experiment

Male animals were used as male C57BL / 6J mice (SLC, Japan). The pretreated animals were adapted to the laboratory environment with free feeding of AIN-76A diet and water for 3 weeks, and then male 7-week-old male mice in good health were used for the experiment. The experimental groups were classified as follows and 10 mice per group were used:

(1) negative control group ingesting AIN76A diet;

(2) a control group fed a high fat diet (60 kcal% high fat diet; Dyets Inc.); And

(3) Test group supplemented with arazyme (0.025%, wt / wt diet) of the present invention to a high fat diet.

The experimental group was tested for 12 weeks to observe the lipid lowering, antidiabetic and hepatoprotective efficacy. The experiment was carried out after approval of KRIBB-ACE-16050 from the Biosafety Ethics Committee of Korea Research Institute of Bioscience and Biotechnology.

The environment of the animal breeding room was maintained at constant temperature (25 ± 2 ℃), constant humidity (50 ± 5%) and photoperiod of 12 hours (lighting 07:00 ~ 19:00), experimental animals 3 to 4 The animals were reared separately, and the diet and drinking water were taken freely. Dietary intake and body weight were measured and recorded at a regular time every week, and after fasting at 12-week intervals for 2 hours, blood was collected from the posterior eye and venous gun using capillary tubes to prevent coagulation using EDTA, and blood biochemical tests. For 30 minutes after blood collection, the plasma was separated by centrifugation at 3,000 rpm and 4 ° C. for 15 minutes, and stored at −70 ° C. for analysis. After the animals were bred for 12 hours before sacrifice, blood was collected and treated in the same manner. The organ tissues (fat tissue, pancreas, liver and muscle) of each animal were extracted immediately after blood collection and weighed. RNA experiments were stored in RNA stabilization solution (Qiagen) to isolate RNA within a week, the rest was quenched with liquid nitrogen and stored in -70 ℃ freezer.

<3-2> 동물실험 결과의 통계처리 및 유효성 평가<3-2> Statistical processing and effectiveness evaluation of animal test results

The results between the negative control group, the control group and the test group were expressed as mean ± standard deviation.The difference between the groups was one-way ANOVA followed by Turkey hoc test (JMP® software, SAS Institute, USA). Less than ( P <0.05), statistical significance was determined.

<< 실험예Experimental Example 1> 췌장 베타세포에서의 인슐린 분비 및 합성 촉진 확인 1> Confirmation of insulin secretion and synthesis promotion in pancreatic beta cells

<1-1> 췌장 베타세포(MIN6)에서의 인슐린 분비 촉진 활성<1-1> Insulin Secretory Activity in Pancreatic Beta Cells (MIN6)

The present inventors experimented to determine the effect of arazyme (arazyme) on insulin secretion ability in pancreatic beta cells.

First, the pancreatic beta cells cultured in Example <2-1> in a 24-well plate were dispensed with 1 × 10 ⁵ cells per well, and a 5% CO ₂ incubator at 37 ° C. Incubated at. After 48 hours, the cells were first replaced with glucose-free DMEM medium and left to stand for 60 minutes in cell hunger (fasting), and then the arazyme prepared in Example 1 prior to DMEM medium replacement. Were treated with 1 and 5 μg / ml, and reacted for 30 minutes, and then replaced with DMEM medium containing 30 mM glucose. The control group was used without the addition of arazyme under the same conditions, and insulin secreted into the medium was measured using an ELISA insulin kit (Alpco diagnostics) (Martinez SC et al., Diabetes. 55: 1581-1591, 2006). In addition, when the arazyme of the concentration was treated, it was confirmed whether or not to show the toxicity to the cells by concentration compared to the control group untreated group, the results of the experiment are shown in Table 1 below.

구분division	시료 농도Sample concentration	30 mM 글루코오스 유도 MIN6 췌장베타세포에서 대조군에 대한 인슐린 분비 증가율 (%)Increasing insulin secretion (%) relative to control in 30 mM glucose-induced MIN6 pancreatic beta cells
아라자임Arazyme	1 μg/ml1 μg / ml	29.5 ± 2.029.5 ± 2.0
아라자임Arazyme	5 μg/ml5 μg / ml	76.0 ± 4.076.0 ± 4.0

As a result, as shown in Table 1, the insulin secretion of pancreatic beta cells induced by high glucose (30 mM) was 29.5% and 76.0% in the arazyme pretreated at 1 and 5 μg / ml concentrations, respectively. It was confirmed that the increase to (Table 1). It was also confirmed that arazyme had no toxicity to cells at these concentrations.

<1-2> 췌장 베타세포(MIN6)에서의 인슐린 합성 유전자 발현 분석<1-2> Analysis of Insulin Synthetic Gene Expression in Pancreatic Beta Cells (MIN6)

The present inventors experimented to determine the effect of arazyme (arazyme) on the expression of insulin-related genes in pancreatic beta cells (MIN6).

Gene expression patterns of the control group and the test group pre-treated with arazyme of Experimental Example <1-1> were analyzed using reverse transcription PCR amplification. Tissues of the control group treated with control and arazyme concentrations were extracted total RNA using TRI solution (Ambion), cDNA was made using a high-capacity cDNA Reverse Transcription kit (Applied Biosystems, USA) Reverse transcriptase PCR (RT-PCR) using SYBR Green Master (Roche, Germany) using the characteristics of SYBR Green intercalating into dsDNA with oligos synthesized to amplify each gene as a template , Applied Biosystems) confirmed the amplification process of cDNA in real time. The oligos used at this time were found to form a single amplicon of 150 to 200 bp during PCR amplification, and their base sequences are shown in Table 2 below.

유전자 명칭Gene name	유전자 번호Gene number	센스sense	안티-센스Anti-sense
Ins1Ins1	NM_008386.3NM_008386.3	ACCCACCCAGGCTTTTGTC (서열번호 2)ACCCACCCAGGCTTTTGTC (SEQ ID NO: 2)	CGGGACTTGGGTGTGTAGAAG (서열번호 3)CGGGACTTGGGTGTGTAGAAG (SEQ ID NO: 3)
Ins2Ins2	NM_001185083.1NM_001185083.1	CCCCACCCAGGCTTTTGT(서열번호 4)CCCCACCCAGGCTTTTGT (SEQ ID NO: 4)	GCGGGACATGGGTGTGTAG(서열번호 5)GCGGGACATGGGTGTGTAG (SEQ ID NO: 5)
PCSK1/3PCSK1 / 3	NM_013628.2NM_013628.2	CTGCTTTCGCCTTCTTTTGC(서열번호 6)CTGCTTTCGCCTTCTTTTGC (SEQ ID NO: 6)	CCGCCGCCCATTCATTA(서열번호 7)CCGCCGCCCATTCATTA (SEQ ID NO: 7)
PCSK2PCSK2	NM_008792.4NM_008792.4	GAAGACGCAGCCTACACCATAA (서열번호 8)GAAGACGCAGCCTACACCATAA (SEQ ID NO: 8)	CTCTCTTTTTACGGTCAAATCCTTCT (서열번호 9)CTCTCTTTTTACGGTCAAATCCTTCT (SEQ ID NO: 9)
GAPDHGAPDH	NM_001001303NM_001001303	ACATCATCCCTGCATCCACT(서열번호 10)ACATCATCCCTGCATCCACT (SEQ ID NO: 10)	AGATCCACGACGGACACATT(서열번호 11)AGATCCACGACGGACACATT (SEQ ID NO: 11)

The expression level of the gene is expressed as the number of PCR cycles at the point where the cDNA is amplified and the fluorescence reaches saturation, which is corrected to the value for glycaldehyde 3-phosphate dehydrogenase (GAPDH) and finally the relative value to the control group. Calculated and calculated.

As a result, as shown in Figure 1, in the test group pre-treated with arazyme of the present invention at a concentration of 1 and 5 ㎍ / ㎖, the expression of Ins1 and Ins2 insulin genes in the cells increased compared to the control group, and also the synthesis of insulin protein The expression of PCSK1 / 3 and PCSK2 genes, which are known to be regulated, was also increased compared to the control group (FIG. 1).

This indicates that arazyme promoted the secretion and synthesis of insulin in pancreatic beta cells, thereby improving pancreatic beta cell function.

<< 실험예Experimental Example 2> 간세포에서의 지질축적 억제 및 인슐린저항성 개선 확인 2> Inhibition of lipid accumulation and improvement of insulin resistance in hepatocytes

<2-1> 간세포에서의 지질축적 억제 확인 <2-1> Confirmation of Inhibition of Lipid Accumulation in Hepatocytes

The present inventors experimented as follows to determine the effect of arazyme (arazyme) on lipid accumulation in hepatocytes (HepG2).

First, hepatocytes cultured in Example <2-1> were placed in a 6-well plate (5-1 10 ⁵ cells per well) and cultured in a 37% 5% CO ₂ incubator. After 24 hours, 0.01, 0.05, 0.1 and 0.5 µg / ml of arazyme prepared in Example 1 were added to 0.2 mM of palmitic acid (PA), a triglyceride accumulation inducer, in each well. Each medium was replaced with the added medium and treated for 24 hours. As a control group, no sample was added under the same conditions, and the content of triacylglycerol (TG) accumulated by harvesting HepG2 cells was measured using a TG measurement kit (Asan Pharmaceutical). In addition, when the arazyme of the concentration was treated, it was also confirmed whether or not to show the toxicity to the cells by concentration compared to the control group untreated. The results of the experiment are shown in Table 3 below.

구분division	시료 농도Sample concentration	HepG2 세포내 TG 축적 감소율(%)% Decrease in TG accumulation in HepG2 cells
아라자임Arazyme	0.01 μg/ml0.01 μg / ml	7.4 ± 1.7 7.4 ± 1.7
아라자임Arazyme	0.05 μg/ml0.05 μg / ml	19.6 ± 2.319.6 ± 2.3
아라자임Arazyme	0.1 μg/ml0.1 μg / ml	24.7 ± 2.724.7 ± 2.7
아라자임Arazyme	0.5 μg/ml0.5 μg / ml	41.4 ± 0.341.4 ± 0.3

As a result, as shown in Table 3, the accumulation of triacylglycerol (TG) in palmitic acid (PA) -induced HepG2 cells in the arazyme pretreated at concentrations of 0.01, 0.05, 0.1 and 0.5 μg / ml. It was confirmed that the concentration-dependent inhibition of 7.4%, 19.6%, 24.7% and 41.4%, respectively, compared to the control group (Table 3). It was also confirmed that arazyme had no toxicity to cells at these concentrations.

<2-2> 간세포에서의 인슐린저항성 개선 확인<2-2> Confirmation of improvement of insulin resistance in hepatocyte

Excessive accumulation of lipids in hepatocytes affects insulin signaling in hepatocytes, indicating insulin resistance. Thus, the present inventors immediately after confirming the inhibitory effect of the accumulation of triacylglycerol (TG) of arazyme in Experimental Example <2-1>, in order to confirm whether arazyme is involved in the improvement of insulin resistance in hepatocytes. The phosphorylation of AKT protein was measured by Western blotting test as follows.

As in Experimental Example <2-1>, HepG2 cells were cultured for 24 hours, and then 0.2 mM of palmitic acid (PA) and concentration (0.01, 0.05, 0.1 and 0.5 µg / ml) in each well. Arazyme was treated and reacted for 24 hours. In the next step, 0.2 mM of insulin was treated for 20 minutes, and HepG2 cells were harvested and lysed to quantify the protein. 40 μg of protein was separated by SDS-PAGE, transferred to PVDF membrane, and then reacted with BSA-block (CANDOR bioscience, Germany) for 1 hour to block nonspecific proteins on PVDF membrane. After washing, the cells were reacted with primary AKT or phospho-AKT antibody for 24 hours. After washing again, reacted with anti-rabbit IgG, a secondary antibody for each antibody, for 1 hour, followed by repeated washing for 15 minutes with TBST solution between each reaction for 4 minutes, and then protein for each antibody. In order to determine the change in the band, the reaction was performed with an ECL solution (Millipore, Germany), and then sensitized with LAS-4000 (Fuji Photo Film, Japan) to identify the AKT or phospho-AKT band.

As a result, as shown in FIG. 2, the expression of phosphorylated AKT protein reduced by palmitic acid (PA) in HepG2 cells increased again in a concentration-dependent manner in the test group treated with arazyme of the present invention. It was confirmed (Fig. 2).

This indicates that arazyme inhibited the accumulation of lipids in hepatocytes and regained the phosphorylation of AKT protein reduced by palmitic acid (PA), thereby improving insulin resistance.

< < 실험예Experimental Example 3> 비알코올성 지방간 동물모델에서 지방간 및 췌장 조직에의 효능 확인 3> Confirmation of efficacy on fatty liver and pancreatic tissue in non-alcoholic fatty liver animal model

<3-1> 혈장의 당뇨, 지질대사 및 간 기능 지표의 분석<3-1> Analysis of Plasma Diabetes, Lipid Metabolism and Liver Function Indicators

Next, the present inventors experimented to determine the effect of arazyme (fatty liver) in the non-alcoholic fatty liver animal model as follows.

After fasting the mice of Example <3-1>, blood was collected from each experimental animal to separate plasma, and fasting glucose, fast fatty acid (nonesterified fatty acid (NEFA), and liver function). Aspartate aminotransferase (AST) and alanine aminotransferase (ALT) concentrations were measured by biochemical automated analyzer (Hitachi-720, Hitachi Medical, Japan). In addition, glycated hemoglobin (HbA1c) was measured using an EASY A1C glycated hemoglobin cartridge (Inpopia, Korea). Insulin resistance index (HOMA-IR) was measured by using Insulin kit (ELISA kit, Alpco diagnostics). The concentration was calculated and measured. The concentrations of triglyceride (TG) and total cholesterol (TC), which are indicators of lipid content, were measured using a separate kit (Asan Pharmaceutical). The results of the experiment are shown in Table 4 below.

혈장 지질생화학 지표Plasma Lipid Biochemical Indicators	음성대조군Negative Control	대조군Control	시험군Test group
공복혈당 (mg/dL)Fasting Blood Sugar (mg / dL)	126.4 ± 10.3126.4 ± 10.3	169.0 ± 12.9169.0 ± 12.9	145.8 ± 7.9145.8 ± 7.9
당화혈색소 (%)Glycated hemoglobin (%)	5.05 ± 0.095.05 ± 0.09	5.41 ± 0.125.41 ± 0.12	5.15 ± 0.065.15 ± 0.06
인슐린저항성 지수Insulin resistance index	6.88 ± 1.306.88 ± 1.30	19.12 ± 4.7319.12 ± 4.73	16.39 ± 3.0316.39 ± 3.03
유리지방산 (mEq/L)Free fatty acid (mEq / L)	2.68 ± 0.13a2.68 ± 0.13a	2.73 ± 0.112.73 ± 0.11	2.55 ± 0.162.55 ± 0.16
중성지방 (mg/dL)Triglycerides (mg / dL)	118.2 ± 7.5118.2 ± 7.5	142.7 ± 9.5142.7 ± 9.5	118.4 ± 4.2118.4 ± 4.2
총콜레스테롤 (mg/dL)Total Cholesterol (mg / dL)	144.5 ± 6.4144.5 ± 6.4	183.1 ± 9.4183.1 ± 9.4	170.6 ± 7.2170.6 ± 7.2
AST (IU/L)AST (IU / L)	95.6 ± 6.195.6 ± 6.1	117.4 ± 5.8117.4 ± 5.8	105.8 ± 11.3105.8 ± 11.3
ALT (IU/L)ALT (IU / L)	26.0 ± 3.626.0 ± 3.6	45.3 ± 10.245.3 ± 10.2	41.5 ± 5.741.5 ± 5.7

As a result, as shown in Table 4, fasting blood glucose was 145.8 +/- 7.9 mg / dL in the test group ingested arazyme compared with the negative control group with 126.4 +/- 10.3 mg / dL and the control group with 169.0 +/- 12.9 mg / dL. It was confirmed that the marked decrease. Glycated hemoglobin significantly decreased to 5.15 ± 0.06% in the arazyme-treated test group compared to 5.05 ± 0.09% in the negative control group and 5.41 ± 0.12% in the control group, and the insulin resistance index (HOMA-IR) was 6.88 in the negative control group. It was confirmed that the test group intake of arazyme was 1.30 ± 4.73 and the control group was 19.12 ± 4.73, which was significantly reduced to 16.39 ± 3.03. Free fatty acids were significantly reduced to 2.55 ± 0.0 mEq / L in the arazyme group compared to 2.68 ± 0.13 mEq / L in the negative control group and 2.73 ± 0.11 mEq / L in the control group ( P < 0.05). Triglycerides were significantly increased to 118.2 ± 7.5 mg / dl in the negative control group and 142.7 ± 9.5 mg / dl in the control group, while those in the arazyme group were significantly reduced to 118.4 ± 4.2 mg / dl ( P <0.05). Total cholesterol was 144.5 ± 6.4 mg / dl negative control group, the control group intake of arazyme compared to 183.1 ± 9.4 mg / dl control group was confirmed to decrease to 170.6 ± 7.2 mg / dl (Table 4).

In addition, the control group fed the high-fat diet showed a symptom of fatty liver, and the contents of AST and ALT, which are indicative of blood hepatotoxicity, were increased compared to the negative control group which received the basic diet for 12 weeks. As shown in Table 4, the AST content decreased to 95.8 ± 6.1 IU / L in the negative control group and 117.4 ± 5.8 IU / L in the control group, but decreased to 105.8 ± 11.3 IU / L in the test group ingested with arazyme. The negative control group was 26.0 ± 3.6 IU / L and the control group was 45.3 ± 10.2 IU / L, while the test group ingested arazyme decreased to 41.5 ± 5.7 IU / L. The protective effect was confirmed (Table 4).

<3-2> 간 조직의 지질 함량 측정<3-2> Lipid content measurement of liver tissue

The present inventors experimented as follows to determine the effect of arazyme in the nonalcoholic fatty liver animal model on the triglyceride (TG) and total cholesterol (TC) content in liver tissue.

The triglyceryl (TG) and total cholesterol (TC) contents of livers extracted from the mice of the negative control group, the control group, and the test group ingested arazyme of Example <3-1> were measured by Folch et al. (J. Biol. Chem. 226: 497-509, 1957) and extracted with lipids using an organic solvent was measured using an enzyme analysis kit (Asan Pharmaceutical, Korea), the results are shown in Table 5 below .

구분division	간 중량당 중성지방량(TG) (mg/g 간)Triglycerides (TG) per liver weight (mg / g liver)	간 중량당 총콜레스테롤량(TC) (mg/g 간)Total cholesterol (TC) per liver weight (mg / g liver)
음성대조군Negative Control	6.2 ± 0.5^a 6.2 ± 0.5 ^a	63.5 ± 4.5^b 63.5 ± 4.5 ^b
대조군Control	6.5 ± 0.2^a 6.5 ± 0.2 ^a	90.4 ± 8.2^a 90.4 ± 8.2 ^a
시험군(아라자임)Test group (Arazyme)	4.7 ± 0.2^b 4.7 ± 0.2 ^b	67.6 ± 2.6^b 67.6 ± 2.6 ^b

(* a, b, c: means that there is statistical significance ( P <0.05) between groups with different a, b, c in superscript)

As a result, as shown in Table 5, the amount of triglyceride per weight (g) of liver was 6.2 ± 0.5 mg in the negative control group and 4.7 ± 0.2 mg in the test group using arazyme compared to 6.5 ± 0.2 mg in the control group. It was confirmed that the amount of fat decreased by 27.7% ( P <0.05). In addition, the total cholesterol per liver weight was 63.5 ± 4.5 mg in the negative control group and significantly increased to 90.4 ± 8.2 mg in the control group, while the test group ingested arazyme was 67.6 ± 2.6 mg, indicating a 25.2% reduction in total cholesterol. (Table 5) ( P <0.05).

<3-3> 간 조직에서의 섬유화 측정<3-3> Fibrosis Measurement in Liver Tissue

The present inventors conducted the following experiment to determine the effect on the degree of liver fibrosis when ingested arazyme in a non-alcoholic fatty liver animal model.

Liver tissues extracted from each experimental animal of the negative control group, the control group and the arazyme ingested Example <3-1> were measured through the sirius red staining to measure the accumulation of collagen. The degree of fibrosis in liver tissue was compared by high fat diet.

As a result, as shown in Figure 3, compared with the negative control group, the accumulation of collagen easily observed in the non-alcoholic fatty liver in the control group was confirmed that the fibrosis of the liver proceeded, compared with the collagen of the test group ingested arazyme Accumulation was effectively inhibited and it was confirmed that fibrosis in liver tissue was improved (FIG. 3).

<3-4> 췌장 조직의 형태학적 분석<3-4> Morphological Analysis of Pancreatic Tissue

Next, the present inventors separated the pancreas of a non-alcoholic fatty liver animal model ingested with arazyme to determine whether the arazyme improved blood glucose, glycated hemoglobin, and insulin resistance indexes were related to pancreatic tissue function. Morphological analysis was carried out as follows.

Each mouse of the negative control group, the control group and the test group ingested arazyme of Experimental Example <3-1> was fixed with 4% paraformaldehyde (paraformaldehyde) at room temperature for 1 hour after CO ₂ treatment, and then the paraffin block was removed. A standard H / E stain was performed. The stained tissues were imaged using an Olympus BX61 (Olympus, Japan) equipped with a digital camera (Olympus DP71) and pancreatic islet using Metamorph imaging software (Molecular Devices, Sunnyvale, CA, USA). The size of was measured.

As a result, as shown in Figure 4, the size of the pancreatic islet is negative control (9.6 ± 1.1) x 10 ³ mm ² and the control (24.7 ± 3.2) x 10 ³ mm ² is the size of the pancreatic islet by the high-fat diet Was significantly increased, but in the test group ingested arazyme (18.6 ± 1.4) x 10 ³ mm ² it was confirmed that the size of the pancreatic islet significantly reduced (Fig. 4). this is

It has been shown that arazyme improves pancreatic tissue function and thus suppresses the increase in pancreatic islet due to the compensatory mechanism.

<< 제제예Formulation example 1> 약학적 제제의 제조 1> Preparation of Pharmaceutical Formulations

<1-1> 산제의 제조<1-1> Preparation of Powder

2 g of arazyme

1 g lactose

After mixing the above components, the airtight cloth was filled to prepare a powder.

<1-2> 정제의 제조<1-2> Preparation of Tablet

Arazyme 100 mg

Corn starch 100 mg

Lactose 100 mg

2 mg magnesium stearate

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

<1-3> 캡슐제의 제조 <1-3> Preparation of Capsule

Arazyme 100 mg

Corn starch 100 mg

Lactose 100 mg

2 mg magnesium stearate

After mixing the above components, the capsule was prepared by filling in gelatin capsules according to the conventional method for producing a capsule.

<1-4> 환의 제조<1-4> Preparation of the ring

1 g of arazyme

Lactose 1.5 g

1 g of glycerin

Xylitol 0.5 g

After mixing the above components, it was prepared to be 4 g per ring in a conventional manner.

<1-5> 과립의 제조<1-5> Preparation of Granules

Arazyme 150 mg

Soy extract 50 mg

Glucose 200 mg

Starch 600 mg

After mixing the above components, 100 mg of 30% ethanol was added, dried at 60 degrees Celsius to form granules, and then filled into fabrics.

<1-6> 주사액제의 제조<1-6> Preparation of Injection Solution

Arazyme 10 μg / ml

Dilute hydrochloric acid BP until pH 7.6

Main sodium chloride BP up to 1 ml

Arazyme was dissolved in a suitable volume of main sodium chloride BP, the pH of the resulting solution was adjusted to pH 7.6 with dilute hydrochloric acid BP, and the volume was adjusted with a main volume of sodium chloride BP and thoroughly mixed. The solution was filled into a 5 ml Type I ampoule of clear glass, encapsulated under an upper grid of air by dissolving the glass, autoclaved at 120 to 15 minutes or more to prepare an injection solution.

<< 제제예Formulation example 2> 식품의 제조 2> Manufacture of food

The powders, tablets, capsules, pills, and granules of Formulation Example 1 may be applied to foods, and foods containing the culture solution of aranicola proteoritus or arazyme separated therefrom are prepared as follows. It was.

<2-1> 밀가루 식품의 제조<2-1> Preparation of Flour Food

Foods for health promotion by adding 0.1 to 10.0 parts by weight of the culture solution of Aranicola proteoriticus or the arazyme separated therefrom to flour, and preparing breads, cakes, cookies, crackers and noodles using the mixture in a conventional manner. Was prepared.

<2-2> 스프 및 육즙(gravies)의 제조<2-2> Preparation of Soups and Gravys

0.1-1.0 parts by weight of the culture solution of Aranicola proteoriticus or arazyme isolated therefrom was added to soups and broth to prepare meat products for health promotion, soups of noodles and broth in a conventional manner.

<2-3> 그라운드 비프(ground beef)의 제조<2-3> Preparation of Ground Beef

10 parts by weight of the culture solution of Aranicola proteoricicus or arazyme isolated therefrom was added to the ground beef to prepare a ground beef for health promotion in a conventional manner.

<2-4> 유제품(dairy products)의 제조<2-4> Production of Dairy Products

0.1-1.0 parts by weight of the culture solution of Aranicola proteoricicus or arazyme isolated therefrom was added to milk, and various dairy products such as butter and ice cream were prepared in a conventional manner using the milk.

<2-5> 선식의 제조<2-5> Preparation of Wire

Brown rice, barley, glutinous rice, and yulmu were alphad by a known method, and then dried and roasted to prepare a powder having a particle size of 60 mesh.

Black beans, black sesame seeds, and perilla were also steamed and dried by a known method, and then ground to a powder having a particle size of 60 mesh.

Araniacola proteoricicus medium or arazyme separated therefrom was decompressed and concentrated in a vacuum concentrator, dried by spraying and drying with a hot air dryer, and then pulverized with a particle size of 60 mesh to obtain a dry powder.

The grains, seeds and the culture solution of Aranicola proteoriticus prepared above or the dry powder of arazyme separated therefrom were combined in the following ratio to prepare a conventional method.

Cereals (30 parts by weight brown rice, 15 parts by weight brittle, 20 parts by weight of barley),

Seeds (7 parts by weight perilla, 8 parts by weight black beans, 7 parts by weight black sesame seeds),

Aranicola proteoricicus culture or dry powder of arazyme isolated therefrom (1 part by weight),

Ganoderma lucidum (0.5 parts by weight),

Foxglove (0.5 part by weight)

<< 제제예Formulation example 3> 음료의 제조 3> Manufacture of beverage

A beverage comprising a culture solution of Aranicola proteoricicus or arazyme isolated therefrom was prepared as follows.

<3-1> 건강음료의 제조<3-1> Preparation of health drink

Substances such as liquid fructose (0.5 parts by weight), oligosaccharides (2 parts by weight), sugar (2 parts by weight), salt (0.5 parts by weight), water (75 parts by weight), and a culture medium of Aranicola proteoricicus or After the separate arazyme (0.5 parts by weight) homogeneously blended for instant sterilization, it was packaged in small packaging containers such as glass bottles and plastic bottles to prepare a healthy beverage.

<3-2> 야채주스의 제조<3-2> Preparation of Vegetable Juice

0.5 g of aranicoim culture or arazyme isolated therefrom was added to 1,000 ml of a juice of a vegetable such as tomato or carrot to prepare a vegetable juice for health promotion in a conventional manner.

<3-3> 과일주스의 제조<3-3> Preparation of Fruit Juice

0.1 g of aranico coli or arazyme isolated therefrom was added to 1,000 ml of fruit juice such as apples or grapes to prepare fruit juice for health promotion in a conventional manner.

Claims

Pharmaceutical composition for the prevention or treatment of metabolic diseases containing arazyme (Arazyme) as an active ingredient.
According to claim 1, wherein the arazyme is a pharmaceutical composition for the prevention or treatment of metabolic diseases, characterized in that the polypeptide consisting of the amino acid sequence described in SEQ ID NO: 1.
According to claim 1, wherein the arazyme is a pharmaceutical composition for the prevention or treatment of metabolic diseases, characterized in that isolated from Aranicola proteolyticus strain culture.
The method of claim 1, wherein the metabolic disease is any one selected from the group consisting of type 2 diabetes, dyslipidemia, insulin resistance, and nonalcoholic fatty liver disease (NAFLD). Or therapeutic pharmaceutical compositions.
The pharmaceutical composition for preventing or treating metabolic diseases according to claim 1, wherein the arazyme increases the expression of the insulin gene or increases the secretion of insulin.
The method of claim 5, wherein the insulin gene is Ins1 or Ins2 characterized in that the pharmaceutical composition for the prevention or treatment of metabolic diseases.
The pharmaceutical composition for preventing or treating metabolic diseases according to claim 1, wherein the arazyme increases the expression of the PCSK1 / 3 or PCSK2 gene.
The pharmaceutical composition for preventing or treating metabolic diseases according to claim 1, wherein the arazyme increases phosphorylation of AKT protein.
The method of claim 1, wherein the metabolic disease is a pharmaceutical composition for the prevention or treatment of metabolic diseases, characterized in that the type 2 diabetes with nonalcoholic fatty liver (NAFLD).
The pharmaceutical composition for preventing or treating metabolic diseases according to claim 1, wherein the arazyme reduces the level of AST or ALT, which is an indicator of hepatotoxicity in the blood.
According to claim 1, wherein the arazyme is a pharmaceutical composition for preventing or treating metabolic diseases, characterized in that to inhibit the fibrosis of the liver.
The method of claim 1, wherein the arazyme is a pharmaceutical composition for preventing or treating metabolic diseases, characterized in that to suppress the increase in the size of the pancreatic islet (pancreatic islet).
Health functional food for improving metabolic diseases containing arazyme (Arazyme) as an active ingredient.
15. The dietary supplement for improvement of metabolic disease according to claim 13, wherein the metabolic disease is type 2 diabetes accompanied with nonalcoholic fatty liver disease (NAFLD).
A method of preventing or treating a metabolic disease comprising administering to a subject a pharmaceutically effective amount of arazyme.
The method of claim 15, wherein the arazyme is a polypeptide consisting of an amino acid sequence set forth in SEQ ID NO: 1.
Arazyme for use as a composition for preventing or treating metabolic diseases.
Arazyme for use as a dietary supplement for the prevention or improvement of metabolic diseases.
The arazyme according to claim 17 or 18, wherein the arazyme is a polypeptide consisting of an amino acid sequence represented by SEQ ID NO: 1.