WO2018066916A1 - Nouvelle algue scédesmus sp. et extrait de cette dernière - Google Patents

Nouvelle algue scédesmus sp. et extrait de cette dernière Download PDF

Info

Publication number
WO2018066916A1
WO2018066916A1 PCT/KR2017/010917 KR2017010917W WO2018066916A1 WO 2018066916 A1 WO2018066916 A1 WO 2018066916A1 KR 2017010917 W KR2017010917 W KR 2017010917W WO 2018066916 A1 WO2018066916 A1 WO 2018066916A1
Authority
WO
WIPO (PCT)
Prior art keywords
genus
composition
extract
hair
skin
Prior art date
Application number
PCT/KR2017/010917
Other languages
English (en)
Korean (ko)
Inventor
김희식
허진아
조대현
배승희
이정주
김기쁨
Original Assignee
한국생명공학연구원
건국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원, 건국대학교 산학협력단 filed Critical 한국생명공학연구원
Publication of WO2018066916A1 publication Critical patent/WO2018066916A1/fr

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/12—Unicellular algae; Culture media therefor
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60—Sugars; Derivatives thereof
    • A61K8/602—Glycosides, e.g. rutin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H17/00—Compounds containing heterocyclic radicals directly attached to hetero atoms of saccharide radicals
    • C07H17/04—Heterocyclic radicals containing only oxygen as ring hetero atoms
    • C07H17/06—Benzopyran radicals
    • C07H17/065—Benzo[b]pyrans
    • C07H17/07—Benzo[b]pyran-4-ones
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C12P19/60—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin

Definitions

  • the present invention relates to novel Genedesmus algae and extracts thereof.
  • UVB of UV rays most affects the skin and mainly penetrates the epidermis and affects skin cells.
  • UVA penetrates into the dermis and mainly affects collagen synthesis-related skin cells.
  • the effect of skin cells by ultraviolet light is that keratinocytes in the skin cells secrete inflammatory cytokines when ultraviolet light is irradiated, and oxidative stress is induced to activate various kinds of protein kinases and phospholipases in the cells. These activated enzymes hydrolyze cell membrane lipids to secrete arachidonic acid.
  • the secreted arachidonic acid is changed to prostaglandin E2 (PGE2) by the action of cyclooxygenase.
  • PGE2 prostaglandin E2
  • the arachidonic acid and PGE2 thus formed cooperate with cytokines to cause various inflammatory reactions, including redness, in the skin and ultimately promote aging of the skin.
  • the fibroblasts of the skin cells are activated by a process similar to the activation of keratinocytes described above by irradiation of ultraviolet rays, and are killed as the amount of ultraviolet rays increases, and DNA damages and ultimately causes skin cancer. And promote aging.
  • ultraviolet rays can cause redness of the skin, immunosuppression, wrinkle formation, and ultimately skin aging and skin cancer, blocking and preventing ultraviolet irradiation are important factors in preventing skin cancer and delaying aging.
  • the genus Scenedesmus is classified as green algae, and the classification system belongs to Chlorophyta, Chlorophyceae, and 4 to 8 unit cells are present. Genesmus is distributed evenly in freshwater around the world and is known to have 20-30% lipid content in the body. As in Patent Document 1 (Korean Patent No. 1443516), the conversion and use of lipids derived from Senedmus into biodiesel have been studied a lot, but more research is needed about using them as raw materials for cosmetics.
  • the present inventors studied a method for inhibiting skin photoaging using natural raw materials, and completed the present invention by confirming that the extract of the genus Senedmus algae exhibits a protective effect against ultraviolet rays.
  • One object of the present invention is to provide an extract of the genus Senedmusus algae which is a natural raw material that can alleviate the side effects caused by the compound used to block ultraviolet rays.
  • Still another object of the present invention is to provide a composition for sunscreen containing the extract.
  • one aspect of the present invention provides a genus of the genus JD-052, deposited with a novel bird strain Accession No. KCTC 18399P.
  • another aspect of the present invention provides a sunscreen composition comprising the extract of Genusmus JD-052, deposited with the accession number KCTC 18399P.
  • the extract of the genus Jedesmus JD-052 of the present invention is excellent in the UV protection effect on the skin cells can be usefully used as a raw material of the composition for the purpose of UV protection.
  • Figure 2 shows a phylogenetic tree of genesis JD-052.
  • Figure 3 shows the growth rate according to the temperature of the genus Genesemus JD-052.
  • Figure 4 shows the growth rate according to the intensity of the genus Genedesmus JD-052.
  • Figure 5 shows the growth rate for each light source of the genus Genesemus JD-052.
  • Figure 6 is a graph showing the UV protection effect of the extract library according to the solvent of genus JD-052.
  • FIGS. 7A-7C show LC / MS results of the extract of Genus mousse JD-052.
  • Figure 7a is a result of culturing under high brightness culture conditions
  • 7b is a result of culturing in normal culture conditions.
  • Figure 8 Sene Death Arma Tooth Mousse JD024 (Scenedesmus armatus JD024) is a graph showing the UV protection effect of the extract library according to the solvent.
  • the present invention provides a genus Genesemus JD-052 deposited with a new bird strain Accession No. KCTC 18399P.
  • the genus Genedesmus JD-052 may be to produce a material that exhibits skin photoaging protection and repair effect, but is not limited thereto.
  • the photoaging may be a fine wrinkle or a decrease in elasticity, but the present invention is not limited thereto and includes all of the aging phenomena caused by light without limitation.
  • the material exhibiting skin photoaging protection and repair effect may include, but is not limited to, isorhamnetin-3-O-di-glucoside.
  • the genus Genedesmus JD-052 can exhibit the highest growth rate at luminous conditions between 180 ⁇ mol / m 2 / s and 220 ⁇ mol / m 2 / s.
  • the genus JD-052 may exhibit more excellent growth rate in an environment in which red light and blue light are irradiated than an environment in which white light is irradiated, but is not limited thereto.
  • the present invention provides a composition for sun protection, comprising an extract of genus JD-052, deposited with accession number KCTC 18399P.
  • the extract is incubated with the genus Jedesmus JD-052; Drying the culture solution of the genus Genedesmus JD-052 to obtain a dried product; And extracting the organic solvent into the obtained dried product, but is not limited thereto.
  • the step of culturing the genus Genedesmus JD-052 may be performed at a temperature condition of 15 °C to 35 °C, luminous conditions between 180 ⁇ mol / m 2 / s to 1520 ⁇ mol / m 2 / s. In addition, in addition to the above conditions it may be performed under the condition that red light and blue light is irradiated.
  • the biomass obtained may be reduced since the growth of the genus JD-052 is not smooth, and no material showing skin protection effect is also produced. There is a problem that the protection effect against the can be significantly lower.
  • the skin cell protection effect against UV may be reduced even when the culture is extracted.
  • the extract When the extract is obtained by extracting it from raw materials, all conventionally known extraction methods such as solvent extraction, ultrasonic extraction, filtration and reflux extraction can be used as extraction methods, and preferably prepared by using solvent extraction or reflux extraction. can do.
  • the extraction process may be repeated several times, after which it may be further subjected to steps such as concentration or lyophilization. Specifically, the obtained extract is concentrated under reduced pressure to obtain a concentrate, and the extract is freeze-dried to prepare a high concentration extract powder using a grinder.
  • the extraction process may be repeated several times, after which it may be further subjected to methods such as concentration or lyophilization.
  • the obtained extract may be concentrated under reduced pressure to obtain a concentrate, and the extract may be lyophilized to prepare a high concentration of extract powder using a grinder.
  • the solvent when extracting the extract may be any one selected from the group consisting of water, organic solvents and mixtures thereof.
  • the organic solvent may be at least one selected from the group consisting of alcohol, hexane (n-hexane), ether, glycerol, propylene glycol, butylene glycol, ethyl acetate, methyl acetate, dichloromethane, chloroform, ethyl acetate and benzene
  • the organic solvent may be ethyl acetate or hexane, but is not limited thereto.
  • Scenedesmus genus JD-052 The extract of sp.JD-052, KCTC 18399P) is effective in preventing or ameliorating the aging phenomenon such as photoaging of the skin caused by UV, that is, wrinkles on the skin or decreased elasticity of the skin.
  • the genus Genedesmus JD-052 is incubated at a temperature condition of 15 °C to 35 °C, luminous conditions between 1480 ⁇ mol / m 2 / s to 1520 ⁇ mol / m 2 / s and the culture is It was confirmed that the extract obtained by extraction with hexane has an excellent effect of protecting skin cells from UV (FIG. 6).
  • the genus Genedesmus JD-052 is incubated at a temperature condition of 15 °C to 35 °C, luminous conditions between 180 ⁇ mol / m 2 / s to 220 ⁇ mol / m 2 / s and the culture It was confirmed that the extract obtained by extracting with ethyl acetate has an excellent effect of protecting skin cells from UV (FIG. 6).
  • the formulation of the composition is a flexible lotion, nourishing lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray, powder, hair tonic, hair cream, hair lotion, hair shampoo, hair It may be one selected from the group consisting of rinse, hair conditioner, hair spray, hair aerosol, pomade, sol gel, emulsion, oil, wax and aerosol, but is not limited thereto.
  • composition of the present invention may be a pharmaceutical composition or a cosmetic composition, but may be used without limitation in a composition requiring prevention or improvement of photoaging.
  • the composition of the present invention comprises (a) a pharmaceutically effective amount of the extract of the present invention described above; And (b) a pharmaceutically acceptable carrier.
  • the pharmaceutical composition of the present invention can be used for the prevention, amelioration and treatment of skin whitening related diseases such as melanosis, chloasma, blemishes, freckles, hepatic spots, brown spots of skin after inflammation and senile black spots. Can be.
  • Pharmaceutically acceptable carriers included in the pharmaceutical compositions of the present invention are those commonly used in the preparation of lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, and the like. It is not.
  • the pharmaceutical composition of the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • compositions of the present invention may be prepared in unit dosage form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporating into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of extracts, powders, granules, tablets, capsules or gels (eg hydrogels), and may further include a dispersant or stabilizer. have.
  • the pharmaceutical composition according to the present invention can be administered orally or parenterally during clinical administration and can be used in the form of general pharmaceutical preparations. That is, the pharmaceutical composition of the present invention may be administered in various oral and parenteral dosage forms in actual clinical administration, and when formulated, diluents such as fillers, extenders, binders, wetting agents, disintegrating agents, and surfactants that are commonly used Or using excipients.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules and the like, which solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose or lactose in the herbal extract or herbal fermentation product. Mixed with gelatin.
  • Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. have.
  • Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories.
  • non-aqueous solvent and the suspension solvent propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used.
  • uthepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol, gelatin and the like can be used as the base of the suppository.
  • the composition of the present invention comprises (a) a cosmetically effective amount of the aforementioned extract of the present invention; And (b) a cosmetically acceptable carrier.
  • cosmetic effective amount means an amount sufficient to achieve the skin improving efficacy of the composition of the present invention described above.
  • Cosmetic compositions of the present invention may also be prepared in any formulations conventionally prepared in the art, including, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactants- Containing cleansing, oils, powder foundations, emulsion foundations, wax foundations, sprays, and the like, but is not limited thereto.
  • the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc. may be used as carrier components.
  • animal oil vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc.
  • trakant cellulose derivative
  • polyethylene glycol silicone
  • bentonite silica
  • talc or zinc oxide etc.
  • lactose When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular in the case of a spray, additionally chlorofluorohydrocarbon, propane Propellants such as butane or dimethyl ether may be included, but are not limited thereto.
  • a solvent, solubilizer or emulsifier is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 Fatty acid esters of, 3-butylglycol oil, glycerol aliphatic esters, polyethyleneglycol or sorbitan may be used, but are not limited thereto.
  • liquid carrier diluents such as water, ethanol or propylene glycol
  • suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Sex cellulose, aluminum metahydroxy, bentonite, agar or tracant may be used, but is not limited thereto.
  • the carrier component is an aliphatic alcohol sulfate, an aliphatic alcohol ether sulfate, a sulfosuccinic acid monoester, an isethionate, an imidazolinium derivative, a methyltaurate, a sarcosinate, a fatty acid amide.
  • Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters may be used, but are not limited thereto.
  • the compounds of the present invention are mixed with base ingredients for shampoo composition such as thickeners, surfactants, viscosity modifiers, humectants, pH adjusters, preservatives, essential oils and the like.
  • CDE may be used as a thickener
  • LES anionic surfactant
  • cocobetaine an amphoteric surfactant
  • polyquater as a viscosity modifier
  • glycerin as a moisturizer
  • glycerin as a moisturizer
  • citric acid as sodium hydroxide
  • Grapefruit extract may be used, in addition to essential oils such as cedarwood, peppermint, rosemary, and silkamino acids, pentaol, vitamin E may be added.
  • the compound of the present invention when the compound of the present invention is 100 parts by weight of CDE 5-10 parts by weight, LES 30-40 parts by weight, cocobetaine 10-20 parts by weight, polyquater 0.1-0.2 parts by weight , 5 to 10 parts by weight of glycerin, 0.1 to 1.01 parts by weight of grapefruit extract, 0.5 to 1 part by weight of silk amino acid, 0.5 to 1 part by weight of pentaol, 0.5 to 2 parts by weight of vitamin E, from cedarwood, peppermint and rosemary as essential oils
  • One may be mixed 0.01 to 0.1 parts by weight, but is not limited thereto.
  • the components included in the cosmetic composition of the present invention include components conventionally used in cosmetic compositions in addition to the compound of the present invention and the carrier component as active ingredients, and include, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments and perfumes. It may include, but is not limited to, conventional adjuvants.
  • the present invention provides a method of treating sunscreen damaged by ultraviolet rays or UV rays comprising the step of administering the composition for the sunscreen to the individual.
  • the effective dosage of the composition of the present invention may vary depending on the formulation method, mode of administration, time of administration, and / or route of administration of the composition, and the type and extent of the reaction to be achieved by administration of the composition, subject to administration.
  • composition of the present invention may be administered once a day, may be divided into several times. Therefore, the above dosage does not limit the scope of the present invention.
  • the route of administration and mode of administration of the compositions of the present invention may be independent of each other, and are not particularly limited in the manner thereof, and may be in accordance with any route of administration and mode of administration as long as the composition can reach the desired site of interest.
  • the composition may be administered by oral or parenteral administration, preferably by parenteral administration.
  • parenteral administration method for example, intravenous administration, intraperitoneal administration, intramuscular administration, transdermal administration or subcutaneous administration may be used, and the method of applying, spraying or inhaling the composition to a diseased site may also be used. But it is not limited thereto.
  • composition of the present invention may be administered by topical application, more preferably by transdermal administration during parenteral administration, and more preferably by applying the composition to the skin of an individual.
  • the term "application” means contacting the composition of the present invention with the skin of an individual in any suitable manner, through which the composition is intended to be absorbed into the skin.
  • the present invention provides a sunscreen method comprising applying to a subject a sunscreen composition comprising an extract of genus JD-052, deposited with accession number KCTC 18399P.
  • the method of treating the skin damaged by ultraviolet rays comprising the step of applying to the subject having a skin damaged by ultraviolet rays comprising a extract of the genus JD-052, deposited with accession number KCTC 18399P.
  • the term "individual” may refer to any animal, including humans, which may be damaged or damaged by ultraviolet rays.
  • the animal may be a mammal such as a cow, a horse, a sheep, a pig, a goat, a camel, an antelope, a dog, a cat, etc., which need treatment of a similar condition as well as a human, but is not limited thereto.
  • the sun protection method of the present invention or the treatment method of the skin damaged by ultraviolet light prevents diseases such as melanosis, chloasma, blemishes, freckles, hepatic spots, brown spots of skin after inflammation and senile black spots, or Can be treated.
  • Example 1 Senedmus JD -052 ( Scenedesmus sp . JD - 052 Separation and Identification
  • Cenedesmus JD-052 was purely separated into a single cell line using micropipetting and micropicking from a clean water system around Cholla Republic (FIG. 1).
  • the genus JD-052 isolated purely into a single cell line was identified by sequencing by PCR using 18S green algae identification primers (ch165F, ch1200R) after DNA extraction.
  • the primer sequence is as follows.
  • ch165F CGACTTCTGGAAGGGACGTA (SEQ ID NO: 1)
  • ch1200R GAGTCAAATTAAGCCGCAGG (SEQ ID NO: 2)
  • N 0 absorbance at 680 nm at the beginning of culture
  • N 1 absorbance at 680 nm at the final time after incubation
  • t 0 initial culture day
  • t 1 final culture day
  • Composition Components of BG11 Medium Content (g / L) NaNO 3 1.500 K 2 HPO 4 0.02 MgSO 4 7H 2 O 0.075 Na 2 CO 3 0.021 CaCl 2 0.027 Na 2 SiO 3 9H 2 O 0.058 Ferric citrate 0.006 Citric acid 0.006 EDTA 0.001 Trace ingredients H 3 BO 3 2.86 MnCl 2 4H 2 O 1.86 ZnSO 4 7H 2 O 0.22 Na 2 MoO 4 2H 2 O 0.391 CuSO 4 5H 2 O 0.079 Co (NO 3 ) 2 6H 2 O 0.0494
  • the growth rate of the genus JD-052 strain was good in the overall range of 15 °C ⁇ 30 °C, the temperature showed the optimal growth rate was 25 °C as the growth rate was 0.2 level (Fig. 3).
  • the sensitized JD-052 in the photocultivator was irradiated with light at 100 ⁇ mol / m 2 / s, 150 ⁇ mol / m 2 / s, 200 ⁇ mol / m 2 / s and 250 ⁇ mol / m 2 / s for 24 hours.
  • Shake culture was performed in BG11 medium.
  • the temperature at the time of culture was 25 degreeC.
  • Cell growth rate was calculated by the equation (1) of Example ⁇ 2-1>.
  • the genus JD-052 strain showed the lowest growth rate at luminous intensity 100 ⁇ mol / m 2 / s, and the growth rate increased with increasing luminous intensity.
  • the optimal brightness of the genus Genedesmus JD-052 was 200 ⁇ mol / m 2 / s, and the growth rate was 0.01. However, the growth rate decreased at a light intensity of 250 ⁇ mol / m 2 / s (FIG. 4).
  • White light, red light + blue light were used as a light source, and the light intensity was 200 micromol / m ⁇ 2> / s for 30 days shaking culture in BG11 medium.
  • the temperature at the time of culture was 25 degreeC.
  • Cell growth rate was calculated by the equation (1) of Example ⁇ 2-1>.
  • C. genus JD-052 strain was cultured under the culture conditions shown in Table 2 with luminous intensity of 200 ⁇ mol / m 2 / s, and the stress conditions were normal (Normal) (200 ⁇ mol / m 2 / s), high brightness. (High light) (1500 ⁇ mol / m 2 / s), UV and incubated for 24 hours under stress conditions. Ethanol, ethyl acetate, hexane and distilled water were used as the extraction solvent. The stress-treated culture was lyophilized after removing the culture to obtain a dry biomass. Each solvent was added to the obtained dry biomass as shown in Table 2 below, and cell extraction was performed for 3 minutes using an ultra sonicator.
  • Example 4> Example Obtained in 3 Senedmus JD -052 Strain Extract Library Confirms the Inhibitory Effect of Skin Cell Damage on UV Light
  • DREAM system novel DNA Repair Regulating Material Discovery System; Acta pharmaceutica. 2015, 65 (3): 331-341
  • Table 3 shows the degree of effect of the hexane extract in the high brightness culture conditions, the most excellent effect.
  • UV protection effect a degree of effect (pre% / post%) JD052 High brightness Hexane +++ 17.86% /-4.28% JD052 Normal brightness Hexane - - a degree of effect: increased% value based on decreased cell viability upon UV irradiation
  • Useful extracts were analyzed by using LC / MS of the genera Senedmusmus JD-052 extract (hexane extract of the culture medium cultured in high brightness culture conditions) showed high protection of the cells damaged by UV light.
  • Example 3 The strain used in Example 3 was sent to Senedmus armatus JD024 ( Scenedesmus Algae were cultured in the same manner except for using armatus JD024), and the effect of inhibiting damage to skin cells against ultraviolet rays was confirmed in the same manner as in Example 4.
  • the ethyl acetate extract or hexane extract derived from the new microalgae of the present invention has a superior skin protection effect against ultraviolet rays compared to extracts derived from the same genus strains known in the art. Able to know.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Engineering & Computer Science (AREA)
  • Birds (AREA)
  • Biomedical Technology (AREA)
  • Dermatology (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Cosmetics (AREA)

Abstract

La présente invention concerne une nouvelle algue Scenedesmus sp. et un extrait de cette dernière. Cet extrait de Scenedesmus sp. JD -052, qui est une nouvelle algue Scenedesmus sp., fait preuve d'un effet de protection contre les UV, et peut donc être utilisé de manière utile dans le domaine de la cosmétique.
PCT/KR2017/010917 2016-10-07 2017-09-29 Nouvelle algue scédesmus sp. et extrait de cette dernière WO2018066916A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160129802A KR101805899B1 (ko) 2016-10-07 2016-10-07 신규 세네데스무스속 조류 및 이의 추출물
KR10-2016-0129802 2016-10-07

Publications (1)

Publication Number Publication Date
WO2018066916A1 true WO2018066916A1 (fr) 2018-04-12

Family

ID=60998702

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/010917 WO2018066916A1 (fr) 2016-10-07 2017-09-29 Nouvelle algue scédesmus sp. et extrait de cette dernière

Country Status (2)

Country Link
KR (1) KR101805899B1 (fr)
WO (1) WO2018066916A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020159298A2 (fr) * 2019-01-31 2020-08-06 한국생명공학연구원 Nouvelles microalgues ayant une productivité élevée de loliolide
CN114703066B (zh) * 2022-04-29 2023-01-17 山东大学 一种栅藻、其活性成分的提取方法与应用

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090127240A (ko) * 2008-06-06 2009-12-10 엘브이엠에이취 러쉐르쉐 서바이빈 발현의 자극에 의한 항-노화 미용 관리 방법
KR20120127685A (ko) * 2011-05-13 2012-11-23 한국원자력연구원 방사선 조사에 의해 지질 함량이 증가된 세네데스무스 디모르푸스 6ｇ, 이의 생산방법 및 상기 세네데스무스 디모르푸스 6ｇ를 이용한 바이오 디젤의 제조방법
KR20150008238A (ko) * 2013-07-11 2015-01-22 주식회사 바이오에프디엔씨 미세 조류 추출물 유래 펩타이드 유도체를 함유하는 자외선 차단용 피부 외용제 조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090127240A (ko) * 2008-06-06 2009-12-10 엘브이엠에이취 러쉐르쉐 서바이빈 발현의 자극에 의한 항-노화 미용 관리 방법
KR20120127685A (ko) * 2011-05-13 2012-11-23 한국원자력연구원 방사선 조사에 의해 지질 함량이 증가된 세네데스무스 디모르푸스 6ｇ, 이의 생산방법 및 상기 세네데스무스 디모르푸스 6ｇ를 이용한 바이오 디젤의 제조방법
KR20150008238A (ko) * 2013-07-11 2015-01-22 주식회사 바이오에프디엔씨 미세 조류 추출물 유래 펩타이드 유도체를 함유하는 자외선 차단용 피부 외용제 조성물

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
HEO, JINA: "Characterization of a natural anti-aging agents from indigenous microalgal strain, Scenedesmus deserticola JD-052", THE KOREAN SOCIETY FOR MICROBIOLOGY AND BIOTECHNOLOGY, 24 June 2016 (2016-06-24), pages A-49 *
HEO, JINA: "Chemical compounds derived from an indigenous microalgal species of Scenedesmus deserticola JD-052 exhibit UV-protect ive activity", vol. 30, 30 September 2016 (2016-09-30), pages PD-20 *

Also Published As

Publication number Publication date
KR101805899B1 (ko) 2018-01-10

Similar Documents

Publication Publication Date Title
WO2011099665A1 (fr) Composition antimicrobienne contenant des extraits d'ingrédients naturels, antiseptique naturel composite et procédé de fabrication associé
WO2019103329A1 (fr) Composition antioxydante contenant un extrait de ver de farine fermenté à titre de principe actif
WO2020218781A1 (fr) Composition fonctionnelle contenant un milieu de culture riche en exosomes dérivé d'une cellule souche immortalisée et un extrait de bourgeon de rose en tant que principes actifs
WO2011059292A2 (fr) Concentré ou extrait de pousse d'aloès officinal favorisant fortement la croissance des cellules cutanées et présentant des effets anti-allergiques et antioxydants supérieurs
WO2022086041A1 (fr) Nouvelle souche de lactobacillus sp. et son utilisation
KR101829553B1 (ko) 완두콩, 황금, 유근피 및 산자나무 열매 혼합물의 추출물을 유효성분으로 함유하는 피부 손상 개선 또는 보호용 화장료 조성물
WO2023027274A1 (fr) Composition cosmétique contenant des exosomes dérivés de racine d'iris germanica en tant que principe actif
JP6591963B2 (ja) ラクトバチルス・ペントーサスの化粧品及び薬品への適用
WO2020246766A1 (fr) Composition pour prévenir ou atténuer le vieillissement cutané, contenant un extrait de rhodiola sachalinensis fermenté à l'aide de bovista plumbea
KR101908077B1 (ko) 천연 한방 추출물을 유효성분으로 포함하는 미백, 피부 노화 방지 또는 피부 주름 개선용 조성물
WO2018066916A1 (fr) Nouvelle algue scédesmus sp. et extrait de cette dernière
KR101390465B1 (ko) 탁시폴린 배당체를 함유하는 작약추출물의 제조방법 및 작약추출물을 함유하는 화장료 조성물
WO2021162415A1 (fr) Composition cosmétique pour l'amélioration de la peau comprenant, en tant que principes actifs, des polysaccharides, un extrait de levure et un produit de fermentation de souche ayant des caractéristiques de probiotiques
KR101860352B1 (ko) 청호 복합 추출물을 유효성분으로 포함하는 모낭충 제거용 화장료 조성물
WO2018111042A2 (fr) Composition cosmétique comprenant un extrait de plantes médicinales en tant qu'ingrédient actif
KR101960810B1 (ko) 블랙커런트 열매와 아로니아 열매의 혼합 추출물을 함유하는 화장료 조성물
KR102059008B1 (ko) 피부미백 기능을 갖는 화장료 조성물
WO2020101414A1 (fr) Composition favorisant la régénération cutanée et la poussée capillaire, contenant de l'apigénine
WO2012102456A1 (fr) Composition cosmétique pour réduire les rides contenant des extraits d'euphorbia supina
KR101970628B1 (ko) 블랙베리 및 크랜베리 추출물을 포함하는 화장료 조성물
KR101508717B1 (ko) 누에 유래 혈림프를 포함하는 화장료 조성물
WO2021182895A1 (fr) Composition cosmétique pour favoriser la présence de bactéries bénéfiques pour la peau
KR101501554B1 (ko) 누에 혈림프 유래 70kDa 단백질을 포함하는 화장료 조성물
WO2020159298A2 (fr) Nouvelles microalgues ayant une productivité élevée de loliolide
WO2019164090A1 (fr) Composition contenant un extrait de symplocarpe fétide ou une fraction de celui-ci utilisé comme principe actif pour l'atténuation des rides

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17858710

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17858710

Country of ref document: EP

Kind code of ref document: A1