WO2018056825A1 - Manipulation of immune activity by modulation of expression - Google Patents

Abstract

The present invention relates to the field of immunity, immune activity and more particularly to the field of "immune check points" including the PD-1/PD-L1 axis, and conditions or diseases involving PD-1/PD-L1 axis signaling. Provided are modulators of immune activity, which modulators influence the activity and/or expression of CMTM6 and/or CMTM4.

Description

Title: Manipulation of immune activity by modulation of expression. FIELD OF THE INVENTION

The present invention relates to the field of immunity, immune activity and more particularly to the field of "immune check points" including the PD-1/PD-L1 axis, and conditions or diseases involving PD-1/PD-L1 axis signaling. Provided are modulators of immune activity, which modulators influence the activity and/or expression of the members of the CMTM family, such as CMTM6 and CMTM4. The modulators may modulate immune activity, e.g. T-cell activity (towards its target), PD-1/PD-L1 axis signaling and/or PD-L1 expression. Also provided for are methods for screening compounds capable of modulating immune activity, PD-1/PD-L1 axis signaling and/or PD-L1 expression as well as methods for treating conditions or diseases involving aberrant immune activity, functioning of PD-1/PD-L1 axis signaling and/or altered PD-L1 levels, such as cancer and autoimmune diseases.

BACKGROUND OF THE INVENTION

The immune system is a host defense system comprising many biological structures, molecules, and processes within an organism that protects against disease. To function properly, an immune system must detect a wide variety of agents, known as pathogens, from viruses to parasitic worms, and distinguish them from the organism's own healthy tissue.

The immune system can be classified into several subsystems, such as the humoral immune system and the cell-based immune system (also referred to as cell-mediated immunity). While the humoral immune system is concerned with aspects of immunity that is mediated by antibodies, cell-mediated immunity is an immune response that does not involve antibodies. Rather, cell-mediated immunity involves, for example, the activation of phagocytes, T-cells such as antigen-specific cytotoxic T-lymphocytes or helper T-lymphocytes, and the release of various cytokines, for example by such T-cells in response to an antigen (upon binding of the TCR of the T cell to a peptide:MHC complex on the target cell). Cell-mediated immunity plays an important role in mediating immune responses in diseases or conditions such as cancer, infections, and autoimmune diseases.

An important component of cell-mediated immunity is the so-called "T-cell mediated immunity" (or T-cell immune activity). T cell or T lymphocyte is a type of lymphocyte that plays a central role in cell-mediated immunity (Williams et al (2007), Annual Review of Immunology, Vol. 25: 171-192; Wei F et al (2013) PNAS; VOL: 110, E2480-2489). T cells can be distinguished from other lymphocytes, such as B cells and natural killer cells, by the presence of a T-cell receptor on the cell surface. They are called T-cells because they mature in the thymus from thymocytes. Once they have completed their development in the thymus, T-cells enter the bloodstream and lymphoid system and are carried by the circulation. To participate in an adaptive immune response, a naive T cell must first encounter antigen in the form of a peptide: MHC complex on the surface of an activated antigen-presenting cell (APC), and is thereby induced to proliferate and differentiate into "effector T cells" (Immunobiology, 5th edition, The Immune System in Health and Disease (2001) by Charles A Janeway, Jr, Paul Travers, Mark Walport, and Mark J Shlomchik, New York: Garland Science; ISBN-10: 0-8153-3642-X).

Effector T cells encompass a broad variety of T cells including T helper cells and T killer cells. Effector T cells are capable of killing or destroying pathogens, infected cells, or aberrant cells (e.g. cancer cells displaying tumor antigens) due to their ability to induce apoptosis and to secrete cytokines such as IFN gamma (IFNg, also referred to as INFg) and TNF alpha (TNFa), as well as chemokines including CXCL9 and CXCL10, and others. Effector T cells can also secrete perforin-granzymes (Immunobiology, 5th edition, The Immune System in Health and Disease (2001 ) by Charles A Janeway, Jr, Paul Travers, Mark Walport, and Mark J Shlomchik, New York: Garland Science; ISBN-10: 0-8153-3642-X).

Effector T cells have also been shown to play an important role in anti-tumor immunity (e.g. against tumor cells displaying tumor antigens). However, tumor microenvironments can pose particular challenges for effector T cells. Specifically, multiple studies have shown that tumors have the ability to suppress immune responses mediated by effector T cells by inhibiting effector T cell function or activity (e.g. secretion of cytokines as mentioned above) and/or reducing or blocking proliferation of effector T cells. One way by which tumors achieve these effects is through expression of so-called inhibitory "immune check points" (Romano and Romero (2015), Journal for immunotherapy, Vol 3: 15).

Immune checkpoints are molecules in the immune system that either turn up or turn down a signal from immune cells (e.g. secretion of cytokines from effector T cells), for example, so as to reduce immune responses to mitigate collateral tissue damage. One such immune check point consists of the programmed death-ligand 1 (PD-L1) and its receptor, the programmed death-1 receptor (PD-1). PD-L1 and PD-1 are often referred to as the "PD-1/PD-L1 axis" or "PD-1/PD-L1 pathway" The PD-1/PD-L1 axis is also referred to as a "negative immune checkpoint" or 'inhibitory immune checkpoint' because it reduces or turns down immune signals (e.g. secretion of cytokines by effector T cells). Normally, inhibitory immune check points, such as for instance the "PD-1/PD-L1 axis, serve as safeguard mechanisms aimed at keeping the immune system from overreacting to a stimulus or mistaking a component of the body for a dangerous invader. In the context of cancer, tumor cells protect themselves from the host immune system or escape host immune surveillance (e.g. cancer cells displaying tumor antigens should normally be recognized and destroyed by effector T cells) by inhibiting or interfering with effector T cell function or activity (e.g. cytokine production or effector T cell proliferation) by signaling through the PD-1/PD-L1 axis, as further discussed below (Taku Okazaki and Tasuku Honjo (2007), International Immunology, Vol: 19, pages 813-824; Iwai Y et al (2002), PNAS Vol: 99, pages 12293).

PD-L1 is a transmembrane glycoprotein also known as cluster of differentiation 274 (CD274) or B7 homolog 1 (B7-H1). In human, PD-L1 is encoded by the CD274 gene. PD-L1 can be expressed on a variety of cell types, including placenta, vascular endothelium, pancreatic islet cells, muscle, hepatocytes, epithelium, and mesenchymal stem cells, as well as on B cells, T cells, dendritic cells, macrophages, mast cells, and others (Suya Dai et al (2014) Cellular Immunology, Vol:290, pages 72-79). The expression of PD-L1 is further up-regulated (i.e. increased compared to resting conditions) on cells by various immune stimuli including for instance anti-lgM antibody, LPS and anti-CD40 antibody for B cells, anti-CD3 antibody for T cells, anti-CD40 antibody, LPS, IFN gamma and granulocyte macrophage colony stimulating factor for macrophages and anti-CD40 antibody, IFN gamma, IL-4, IL-12 and GM-CSF for dendritic cells (Taku Okazaki and Tasuku Honjo (2007), International Immunology, Vol: 19, pages 8 3-824). PD-1 (also known as CD279 or cluster of differentiation 279) is a cell surface receptor that belongs to the immunoglobulin superfamily. More specifically, PD-1 is a member of the CD28 family of receptors, which includes CD28, CTLA-4, ICOS, PD-1 , and BTLA. In human, PD-1 is encoded by the PDCD1 gene. PD-1 is expressed at the surface of immune cells such as activated T cells, including effector T cells (e.g. killer T cells), B cells, NKT cells, and myeloid cells (Suya Dai et al (2014) Cellular Immunology, Vol:290, pages 72-79; Gianchecchi et al (2013), Autoimmun. Rev. 12 (2013) 1091-1100).

Under normal situation, the PD-1/PD-L1 axis plays a major role in suppressing the immune system during particular events such as pregnancy, tissue allografts, autoimmune diseases and other disease states such as hepatitis. Normally, the immune system reacts to foreign antigens that have accumulated in the lymph nodes or spleen by triggering the proliferation of antigen-specific CD8+ effector T cells (also known as killer T cells). The binding of PD-L1 to its receptor PD-1 transmits an inhibitory signal which reduces the proliferation of these CD8+ T cells within the lymphoid organs. More specifically, binding of PD-L1 to its receptor PD-1 on T cells delivers a signal that inhibits T cell receptor (TCR)-mediated activation of the T cell, as for instance reflected by cytokine (e.g. IL-2 and others) production and T cell proliferation, thus effectively dampening or suppressing the immune response (Wei F et al (2013) PNAS; VOL: 110, E2480-2489). Also in non-lymphoid tissues, binding of PD-L1 to PD-1 on T cells inhibits T cell activation.

Under normal situations, the suppression of the immune system by the PD-1/PD-L1 axis is meant to minimize or avoid the death of bystander host cells (e.g. healthy cells) and to prevent the development of autoimmune diseases. Indeed, it was shown that PD-L1 deficiency in mouse or PD-L1 dysregulation in human due to the occurrence of SNP(s) in the gene encoding the PD-L1 protein or the PD-1 receptor was associated with autoimmunity. These results show the importance of the PD-1/PD-L1 axis in preventing overshooting of the immune system against host cells.

Under pathological conditions, such as cancers, the suppression of the immune system by the PD-1/PD-L1 axis is maladaptive and detrimental to the host, because it allows the tumor cells to escape immune surveillance and continue growing. For this reason, the PD-1/PD-L1 axis has become a main center of interest for the treatment of various cancers such as melanoma, breast, lung, kidney, ovary, bladder, colon, hepatocellular, gastrointestinal tract (Gl) cancer, Hodgkin's lymphoma, and colorectal cancers, and others It was shown that in the cancer disease state, the expression of PD-L1 is often up-regulated (i.e. a higher expression of the protein, e.g. in the cell surface) at the external surface (cell surface) of cancer cells (Taku Okazaki and Tasuku Honjo (2007), International Immunology, Vol: 19, pages 813-824). In this context, the interaction between the PD-L1 on the cancer cell surface and the PD-1 receptor on an immune cell (e.g. T-cell) is promoted. This leads to decreased or reduced immune cell (e.g. effector T cell) function or activity, e.g. decreased or reduced secretion of cytokines and/or decreased or reduced proliferation of T cells, which in turn prevents or hinders the immune system from attacking the tumor cells. PD-L1 can also be expressed by non-cancerous cells within the tumor micro-environment, with the same deleterious effects on immune cell function.

Globally, this allows cancer cells to escape detection by the host immune system.

These results prompted the development of new cancer therapies aimed at inhibiting or blocking the PD-1/PD-L1 axis. For instance, PD-1/PD-L1 axis inhibitors that block the interaction of PD-L1 with the PD-1 receptor are currently being used to prevent the cancer from evading the immune system (Brahmer et al. (2010) J Clin Oncol 28:3167-75; Brahmer et al. (2012) N. Engl J Med 366:2455-65; Flies et al. (2011 ) Yale J Biol Med 84:409-21; Topalian et al. (2012b) N Engl J Med 366:2443-54.). Examples of PD-1/PD-L1 axis inhibitors include anti-PD-L1 antibodies (e.g. BMS-936559), as well as anti-PD-1 antibodies (e.g. nivolumab (BMS-936558), and combination thereof. Although cancer therapies relying on the use of such compounds have shown promising clinical results in humans, such treatment is still not optimal. For instance, one of the drawbacks associated with the use of antibodies includes their large size (limits diffusion into solid tumors) and their ability to activate antibody dependent cell- mediated cytotoxicity, through their Fc-region. While Fc-mediated effects are an important part of the efficacy of many antibody therapeutics, in the case of PD-1/PD-L1 axis inhibition this may be counterproductive. A further drawback of anti-PD-L1 or anti-PD-1 antibodies is their lack of specificity for cancer cells or lack of specific effects on cancer cells (i.e. they target healthy cells or has effects on healthy cells as well). Others adverse effects experienced by patients treated with such compounds include fatigue, infusion reactions, diarrhea, arthralgia, rash, nausea, pruritis, headache, rash, hypothyroidism, hepatitis, endopthalmitis, diabetes milletus, myasthenia gravis, pneumonitis, vitiligo, colitis, hypophysitis, thyroditis, and others. Further, not all subjects respond to anti-PD-L1 antibody- or anti-PD-1 antibody based therapy.

Alternative (non-antibody) PD-L1 or PD-1 or PD-1/PD-L1 axis inhibitors are being developed such as engineered affinity proteins (e.g. engineered Affimer protein scaffold), which are smaller in size than antibodies, and thus have the potential to better diffuse within solid tumors. However, such inhibitor compounds also lack cell specificity, i.e. target healthy cells in addition to cancer cells.

Therefore, there is a need for alternative or improved therapies, including cancer therapies or treatments, which do not suffer from one or more of the limitations above. More specifically, there is a need for alternative or new compounds and/or methods which can be used to block or inhibit or reduce the function or activity of the PD-1/PD-L1 axis in cancer cells and/or immune cells. Further, there is also a need for alternative or new compounds and/or methods which can be used to activate or enhance or increase the function or activity of the PD-1/PD- L1 axis in cells in the context of autoimmune disorders. SUMMARY OF THE INVENTION

The present invention relates to the finding of cellular proteins that may modulate immune activity, in particular modulate cell-mediated immunity, PD-1/PD-L1 axis signaling, PD-L1 expression and/or PD-L1 protein levels. It was found that modulating expression or activity of these proteins alters (e.g. up-regulates or down-regulates) the expression or amount of PD- L1 protein in a cell (e.g. at the cell surface). With respect to PD-L1 expression, within the context of the current invention, this refers to both non-stimulated PD-L1 expression and to PD-L1 expression as the consequence of (the presence of) stimuli. The skilled person knows that, for example, the expression of PD-L1 is further up-regulated (i.e. increased compared to resting conditions) on cells by various immune stimuli including for instance anti-lgM antibody, LPS and anti-CD40 antibody for B cells, anti-CD3 antibody for T cells, anti-CD40 antibody, LPS, IFN gamma and granulocyte macrophage colony stimulating factor for macrophages and anti-CD40 antibody, I FN gamma (INFg), IL-4, IL-12 and GM-CSF for dendritic cells (see, e.g. Taku Okazaki and Tasuku Honjo (2007), International Immunology, Vol: 19, pages 813- 824).

Specifically, the present inventors found that blocking the expression or down-regulating the expression of specific members of the CMTM family, namely CMTM6 and/or CMTM4), in a cell (e.g. cancer cell, pancreatic cells, etc.), decreases the expression of PD-L1 or decreases the amount of PD-L1 protein (e.g. at the cell surface) in said cell.

As will be understood by the skilled person, and without being bound to any theories, it is believed that these finding may be applied, for instance in clinic or in treatment of a patient suffering from cancer or autoimmune disease, according to the following non-limiting scenarios:

Scenario 1 ) Decreasing the levels of PD-L1 (e.g. at the cell surface), as a consequence of blocking, inhibiting or down-regulating CMTM6 and/or CMTM4 proteins in a cell (e.g. cancer cell), for example in a subject, will impair or decrease PD-1/PD-L1 signaling or impair or decrease binding of PD-L1 to its receptor PD-1 (as a consequence of limited availability of PD-L1 ). This will ultimately increase (host) immune activity (e.g. increased T-cell function such as cytokine and chemokine secretion). Such situation would be advantageous, for instance, for the treatment of cancer (e.g. bladder, lung, melanoma, colon, Gl tract, Hodgkin's lymphoma, and others), where increased host immune activity against cancer cells is desired.

Scenario 2) Increasing the levels of PD-L1 (e.g. at the cell surface), as a consequence of up- regulating or increasing CMTM6 and/or CMTM4 proteins in a cell (e.g. pancreatic cell) of a subject, will enhance or increase PD-1/PD-L1 signaling or facilitate or increase binding of PD- L1 to its receptor PD-1. This will ultimately decrease host immune activity (e.g. decreased T- cell function such as cytokine and chemokine secretion). Such situation would be advantageous, for instance, for the treatment of an autoimmune disease (e.g. diabetes type 1 , systemic lupus erythematosus, rheumatoid arthritis, and others), where decreased host immune activity against cells (e.g. pancreatic cells) is desired.

The present findings (including scenarios above) have important implications for the field of immunity, in particular cell-mediated immunity, particularly for diseases or conditions involving aberrant PD-1/PD-L1 axis signaling or altered levels of PD-L1 expression or amount of PD-L1 proteins (e.g. at the cell surface), such as immunotherapy of cancer or treatment of autoimmune diseases. Specifically, the present findings may be used as follows:

1) to develop screening assays to uncover new compounds capable of modulating immune activity, in particular PD-1/PD-L1 axis signaling and/or expression and/or amount of PD-L1 protein levels (e.g. at the cell surface), e.g. by selecting compounds capable of modulating the expression or amount of a member of the CMTM6 and/or CMTM4 proteins.

2) to develop methods of treating diseases or conditions involving aberrant immune activity, in particular aberrant PD-1/PD-L1 axis signaling and/or altered levels of PD-L1 expression and/or amount of PD-L1 proteins (e.g. at the cell surface), such as immunotherapy of cancer and autoimmune diseases, by treating a subject with compounds capable of modulating the expression or amount of CMTM6 and/or CMTM4 proteins. 3) to use CMTM6 and/or CMTM4 proteins, and modulators thereof, for the treatment of diseases or conditions involving aberrant PD-1/PD-L1 axis signaling or altered levels of PD- L1 expression or amount of PD-L1 proteins (e.g. at the cell surface), such as immunotherapy cancer or treatment of autoimmune diseases. These and other advantages of the invention will become obvious in the present disclosure.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Haploid genetic screen for PD-L1 in HAP1 cells. Mutagenized HAP1 cells were stained for PD-L1 , sorted by flow cytometry for high or low PD-L1 staining intensities, and gene-trap insertion sites were mapped to the human genome. For visualization, per gene the normalized coefficient of disruptive gene-trap integrations (mutational index, Ml) within the PD-L1 high and low populations is plotted on the y-axis against the combined number of total insertions on the x-axis. Genes for which insertions could only be mapped in either one of the two populations, were assigned 1 insertion in the other population to allow plotting. Genes were considered enriched in the PD-L1 high population or significantly enriched in the PD-L1 low population when P<=10E-6.

Figure 2. HAP1 cells were infected with two independent lentiviral short hairpin (sh)RNAs targeting CMT 6 to cause RNA interference, as indicated in example 2. pLKO.1 vector served as a control vector ('Ctrl'). After puromycin selection, cells were cultured in the absence ('un' or 'untreated') or in the presence of 5ng/ml INF gamma ('INFg') for 48 hours before being were harvested for flow cytometry and qRT-PCR analysis. The results show that down-regulation of CMTM6 expression by RNA interference reduces INF gamma-induced surface expression of PD-L1 in HAP1 cells.

Figure 3. A375 cells were infected with two independent lentiviral short hairpin (sh)RNAs targeting CMTM6 to cause RNA interference, as indicated in example 2. pLKO.1 vector served as a control vector ('Ctrl'). After puromycin selection, cells were cultured in the absence ('untreated') or in the presence of 25ng/ml INF gamma ('INFg') for 48 hours before being harvested for flow cytometry and qRT-PCR analysis. The results show that down- regulation of CMTM6 by RNA interference lowers or blocks INF gamma-induced surface expression of PD-L1 in A375 cells.

Figure 4. 8505C cells were infected with two independent lentiviral short hairpin (sh)RNAs targeting CMTM6 to cause RNA interference, as indicated in example 2. pLKO.1 vector served as a control vector ('Ctrl'). After puromycin selection, cells were cultured in the absence or presence of 50ng/ml INF gamma for 48 hours before being harvested for flow cytometry and qRT-PCR analysis. The results show that down-regulation of CMTM6 by RNA interference lowers or blocks PD-L1 expression.

Figure 5. RKO cells were infected with two independent lentiviral short hairpin (sh)RNAs targeting CMTM6 to cause RNA interference, as indicated in example 2. pLKO.1 vector served as a control vector ('Ctrl'). After puromycin selection, cells were cultured in the absence ('un' or 'untreated') or in the presence of 25 ng/ml INF gamma ('IFNg') for 48 hours before being harvested for flow cytometry and qRT-PCR analysis. The results show that down-regulation of CMTM6 by RNA interference lowers or blocks PD-L1 expression.

Figure 6. DLD1 cells were infected with two independent lentiviral short hairpin (sh)RNAs targeting CMTM6 to cause RNA interference, as indicated in example 2. pLKO.1 vector served as a control vector ('Ctrl'). After puromycin selection, cells were cultured in the absence ('un' or 'untreated') or in the presence of 25 ng/ml INF gamma ('IFNg') for 48 hours before being harvested for flow cytometry and qRT-PCR analysis. The results show that down-regulation of CMTM6 by RNA interference lowers INF gamma-induced surface expression of PD-L1 in DLD1 cells.

Figure 7. LOVO cells were infected with two independent lentiviral short hairpin (sh)RNAs targeting CMTM6 to cause RNA interference, as indicated in example 2. pLKO.1 vector served as a control vector ('Ctrl'). After puromycin selection, cells were cultured in the absence ('un' or 'untreated') or in the presence of 25 ng/ml INF gamma ('IFNg') for 48 hours before being harvested for flow cytometry and qRT-PCR analysis. The results show that down-regulation of CMTM6 by RNA interference lowers INF gamma-induced surface expression of PD-L1 in LOVO cells. Figure 8. H2030 cells were infected with two independent lentiviral short hairpin (sh)RNAs targeting CMTM6 to cause RNA interference, as indicated in example 2. pLKO.1 vector served as a control vector ('Ctrl'). After puromycin selection, cells were cultured in the absence ('un' or 'untreated') or in the presence of 25 ng/ml INF gamma ('IFNg') for 48 hours before being harvested for flow cytometry and qRT-PCR analysis. The results show that down-regulation of CMTM6 by RNA interference lowers INF gamma-induced surface expression of PD-L1 in H2030 cells.

Figure 9. Haploid genetic screen for PD-L1 in CMTM6 knock-out HAP1 cells. CMTM6- deficient HAP1 cells were mutagenized and stained for PD-L1 , as described for parental HAP1 cells in Figure 1. Insertions sites in cells sorted for high or low PD-L1 staining intensity were mapped accordingly and data are calculated, visualized and labeled following the same criteria as in Figure 1. The mutated CMTM6 locus no longer affects PD-L1 levels, however, CMTM4 emerges as a new positive regulator of cell surface PD-L1 in the absence of CMTM6. STUB1 scores as a negative regulator for PD-L1.

The next figures are with reference to the figures mentioned in Example 5:

Figure 6-1 : Identification of CMTM6 as a modulator of PD-L1 expression.

(a) Flow cytometry-based screen for modulators of PD-L1 cell surface expression in HAP1 cells. Dots represent individual genes, X axis indicates the number of disruptive insertions per gene, Y axis the frequency of independent insertions in the PD-L1^HI channel over the frequency of insertions in the PD-L1 ^LOW channel for each gene. The darker grey dots below the x-axis and above the x-axis indicate genes with significant enrichment of insertions (FDR- corrected P-value, FCPv<10^"6)- within the PD-L1 ^LOW and PD-L1 ^HI population, respectively. The bigger, dark grey dots indicate known components of the IFNyR signaling pathway plus IRF1 and CMTM6 (in bold). The lighter grey bigger dot represents PD-L1 (CD274*) when excluding integrations downstream of exon 5 (Refseq identifier NM_014143.3). (b) Relative PD-L1 cell surface expression in control or independent CMTM6 knockdown HAP1 cells, either with or without IFNy exposure, (c) Validation of CMTM6 knockdown by Western Blot. Data are representative of one (a) or at least three (b,c) independent experiments, and were analyzed by unpaired t-test (b). Error bars represent s.d. of triplicates (b). *P<0.05; **P<0.01 ; ***P<0.001. MFI, median fluorescence intensity; Ml, mutation index.

Figure 6-2: CMTM6 regulates PD-L1 expression in different tumor types and primary dendritic cells.

(a,b,f) Relative PD-L1 cell surface expression in control or independent CMTM6 knockdown A375 melanoma cells (a-b), 8505c thyroid cancer cells (f), either with or without IFNy exposure. (c,g) Western blot analysis of CMTM6 and PD-L1 expression in control or independent CMTM6 knockdown A375 melanoma cells (c) or 8505c thyroid cancer cells (g), either with or without IFNy exposure. Each cell line was tested in at least three independent experiments; representative results are shown, (d) Flow cytometric analysis, and (e) western blot analysis of PD-L1 expression in parental, CMTM6 deficient, CMTM6 overexpressing and CMTM6 reconstituted A375 melanoma cells, (h) Flow cytometric analysis of PD-L1 expression in control or independent CMTM6 knockdown primary BM progenitor-derived DCs, either with or without LPS exposure, (i) Knockdown efficiency of CMTM6 in primary BM progenitor-derived DCs. Data are representative of at least three (a-f) or two (h, i) independent experiments and were analyzed by unpaired t-test (b,f). Error bars represent s.d. of triplicates (b,d,f,i). *P<0.05; **P<0.01 ; ***P<0.001. MFI, median fluorescence intensity; BM, bone marrow; DC, dendritic cell.

Figure 6-3. Identification of C TM4 as a second PD-L1 regulator.

(a) Haploid genetic screen for modulators of PD-L1 cell surface expression in CMTM6- deficient HAP1 cells, (b) PD-L1 surface expression of parental, CMTM6 knockdown, CMTM4 knockdown, or double knockdown H2030 cells, either with or without IFNy exposure, (c) Flow cytometric analysis and (d) western blot analysis of PD-L1 expression in parental A375, CMTM6 KO A375, and CMTM6 KO A375 reconstituted with the indicated CMTM family member, either with or without IFNy exposure. Data are representative of one (a), two (b) or three (c,d) independent experiments and were analyzed by unpaired t-test (b). Error bars represent s.d. of triplicates (b). *P<0.05; **P<0.01 ; ***P<0.001. MFI, median fluorescence intensity; KO, knockout. Ml, mutation index.

Figure 6-4. CMTM6 forms a molecular partner of PD-L1 and regulates PD-L1 protein stability.

Time course of PD-L1 surface protein (a) or mRNA (b) levels in A375 cells upon IFNv exposure (c) SDS-PAGE analysis of anti-V5 immunoprecipitates from V5-PD-L1 overexpressing CMTM6 KO or CMTM6 overexpressing A375 cells at different time points after ³⁵S methionine/cysteine labeling, (d) Immunoblots of lysates or anti-PD-L1 immunoprecipitates from the indicated A375 melanoma cells, either with or without IFNv exposure. Arrows indicate CMTM6. (e) Immunoblots of lysates or anti-V5 immunoprecipitates from V5-PD-L1 overexpressing parental, CMTM6 KO or CMTM6 overexpressing A375 cells. PD-L1 surface protein (f) or lysate immunoblots (g) of parental, CMTM6 KO, STUB1 KO or double KO A375 cells, (h) Comparative membrane-fractionated mass spectrometry of 4 CMTM6 proficient and 4 CMTM6 deficient 8505c clones, (i) Overview of proteins consistently found up- or down-regulated upon CMTM6 removal in both 8505c and RKO. (j) IL-2 production by PD-1 ^HI, PD-1 ^INTER and PD-1 ^EG primary human T cells obtained by transduction with the MART-1 specific 1 D3 TCR and PD-1 , and co-cultured with unloaded or MART- 1 peptide-loaded parental or CMTM6 KO 8505C cells. Data are representative of two (a, b), one (c,h) or three (d,e,f,g,j) independent experiments and were analyzed by unpaired t-test (fj). Error bars represent s.d. of triplicates (a,b,f,j). *P<0.05; **P<0.01 ; ***P<0.001. MFI, median fluorescence intensity; KO, knockout; OE, overexpression.

Extended Data Figure Legends

Extended data Figure 6-1. PD-L1 is regulated by IFNy and by the UTR in HAP1

(a) Flow cytometric analysis of PD-L1 expression of untreated HAP1 cells and HAP1 cells treated with the indicated concentrations of IFNy. An IFNy concentration of 0.5 ng/ml was chosen for the subsequent genetic screen, to allow identification of gene integrations that either enhance or suppress PD-L1 expression. Data are representative of three independent experiments, (b) Schematic representation of the PD-L1 gene and of the gene trap insertions observed in HAP1 cells sorted on the basis of either low or high PD-L1 expression. Note the bias towards integrations within introns 5 and 6 in the PD-L1 gene in PD-L1 ^HI cells relative to PD-L1 ^LOW cells, consistent with the structural variants beyond exon 4 of PD-L1 that have been shown to result in enhanced PD-L1 expression in a subset of adult T-cell leukaemia, diffuse large B-cell lymphoma, and stomach cancers—, (c) Screen data as depicted in Fig. 6- 1 , but now with PD-L1 (CD274) data plotted when either including (CD274) or excluding (CD274*) integrations downstream of exon 5 (Refseq identifier NM_014143.3). Ml, mutation index.

Extended data Figure 6-2. RNA expression of CMTM6 in human cancers and correlation with PD-L1 mRNA levels.

Pearson correlation coefficients are shown along with associated unadjusted p-values. As randomly selected genes are on average also weakly positively correlated (not shown), empirical p-values, which represent one minus the quantile of the CMTM6 and CD274 expression correlation coefficient among a reference distribution composed of correlation coefficients between CMTM6 and randomly selected genes, are also depicted. Empirical p- values smaller than .5 denote a stronger correlation between CMTM6 and CD274 than the median observed correlation in the reference distribution. TPM, transcript per million. ACC: adrenocortical carcinoma, BLCA: urothelial bladder carcinoma, BRCA: breast cancer, CESC: cervical squamous cell carcinoma, CHOL: cholangiocarcinoma, COAD: colorectal adenocarcinoma, DLBC: diffuse large B-cell lymphoma, ESCA: esophageal cancer, GBM: glioblastoma multiforme, HNSC: head and neck squamous, KICH: chromophobe renal cell carcinoma, KIRC: clear cell kidney carcinoma, KIRP: papillary kidney carcinoma, LAML: acute myeloid leukemia, LGG: lower grade glioma, LIHC: liver hepatocellular carcinoma, LUAD: lung adenocarcinoma, LUSC: lung squamous cell carcinoma, OV: ovarian serous cystadenocarcinoma, PAAD: pancreatic ductal adenocarcinoma, PCPG: pheochromocytoma and paraganglioma, PRAD: prostate adenocarcinoma, READ: rectum adenocarcinoma, SKCM: cutaneous melanoma, STAD: stomach cancer, TGCT: testicular germ cell cancer, THCA: papillary thyroid carcinoma, UCEC: uterine corpus endometrial carcinoma, UCS: uterine carcinosarcoma, UVM: uveal melanoma

Extended data Figure 6-3. Regulation of PD-L1 by CMTM6 in different tumor types.

Flow cytometric analysis of PD-L1 expression of WM2664 melanoma (a), COL0679 melanoma (c), DLD1 colorectal cancer (e), H2122 non-small lung cancer (o) cells and three short term cultures of melanoma xenografts (q), in which cells transduced independently with two vectors expressing different CMTM6 shRNAs are compared with cells transduced with control vector. Western blot analysis of CMTM6 and PD-L1 expression in WM2664 melanoma (b), COL0679 melanoma (d), DLD1 colorectal cancer (f), H2122 non-small lung cancer (p) cells, in which cells transduced independently with two vectors expressing different CMTM6 shRNAs are compared with cells transduced with control vector. Western blot analysis of CMTM6 and PD-L1 expression in WM2664 melanoma (b), COL0679 melanoma (d), DLD1 colorectal cancer (f) and H2122 non-small lung cancer (p) cells in which cells transduced independently with two vectors expressing different CMTM6 shRNAs are compared with cells transduced with control vector. Flow cytometric analysis of PD-L1 expression as detected upon staining with anti-PD-L1 antibody or with PD-1-Fc in 8505c thyroid cancer (g,h), RKO colorectal cancer (i j) and H2030 non-small lung cancer (l,m) cells and western blot analysis of CMTM6 and PD-L1 expression in RKO colorectal cancer (k) and H2030 non-small cell lung cancer in which cells transduced independently with two vectors expressing different CMTM6 shRNAs are compared with cells transduced with control vector. In all cases, cells treated with IFNy (25 ng/ml) or left untreated were compared. Panel g) is identical to the one depicted in Fig. 6- 2, shown again here to facilitate comparison. Data are representative of three (c-n), two (a,b,o,p) or one (q) independent experiments and were analyzed by unpaired t-test (a,c,e,g-m,o,q). Error bars represent s.d. of triplicates (a,c,e,g-m,o,q). *P<0.05; **P<0.01 ; *^**P<0.001. MFI, median fluorescence intensity; PDX, patient derived xenograft; NSCLC, non-small cell lung cancer; CRC, colorectal cancer.

Extended data Figure 6-4. CMT 4 and CMT 6, but not other CMTM family members, are regulators of PD-L1.

(a) Validation of CMTM6 and CMTM4 downregulation by Western blot analysis of cells shown in Fig. 6- 3b. (b,c) Ectopic expression of CMTM4 restores IFNy-induced PD-L1 expression in CMTM6-deficient cells. Two clones of CMTM6-deficient A375 cells ('CMTM6 KO#6' and 'CMTM6 KO#12') were transduced with retroviral vectors encoding CMTM4 ( ΜΤΜ4 OE') or CMTM6 ('CMTM6 OE') individually. After blasticidin selection, cells were cultured in the absence ('untreated') or presence of 25ng/ml IFNy for 72 hours before analysis by flow cytometry (b), and Western blot analysis (c). Note that introduction of CMTM4 in CMTM6 expressing cells can also lead to a small but significant increase in PD-L1 cell surface levels (panel b). Untransduced A375 parental cells served as controls. (d,e) Western blot analysis of expression of the indicated CMTM family members, as determined by staining with an anti- FLAG antibody. Two exposures of the same gel are shown. Expression of CMTM2 and 8 is not detected, and CMTM5 expression is low as compared to that of other CMTM family members, (f) Phylogenetic analysis of the CMTM family by CLUSTALW. CMTM6 and 4 form the two most closely related members. In view of the lack of detectable expression/ low expression observed for CMTM2, 8 and 5, an effect of these CMTM members on PD-L1 protein fate cannot be excluded. However, the observation that CMTM family members 7 and 3 that are more closely related to CMTM4 and 6 do not influence PD-L1 expression makes this unlikely, (g) Results of the flow cytometry based screen as shown in Fig. 6- 1a, with the position of all CMTM family members indicated. Data are representative of two independent experiments (a-e). Error bars represent s.d. of triplicates (b). *P<0.05; **P<0.01 ; ***P<0.001. MFI, median fluorescence intensity; KO, knockout; OE, overexpression. Ml, mutation index. Extended data Figure 6-5. CMTM6 downregulation does not affect MHC class I and PD- L2 cell surface levels or PD-L1 mRNA levels and regulates PD-L1 stability after egress from the endoplasmic reticulum.

Flow cytometric analysis of MHC class I and PD-L2 expression in the panel of cell lines tested in Fig. 6- 2 and Extended Data Fig. 6- 3 (a), and in BM progenitor-derived DCs (b,c) in which cells transduced with control vector are compared with cells transduced independently with two vectors expressing different shRNA directed against CMTM6. For cell lines, cells treated with IFNy (as indicated in the other figure legends) or left untreated were compared, for BM progenitor-derived DCs, cells treated with 500 ng/ml LPS or left untreated were compared, (d) qPCR analyses were performed to quantify relative mRNA levels of PD-L1 in the abovementioned tumor lines, (e) Quantification of the experiment shown in Fig. 6- 4c (f) Immunoprecipitates of the same samples as used in Fig. 6- 4c were either mock treated, treated with EndoH, or treated with PNGaseF to examine the kinetics of protein maturation. No relevant difference in maturation kinetics were observed between cells overexpressing CMTM6 and CMTM6-deficient cells. Pulse chase experiments were performed three times, once comparing CMTM6 overexpressing and CMTM6-deficient cells (a), and twice comparing wt and CMTM6-deficient cells. Other data are representative of at least two independent experiments. MFI, median fluorescence intensity; BM, bone marrow; DC, dendritic cell; KO, knockout; OE, overexpression; EndoH, endoglycosidase H; PNGaseF, peptide-N- glycosidase F.

Extended data Figure 6-6. Specificity and membrane localization of C TM6, and co- localization with PD-L1 in human tumors.

(a) Membrane-fractionated proteome of 8505C and RKO cells. CMTM6 and PD-L1 were detected by LC-MS/MS predominantly from the plasma membrane fractions. Label-free quantification (LFQ) performed by intensity-based normalization of 4 fractions together across different cell lines is depicted, (b) A375 parental cells, CMTM6 KO or CMTM6 overexpressing cells were fixed and formalin embedded, and stained for CMTM6 with a monoclonal antibody (1 D6) generated against a peptide from the C-terminal domain of CMTM6. Analysis shows mainly membranous stain, as indicated by the arrowheads, (c) Sequential slides from lymph node and subcutaneous metastases from 3 melanoma patients were stained for PD-L1 (left) or for CMTM6 (right), showing frequent localization of PD-L1 within CMTM6 positive areas. In total, samples from 9 melanoma patients and 5 PD-L1 positive lung cancer samples were analyzed. OE, overexpression; KO, knockout.

Extended data Figure 6-7. Interactions between CMTM6, PD-L1 , and CMTM4, and effect of CMTM6 on PD-L1 stability. (a) A375 parental cells, CMTM6-deficient cells, PD-L1 -deficient cells, and cells ectopically expressing CMTM6 or PD-L1 , were cultured in the absence or presence of 25ng/ml I FNY for 48 hours before preparation of cell lysates. Immunoprecipitation was performed using a CMTM6-specific antibody immobilized on protein A coated beads. Immunoprecipitates and whole cell lysate were subjected to SDS-PAGE and immunoblotted for CMTM6 and PD-L1. Two exposures of the same western blot are shown. Arrows indicate PD-L1 bands, (b) parental 8505C cells and CMT 6-deficient 8505C cells were cultured in the absence or presence of 50ng/ml IFNy for 72 hours before preparation of cell lysates. Immunoprecipitation was performed using CMTM6- or PD-L1 -specific antibodies immobilized on protein A coated beads. Immunoprecipitates and whole cell lysates were subjected to SDS-PAGE and immunoblotted for CMTM6 and PD-L1. Two exposures of the same western blot are shown. Normal IgG served as control. Arrows indicate PD-L1 bands, (c, d) Parental and CMTM6 knockout RKO cells (c) and (d) 8505c cells were lysed and immunoprecipitation was performed using antibodies immobilized on protein G coated beads as indicated. Immunoprecipitates and whole cell lysates were subjected to SDS-PAGE, and Western blot analysis of CMT 4 and PD-L1 was carried out. Two exposures of the same Western blots are shown. Arrows indicate CMTM4. Data are representative of three independent experiments. KO, knockout; OE, overexpression. Extended data Figure 6-8. Aspects of PD-L1 regulation by CMTM6.

(a) V5-tagged PD-L1 was introduced into parental, CMTM6-overexpressing and CMTM6- deficient A375 cells. Cell lysates were denatured and then subjected to immunoprecipitation with anti-V5 antibody immobilized on protein G-coated beads. Immunoprecipitates were then analyzed by immunoblotting with anti-V5 antibody as a control for the experiments shown in Fig. 6- 4e. Results of the FACS-based genetic screens in CMTM6 expressing and CMTM6 deficient HAP1 cells as shown in Fig. 6- 1a (b) and in Fig. 6- 3a (c). (d) Relative expression of PD-L1 , PD-L2 and the indicated PD-L1 - PD-L2 chimeric proteins in CMTM6 KD A375 cells as compared to matched control. Chimeras were detected with an anti PD-L1 or an anti PD- L2 antibody, (e) Schematic overview of the chimeric proteins analyzed. (f,g) 293T human embryonic kidney cells were co-transfected with a vector encoding either PD-L1 , PD-L2 or the indicated chimeric protein, together with a vector encoding CMTM6. Cell lysates were denatured and subjected to immunoprecipitation with anti-flag antibody immobilized on protein G-coated beads. Lysates and immunoprecipitates were then analyzed by immunoblotting with the indicated antibodies. Data are representative of three (a,d), one (f) or two (g) independent experiments. Error bars represent s.d. of triplicates. MFI , median fluorescence intensity; KO, knockout; OE, overexpression; TM, transmembrane; IC, intracellular; EC, extracellular. Extended data Figure 6-9. Orientation mapping of CMTM6.

(a) Predicted domain topology of C TM6 according to TMHMM Server v. 2.0 (http:/ www.cbs.dtu.dk/services/TM HMM/). (b,c) A375 cells were transduced with C- or N- terminal HA epitope tagged CMTM6. HA staining was performed in both live cells and fixed and permeabilized cells followed by flow cytometry analysis and quantified in (c). MFI, median fluorescence intensity.

Extended data Figure 6-10. Selectivity of CMTM6 and CMT 6 loss alleviates PD-L1 - mediated T cell suppression.

(a) Comparative membrane-fractionated mass spectrometry of CMTM6 proficient or deficient RKO cells. 4 wild type and 4 CMTM6 KO RKO clones were analyzed by LC-MS/MS and differential protein abundance is shown in a volcano plot, (b) Table indicating proteins found up- or down-regulated upon CMTM6 removal in both 8505c and RKO. Flow cytometric (c) and Western blot (d) analysis of CMTM6 and PD-L1 expression in parental A375 or CMTM6 deficient A375 clones in which PD-L1 is ectopically expressed by lentiviral transduction, (e). Primary human T cells were transduced with the MART-1 specific 1 D3 TCR— and PD-1. Transduced T cells were co-cultured with unloaded or MART-1 peptide loaded PD-L1- overexpressing A375 cells ('Parental + PD-L1 OE'), parental A375 cells ('Parental'), or CMTM6-deficient A375 cells that overexpressed PD-L1 ('CMTM6 KO+PD-L1 OE'). IL-2 production in T cells that expressed high, intermediate, or low levels of PD-1 ('PD-1 ^HI', 'PD- ₁ INTER. _{Qr ipD 1} Low^ _{were ana}|_yzecj _by f|_0W cytometry. Untransduced A375 cells ('Parental') served as controls. Data are representative of three independent experiments and were analyzed by unpaired t-test (c). Error bars represent s.d. of triplicates. *P<0.05; **P<0.01 ; ***P<0.001. KO, knockout; OE, overexpression; TM, transmembrane; PM, plasma membrane.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

Various terms relating to the methods, compositions, uses and other aspects of the present invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art to which the invention pertains, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. The "Programmed Death-1 (PD-1)" receptor as used herein refers to an immune-inhibitory receptor belonging to the CD28 family. PD-1 is expressed predominantly on previously activated T cells in vivo, and binds to two ligands, PD-L1 and PD-L2. The term "PD-1" as used herein includes human PD-1 (hPD-1), variants, isoforms, and species homologs of hPD- 1 , and analogs having at least one common epitope with hPD-1. The complete hPD-1 sequence can be found under GENBANK Accession No. U64863. PD-1 is expressed on immune cells such as activated T cells (including effector T cells), B cells, myeloid cells, thymocytes, and natural killer (NK) cells (Suya Dai et al (2014) Cellular Immunology, Vol:290, pages 72-79; Gianchecchi et al (2013), Autoimmun. Rev. 12 (2013) 1091-1 100).

"Programmed Death Ligand-1 (PD-L1)" as used herein refers to one of two cell surface glycoprotein ligands for PD-1 (the other being PD-L2) that down-regulates immune cell activation and cytokine secretion upon binding to PD-1. The term "PD-L1" as used herein includes human PD-L1 (hPD-L1), variants, isoforms, and species homologs of hPD-L1 , and analogs having at least one common epitope with hPD-L1. The complete hPD-L1 sequence can be found under GENBANK Accession No. Q9NZQ7. PD-L1 is expressed on a variety of cells including cells of hematopoietic lineage such as activated T cells, B cells, monocytes, dendritic cells (DCs), mast cells, and macrophages. PD-L1 is also expressed on peripheral non-hematopoietic tissue such as heart cells, skeletal muscle cells, pancreatic islet cells, placenta cells, lung cells, hepatocytes, epithelium cells, kidney cells, mesenchymal stem cells, liver cells, and others (Suya Dai et al (2014) Cellular Immunology, Vol:290, pages 72- 79).

In more detail, PD-L1 is expressed on T and B cells, myeloid cells (e.g. dendritic cells, macrophages, neutrophils), mesenchymal stem cells, and bone marrow-derived mast cells. PD-L1 is also expressed on a wide range of non-hematopoietic cells (e.g., cornea, lung, vascular epithelium, liver non-parenchymal cells, mesenchymal stem cells, pancreatic islets, placental synctiotrophoblasts, keratinocytes, brown adipose tissue, etc.), and is upregulated on a number of cell types after activation. Both type I and type II interferons (IFNs) and hypoxia upregulate PD-L1. PD-L1 is expressed in many cancers. Any cell that expresses or can express PD-L1 , including those wherein PD-L1 is activated or introduced using a vector, is consider a suitable cell within the context of the current invention.

The term "PD-1/PD-L1 axis" as used herein consists of the PD-1 receptor and its ligand PD- L1. The term "PD-1/PD-L1 axis signaling" is a way of communication between cells (cell signaling), for instance between a first cell expressing PD-1 and a second cell expressing PD- L1 , and which involves the release of a biochemical signal (e.g. release of proteins, lipids, ions, neurotransmitters, enzymes, gases, etc.), which in turn causes an effect (e.g. inhibition, activation, blockade, etc.) on one or both cells. The term "cell signaling" in general refers to the biochemical relationship between a variety of signal transduction molecules that play a role in the transmission of a signal from one portion of a cell to another portion of the cell. A "cell surface receptor" includes, for example, molecules and complexes of molecules that are located on the surface of a cell and are capable of receiving a signal and transmitting such a signal across the plasma membrane of a cell. An example of a cell surface receptor of the present invention is the PD-1 receptor, which is, for example, located on the surface of activated B cells, activated T cells and myeloid cells. In the context of the present invention, an example of "PD-1/PD-L1 axis signaling" is when PD-L1 expressed at the cell surface of a first cell (e.g. cancer cells or a cancer-infiltrating immune cells) binds to its receptor PD-1 expressed at the cell surface of a second cell (e.g. a T cell, such as an effector T cell). The binding of PD-L1 to its receptor PD-1 transmits an inhibitory signal to the T-cell which results in a decrease in T cell proliferation (e.g. effector T cells) as well as T cell activity (e.g. secretion of cytokines and chemokines as discussed herein; Wei F et al (2013) PNAS; Vol: 110, E2480-2489). Thus, one possible end result of PD-1/PD-L1 axis signaling is the dampening or inhibition of immune activity or function mediated by T cells (e.g. effector T cells). Such situation may be detrimental in the context of cancer (e.g. lung cancer, bladder cancer, Gl tract cancer, melanoma, etc.), as discussed herein. Another example of "PD-1/PD- L1 axis signaling" is when PD-L1 expressed at the cell surface of a first cell (e.g. pancreatic cells) binds to its receptor PD-1 expressed at the cell surface of a second cell (e.g. a T cell, such as an effector T cell). The binding of PD-L1 to its receptor PD-1 transmits an inhibitory signal to the T-cell which ultimately causes a reduction or inhibition of T-mediated secretion of cytokines (e.g. Interferon gamma, TNF alpha, and others) and chemokines (e.g. CXCL9, CXCL10) as well as reduced T cell (e.g. effector T cell) proliferation (Wei F et al (2013) PNAS; Vol: 10, E2480-2489). Thus, one possible end result of PD-1/PD-L1 axis signaling is the dampening or inhibition of immune activity or function mediated by T cells (E.g. effector T cells). Such situation may be advantageous in the context of autoimmune diseases (e.g. diabetes type 1 , rheumatoid arthritis, systemic lupus erythematosus, etc.), where dampening of an overly active immune system (e.g. T-cell mediated effects) is desired, as discussed herein. Other examples of end results of PD-1/PD-L1 axis signaling are described in the scenarios above.

The term "cancer-infiltrating (immune) cells" as used herein refers to white blood cells that have left the bloodstream and migrated into a tumor or cancer. They are mononuclear immune cells, which may be a mixture of different types of cells, for instance T cells, B cells, NK cells, macrophages, and others in variable proportions, T cells often being abundant cancer-infiltrating immune cells. Thus, it is understood that cancer-infiltrating immune cells, such as T-cells (e.g. effector T-cells) may express PD-L1 and/or PD-1 , as explained herein. It was shown that cancer-infiltrating immune cells are implicated in killing tumor cells, and that the presence of such cancer-infiltrating immune cells (e.g. cytotoxic T cells) in tumors is often associated with better clinical outcomes.

The term "STUB1 homology and U-Box containing protein 1" (abbreviated as "STUB1") as used herein refers to a human gene and protein also known as "C terminus of HSC70- Interacting Protein" (also known as CHIP; UBOX1 ; SCAR16; HSPABP2; NY-CO-7; SDCCAG7).

The term "CKLF-like MARVEL transmembrane domain containing 6" (abbreviated as "CMTM6") as used herein refers to protein encoded by a gene belonging to the chemokine- like factor gene superfamily, a protein family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. This gene is widely expressed in many tissues, but the exact function of the encoded protein is unknown (HGNC:HGNC: 19177; Ensembl: ENSG00000091317); (Jia Lu et al (2016), Asian Pacific Journal of Cancer Prevention, Vol 17, pages 2741-2744).

The term "CKLF-like MARVEL transmembrane domain containing 4" (abbreviated as "CMTM4", ENSG00000183723 in human) as used herein refers to protein encoded by a gene belonging to the chemokine-like factor gene superfamily, a protein family that is similar to the chemokine and the transmembrane 4 superfamilies of signaling molecules. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16.

The term "CKLF-like MARVEL transmembrane domain containing family" (abbreviated as "CMTM family") as used herein refers to a group of CMTM proteins including CMTM1 , CMTM2, CMTM3, CMTM4, CMTM5, CMTM6, CMTM7, and CMTM8. The CMTM family is a novel family of genes/proteins first reported at international level by Peking University Human Disease Gene Research Center (Jia Lu et al (2016), Asian Pacific Journal of Cancer Prevention, Vol 17, pages 2741-2744).

The term "immune activity" as used herein refers to the action or interaction, including the end results, of one or more cell of the immune system (for example, T lymphocytes (e.g. effector T cells), B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, neutrophils, and others) and soluble macromolecules produced by any of these cells or the liver (including antibodies, cytokines (e.g. IFN gamma, TNF alpha), chemokines (e.g. CXCL9, CXCL10), and complement) that results in selective targeting, binding to, damage to, destruction of, and/or elimination from a vertebrate's body of invading pathogens, cells or tissues infected with pathogens, cancerous or other abnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues. The term "immune activity" encompasses the activity or function of T cells, such as effector T cells as described herein, that is expressed towards a target cell (e.g. cancer cells or pancreatic cells) under both basal condition (non-immune challenge) and immune challenge or stimulation condition. In an embodiment, immune activity or immune response includes T cell mediated and/or B cell mediated immune responses that are influenced by modulation of T cell co-stimulation/ co-inhibition. Exemplary immune responses include T cell responses, e.g., cytokine production, and cellular cytotoxicity. In addition, the term immune response includes immune responses that are indirectly affected by T cell activation, e.g., antibody production (humoral responses) and activation of cytokine responsive cells, e.g. macrophages.

The term "effector T cell" as used herein refers to a naive T cell that has encountered antigen in the form of a peptide: MHC complex on the surface of an activated antigen-presenting cell (APC), and as a result, is induced to proliferate and differentiate into "effector T cells". Effector T cells fall into two functional classes that detect different types of peptide:MHC complexes (including tumor antigens). For instance, peptides from intracellular pathogens that multiply in the cytoplasm are carried to the cell surface by MHC class I molecules and presented to CD8 T cells. These differentiate into cytotoxic T cells that kill infected target cells. Peptide antigens from pathogens multiplying in intracellular vesicles, and those derived from ingested extracellular bacteria and toxins, are carried to the cell surface by MHC class II molecules and presented to CD4 T cells. CD4 T cells can differentiate into multiple types of effector T cells, including TH1 , TH2, and TH17. Pathogens that accumulate in large numbers inside macrophage and dendritic cell vesicles tend to stimulate the differentiation of TH1 cells, whereas extracellular antigens tend to stimulate the production of TH2 cells. TH1 cells activate the microbicidal properties of macrophages, and induce B cells to make IgG antibodies that are very effective at opsonizing extracellular pathogens for uptake by phagocytic cells. TH2 cells initiate the humoral immune response by activating naive antigen- specific B cells to produce IgM antibodies. These TH2 cells can subsequently stimulate the production of different isotypes, including IgA and IgE, as well as neutralizing and/or weakly opsonizing subtypes of IgG. (Immunobiology, 5th edition, The Immune System in Health and Disease (2001 ) by Charles A Janeway, Jr, Paul Travers, Mark Walport, and Mark J Shlomchik, New York: Garland Science; ISBN-10: 0-8153-3642-X)./nlp2 The term "effector T cell activity" as used herein refers to immune activity mediated by effector T cells upon signaling through the T cell receptor (TCR) expressed on T cells. In the context of the present invention, "effector T cell activity" encompasses the activity described above, for instance ability to induce apoptosis in a target cell by secreting perforin-granzymes as well as ability to kill or destroy pathogens or infected cells or aberrant cells (e.g. cancer cells displaying tumor antigens) by secreting substances such as cytokines (e.g. IFN gamma, TNF alpha) and chemokines (e.g. CXCL9, CXCL10).

The term "compound capable of modulating (e.g. increasing or decreasing) immune activity (e.g. effector T cell activity) as used herein refers to a compound, substance (a test substance in the screening method as taught herein), or agent that regulates an immune activity. Such compound may also be referred to as "modulator". "Regulating," "modifying" or "modulating" an immune activity refers to any alteration in a cell of the immune system (e.g. T cells such as effector T cells, cancer infiltrating immune cells or other immune cells) or in the activity of such cell, for example as the consequence of such alteration. Such regulation includes stimulation or suppression or reduction of the immune activity which may be manifested by an increase or decrease in the number of various cell types, an increase or decrease in the activity of these cells (e.g. secretion of cytokines, chemokines, perforin- granzymes as discussed above), or increase or decrease in signaling pathway (e.g. PD-1/PD- L1 axis) between these cells, or any other changes which can occur within the immune system.

The term "cancer" as used herein refers a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues and may also metastasize to distant parts of the body through the lymphatic system or bloodstream. Non- limiting examples of cancers, and that may treated within the context of the current invention, include bladder cancer, gastrointestinal (Gl) tract cancers, lung cancer, melanoma, Hodgkin's lymphoma, skin cancer (melanoma), head and neck squamous cell carcinomas (HNSCC), adrenocortical tumors, adrenal cancer, anal cancer, bile duct cancer, bladder cancer, bone cancer, brain cancer, breast cancer, central nervous system cancer, cervical cancer, chest cancer, colon cancer, colorectal cancer, endometrial cancer, epidermoid carcinoma, esophageal cancer, eye cancer, glioblastoma, glioma, gallbladder cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumor, gestational trophoblastic disease, head and neck, Hodgkin disease, Kaposi sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, leukemia, liver cancer (such as hepatocellular carcinoma), lung cancer (including non-small cell, small cell, and lung carcinoid tumors), lymph node cancer, lymphoma, lymphoma of the skin, melanoma, mesothelioma, mouth cancer, multiple myeloma, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, oral cavity and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary cancer, prostate cancer, pediatric malignancies, rectal cancer, retinoblastoma, rhabdomyosarcoma, salivary gland, sarcoma, skin cancer, small intestine cancer, stomach cancer, testicular cancer, thymus cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, Merkel cell cancer, microsatellite unstable cancers and/or vulvar cancers. The term "autoimmune diseases" as used herein refers to a pathological state arising from an abnormal immune response of the body to substances and tissues that are normally present in the body (i.e. "self"). Autoimmunity, on the other hand, is the presence of a self-reactive immune response (e.g., auto-antibodies, self-reactive T-cells), with or without damage or pathology resulting from it. This may be restricted to certain organs (e.g. in autoimmune thyroiditis) or involve a particular tissue in different places (e.g. Goodpasture's disease which may affect the basement membrane in both the lung and the kidney). The treatment of autoimmune diseases is typically with immunosuppression— medication that decreases the immune response. Novel treatments include cytokine blockade (or the blockade of cytokine signaling pathways), removal of effector T-cells and B-cells (e.g. anti-CD20 therapy can be effective at removing instigating B-cells). Intravenous Immunoglobulin has been helpful in treating some antibody mediated autoimmune diseases as well, possibly through negative feedback mechanisms. At least 80 types of autoimmune diseases are recognized. Non- limiting examples of autoimmune diseases include type 1 diabetes, rheumatoid arthritis, lupus (e.g. systemic lupus erythematosus), and others. Examples of other autoimmune diseases which may be treated with in the context of the current invention include but are not limited to multiple sclerosis (MS), Crohn's disease, scleroderma, Sjogren's syndrome, pemphigus vulgaris, pemphigoid, addison's disease, ankylosing spondylitis, aplastic anemia, autoimmune hemolytic anemia, autoimmune hepatitis, coeliac disease, dermatomyositis, Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, idiopathic leucopenia, idiopathic thrombocytopenic purpura, male infertility, mixed connective tissue disease, myasthenia gravis, pernicious anemia, phacogenic uveitis, primary biliary cirrhosis, primary myxoedema, Reiter's syndrome, stiff man syndrome, thyrotoxicosis, ulceritive colitis, and Wegener's granulomatosis. The term infectious (viral and non-viral) diseases or infection as used herein refers to a disease or condition attributable to the presence in a host of a foreign organism or agent that reproduces within the host. Infections typically involve breach of a normal mucosal or other tissue barrier by an infectious organism or agent. A subject that has an infection is a subject having objectively measurable infectious organisms or agents present in the subject's body. Infections are broadly classified as bacterial, viral, fungal, or parasitic based on the category of infectious organism or agent involved. Other less common types of infection are also known in the art, including, e.g. , infections involving rickettsiae, mycoplasmas, and agents causing scrapie, bovine spongiform encephalopthy (BSE), and prion diseases (e.g. , kuru and Creutzfeldt-Jacob disease). Examples of bacteria, viruses, fungi, and parasites which cause infection are well known in the art. Exemplary viruses include, but are not limited to: Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-I II), HIV-2, LAV or HTLV- MI/LAV, or HIV-III, and other isolates, such as HIV-LP; Picornaviridae (e.g. , polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g. , strains that cause gastroenteritis); Togaviridae (e.g. , equine encephalitis viruses, rubella viruses); Flaviviridae (e.g., dengue viruses, encephalitis viruses, yellow fever viruses); Coronaviridae (e.g. , coronaviruses); Rhabdoviridae (e.g., vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g. , ebola viruses); Paramyxoviridae (e.g. , parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); adenovirus; Orthomyxoviridae (e.g. , influenza viruses); Bungaviridae (e.g. , Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g. , reoviruses, orbiviurses and rotaviruses, i.e., Rotavirus A, Rotavirus B. Rotavirus C); Birnaviridae; Hepadnaviridae (Hepatitis A and B viruses); Parvoviridae (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, Human herpes virus 6, Human herpes virus 7, Human herpes virus 8, varicella zoster virus, cytomegalovirus (CMV), herpes virus; Epstein-Barr virus; Rous sarcoma virus; West Nile virus; Japanese equine encephalitis, Norwalk, papilloma virus, parvovirus B 19; Poxyiridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g. , African swine fever virus); Hepatitis D virus, Hepatitis E virus, and unclassified viruses (e.g. , the etiological agents of Spongiform encephalopathies, the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class l=enterally transmitted; class 2=parenterally transmitted (i.e. , Hepatitis C); Norwalk and related viruses, and astro viruses). Bacteria include both Gram negative and Gram positive bacteria. Examples of Gram positive bacteria include, but are not limited to Pasteurella species, Staphylococci species, and Streptococcus species. Examples of Gram negative bacteria include, but are not limited to Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include but are not limited to: Helicobacter pyloris, Borrelia burgdorferi, Legionella pneumophilia, Mycobacteria spp. (e.g. , M. tuberculosis, M. avium, M. intracellular e, M. kansasii, M. gordonae, M. leprae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic spp.), Streptococcus pneumoniae, pathogenic Campylobacter spp.,Enterococcus spp., Haemophilus influenzae {Hemophilus influenza B, and Hemophilus influenza non- typable), Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium spp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidum, Treponema pertenue, Leptospira, Rickettsia, Actinomyces israelii, meningococcus, pertussis, pneumococcus, shigella, tetanus, Vibrio cholerae, yersinia, Pseudomonas species, Clostridia species, Salmonella typhi, Shigella dysenteriae, Yersinia pestis, Brucella species, Legionella pneumophila, Rickettsiae, Chlamydia, Clostridium perfringens, Clostridium botulinum, Staphylococcus aureus, Pseudomonas aeruginosa, Cryptosporidium parvum, Streptococcus pneumoniae, and Bordetella pertussis. Exemplary fungi and yeast include, but are not limited to, Cryptococcus neoformans, Candida albicans, Candida tropicalis, Candida stellatoidea, Candida glabrata, Candida krusei, Candida parapsilosis, Candida guilliermondii, Candida viswanathii, Candida lusitaniae, Rhodotorula mucilaginosa, Aspergillus fumigatus, Aspergillus flavus, Blastomyces dermatitidis, Aspergillus clavatus, Cryptococcus neoformans, Chlamydia trachomatis, Coccidioides immitis, Cryptococcus laurentii, Cryptococcus albidus, Cryptococcus gattii, Nocardia spp, Histoplasma capsulatum, Pneumocystis jirovecii (or Pneumocystis carinii), Stachybotrys chartarum, and any combination thereof. Exemplary parasites include, but are not limited to: Entamoeba histolytica; Plasmodium species (Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, Plasmodium vivax), Leishmania species (Leishmania tropica, Leishmania braziliensis, Leishmania donovani), Infectious (viral and non-viral) diseases that can be subject to the current invention, e.g treated for within the context of the current invention include such a caused by the foreign organisms as listed above. Preferably the infectious disease is a viral, bacterial, fungal, or parasitic disease, preferably a chronic infectious disease. Throughout the description, the terms "disease" and "conditions" may be used interchangeably.

The term "subject" as used herein refers to any human or non-human animal. The term "non- human animal" includes, but is not limited to, vertebrates such as nonhuman primates, sheep, dogs, cats, rabbits, ferrets, rodents such as mice, rats and guinea pigs, avian species such as chickens, amphibians, and reptiles. In preferred embodiments, the subject is a mammal such as a non-human primate, sheep, dog, cat, rabbit, ferret or rodent. In more preferred embodiments, the subject is a human. The terms, "subject," "patient" and "individual" are used interchangeably herein. The term "HAP1 cells" as used herein refers to a cell line commonly used for biomedical and genetic research. This cell line has a haploid karyotype except for chromosomes 8 and 15. HAP1 cells are derived from a line of cancerous cells (i.e. KBM-7), which means they are able to divide indefinitely. Due to their haploidy, HAP1 cells are useful in biomedical research and genetic experiments. When working in diploid cells, it is difficult to screen for mutations phenotypically, especially when considering recessive mutations. Because there are two copies of each gene, the effect of the mutation is often covered up by the non-mutated gene. In haploid cells, there is only one copy of most genes, so mutated phenotypes are immediately exposed. The HAP1 cell line is often used in in vitro studies as a model of leukemia (e.g. chronic myeloid leukemia). (Blomen VA et al., Science. 2015 Nov 27;350(6264): 1092-6. doi: 10.1 126/science.aac7557).

The term "A375 cells" as used herein refers to a human amelanotic melanoma cell line used in cytokine research, as it is not influenced by many biomolecules— e.g., prostaglandin E2; lectins; bacterial endotoxins and cytokines such as IL2, TNF; interferons or colony stimulating factors. A375 cells are extremely sensitive to growth-inhibitory effects of oncostatin M. A375 cell line is often used in in vitro studies as a model of melanoma cancer. (Prahallad A et al., Nature. 2012 Jan 26;483(7387): 100-3. doi: 10.1038/natu re 10868).

The term "8505C cells" as used herein refers to a human thyroid carcinoma cell line used in vitro studies as a model of thyroid cancer. (Prahallad A et al., Nature. 2012 Jan 26;483(7387): 100-3. doi: 10.1038/natu re 10868).

The term "RKO cells" as used herein refers to a colon carcinoma cell line developed by Michael Brattain. RKO cells contain wild-type p53 but lack endogenous human thyroid receptor nuclear receptor (h-TRbeta1). The RKO cell line is often used in in vitro studies as a model of colon cancer. (Corvaisier et al., Oncotarget. 2016 Aug 4. doi: 10.18632/oncotarget.11057.).

The term "DLD1 cells" as used herein refers to a colorectal carcinoma cell line, which is often used in in vitro studies as a model of colorectal cancer. (Ahmed MA et al., Oncotarget. 2016 Sep 17. doi: 10.18632/oncotarget.12099). The term "LOVO cells" as used herein refers to a colon cancer cell line, which is often used in in vitro studies as a model of colon cancer. (Sun C et al., Cell Rep. 2014 Apr 10;7(1):86-93. doi: 10.1016/j.celrep.2014.02.045). The term "H2030 cells" as used herein refers to a lung cancer cell line, which is often used in in vitro studies as a model of lung cancer. (Sun C et al., Cell Rep. 2014 Apr 10;7(1):86-93. doi: 10.1016/j.celrep.2014.02.045).

The term "Colo 679 cells" as used herein refers to a melanoma cell line, which is often used in in vitro studies as a model of colon colorectal cancer. (Sun et al. Nature., 2014 Apr 3;508(7494):118-22. doi: 10.1038/nature13121.).

The skilled person is well acquainted with HAP1 cells, A375 cells, 8505C cells, RKO cells, DLD1 cells, LOVO cells, H2030 cells and colo 679 cells and variant thereof, and knows how to use and how to obtain or purchase such cells.

The singular forms "a," "an" and "the", as used herein, include plural referents unless the context clearly dictates otherwise. For example, a method for administrating a drug includes the administrating of a plurality of molecules (e.g. 10's, 100's, 1000's, 10's of thousands, 100's of thousands, millions, or more molecules).

The term "and/or" as used herein indicates that one or more of the stated cases may occur, alone or in combination with at least one of the stated cases, up to with all of the stated cases.

The use of the alternative (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives.

The term "to comprise" and its conjugations as used herein is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. It also encompasses the more limiting "to consist of."

The term "treatment" or "treating" as used herein comprises a treatment relieving, reducing or alleviating at least one symptom in a subject or effecting a delay of progression of a disease (e.g. cancer or autoimmune disease). Within the meaning of the present invention, the term "treat" also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease (e.g. cancer or autoimmune diseases).

The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells. The term is intended to include radioactive isotopes, chemotherapeutic agents e.g., methotrexate, adriamicin, vinca alkaloids (vincristine, vinblastine, etoposide), doxorubicin, melphalan, mitomycin C, chlorambucil, daunorubicin or other intercalating agents, enzymes and fragments thereof such as nucleolytic enzymes, antibiotics, and toxins such as small molecule toxins or enzymatically active toxins of bacterial, fungal, plant or animal origin.

A "chemotherapeutic agent" refers to a chemical compound useful in the treatment of cancer. Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide (CYTOXAN®); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide and trimethylomelamine; acetogenins (especially bullatacin and bullatacinone); delta-9-tetrahydrocannabinol (dronabinol, MARINOL®); beta-lapachone; lapachol; colchicines; betulinic acid; a camptothecin (including the synthetic analogue topotecan (HYCAMTIN®), CPT-1 1 (irinotecan, CAMPTOSAR®), acetylcamptothecin, scopolectin, and 9-aminocamptothecin); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); podophyllotoxin; podophyllinic acid; teniposide; cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1 -TM 1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, chlorophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimustine; antibiotics such as the enediyne antibiotics (e. g., calicheamicin, especially calicheamicin gammal l and calicheamicin omegaH ; CDP323, an oral alpha-4 integrin inhibitor; dynemicin, including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L- norleucine, doxorubicin (including ADRIAMYCI N®, morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, doxorubicin HCI liposome injection (DOXIL®), liposomal doxorubicin TLC D-99 (MYOCET®), peglylated liposomal doxorubicin (CAELYX®), and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, porfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate, gemcitabine (GEMZAR®), tegafur (UFTORAL®), capecitabine (XELODA®), an epothilone, and 5- fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfornithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; 2- ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2'-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine (ELDISINE®, FILDESIN®); dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); thiotepa; taxoid, e.g., paclitaxel (TAXOL®), albumin-engineered nanoparticle formulation of paclitaxel (ABRAXANE™), and docetaxel (TAXOTERE®); chloranbucil; 6-thioguanine; mercaptopurine; methotrexate; platinum agents such as cisplatin, oxaliplatin (e.g., ELOXATIN®), and carboplatin; vincas, which prevent tubulin polymerization from forming microtubules, including vinblastine (VELBAN®), vincristine (ONCOVIN®), vindesine (ELDISINE®, FILDESIN®), and vinorelbine (NAVELBINE®); etoposide (VP-16); ifosfamide; mitoxantrone; leucovorin; novantrone; edatrexate; daunomycin; aminopterin; ibandronate; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid, including bexarotene (TARGRETIN®); bisphosphonates such as clodronate (for example, BONEFOS® or OSTAC®), etidronate (DIDROCAL®), NE-58095, zoledronic acid/zoledronate (ZOMETA®), alendronate (FOSAMAX®), pamidronate (AREDIA®), tiludronate (SKELID®), or risedronate (ACTONEL®); troxacitabine (a 1 ,3-dioxolane nucleoside cytosine analog); antisense oligonucleotides, particularly those that inhibit expression of genes in signaling pathways implicated in aberrant cell proliferation, such as, for example, PKC-alpha, Raf, H-Ras, and epidermal growth factor receptor (EGF-R); vaccines such as THERATOPE® vaccine and gene therapy vaccines, for example, ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine; topoisomerase 1 inhibitor (e.g., LURTOTECAN®); rmRH (e.g., ABARELIX®); BAY439006 (sorafenib; Bayer); SU-1 1248 (sunitinib, SUTENT®, Pfizer); perifosine, COX-2 inhibitor (e.g., celecoxib or etoricoxib), proteosome inhibitor (e.g., PS341); bortezomib (VELCADE®); CCI-779; tipifarnib (R1 1577); orafenib, ABT510; Bcl-2 inhibitor such as oblimersen sodium (GENASENSE®); pixantrone; EGFR inhibitors (see definition below); tyrosine kinase inhibitors (see definition below); serine-threonine kinase inhibitors such as rapamycin (sirolimus, RAPAMUNEC); farnesyltransferase inhibitors such as lonafarnib (SCH 6636, SARASAR™); and pharmaceutically acceptable salts, acids or derivatives of any of the above; as well as combinations of two or more of the above such as CHOP, an abbreviation for a combined therapy of cyclophosphamide, doxorubicin, vincristine, and prednisolone; and FOLFOX, an abbreviation for a treatment regimen with oxaliplatin (ELOXATIN™) combined with 5-FU and leucovorin. Chemotherapeutic agents as defined herein also include "anti-hormonal agents" or "endocrine therapeutics" which act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer. They may be hormones themselves, including, but not limited to: anti-estrogens with mixed agonist/antagonist profile, including, tamoxifen (NOLVADEX®), 4-hydroxytamoxifen, toremifene (FARESTON®), idoxifene, droloxifene, raloxifene (EVISTA®), trioxifene, keoxifene, and selective estrogen receptor modulators (SERMs) such as SERM3; pure anti-estrogens without agonist properties, such as fulvestrant (FASLODEX®), and EM800 (such agents may block estrogen receptor (ER) dimerization, inhibit DNA binding, increase ER turnover, and/or suppress ER levels); aromatase inhibitors, including steroidal aromatase inhibitors such as formestane and exemestane (AROMASIN®), and nonsteroidal aromatase inhibitors such as anastrazole (ARIMIDEX®), letrozole (FEMARA®) and aminoglutethimide, and other aromatase inhibitors include vorozole (RIVISOR®), megestrol acetate (MEGASE®), fadrozole, and 4(5)-imidazoles; lutenizing hormone-releaseing hormone agonists, including leuprolide (LUPRON® and ELIGARD®), goserelin, buserelin, and tripterelin; sex steroids, including progestines such as megestrol acetate and medroxyprogesterone acetate, estrogens such as diethylstilbestrol and premarin, and androgens/retinoids such as fluoxymesterone, all transretionic acid and fenretinide; onapristone; anti-progesterones; estrogen receptor down-regulators (ERDs); anti-androgens such as flutamide, nilutamide and bicalutamide; and pharmaceutically acceptable salts, acids or derivatives of any of the above; as well as combinations of two or more of the above.

The term "antibody" (Ab) as used herein includes monoclonal antibodies, polyclonal antibodies, multi-specific antibodies (e.g. bispecific antibodies), single chain antibodies, e.g., antibodies from llama and camel, antibody fragments, e.g., variable regions and/or constant region fragments, so long as they exhibit a desired biological activity, e.g., antigen-binding activity. The term "immunoglobulin" (Ig) is used interchangeably with "antibody" herein. An "isolated antibody" is one which has been identified, and/or separated, and/or recovered from its natural environment.

The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. In contrast to polyclonal antibody preparations which include different antibodies directed against different epitopes, each monoclonal antibody is directed against a single epitope, i.e., a single antigenic determinant. In addition to their specificity, the monoclonal antibodies are advantageous in that they may be synthesized uncontaminated by other antibodies. The monoclonal antibodies useful in the present invention may be prepared by the hybridoma methodology or may be made using recombinant DNA methods in bacterial, eukaryotic animal or plant cells (see, e.g., U.S. Pat. No. 4,816,567). The "monoclonal antibodies" may also be isolated from phage antibody libraries, using the available techniques, he monoclonal antibodies herein include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.

An "antibody fragment" comprises a portion of a multimeric antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, dimmers and trimers of Fab conjugates, Fv, scFv, minibodies,; dia-, tria-, and tetrabodies; linear antibodies (See Hudson et al, Nature Med. 9, 129-134 (2003)).

Members of the Camelidae family, e.g., llama, camel, and dromedaries, contain a unique type of antibody, that are devoid of light chains, and further lack the CH1 domain (Muyldermans, S., Rev. Mol. Biotechnol., 74, 277-302 (2001)). The variable region of these heavy chain antibodies are termed VHH or VHH, and constitute the smallest available intact antigen binding fragment (15 kDa) derived from a functional immunoglobulin.

Methods for preparing antibodies, fragments and analogs thereof are known in the art. Methods of screening

In a first aspect, the present invention relates to a method for screening for a compound capable of modulating immune activity, the method comprising:

(a) contacting a cell expressing a CMTM6 and/or CMTM4 protein(s) with a test compound;

(b) measuring the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) in said cell; and

(c) selecting a test compound modulating the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) compared to the expression level or activity measured in the absence of the test compound,

wherein the test compound is a compound capable of decreasing immune activity if the test compound increases the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) and

wherein the test compound is a compound capable of increasing immune activity if the test compound decreases the level of expression or activity of the CMTM6 and/or CMTM4 protein(s).

In step (a), the cell may be any cell expressing a CMTM6 and/or CMTM4 protein(s) (including recombinant cells, modified to express said protein(s). For instance, the cell may be a cell line suitable for use in screening assays, preferably a cancer cell line. Non-limiting examples of suitable cells which express a CMTM6 and/or CMTM4 protein(s) include HAP1 cells, A375 cells, 8505C cells, RKO cells, DLD1 cells, LOVO cells, H2030 cells and colo 679 and variant thereof as well as other suitable cell lines. Also included are those cells that are transfected to (recombinant) express a CMTM6 and/or CMTM4 protein(s).

The skilled person is well acquainted with such cell lines and knows how to obtain them.

The skilled person is also acquainted with methods for determining whether a cell, e.g. a cell line, expresses a CMTM6 and/or CMTM4 gene(s) or a CMTM6 and/or CMTM4 protein(s), for instance by using PCR, immunohistochemistry, ELISA methods, and others. These and other methodologies may be used in step (b).

It is understood that the compounds uncovered in step (c) can be used for the development of medicaments suitable for the treatment of diseases or conditions involving (aberrant function of) the PD-1/PD-L1 axis such as cancers or autoimmune diseases, for instance such as described in scenarios 1 and 2 above and in the definition section. The test compound is a compound capable of increasing immune activity if the test compound decreases the level of expression or activity of a CMTM6 and/or CMTM4 protein(s); such compound is also referred to as an antagonist or inhibitor of CMTM6 and/or CMTM4. Such compound identified by the screenings methods disclosed herein may thus for example be used to enhance T-cell function to upregulate cell-mediated immune responses, for the treatment of T cell dysfunctional disorders. The term "T cell dysfunctional disorders" as used herein refers to any condition or disease wherein there is a deficiency of T cells (not enough) or wherein the T cells or T cell function (e.g. secretion of cytokines, chemokines) is deficient or insufficient so that the immune system's ability to fight diseases (e.g. infectious diseases, cancers, etc.) is compromised or entirely absent. Non-limiting examples of T cell dysfunctional disorders include infectious diseases (e.g. diseases caused by a pathogen such as a virus such as AIDS), cancers (e.g. melanoma, lung cancer, bladder cancer, Gl tract cancer, HNSCC, and Hodgkin's lymphoma and other cancers), autoimmune diseases (e.g. rheumatoid arthritis) or any other condition or disease that would benefit from upregulation or enhancement or alteration of an immune response function (e.g. T cell function.

Therefore, the compounds identified by the screenings methods disclosed herein may thus for example be used for the treatment of cancer or infections or any other condition that benefits from upregulation or enhancement of an immune response function.

In a second aspect, the present invention relates to a method for screening for a compound capable of modulating the level of expression of the PD-L1 protein in a cell, the method comprising:

(a) contacting a cell expressing a CMTM6 and/or CMTM4 protein(s) with a test compound; (b) measuring the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) in said cell; and

(c) selecting a test compound modulating the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) compared to the expression level or activity measured in the absence of the test compound,

wherein the test compound is a compound capable of increasing the level of expression of the PD-L1 protein if the test compound increases the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) and

wherein the test compound is a compound capable of decreasing the level of expression of the PD-L1 protein if the test compound decreases the level of expression or activity of the CMTM6 and/or CMTM4 protein(s). Steps (a) and (b) may be performed as described above. It is understood that the compounds uncovered in step (c) can be used for the development of medicaments suitable for the treatment of diseases or conditions involving (aberrant function of) the PD-1/PD-L1 axis such as cancers or autoimmune diseases, for instance such as described in scenarios 1 and 2 above.

The test compound is a compound capable of decreasing the level of expression of the PD- L1 protein if the test compound decreases the level of expression or activity of a CMTM6 and/or CMTM4 protein(s). Such compound identified by the screenings methods disclosed herein may thus for example be used to enhance T-cell function to upregulate cell-mediated immune responses, for the treatment of T cell dysfunctional disorders. Such compound identified by the screenings methods disclosed herein may thus for example be used for the treatment of cancer or infections or any other condition that benefits from upregulation or enhancement of an immune response function.

In an embodiment, relating to the method for screening as taught herein, measuring the level of expression or activity of a CMTM6 and/or CMTM4 protein(s) involves measuring the level of gene expression, the level of mRNA (as a measure of transcription), the level of protein, the level of cell surface protein, activity of the protein or, phosphorylation status of the CMTM6 and/or CMTM4 protein(s). The skilled person is well-acquainted with techniques for achieving this goal.

In an embodiment relating to the method for screening as taught herein, the immune activity is mediated by a T cell, preferably an effector T cell, wherein the immune activity comprises secretion of cytokines, preferably IFN gamma, and TNF alpha, secretion of chemokines, preferably CXCL9 and CXCL10, and secretion of perforin-granzymes, following binding of a T cell receptor to a peptide-MHC complex on a target cell (also referred to herein is T-cell activity). In an embodiment relating to the method for screening as taught herein, the level of expression of the PD-L1 protein is the level of cell surface expression of the PD-L1 protein. Cell surface expression of PD-L1 protein can be performed using any suitable methods in the art, for instance flow cytometry as described in the present experimental section. In an embodiment relating to the method for screening as taught herein, the method is screening for a compound capable of modulating PD-1/PD-L1 axis signaling, and/or capable of modulating immune activity, for instance as described above in scenarios 1 and 2. In an embodiment relating to the method for screening as taught herein, the method further comprises measuring immune activity and/or measuring the level of expression of the PD-L1 protein and/or PD-1/PD-L1 axis signaling in the presence of the compound selected in (c).

For instance, immune activity or PD-1/PD-L1 axis signaling may be measured by determining the levels of cytokines (e.g. IFN gamma, TNF alpha), chemokines (CXCL9, CXCL10) and/or perforin-granzymes released by immune cells (e.g. effector T cells), using standards techniques, in an assay wherein cells, e.g. expressing PD-L1 and/or a CMTM6 and/or CMTM4 protein(s) , for example cells of step (a), are co-incubated with immune cells expressing the PD-1 receptor such as T cells (e.g. effector T-cells), and wherein both cell types are treated with the test compound, and the results are compared to the situation wherein the cells are not treated with the selected compounds. Assays to measure the effect of PD-1 - PD-L1 axis signaling on T cells are known to those skilled in the art (Kataoka et al. Aberrant PD-L1 expression through 3 -UTR disruption in multiple cancers. Nature. 2016 May 23;534(7607):402-6. doi: 10.1038/nature18294. PubMed PMID: 27281199).

In a further aspect, the present invention relates to a method for screening for a compound capable of modulating the expression and/or activity of a CMTM6 and/or CMTM4 protein(s), the method comprising

(x) contacting a cell expressing PD-L1 protein and expressing a CMTM6 and/or CMTM4 protein(s) with a test compound;

(y) measuring the level of expression of the PD-L1 protein, optionally cell-surface expression of PD-L1 ; and

(z) selecting a test compound modulating the level of expression of PD-L1 protein as compared to a cell contacted with the test compound, wherein the cell is expressing PD-L1 protein but is not expressing said CMTM6 and/or CMTM4 protein(s) ,

wherein the test compound is a compound capable of decreasing the expression and/or activity of the CMTM6 and/or CMTM4 protein(s) if the test compound decreases the expression of PD-L1 and

wherein the test compound is a compound capable of increasing the expression and/or activity of the CMTM6 and/or CMTM4 protein(s) if the test compound increases the expression of PD-L1 Steps (x) and (y) may be performed as described above (for steps (a) and (b)). It is understood that the compounds uncovered in step (z) can be used for the development of medicaments suitable for the treatment of diseases or conditions involving (aberrant function of) the PD-1/PD-L1 axis such as cancers or autoimmune diseases, for instance such as described in the scenarios above. It is also understood that the compounds uncovered may be used in other disorders that involve (aberrant function of) the two members of the CMTM protein family.

In an embodiment, screening may be based on co-localization of CMTM6 and PD-L1. This may be advantageous for instance because imaging-based screens confer the advantage of high-throughput and robustness.

Also provided is for a method of screening for compounds that modulate the interaction, in particular molecular interaction, between PD-L1 and CMTM6 and/or CMTM4. As shown in the examples, CMTM6 and/or CMTM4 interact with PD-L1 , for example, as witnessed by co- immunoprecipitation of the two proteins.

Within the context of the current invention the term "interaction", or "interacting" refer to any physical association between proteins, directly, or indirectly via other molecules such as lipids, carbohydrates, other proteins, nucleotides, and other cell metabolites. Examples of interactions include protein- protein interactions. The term preferably refers to a stable association between two or more molecules (e.g. PDL-1 and CMTM6 and/or CMTM4) due to, for example, electrostatic, hydrophobic, ionic and/or hydrogen-bond interactions under physiological conditions. The interaction between the proteins may be either direct or indirect.

By this method for screening according to the present invention, it is possible to identify compounds capable of changing (inhibiting or augmenting) the binding property of the interaction between the proteins (e.g. PD-L1 and CMTM6 and/or CMTM4). Such a compound can become the candidate of the therapeutic agent or the preventive agent for the disease (illness) with which the interaction between the proteins is associated, including those disclosed herein, for example cancer, and or infectious disease, in particular those diseases that benefit from reduced or increased PD-L1-PD-1 axis signaling.

Such compound identified by the screenings methods disclosed and that inhibits or reduces the interaction between PD-L1 and CMTM6 and/or CMTM4 may thus for example be used to enhance T-cell function to upregulate cell-mediated immune responses. Such compound identified by the screenings methods disclosed herein may thus for example be used for the treatment of cancer or infections or any other condition(s) that would benefit from upregulation or enhancement of an immune response function, e.g. cancer, such as the cancer types described herein. The skilled person is well-aware of methods for screening for compounds that change the interaction between two proteins, including methods suitable for measuring interaction and change thereof between two membrane proteins. The screening of drugs is, for example possible by conventional enzyme-linked immunosorbent assay (ELISA) or by direct observation of one molecule using NMR spectroscopy, X-ray crystal analysis or electron microscopy, fluorescence resonance energy transfer, etc. Other suitable assays include those disclosed in, for example, WO 2004/023146 A2.

Therefore, there is provided for a method for screening for a compound for treatment of a disease, preferably selected from the group consisting of cancer, infection, or any other condition(s) that would benefit from upregulation or enhancement of an immune response function, e.g. cancer, such as the cancer types described herein, wherein the method is characterized by utilizing the interaction between PD-L1 and CMTM/6 and/or CMTM4.

Preferably the method comprises comparing the interaction between PD-L1 and CMTM 6 and/ CMTM4 in the absence and presence of the compound to be screened. The membrane may be any membrane comprising a bilayer of lipids, including vesicles and artificial membranes or isolated plasma membrane. The membrane may also be the membrane of a cell expressing CMTM6 and/or CMTM4 and PD-L1. In the screening assay, the compound to be screened may be added before, during or after PD-L1 and/or CMTIV16 and/or CMTM4 interact.

As mentioned, compounds that reduce or inhibit the interaction between PD-L1 and CMTM6 and/or CMTM4 are candidate drugs for treatment of conditions that would benefit from reduced PD-L1-PD-1 axis signaling. Compounds that reduce or inhibit the interaction between PD-L1 and CMTM6 and/or CMTM4 are candidate drugs for treatment of for example cancer, infection, or any other condition(s) that would benefit from upregulation or enhancement of an immune response function.

Also provided is a method for screening for a compound for the treatment of cancer or infection, said method being characterized by using CMTM6 and/or CMTM4, preferably being characterized by further using PD-L1 , and as described herein above. In a preferred embodiment, the method of screening comprises the step of (a) contacting a cell expressing CMTM6 and/or CMTM4 with a test compound;

(b) measuring the level of expression or activity of CMTM6 and/or CMTM4; and

(c) selecting a test compound modulating the level of expression or activity of CMTM6 and/or CMTM4 compared to the expression level or activity measured in the absence of the test compound,

wherein the test compound is a (candidate) compound for treatment of cancer or infection if the test compound decreases the level of expression or activity of CMTM6 and/or CMTM4. Also provided are compounds that decrease the level or activity of CMTM6 and/or CMTM4, preferably wherein the compound is an inhibitor or antagonist of CMTM6 and/or CMTM4 for use in the treatment of a disease in combination with an immune checkpoint inhibitor.

Also provided is a method of screening for an inhibitor of PD-L1 cell surface expression, the method comprising:

(a) contacting a cell expressing PD-L1 and CMTM6, or PD-L1 , CMTM6 and CMTM4 with a test compound, wherein the test compound specifically binds to CMTM6;

(b) measuring the cell surface expression of PD-L1 in the cell in the presence and absence of the test compound, wherein a reduction of PD-L1 cell surface expression in the presence of the test compound compared to the absence of the test compound identifies the test compound as an inhibitor of PD-L1 cell surface expression. In certain embodiments, the test compound is an antibody, optionally an antibody that specifically binds to CMTM6 and CMTM4. Also provided is a method of screening for an inhibitor of PD-L1 cell surface expression, the method comprising:

(a) contacting a cell expressing PD-L1 and C TM4, or PD-L1 , CMTM6 and CMTM4 with a test compound, wherein the test compound specifically binds to CMTM4;

(b) measuring the cell surface expression of PD-L1 in the cell in the presence and absence of the test compound, wherein a reduction of PD-L1 cell surface expression in the presence of the test compound compared to the absence of the test compound identifies the test compound as an inhibitor of PD-L1 cell surface expression. In certain embodiments, the test compound is an antibody, optionally an antibody that specifically binds to CMTM6 and/or CMTM4.

Also provided is for the use of CMTM6 and/or CMTM4 in identifying of or screening for compounds for use in the treatment of cancer or infection Also provided is for the use of CMTM6 and/or CMTM4 in identifying of or screening for compounds that may be used to enhance T-cell function to upregulate cell-mediated immune responses, for the treatment of T cell dysfunctional disorders. Also provided is for the use of CMTM6 and/or CMTM4 in identifying of or screening for compounds for reducing PD-L1-PD-1 axis signaling.

The screening methods disclosed herein are also useful for identifying compounds that can be used to increase ubiquitination of PD-L1 and/or reduce half-life of PD-L1 in a cell. As shown in the examples, reduced expression and/or activity of CMTM 6 and/or CMTM 4, for example CMTM 6 and CMTM 4, increases ubiquitinated PD-L1. Therefore, the screening methods as disclosed herein can be used to identify compounds that increase ubiquitination of PD-L1 , e.g. by reducing expression or activity of CMTM6 and/or CMTM4, e.g. by reducing plasma membrane expression (or localization) of CMTM6 and/or CMTM4, or by interfering with the interaction between PD-L1 and CMTM6 and/or CMTM4.

The screening methods disclosed herein are useful in identifying compounds that may be used to enhance T-cell function to upregulate cell-mediated immune responses, for the treatment of T cell dysfunctional disorders. Such compounds identified by the screening methods disclosed herein are useful in, the treatment of conditions that would benefit from reduced PD-L1-PD-1 axis signaling. Such compounds identified by the screening methods disclosed herein may be used treat cancer and infections, or any other condition(s) that would benefit from upregulation or enhancement of an immune response function. Test compounds that can be screened in the methods disclosed herein include, without limitation, small molecules, nucleic acids (e.g., siRNA, shRNA, miRNA), and polypeptides, (e.g., antibodies).

Methods of in vitro modulation

In a further aspect, the present invention relates to an in vitro method for modulating PD-L1 protein expression and/or PD-1/PD-L1 axis signaling in a cell, the method comprising modulating the expression or activity of a CMTM6 and/or CMTM4 protein(s). In an embodiment relating to the in vitro method for modulating PD-L1 protein expression and/or PD-1/PD-L1 axis signaling in a cell as taught herein, PD-L1 protein expression and/or PD-1/PD-L1 axis signaling is increased when the level of expression or activity of a CMTM6 and/or CMTM4 protein(s) is decreased and/or

wherein PD-L1 protein expression and/or PD-1/PD-L1 axis signaling is decreased when the level of expression or activity of a CMTM6 and/or CMTM4 protein(s) is decreased.

In an embodiment relating to the in vitro method for modulating PD-L1 protein expression and/or PD-1/PD-L1 axis signaling in a cell as taught herein, modulating PD-L1 protein expression and/or PD-1/PD-L1 axis signaling is performed by treating the cells in the presence of a compound identified with the method for screening as taught herein and/or by treating the cells with a siRNA, shRNA, TALENs, MEGATALENs, CRISPR or Zinc finger nucleases directed to silence expression of a gene encoding a CMTM6 and/or CMTM4 protein(s).

Treatment with CMTM6 and/or CMTM4 modulator(s)

In a further aspect, the present invention relates to a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s)for use in modulating immune activity, PD- 1/PD-L1 axis signaling and/or PD-L1 protein expression in a patient in need thereof, wherein the modulator is a modulator that increases immune activity, decreases PD-1/PD-L1 axis signaling and/or decreases PD-L1 protein expression when the modulator decreases the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) and wherein the modulator is a modulator that decreases immune activity, increases PD-1/PD-L1 axis signaling and/or increases PD-L1 protein expression when the modulator increases the expression and/or activity of a CMTM6 and/or CMTM4 proteins(s). In a further aspect, the present invention relates to a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 proteins(s) for use in immunotherapy, immunotherapy in a cancer patient, preferably a patient suffering from a cancer selected from melanoma, lung cancer, bladder cancer, Gl tract cancer, HNSCC, and Hodgkin's lymphoma and other cancers involving (aberrant function of) the PD-1/PD-L1 axis, or for use in the treatment of an autoimmune disease involving (aberrant function of) the PD-1/PD-L1 axis, preferably systemic lupus erythematosus, rheumatoid arthritis, and type 1 diabetes, wherein the modulator is a modulator that increases immune activity, decreases PD-1/PD-L1 axis and/or decreases PD-L1 protein expression when the modulator decreases the expression and/or activity of a CMTM6 and/or CMTM4 proteins(s) and, wherein the modulator is a modulator that decreases immune activity, increases PD-1/PD-L1 axis signaling and/or increases PD-L1 protein expression when the modulator increases the expression and/or activity of a CMTM6 and/or CMTM4 proteins(s). In the embodiment relating to the modulator of the expression and/or activity of a CMTM6 and/or CMTM4 proteins(s) for use as taught herein, the treatment may also involve the use of a PD-1/PD-L1 axis binding antagonist and/or agonist. PD-1/PD-L1 axis binding antagonists are well-known in the art. For instance, PD-1/PD-L1 axis inhibitors that block the interaction of PD-L1 with the PD-1 receptor are currently being used to prevent the cancer from evading the immune system (Brahmer et al. (2010) J Clin Oncol 28:3167-75; Brahmer et al. (2012) N. Engl J Med 366:2455-65; Flies et al. (2011) Yale J Biol Med 84:409-21.; Topalian et al. (2012b) N Engl J Med 366:2443-54.). Non-limiting examples of PD-1/PD-L1 axis inhibitors include anti-PD-L1 antibodies (e.g. BMS-936559) as well as anti-PD-1 antibodies (e.g. nivolumab (BMS-936558), and combination thereof. Other PD-1/PD-L1 axis binding antagonists may be used. Non-limiting examples of PD-1/PD-L1 axis binding agonists include PD-1 agonists such as those described in EP2742953. Other PD-1/PD-L1 axis binding agonists may be used. In a further aspect, the present invention relates to the use of a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 proteins(s) for modulating immune activity, PD- 1/PD-L1 axis signaling and/or PD-L1 protein expression, wherein the modulator is a modulator that increases immune activity, decreases PD-1/PD-L1 axis signaling and/or decreases PD-L1 protein expression when the modulator decreases the expression and/or activity of a CMTM6 and/or CMTM4 proteins(s) and, wherein the modulator is a modulator that decreases immune activity, increases PD-1/PD-L1 axis signaling and/or increases PD-L1 protein expression when the modulator increases the expression and/or activity of a CMTM6 and/or CMTM4 proteins(s). In a further aspect, the present invention relates to an antibody and antigen binding fragment thereof (including immunoglobulin, aptamers, affimers, single-chain antibodies, nanobodies and the like) as well as multi-specific antibodies against a CMTM6 and/or CMTM4 proteins(s) for use in the treatment of a disorder that would benefit from an increase in immune activity, decrease of PD-1/PD-L1 axis signaling and/or decrease of PD-L1 protein expression, preferably wherein said disorder is a cancer.

Globally, it is understood that the CMTM6 and/or CMTM4 modulator compounds discussed above may be uncovered or found by the screening methods as taught herein and may be advantageously used for the treatment of diseases or conditions involving (aberrant function of) the PD-1/PD-L1 axis such as cancers or autoimmune diseases, for instance such as described in the scenarios 1 above. Preferably the CMTM6 and/or CMTM4 modulator is an inhibitor or antagonist of CMTM6 and/or CMTM4. Such inhibitor or antagonist may lead to reduction in expression of CMTM6 and/or CMTM4, or to inhibition of the activity of CMT 6 and/or CMTM4. For example, and as shown herein inhibiting or antagonizing CMTM6 and/or CMTM4 causes reduced PD-1/PD-L1 axis signaling, reduced expression of PD-L1 , in particular reduced expression of PD-L1 at the cell surface, increased ubiquitination of PD-L1 and decreased half-life of PD-L1 in the cell. Also comprised by the inhibitors or antagonists of CMTM6 and/or CMT 4 that may be used within the context of the current invention are antibodies against CMTM6 and/or CMTM4preferably antibodies that interfere with or inhibit the interaction between PD-L1 and CMTM6 and/or CMTM4, and antibodies that induce internalization of CMTM6 and/or CMTM4.

Some embodiment of any of the methods, uses, compositions, or compositions for use as disclosed herein, also include the combination of modulation of CMTM6 and/or CMTM4. In a preferred embodiment, of such methods, uses, compositions or compositions for use, CMTM6 and/or CMTM4 is (are) inhibited or antagonized.

As will be understood by the skilled person, also provided is for embodiments that encompass targeting STUB1 and CMTM4 and/or CMTM6, for example targeting a patient with STUB1 modulators and with CMTM4 and/or CMTM6 modulators, and preferably in addition in combination with those other drugs as presented herein throughout.

Combination treatments with immune checkpoint inhibitors or immune checkpoint modulators.

According to the invention, there is also provided for combination treatments of compounds that decreases the level of expression or activity of CMTM6 and/or CMTM4, preferably wherein the compound is an inhibitor or antagonist of CMTM6 and/or CMTM4 in combination with immune checkpoint inhibitors or modulators.

Within the context of the current invention, such inhibitor or antagonist of CMTM6 and/or CMTM4 is a compound that, preferably specifically, inhibits the level of expression or activity of CMTM6 and/or CMTM4 (i.e. may be a bispecific inhibitor), for example may reduce the amount of CMTM6 and/or CMTM4 protein, in the cell or at the cell surface, or may reduce its activity, or may interfere with the interaction between PD-L1 and CMTM6 or CMTM4 (or both), as shown in the examples herein.

The term "immune checkpoint inhibitor or modulator" as used herein refers to any molecule that directly or indirectly inhibits, partially or completely, an immune checkpoint pathway. It is generally thought that immune checkpoint pathways function to turn on or off aspects of the immune system, particularly T cells, but also for instance myeloid cells, NK cells and B cells. Following activation of a T cell, a number of inhibitory receptors can be upregulated and present on the surface of the T cell in order to suppress the immune response at the appropriate time. Aspects of the disclosure are related to the observation that inhibiting such immune checkpoint pathways and administering synthetic nanocarrier compositions comprising antigens and immunostimulators, can result in the generation of enhanced immune responses to the antigen and/or a reduction in immunosuppressive immune responses against the antigen. Examples of immune checkpoint pathways include, without limitation, PD-1/PD-L1 , CTLA4/B7-1 , TIM-3, LAG3, By-He, H4, HAVCR2, ID01 , CD276 and VTCN1 , B7-H3, B7-H4, CD47, or KIR. Aspects of the disclosure are also related to the observation that inhibition of one checkpoint pathway, such as the CTLA4/B7-1 pathway can lead to increased activation of the PD-1/PD-L1 pathway, for instance through increased PD- L1 expression, creating a rationale for combination treatments. Immune checkpoints and modulators thereof as well as methods of using such compounds are described in the literature. For instance, non-limiting examples of immune checkpoint inhibitors or modulators include fully human monoclonal antibodies, such as BMS-936558/MDX-1106, BMS- 936559/MDX-1 105, ipilimumab/Yervoy, tremelimumab, BMS-986016, Durvalumab, MEDI4736, Urelumab, CDX-1127, and Avelumab; humanized antibodies, such as CT-011 , IV1K-3475, Hu5F9-G4, CC-90002, MBG453, TSR-022, and Atezolizumab; and fusion proteins, such as AMP-224 and TTI-621 , and others. Other non-limiting examples of immune checkpoint modulators (agonists) include antibodies directed against e.g. CD40, OX40, GITR, CD137 (4-1 BB), CD27, ICOS, and TRAIL. In accordance with this invention, the one or more immune checkpoint modulator(s) may independently be a polypeptide or a polypeptide- encoding nucleic acid molecule; said polypeptide comprising a domain capable of binding the targeted immune checkpoint and/or inhibiting the binding of a ligand to said targeted immune checkpoint so as to exert an antagonist function (i.e. being capable of antagonizing an immune checkpoint-mediated inhibitory signal) or an agonist function (i.e. being capable of boosting an immune checkpoint- mediated stimulatory signal). Such one or more immune checkpoint modulator(s) can be independently selected from the group consisting of peptides (e.g. peptide ligands), soluble domains of natural receptors, RNAi, antisense molecules, antibodies and protein scaffolds. In a preferred embodiment, the immune checkpoint modulator is an antibody. In the context of the invention, the immune check modulator antibody is used in the broadest sense and encompasses e.g. naturally occurring and engineered by man as well as full length antibodies or functional fragments or analogs thereof that are capable of binding the target immune checkpoint or epitope (thus retaining the target-binding portion). It can be of any origin, e.g. human, humanized, animal (e.g. rodent or camelid antibody) or chimeric. It may be of any isotype with a specific preference for an IgGI or lgG4 isotype. In addition, it may be glycosylated or non- glycosylated. The term "antibody" also includes bispecific or multi- specific antibodies so long as they exhibit the binding specificity described herein. Non- limiting examples of agonistic immune checkpoint modulators are those that exert an agonist function in the sense that they are capable of stimulating or reinforcing stimulatory signals, for example those mediated by CD28 with a specific preference for any of ICOS, CD137 (or 4- 1 BB), OX40, CD27, CD40 and GITR immune checkpoints. Standard assays to evaluate the binding ability of the antibodies toward immune checkpoints are known in the art, including for example, ELISAs, Western blots, RIAs and flow cytometry. The binding kinetics (e.g., binding affinity) of the antibodies also can be assessed by standard assays known in the art, such as by Biacore analysis. Where in the application reference is made to an immune checkpoint inhibitor, also an immune checkpoint modulator may be used, except in those cases where it is apparent from the context of the wording that this is not the case.

For example, in the instance of the PD-1/PD-L1 immune checkpoint pathway, an inhibitor may bind to PD-1 or to PD-L1 and prevent interaction between the receptor and ligand. Therefore, the inhibitor may be an anti-PD-1 antibody or anti-PD-L1 antibody. Similarly, in the instance of the CTLA4/B7-1 immune checkpoint pathway, an inhibitor may bind to CTLA4 or to B7-1 and prevent interaction between the receptor and ligand. Further examples of immune checkpoint inhibitors can be found, for example, in WO2014/144885. Such immune checkpoint inhibitors are incorporated by reference herein. In some embodiments of any one of the methods, compositions or kits provided, the immune checkpoint inhibitor is a small molecule inhibitor of an immune checkpoint pathway. In some embodiments the immune checkpoint inhibitor is a polypeptide that inhibits an immune checkpoint pathway. In some embodiments the inhibitor is a fusion protein. In some embodiments the immune checkpoint inhibitor is an antibody. In some embodiments the antibody is a monoclonal antibody. Non- limiting examples of immune checkpoint inhibitors include fully human monoclonal antibodies, such as BMS-936558/MDX-1106, BMS-936559/MDX-1105, ipilimumab/Yervoy, tremelimumab, BMS-986016, Durvalumab, MEDI4736, Urelumab, CDX-1 127, and Avelumab; humanized antibodies, such as CT-011 , MK-3475, Hu5F9-G4, CC-90002, MBG453, TSR- 022, and Atezolizumab; and fusion proteins, such as AMP-224 and TTI-621. Non-limiting examples of positive immune checkpoint modulators include antibodies against CD27, CD137. Therefore provided is for an immune checkpoint inhibitor for use in the treatment of a disease, wherein in the treatment also involves the use of a compound that decreases the level of expression or activity of CMTM6 and/or CMTM4, preferably wherein the compound is an inhibitor or antagonist of CMTM6 and/or CMTM4.

Preferably the compound is an antibody against CMTM6 and/or CMTM4.

Preferably the disease is a disease that would benefit from decreased PD-1/PD-L1 axis signaling and/or that would benefit from upregulation or enhancement of an immune response function.

Preferably the disease is cancer or infection.

Preferably the immune checkpoint inhibitor or modulators is an inhibitor of PD-1 , PD-L1 , CTLA-4 or CD47.

Preferably, the treatment also involves the use of a cytotoxic agent or chemotherapeutic agent or other standard of care, such as radiotherapy. Methods of treatment

In a further aspect, the present invention relates to a method for the treatment of a disorder that would benefit from an increase of immune activity, decrease of PD-1/PD-L1 axis signaling and/or decrease of PD-L1 protein expression, preferably wherein said disorder is a cancer, for instance as described in scenario 1 above), the method comprises administering to a human in need of such treatment a therapeutically effective amount of

- a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s), wherein the modulator decreases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s). In a further aspect, the present invention relates to a method for the treatment of a disorder that would benefit from a decrease of immune activity, increase of PD-1/PD-L1 axis signaling and/or increase of PD-L1 protein expression, preferably wherein said disorder is an autoimmune disease (for instance as described in scenario 2 above), the method comprises administering to a human in need of such treatment a therapeutically effective amount of - a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s), wherein the modulator increases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s). It is understood that "an effective amount" of a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) refers to the amount of a compound or a modulator as taught herein required to ameliorate the symptoms of a disease (e.g. cancer or autoimmune disease), for example, but not necessarily relative to an untreated patient.

The skilled person understands that the effective amount of active agent(s) used to practice the present disclosure for therapeutic treatment of cancer or autoimmune diseases will vary depending upon the manner of administration, the age, body weight, and general health of the subject. Ultimately, the attending physician will decide the appropriate amounts and dosage regimen. Such amount is referred to as an "effective" or "acceptable" amount. Thus, in connection with the administration of a drug which, in the context of the current disclosure, is "effective against" a disease or condition indicates that administration in a clinically appropriate manner results in a beneficial effect for at least a statistically significant fraction of patients, such as an improvement of symptoms, a cure, a reduction in at least one disease sign or symptom, extension of life, improvement in quality of life, or other effect generally recognized as positive by medical doctors familiar with treating the particular type of disease or condition.

In a further aspect, the present invention relates to a method of promoting health, the method comprises communicating to a target audience, the use of a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) for treating an individual with a disease or disorder that would benefit from the modulation of immune activity, PD-1/PD-L1 axis signaling and/or PD-L1 protein expression. In a further aspect, the present invention relates to the use of a CMTM6 and/or CMTM4 protein(s) for modulating immune activity, PD-L1 expression, PD-L1 protein expression and/or PD-1/PD-L1 axis signaling.

Also provided is a method for increasing ubiquitination of PD-L1 , the method comprises inhibiting the expression or activity of CMTM6 and/or CMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody. In certain embodiments, the antibody specifically binds to CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM6. In certain embodiments, the antibody specifically binds to CMTM4, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM4. In certain embodiments, the antibody specifically binds to CMTM4 and CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 , CMTM6 and CMTM4. Also provided is a method for decreasing half-life of PD-L1 , the method comprises inhibiting the expression or activity of CMTM6 and/or CMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody. In certain embodiments, the antibody specifically binds to CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM6. In certain embodiments, the antibody specifically binds to CMTM4, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM4. In certain embodiments, the antibody specifically binds to CMTM4 and CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 , CMTM6 and CMTM4.

Also provided is a method for reducing PD-1/PD-L1 signaling, the method comprises inhibiting the expression or activity of CMTM6 and/or CMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody. In certain embodiments, the antibody specifically binds to CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 and CMT 6. In certain embodiments, the antibody specifically binds to CMTM4, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM4. In certain embodiments, the antibody specifically binds to CMTM4 and CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 , CMTM6 and CMTM4.

Also provided is a method for upregulation or enhancement of an immune response function, the method comprises inhibiting the expression or activity of CMTM6 and/or CMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody. In certain embodiments, the antibody specifically binds to CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM6. In certain embodiments, the antibody specifically binds to CMTM4, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM4. In certain embodiments, the antibody specifically binds to CMTM4 and CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 , CMTM6 and CMTM4.

Also provided is a method for reducing expression of PD-L1 , preferably of cell-surface PD-L1 , the method comprises inhibiting the expression or activity of CMTM6 and/or CMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody. In certain embodiments, the antibody specifically binds to CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM6. In certain embodiments, the antibody specifically binds to CMTM4, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM4. In certain embodiments, the antibody specifically binds to CMTM4 and CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 , CMTM6 and CMTM4.

Also provided is a method of reducing cell-surface PD-L1 expression in a subject, the method comprising administering to the subject an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody. In certain embodiments, the antibody specifically binds to CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM6. In certain embodiments, the antibody specifically binds to CMTM4, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM4. In certain embodiments, the antibody specifically binds to CMTM4 and CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 , CMTM6 and CMTM4.

Also provided is a method of enhancing T-cell activation in a subject, the method comprising administering to the subject an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody. In certain embodiments, the antibody specifically binds to CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM6 and/or reduces the cell surface expression of PD-L1. In certain embodiments, the antibody specifically binds to CMTM4, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM4 and/or reduces the cell surface expression of PD-L1. In certain embodiments, the antibody specifically binds to CMTM4 and CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 , CMTM6 and CMTM4 and/or reduces the cell surface expression of PD-L1.

Also provided is a method of treating cancer or infectious disease in a subject, the method comprising administering to the subject an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody. In certain embodiments, the antibody specifically binds to CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM6 and/or reduces the cell surface expression of PD-L1. In certain embodiments, the antibody specifically binds to CMTM4, optionally wherein the antibody inhibits the interaction of PD-L1 and CMTM4 and/or reduces the cell surface expression of PD-L1. In certain embodiments, the antibody specifically binds to CMTM4 and CMTM6, optionally wherein the antibody inhibits the interaction of PD-L1 , CMTM6 and CMTM4 and/or reduces the cell surface expression of PD-L1. Also provided is a method according to any one of the foregoing methods, further comprising providing or administering an immune checkpoint inhibitor or modulator and/or a cytotoxic agent and/or chemotherapeutic agent. In an embodiment, the inhibitor or antagonist inhibits the interaction between PD-L1 and CMTM6 and/or CMTM4.

In an embodiment, the inhibitor or antagonist induces internalization of CMTM6 and/or CMTM4.

Methods of Diagnosis/Prognostics

In a further aspect, the present invention relates to a method for predicting immune activity towards cancer cells in a patient, the method comprising measuring the level of expression and/or activity of a CMTM6 and/or CMTM4 protein(s) in cancer cells and/or cancer-infiltrating cells obtained from said patient, wherein increased expression and/or activity of the CMTM6 and/or CMTM4 protein(s) is predictive for poor activity of the T-cell towards the cancer cell and wherein decreased expression and/or activity of the CMTM6 and/or CMTM4 protein(s) is predictive for strong activity of the T-cell towards the cancer cell. Expression and/or activity may be compared to a standard, for example a healthy subject.

In a further aspect, the present invention relates to a method for predicting immune activity towards cancer cells in a patient as taught herein, wherein the method is used to determining likelihood that the patient will exhibit benefit from treatment with a PD-1/PD-L1 axis binding antagonist and/or exhibit benefit from treatment with a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s).

In a further aspect, the present invention relates to a method for predicting immune activity towards cells in a patient suffering from an autoimmune disease, the method comprising measuring the level of expression and/or activity of a CMTM6 and/or CMTM4 protein(s) in the cells obtained from said patient, wherein decreased expression and/or activity of the CMTM6 and/or CMTM4 protein(s) is predictive for strong activity of the T-cell towards the cells and wherein increased expression and/or activity of the CMTM6 and/or CMTM4 protein(s)is predictive for poor activity of the T-cell towards the cells. Expression and/or activity may be compared to a standard, for example a healthy subject.

In a further aspect, the present invention relates to a method for predicting immune activity towards cells in a patient suffering from an autoimmune disease as taught herein, wherein the method is used to determine the likelihood that the patient will exhibit benefit from treatment with a PD-1/PD-L1 axis binding agonist and/or exhibit benefit from treatment with a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s). It is understood that measuring the level of expression of a CMTM6 and/or CMTM4 protein(s) in cancer cells and/or cancer-infiltrating cells or other cells (e.g. pancreatic cells) obtained from a patient, can be reliably used in place of or in addition to traditional methods relying on the cell surface detection of PD-L1 protein in such cells using immunohistochemistry. Such traditional methods are known to be labor-intensive and do not always work (i.e. do not always yield PD-L1 immuno-positive staining). Therefore, the present method may be an advantageous alternative to methods relying on immunohistochemistry.

EXAMPLES

Example 1 : Haploid Genetic Screen for modulator of PD-L1

In order to identify novel regulators of PD-L1 , we made use of a forward genetic screening approach in haploid human HAP1 cells. We noticed that HAP1 cells upregulate PD-L1 mRNA upon stimulation with interferon gamma (IFNg) and that this results in an increase in the abundance of PD-L1 at the cell surface of these cells that can be detected with antibodies.

Next, we created a library of loss-of-function mutants in HAP1 cells using a modified version of a retroviral gene trap (Jae et al., Science, 2013), expanded these cells, treated them with IFNg and subjected them to a staining for PD-L1 at the cell surface using antibodies. This resulted in a near-normal distribution of signal intensity when analyzed by flow-cytometry. For the genetic screen, we selected those mutants that displayed the strongest and weakest anti- PD-L1 staining, sorted a total of ca. 10 million cells for each population and analyzed their gene-trap integration sites, similar as described before (Blomen et al., Science, 2015).

Material and Methods

HAP1 cells were mutagenized using gene-trap retrovirus (for example described in Carette et al. (2011). Nature, 477(7364), 340-3. doi:10.1038/nature10348; available from www.horizon- genomics.com/hap1-wildtype.html) produced in HEK293T cells using a gene trap vector similar to that described previously (Jae et al., Science 2013 340(6131 ):479-83) in which green fluorescent protein (GFP) was exchanged for blue fluorescent protein (BFP).

Cells were seeded in 12 T175 flasks at 40% confluence. The next day, the medium was replaced with DM EM supplemented with 30% fetal calf serum (FCS) prior to transfection with 6.6 microgram gene trap plasmid per T175 flask, in combination with the packaging plasmids pCMV-Gag-pol, pCMV-VSVg and pAdVAntage (Carette et al., Science 2009 326(5957):1231- 1235). The medium was harvested 48 hours post transfection and subsequently concentrated by ultracentrifugation at 21.000 rpm for 2 hours at 4°C. The supernatant was discarded and the pellets were resuspended in 200 microliter phosphate buffered saline (PBS, Life technologies) overnight at 4°C. Retrovirus-containing medium was collected and concentrated twice daily for three days.

To generate a mutagenized HAP1 cell population, ca. 40 million HAP1 cells were repeatedly transduced with gene-trap retrovirus in the presence of 8 microgram/ml protamine sulphate (Sigma). The mutant library was subsequently expanded prior to antibody staining and flow cytometric cell sorting.

For the genetic screens measuring PD-L1 (encoded by gene CD274) at the cell surface, mutagenized HAP1 libraries (starting with either parental HAP1 cells or the respective HAP1 mutants described below) were expanded to ca. 1.5x109 cells and subsequently treated with 0.5 nanogram/microliter interferon gamma (IFNg, peprotech) for 24 hours to induce expression of PD-L1. Subsequently, ca. 3x109 cells were dissociated using trypsin-EDTA (Life technologies), washed with PBS and stained with a FITC labeled antibody directed against PD-L1 (MIH1 , BD pharmingen) at 1 :20 dilution for 30' at RT in PBS containing 0.5% w/v bovine serum albumin (Sigma) and 0.2% w/v sodium azide (Sigma). Next, the cells were washed three times with PBS containing 1 % FCS and subsequently stained with a FITC labeled polyclonal goat anti-mouse Ig (BD pharmingen) at 1 :100 dilution for 30' at RT in PBS containing 0.5% w/v bovine serum albumin (Sigma) and 0.2% w/v sodium azide (Sigma).

Following two washes with PBS containing 1 % FCS and one wash with PBS, stained cells were passed through a 40 micrometer strainer (BD FalconTM) and subsequently fixed using BD fix buffer I (BD biosciences) for 10 minutes at 37°C, followed by a wash with PBS containing 1 % FCS. Subsequently, cells were permeabilized by suspension in cold (-20°C) BD permeabilization buffer (BD biosciences) while vortexing and incubated on ice for 30 minutes prior to incubation with 100 microgram/ml RNAse A (Qiagen, Germany) and 10 microgram/milliliter propidium iodide (Cayman Chemical) at 37°C temperature for 30 minutes. Alternatively, cells were subjected to treatment with 3 micromolar 4', 6- diamidino-2- phenylindole (DAPI) for 30 minutes. In each case, the staining was concluded by a final wash in PBS 10% FCS.

Following staining, cells were sorted on a Biorad S3 Cell sorter (Biorad) or a Moflo Asterios sorter (Beckman Coulter) to collect the highest and lowest staining populations for PD-L1 (approximately 1-5%) and 1n DNA content.

Sorted cells were pelleted by centrifugation (2500 rpm, 10 minutes) and genomic DNA was isolated using Qiagen DNA mini kit (Qiagen). To facilitate de-crosslinking pellets were resuspended in PBS (200 microliter per 10 million cells) and after the addition of Proteinase K and lysis buffer (buffer AL, both Qiagen) incubated overnight at 56°C with agitation. The following day, DNA was isolated according to manufacturer's specifications and measured by Nanodrop2000 spectrophotometer (Thermo Fisher).

Insertion sites were amplified and cloned as described in Blomen et al., Science 2015, 350(6264): 1092-6, using the pre-adenylated linker in combination with thermostable RNA ligase 1 from Thermus scotoductus bacteriophage (Blondal et al, Nucleic Acid Research 2005, 33(1) 135-142, patent WO 2010/094040 A1 ) and sequenced on an lllumina HiSeq2500 (lllumina) using sequencing primer 5'-ctagcttgccaaacctacaggtggggtctttca-3' (SEQ I D NO: 1) as single-reads with a read-length of 65 base pairs.

Following deep sequencing, gene-trap insertion sites were identified as reads aligning uniquely to the human genome (hg19) without or with a single mismatch using bowtie (Langmead et al., Genome Biol 2009, 10: R25) for both the high and low PD-L1 sorted populations. Aligned reads were intersected with hg19 RefSeq gene coordinates (for every gene the longest RefSeq region was selected) to establish intragenic insertion sites and their orientation respective to the gene using intersectBED (Quinlan and Hall, Bioinformatics 2010, 26 (6): 841 -842). For the purpose of this analysis, insertion sites integrated in sense orientation relative to the directionality of the affected gene were considered disruptive. In the case of overlapping genes, only those genomic regions unique to a single gene were considered. In order to identify genes enriched for disruptive gene-trap integrations in either query population, per gene, the number of disruptive insertion sites in that gene and the total number of disruptive gene-trap integrations in the corresponding population (e.g. PD-L1 high) was compared to the corresponding values in the other population (e.g. PD-L1 low) using a two-sided Fisher's exact test.

Resulting P-values were adjusted for multiple testing using Benjamini and Hochberg FDR correction. Fishtail plots were created in Prism 6 for Mac OS X (GraphPad, version 6. Oh) by calculating the ratio of the number of disruptive integrations per gene in both populations normalized by the number of total integrations in the two populations (deemed mutational index (Ml), plotted on the y-axis) and the sum of disruptive integrations identified in both the high and low populations (plotted on the x-axis). For genes in which one or more disruptive gene-trap insertion were identified in one population but not in the other, one insertion was assigned to that gene in the population in which no insertion could be mapped to allow Ml calculation (circumventing division by 0 and allowing plotting on a logarithmic scale):

where High(x) and Low(x) denote the sum of disruptive gene-trap insertions mapped in gene x in the high and low population respectively. For PD-L1 (Gene CD274) it has been described that alterations of the 3' portion of the gene can stabilize the gene product and lead to higher PD-L1 proteins levels (Kataoka et al., Nature. 2016 May 23;534(7607):402-6). As this was also recapitulated by our gene-trap insertion method (gene-trap integrations into the 3' portion of the gene resulting in increased rather than decreased staining for PD-L1), we disregarded the portion of the gene that lies downstream of exon 5 (Refseq identifier NM_014143.3).

Results

The results of the genetic haploid genetic screen for PD-L1 levels at the cell surface in parental ('wild-type') HAP1 cells treated with IFNg are shown in Figure 1. Specifically, the genetic haploid genetic yielded a total of 215 significant outliers with an FDR-corrected P- value of smaller than 10E-6, 93 of which occurred in the PD-L1 high population and 122 in the PD-L1 low population. Besides the gene coding for PD-L1 itself (CD274), this included a set of genes known to mediate IFNg signaling events, including the receptor (IFNGR1 and IFNGR2), the kinases JAK1 and JAK2, as well as the transcription factors STAT1 and IRF1. Beyond these expected genes, the screen identified a strong regulator of PD-L1 levels in both populations: CKLF Like MARVEL Transmembrane Domain Containing 6 (CMTM6) as a positive regulator of PD-L1 (Figure 1). Noticeably, other family members of CMTM proteins (CMTM 1 though CMTM8) did not significantly affect PD-L1 surface levels in CMTM6- proficient HAP1 cells. Example 2: Generation and analysis of clonal CMTM6 knockout cells

Next, we sought to validate the involvement of CMTM6 in surface PD-L1 levels by transducing various cell types (cancer cell lines) with lentiviral vectors encoding fluorescently- tagged Cas9 and sgRNAs targeting the CMTM6 gene. Material and Methods

HAP1 cells, A375 cells, 8505C cells, RKO cells, DLD1 cells, LOVO cells, and H2030 cells were transfected with a pair of pX330 plasmids (Cong et al. Science. 2013, PMID: 23287718) encoding single-guide (sg)RNAs targeting the sequences 5'- TTGAGAACGCGCCGGAGCAATGG-3' (SEQ ID NO:2) and 5 - GCTGAAACGAAGGAGCTCGGCGG-3' (SEQ ID NO: 3) on the non-coding strand in the CMTM6 gene, along with a plasmid carrying a Blasticidin S resistance cassette (Blasticidin S deaminase). Transfected cells were briefly selected with 30 microgram/milliliter Blasticidin S (Invivogen) for 24-48 hours and subsequently subcloned into 96-well tissue culture plates. Clones were expanded and analyzed for deleterious editing of the CMTM6 locus by PCR (using primers 5'-GCTACCGGGGACTTCTGGAGTCCG-3' (SEQ ID NO: 4) and 5'- AGAGCCTTGGGACTGAGGGGCCGC-3' (SEQ ID NO:5) and Sanger sequencing of the PCR products using primer 5'-AGAGCCTTGGGACTGAGGGGCCGC-3' (SEQ ID NO:6).

After genotyping, subclones were checked for ploidy using a propidium iodide staining followed by FACS analysis. A clone carrying a deletion of 101 base pairs within the CMTM6 locus that induces a frame-shift in the open reading frame was chosen for mutagenesis and subsequent analysis in the genetic suppressor screen. For the generation of clonal STUB1 knock-out cells, the cells were co-transfected with pX330 encoding an sgRNA targeting the sequence 5 -ACGCTCCGCGGCAATGAGCCTGG-3' (SEQ ID NO: 7) on the non-coding strand in the STUB1 gene along with a plasmid that directs integration of a CMV-driven Blasticidin-S resistance cassette into the disrupted locus (Blomen et al., Science 2015, 350(6264): 1092-6). Loci disrupted in this fashion were amplified using primers 5'- CTGGCACTCTTCCAGCTCCCTGGG-3' (SEQ ID NO:8) and 5'- GTCCTCATAGAGCATGGTGATC-3' (SEQ ID NO: 9) (which binds in the Blasticidin-S resistance gene), and sequenced using the latter primer.

FACS analysis of polyclonal cells transduced with Lenti-CRISPR constructs

For production of lentiviral particles, sgRNA-containing plasmids (pL-CRISPR.EFS.tRFP,

Addgene ID 57819) were transfected into HEK293T cells along with standard lentiviral packaging plasmids (pCMV-dR8.2dVPR, pCMV-VSVg and pAdVAntage). The sequence targeted in STUB1 is 5'-TCGCGATTCGAAGAGCGCTGGGG-3' (SEQ ID NO:10), the sequences targeted in CMTM6 are 5'- TTGAGAACGCGCCGGAGCAATGG-3' (SEQ ID NO:11) and 5'-CCGGGTCCTCCTCCGTAGTGGGG-3' (SEQ ID NO:12). Virus was produced and purified as described for mutagenesis above, except multiple harvests and ultracentrifugation were omitted. Cells were transduced with viral particles at a low multiplicity of infection, yielding a heterogeneous population of transduced and non-transduced cells. For each viral construct, this mixture of cells was expanded, treated with 5 nanogram/milliliter IFNg for 24 hours and stained for PD-L1 at the cell surface (similar as described above). Within each population, the intensity of PD-L1 staining was compared between the cells transduced by lentiviral particles and those that were not (gauged by fluorescence of the lentiviral Cas9-tRFP fusion protein). FACS analysis of clonal cells

Cells or the respective clonal knock-out mutants were transduced with retroviral particles of either pBABE-puro encoding CMTM6 or empty vectors, produced in Hek293T packaging cells co-transfected with the retroviral packaging plasmids also used for gene-trap mutagenesis. After transduction, cells were selected with 1 microgram/milliliter Puromycin (Invivogen) and expanded. One day before FACS analysis, cells were stimulated with 5 nanogram/milliliter I FNg for 24 hours. Cells were then stained for PD-L1 and analyzed by flow cytometry as described above. Immunofluorescent confocal microscopy of cells expressing tagged CMTM6

HEK293T cells were transduced with the retroviral vector pBABE-puro encoding C-terminally FLAG-tagged CMTM6 (pBp-CMTM6-FLAG) or empty vector produced in (separate) HEK293T packaging cells co-transfected with the retroviral packaging plasmids also used for gene-trap mutagenesis. After transduction, cells were selected with 2 microgram/milliliter Puromycin (Invivogen) and expanded. Selected cells were subsequently seeded onto glass slides coated with poly-L-lysine (Sigma), in the presence or absence of 30 nanograms/milliliter I FNg and harvested on the next day after brief addition of AlexaFluor- 647-labeled wheat-germ-agglutinin (Life Technologies) by fixation with PBS containing 4% para-formaldehyde (PFA) for 30 minutes at room temperature.

Subsequently, cells were permeabilized with PBS containing 0.05% v/v Triton X-100 (Sigma) for 10 minutes and then blocked in PBS containing 10% v/v normal goat serum for one hour with agitation. Cells were then incubated with primary antibodies directed against the FLAG epitope (Sigma) as well as the Golgi protein Giantin (Covance) for at least one hour in the presence of 10% normal goat serum. Following three washes with PBS, cells were incubated with fluorescently-labeled secondary antibodies and DAPI in the presence of 10% goat serum for one hour in the dark. After three final washes, the glass slides containing the stained cells were mounted onto cover slips and imaged by confocal microscopy on a Leica-Microsystems confocal microscope using LCS software (Leica-Microsystems, Vienna, Austria).

Protein lysate preparation and immunoblots

Cells for Westernblot analysis were seeded in 6-well plates and cultured in the conditions that are described in the figure legends. To harvest the lysate, the cells were washed with PBS and lysed with RIPA buffer supplemented with protease inhibitor cocktail (#1 1697498001 , Roche). After incubation on ice for 30 minutes, the lysate was subjected to centrifugation at 20,000g for 15 minutes at 4°C. The supernatant was processed with Novex NuPAGE Gel Electrophoresis Systems, according to the manufacturer's instructions (ThermoFisher Scientific).

RNA isolation, First strand cDNA synthesis and qRT-PCR

Total RNA was isolated from the cells using RNeasy Mini Kit (# 74104, Qiagen). cDNA was obtained by reverse transcription using Maxima First Strand cDNA Synthesis Kit for RT-qPCR (#K1672, ThermoFisher Scientific) according to the manufacturer's instructions. SensiFAST SYBR® No-ROX Kit (#BIO-98020, Bioline) was used for RT-PCR gene expression assay carried out on Roche LightCycler® 480 platform. Relative mRNA levels of each gene shown were normalized to the expression of the housekeeping gene GAPDH. Primer sets used in the experiments are as follows:

CMTM6-F:TTCTTCACAGATGAAGGCCA (SEQ ID NO: 13)

CMTM6-R:GCTGCCTACTTTTTCATGGG (SEQ ID NO: 14)

CD274-F:ATTTGGAGGATGTGCCAGAG (SEQ ID NO: 15)

C D274-R : CCAGCACACTGAG AATCAACA (SEQ ID NO: 16)

GAPDH-F:AAGGTGAAGGTCGGAGTCAA (SEQ ID NO: 17)

GAPDH-R: AATGAAGGGGTCATTGATGG (SEQ ID NO: 18) CRISPR qRNA vectors

pLentiCrisprV2 vectors targeting CMTM6 were generated using Gibson assembly cloning method. The gRNA sequence was retrieved from the Brunello library (PubMed 26780180). The following gRNA sequences were used: CMTM6 sgRNA#1 CCATGAAAAAGTAGGCAGCG AGG (SEQ ID NO: 19)

CMTM6 sgRNA#2 CCGGGTCCTCCTCCGTAGTG GGG (SEQ ID NO: 20)

CMTM6 sgRNA#3 GCAAGCCCTTGAGAACGCGC CGG (SEQ ID NO: 21)

CMTM6 sgRNA#4 TCACAATGTACTTTATGTGG AGG (SEQ ID NO: 22)

pLentiCrisprV2 vectors targeting PD-L1 was generated as described on http://genome- engineering.org/gecko/wp-content uploads/2013/12/lentiCRISPRv2-and-lentiGuide-oligo- cloning-protocol.pdf. The following gRNA were used:

PD-L1 sgRNA#1 ACTGCTTGTCCAGATGACTT (SEQ ID NO: 23)

PD-L1 sgRNA#2 CACCACCAATTCCAAGAGAG (SEQ ID NO: 24)

For production of lentiviral particles, the described plasmids were co-transfected into HEK293T cells along with packaging plasmids (psPAX2, pVSV-G). Two days after transfection, lentiviral supernatant was harvested and used for transduction. Two days after transduction cells were selected by exposing them to blasticidin or puromycin.

Antibody staining

Surface levels of PD-L1 were assessed by staining cells with a fluorochrome labeled antibody directed against PD-L1 (ebioscience, clone MI H1 ) at a dilution of 1 : 100 in PBS containing 0.5% w/v bovine serum albumin (Sigma) and 0.2% w/v sodium azide (Sigma). Staining intensity was analyzed on a LSRI I (BD bioscience). Cell lines

A375, DLD1 , Lovo, RKO, H2030 cells were purchased from American Type Culture Collection (ATCC). 8505C was purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DMSZ). A375 cells were cultured in DMEM supplemented with FCS (8%) and penicillin/streptomycin (100U/ml); the other cells were cultured in RPMI supplemented with FCS (8%) and penicillin/streptomycin (100U/ml).

Generation of CMTM6 and PD-L1 KO clones

A375 or 8505c cells were seeded at a density of 10^Λ5 cells per well in a 6 well plate. A day after seeding, cells were transfected with the pLentiCrisprV2 plasmid containing a sgRNA targeting C TM6 or PD-L1. After 24h cells were exposed to puromycin for either 48h (8505c) or 72h (A375). Selected cells were cloned by limiting dilution and clones were checked for gene disruption by sequencing the area targeted by the sgRNA and by Western blotting.

Results

Staining for PD-L1 and flow-cytometric analysis showed that those cells that had received Cas9 (along with a sgRNA), as gauged by red fluorescence, showed increase in PD-L1 staining when STUB1 was targeted or, inversely, a reduction in PD-L1 staining when CMTM6 was targeted. Importantly, these phenotypic changes are not due to technical variation, e.g. in the staining step, as both Cas9-containing and untransduced cells are stained the same reaction, thus making the experiment internally controlled and suitable to measure even small differences in staining intensity.

Furthermore, we observed that the effect of CMTM6 loss on PD-L1 surface levels could be corrected or reversed by complementation of the knock-out cells with exogenous CMTM6, whereas this treatment did not noticeably elevate PD-L1 staining in wild-type (i.e. CMTM6- proficient) HAP1 cells. To determine the generality of CMTM6-mediated PD-L1 regulation, we extended the validation to a variety of cell lines namely A375, 8505C, DLD1 , LOVO, RKO and H2030. In all cases, we observed that shRNA-mediated gene suppression or CRISPR/Cas9-mediated gene disruption of CMTM6 significantly diminishes PD-L1 levels. Diminishment of both IFNg- induced and endogenous PD-L1 expression was observed.

We observed that IFNg-induced PD-L1 up-regulation is reduced in HAP1 cells that express shRNA targeting CMTM6, as shown in Figure 2. Similar results were observed in A375 cells that were infected with two independent lentiviral shRNAs targeting CMTM6 (Figure 3), in 8505C cells in which CMTM6 was down-regulated by RNA interference (Figure 4), in RKO cells in which CMTM6 was down-regulated by RNA interference (Figure 5), in DLD1 cells in which CMTM6 was down-regulated by RNA interference (Figure 6), in LOVO cells in which CMTM6 was down-regulated by RNA interference (Figure 7), in H2030 cells in which CMTM6 was down-regulated by RNA interference (Figure 8). Similar results were obtained when CMT 6 was disrupted by CRISPR technology in A375 cells as well as 8505C cells (data not shown).

Example 3: CMTM6 and/or CMTM4

To investigate whether CMTM6 is unique among CMTM proteins in regulating PD-L1 biology and to identify the cause of the effect of C TM6 deletion on PD-L1 cell surface levels in HAP1 cells, we conducted a haploid genetic modifier screen. For this screen, CMTM6 was knocked-out in HAP1 cells using CRISPR/Cas9. The resulting CMTM6-KO cells were then subjected to genome-wide mutagenesis to generate a library of combinatorial mutants (carrying a mutation in CMTM6 in addition to random mutations in other genes caused by gene-trap integrations). PD-L1 staining and flow-cytometric separation of these cells in a genetic screen yielded a total of 265 significant outliers with an FDR-corrected P-value of smaller than 10E-6, 112 of which occurred in the PD-L1 high population and 153 in the PD-L1 low population. Importantly, this screen also identified STUB1 as a negative regulator of PD- L1 also in the absence of CMTM6. Furthermore, the screen shows that CMTM4, which had no noticeable effect on PD-L1 levels in CMTM6-proficient cells (see Figure 1), stood out as a strong positive PD-L1 regulator in this experiment, as shown in Figure 9, rationalizing the modest effect of CMTM6 depletion on PD-L1 in HAP1 cells (proficient for CMTM4) and indicating that the ability of CMTM6 to regulate PD-L1 is not a unique feature of this member of the CMTM family.

Example 4: Cellular localization of CMT 6 Next, we wondered about the mechanism by which CMTM proteins could affect surface levels of PD-L1. To this end, we expressed FLAG-tagged CMTM6 in HEK293T cells and analyzed the subcellular localization of this protein by confocal microscopy. This showed that next to vesicular structures CMTM6-FLAG signal was most abundant at the perimeter of the cell, especially at sites of membrane protrusions, suggesting that PD-L1 and CMTM6 can both occupy regions of the plasma membrane.

Example 5: Identification of CMT 6 and CMTM4 as PD-L1 protein regulators Summary

The clinical benefit in patients with diverse types of metastatic cancers that is observed upon blockade of the PD-1 - PD-L1 interaction has highlighted the importance of this inhibitory axis in the suppression of tumor-specific T cell responses^1"9. In spite of the key role of PD-L1 expression by cells within the tumor micro-environment, our understanding of the regulation of the PD-L1 protein is limited^10"15. Using a haploid genetic screen, we here identify CMTM6, a type 3 transmembrane protein of previously unknown function, as a regulator of the PD-L1 protein. Interference with CMTM6 expression results in impaired PD-L1 protein expression in all tumor cell types tested and in primary human dendritic cells. Furthermore, through both a haploid genetic modifier screen in CMTM6 deficient cells and genetic complementation experiments, we demonstrate that this function is shared by its closest family member CMTM4, but not by all other CMTM members tested. Notably, CMTM6 increases the PD-L1 protein pool without affecting PD-L1 transcript levels. Rather, we demonstrate that CMTM6 is present at the cell surface, associates with the PD-L1 protein, reduces its ubiquitination and increases PD-L1 protein half-life. Consistent with its role in PD-L1 protein regulation, T cell inhibitory capacity of PD-L1 expressing tumor cells is enhanced by CMTM6. Collectively, our data reveal that PD-L1 relies on CMTM6 and/or CMTM4 to efficiently carry out its inhibitory function, and suggest potential new avenues to block this pathway.

Material and Methods

Cell lines

A375, DLD1 , RKO, H2030, and H2122 cells were purchased from American Type Culture Collection (ATCC). 8505C was purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DMSZ). WM2664 and COL0679 cells were kind gifts from Rene Bernards (The Netherlands Cancer Institute). Short term cell lines from patient derived melanoma xenografts were generated as described— and were a kind gift of Daniel Peeper and Kristel Kemper. HAP1 cells have been described previously—. HAP1 cells were cultured in IMDM (ThermoFisher Scientific) supplemented with 10% fetal calf serum (FCS, Sigma), 100 U/ml penicillin-streptomycin (ThermoFisher Scientific) and L-glutamine (ThermoFisher Scientific); A375 and short term melanoma xenograft cultures were maintained in DMEM supplemented with 10% FCS (Sigma) and 100 U/ml penicillin/streptomycin (ThermoFisher Scientific). All other cell lines were cultured in RPMI supplemented with 10% FCS (Sigma) and 100 U/ml penicillin/streptomycin (ThermoFisher Scientific). IFNy treatment was performed over a period of 48h at a concentration of 25 ng/ml, if not indicated otherwise.

Identification of genetic regulators

The approach as described in Brockmann et al. was followed to identify regulators of PD-L1 abundance. Mutagenized HAP1 libraries (starting with either wild-type cells or CMTM6- deficient HAP1 cells) were expanded to approximately 1.5x10^s cells and subsequently treated with 0.5 ng/ml IFNy (Peprotech) for 24 hours to induce expression of PD-L1. Subsequently, approximately 3x10⁹ cells were dissociated using trypsin-EDTA (Life technologies), washed with PBS and stained with FITC labelled anti-PD-L1 antibody (BD pharmingen) at 1 :20 dilution for 30' at RT in PBS containing 0.5% w/v bovine serum albumin (Sigma) and 0.2% w/v sodium azide (Sigma). Subsequently, cells were washed three times with PBS containing 1 % FCS and stained with FITC labeled polyclonal goat anti-mouse Ig (BD pharmingen) at 1 :100 dilution for 30' at RT in PBS containing 0.5% w/v bovine serum albumin (Sigma) and 0.2% w/v sodium azide (Sigma) to allow signal amplification. Following two washes with PBS containing 1 % FCS and one wash with PBS, stained cells were passed through a 40 μιτι strainer (BD FalconTM) and subsequently fixed using BD fix buffer I (BD biosciences) for 10 minutes at 37°C, followed by a wash with PBS containing 1% FCS.

Subsequently, cells were permeabilized by suspension in cold (-20°C) BD permeabilization buffer (BD biosciences) while vortexing, and incubated on ice for 30 minutes prior to incubation with 100 pg/ml RNAse A (Qiagen, Germany) and 10 pg/ml propidium iodide (Cayman Chemical) at 37°C temperature for 30 minutes. Alternatively, cells were subjected to treatment with 3 μΜ 4',6- diamidino-2-phenylindole (DAPI) for 30 minutes. Stainings were concluded by a final wash in PBS 10% FCS. Following staining, cells were sorted on a Biorad S3 Cell sorter (Biorad) or a Moflo Asterios cell sorter (Beckman Coulter) to collect the 1-5% of cells with the highest and lowest PD-L1 staining intensity and 1 n DNA content. Sorted cells were used for isolation of genomic DNA and retroviral gene-trap insertion sites were retrieved, mapped and analyzed as described in Brockmann et al. For PD-L1 it has been described that alterations of the 3' portion of the gene can stabilize the gene product and lead to higher PD-L1 proteins levels—. As this was also recapitulated by our gene-trap insertion method (gene-trap integrations into the 3' portion of the gene resulting in increased rather than decreased staining intensity for PD-L1), integrations in the portion of the gene that lies downstream of exon 5 (Refseq identifier NM_014143.3) were disregarded where indicated.

Generation of knockout cell lines

Knockout cell lines were generated using the CRISPR/Cas9 system. To generate knockout HAP1 cells, cells were transfected with px330 vector (Addgene #42230) encoding a gRNA for the gene of interest and a vector encoding a gRNA for the zebrafish TIA gene (5'- ggtatgtcgggaacctctcc-3' (SEQ ID NO: 25)), as well as a P2A-blasticidin resistance cassette flanked by two TIA target sites. This allows incorporation of the blasticidin resistance gene into the locus of interest, resulting in a stable knockout, essentially as described—. Following blasticidin selection (10 pg/ml), resistant clones were expanded.

To generate knockout A375 and 8505c cells, cells were transfected with pLentiCRISPRv2 vector (Addgene #52961 ) encoding gRNAs targeting non-overlapping regions of the CMTM6 gene — . Following puromycin selection (2 pg/ml, for 2 days), single cell clones were expanded and gene disruptions were validated by sequencing and Western blot analysis. The gRNA sequence CCGGGTCCTCCTCCGTAGTG (SEQ ID NO:26) was used to generate the A375 CMTM6 knockout clone "CMTM6 KO#6" and the 8505C CMTM6 knockout clone "CMTM6 KO#1 ", the gRNA sequence TCACAATGTACTTTATGTGG (SEQ ID NO: 27) was used to generate the A375 CMTM6 knockout clone "CMTM6 KO#12" and the 8505C CMTM6 knockout clone "CMTM6 KO#3". The gRNA sequence ACTGCTTGTCCAGATGACTT (SEQ ID NO: 28) was used to generate the A375 PD-L1 KO clone and the gRNA sequence GGAGATGGAGAGCTATGATG (SEQ ID NO: 29) was used to generate all the STUB1 KO clones.

Immunoprecipitation, SDS-PAGE and Western blot analysis

Cells for Western blot analysis were seeded in 6-well plates and cultured as described in figure legends. To harvest cell lysates, cells were washed with PBS and lysed with RIPA buffer supplemented with freshly added protease inhibitor cocktail (Roche). After incubation on ice for 30 minutes, cell lysates were subjected to centrifugation at 20,000g for 15 minutes at 4°C. Supernatants were subsequently processed using Novex NuPAGE Gel Electrophoresis Systems, according to the manufacturer's instructions (ThermoFisher Scientific). Cells for (co)immunoprecipitation experiments were seeded in 15-cm dishes and cultured as described in figure legends, using 5 million cells per immunoprecipitation reaction. Cells were washed with cold PBS buffer and lysed in CHAPS buffer (1 % CHAPS, 50 mM TRIS-HCI pH 7.5, 150 tnM NaCI). For the detection of protein ubiquitination, cells were lysed in the denaturing buffer (50 mM Tris-HCI, 0.5 mM EDTA and 1 % SDS) followed by heating at 95 °C for 10 minutes and then quenched by adding 9 volumes of quenching buffer (0.5% Triton X- 100, 20 mM Tris-HCI (pH 8.0), 137 mM NaCI, 10% glycerol, 2 mM EDTA). Protease inhibitor cocktail (Roche) was freshly added to all buffers. Cell lysates were incubated on a rotator for 30 minutes at 4°C, and then centrifuged at 20,000g for 15 minute at 4°C. Supernatants were subsequently processed using Dynabeads® Protein A or Protein G for Immunoprecipitation (ThermoFisher Scientific), and the indicated antibodies. The final elute was processed and Western blot analysis was performed using Novex NuPAGE Gel Electrophoresis Systems, according to the manufacturer's instructions (ThermoFisher Scientific).

Pulse Chase and EndoH-PNGaseF treatment

V5-tagged PD-L1 transduced CMTM6 overexpressing A375 cells, and V5-tagged PD-L1 transduced CMTM6 knockout A375 cells were cultured in methionine- and cysteine-free medium for 1 h at 37°C. Cells were then pulse labeled with 0.5 mCi/ml [³⁵S]Cys/[³⁵S]Met (PerkinElmer) for 1 hour. Cells were washed with PBS to remove residual [³⁵S]Cys/[³⁵S]Met, and then cultured in regular medium with extra 'cold' methionine and cysteine for 0, 1 , 2, 3 and 6h. Cell samples were lysed and used for immunoprecipitation with anti-V5 antibody (ThermoFisher) immobilized on protein A or protein G coated beads (ThermoFisher). Immunoprecipitates were either left untreated or treated with EndoH or PNGaseF (New England Biolabs), according to the manufacturer's instructions.

Immunoprecipitates were run on NuPAGE 4-12% gels. Gels were treated with 1M NaSalicylate pH5.6 before drying, and then analysed on Fujifilm BAS-MP phosphor imager screens. Quantification was performed using a Fujifilm FLA-3000 phosphorimager and AIDA image analyzer software. Gels were exposed to film using intensifier screens at -80 C.

Viral vectors

Lentiviral shRNA vectors were retrieved from the arrayed TRC human genome-wide shRNA collection. Additional information is available at http://www.broadinstitute.org/rnai/public/clone/search using the TRCN number. The following lentiviral shRNA vectors were used: shCMTM6-4: TRCN0000127888

shCMTM6-6: TRCN0000130177

shCMTM4-1 : TRCN0000142717

shCMTM4-2: TRCN0000142470 PD-L1 , PD-1 , PD-L2, CMTM6, CMTM4 and PD-L1 - PD-L2 chimeras expressing lentiviral vectors were generating by insertion of the relevant gblock (IDT) into a pCDH-CMV-MCS- EF1-Puro (CD510B-1 , System Bioscience)-derived vector in which the puromycin resistance cassette was substituted with a blasticidin resistance cassette. PD-L1 - PD-L2 chimeras were generated as follows:

PD-L1 - PD-L2 TM : aa 1 -18 PD-L1 - DYDDDDKD - aa 19-238 PD-L1 - aa 221-242 PD-L2 - aa 263-290 PD-L1

PD-L1 - PD-L2 IC: aa 1-18 PD-L1 - DYDDDDKD - aa 19-262 PD-L1 - aa 246-273 PD-L2 PD-L1 - PD-L2 EC: aa 1 -20 PD-L2 - DYDDDDKD - aa 21 -221 PD-L2 - aa 232-290 PD-L1 , in which DYDDDDKD refers to the sequence of the FLAG epitope tag. For generation of chimeras isoform NP_054862.1 (PD-L1) and N P_079515.2 (PD-L2) were used.

V5 tagged PD-L1 was retrieved from the CCSB-Broad Lentiviral Expression Library (#ccsbBroad304_15876). CMTM family members were ordered as individual gblocks (IDT) coding for the different family members using Ensemble gold transcripts ENST00000379500.6 (CMTM 1), ENST00000268595.2 (CMTM2), ENST00000361909.8 (CMTM3), ENST00000330687.8 (CMTM4), ENST00000339180.8 (CMTM5), ENST00000205636.3 (CMTM6), ENST00000334983.9 (CMTM7), ENST00000307526.3 (CMTM8) c terminally fused with a FLAG tag, preceded by a short AAV-linker and cloned into the pMX-IRES-Blast vector using restriction enzymes Bglll and Sail (CMTM 1 and CMTM4), EcoRI and Notl (CMTM2) or BamHI and Sail (CMTM3, CMTM5, CMTM6, CMTM7, CMTM8). The retroviral vector pBABE-puro encoding C-terminally FLAG-tagged CMTM6 (pBp-CMTM6- FLAG) was generated by cloning a gblock for CMTM6 (ENST00000205636.3) digested with BamHI and Xhol into pBABE-puro digested with BamHI and Sail.

For production of lentiviral particles, the described plasmids were co-transfected into HEK293T cells along with packaging plasmids (pPAX2, pVSV-G). Two days after transfection, lentiviral supernatant was harvested and used for transduction. Retroviral particles were produced and purified as described for HAP1 mutagenesis, except that multiple harvests and ultracentrifugation were omitted. Two days after transduction, cells were selected by exposing them to blasticidin or puromycin.

Antibodies

The following antibodies were used for Western Blot analyses and immunoprecipitations: anti- HSP90: H1 14 (SantaCruz), anti-CMTM6: HPA026980 (Atlas) or anti-CMTM6 monoclonal antibody directed against a peptide in the C-terminal domain of CMTM6 generated by Absea, anti-CMTM4: HPA014704 (Atlas), anti-PD-L1 for Western blot analysis: 405.9A1 1 (Cell Signaling), anti-PD-L1 for immunoprecipitation: E1 L3N (Cell Signaling), normal rabbit IgG: #2729 (Cell Signaling), anti-FLAG tag: M2 (Sigma), anti-V5 tag: R960-25 (Thermofisher), anti- STUB1 sc 133066(Santa Cruz), anti-Ubiquitin antibody #3933 (Cell signaling), Goat anti- mouse IgG (H+L)- HRP conjugate (BIO- RAD), and Goat anti-rabbit IgG (H+L)- HRP conjugate (BIO-RAD). The following antibodies were used for flow cytometry: anti-PD-L1 : M1 H1 (eBioscience), anti-PD-L2: 24F.10C12 (Biolegend), anti-MHC-l: BB7.2 (BD bioscience), anti-murine TCR: H57-597 (BD bioscience), anti-CD8: RPA-T8 (BD bioscience), anti-CD3: SK7 (eBioscience), anti-PD-1 : eBioJ105 (eBioscience), anti-IL-2: 554567 (BD bioscience). The following antibodies were used for immunohistochemistry: anti-PD-L1 : 22C3 (Dako); anti-CMTM6 monoclonal antibody directed against a peptide in the C-terminal domain of CMTM6, was generated by Absea.

RNA isolation, first strand cDNA synthesis and qRT-PCR

Total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen). cDNA was obtained by reverse transcription using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (ThermoFisher Scientific), according to the manufacturer's instructions. SensiFAST SYBR® No-ROX Kit (Bioline) was used for RT-PCR gene expression analysis, carried out on Roche LightCycler® 480 platform. Relative mRNA levels were normalized to GAPDH mRNA levels. Primer sets used were as follows:

CD274-F:ATTTGGAGGATGTGCCAGAG (SEQ ID NO: 30)

C D274-R :CCAGCACACTGAGAATCAACA (SEQ ID NO: 31 )

GAPDH-F:AAGGTGAAGGTCGGAGTCAA (SEQ ID NO: 32)

GAPDH-R:AATGAAGGGGTCATTGATGG (SEQ ID NO: 33).

IL-2 production assay

Human peripheral blood T cells (Sanquin) were activated and transduced with a retroviral vector encoding the MART-I specific 1 D3 TCR as described— and with a lentiviral vector encoding PD-1 , and MART-I TCR and PD-1 expression was validated by flow cytometry. Both 8505c (parental and CMTM6 KO) and A375 cells (parental, PD-L1 overexpressing, and CMTM6KO PD-L1 overexpressing) were pulsed with 10 ng/ml MART- I 2&.35 peptide for 1 hour at 37°C. Next, 1 * 10⁵ transduced cells were incubated with 1 ^χ 10⁵ peptide-pulsed cells or non-pulsed cells in the presence 1 pL/mL Golgiplug (BD Biosciences). After a 5-hour incubation at 37°C, cells were washed and stained with phycoerythrin (PE)-labeled anti murine TCR beta chain, V500 labeled anti-CD8, PerCP Cy5.5 labeled anti-CD3 and PE Cy7 labeled anti-PD-1 , and analyzed for IL-2 production by intracellular cytokine staining. Activity of T cells with different levels of PD-1 expression was analyzed by gating on murine TCR beta chain-positive cells expressing low, intermediate, or high levels of PD-1.

Membrane fractionation and MS analysis

Snap-frozen cell pellets were lysed by gentle homogenization in isotonic buffers supplemented with phosphatase inhibitor (PhosSTOP, Roche) and protease inhibitor (complete mini EDTA-free, Roche). Cellular disruption of >95% was confirmed by microscopy. Plasma membrane (F4), inner membrane (F3) and cytosolic (F1) fractions were prepared by differential centrifugation using a plasma membrane purification kit (Abeam, ab65400).

From fractions F1 , F3 and F4, 20 ug of proteins was diluted 20 times in 50mM ammonium bicarbonate, reduced in 4mM dithiothreitol (DTT), alkylated in 8mM iodoacetamide (IAA), and digested sequentially at 37oC with 1 :75 Lys C (Wako) and 1 :50 trypsin (Sigma-Aldrich) for 4 and 12 hours respectively. Digested peptides were acidified to 0.1 % formic acid (FA) and purified by strong cation exchange (SCX) STAGE tips, using loading buffer 80% acetonitrile (ACN), 0.1 % FA and elution buffer 0.5M ammonium acetate, 20% ACN, 0.1% FA. Eluted peptides were dried by vacuum and 4pg equivalent of peptides was analyzed in a 3hr reverse-phase separation on the UHPLC 1290 system (Agilent) coupled to an Orbitrap Q Exactive HF mass spectrometer (Thermo Scientific). SCX flowthrough from cytosolic fraction (denoted F2) was analysed separately to increase proteome coverage.

RP-nanoLC-MS/MS

Proteomics data were acquired using an UHPLC 1290 system (Agilent) coupled to an Orbitrap Q Exactive HF spectrometer (Thermo Scientific). Peptides were first trapped on a 2 cm x 100 pm Reprosil C18 pre-column (3 μιη) and then separated on a 50 cm x 75 pm Poroshell EC-C18 analytical column (2.7 μιη). Trapping was performed for 10 min in 0.1 M acetic acid (Solvent A) and elution with 80% ACN in 0.1 M acetic acid (Solvent B) in gradients as follows: 10-40% solvent B in 155 min, 40-100% in 3min and finally 100% for 1 min. Flow was passively split to 300 nl/min. MS data were obtained in data-dependent acquisition mode. Full scans were acquired in the m/z range of 375-1600 at the resolution of 35,000 (m/z 400) with AGC target 3E6. Top 15 most intense precursor ions were selected for HCD fragmentation performed at normalized collision energy (NCE) 25%, after accumulation to target value of 5E4. MS/MS acquisition was performed at a resolution of 17,500.

Database search Raw files were processed using MaxQuant version 1.5.3.30 and searched against the human Swissprot database (version May 2016) using Andromeda.

Cysteine carbamidomethylation was set to fixed modification, while variable modifications of methionine oxidation and protein N-terminal acetylation, as well as up to 2 missed cleavages were allowed. False discovery rate (FDR) was restricted to 1 % in both protein and peptide identification. Label-free quantification (LFQ) was performed with "match between runs" enabled. Analysis of CMTM6 RNA levels and correlation between CMTM6 and CD274 RNA levels in TCGA samples

TCGA RNA sequencing data was downloaded from the Broad TCGA genome data analysis center 2015-11-01 release of the standard runs (http://gdac.broadinstitute.org/runs/stddata). For projects where data from multiple sequencing platforms is available, lllumina HiSeq data was preferentially used. The (RSEM) normalized read count field was multiplied by 10^Λ6 to arrive at the reported TPM expression values. Correlation coefficients and associated unadjusted p-values between CMTM6 and CD274 were computed per TCGA sequencing project with Pearson's method. Two-dimensional kernel density estimates were computed using the MASS::kde2d() function in version 3.3.1 of the R programming language. We computed the correlations between CMTM6 and 10⁴ randomly selected genes (identical between sequencing projects) to obtain a reference distribution of correlation coefficients for CMTM6, specific for each TCGA project. The reported empirical p-values are defined as one minus the quantile of the CMTM6 and CD274 correlation within this reference distribution. Immunohistochemistry

Immunohistochemistry of the formalin-fixed paraffin-embedded samples was performed on a BenchMark Ultra autostainer (Ventana Medical Systems). Briefly, 3 Mm paraffin serial sections were cut, heated at 75°C for 28 minutes and deparaffinised in the instrument with EZ prep solution (Ventana Medical Systems). Heat-induced antigen retrieval was carried out using Cell Conditioning 1 (CC1 , Ventana Medical Systems) for 48' for PD-L1 , and 64' for CMTM6 antibodies at 95°C.

PD-L1 clone 22C3 (Dako) was used at 1 :40 dilution, 1 hour at room temperature and CMTM6 clone 1 D6 was used directly from hybridoma supernatant at either 1 :500 or 1 : 1000 dilution for tumor samples and 1 : 100 dilution for cell lines, 1 hour at room temperature. Bound antibody was detected using the OptiView DAB Detection Kit (Ventana Medical Systems). Slides were counterstained with Hematoxylin and Bluing Reagent (Ventana Medical Systems). Patient melanoma samples were obtained (following Institutional Review Board approval) from the NKI-AVL pathology archive biobank and selected for PD-L1 expression.

Statistical analysis

All student T tests were two tailed under the assumption of equal variance between samples. Results

Antibodies that block the PD-1 - PD-L1 axis are currently evaluated in approximately 800 clinical studies and have been approved for 7 different tumor types. In addition, expression of PD-L1 on either tumor cells or on tumor-infiltrating immune cells identifies patients that are more likely to respond to these therapies^{16 7}. In view of the limited understanding of the regulation of PD-L1 expression, we set out to identify PD-L1 protein regulators through genetic screening. Interferon gamma (I FNy) treated haploid HAP1 cells^{18 19} express high levels of cell surface PD-L1 (Extended Data Fig. 6- 1 a). Based on this observation, we performed a fluorescence activated cell sorting (FACS)-based haploid genetic screen for PD- L1 modulators in I FNy treated HAP1 (Fig. 6- 1 a, experimental outline as in ²⁰). The entire I FNyR signaling pathway²¹ plus IRF1 , a known regulator of PD-L1 upon I FNy exposure¹⁰ were identified as strong hits (Fig. 6- 1a, Supplementary table 1), demonstrating the validity of the screen setup. In addition, the PD-L1 gene itself (CD274) showed a strikingly different integration pattern in PD-L1 ^HI and PD-L1 ^L0 cells. Specifically, whereas PD-L1 ^L0W cells showed the expected enrichment of integrations towards the 5' end of the gene, a strong enrichment of integrations in intron 5 and 6 was observed in PD-L1 ^HI cells (Extended Data Fig. 6- 1 b), fully consistent with the recently described negative regulatory role of the PD-L1 3' UTR (Extended Data Fig. 6- 1c).

In addition to the above hits, we identified CKLF (Chemokine-like factor)-like MARVEL transmembrane domain containing family member 6 (CMTM6) as one of the most significant hits within PD-L1 ^LOW cells. CMTM6 was not observed in a similar screen for regulators of I RF1 protein levels²⁰, suggesting that its role was independent of the IFNyR pathway. CMTM6 is a ubiquitously expressed transmembrane protein that belongs to a family of 8 MARVEL domain-containing proteins²² for which no clear function has been described. Transcriptome analysis of tumor samples in The Cancer Genome Atlas (TCGA) showed CMTM6 expression in all of the analyzed samples distributed across 30 cancer types, and showed that RNA expression levels of CMTM6 and CD274 are weakly correlated in the majority of tumor types (Extended Data Fig. 6- 2). shRNA mediated knockdown of CMTM6 in HAP1 cells reduced IFNy-induced PD-L1 expression approximately 2-fold as compared to control (Fig. 6- 1 b,c). To assess whether CMTM6 also influences PD-L1 cell surface levels beyond the HAP1 system, we examined the effect of CMTM6 knockdown in a series of tumor lines. In A375 melanoma cells, which only show detectable PD-L1 expression after IFNy exposure, CMTM6 knockdown prevented IFNv-induced PD-L1 expression to a large extent (Fig. 6- 2a-c, reduction up to 11 fold). CMTM6-deficient A375 clones generated with CRISPRs/Cas9 likewise showed reduced cell surface and overall PD-L1 protein levels, while lentiviral reconstitution of CMTM6 reverted this phenotype (Fig. 6- 2d,e). In the 8505C thyroid cancer cell line that shows a high basal level of PD-L1 expression, both steady state and IFNy- induced PD-L1 cell surface and total protein levels were substantially reduced by CMTM6 knockdown (Fig. 6- 2 f, g, up to 7- and 5-fold). In total, we assessed the effect of CMTM6 knockdown in 12 human tumor lines, representing melanoma (Fig. 6- 2a-c, Extended Data Fig. 6- 3a-d), thyroid cancer (Fig. 6- 2 f, g), colorectal cancer (Extended Data Fig. 6- 3 e, f, i, k), lung cancer (Extended Data Fig. 6- 3 I, n-p) and CML (Fig. 6- 1 b, c), and also in three short term cultures of melanoma xenografts (Extended Data Fig. 6- 3 q), and consistently observed diminished expression of PD-L1 (between 2 and 11 fold) upon knockdown of CMT 6. Reduced PD-L1 cell surface levels were likewise observed when cells were stained with recombinant PD-1-Fc protein (Extended Data Fig. 6- 3 h, j, m). PD-L1 can both be expressed by cancer cells and by infiltrating immune cells, and PD-L1 expression on immune cells may contribute to T cell inhibition^16,17. To assess whether CMTM6 also influences PD-L1 levels in primary human dendritic cells (DCs), we generated DCs from human bone marrow (BM) progenitors²³. Comparison of LPS-induced PD-L1 expression in control and CMTM6 knockdown DCs showed that partial knockdown of CMTM6 resulted in partial reduction of PD-L1 cell surface levels (Fig. 6- 2 h, i). The above data establish CMTM6 as a modulator of PD-L1 protein levels. Whereas in some tumor lines, the effect of CMTM6 knockdown is profound (e.g. A375, 8505c), in others it is moderate (e.g. HAP1), suggesting the possible existence of (an) additional regulator(s). We therefore generated CMTIVI6-knockout HAP1 cells and performed a modifier screen, with the aim to identify genetic factors that selectively regulate PD-L1 in the absence of CMTM6. Consistent with the primary screen, genes mediating IFNyR signaling were prominent hits. As expected, in this setting, integrations within the CMTM6 locus were no longer enriched within the PD-L1 ^LOW cell population (Fig. 6- 3 a, Supplementary table 2). Strikingly, in CMTM6- deficient HAP1 cells, CMTM4, another member of the CMTM family with 55% homology to CMTM6 was identified as a positive regulator of PD-L1 expression (Fig. 6- 3 a). Notably, while CMTM4 is a highly significant hit in CMTM6-deficient HAP1 cells (36.7-fold, FCPv≤10^{" 314}), it is not in CMTM6 proficient HAP1 cells (0.9-fold, FCPv = 0.94789), suggesting that in this system, CMTM4 functions as a back-up regulator of PD-L1 expression. To validate these data, we transduced H2030 cells, in which CMTM6 depletion modestly suppresses PD-L1 expression and CMTM4 is highly expressed, with shRNAs for CMTM4 and CMTM6, either separately or in combination. In these cells, silencing of CMTM6 led to repression of IFNy-induced PD-L1 expression that was further enhanced when CMTM4 was simultaneously targeted (Fig. 6- 3 b, Extended Data Fig. 6- 4 a). More directly, ectopic expression of CMTM4 could fully restore IFNy-induced PD-L1 expression in CMTM6- knockout cells (Extended Data Fig. 6- 4 b, c). Additionally, increasing the levels of CMTM6 and CMTM4 also increases the levels of PD-L1 (Extended Data Fig. 6- 4 b, c). To understand whether regulation of PD-L1 expression is a specific property of CMTM6 and CMTM4, we individually introduced FLAG-tagged versions of all CMTM family members into CMTM6- deficient A375 cells. Contrary to what was observed upon CMTM6 and CMTM4 introduction, expression of other CMTM members (detected for CMTM 1 , 3, 5, and 7, Extended Data Fig. 6- 4 d, e) did not induce a substantial increase in PD-L1 expression, as assessed by either flow cytometry or Western blot analysis (Fig. 6- 3 c, d).

To study the mechanism by which CMTM6 regulates PD-L1 levels, we first assessed the relationship between CMTM6 expression and PD-L1 mRNA levels. Comparison of PD-L1 mRNA levels and cell surface protein levels at different time points after IFNy stimulation revealed that while CMTM6 depletion greatly reduced PD-L1 cell surface levels, induction of PD-L1 mRNA by IFNy was not substantially altered (Fig. 6- 4 a, b; Extended Data Fig. 6- 5 d). Notably, both in cell lines (Extended Data Fig. 6- 5 a) and in primary DCs (Extended Data Fig. 6- 5 b, c) levels of MHC-I and PD-L2 protein were not significantly affected by CMTM6 inhibition, indicating that while CMTM6 regulates PD-L1 at the protein level, it is not a general regulator of protein translation or stability.

To determine where in the PD-L1 protein life cycle CMTM6 exerts its effect, CMTM6-deficient and CMTM6-overexpressing A375 cells were transduced with a V5-tagged PD-L1 gene. Immunoprecipitation of PD-L1-V5 at different time points after a 1-h ³⁵S pulse labeling demonstrated a much more rapid decay of PD-L1 in the absence of CMTM6 (fraction PD-L1 remaining at t= 6h; 94% versus 8%, Fig. 6- 4 c; Extended Data Fig. 6- 5 e). Notably, PD-L1 resistance to deglycosylation by Endoglycosidase H, was equally efficient in both cell populations, indicating that CMTM6 influences PD-L1 protein fate after egress from the endoplasmic reticulum (Extended Data Fig. 6- 5 f). To reveal the cellular localization of endogenous CMTM6, we performed mass spectrometry analysis of different subcellular fractions, demonstrating that endogenous CMTM6 is predominantly present within the plasma membrane fraction (Extended Data Fig. 6- 6 a). In addition, immunohistochemical analysis confirmed the presence of CMTM6 at the cell membrane (Extended Data Fig. 6-6 b). Furthermore, immunohistochemical analysis of 9 melanomas revealed CMTM6 protein expression in human tumors, and also showed that PD- L1 staining in 8 of these samples was restricted to areas with clear CMTM6 expression (Extended Data Fig. 6- 6 c). Similarly, in 3 out of 5 PD-L1 positive lung cancer samples, we observed PD-L1 localization in CMTM6 positive areas.

A hypothesis arising from the above data is that CMTM6 and PD-L1 could interact molecularly. To test this, we performed immunoprecipitations of PD-L1 followed by Western blot analysis of CMTM6, and vice versa. In lysates from A375 cells or 8505C cells, anti-PD-L1 antibody co-immunoprecipitated CMTM6. Likewise, PD-L1 was present in anti-CMTM6 immunoprecipitates. As expected, co-immunoprecipitation of PD-L1 and CMTM6 in A375 was dependent upon PD-L1 induction by IFNy. As a further control for antibody specificity, co- immunoprecipation of both CMTM6 and PD-L1 was abrogated upon gene inactivation of the partner molecule (Fig. 6- 4 d; Extended Data Fig. 6- 7 a, b). Co-immunoprecipitation was likewise observed for PD-L1 and CMTM4, and CMTM4 and 6 (Extended data Fig. 6- 7 c, d).

To understand how CMTM6 influences PD-L1 degradation, wild type, CMTM6 KO, and CMTM6 overexpressing A375 were transduced with a V5-tagged PD-L1 gene and ubiquitination of PD-L1 was analyzed. In the absence of CMTM6, the amount of ubiquitinated PD-L1 was increased, in spite of the overall lower PD-L1 levels (Fig. 6- 4 e; Extended Data Fig. 6-8 a), suggesting that CMTM4 and/or CMTM6 may protect PD-L1 from ubiquitination. Intriguingly, STUB1 , an E3 ubiquitin ligase that has amongst others been implicated in degradation of Foxp3 in regulatory T cells²⁴, was identified as a negative regulator of PD-L1 expression in both haploid genetic screens (Extended Data Fig. 6- 8b, c). To assess whether STUB1 affects PD-L1 degradation, we disrupted STUB1 in either CMTM6 proficient or deficient A375 cells. Deletion of STUB1 resulted in a more profound increase in PD-L1 levels in CMTM6 deficient than in CMTM6 proficient cells, identifying STUB1 as an E3 ligase that causes destabilization of PD-L1 (Fig. 6- 4 f, g), either by direct modification of one of the lysines in the PD-L1 cytoplasmic domain or indirectly. Those data, additionally, would suggest a functional connection between STUB1 and CMTM6, as the effect of STUB1 depletion is of greater magnitude in a CMTM6 deficient than in a CMTM6 proficient context (Fig. 6- 4 f, g). Consistent with the model that CMTM6 may protect PD-L1 by preventing ubiquitination, PD- L1/L2 fusion proteins are only influenced by CMTM6 when carrying the PD-L1 transmembrane and intracellular domain (Extended Data Fig. 6- 8 d, e), and the PD-L1 transmembrane domain is required for efficient co-immunoprecipitation (Extended Data Fig. 6- 8 f). In line with the role of the PD-L1 transmembrane and intracellular domain in CMTM6- mediated stabilization, orientation mapping of CMTM6 revealed that a large part of the molecule is located within the cytosol and cell membrane (Extended Fig. 6- 9).

In view of the broad RNA expression pattern of CMTM6, we wished to assess the effects of CMTM6 on the membrane proteome in an unbiased manner. Mass spectrometric analysis of a series of independent CMTM6 deficient and proficient clones revealed that, both within the RKO colorectal cancer line and the 8505c thyroid cancer cell line, PD-L1 was the most significantly influenced hit (Fig. 6- 4 h, I; Extended Data Fig. 6- 10 a, b). Expression of PD-L1 affects T cell responsiveness in a quantitative manner, with higher levels of PD-L1 expression leading to an increased impairment of T cell survival/ activity^{11 25}. To determine whether CMTM6 influences PD-L1 mediated T cell suppression, we incubated mixtures of MART-I TCR transduced T cells that expressed different levels of PD-1 with antigen-loaded CMTM6- deficient or -proficient 8505C or A375 cells. IL-2 production of PD-1 ^{I TER} and PD-1^HI T cells upon encounter of CMTM6-proficient tumor cells was reduced relative to that of PD-1 ^NEG T cells. However, upon CMTM6 disruption in either 8505C or A375 tumor cells, IL-2 production of PD-1 expressing T cells was significantly restored (Fig. 6- 4 j; Extended Data Fig. 6- 10 c- e).

Recent work has revealed a number of mechanisms of transcriptional and post-transcriptional (dys)regulation of the PD-L1 gene in tumor cells^10"15. Here we identify CMTM6 and CMTM4 as regulators of PD-L1 protein stability. Based on the available data we conclude that CMTM6 and/or CMTM4, the two most closely related members of the CMTM family (Extended Data Fig. 6- 4 f), influence PD-L1 expression across a range of cell types. Furthermore, the observations that I) CMTIV16 affects PD-L1 protein stability at late time points after biosynthesis, II) CMTM6, CMTM4 and PD-L1 interact, as shown by co-immunoprecipitation, III) CMTM6 is largely located at the cell surface collectively sketch a model in which CMTM6 interacts with PD-L1 at the tumor cell surface and thereby protects it from degradation.

In line with this, CMTM6 influences the levels of PD-L1 ubiquitination and absence of the STUB1 E3 ubiquitin ligase partially reverts the CMTM6 KO phenotype. Intriguingly, for one of the other CMTM family members, CMTM7, cell surface expression has been described in association with the B cell receptor (BCR) complex, where it may contribute to BCR signaling²⁸. It could be speculated that CMTM6 may also fulfill a similar role in the immunological synapse between T cells and tumor cells or antigen presenting cells (APCs). Finally, the co-localization of PD-L1 and CMTM6 in melanoma samples and the observation that CMTM6 depletion ameliorates PD-L1 mediated T cell suppression suggest a potential value of CMTM6 and/or CMTM4 as therapeutic targets, either in isolation, or to enhance the effectiveness of the current PD-L1/PD-1 blocking therapies.

References cited in Example 5

1 Topalian, S. L. et al. Safety, activity, and immune correlates of anti-PD-1 antibody in cancer. The New England journal of medicine 366, 2443-2454, doi: 10.1056/NEJMoa 200690 (2012).

2 Brahmer, J. R. et al. Safety and activity of anti-PD-L1 antibody in patients with advanced cancer. The New England journal of medicine 366, 2455-2465, doi: 10.1056/NEJMoa1200694 (2012).

3 Ansell, S. M. et al. PD-1 blockade with nivolumab in relapsed or refractory Hodgkin's lymphoma. The New England journal of medicine 372, 31 1-319, doi: 10.1056/NEJMoa1411087 (2015).

4 Powles, T. et al. MPDL3280A (anti-PD-L1) treatment leads to clinical activity in metastatic bladder cancer. Nature 515, 558-562, doi: 10.1038/nature13904 (2014).

5 Garon, E. B. et al. Pembrolizumab for the treatment of non-small-cell lung cancer. The New England journal of medicine 372, 2018-2028, doi:10.1056/NEJMoa1501824 (2015).

6 Le, D. T. et al. PD-1 Blockade in Tumors with Mismatch-Repair Deficiency. The New England journal of medicine 372, 2509-2520, doi:10.1056/NEJMoa1500596 (2015).

7 Motzer, R. J. et al. Nivolumab versus Everolimus in Advanced Renal-Cell Carcinoma. The New England journal of medicine 373, 1803-1813, doi: 10.1056/NEJMoa1510665 (2015).

8 Nghiem, P. T. et al. PD-1 Blockade with Pembrolizumab in Advanced Merkel-Cell Carcinoma. The New England journal of medicine 374, 2542-2552, doi: 10.1056/NEJMoa1603702 (2016).

9 Ferris, R. L. et al. Nivolumab for Recurrent Squamous-Cell Carcinoma of the Head and Neck. The New England journal of medicine, doi:10.1056/NEJMoa1602252 (2016).

10 Lee, S. J. et al. Interferon regulatory factor-1 is prerequisite to the constitutive expression and IFN-gamma-induced upregulation of B7-H1 (CD274). FEBS letters 580, 755- 762, doi:10.1016/j.febslet.2005.12.093 (2006).

11 Kataoka, K. et al. Aberrant PD-L1 expression through 3'-UTR disruption in multiple cancers. Nature 534, 402-406, doi: 10.1038/nature18294 (2016).

12 Casey, S. C. et al. MYC regulates the antitumor immune response through CD47 and PD-L1. Science (New York, N.Y.) 352, 227-231 , doi:10.1126/science.aac9935 (2016).

13 Dorand, R. D. et al. Cdk5 disruption attenuates tumor PD-L1 expression and promotes antitumor immunity. Science (New York, N.Y.) 353, 399-403, doi:10.1126/science.aae0477 (2016). 14 Li, C.-W. et al. Glycosylation and stabilization of programmed death ligand-1 suppresses T-cell activity. Nature communications 7, 12632, doi:10.1038/ncomms12632 (2016).

15 Lim, S. O. et al. Deubiquitination and Stabilization of PD-L1 by CSN5. Cancer cell, doi: 10.1016/j.ccell.2016.10.010 (2016).

16 Herbst, R. S. et al. Predictive correlates of response to the anti-PD-L1 antibody MPDL3280A in cancer patients. Nature 515, 563-567, doi:10.1038/nature14011 (2014).

17 Ribas, A. & Hu-Lieskovan, S. What does PD-L1 positive or negative mean? The Journal of experimental medicine, doi: 10.1084/jem.20161462 (2016).

18 Carette, J. E. et al. Haploid genetic screens in human cells identify host factors used by pathogens. Science (New York, N.Y.) 326, 1231-1235, doi:10.1126/science.1 178955 (2009).

19 Carette, J. E. et al. Ebola virus entry requires the cholesterol transporter Niemann- Pick Cl Nature 477, 340-343, doi:10.1038/natu re 10348 (2011).

20 Brockmann, M. et al. Genetic wiring maps of single-cell protein states reveal an off- switch for GPCR signalling. Nature, doi:10.1038/nature22376 (2017).

21 Platanias, L. C. Mechanisms of type-l- and type-ll-interferon-mediated signalling. Nature reviews. Immunology 5, 375-386, doi: 10.1038/nri1604 (2005).

22 Han, W. et al. Identification of eight genes encoding chemokine-like factor superfamily members 1-8 (CKLFSF1-8) by in silico cloning and experimental validation. Genomics 81 ,

609-617 (2003).

23 Xiao, Y. et al. Identification of the Common Origins of Osteoclasts, Macrophages, and Dendritic Cells in Human Hematopoiesis. Stem cell reports 4, 984-994, doi: 10.1016/j.stemcr.2015.04.012 (2015).

24 Chen, Z. et al. The ubiquitin ligase Stubl negatively modulates regulatory T cell suppressive activity by promoting degradation of the transcription factor Foxp3. Immunity 39, 272-285, doi: 10.1016/j.immuni.2013.08.006 (2013).

25 Wei, F. et al. Strength of PD-1 signaling differentially affects T-cell effector functions. Proceedings of the National Academy of Sciences of the United States of America 110, E2480-2489, doi: 10.1073/pnas.1305394110 (2013).

26 Miyazaki, A., Yogosawa, S., Murakami, A. & Kitamura, D. Identification of CMTM7 as a transmembrane linker of BLNK and the B-cell receptor. PloS one 7, e31829, doi: 10.1371/journal.pone.0031829 (2012).

27 Benjamini, Y. & Hochberg, Y. Controlling the False Discovery Rate: A Practical and Powerful Approach to Multiple Testing. Journal of the Royal Statistical Society. Series B

(Methodological) 57, 289-300 (1995). 28 Jorritsma, A. et al. Selecting highly affine and well-expressed TCRs for gene therapy of melanoma. Blood 110, 3564-3572, doi:10.1182/blood-2007-02-075010 (2007).

29 Kemper, K. et al. Intra- and inter-tumor heterogeneity in a vemurafenib-resistant melanoma patient and derived xenografts. EMBO molecular medicine 7, 1104-1 118, doi: 10.15252/emmm.201404914 (2015).

30 Lackner, D. H. et al. A generic strategy for CRISPR-Cas9-mediated gene tagging. Nature communications 6, 10237, doi:10.1038/ncomms10237 (2015).

31 Doench, J. G. et al. Optimized sgRNA design to maximize activity and minimize off- target effects of CRISPR-Cas9. Nature biotechnology 34, 184-191 , doi:10.1038/nbt.3437 (2016).

Claims

1. A method for screening for a compound capable of modulating immune activity, the method comprising:

(a) contacting a cell expressing a CMTM6 and/or CMTM4 protein(s)

with a test compound;

(b) measuring the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) in said cell; and

(c) selecting a test compound modulating the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) compared to the expression level or activity measured in the absence of the test compound,

wherein the test compound is a compound capable of decreasing immune activity if the test compound increases the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) and

wherein the test compound is a compound capable of increasing immune activity if the test compound decreases the level of expression or activity of the CMTM6 and/or CMTM4 protein(s).

2. A method for screening for a compound capable of modulating the level of expression of the PD-L1 protein in a cell, the method comprising:

(a) contacting a cell expressing a CMTM6 and/or CMTM4 protein(s) with a test compound;

(b) measuring the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) in said cell; and

(c) selecting a test compound modulating the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) compared to the expression level or activity measured in the absence of the test compound,

wherein the test compound is a compound capable of increasing the level of expression of the PD-L1 protein if the test compound increases the level of expression or activity of the CMTM6 and/or CMTM4 protein(s) and

wherein the test compound is a compound capable of decreasing the level of expression of the PD-L1 protein if the test compound decreases the level of expression or activity of the CMTM6 and/or CMTM4 protein(s).

3. The method for screening of any one of the previous claims wherein measuring the level of expression or activity of a protein of the CMTM6 and/or CMTM4 protein(s) involves measuring the level of gene expression, the level of mRNA, the level of protein, the level of cell surface protein, activity of the protein or, phosphorylation status of the CMTM6 and/or CMTM4 protein(s) .

4. The method for screening of any one of the previous claims wherein the immune activity is mediated by a T cell, preferably an effector T cell, wherein the immune activity comprises secretion of cytokines, preferably IFN gamma, and TNF alpha, secretion of chemokines, preferably CXCL9 and CXCL10, and secretion of perforin-granzymes, following binding of a T cell receptor to a peptide:MHC complex on a target cell.

5. The method for screening of any one of the previous claims wherein the level of expression of the PD-L1 protein is the level of cell surface expression of the PD-L1 protein.

6. The method for screening of any one of the previous claims, wherein the method is screening for a compound capable of modulating PD-1/PD-L1 axis signaling, and/or capable of modulating immune activity.

7. The method for screening of any one of the previous claims, wherein the method further comprises measuring immune activity and/or measuring the level of expression of the PD-L1 protein and/or PD-1/PD-L1 axis signaling in the presence of the compound selected in (c).

8. A method for screening for a compound capable of modulating the expression and/or activity of CMTM6 and/or CMTM4 protein(s) , the method comprising:

(x) contacting a cell expressing PD-L1 protein and expressing a CMTM6 and/or CMTM4 protein(s) with a test compound;

(y) measuring the level of expression of the PD-L1 protein, optionally the level of cell-surface expression of PD-L1 protein; and

(z) selecting a test compound modulating the level of expression of PD-L1 protein as compared to a cell contacted with the test compound, wherein the cell is expressing PD-L1 protein but is not expressing said CMTM6 and/or CMTM4 protein(s) ,

wherein the test compound is a compound capable of decreasing the expression and/or activity of the CMTM6 and/or CMTM4 protein(s) if the test compound decreases the expression of PD-L1 and

wherein the test compound is a compound capable of increasing the expression and/or activity of the CMTM6 and/or CMTM4 protein(s) if the test compound increases the expression of PD-L1

9. An in vitro method for modulating PD-L1 protein expression and/or PD-1/PD-L1 axis signaling in a cell, the method comprising modulating the expression or activity of a CMTM6 and/or CMTM4 protein(s) .

10. The in vitro method for modulating PD-L1 protein expression and/or PD-1/PD-L1 axis signaling in a cell according to claim 9,wherein PD-L1 protein expression and/or PD-1/PD-L1 axis signaling is increased when the level of expression or activity of a CMTM6 and/or CMTM4 protein(s) is increased and/or

wherein PD-L1 protein expression and/or PD-1/PD-L1 axis signaling is decreased when the level of expression or activity of a CMTM6 and/or CMTM4 protein(s) is decreased.

11. The in vitro method for modulating PD-L1 protein expression and/or PD-1/PD-L1 axis signaling in a cell according to any one of claimslO -11 , wherein modulating PD-L1 protein expression and/or PD-1/PD-L1 axis signaling is performed by treating the cells in the presence of a compound identified with the method for screening according to any one of claims 1-8 and/or by treating the cells with a siRNA, shRNA, TALENs, MEGATALENs, CRISPR or Zinc finger nucleases directed to silence expression of a gene encoding a CMTM6 and/or CMTM4 protein(s) .

12. A modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) for use in modulating immune activity, PD-1/PD-L1 axis signaling and/or PD-L1 protein expression in a patient in need thereof,

wherein the modulator is a modulator that increases immune activity, decreases PD-1/PD-L1 axis signaling and/or decreases PD-L1 protein expression when the modulator decreases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s) and

wherein the modulator is a modulator that decreases immune activity, increases PD-1/PD-L1 axis signaling and/or increases PD-L1 protein expression when the modulator increases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s).

13. A modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) for use in immunotherapy, immunotherapy in a cancer patient, preferably a patient suffering from a cancer selected from melanoma, lung cancer, bladder cancer, Gl tract cancer, HNSCC, and Hodgkin's lymphoma, or for use in the treatment of an autoimmune disease, preferably systemic lupus erythematosus, rheumatoid arthritis, and type 1 diabetes.

wherein the modulator is a modulator that increases immune activity, decreases PD-1/PD-L1 axis and/or decreases PD-L1 protein expression when the modulator decreases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s)and wherein the modulator is a modulator that decreases immune activity, increases PD-1/PD-L1 axis signaling and/or increases PD-L1 protein expression when the modulator increases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s).

14. A modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) for use according to any one of claims 12-13, wherein the treatment also involves the use of a PD-1/PD-L1 axis binding antagonist and/or agonist.

15. Use of a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) for modulating immune activity, PD-1/PD-L1 axis signaling and/or PD-L1 protein expression

wherein the modulator is a modulator that increases immune activity, decreases PD-1/PD-L1 axis signaling and/or decreases PD-L1 protein expression when the modulator decreases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s)and

wherein the modulator is a modulator that decreases immune activity, increases PD-1/PD-L1 axis signaling and/or increases PD-L1 protein expression when the modulator increases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s).

16. An antibody against a CMTM6 and/or CMTM4 protein(s) for use in the treatment of a disorder that benefits from an increase in immune activity, decrease of PD-1/PD-L1 axis signaling and/or decrease of PD-L1 protein expression, preferably wherein said disorder is a cancer.

17. Method for the treatment of a disorder that benefits from an increase of immune activity, decrease of PD-1/PD-L1 axis signaling and/or decrease of PD-L1 protein expression, preferably wherein said disorder is a cancer, the method comprises administering to a human in need of such treatment a therapeutically effective amount of

- a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) , wherein the modulator decreases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s).

18. Method for the treatment of a disorder that benefits from a decrease of immune activity, increase of PD-1/PD-L1 axis signaling and/or increase of PD-L1 protein expression, preferably wherein said disorder is an auto-immune disease, the method comprises administering to a human in need of such treatment a therapeutically effective amount of - a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) , wherein the modulator increases the expression and/or activity of the CMTM6 and/or CMTM4 protein(s).

19. Method of promoting health, the method comprises communicating to a target audience, the use of a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) for treating an individual with a disease or disorder that benefits from the modulation of immune activity, PD-1/PD-L1 axis signaling and/or PD-L1 protein expression.

20. Use of a CMTM6 and/or CMTM4 protein(s) for modulating immune activity, PD-L1 expression, PD-L1 protein expression and/or PD-1/PD-L1 axis signaling.

21. A method for predicting immune activity towards cancer cells in a patient, the method comprising measuring the level of expression and/or activity of a CMTM6 and/or CMTM4 protein(s) in cancer cells and/or cancer-infiltrating cells obtained from said patient, wherein increased expression/ activity of the CMTM6 and/or CMTM4 protein(s) is predictive for poor activity of the T-cell towards the cancer cell and wherein decreased expression and/or activity of the CMTM6 and/or CMTM4 protein(s) is predictive for strong immune activity towards cancer cells.

22. The method for predicting immune activity towards cancer cells in a patient according to claim 21 , wherein the method is used to determining likelihood that the patient will exhibit benefit from treatment with a PD-1/PD-L1 axis binding antagonist and/or exhibit benefit from treatment with a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) .

23. A method for predicting immune activity towards cells in a patient suffering from an autoimmune disease, the method comprising measuring the level of expression and/or activity of a CMTM6 and/or CMTM4 protein(s) in the cells obtained from said patient, wherein decreased expression and/or activity of the CMTM6 and/or CMTM4 protein(s) is predictive for strong activity of the T-cell towards the cells and wherein increased expression and/or activity of the CMTM6 and/or CMTM4 protein(s) is predictive for poor activity of the T-cell towards the cells.

24. The method for predicting immune activity towards cells in a patient suffering from an autoimmune disease according to any one of claims 21-23, wherein the method is used to determining likelihood that the patient will exhibit benefit from treatment with a PD-1/PD-L1 axis binding agonist and/or exhibit benefit from treatment with a modulator of the expression and/or activity of a CMTM6 and/or CMTM4 protein(s) .

25. A method for screening for a compound for treatment of cancer or infection, characterized by using CMTM6 and/or CMT 4.

26. The method of claim 25, wherein the method of screening comprises the step of (a) contacting a cell expressing CMTM6 and/or CMTM4 with a test compound;

(b) measuring the level of expression or activity of CMTM6 and/or CMTM4; and

(c) selecting a test compound modulating the level of expression or activity of CMTM6 and/or CMTM4 compared to the expression level or activity measured in the absence of the test compound,

wherein the test compound is a compound for treatment of cancer or infection if the test compound decreases the level of expression or activity of CMTM6 and/or CMTM4.

27. A method for screening for a compound for treatment of a disease, preferably selected from the group consisting of cancer and infection, or a condition that benefits from upregulation or enhancement of an immune response, wherein the method is characterized by utilizing the interaction between PD-L1 and CMTIW6 and/or CMT 4, preferably wherein the method comprises comparing the interaction between PD-L1 and CMTM 6 and/ CMTM4 in the absence and presence of the compound to be screened.

28. A immune checkpoint inhibitor for use in the treatment of a disease, wherein in the treatment also involves the use of a compound that decreases the level of expression or activity of CMTM6 and/or CMTM4, preferably wherein the compound is an inhibitor or antagonist of CMTM6 and/or CMTM4.

29. The immune checkpoint inhibitor for use in the treatment of a disease according claim 28, wherein the compound is an antibody against CMTM6 and/or CMTM4.

30. The immune checkpoint inhibitor for use in the treatment of a disease according to any one of claims 28-29, wherein the disease is a disease that benefits from decreased PD-1/PD- L1 axis signaling and/or that benefits from upregulation or enhancement of an immune response function.

31. The immune checkpoint inhibitor for use in the treatment of a disease according to any one of claims 28-30, wherein the disease is cancer or infection.

32. The immune checkpoint inhibitor for use in the treatment of a disease according to any one of claims 28-31 , wherein the immune checkpoint inhibitor is an inhibitor of PD-1 , PD-

L1 , CTLA-4 or CD47.

33. The immune checkpoint inhibitor for use in the treatment of a disease according to any one of claims 28-32, wherein the treatment also involves the use of a cytotoxic agent and/or chemotherapeutic agent.

34. A method for increasing ubiquitination of PD-L1 , wherein the method comprises inhibiting the expression or activity of CMTM6 and/or CMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, , preferably wherein the inhibitor or antagonist is an antibody.

35. A method for decreasing half-life of PD-L1 , wherein the method comprises inhibiting the expression or activity of CMTM6 and/or CMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody.

36. A method for reducing PD-1/PD-L1 signaling, wherein the method comprises inhibiting the expression or activity of CMTM6 and/or CMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody.

37. A method for upregulation or enhancement of an immune response function, wherein the method comprises inhibiting the expression or activity of CMTM6 and/or CMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody.

38. A method for reducing expression of PD-L1 , preferably of cell-surface PD-L1 , wherein the method comprises inhibiting the expression or activity of CMTM6 and/orCMTM4, preferably by providing or administering an inhibitor or antagonist of CMTM6 and/or CMTM4, preferably wherein the inhibitor or antagonist is an antibody.

39. A method according to any one of claims 34 - 38, further comprising providing or administering an immune checkpoint inhibitor and/or a cytotoxic agent and/or chemotherapeutic agent.