WO2018053457A1 - Méthodes de modification génétique de levure pour produire des variants de levure - Google Patents

Méthodes de modification génétique de levure pour produire des variants de levure Download PDF

Info

Publication number
WO2018053457A1
WO2018053457A1 PCT/US2017/052128 US2017052128W WO2018053457A1 WO 2018053457 A1 WO2018053457 A1 WO 2018053457A1 US 2017052128 W US2017052128 W US 2017052128W WO 2018053457 A1 WO2018053457 A1 WO 2018053457A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
nucleic acid
flanking
gene
endonuclease restriction
Prior art date
Application number
PCT/US2017/052128
Other languages
English (en)
Other versions
WO2018053457A9 (fr
Inventor
Christian Schroeder KAAS
Alejandro Chavez
Xiaoge GUO
Original Assignee
President And Fellows Of Harvard College
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by President And Fellows Of Harvard College filed Critical President And Fellows Of Harvard College
Publication of WO2018053457A1 publication Critical patent/WO2018053457A1/fr
Publication of WO2018053457A9 publication Critical patent/WO2018053457A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/26—Preparation of nitrogen-containing carbohydrates
    • C12P19/28—N-glycosides
    • C12P19/30—Nucleotides
    • C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides

Definitions

  • Gene drives are generally known as genetic elements that skew the natural odds in their favor of being inherited and passed on by progeny. Examples include homing endonuclease genes that copy themselves into chromosomes lacking them, segregation distorters that destroy competing chromosomes during meiosis, transposons that insert copies of themselves elsewhere in the genome, Medea elements that eliminate competing siblings who do not inherit them, and maternally heritable microorganisms such as Wolbachia that induce cytoplasmic incompatibility to favor the spread of infected individuals. Because they circumvent the normal rules of natural selection, all of these elements have been considered as potential "gene drive” systems capable of spreading engineered modifications through insect vector populations to block the spread of disease.
  • Homing endonuclease based gene drives have been proposed as a means of genetically controlling malaria mosquito populations. See Windbichler et al., Nature, doi:10.1038/nature09937 (2011). Site-specific selfish genes have been proposed as tools for the control and genetic engineering of natural populations. See Burt, Proc. R. Soc. Lond. B (2003) 270, 921-928 (2003).
  • gene drives are limited in their ability to rapidly and efficiently introduce genetically altered variants in a given population. A need therefore exists to develop gene drives which can target any desired gene and allow for rapid and efficient generation of genetically altered variants in a given population.
  • the present disclosure provides for methods of making a plurality of genetically altered proliferating cells based on gene drive, which has been shown to violate Mendelian inheritance allowing for dominant inheritance of drives upon mating of the cells.
  • aspects of the present disclosure are directed to engineered foreign nucleic acid sequences containing RNA guided gene drives.
  • These foreign nucleic acid sequences are synthesized as substrate bound oligonucleotide sequences which are stably introduced into the genomes of proliferating cells, such as yeast cells. Through rounds of mating and sporulation, a plurality of genetically altered yeast cell variants are generated.
  • the cell progeny may have one or more desired traits resulting from expression of the foreign nucleic acid.
  • the foreign nucleic acid sequence encodes at least an RNA guided DNA binding protein, such as one or more of an RNA guided DNA binding protein nuclease, an RNA guided DNA binding protein nickase or a nuclease null RNA guided DNA binding protein fused to a cleavage domain such as a nuclease or nickase domain, and one or more or a plurality of guide RNAs (ribonucleic acids).
  • a guide RNA is complementary to DNA (deoxyribonucleic acid), such as a target DNA in the genome of a proliferating cell.
  • the foreign nucleic acid sequence also encodes at least one or more promoters such that the proliferating cell may express the RNA guided DNA binding protein and the guide RNAs or any other nucleic acid sequence or gene which may be in the foreign nucleic acid sequence.
  • promoters such that the proliferating cell may express the RNA guided DNA binding protein and the guide RNAs or any other nucleic acid sequence or gene which may be in the foreign nucleic acid sequence.
  • suitable promoters based on the present disclosure and the particular cell.
  • the foreign nucleic acid sequence may also include any other nucleic acid sequence or sequences known to those of skill in the art to be required for expression of the foreign nucleic acid sequence by a proliferating cell.
  • the foreign nucleic acid sequence may also include any other gene sequence or gene sequences desired to be expressed by the cell.
  • Such a gene sequence or such gene sequences may be referred to as "cargo sequence” or “cargo DNA.” It is to be understood that one of skill will readily be able to identify one or more gene sequences depending upon the desired trait one of skill wishes to be exhibited by the cell or the organism developed from the cell when the cell expresses the foreign nucleic acid sequence.
  • the foreign nucleic acid sequence also encodes at least two flanking sequences which flank at least the RNA guided DNA binding protein nuclease and the one or more guide RNAs. As known to those of skill in the art, flanking sequences are placed at opposite ends of a particular nucleic acid sequence such that the particular nucleic acid sequence is between the flanking sequences.
  • flanking sequences include at least a sequence which is identical to a corresponding sequence on a selected chromosome. According to one aspect, such flanking sequences allow a cell to insert the foreign nucleic acid sequence into its genomic DNA at a cut site using well-understood mechanisms such as homologous recombination or nonhomologous end joining.
  • RNA guided DNA binding protein and one or more or a plurality of guide RNAs are produced.
  • the RNA guided DNA binding protein and a guide RNA produces a complex of the RNA guided DNA binding protein, the guide RNA and a double stranded DNA target sequence.
  • the RNA is said to guide the DNA binding protein to the double stranded DNA target sequence for binding thereto.
  • This aspect of the present disclosure may be referred to as co-localization of the RNA and DNA binding protein to or with the double stranded DNA.
  • DNA binding proteins within the scope of the present disclosure may include those which create a double stranded break (which may be referred to as a DNA binding protein nuclease), those which create a single stranded break (referred to as a DNA binding protein nickase) or those which have no nuclease activity (referred to as a nuclease null DNA binding protein) but otherwise bind to target DNA.
  • the foreign nucleic acid sequence may encode one or more of a DNA binding protein nuclease, a DNA binding protein nickase or a nuclease null DNA binding protein fused to a cleavage domain such as a nuclease or a nickase domain.
  • the foreign nucleic acid sequence may also encode one or more transcriptional regulator proteins or domains or one or more donor nucleic acid sequences that are intended to be inserted into the genomic DNA.
  • the foreign nucleic acid sequence encoding an RNA guided nuclease-null DNA binding protein which is fused to a cleavage domain may further encode the transcriptional regulator protein or domain fused to the RNA guided nuclease-null DNA binding protein.
  • the foreign nucleic acid sequence encoding one or more RNAs further encodes a target of an RNA-binding domain and the foreign nucleic acid encoding the transcriptional regulator protein or domain further encodes an RNA-binding domain fused to the transcriptional regulator protein or domain.
  • expression of a foreign nucleic acid sequence by a cell may result in a double stranded break, a single stranded break and/or transcriptional activation or repression of the genomic DNA.
  • Donor DNA may be inserted at the break site by cell mechanisms such as homologous recombination or nonhomologous end joining. It is to be understood that expression of a foreign nucleic acid sequence as described herein may result in a plurality of double stranded breaks or single stranded breaks at various locations along target genomic DNA, including one or more or a plurality of gene sequences, as desired.
  • aspects of the present disclosure are directed to using the foreign nucleic acid sequence as a gene drive.
  • the concept of a gene drive is known to those of skill in the art and refers to a foreign nucleic acid sequence which when expressed is capable of inserting itself into the genome of the cell into which it has been introduced.
  • the concept of a gene drive is provided in Windbichler et al., Nature, doi:10.1038/nature09937 (2011) and Burt, Proc. R. Soc. Lond. B (2003) 270, 921-928 (2003) each of which is hereby incorporated by reference in their entireties.
  • the foreign nucleic acid sequences described herein act as gene drives when introduced into a cell.
  • the foreign nucleic acid sequence is expressed by the cell to produce an RNA guided DNA binding protein and a guide RNA.
  • the guide RNA is complementary to a target DNA sequence on a chromosome.
  • the RNA guided DNA binding protein and the guide RNA co-localize to the target DNA, and the target DNA is cleaved in a site specific manner.
  • the target DNA may be a target DNA site on one or both chromosomes of a chromosome pair.
  • the foreign nucleic acid sequence is then inserted into the genomic DNA at the target DNA cut site, for example, by homologous recombination.
  • the foreign nucleic acid sequence may be inserted into the genomic DNA at one or both chromosomes of a chromosome pair if each chromosome has been cleaved in a site specific manner by the RNA guided DNA binding protein. If inserted into both chromosomes of a chromosome pair, then the cell is homozygous for the foreign nucleic acid sequence. In an alternate embodiment, the foreign nucleic acid sequence is inserted into a first chromosome of a chromosome pair. The inserted foreign nucleic acid sequence is then expressed by the cell and the RNA guided DNA binding protein and the guide
  • RNA co-localize at or to a second chromosome of a chromosome pair which is then cleaved in a site specific manner, just as was the first chromosome.
  • the cleaved target DNA in the second chromosome is then repaired, for example by homologous recombination, using the first chromosome as a template.
  • the second chromosome is repaired to include the foreign nucleic acid sequence resulting in a cell that is homozygous for the foreign nucleic sequence, i.e., the foreign nucleic acid sequence is present in both the first and second chromosome of the chromosome pair.
  • the mechanisms by which cells repair damaged, cleaved or cut genomic DNA are well known.
  • aspects of the present disclosure take advantage of these cell mechanisms in combination with DNA binding protein nucleases or nickases to create a gene drive with desired foreign genetic material that inserts into the genomic DNA of cells wherein the cell becomes homozygous for the foreign genetic material.
  • a population of transgenic organisms having one or more desired traits can be generated when the foreign genetic material is introduced into a germline cell of the organism. In the case of yeast, through rounds of mating and sporulation, a plurality of genetically altered yeast cell variants are generated.
  • a method of making a plurality of substrate bound oligonucleotide sequences for insertion into corresponding vectors includes synthesizing the plurality of oligonucleotide sequences with each oligonucleotide sequence including at least one unique guide RNA spacer sequence and a plurality of endonuclease restriction sites, wherein each oligonucleotide sequence includes first flanking outer endonuclease restriction sites, second flanking inner endonuclease restriction sites, flanking random primer binding sites and a unique gene drive component flanked by the flanking random primer binding sites, wherein the unique gene drive component includes in series, an upstream target nucleic acid flanking sequence, a third endonuclease restriction site, the at least one unique guide RNA spacer sequence having a sequence complementary to a target nucleic acid sequence, a fourth endonuclease restriction site and a downstream target nucleic acid flanking sequence, and wherein the
  • a method of making a plurality of vectors with each vector of the plurality including a unique gene drive component includes removing a plurality of bound oligonucleotide sequences from a substrate using a first endonuclease, wherein each substrate bound oligonucleotide sequence includes at least one unique guide RNA spacer sequence and a plurality of endonuclease restriction sites, wherein each substrate bound oligonucleotide sequence includes first flanking outer endonuclease restriction sites, second flanking inner endonuclease restriction sites, flanking random primer binding sites and the unique gene drive component flanked by the flanking random primer binding sites, wherein the unique gene drive component includes in series, an upstream target nucleic acid flanking sequence, a third endonuclease restriction site, the at least one unique guide RNA spacer sequence having a sequence complementary to a target nucleic acid sequence, a fourth endonuclease restriction site and
  • a method of making a plurality of vectors with each vector of the plurality including a unique gene drive includes providing a plurality of vectors with each vector of the plurality including an oligonucleotide sequence including first flanking endonuclease restriction sites, flanking random primer binding sites and a unique gene drive component flanked by the flanking random primer binding sites, wherein the unique gene drive component includes in series, an upstream target nucleic acid flanking sequence, a second endonuclease restriction site, at least one unique guide RNA spacer sequence having a sequence complementary to a target nucleic acid sequence, a third endonuclease restriction site and a downstream target nucleic acid flanking sequence, wherein the first flanking endonuclease restriction sites, the second endonuclease restriction site, and the third endonuclease restriction site are different, and creating the plurality of vectors with each vector of the plurality including a unique gene drive by (1) cutting
  • a method of making a plurality of genetically altered proliferating cells includes combining a plurality of proliferating cells including a target gene sequence with a plurality of vectors with each vector of the plurality including an oligonucleotide sequence including first flanking endonuclease restriction sites, flanking random primer binding sites and a unique gene drive flanked by the flanking random primer binding sites, wherein the unique gene drive includes in series, an upstream target genomic nucleic acid flanking sequence, a guide RNA promoter, at least one unique guide RNA sequence having a spacer sequence complementary to the target genomic nucleic acid sequence, an optional cargo sequence, and a downstream target genomic nucleic acid flanking sequence, wherein corresponding cells of the plurality of proliferating cells each receive a single vector, wherein the corresponding cells each include an RNA guided DNA binding protein, and wherein the guide RNA is produced and a colocalization complex of the guide RNA and the RNA guided DNA binding protein forms
  • the disclosure provides a substrate having a plurality of substrate bound oligonucleotide sequences for insertion into corresponding vectors, with each oligonucleotide sequence including at least one unique guide RNA spacer sequence and a plurality of endonuclease restriction sites, wherein each oligonucleotide sequence includes first flanking outer endonuclease restriction sites, second flanking inner endonuclease restriction sites, flanking random primer binding sites and a unique gene drive component flanked by the flanking random primer binding sites, wherein the unique gene drive component includes in series, an upstream target nucleic acid flanking sequence, a third endonuclease restriction site, the at least one unique guide RNA spacer sequence having a sequence complementary to a target nucleic acid sequence, a fourth endonuclease restriction site and a downstream target nucleic acid flanking sequence, and wherein the first flanking outer endonuclease restriction sites, the second flanking inner endonuclease
  • the disclosure further provides a modified donor method for improved chromosomal integration efficiency of gene drives into cells such as yeast cells.
  • cells such as yeast cells.
  • Two linear fragments are prepared from a donor plasmid vector including a gene drive.
  • the two linear fragments are transformed into the proliferating cells.
  • the two linear fragments undergo homologous recombination to generate a stably inherited circular plasmid after being transformed into the cells.
  • the modified donor method results in improved transformation efficiency of about 10, 100, to 1000 fold.
  • the modified donor method results in 100% integration efficiency of the gene drive at the desired locus.
  • a method of making a genetically altered proliferating cell comprises providing to the proliferating cell including a target gene sequence with a vector including an oligonucleotide sequence including first flanking endonuclease restriction sites, flanking random primer binding sites and a unique gene drive flanked by the flanking random primer binding sites, wherein the unique gene drive includes in series, an upstream target genomic nucleic acid flanking sequence, a guide RNA promoter, at least one unique guide RNA sequence having a spacer sequence complementary to the target genomic nucleic acid sequence, an optional cargo sequence, and a downstream target genomic nucleic acid flanking sequence, wherein the proliferating cell includes an RNA guided DNA binding protein, and wherein the guide RNA is produced and a colocalization complex of the guide RNA and the RNA guided DNA binding protein forms at the target genomic nucleic acid sequence and the target genomic nucleic acid sequence is cut and the unique gene drive is inserted therein to produce the genetically altered proliferating cell
  • the disclosure provides a plurality of vectors with each vector of the plurality includes an oligonucleotide sequence according to the present disclosure.
  • the disclosure further provides a cell including a vector including an oligonucleotide sequence according to the present disclosure.
  • FIGS. 1A-1B show the difference of Mendelian and biased inheritance in Yeast (Saccharomyces cerevisiae).
  • Gene drives are able to selfishly drive themselves through a population of cells thus when two haploid cells each with drives mate to produce a diploid cell and the diploid cell subsequently sporulates and produces haploid cells, all of their progeny will inherit both drives, in contrast to standard Mendelian inheritance in which only 25% of the progeny receive both genes (FIG. 1A). This feature is what enables gene drives to rapidly propagate through a population of sexually reproducing cells at high efficiency (FIG. IB).
  • FIGS. 3A-3G show a schematic of a general strategy for construction of gene drive from OLS array.
  • FIG. 3A An ssDNA oligo is synthesized containing the variable sequence constituting a gene drive including e.g., upstream flanking sequence, targeting sequence and downstream flanking sequence.
  • FIG. 3B This oligo is amplified into a dsDNA PCR product.
  • FIG. 3C The dsDNA PCR product is then digested with a restriction enzyme insertion of the oligo into a plasmid backbone.
  • FIGS. 3D-3E The dsDNA PCR product is then digested with a restriction enzyme insertion of the oligo into a plasmid backbone.
  • the plasmid is then linearized by another restriction enzyme to insert cargo sequence and promoter sequence for expression of the guide RNA and then linearized again by a 3 rd enzyme to insert the guide RNA scaffold and cargo sequence.
  • FIGS. 3F-3G The final gene drive construct is then amplified using standard primers flanking the entire gene drive and subsequent enzymatic digestion remove the general sequence flanking the gene drive exposing the flanking sequence.
  • FIG. 4 depicts general building blocks for insertion into oligo based gene drives.
  • Promoter (left) and guide RNA scaffold + terminator (right) sequences are shown with different cargo examples.
  • the sequences are flanked by type 2 restriction sites for standardized insertion into plasmids.
  • FIGS. 5A-5C show integration of a gene drive for promoter swapping in yeast cells.
  • FIG. 5A shows a schematic of a gene drive designed for targeting upstream of the initiation codon of the ADE2 gene in a yeast cell expressing Cas9. Following the introduction of a double stranded break the gene drive is wedged in between the native promoter and the ADE2 coding region.
  • FIG. 5B shows that if the gene drive does not contain a selection marker inside the gene drive element, a low insertion efficiency is observed as compared to inserting a selection marker inside the gene drive (red colonies represent successful integration).
  • FIG. 5A shows a schematic of a gene drive designed for targeting upstream of the initiation codon of the ADE2 gene in a yeast cell expressing Cas9. Following the introduction of a double stranded break the gene drive is wedged in between the native promoter and the ADE2 coding region.
  • FIG. 5B shows that if the gene drive does not contain a selection marker inside the gene drive element,
  • yeast cells containing no gene drives display white phenotype on both rich media (YPD) and minimal media with galactose (MM+Galactose).
  • yeast cells containing a gene drive upstream of ADE2 without a new promoter being added the phenotype is red (indicating the cells do not express ADE2) on both types of media.
  • yeast cells containing a gene drive where the gene drive inserts a GAL7 promoter upstream of the ADE2 gene the phenotype is red on YPD and white on minimal media with galactose (indicating the cells do no express ADE2 on YPD media but will produce ADE2 on galactose media).
  • FIGS. 6A-6C show enriching for haploid and diploid cells using counter selectable markers.
  • FIG. 6A is a graph that shows that in order to cycle gene drives into yeast cells, the haploid yeast cells are mated to yield diploid yeast cells, which will subsequently sporulate and produce haploid yeast cells.
  • FIG. 6B shows that enriching is done by using haploid specific promoters which select for haploid yeast cells in media without Tryptophan (due to inactive transcription of TRPl) and uracil (due to inactive transcription of URA3); whereas diploid yeast cells can be selected for in media with 5-FOA (toxic to cells expressing URA3) and 5- FAA (toxic to cells expressing TRPl).
  • FIG. 6C shows that the selection is shown to be most efficient when both 5-FAA and 5-FOA are added in the same mixture.
  • FIGS. 7A-7B show a comparison of transformation efficiency between yeast transformed with circular plasmid (Fig. 7A) and yeast transformed with linearized fragments (Fig. 7B).
  • the present disclosure provides methods of making a plurality of genetically altered proliferating cells based on the technology of gene drive.
  • Gene drives have been shown to violate Mendelian inheritance allowing for biased inheritance of drives upon mating.
  • Yeast cell e.g., Saccharomyces cerevisiae, is able to grow as haploid with either mating type a or a.
  • Yeast cells of opposite mating types can be mated giving rise to diploid yeast cells that can later be sporulated to produce haploid yeast cells again.
  • a diverse population of yeast cells each containing one gene drive are allowed one cycle of mating and sporulation each member of the population would then contain two gene drives.
  • gene drives can be engineered to alter and edit target genes and/or sequences of a cell or an organism that mainly reproduce sexually, such as yeast, fungi, insects, animals and plants.
  • the disclosure provides that a particular gene drive component can be synthesized in an oligonucleotide sequence.
  • the oligonucleotide sequence includes additional sequences such as endonuclease restriction sites and primer binding sites for cloning and amplification.
  • the disclosure provides a method of making a plurality of substrate bound oligonucleotide sequences for insertion into corresponding vectors including synthesizing the plurality of oligonucleotide sequences with each oligonucleotide sequence including at least one unique guide RNA spacer sequence and a plurality of endonuclease restriction sites, wherein each oligonucleotide sequence includes first flanking outer endonuclease restriction sites, second flanking inner endonuclease restriction sites, flanking random primer binding sites and a unique gene drive component flanked by the flanking random primer binding sites, wherein the unique gene drive component includes in series, an upstream target nucleic acid flanking sequence, a third endonuclease restriction site, the at least one unique guide RNA spacer sequence having a sequence complementary to a target nucleic acid sequence, a fourth endonuclease restriction site and a downstream target nucleic acid flanking sequence, and wherein the first flank
  • the plurality of oligonucleotide sequences is made by array-based oligonucleotide synthesis including but are not limited to semiconductor-based electrochemical-synthesis process, photolithographic techniques, inkjet printing, and successively reacting nucleotide monomers.
  • the plurality of oligonucleotide sequences is made using monomer by monomer oligonucleotide synthesis.
  • sequences amenable for cloning of the gene drive component through vectors can be included in the oligonucleotide sequences containing the gene drive component. These additional sequences can include but are not limited to endonuclease restriction sites.
  • each endonuclease restriction site of the plurality of endonuclease restriction sites is a member selected from the group consisting of type II restriction endonucleases such as Acul, Alwl, Bael, Bbsl, Bbvl, Bed, BceAI, Bcgl, BciVI, BcoDI, BfuAI, Bmrl, Bpml, BpuEI, Bsal, BsaXI, BseRI, Bsgl, BsmAI, BsmBI, BsmFI, Bsml, BspCNI, BspMI, BspQI, BsrDI, Bsrl, BtgZI, BtsCI, Btsl, BtsIMutI, CspCI, Earl, Ecil, Faul, Fokl, Hgal, Hphl, HpyAV, MboII, Mlyl, Mmel, Mnll, NmeA
  • the present disclosure contemplates inserting the oligonucleotide sequence containing the gene drive into the target genome.
  • the insertion is via homologous recombination.
  • the upstream target nucleic acid flanking sequence and the downstream target nucleic acid flanking sequence are complementary to corresponding sequences between an endogenous promoter and a corresponding endogenous gene within a target cell.
  • the upstream target nucleic acid flanking sequence and the downstream target nucleic acid flanking sequence are complementary to corresponding sequences between gene coding regions of an endogenous gene within a target cell.
  • the disclosure provides that the number of oligonucleotide sequences depends on the particular gene drives and the size of the target genome and target genes.
  • the plurality of oligonucleotide sequences includes between 2 and 250,000, between 10 and 100,000, between 20 and 6,000, between 50 and 1,000, and between 100 and 500 oligonucleotide sequences.
  • a method of making a plurality of vectors with each vector of the plurality including a unique gene drive component including removing a plurality of bound oligonucleotide sequences from a substrate using a first endonuclease, wherein each substrate bound oligonucleotide sequence includes at least one unique guide RNA spacer sequence and a plurality of endonuclease restriction sites, wherein each substrate bound oligonucleotide sequence includes first flanking outer endonuclease restriction sites, second flanking inner endonuclease restriction sites, flanking random primer binding sites and the unique gene drive component flanked by the flanking random primer binding sites, wherein the unique gene drive component includes in series, an upstream target nucleic acid flanking sequence, a third endonuclease restriction site, the
  • the present disclosure provides a method of making a plurality of vectors with each vector of the plurality including a unique gene drive including providing a plurality of vectors with each vector of the plurality including an oligonucleotide sequence including first flanking endonuclease restriction sites, flanking random primer binding sites and a unique gene drive component flanked by the flanking random primer binding sites, wherein the unique gene drive component includes in series, an upstream target nucleic acid flanking sequence, a second endonuclease restriction site, at least one unique guide RNA spacer sequence having a sequence complementary to a target nucleic acid sequence, a third endonuclease restriction site and a downstream target nucleic acid flanking sequence, wherein the first flanking endonuclease restriction sites, the second endonuclease restriction site, and the third endonuclease restriction site are different, and creating the plurality of vectors with each vector of the plurality including a unique gene drive by (1) cutting each oligonucle
  • a method of making a plurality of genetically altered proliferating cells including combining a plurality of proliferating cells including a target gene sequence with a plurality of vectors with each vector of the plurality including an oligonucleotide sequence including first flanking endonuclease restriction sites, flanking random primer binding sites and a unique gene drive flanked by the flanking random primer binding sites, wherein the unique gene drive includes in series, an upstream target genomic nucleic acid flanking sequence, a guide RNA promoter, at least one unique guide RNA sequence having a spacer sequence complementary to the target genomic nucleic acid sequence, an optional cargo sequence, and a downstream target genomic nucleic acid flanking sequence, wherein corresponding cells of the plurality of proliferating cells each receive a single vector, wherein the corresponding cells each include an RNA guided DNA
  • the method further includes a first round step of mating the plurality of genetically altered proliferating cells among themselves to produce a plurality of first round variant cells with each variant having two unique gene drives.
  • the method further includes a second round step of mating the plurality of first round variant cells among themselves to produce a plurality of second round variant cells with each variant having four unique gene drives.
  • the method further includes a third round step of mating the plurality of second round variant cells among themselves to produce a plurality of third round variant cells with each variant having eight unique gene drives.
  • the method further includes a fourth round step of mating the plurality of third round variant cells among themselves to produce a plurality of fourth round variant cells with each variant having sixteen unique gene drives.
  • the method further includes subsequent rounds of mating the plurality of previous round variant cells among themselves to produce a plurality of variant cells with each variant having amplified gene drives before equilibrium is attained.
  • the proliferating cell type is a member of the group consisting of genus Saccharomyces, genus Schizosaccharomyces), genus Kluveromyces, genus Candida and Pichia pastoris. In other embodiments, the proliferating cell type is a member of the group consisting of Aspergillus nidulans, A. oryza, A. niger, and A. sojae.
  • a substrate having a plurality of substrate bound oligonucleotide sequences containing the gene drive are provided according to the disclosure.
  • the disclosure provides a plurality of vectors with each vector of the plurality including an oligonucleotide sequence containing the gene drive is provided according to the disclosure.
  • the vector is a plasmid or any other genetic element that can be propagated in a bacterial host.
  • each vector of the plurality including an oligonucleotide sequence including first flanking endonuclease restriction sites, flanking random primer binding sites and a unique gene drive flanked by the flanking random primer binding sites, wherein the unique gene drive includes in series, an upstream target genomic nucleic acid flanking sequence, a guide RNA promoter, at least one unique guide RNA sequence having a spacer sequence complementary to the target genomic nucleic acid sequence, an optional cargo sequence, and a downstream target genomic nucleic acid flanking sequence.
  • the disclosure provides a cell including a vector including an oligonucleotide sequence containing the gene drive according to the disclosure.
  • Proliferating cell types or organisms useful in the methods described herein are those which proliferate at a rate sufficient to carry out experiments in a desirable period of time.
  • exemplary proliferating cell types are capable of switching between a haploid and a diploid state.
  • Exemplary eukaryotic cells include yeast strains or fungus strains.
  • Exemplary yeast strains include Saccharomyces cerevisia (and subtypes such as S288C, CEN.PK etc), genus Saccharomyces (e.g., S. cerevisiae, S. bayanus, S. boulardii, S. pastorianus, S. rouxii and S. uvarum), Schizosaccharomyces (e.g., S. pombe), Kluveromyces (e.g., K. lactis and K. fragilis), genus Candida (C. albicans, C. krusei and C. tropicalis) and Pichia pastoris and the like.
  • Saccharomyces cerevisia and subtypes such as S288C, CEN.PK etc
  • genus Saccharomyces e.g., S. cerevisiae, S. bayanus, S. boulardii, S. pastorianus, S. rouxii and S. uvarum
  • Exemplary fungus strains include Aspergillus nidulans, A. oryza, A. niger, A. sojae and the like.
  • Exemplary eukaryotic organisms potentially include all sexually mating eukaryotic organisms which include but are not limited to Drosophila melanogaster, Caenorhabditis elegans, Mus musculus, Rattus norvegicus and the like.
  • cargo sequences can be used to insert, delete, and/or modulate the target gene or sequences in the cell or for screening and/or selection of the cells containing the gene drive.
  • the cargo sequence is a target gene promoter.
  • the cargo sequence is a target gene.
  • the cargo sequence is a nucleic acid sequence encoding an RNA guided DNA binding protein.
  • the cargo sequence is a nucleic acid sequence encoding a fluorescent protein allowing for screening of organism carrying the gene drive.
  • the cargo sequence is a nucleic acid sequence encoding a fluorescent protein fused to a target protein at the C-terminal or N-terminal region.
  • the cargo sequence is a nucleic acid sequence encoding a scaffold domain fused to a target protein at the C-terminal or N-terminal region, wherein the scaffold domain confers binding property to the target protein for phenotype analysis.
  • the cargo sequence is a nucleic acid sequence encoding a regulatory subunit fused to a target protein at the C-terminal or N-terminal region, wherein the regulatory subunit creates novel regulatory phenotype of the target gene expression.
  • the cargo sequence is a nucleic acid sequence containing restriction sites allowing removal of the cargo sequence at a later stage.
  • the cargo sequence is a nucleic acid sequence encoding an altered endogenous untranslated region of a target gene changing the transcription and/or translation efficiency of the target gene.
  • the cargo sequence is a nucleic acid sequence encoding a Cas9 protein.
  • the cargo sequence is a nucleic acid sequence encoding a Cas9 enzyme, a Cas9 nickase, a nuclease null Cas9 fused to a cleavage domain, a nuclease null Cas9 or a nuclease null Cas9 with a transcriptional modulator attached thereto.
  • the disclosure provides that the engineered gene drive oligonucleotide sequences will be delivered into a sexually proliferating cell type where the RNA guided DNA binding protein such as endonuclease Cas9 will cut the chromosomes at a specific site.
  • the cell will repair the damage by copying the drive sequence onto the damaged chromosome. This is derived from genome editing techniques and similarly relies on the fact that double strand breaks are most frequently repaired by homologous recombination if a template is present, and less often by non-homologous end joining.
  • the cell then has two copies of the drive sequence.
  • yeast cells may be genetically modified using methods known to those of skill in the art including by LiAc, Electroporation, Biolistic transformation as described in Kawai S, Hashimoto W, Murata K. Transformation of Saccharomyces cerevisiae and other fungi: Methods and possible underlying mechanism. Bioengineered Bugs. 2010;l(6):395-403 hereby incorporated by reference in its entirety.
  • the RNA guided DNA binding protein can be provided to a cell by genetically modifying the cell to include a nucleic acid encoding the RNA guided DNA binding protein or otherwise providing a vector or plasmid encoding the RNA guided DNA binding protein wherein the nucleic acid is expressed to produce the RNA guided DNA binding protein.
  • the RNA guided DNA binding protein may also be provided to the cell as a native protein, i.e. not as a product of expression of a nucleic acid sequence. Methods of providing an RNA guided DNA binding protein to a cell are known in the art.
  • Nucleic acids within cells of a pool of proliferating cells may be amplified using methods known to those of skill in the art.
  • Exemplary amplification methods include contacting a nucleic acid with one or more primers that specifically hybridize to the nucleic acid under conditions that facilitate hybridization and chain extension.
  • Exemplary methods for amplifying nucleic acids include the polymerase chain reaction (PCR) (see, e.g., Mullis et al. (1986) Cold Spring Harb. Symp. Quant. Biol. 51 Pt 1 :263 and Cleary et al. (2004) Nature Methods 1 :241; and U.S. Patent Nos.
  • isothermal amplification e.g., rolling circle amplification (RCA), hyperbranched rolling circle amplification (HRCA), strand displacement amplification (SDA), helicase-dependent amplification (HDA), PWGA
  • RCA rolling circle amplification
  • HRCA hyperbranched rolling circle amplification
  • SDA strand displacement amplification
  • HDA helicase-dependent amplification
  • PWGA any other nucleic acid amplification method using techniques well known to those of skill in the art.
  • Nucleic acids within cells of a pool of proliferating cells may be sequenced using methods known to those of skill in the art such as high throughput disclosed in Mitra (1999) Nucleic Acids Res. 27(24):e34; pp.1-6. Sequencing methods useful in the present disclosure include Shendure et al., Accurate multiplex polony sequencing of an evolved bacterial genome, Science, vol. 309, p. 1728-32. 2005; Drmanac et al., Human genome sequencing using unchained base reads on self-assembling DNA nanoarrays, Science, vol. 327, p. 78-81.
  • Exemplary next generating sequencing methods known to those of skill in the art include Massively parallel signature sequencing (MPSS), Polony sequencing, pyrosequencing (454), Illumina (Solexa) sequencing by synthesis, SOLiD sequencing by ligation, Ion semiconductor sequencing (Ion Torrent sequencing), DNA nanoball sequencing, chain termination sequencing (Sanger sequencing), Heliscope single molecule sequencing, Single molecule real time (SMRT) sequencing ( Pacific Biosciences) and nanopore sequencing such as is described at world wide website nanoporetech.com.
  • RNA-guided DNA binding protein includes an RNA-guided DNA binding protein nuclease, a thermophilic RNA-guided DNA binding protein nuclease, an RNA-guided DNA binding protein nickase, or a nuclease null RNA-guided DNA binding protein fused to a cleavage domain such as a nuclease or a nickase domain.
  • the RNA- guided DNA binding protein includes a Cas nuclease, a Cas nickase or a nuclease null Cas protein fused to a cleavage domain such as a nuclease or a nickase domain.
  • a Cas nickase or a nuclease-null Cas protein is provided where one or more amino acids in Cas, such as Cas9, are altered or otherwise removed to provide a Cas nickase or a nuclease null Cas protein fused to a cleavage domain such as a nuclease or a nickase domain.
  • the amino acids include D10 and H840 of Cas9.
  • RNA guided DNA binding proteins are readily known to those of skill in the art to bind to DNA for various purposes.
  • DNA binding proteins may be naturally occurring.
  • DNA binding proteins having nuclease activity are known to those of skill in the art, and include naturally occurring DNA binding proteins having nuclease activity, such as Cas9 proteins present, for example, in Type II CRISPR systems.
  • Cas9 proteins and Type II CRISPR systems are well documented in the art. See Makarova et al., Nature Reviews, Microbiology, Vol. 9, June 2011, pp. 467-477 including all supplementary information hereby incorporated by reference in its entirety.
  • a Cas as described herein may be any Cas known to those of skill in the art that may be directed to a target nucleic acid using an RNA as known to those of skill in the art.
  • the Cas may be wild type or a homolog or ortholog thereof, such as Cpfl (See, Zetsche, Bernd et al., Cpf 1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System, Cell, Volume 163, Issue 3, pgs 759 - 771, hereby incorporated by reference in its entirety).
  • the Cas may be nonnaturally occurring, such as an engineered Cas as disclosed in Slaymaker, I.M., Gao, L., Zetsche, B., Scott, D.A., Yan, W.X. and Zhang, F., 2016. Rationally engineered Cas9 nucleases with improved specificity. Science, 351 (6268), pp.84-88 hereby incorporated by reference in its entirety.
  • the Cas may have one or more nucleolytic domains altered to prevent nucleolytic activity, such as with a Cas nickase or nuclease null or "dead” Cas. Aspects of the present disclosure utilize nicking to effect cutting of one strand of the target nucleic acid.
  • a nuclease null or "dead” Cas may have a nuclease attached thereto to effect cutting, cleaving or nicking of the target nucleic acid. Such nucleases are known to those of skill in the art.
  • the RNA-guided DNA binding protein includes a Cas9 nuclease, a Cas9 nickase or a nuclease null Cas9 protein.
  • the RNA- guided DNA binding protein includes a spCas9 nuclease, a spCas9 nickase or a nuclease null spCas9 protein.
  • the RNA-guided DNA binding proteins includes S. pyogenes Cas9, S. thermophilis Cas9, N. meningitides Cas9, T. denticola Cas9, or S. aureus Cas9.
  • the RNA-guided DNA binding protein includes a Cpfl nuclease, a Cpfl nickase or a nuclease null Cpfl protein.
  • the Cas9 protein, Cas9 protein nickase or nuclease null Cas9 includes homologs and orthologs thereof which retain the ability of the protein to bind to the DNA and be guided by the RNA.
  • the Cas9 protein includes the sequence as set forth for naturally occurring Cas9 from S. thermophiles or S. pyogenes or N. meningitides or T. denticola or S. aureus or Cpfl or NgAgo or C2C2 or protein sequences having at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% homology thereto and being a DNA binding protein, such as an RNA guided DNA binding protein.
  • An exemplary CRISPR system includes the S. thermophiles Cas9 nuclease (ST1 Cas9) (see Esvelt KM, et al., Orthogonal Cas9 proteins for RNA-guided gene regulation and editing, Nature Methods., (2013) hereby incorporated by reference in its entirety).
  • An exemplary CRISPR system includes the S. pyogenes Cas9 nuclease (Sp. Cas9), an extremely high-affinity (see Steinberg, S.H., Redding, S., Jinek, M., Greene, E.C. & Doudna, J.A. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.
  • nuclease null or nuclease deficient Cas 9 can be used in the methods described herein.
  • nuclease null or nuclease deficient Cas9 proteins are described in Gilbert, L.A. et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154, 442-451 (2013); Mali, P. et al. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nature biotechnology 31, 833-838 (2013); Maeder, M.L. et al. CRISPR RNA- guided activation of endogenous human genes. Nature methods 10, 977-979 (2013); and Perez- Pinera, P. et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors.
  • the DNA locus targeted by Cas9 precedes a three nucleotide (nt) 5'-NGG-3 ' "PAM” sequence, and matches a 15-22-nt guide or spacer sequence within a Cas9-bound RNA cofactor, referred to herein and in the art as a guide RNA. Altering this guide RNA is sufficient to target Cas9 or a nuclease deficient Cas9 to a target nucleic acid.
  • CRISPR-based biotechnology applications see Mali, P., Esvelt, K.M.
  • sgRNA single guide RNA
  • gRNA and tracrRNA two natural Cas9 RNA cofactors
  • Cas9 proteins are known to exist in many Type II CRISPR systems including the following as identified in the supplementary information to Makarova et al., Nature Reviews, Microbiology, Vol. 9, June 2011, pp. 467-477: Methanococcus maripaludis C7; Corynebacterium diphtheriae; Corynebacterium efficiens YS-314; Corynebacterium glutamicum ATCC 13032 Kitasato; Corynebacterium glutamicum ATCC 13032 Bielefeld; Corynebacterium glutamicum R; Corynebacterium kroppenstedtii DSM 44385; Mycobacterium abscessus ATCC 19977; Nocardia farcinica IFM10152; Rhodococcus erythropolis PR4; Rhodococcus jostii RHA1; Rhodococcus opacus B4 uid36573; Acidothermus cellulolyticus 11B; Arthrobacter chlorophenolicus A6; Kri
  • the Cas9 protein may be referred by one of skill in the art in the literature as Csnl.
  • An exemplary S. pyogenes Cas9 protein sequence is provided in Deltcheva et al., Nature All, 602-607 (2011) hereby incorporated by reference in its entirety.
  • CRISPR systems useful in the present disclosure are described in R. Barrangou, P. Horvath, CRISPR: new horizons in phage resistance and strain identification. Annual review of food science and technology 3, 143 (2012) and B. Wiedenheft, S. H. Sternberg, J. A. Doudna, RNA-guided genetic silencing systems in bacteria and archaea. Nature 482, 331 (Feb 16, 2012) each of which are hereby incorporated by reference in their entireties.
  • the RNA-guided DNA binding protein includes an effector moiety or group attached thereto to affect or alter or modulate a target nucleic acid.
  • the RNA- guided DNA binding protein may be a nuclease null RNA-guided DNA binding protein including an effector moiety or group attached thereto.
  • An effector moiety or group includes a modulator moiety or group. Modulating may refer to the function of the effector group or moiety attached to the RNA-guided DNA binding protein or guide RNA.
  • a target nucleic acid may be modulated by being cut or nicked by the RNA-guided DNA binding protein.
  • a target nucleic acid may be modulated by being bound by the RNA-guided DNA binding protein.
  • a target nucleic acid may be modulated by the function of the effector group or moiety attached to the RNA-guided DNA binding protein or the guide RNA.
  • a target nucleic acid may be modulated by being bound by the RNA-guided DNA binding protein and the function of the effector group or moiety attached to the RNA-guided DNA binding protein or the guide RNA.
  • RNA-guided DNA binding proteins includes Cas9 proteins include Cas9 proteins attached to, bound to or fused or connected or tethered with a functional protein or effector group or modulator such as transcriptional regulators, such as transcriptional activators or repressors, a Fok-domain, such as Fok 1, an aptamer, a binding protein, PP7, MS2 and the like.
  • the nuclease null Cas9 protein and the guide RNA colocalize to the target nucleic acid or the nucleic acid encoding the guide RNA resulting in binding but not cleaving of the target nucleic acid as encoded by cargo sequences can be included.
  • the activity or transcription of the target nucleic acid is regulated by such binding.
  • the Cas9 protein can further comprise a transcriptional regulator or DNA modifying protein attached thereto.
  • the transcriptional regulator protein or domain is a transcriptional activator.
  • the transcriptional regulator protein or domain upregulates expression of the target nucleic acid.
  • the transcriptional regulator protein or domain is a transcriptional repressor.
  • the transcriptional regulator protein or domain downregulates expression of the target nucleic acid.
  • Transcriptional activators and transcriptional repressors can be readily identified by one of skill in the art based on the present disclosure. Exemplary transcriptional regulators are known to a skilled in the art and include VPR, VP16, VP64, P65 and RTA.
  • aspects of the present disclosure include methods and materials for localizing transcriptional regulatory domains to targeted loci of target nucleic acids by fusing, connecting or joining such domains to an RNA-guided DNA binding protein such as Cas or a guide RNA.
  • Exemplary effector groups or moieties include a detectable moiety, a transcriptional regulator, a protein domain, a nuclease, a phosphatase, deaminase, kinase, polynucleotide kinase, Uracil-DNA glycosylase, nuclease, endonuclease, exonuclease, site-specific nuclease, ligase, polymerase, recombinase, methyl-transferase, fluorescent protein, beta-galactosidase, antibody, scFv single-chain variable fragment of an antibody, nanobody, transcriptional activator, transcriptional repressor, biotin, streptavidin, aptamer, nanoparticle, gold nanoparticle, quantum dot, magnetic bead, paramagnetic particle, or oligonucleotide.
  • Exemplary DNA-modifying enzymes are known to a skilled in the art and include Cytidine dea
  • Embodiments of the present disclosure are directed to the use of a RNA-guided DNA binding protein/guide RNA system, such as a CRISPR/Cas system and, in particular, a guide RNA which may include one or more of a spacer sequence, a tracr mate sequence and a tracr sequence.
  • the term spacer sequence is understood by those of skill in the art and may include any polynucleotide having sufficient complementarity with a target nucleic acid sequence to hybridize with the target nucleic acid sequence and direct sequence-specific binding of a CRISPR complex to the target sequence.
  • an exemplary spacer sequence is between 10 and 30 nucleotides in length.
  • an exemplary spacer sequence is between 15 and 25 nucleotides in length.
  • An exemplary spacer sequence is between 18 and 22 nucleotides in length.
  • An exemplary spacer sequence is 20 nucleotides in length.
  • the guide RNA may be formed from a spacer sequence covalently connected to a tracr mate sequence (which may be referred to as a crRNA) and a separate tracr sequence, wherein the tracr mate sequence is hybridized to a portion of the tracr sequence.
  • the tracr mate sequence and the tracr sequence are connected or linked such as by covalent bonds by a linker sequence, which construct may be referred to as a fusion of the tracr mate sequence and the tracr sequence.
  • the linker sequence referred to herein is a sequence of nucleotides, referred to herein as a nucleic acid sequence, which connect the tracr mate sequence and the tracr sequence.
  • a guide RNA may be a two component species (i.e., separate crRNA and tracr RNA which hybridize together) or a unimolecular species (i.e., a crRNA-tracr RNA fusion, often termed an sgRNA).
  • Tracr mate sequences and tracr sequences are known to those of skill in the art, such as those described in US 2014/0356958 and as shown in Fig. 2.
  • An exemplary tracr mate sequence and tracr sequence is N20 to N8- gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttttt with N20-8 being the number of nucleotides complementary to a target locus of interest.
  • the tracr mate sequence is between about 17 and about 27 nucleotides in length.
  • the tracr sequence is between about 65 and about 75 nucleotides in length.
  • the linker nucleic acid sequence is between about 4 and about 6.
  • two or more or a plurality of guide RNAs may be used in the practice of certain embodiments.
  • the guide RNA is between about 10 to about 500 nucleotides.
  • the guide RNA is between about 20 to about 100 nucleotides.
  • the spacer sequence is between about 10 and about 500 nucleotides in length and particularly between about 14 and about 22 nucleotides in length.
  • the tracr mate sequence is between about 10 and about 500 nucleotides in length.
  • the tracr sequence is between about 10 and about 100 nucleotides in length.
  • the linker nucleic acid sequence is between about 4 and about 100 nucleotides in length, and particularly between about 4 and about 6 nucleotides in length.
  • the guide RNA includes an effector moiety or group attached thereto.
  • An effector moiety or group includes a modulator moiety or group.
  • Exemplary effector groups or moieties include a detectable moiety, a transcriptional regulator, a protein domain, a nuclease, a phosphatase, deaminase, kinase, polynucleotide kinase, Uracil-DNA glycosylase, nuclease, endonuclease, exonuclease, site-specific nuclease, ligase, polymerase, recombinase, methyl-transferase, fluorescent protein, beta-galactosidase, antibody, scFv single-chain variable fragment of an antibody, nanobody, transcriptional activator, transcriptional repressor, biotin, streptavidin, aptamer, nanoparticle, gold nanoparticle, quantum dot, magnetic bead, paramagnetic particle, or oligonucleotide.
  • Target nucleic acids as described herein include any nucleic acid sequence to which a co-localization complex as described herein can be useful to either cut, nick or regulate or modulate.
  • Target nucleic acids include nucleic acid sequences, such as genomic nucleic acids, such as genes, capable of being expressed into proteins.
  • a co-localization complex can bind to or otherwise co-localize with the target nucleic acid at or adjacent or near the target nucleic acid and in a manner in which the co-localization complex may have a desired effect on the target nucleic acid.
  • One of skill based on the present disclosure will readily be able to identify or design guide RNAs and Cas9 proteins which co- localize to a target nucleic acid.
  • effector groups or modulators or transcriptional regulator proteins or domains which likewise co-localize to a target nucleic acid.
  • the present disclosure provides a gene drive based method of making a plurality of genetically altered proliferating cells.
  • a "gene drive” is an inheritance-biasing element that skews Mendelian inheritance in order to favor its passage to subsequent generations.
  • Gene drives based on RNA guided endonucleases such as Cas9 can copy themselves at high efficiency making it virtually impossible for a diploid cell to be heterozygote for the particular gene drive.
  • FIGS. 1A-1C gene drives thus display a pattern of inheritance different from Mendelian inheritance. It has been envisioned that gene drives can act as agents allowing one or several specific traits to pass through an entire population and reach equilibrium when all organisms in a given population contain the particular gene drive(s).
  • the disclosure provides methods of using gene drives to induce variations in a given population by releasing a multitude of gene drives at the same time point and using the variations that will occur within the first couple of generations before the population reach equilibrium for all gene drives and thus are genetically identical again. For example, if 20 gene drives are released in a yeast population, all the yeast cells would contain two gene drives after the first round of mating and sporulation, giving rise to -400 different yeast genotypes, which would then reach >100,000 unique genotypes after the second round of mating and sporulation when each yeast cell would contain at most 4 gene drives (FIG. 2).
  • FOG. 2 a selection marker
  • a gene drive consists of at least five fragments: 1) A sequence homologous to the DNA upstream of the insertion site of the drive (upstream flanking sequence), 2) a promoter sequence ensuring the transcription of the targeting and guide sequences (guide RNA promoter), 3) a targeting sequence (for guide RNA sequence) specific for the insertion site in the host genome 4) a spacer tail sequence and transcriptional terminator allowing the transcribed RNA to interact with Cas9 or other programmable nuclease, and 5) a sequence homologous to the DNA downstream of the insertion site (downstream flanking sequence).
  • a limiting parameter for utilization of this concept would be the cost of synthesis of the gene drives which are -100 USD per drive for a 500bp gene drive cassette.
  • the five fragments mentioned above only 1 , 3 and 5 are specific for a given drive whereas 2 and 4 are constant for each and every drive (although they constitute 80% of the sequence to be synthesized).
  • the disclosure provides an outline of a scheme for the synthesis of gene drives from oligonucleotide pools allowing for a drive to be made for a low cost of ⁇ 5 cents and subsequently inserting the constant sequence to create standardized low cost gene drives.
  • the gene drives can be made to target a region just upstream of a translational initiation ATG site of any given gene and thus creating the possibility of making promoter swaps or performing epitope tagging of genes.
  • the gene drives according to the present disclosure also allow one skilled in the art to perform simultaneous genetic manipulations including but not limited to knock out, repression, activation, induction, or protein fusion etc., in the same system in a high throughput manner at a low cost.
  • the present disclosure provides the use of gene drives for rapid and efficient generation of combinatorial genetic diversity and methods for cost efficient generation of gene drives at library scales.
  • the present disclosure provides a method for constructing a gene drive using short oligo DNA sequences in a standardized method.
  • a schematic of a general strategy for constructing gene drives from oligos according to an exemplary embodiment is shown in FIGS. 3A-3G.
  • the oligo (or library of oligos) is PCR amplified based on the primer sequences flanking the pre-drive sequence (FIGS. 3A-3B).
  • the pre-drive oligo is inserted into a minimal vector from which guide RNA promoter sequence can be inserted into on one side of the targeting sequence.
  • the plasmid vector is then reopened on the other side of the targeting sequence to insert the guide RNA and terminator sequences (FIGS. 3C-D).
  • the final gene drive is PCR amplified and subject to enzymatic digestion to remove the PCR primer flanking sequences (FIGS. 3F-3G).
  • the present disclosure provides that as the system is standardized, it is possible to insert additional cargo sequences flanking the necessary target sequence promoter and guide RNA sequence (FIG. 4). For example, it is possible to add a selection marker on one side and an inducible promoter on the other side, although any other desired genetic manipulations can be added to either side depending on the needs of a skilled in the art.
  • the general building blocks as shown in FIG. 4 can be synthesized and inserted into standardized plasmids allowing quick PCR amplification of a particular gene drive that is needed for a given experiment.
  • a gene drive can be efficiently used to switch the promoter of an endogenous gene
  • the present disclosure provides as an exemplary embodiment a method for switching the promoter of an endogenous gene using a gene drive.
  • Gene drives can target an insertion at any position in the genome flanked by the Cas9 NGG motif.
  • the gene drive method allows for knocking out an endogenous gene by removing the gene and replacing it with the gene drive. According to alternative
  • the gene drive can be wedged in between the native promoter and coding region of a target gene (FIG. 5A). This strategy would allow the decoupling of the native promoter to the coding region of a target gene and swap the native promoter with any desired promotor.
  • FIGS. 5A-5C three gene drives were constructed. 1) A gene drive was constructed without a selection marker; 2) A gene drive was constructed with a HIS 3 marker on one side and only the guide RNA terminator on the other side and 3) A gene drive with a HIS3 marker on one side and guide RNA terminator plus an inducible GAL7 promoter on the other side.
  • Yeast expressing haploid specific ura3 and trpl can be used for liquid cyclic mating
  • the present disclosure provides a method for enriching for haploid or diploid yeast cells using selectable markers.
  • a method for enriching for haploid or diploid yeast cells using selectable markers In order to create yeast pools that contain multiple gene drives, it is desirable to have an efficient system of liquid mating where the majority of cells are mated and sporulated (FIG. 6A). In an exemplary embodiment, this was achieved through expressing the TRP1 gene under the control of the haploid- specific HO promoter and the URA3 gene under the control of the haploid-specific STE5 promoter. Both of these promoters are only strong and active in haploid cells but are repressed in diploid cells (FIG. 6B).
  • haploid and diploid cells By growing the haploid and diploid cells in media lacking tryptophan and uracil, the diploid cells showed a severe growth defect (due to neither the TRP1 or URA3 genes being expressed), while the haploid cells grew well.
  • haploid cells when haploid cells are grown in media containing 5-Fluoroorotic acid (5-FOA) and Fluoroanthranilic acid (5-FAA), which is toxic to cells that express TRPl and URA3, respectively, they showed poor growth, while the diploid cells that express neither gene grew well (FIG. 6C). Therefore, using the disclosed selection method, a skilled in the art is readily able to select between haploid and diploid states of yeast cells to facilitate sequential rounds of mating and haploid isolation.
  • 5-Fluoroorotic acid 5-FOA
  • Fluoroanthranilic acid 5-FAA
  • the gene drive-containing fragments were synthesized as gBlocks® Gene Fragments by IDT (Coralville, Iowa) and cloned into a pADE2 -backbone vector via Gibson Assembly (Gibson et al, Enzymatic assembly of DNA molecules up to several hundred kilobases, Nature Methods 2009, 6:343- 345). Briefly, the backbone vector was digested by Sacl and Kpnl followed by gel purification of a 6.4 kb fragment. The gBlock was then fused into the SacI-KpnI-linearized backbone in a standard overnight Gibson reaction. Subsequently, 1 ⁇ of product was transformed into chemically competent DH5alpha E.coli cells.
  • the first fragment was obtained via digestion of the pADE2-gene drive plasmid with Aflll and Aatll followed by gel purification of a 6.8kb fragment to create a gap at the ADE2 sequence in the plasmid.
  • the second fragment was a -730 bp PCR fragment amplified off the pADE2-gene drive plasmid using primers TGAGAAGTGACGCAAGCATC and ATGACCACGTTAATGGCTCC.
  • AGGATTGGAAAAGGAGCCATTAACGTGGTCAT were used to recombine into an intact circular plasmid for stable inheritance and propagation into the progeny yeast cells.
  • the present disclosure utilizes the following material and methods in one or more of the Examples described herein.
  • the sequence upstream of the translational initiation ATG for each gene in the yeast genome was mined for the presence of the Cas9 NGG motif using a custom batch script. The distance from the ATG to the double- stranded break was minimized but all spacer sequences not unique in the genome for the 13 bp upstream of the NGG was discarded.
  • the 34bp downstream flanking sequence of the double stranded break was denoted as DOWN for the drive and the 34bp upstream flanking sequence of the ATG was denoted as UP for the drive.
  • the oligo was designed as: Primer upstream sequence (GC AGTCCGTCTTGCCATC) , UP sequence
  • the pre-drive was amplified using the primers CATGCGTCTCTCCTAGTGCAGTCCGTCTTGCCATC and
  • the oligo was either ordered as ssDNA oligo (IDT) or as part of an oligo pool (Custom array).
  • the background vector was made by amplifying a 2.7kb backbone fragment from pAG60 vector (Addgene #35128) using the primers
  • the template DNA was digested using 10U of Dpnl in the PCR buffer for 10 minutes at 37°C.
  • the PCR product was ligated using T4 ligase in the PCR buffer for lh and ⁇ was used to transform chemically competent DH5alpha chemically competent E. coli.
  • the minimal backbone vector was digested using 1U of Ahdl and Rsal and the 2.3kb fragment was purified from agarose gel.
  • a gBlock was designed containing mutations of Bsal, BsrDI and Btsl sites in the ampicillin coding region creating silent mutations.
  • the gBlock was fused to the backbone by adding 40ng of gBlock, 40ng of backbone in 6 ⁇ 1 total volume and 6 ⁇ 1 of 2x Gibson Assembly Master Mix (New England Biolabs). The mixture was left to react for 2h at 50°C and ⁇ was transformed into DH5alpha chemically competent E. coli.
  • oligo containing the His3 selection marker flanked by the guide-RNA promoter was synthesized and an oligo only containing the guide-RNA promoter were amplified using primers GCCTTTTTACGGTTCCTGGC and GTGACCTGTTCGTTGCAACA. 400 pmoles of insertion oligo and 40 pmol of background miniprep DNA were mixed in a 20 ⁇ 1 reaction containing 2 ⁇ 1 of Cutsmart buffer (NEB), ⁇ Bsal-HF enzyme (NEB), 2 ⁇ 1 ATP, ⁇ T4 DNA ligase (NEB) and were placed in a thermocyclers for 12 hours cycling between 37°C for 2 minutes and 16°C for 2 minutes.
  • thermocyclers for 12 hours cycling between 37°C for 2 minutes and 16°C for 2 minutes. Following heat inactivation at 65 °C for 20 minutes, the mixture were given an additional ⁇ of Sapl enzyme to each reaction and allowed to digest at 37°C for an additional hour. Golden gate reactions were transformed into DH5alpha chemically competent E. coli and plated on LB plates containing ampicillin selection. The colonies were harvested after 18h from the plate and used as input for a standard miniprep plasmid extraction (Qiagen #27106).
  • a cas9 containing yeast background strain was created by transforming BY4741/4742 strain background with the two linear fragments 1) pNEB 193-HO-TRPl- STE5p-CaURA3- nopl-cas9-natMX-HO plasmid linearized using Pmel (NEB) and 2) knocking out TRP1 using LEU2.
  • the two strains were mated for 24h in YPD media and switched to minimal media with Histidine+Uracil+Trypthophan to select for diploid cells.
  • MATa cycle-competent (based on BY4741), MATalpha cycle-competent (based on BY4742) and diploid cycle-competent (mate of MATa and MATalpha cycle-competent).
  • the plasmids containing drive with and without the Gal7 promoter and His3 marker sequence were amplified using the general primers GCGAAAGGTGGATGGGTAG CCCTGATTCTGTGGATAACCG for 30 cycles using Phusion polymerase (NEB) and subsequently adding 1U of Bsgl (NEB) into the PCR buffer.
  • the reaction was allowed to react at 37C for lh before enzymatic purification using DNA Clean & Concentrator- 5 (Zymo research).
  • Yeast cells were transformed using the Li- Ac method as previously described (Gietz RD and Schiest RH, High-efficiency yeast transformation using the LiAc/SS carrier
  • Transformants were screened on YPD, SC-His+ galactose and SC-His+glucose containing media.
  • YPD 24 g Bacto agar, 20 g Bacto peptone, 10 g Yeast extract, lOg glucose, 950 mL H2O. Autoclave before use.
  • SC 3.4g base w/o amino acids, lOg glucose,0.36g DO supplement -URA (Clontech, cat: 630416), 5ml 1% Uracil, Fill to 500ml of H 2 0. Autoclave before use.
  • SC+FOA+FAA SC media made above autoclaved. Create stock 5-FOA: dissolve O.lg of 5-FOA in 1ml of DMSO. Store at -20°C. Create stock 5 -FAA: dissolve O.lg of 5- FAA in 1ml of DMSO. Make fresh. Add 30 ⁇ 1 of each mix to a 5ml growth culture of SC and vortex to dissolve.
  • SC-Trp-Ura 3.4g base w/o amino acids, lOg glucose,0.36g DO supplement -TRP/- URA (Clontech, cat: 630427), Fill to 500ml of H 2 0. Autoclave before use.
  • PreSpo Pre-sporulation media, make fresh for each use or store max 2 weeks: 5 g yeast extract (1%), lOg Peptone (2%), 5g potassium acetate (1%), Fill to 500ml of 3 ⁇ 40. Autoclave before use.
  • Passage 1 MATa and MATalpha cycle competent yeast were mated in YPD media overnight. Typically add 50 ⁇ 1 of each saturated culture.
  • Passage 2 Cells were washed twice in water to remove the additives found in the YPD media. ⁇ of saturated cells were used to inoculate a 5ml SC media culture to allow the cells to adjust to minimal media for a minimum of 4 hours.
  • Passage 3 Cells were spun down and resuspended in SC + FAA + FOA. Run in two to three different concentrations to get enough cells within the given time.
  • Passage 4 Cells were passage to SC+FAA+FOA to continue the selection for diploid cells.
  • Passage 5 Cells were inoculate in 8ml of pre-sporulation media with i.e. 100/500 ⁇ 1 of cells. OD was measured after 4-6h culture in exponential grown phase with an OD of 0.7-1.0 was used.
  • Passage 6 Cells were spin down and washed twice in water. The cells were resuspended in sporulation media and allowed to incubate for 48-96h at 30C. Sporulation were verified using a microscope.
  • haploid yeast Sporulated cells were centrifuged and resuspended in 50 ⁇ ⁇ of a stock solution of zymolyase (50 ⁇ g/mL in 1M sorbitol) and incubated at 30C for 10 minutes. Trie cells were added to 5 ml of 1.5% Nonidet P-40 (Sigma- Aldrich) and left on ice for 15 minutes. Sonicate the tube for 30 sec at 50% to 75% full power, then set on ice 2 min. Repeat twice. Centrifuge spores 10 min at 1200 x g. Aspirate or pour off supernatant and resuspend in 10ml of PBS. Vortex vigorously. Repeat twice resuspending in 5ml of SC- URA-TRP media in the end.
  • TGGGCTAGCGGTAAAGGTG and rv ACGGACTAGCCTTATTTTAACTTGCT at 60°C for a 202bp band.
  • ADE2 drive containing His3 selection marker, SNR52promoter, spacer sequence, guide sequence and a Gal7 promoter
  • ADE2 drive containing His3 selection marker, SNR52promoter, spacer sequence, guide sequence
  • GCGCACATTTCCCCGAAAAGTGCCACCTGAACGAAGCATCTGTGCTTCATTTTG gBlock containing sequence to remove common restriction sites in the amp coding region AGAATTATGCAGAGCTGCCATAACCATGAGTGATAACACAGCGGCCAACTTACT

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne une méthode de modification génétique d'une cellule consistant à combiner la cellule comprenant une séquence génomique cible avec un vecteur comprenant une séquence oligonucléotidique comprenant un forçage génétique unique et des séquences d'acide nucléique qui ciblent la séquence génomique cible, le forçage génétique unique étant inséré dans la séquence génomique cible pour produire une cellule génétiquement modifiée.
PCT/US2017/052128 2016-09-19 2017-09-19 Méthodes de modification génétique de levure pour produire des variants de levure WO2018053457A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662396395P 2016-09-19 2016-09-19
US62/396,395 2016-09-19

Publications (2)

Publication Number Publication Date
WO2018053457A1 true WO2018053457A1 (fr) 2018-03-22
WO2018053457A9 WO2018053457A9 (fr) 2018-04-26

Family

ID=61618983

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/052128 WO2018053457A1 (fr) 2016-09-19 2017-09-19 Méthodes de modification génétique de levure pour produire des variants de levure

Country Status (1)

Country Link
WO (1) WO2018053457A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114369145A (zh) * 2021-12-31 2022-04-19 天津大学 胞质不相容性因子CifA或CifB突变基因及蛋白

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9023601B2 (en) * 2002-09-12 2015-05-05 Gen9, Inc. Microarray synthesis and assembly of gene-length polynucleotides
US20150225730A1 (en) * 2014-02-12 2015-08-13 Dna2.0, Inc. Methods for generating libraries with co-varying regions of polynuleotides for genome modification

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9023601B2 (en) * 2002-09-12 2015-05-05 Gen9, Inc. Microarray synthesis and assembly of gene-length polynucleotides
US20150225730A1 (en) * 2014-02-12 2015-08-13 Dna2.0, Inc. Methods for generating libraries with co-varying regions of polynuleotides for genome modification

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DICARLO ET AL.: "Safeguarding CRISPR-Cas9 gene drives in yeast (incl. Online methods)", NATURE BIOTECHNOLOGY, vol. 33, no. 12, December 2015 (2015-12-01), pages 1250 - 1255 +2, XP002764552 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114369145A (zh) * 2021-12-31 2022-04-19 天津大学 胞质不相容性因子CifA或CifB突变基因及蛋白

Also Published As

Publication number Publication date
WO2018053457A9 (fr) 2018-04-26

Similar Documents

Publication Publication Date Title
US20230272373A1 (en) Methods and Compositions for the Single Tube Preparation of Sequencing Libraries Using Cas9
US20230272380A1 (en) Engineered Guide RNA Sequences for In Situ Detection and Sequencing
US11261439B2 (en) Methods of making guide RNA
US10738303B2 (en) Comprehensive in vitro reporting of cleavage events by sequencing (CIRCLE-seq)
US20180127759A1 (en) Dynamic genome engineering
US11028429B2 (en) Full interrogation of nuclease DSBs and sequencing (FIND-seq)
US20190264193A1 (en) Protein engineering methods
US20170088845A1 (en) Vectors and methods for fungal genome engineering by crispr-cas9
US10851369B2 (en) Frequency-based modulation of diverse species in a nucleic acid library
KR20210137009A (ko) 미생물에서 풀링 게놈 편집
EP3872171A1 (fr) Détection d'arn et édition dépendant de la transcription à l'aide d'arncr transactivateurs reprogrammés
WO2018053457A1 (fr) Méthodes de modification génétique de levure pour produire des variants de levure
US11939571B2 (en) Library-scale engineering of metabolic pathways
EP2935582B1 (fr) Compositions et procédés pour la création de cellules et organismes modifiés et améliorés
CN111386343A (zh) 用于克鲁维酵母宿主细胞基因组整合的方法
US20190161751A1 (en) Methods of Screening Using Barcoded Libraries
Liao et al. One-step assembly of large CRISPR arrays enables multi-functional targeting and reveals constraints on array design
WO2023225358A1 (fr) Génération et suivi de cellules avec des éditions précises

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17851746

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17851746

Country of ref document: EP

Kind code of ref document: A1