WO2018053070A1 - Méthodes améliorées d'analyse d'adn édité - Google Patents

Méthodes améliorées d'analyse d'adn édité Download PDF

Info

Publication number
WO2018053070A1
WO2018053070A1 PCT/US2017/051469 US2017051469W WO2018053070A1 WO 2018053070 A1 WO2018053070 A1 WO 2018053070A1 US 2017051469 W US2017051469 W US 2017051469W WO 2018053070 A1 WO2018053070 A1 WO 2018053070A1
Authority
WO
WIPO (PCT)
Prior art keywords
dna
linear amplification
primer
tag
template
Prior art date
Application number
PCT/US2017/051469
Other languages
English (en)
Inventor
Hon-Ren HUANG
Christian Dombrowski
Reynald Michael LESCARBEAU
Jessica Lynn SEITZER
Craig Elder Mealmaker
Daniel Joseph O'connell
Original Assignee
Intellia Therapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Intellia Therapeutics, Inc. filed Critical Intellia Therapeutics, Inc.
Publication of WO2018053070A1 publication Critical patent/WO2018053070A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K41/00—Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
    • A61K41/0047—Sonopheresis, i.e. ultrasonically-enhanced transdermal delivery, electroporation of a pharmacologically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424—Serine endopeptidases (3.4.21)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21—Serine endopeptidases (3.4.21)
    • C12Y304/21026—Prolyl oligopeptidase (3.4.21.26), i.e. proline-specific endopeptidase

Definitions

  • DLB double-stranded breaks
  • ZFN zinc finger nucleases
  • TALEN transcription activator-like effector nucleases
  • CRISPR CRISPR associated nucleases
  • HDR homology directed repair
  • an exogenous DNA template provided along with the nuclease components can specifically drive the insertion of a desired sequence.
  • HDR primarily takes place during cell division, however, HDR events usually occur extremely infrequently in non-cycling cells, even in the presence of excess exogenous template and sequence-specific DSBs induced by nucleases such as CRISPR/Cas9.
  • Analysis of editing results e.g., quantifying the amount of template-driven repair vs.
  • the repair template may act as a primer in early
  • the invention comprises a method for detecting gene editing events, such as the formation of insertion/deletion (“indel") mutations and homology directed repair (HDR) events in target DNA utilizing linear amplification with a tagged primer and isolating the tagged amplification products (herein after referred to as "LAM- PCR,” or “Linear Amplification (LA)” method).
  • the method comprises quantifying the gene editing event.
  • the method comprises isolating cellular DNA from a cell that has been induced to have a double strand break (DSB) and optionally that has been provided with an HDR template to repair the DSB; performing at least one cycle of linear amplification of the DNA with a tagged primer; isolating the linear amplification products that comprise tag, thereby discarding any amplification product that was amplified with a non-tagged primer; optionally further amplifying the isolated products; and analyzing the linear amplification products, or the further amplified products, to determine the presence or absence of an HDR editing event such as, for example, an insertion, deletion, or HDR template sequence in the target DNA.
  • the editing event can be quantified.
  • Quantification and the like as used herein includes detecting the frequency and/or t pe(s) of editing events in a population.
  • An "HDR template sequence" may be a full length or partial HDR template sequence.
  • the method for detecting gene editing events in target DNA comprises inducing a DSB in a cell; optionally contacting the cell with an HDR template DNA to induce HDR; isolating cellular DNA; performing at least one cycle of linear amplification of the DNA with a tagged primer; isolating the linear amplification products that comprise tag, thereby discarding any amplification product that was amplified with a non-tagged primer; optionally further amplifying the isolated products; and analyzing the linear amplification products, or the further amplified products, to determine the presence or absence of gene editing events such as, for example, insertions, deletions, or HDR template sequence in the target DNA.
  • the editing event can be quantified.
  • An "HDR template sequence" may be a full length or partial HDR template sequence.
  • the editing event is an insertion, deletion, or homology directed repair (HDR).
  • HDR homology directed repair
  • the tagged primer comprises a molecular barcode. In some embodiments, the tagged primer comprises a molecular barcode, and only one cycle of linear amplification is conducted.
  • the analyzing step comprises sequencing the linear amplified products or the further amplified products. Sequencing may comprise any method known to those of skill in the art, including, next generation sequencing, and cloning the linear amplification products or further amplified products into a plasmid and sequencing the plasmid or a portion of the plasmid. In other aspects, the analyzing step comprises performing digital PCR (dPCR) or droplet digital PCR (ddPCR) on the linear amplified products or the further amplified products.
  • dPCR digital PCR
  • dddPCR droplet digital PCR
  • the analyzing step comprises contacting the linear amplified products or the further amplified products with a nucleic acid probe designed to identify DNA comprising HDR template sequence and detecting the probes that have bound to the linear amplified product(s) or further amplified product(s).
  • the method further comprises determining the location of the HDR template in the target DNA. [14] In certain embodiments, the method further comprises determining the sequence of an insertion site in the target DNA, wherein the insertion site is the location where the HDR template incorporates into the target DNA, and wherein the insertion site may include some target DNA sequence and some HDR template sequence.
  • the HDR template is single-stranded.
  • the tagged primer is in the same 5' to 3' orientation as the single- stranded HDR template. In some embodiments, the tagged primer is designed so that it should not hybridize to the HDR template.
  • the HDR template is double-stranded.
  • a double- stranded HDR template is used, only one cycle of linear amplification is performed prior to isolating the linear amplification product.
  • one or both ends of the template DNA are homologous to one or more nucleotides at the double strand break site.
  • the linear amplification of the target DNA with a tagged primer is performed for 1-50 cycles, 1-60 cycles, 1-70 cycles, 1-80 cycles, 1 -90 cycles, or 1 -100 cycles.
  • the linear amplification of the target DNA with a tagged primer comprises a denaturation step to separate DNA duplexes, an annealing step to allow primer binding, and an elongation step.
  • the linear amplification is isothermal (does not require a change in temperature).
  • the isothermal linear amplification is a loop-mediated isothermal amplification (LAMP), a strand displacement amplification (SDA), a heli case-dependent amplification, or a nicking enzyme amplification reaction.
  • the tagged primer anneals to the target DNA at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 1 10, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, at least 300, at least 1,000, at least 5,000, or at least 10,000 nucleotides away from of the expected editing event location, e.g., the insertion, deletion, or template insertion site.
  • the expected editing event location e.g., the insertion, deletion, or template insertion site.
  • the tagged primer comprises a molecular barcode.
  • the molecular barcode comprises a sequence that is not complementary to the target DNA. In some embodiments, the molecular barcode comprises 6, 8, 10, or 12 nucleotides.
  • the tag on the primer is biotin, streptavidin, digoxigenin, a DNA sequence, or fluorescein isothiocyanate (FITC).
  • the linear amplification product(s) are isolated using a capture reagent specific for the tag on the primer.
  • the capture reagent is on a bead, solid support, matrix, or column.
  • the isolation step comprises contacting the linear amplification product(s) with a capture reagent specific for the tag on the primer.
  • the capture reagent is biotin, streptavidin, digoxigenin, a DNA sequence, or fluorescein isothiocyanate (FITC).
  • the tag is biotin and capture reagent is streptavidin. In some embodiments, the tag is streptavidin and the capture reagent is biotin.
  • the tag is on the 5' terminus of the primer, the 3 ' terminus of the primer, or internal to the primer.
  • the tag and/or the capture reagent is removed after the isolation step. In some embodiments, the tag and/or the capture reagent is not removed, and the further amplifying and analyzing steps are performed in the presence of tag and/or capture.
  • the further amplification is non-linear. In some embodiments, the further amplification is digital PCR, qPCR, or RT-PCR. In some embodiments, the sequencing is next generation sequencing (NGS).
  • NGS next generation sequencing
  • the target DNA is genomic or mitochondrial. In some embodiments, the target DNA is genomic DNA of a prokaryotic or eukaryotic cell. In some embodiments, the target DNA is mammalian.
  • the target DNA may be from a non-dividing cell or a dividing cell. In some embodiments, the target DNA may be from a primary cell. In some embodiments, the target DNA is from a replicating cell.
  • the cellular DNA is sheared prior to linear amplification.
  • the sheared DNA has an average size between 0.5 kb and 20 kb.
  • the cellular DNA is sheared to an average size of 0.5, 0.75, 1.0, 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75, 3.0, 3.25, 3.5, 3.75, 4.0, 4.25, 4.5, 4.75, 5.0, 5.25, 5.5, 5.75, 6.0, 6.25, 6.5, 6.75, 7.0, 7.25, 7.5, 7.75, 8.0, 8.25, 8.5, 8.75, 9.0, 9.25, 9.5, 9.75, 10.0, 10.25, 10.5, 10.75, 1 1.0, 11.25, 1 1.5, 1 1.75, 12.0, 12.25, 12.5, 12.75, 13.0, 13.25, 13.5, 13.75, 14.0, 14.25, 14.5, 14.75, 15.0, 15.25, 15.5, 15.75, 16.0, 16.25, 16.5, 16.
  • the amount of input cellular DNA is between 1 ng and 5 ⁇ g. In some instances, the amount of input cellular DNA is between 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130- 140, 140-150, 150-160, 160-170, 170-180, 180-190, 190-200, 200-210, 210-220, 220-230, 230-240, 240-250, 250-260, 260-270, 270-280, 280-290, 290-300, 300-310, 310-320, 320- 330, 330-340, 340-350, 350-360, 360-370, 370-380, 380-390, 390-400, 400-410, 410-420, 420-430, 430-440, 440-450, 450-460, 460-470, 470-480, 480-490,
  • FIG. 1 shows a schematic of a mechanism for template contamination while analyzing DNA.
  • FIG. 2 shows a schematic of one embodiment of a linear amplification polymerase chain reaction (LAM-PCR) process utilizing a tagged primer for analyzing DNA.
  • LAM-PCR linear amplification polymerase chain reaction
  • Fig. 3A shows percent editing (open bars) and percent homology directed repair (HDR; hashed bars) in Hepal .6 cells after an extended cell culture period (7 days).
  • the methods used to analyze percent HDR were PCR-based without the use of a tagged primer and isolation steps.
  • Fig. 3B shows the template construct used to generate the data shown in Fig.
  • Figs. 4A shows the percent editing in Hepa 1-6 cells induced to make a DSB with Cas9 and provided with HDR template, where the reaction mixture was treated with Exol in an attempt to reduce false-positive HDR hits.
  • Fig. 4B shows the percent homology directed repair in Hepa 1-6 cells induced to make a DSB with Cas9 and provided with HDR template, where the reaction mixture was treated with Exol in an attempt to reduce false-positive HDR hits.
  • Fig. 4C shows the same results as Fig. 4B with greater expansion of the y- axis to show the low levels of HDR in the presence of template only, without Cas9.
  • Fig. 5 shows percent HDR in Hepa 1-6 cells induced to undergo HDR via liponanoparticle (LNP) delivery of Cas9, Guide RNA, and HDR template.
  • LNP liponanoparticle
  • the legend provides [ng of Cas9], [ng of guide RNA].
  • the reaction mixture was treated with Exol in an attempt to reduce false-positive HDR hits.
  • Fig. 6 shows results of an editing experiment utilizing the LA Method to quantitate HDR events.
  • the graph shows the editing percentage of mouse transthyretin (TTR) in Hepal .6 lysates treated with single-stranded mouse TTR (mTTR) repair template using the LA Method of the invention.
  • Samples were treated with RNP (+RNP) or without RNP (- RNP), followed by linear amplification using one of LA Primer 1, 2, 3, or 4 (SEQ ID No: 2- 5). Exclusion of RNP led to a minimal measurement of background editing when the LA Method was used, with a clear window of editing seen with inclusion of RNP.
  • LA linear amplification.
  • FIG. 7 shows results of the same experiment as shown in Fig. 6, using the same samples used to generate the data in Fig 5, but this time measuring percentage of HDR rather than editing percentage. Samples incubated with template, but without RNP, showed minimal HDR when the LA Method was used.
  • Fig. 8 shows results of an editing experiment utilizing the LA Method to quantitate HDR events.
  • the graph shows the editing percentage of TTR in Hepal .6 lysates treated with single-stranded repair template (13, 3, or 13M; SEQ ID Nos: 8, 9 or 10, respectively) with RNP (right panels) or without RNP (left panels), followed by linear amplification.
  • Use of the LA Method in samples without RNP led to minimal background measurement of editing with a clear window for measurement of editing with inclusion of RNP.
  • Fig. 9 shows results of the same experiment as shown in Fig. 8, this time measuring percentage of HDR rather than editing percentage.
  • Use of the LA Method in samples without RNP led to minimal background measurement of HDR with a clear window for measurement of HDR with inclusion of RNP.
  • Fig. 10 shows a schematic of one embodiment of a linear amplification polymerase chain reaction (LAM-PCR) process utilizing a tagged primer for analyzing DNA.
  • the genomic DNA is optionally fragmented prior to LAM-PCR.
  • Tagged LA primers containing unique molecular barcodes are used.
  • the star represents a biotin tag on the LA primer; "P5" represents a sequencing adapter sequence (e.g., Illumina P5); “UMI” represents the unique molecular barcode; “GSP FWD” represents a gene specific forward primer sequence; “SAV” represents a streptavidin capture reagent; “GSP_REV” represents a gene specific reverse primer sequence; and “P7” represents a sequencing adapter sequence (e.g., Illumina P7).
  • P5 represents a sequencing adapter sequence (e.g., Illumina P5)
  • UMI represents the unique molecular barcode
  • GSP FWD represents a gene specific forward primer sequence
  • SAV represents a streptavidin capture reagent
  • GSP_REV represents a gene specific reverse primer sequence
  • P7 represents a sequencing adapter sequence (e.g., Illumina P7).
  • Fig. 11 shows results of an experiment testing the effect of shearing (e.g., fragmenting) DNA on the sensitivity of LAM-PCR method utilizing a barcoded LA primer.
  • the "fold change" on the y-axis refers to the percentage of genomic capture normalized to 1000 ng. Shearing the DNA improved the sensitivity of the assay when the quantity of input DNA was 250 ng or less.
  • Table 1 provides a listing of certain sequences referenced herein.
  • Fi501 primer 11 AATGATACGGCGACCACCGAGATCTACACnnnnnnnACACTCTTTCC
  • Ri701 primer 12 CAAGCAGAAGACGGCATACGAGATnnnnnnnnGTGACTGGAGTTCAGA
  • GSP7R 18 GGAGTTCAGACGTGTGCTCTTCCGATCTTTCCTGGGAGGTGTCCACGT
  • the methods described herein allow for quantitative analysis of gene editing events, for example indel formation or template-mediated HDR events.
  • the methods involve removing the template DNA that may contaminate the reaction and give false positives.
  • the methods generally involve: linear amplification of the target DNA with a tagged primer, isolation of the tagged linear amplification products, and analysis of the products to determine, for example, the presence of an indel or whether template sequence was indeed incorporated into the repaired DNA.
  • the target DNA to be analyzed may be genomic or mitochondrial DNA of a prokaryotic or eukaryotic cell, including humans.
  • a "LAM-PCR method" includes the steps of linear amplification of target DNA with a tagged primer, and isolation of the tagged linear amplification products.
  • the HDR template DNA may be single or double-stranded.
  • linear amplification refers to methods where the number of copies of amplification product increases linearly according to the number of amplification cycles.
  • Each amplification cycle may involve a denaturation step to separate DNA duplexes, an annealing step to allow primer binding, and an elongation step.
  • the denaturing and annealing steps may be carried out by using standard heating and cooling conditions, which are known to those of skill in the art.
  • An example protocol of denaturing and annealing steps is denaturing at 98°C for 10s; annealing at 67°C for 15s; and elongation at 72°C for 5s.
  • the annealing temperature may vary depending on the primer design and sequence.
  • conditions for elongation may vary according to the desired sequence to be analyzed and the relative location of the linear amplification primer.
  • the number of cycles performed can vary from 1 to 50 or more.
  • the number of cycles may be 1-50 cycles, 1-60 cycles, 1-70 cycles, 1-80 cycles, 1-90 cycles, or 1-100 cycles.
  • the number of cycles may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50, and so on increasing via multiples of 1 to about 100.
  • isothermal linear amplification methods i.e., linear amplification approaches that do not require changing the reaction temperature
  • Example methods of isothermal linear amplification include loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification, nicking enzyme amplification reaction, or other methods of isothermal linear amplification known to those skilled in the art.
  • LAMP loop-mediated isothermal amplification
  • SDA strand displacement amplification
  • helicase-dependent amplification helicase-dependent amplification
  • nicking enzyme amplification reaction or other methods of isothermal linear amplification known to those skilled in the art.
  • strand displacement polymerase(s) are used for SDA.
  • the strand displacement polymerases are Bst DNA Polymerase, Large Fragment or Klenow Fragment (3 '-5' exo-).
  • the target DNA (e.g., the input material comprising cellular or genomic DNA) is sheared or fragmented prior to linear amplification.
  • Sheared and fragmented are used interchangeably throughout.
  • Methods of shearing or fragmenting nucleic acids such as DNA are known in the art, and include, for example, physical shearing (e.g., acoustic shearing, sonication, hydrodynamic shearing, etc.), enzymatic methods (e.g., use of DNase I, restriction endonucl eases, non-specific nucleases, transposase, etc.), or chemical fragmentation (e.g., use of heat and divalent metal cations).
  • the DNA is sheared or fragmented to an average size between 0.5 kb to 20.0 kb. In some embodiments, the DNA is sheared or fragmented to an average size of 0.5, 0.75, 1.0, 1.25, 1.5, 1.75, 2.0, 2.25, 2.5, 2.75, 3.0, 3.25, 3.5, 3.75, 4.00, 4.25, 4.5, 4.75, 5.0, 5.25, 5.5, 5.75, 6.0, 6.25, 6.5, 6.75, 7.0, 7.25, 7.5, 7.75, 8.0, 8.25, 8.5, 8.75, 9.0, 9.25, 9.5, 9.75, 10.0, 10.25, 10.5, 10.75, 11.0, 11.25, 11.5, 11.75, 12.0, 12.25, 12.5, 12.75, 13.0, 13.25, 13.5, 13.75, 14.0, 14.25, 14.5, 14.75, 15.0, 15.25, 15.5, 15.75, 16.0, 16.25, 16.5, 16.75, 17.0, 17.25, 17.5, 17.75,
  • the amount of target DNA (e.g., the input material comprising cellular or genomic DNA) used in the LA reaction is between about 1 ng and 5 ⁇ g. In some embodiments, the amount of target DNA is between 1 ng and 1000 ng. In some embodiments, the amount of target DNA is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 ng.
  • the amount of target DNA is between 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90- 100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, 190-200, 200-210, 210-220, 220-230, 230-240, 240-250, 250-260, 260-270, 270-280, 280- 290, 290-300, 300-310, 310-320, 320-330, 330-340, 340-350, 350-360, 360-370, 370-380, 380-390, 390-400, 400-410, 410-420, 420-430, 430-440, 440-450, 450-460, 460-470, 470- 480, 480-490, 490-500, 500-510, 510-520, 520-530, 530-540, 540-
  • One or more linear amplification (LA) primers may be designed to amplify the desired DNA site to be analyzed (see Figures 2 and 10, for example).
  • the primer anneals to the same strand of the target DNA as the single-stranded HDR template would anneal (i.e., the primer is in the same 5' to 3' orientation as the single-stranded HDR template).
  • the HDR template is double-stranded, only one cycle of linear amplification is performed prior to isolating the linear amplification product.
  • the primer may be as far upstream or downstream as permitted by the maximum processivity of the polymerase being employed, e.g., over 10,000 nucleotides. In some embodiments, the primer may be 50 to 300 nucleotides away from the target site (e.g., the expected indel or template insertion site).
  • the primer may be at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260, at least 270, at least 280, at least 290, or at least 300 nucleotides away from the target site.
  • the primer may be designed such that it does not hybridize with the HDR template during amplification reactions. Primers may also be optimized for GC content, melting temperature, and amplification efficiency.
  • the primer anneals to the same strand that the single-stranded template would anneal.
  • the primer anneals to the strand that is complementary to the template (or one strand of a double-stranded template). In such a circumstance utilizing a double-stranded template, it is preferred to use only one linear amplification cycle prior to purification.
  • the primer e.g., the pool of primers
  • the primer can include a molecular barcode(s).
  • the molecular barcodes may comprise one or more target specific regions, label regions, sample index regions, universal PCR regions, adaptors (e.g., NGS sequencing adaptors such as Illumina P5 or P7 sequences, or portions thereof), linkers, or any combination of these elements.
  • the molecular barcode may be a sample tag or a molecular identifier label.
  • multiple molecular barcodes may be used.
  • the molecular barcode may comprise one or more oligonucleotides.
  • the molecular barcode may be at least about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50 or more nucleotides in length.
  • the molecular barcode may comprise a random nucleotide sequence.
  • the random nucleotide sequence may be computer generated.
  • the random nucleotide sequence may have no pattern associated with it.
  • the random nucleotide sequence may be at least about 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 20 nucleotides in length.
  • the molecular barcode may comprise a non-random nucleotide sequence, wherein the nucleotides comprise a pattern.
  • the molecular barcode may be a commercially available sequence.
  • the molecular barcode may comprise one or more secondary structures.
  • the molecular barcode may comprise a hairpin structure.
  • the linear amplification primers include a tag.
  • the linear amplification primers include one or more molecular barcodes and a tag.
  • the tag is a purification tag that may be associated with a capture reagent such that the tag-capture reagent interaction is stronger than standard DNA- DNA interactions to allow for proper purification of the linear amplification products resulting from such tagged primers.
  • the tag should be of a size and structure such that it will not interfere with binding or priming of an amplification reaction.
  • the tag is at the 5 ' end of the primer. In some embodiments, the tag is at the 3' end of the primer.
  • the tag is at an internal nucleotide site.
  • the tag may be attached, conjugated, or otherwise associated with the primer by methods known to those of skill in the art.
  • Exemplary tags include biotin, streptavidin, digoxigenin, a DNA sequence, or fluorescein or a derivative of fluorescein such as fluorescein isothiocyanate (FITC).
  • Capture reagents are chosen according to the tag.
  • a biotin tag may utilize a streptavidin capture.
  • a streptavidin tag may utilize a biotin capture.
  • a digoxigenin tag may utilize an anti-digoxigenin antibody or Fab fragment capture(s).
  • a DNA sequence tag may utilize a complementary DNA sequence capture.
  • a fluorescein or a derivative of fluorescein tag, such as FITC tag may utilize an anti-FITC or anti-fluorescein antibody or Fab fragment capture.
  • FITC is used as an example fluorescein derivative.
  • the term “FITC” would be interchangeable with any fluorescein derivative, including 6-FAM (6-carboxyfluorescein), carboxylates, and succinimidyl esters.
  • tags and capture reagents are interchangeable such that in some instances the capture reagent may be called a capture reagent and vice versa - the tag-capture pairing is key.
  • a purification or isolation step allows removal of non-tagged amplification products (e.g., those resulting from template-primed events or background genomic DNA) which may skew the results or negatively affect downstream steps. Only amplification products primed from the desired tagged LA primer will be captured after
  • purification/isolation can be designed to separate any untagged nucleic acids (e.g., free template DNA, genomic DNA, RNA) from the tagged linear amplification products.
  • the capture reagent can be on beads, a solid surface, or a column. Wash steps may be designed to reduce nonspecific binding.
  • the linear amplification products can be purified using streptavidin beads and high salt (e.g., 1 M NaCl) and/or high pH buffer washes.
  • the purification or isolation step comprises contacting the linear amplification product or products with a capture reagent that is specific for the tag used on the primer.
  • the purification or isolation step comprises discarding any DNA that is not captured.
  • the purification or isolation step comprises washing the capture-tag so as to remove essentially all of the non-tagged DNA and RNA.
  • the tag-capture pair is biotin and streptavidin.
  • biotin is the tag and streptavidin is the capture reagent.
  • more than one biotin may be used per primer as a tag.
  • the biotin tag is added using photoreactive biotinylation reagents.
  • streptavidin is the tag and biotin is the capture reagent.
  • more than one streptavidin may be used per primer as a tag.
  • the tag-capture is digoxigenin and an anti-digoxigenin antibody or Fab fragment.
  • digoxigenin is the tag and an anti- digoxigenin antibody or Fab fragment is the capture.
  • more than one digoxigenin may be used per primer as a tag.
  • digoxigenin is attached to a 5 '-amino substituted primer.
  • an anti-digoxigenin antibody or Fab fragment is the tag and digoxigenin is the capture.
  • more than one anti- digoxigenin antibody or Fab fragment may be used per primer as a tag.
  • the tag-capture is a DNA sequence tag and a complementary DNA sequence capture.
  • the complementary DNA sequence capture nucleotides are contained on microspheres.
  • the microspheres are oligonucleotide-coupled polystyrene microparticles, which may be termed "beads.”
  • the tag is a "TAG” sequence and the capture is performed using MagPlex-TAGTM microspheres (Luminex) with an "anti-TAG” sequence.
  • the tag-capture is fluorescein or a derivative of fluorescein and an anti-FITC or anti-fluorescein antibody or Fab fragment.
  • the fluorescein or derivative of fluorescein is FITC, 6-FAM (6- carboxyfluorescein), carboxylates, and succinimidyl esters.
  • the fluorescein or derivative of fluorescein is the tag and an anti-FITC and anti-fluorescein antibody or Fab fragment is the capture.
  • more than one fluorescein or derivative of fluorescein may be used per primer as a tag.
  • an anti- FITC or anti-fluorescein antibody or Fab fragment is the tag and fluorescein or derivative of fluorescein is the capture. In some embodiments, more than one anti-FITC or anti-fluorescein antibody or Fab fragment may be used per primer as a tag.
  • aptamer sequences for use as a tag may be designed to bind to a capture protein.
  • the linear amplification products can be separated from the capture reagent or the tag prior to further amplification, or the amplification may be performed in the presence of the capture reagent and tag.
  • Analysis of the linear amplification products may involve unbiased methods that provide information on the nature and amount of each editing event.
  • analysis can be performed using methods such as PCR amplification and next generation sequencing (NGS). Additional analysis methods include digital PCR (dPCR), droplet digital PCR (ddPCR), qPCR, and RT-PCR.
  • dPCR digital PCR
  • ddPCR droplet digital PCR
  • qPCR qPCR
  • RT-PCR RT-PCR.
  • a probe can be used to detect and quantify linear amplification products containing desired sequences.
  • the linear amplification product can be cloned into a plasmid and sequenced by Sanger sequencing.
  • next generation sequencing refers to non-Sanger-based sequencing technologies having increased throughput, for example with the ability to generate hundreds of thousands of relatively small sequence reads at a time.
  • next generation sequencing techniques include, but are not limited to, sequencing by synthesis, sequencing by ligation, and sequencing by hybridization.
  • Some relatively well- known next generations sequencing methods further include pyrosequencing developed by 454 Corporation, the Solexa system, and the SOLiD (Sequencing by Oligonucleotide Ligation and Detection) developed by Applied Biosystems (now Life Technologies, Inc.), and the Sequel System (PacBio ® ).
  • Example 1 Template DNA can contaminate sequencing results
  • primers may be designed such that they hybridize to genomic DNA, but not the template itself. Nevertheless, during an amplification cycle, the template may bind to genomic DNA and act as a primer itself, resulting in a first extension product that includes a binding site for a reverse amplification primer (see Figure 1). In a subsequent cycle, the first extension product can be amplified by standard priming by the reverse primer, creating a complementary extension product. The complementary extension product can subsequently hybridize with genomic DNA and act as a primer that results in a second extension product that includes a binding site for a forward amplification primer.
  • an artificial template containing both primer binding sites can be created from the original repair template. If this occurs during an early portion of the amplification reaction, the artificial template will be amplified along with the desired genomic DNA sequence, and quantitation of HDR repair events may be inaccurately skewed.
  • Figure 2 shows the design of a LA Method described herein using a biotinylated LA primer, linear amplification, and purification of LA products using streptavidin beads.
  • the LA Method may be followed by standard amplicon-based PCR sequencing (amplicon-seq PCR) and next generation sequencing (NGS) analysis.
  • RNP Cas9-guide RNA ribonucleoprotein
  • mTTR mouse transthyretin
  • RNP was formed by mixing 5 ⁇ , of 50 ⁇ Cas9 with 20 ⁇ , of 25 ⁇ single guide RNA (CR686 (SEQ ID No: 1)) at room temperature.
  • Murine hepatocellular carcinoma Hepal.6 cells were electroporated with RNP (100,000 cells/reaction with 1 ⁇ RNP in ⁇ , total volume) and 0, 50 pmol, or 100 pmol of template (686 Rev; SEQ ID No: 15). Control cells were electroporated with 100 pmol of template without any RNP. Cells were plated into a 96-well dish with 100 ⁇ . of cell culture media. On Day 2, cells were passaged 1 : 10 in 96 well plates. Lysates were made at Day 7 post transfection.
  • Figure 3A shows that after 7 days, the template-only control did not yield any detectable levels of contamination in the NGS analysis, while samples containing CRISPR/Cas9 components and template showed significant editing rates, including up to 20% HDR events.
  • the same experimental design produced similar HDR results in CD3+ T Cells (data not shown).
  • One strategy for eliminating template contamination includes treating cell lysates with exonuclease (Exol) to digest single-stranded DNA template prior to
  • Hepal .6 cells (10000 cells per well in a 96-well plate) were transfected with 0.39 0.78, 1.56, 3.125, 6.25, 12.5, 25, 50, or 100 pmols of single-stranded DNA template, with or without ⁇ of RNP targeting mouse TTR.
  • RNP was prepared by boiling single guide RNA (G209; SEQ ID No: 16) at 95 °C for 2 min, cooling on ice to room temperature, and incubating with equimolar amounts of Cas9 (10 ⁇ and 10 ⁇ to make a final concentration of ⁇ in 100 ⁇ ) and transfected into cells using CRISPRMAX (Thermo Fisher) according to standard protocols.
  • Template DNA (696 Rev; SEQ ID No: 15) was co- formulated with RNP in a single lipoplex.
  • Cells were cultured for 3 days prior to lysis and Exol treatment.
  • Exol digestion 12.5 of ly sate was mixed with 1.5 of 10X buffer and 1 ⁇ . of Exol enzyme. Reactions were incubated at 37°C for 30 min to allow for single- strand DNA (ssDNA) digestion, followed by 80°C for 20 min to inactive the enzyme.
  • ssDNA single- strand DNA
  • Figures 4A-B show that in this experiment, Exol treatment reduced template contamination to less than 0.2% in the template-only controls as measured by editing percent (Figure 4A) or HDR percentage (Figure 4B).
  • Figure 4C provides the same data as shown in Figure 4B with an expanded y-axis.
  • LNPs lipid nanoparticles
  • Exol treatment was used to clean up the samples prior to analysis.
  • LNPs containing Cas9-encoding mRNA, guide RNA, or template were separately formulated with a cationic lipid to nucleic acid phosphate (N: P) molar ratio of about 4.5.
  • the lipid nanoparticle components were dissolved in 100% ethanol with the following molar ratios: 45 mol-% (12.7 mM) cationic lipid; 44 mol- % (12.4 mM) cholesterol; 9 mol-% (2.53 mM) DSPC; and 2 mol-% (.563 mM) PEG2k- DMG.
  • the nucleic acid cargo was dissolved in 50 mM acetate buffer, pH 4.5, resulting in a concentration of RNA or DNA cargo of approximately 0.45 mg/mL.
  • LNPs were formed by microfluidic mixing of the lipid and nucleic acid solutions using a Precision Nanosystems NanoAssemblrTM Benchtop Instrument, according to the manufacturer's protocol. A 2: 1 ratio of aqueous to organic solvent was maintained during mixing using differential flow rates. After mixing, the LNPs were collected, diluted in phosphate buffered saline (PBS, approximately 1 : 1), and then remaining buffer was exchanged into PBS (100-fold excess of sample volume), overnight at 4°C under gentle stirring using a 10 kDa Slide-a-LyzerTM G2 Dialysis Cassette (ThermoFisher Scientific). The resulting mixture was then filtered using a 0.2 ⁇ sterile filter.
  • PBS phosphate buffered saline
  • FIG. 8 shows a schematic of the LA Method as described herein.
  • Hepal .6 cells (10000 cells per well in a 96-well plate) were transfected with 0 or 100 nM RNP directed to the mouse TTR (mTTR) gene as described above, and with 0, 25, 50, or 100 pmols of single-stranded repair template 13 (SEQ ID No: 8), using
  • Lipofectamine 2000 Template was formulated in a separate lipoplex at the highest concentration, and 2-fold dilutions were made to achieve lower concentrations using transfection media. Cells were cultured for 3 days before lysis and analysis.
  • Figure 6 shows the total editing percent calculated from NGS analysis with (+ RNP) and without RNP (- RNP).
  • Figure 7 shows the percent HDR calculated from the same samples. These data show that by using the LA Method, template contamination can be consistently reduced below 0.04%. Dashed boxes in Figure 7 indicate that even at higher concentration of template, a very small percentage of HDR is seen without RNP.
  • the four linear amplification primers show similar results, and analysis of the underlying repair structures are consistent across primers. The consistency of efficacy of the LA Method to reduce template contamination across primers shows that this process can be used with a range of different primers.
  • Example 5 Use of molecular barcodes in the LA primer deconvolutes PCR amplification bias and increases sensitivity of the LA Method while decreasing the amount of input material required
  • PCR used in quantitative sequencing methods may skew results based upon amplification bias, resulting in an over- or underrepresentation of certain amplicons (e.g., alleles) in a population.
  • the methodology outlined in the schematic of Figure 10 enables deconvolution of PCR bias through use of molecular barcoded LA primers. Because each LA primer used in the (single) linear amplification step contains a unique molecular barcode, each linear amplification product contains a unique identifier that can be analyzed following the PCR reactions to determine whether any particular linear amplification product was more or less efficiently amplified as compared to others in the population. Further, this method allows for a significant decrease in the amount of genomic input material that is typically required for assaying rare genetic events in a population (e.g., micrograms to nanograms of input material).
  • a single cycle of LAM-PCR was performed under the following conditions: 98°C for 30 s; 98°C for 10 s; 65°C for 30 s; 72°C for 5 s; 72°C for 2 min; then hold at 4°C.
  • Bio LA primer was removed using size selection by AMPure beads by adding 80 ⁇ . of AMPure to 100 ⁇ . of single cycled LA product for a ratio of 0.8x: lx. This ratio excluded fragments under 100 bp.
  • the AMPure beads and LA product were then pelleted on a magnet and the supernatant was removed once cleared.
  • the bead pellet was washed three times with 80% ethanol, and allowed to dry at room temperature for 5 mins, or until first crack in bead pellet appeared.
  • LA product was eluted off the beads by adding ⁇ 0 ⁇ . of water and vortexing for 20 s, or until the beads went into solution. The beads were then pellet again on a magnet. Ten ⁇ . of the DNA/water suspension was removed, and 40 ⁇ . of 5x Q5 buffer was added for a total volume of 50 ⁇ ..
  • One hundred ⁇ . of Dynabeads MyOne Streptavidin CI (Thermo Fisher) beads were then added to purify the LA products prior to NGS analysis.
  • the beads were washed three times with buffer containing 10 mM Tris, pH7.5 and 1 M NaCl, and purified in a 96-well plate on a KingFisher Purification System (ThermoFisher). Beads with captured DNA were recovered in 30 of water after purification.
  • Standard PCR reactions were performed on the purified LA products (e.g., directly on the beads) in a volume of 72 ⁇ ..
  • the Forward NGS adapter primer (SEQ ID NO: 6) and a chimeric reverse primer with a gene specific 3' end and Illumina P7 5' end (SEQ ID NO: 18) were used in a 50-cycle amplification, e.g., 98°C for 30 s, 98°C for 10 s, 65°C for 75 s, 65°C 5 m, 4°C hold.
  • the reaction products were prepped using size selection by AMPure beads by adding 43.2 ⁇ . of AMPure to 72 ⁇ . of PCR product for a ratio of 0.6x: lx.
  • AMPure beads and PCR product were then pelleted on a magnet and the supernatant was removed once cleared.
  • the bead pellet was washed three times with 80% ethanol, then dried at room temperature for 5 mins, or until first crack in bead pellet appeared.
  • PCR products were eluted off beads by adding 50 ⁇ of water and vortexing for 20 s, or until beads go into solution. The beads were pelleted again on a magnet.
  • the eluted clean PCR product was then removed and an additional 12 cycle standard PCR was performed with full length NGS adapters (e.g., comprising alO bp molecular barcode for indexing) using Fi501v2 (SEQ ID NO: 19) and Ri701v2 (SEQ ID NO:20) primers.
  • the PCR reaction used a 20 volume using 2.0 of PCR product with 2.5 ⁇ Fi501v2 and 2.5 ⁇ Ri701v2 primers and 10 ⁇ . of 2x Q5 High fidelity Hot start Master mix.
  • the cycle conditions were 98°C 30s, 98°C 10s, 65°C 75 s, 65°C 5 min, 4°C hold.
  • PCR samples were pooled and a 0.7x: l AMPure reaction was performed. This ratio excluded fragments under 100 bp.
  • the AMPure beads and PCR product were then pelleted on a magnet and the supernatant was removed once cleared. The bead pellet was washed three times with 80% ethanol, then was allowed to dry at room temperature for 5 mins, or until first crack in bead pellet appeared.
  • PCR products were eluted off beads by adding 50 ⁇ . of water and vortexing for 20 s, or until beads go into solution. The beads were again pelleted on a magnet, and 50 ⁇ . of eluate was removed to another clean 1.7mL tube. One ⁇ .

Abstract

L'invention concerne des compositions et des méthodes de détection et de quantification d'événements d'édition de gènes. Les méthodes selon l'invention peuvent comprendre des étapes d'amplification linéaire de l'ADN cible avec une amorce marquée, d'isolement des produits d'amplification linéaire et d'analyse des produits pour déterminer la fréquence de l'événement d'édition de gène.
PCT/US2017/051469 2016-09-14 2017-09-14 Méthodes améliorées d'analyse d'adn édité WO2018053070A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662394469P 2016-09-14 2016-09-14
US62/394,469 2016-09-14

Publications (1)

Publication Number Publication Date
WO2018053070A1 true WO2018053070A1 (fr) 2018-03-22

Family

ID=59955717

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/051469 WO2018053070A1 (fr) 2016-09-14 2017-09-14 Méthodes améliorées d'analyse d'adn édité

Country Status (2)

Country Link
US (1) US20190328855A1 (fr)
WO (1) WO2018053070A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022086880A1 (fr) * 2020-10-19 2022-04-28 Morava Inc. Séquençage de nouvelle génération amélioré
EP4202058A4 (fr) * 2021-11-09 2024-05-01 Nanodigmbio Nanjing Biotechnology Co Ltd Élément de construction de banque compatible avec les plates-formes de double séquençage, kit et procédé de construction de banque

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011086118A1 (fr) * 2010-01-14 2011-07-21 Deutsches Krebsforschungszentrum Détermination de la localisation d'une cassure double brin d'adn in vivo et application associée
US20150167066A1 (en) * 2013-12-12 2015-06-18 Raindance Technologies, Inc. Distinguishing rare variations in a nucleic acid sequence from a sample
WO2015121236A1 (fr) * 2014-02-11 2015-08-20 F. Hoffmann-La Roche Ag Séquençage ciblé et filtrage uid
WO2016081798A1 (fr) * 2014-11-20 2016-05-26 Children's Medical Center Corporation Procédés relatifs à la détection de bris bicaténaires récurrents et non spécifiques dans le génome
WO2016100974A1 (fr) * 2014-12-19 2016-06-23 The Broad Institute Inc. Identification non biaisée de cassures bicaténaires et réarrangement génomique par séquençage de capture d'insert à l'échelle du génome

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011086118A1 (fr) * 2010-01-14 2011-07-21 Deutsches Krebsforschungszentrum Détermination de la localisation d'une cassure double brin d'adn in vivo et application associée
US20150167066A1 (en) * 2013-12-12 2015-06-18 Raindance Technologies, Inc. Distinguishing rare variations in a nucleic acid sequence from a sample
WO2015121236A1 (fr) * 2014-02-11 2015-08-20 F. Hoffmann-La Roche Ag Séquençage ciblé et filtrage uid
WO2016081798A1 (fr) * 2014-11-20 2016-05-26 Children's Medical Center Corporation Procédés relatifs à la détection de bris bicaténaires récurrents et non spécifiques dans le génome
WO2016100974A1 (fr) * 2014-12-19 2016-06-23 The Broad Institute Inc. Identification non biaisée de cassures bicaténaires et réarrangement génomique par séquençage de capture d'insert à l'échelle du génome

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JIAZHI HU ET AL: "Detecting DNA double-stranded breaks in mammalian genomes by linear amplification-mediated high-throughput genome-wide translocation sequencing", NATURE PROTOCOLS, vol. 11, no. 5, 31 March 2016 (2016-03-31), GB, pages 853 - 871, XP055423017, ISSN: 1754-2189, DOI: 10.1038/nprot.2016.043 *
RICHARD L FROCK ET AL: "Genome-wide detection of DNA double-stranded breaks induced by engineered nucleases", NATURE BIOTECHNOLOGY, vol. 33, no. 2, 15 December 2014 (2014-12-15), pages 179 - 186, XP055258610, ISSN: 1087-0156, DOI: 10.1038/nbt.3101 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022086880A1 (fr) * 2020-10-19 2022-04-28 Morava Inc. Séquençage de nouvelle génération amélioré
EP4202058A4 (fr) * 2021-11-09 2024-05-01 Nanodigmbio Nanjing Biotechnology Co Ltd Élément de construction de banque compatible avec les plates-formes de double séquençage, kit et procédé de construction de banque

Also Published As

Publication number Publication date
US20190328855A1 (en) 2019-10-31

Similar Documents

Publication Publication Date Title
US11692213B2 (en) Compositions and methods for targeted depletion, enrichment, and partitioning of nucleic acids using CRISPR/Cas system proteins
US20220333160A1 (en) Methods for selectively suppressing non-target sequences
US10858651B2 (en) Compositions and methods for enrichment of nucleic acids
US20210355537A1 (en) Compositions and methods for identification of a duplicate sequencing read
JP5806213B2 (ja) 核酸の特異的解析のためのプローブ
EP3633047B1 (fr) Procédés de séquenage d' acides nucléiques basé sur un enrichissement d'acides nucléiques
JP2023080282A (ja) Ｃａｓタンパク質の使用、標的核酸分子の検出方法、及びキット
JP6982087B2 (ja) 競合的鎖置換を利用する次世代シーケンシング（ｎｇｓ）ライブラリーの構築
JP6335918B2 (ja) 制限酵素を用いない標的富化
US20180051320A1 (en) Depletion of abundant sequences by hybridization (dash)
EP3174997B1 (fr) Procédé de sélection d'une séquence d'acides nucléiques
JP2022527725A (ja) 部位特異的核酸を用いた核酸濃縮と続いての捕捉方法
EP3174998B1 (fr) Procédé de sélection d'une séquence d'acide nucléique cible
WO2018067447A1 (fr) Méthodes améliorées d'identification de sites de rupture de double-brin
JP2018506307A (ja) 非特異的増幅産物を減少させる為の方法及び組成物
CA3069843A1 (fr) Detection d'acides nucleiques rares
US11680285B2 (en) Hooked probe, method for ligating nucleic acid and method for constructing sequencing library
WO2018053070A1 (fr) Méthodes améliorées d'analyse d'adn édité
US20160273027A1 (en) Methods for detecting nucleic acids proximity
WO2022229128A1 (fr) Amplification d'adn simple brin
WO2023012195A1 (fr) Procédé
JP2022131985A (ja) 分子バーコディング効率を向上させるための組成物及びその用途
JP2022521209A (ja) 改良された核酸標的濃縮および関連方法
US20180171398A1 (en) Improvements in and relating to nucleic acid probes and hybridisation methods

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17772243

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17772243

Country of ref document: EP

Kind code of ref document: A1