WO2018043932A1 - Composition for preventing and treating dental pulp disease - Google Patents
Composition for preventing and treating dental pulp disease Download PDFInfo
- Publication number
- WO2018043932A1 WO2018043932A1 PCT/KR2017/008437 KR2017008437W WO2018043932A1 WO 2018043932 A1 WO2018043932 A1 WO 2018043932A1 KR 2017008437 W KR2017008437 W KR 2017008437W WO 2018043932 A1 WO2018043932 A1 WO 2018043932A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- composition
- pulp
- treatment
- disease
- prevention
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
- A61K31/737—Sulfated polysaccharides, e.g. chondroitin sulfate, dermatan sulfate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
- A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K51/00—Preparations containing radioactive substances for use in therapy or testing in vivo
- A61K51/02—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus
- A61K51/025—Preparations containing radioactive substances for use in therapy or testing in vivo characterised by the carrier, i.e. characterised by the agent or material covalently linked or complexing the radioactive nucleus inorganic Tc complexes or compounds
Definitions
- the present invention relates to a composition for preventing and treating pulp diseases, and more particularly, a composition for preventing and treating pulp diseases that can increase the activity of dental hard tissues while shortening the curing time of materials and differentiating dentin cells using such compositions. It is about a promotion method.
- the dental pulp is a soft connective tissue that fills the pulp cavity inside the tooth and is rich in nerves and blood vessels.
- the nerves of the pulp make up the plexus in the dentin cells in contact with the inner surface of the dental dentin of the outermost pulp, and the branches reach the dentin superficial layer.
- the pulp forms a complex with the dentin, which is responsible for the regeneration and healing of the dentin (hemorrhoids).
- the dentin is damaged by caries, trauma, etc., pulp inflammatory reaction or tissue damage can easily occur, and as a result, pulp disease is more likely to be caused. Therefore, it is important to prevent pulp disease caused by damage to the hard tissue of the tooth, particularly dentin in the hard tissue of the tooth, and to prevent irreversible tissue damage.
- MTA mineral trioxide aggregate
- MTA is composed of tricalcium silicate, tricalcium aluminate, tricalcium oxide, and silicate oxide, and is a hydrophilic fine powder that cures within 4 hours when contacted with moisture. , PH after curing is about 12.5.
- MTA has a relatively high stability after curing, not only induces dentin bridge formation, but also maintains a monocaloric pH to remove bacteria that may be present in the demodulated dimensions.
- MTA is a relatively expensive dental material and has sandy consistancy in the stirring process.
- the inventors of the present invention have searched for materials that are safe for the human body in connection with the prevention and treatment of pulp disease, and the above-mentioned disadvantages have been achieved through the use of the hydraulic binder and the brown algae-derived polysaccharide with viscosity. It was recognized that it could be supplemented.
- the inventors of the present invention have focused on the use of fucoidan, which is rich in nutrients such as essential minerals and vitamins, which are beneficial to the human body, such as calcium and iodine, and which has high physiological activity, among polysaccharides derived from brown algae.
- the problem to be solved by the present invention is to provide a composition for the prevention and treatment of pulp diseases that shorten the curing time and contribute to bone formation.
- composition for preventing and treating pulp disease comprising fucoidan and hydraulic binder.
- the polysaccharide is cellulose, alkyl cellulose, alkyl hydroxyalkyl cellulose, hydroxyalkyl cellulose, cellulose sulfate, salt of carboxymethyl cellulose, carboxymethyl cellulose, carboxyethyl cellulose, chitin, carboxymethyl chitin, hyaluronic acid, hyaluronic acid Salts of lonic acid, alginates, alginic acids, propylene glycol alginates, glycogen, dextran, dextran sulfate, curdlan, pectin, pullulan, xanthan, chondroitin sulfate, chondroitin sulfate, carboxymethyl dextran, Carboxymethyl Chitosan, Chitosan, Heparin, Heparin Sulfate, Heparan, Heparan S
- the polysaccharide may be a polysaccharide having a sulfate group.
- the composition for the prevention and treatment of pulp disease may be configured to include one or more of the various polysaccharides described above, not fucoidan.
- the term "fucoidan” refers to a sulfated polysaccharide having a sticky viscous structure, and is generally contained in brown algae such as seaweed and kelp, and has an average molecular weight of 20 kDa. It may be a substance in which sugar and sulfate groups are combined. Fucoidan can be specifically obtained from marine brown algae such as sugar kelp (Laminaria saccharina), L. digitata, Fucus distichus, and Okinawa mozuku (Cladosiphon okamuranus).
- hydraulic cement refers to a property that various cements react with water or an aqueous solution to produce hydrates with low solubility to cure.
- hydraulic cement may be used.
- portland cement, portland cement, mixed cement, and special cement can be used for hydraulic cement.
- using portland cement as a hydraulic binder may be excellent in biocompatibility, but various materials may be used as the hydraulic binder, without being limited thereto.
- the hydraulic binder may be included in an amount of 15 wt% to 55 wt% based on the total weight of the composition.
- the curing time may be too long due to the low viscosity in the dimensional treatment where it is important to immediately temporarily restore the pulp portion.
- the hydraulic binder when the hydraulic binder is a composition having 55 wt% or more relative to the total weight of the composition, the viscosity may be difficult to operate due to the high viscosity, so that the hydraulic binder may be included at 55 wt% or less relative to the total weight of the composition. have.
- maintaining the average particle size (D50) of the hydraulic binder below 3 ⁇ m is desirable for manipulating the binder and maintaining high biological activity.
- the hydraulic binder may further contain calcium oxide, calcium hydroxide and calcium chloride.
- calcium chloride may be involved in shortening the curing time of the hydraulic binder, and may improve biocompatibility and sealability.
- the hydraulic binder may serve to impart strength and durability in the composition for preventing and treating pulp diseases.
- pulp disease refers to a lesion occurring in the dimensions of a tooth.
- pulp disease may include pulp redness, pulpitis, pulp degeneration, necrosis of pulp, root root lesion and dental caries.
- compositions for the prevention and treatment of pulp diseases can be used without limitation to treat pulp damage, pulpitis pulp degeneration, pulp necrosis, apical lesions and dental caries caused by dental caries.
- the compositions can be used to treat or prevent a wide variety of diseases.
- prevention may refer to any action that inhibits or delays the development of pulp disease by administration of the composition, and "treatment” means that symptoms of pulp disease are improved by administration of the composition. It can mean any action that is beneficially changed.
- the composition can prevent or treat pulp disease by promoting the regeneration of pulp by effectively forming dentin glia and promoting the differentiation of dentin blasts in the pulp space due to pulp disease.
- the composition can be used in methods of treating pulp.
- the treatment method includes the direct pulp demodulation described above.
- the treatment method is not the same, but various treatment methods for the pulp, for example, apexification, barrier technique, indirect pulp capping, pulpotomy, and apical resection (pulpectomy), induction of hard tissue formation around the apical tip, guided bony regeneration (GBR) and perforation repair (perforation repair).
- GBR guided bony regeneration
- perforation repair perforation repair
- the composition when the dental nerves are exposed, the composition is applied to damaged nerves to aid in healing and to prevent secondary infection, when used in direct pulp demodulation, which can effectively treat pulp disease.
- the composition may further comprise a drug capable of modulating the regeneration and inflammatory response of the pulp-dentin complex.
- drugs include histone deacetylases inhibitors, antioxidants, anti-inflammatory agents whose main action is inhibition of phospholipases and cyclooxygenases, Wnt signaling regulators and antibiotics. can do.
- additional drugs include trichostatin A, butyrate, valproic acid, apicidin; N-acetyl cysteine; Aspirin, tylenol, ibuprofen, diclofenac, indomethacin, ketoprofen, voltaren, feldene, mobic; Penicillin, cephalosporin, kanamycin, gentamycin, gentamicin, sisomycin, erythromycin, vancomycin, icoplanin, quinolone ), Isoxazole derivative and lithium chloride (lithium chloride) may be one or more drugs selected from the group consisting of.
- the composition may further comprise a non-aqueous liquid.
- Properties of the non-aqueous liquid may be hygroscopic, biocompatible, storage stability, hygroscopic, surfactant and easily mixed with water.
- the non-aqueous liquid may be involved in the pasting of the hydraulic binder. It may be desirable for the non-aqueous liquid to contain only minimal moisture at a level that does not substantially contain water or cause curing to react with the hydraulic binder to cause the hydration reaction. Specifically, it may be preferable that the non-aqueous liquid is included by 15 wt% to 35 wt% with respect to the total weight of the composition.
- non-aqueous liquids include N-methyl-2-pyrrolidone (NMP), polyoxyethylene sorbitan monolaurate, dimethyl isosorbide ), Diethylene glycol dimethyl ether (diethylene glycol dimethyl ether) and butylene glycol (butylene glycol) may include one or more selected from the group consisting of.
- NMP N-methyl-2-pyrrolidone
- polyoxyethylene sorbitan monolaurate dimethyl isosorbide
- Diethylene glycol dimethyl ether diethylene glycol dimethyl ether
- butylene glycol butylene glycol
- butylene glycol butylene glycol
- the fucoidan in the composition according to an embodiment of the present invention may be 5 wt% to 10 wt% with respect to the total weight of the composition.
- gross weight may refer to the weight of the entire composition for preventing and treating pulp diseases including fucoidan and hydraulic binder.
- the fucoidan may be included by 5 wt% to 10 wt% with respect to the total weight of the composition.
- the biological activity may be maximized.
- the biological activity may mean physiological or pharmacological activity, but is not limited thereto.
- the biological activity may be osteogenic activity, antiviral activity, cell proliferation inducing activity, cell adhesion enhancing activity, antifungal activity, body stability, antioxidant activity, anti-inflammatory activity, immunosuppressive activity and hemostatic.
- the present invention is not limited thereto, and the composition for preventing and treating pulp diseases including fucoidan of 10 wt% or less based on the total weight of the composition may have various biological activities.
- composition for the prevention and treatment of pulp disease including fucoidan of 10 wt% or less relative to the total weight of the composition can induce an increase in cell proliferation and cell cycle associated proteins FAK and PI3K-Akt, and induces improved cell adhesion can do.
- the composition can be applied for the prevention and treatment of diseases.
- it can be used as a composition for the prevention and treatment of pulp disease.
- the hydraulic binder in the composition according to an embodiment of the present invention may include one selected from the group consisting of natural portland cement, portland cement, mixed cement and special cement, and combinations thereof.
- natural portland cement may be a cement having calcium silicate as the hydraulic main mineral.
- the natural portland cement may be one cement selected from the group consisting of ordinary portland cement, medium heat portland cement, crude steel portland cement, crude steel portland cement and sulfate resistant portland cement, and combinations thereof.
- portland cement may refer to a cement of a series such as Portland cement.
- the portland cement may be one cement selected from the group consisting of white portland cement, well cement and clad cement, and combinations thereof.
- mixed cement may be cement made by combining pozzolanic or quenched blast furnace slag with clinker of Portland cement and applying gypsum.
- the mixed cement may be one cement selected from the group consisting of blast furnace cement, fly ash cement, silica cement, ultra low heat cement, geothermal cement and RCCP cement, and combinations thereof.
- specialty cement may refer to cement other than the natural portland cement, portland cement, and mixed cement described above, and may refer to cement used for a specific purpose.
- the special cement may be one cement selected from the group consisting of alumina cement, cemented carbide and GRC low alkali cement, and combinations thereof.
- the pulp disease in the composition according to an embodiment of the present invention may comprise one selected from the group consisting of pulp red blood, pulpitis, pulp degeneration, pulp necrosis, anterior root lesion and dental caries and combinations thereof have.
- dimensional congestion may mean congestion in which blood vessels of the pulp are first expanded when physical, chemical or bacterial stimuli are applied to the pulp, but are not limited thereto. Induce redness.
- the term "dentitis” may mean inflammation caused by the expansion of blood vessels in the pulp initially when physical, chemical or bacterial stimuli are applied, but are not limited thereto, and various stimuli may induce pulpitis. Can be.
- dimension degeneration may mean that a degenerative or atrophic change occurs due to aging even without the change or stimulus caused by the aforementioned stimulus.
- dimension necrosis may refer to a disease in which pulp tissue necrosis when a circulatory disorder occurs due to inflammation or the like.
- root root lesion may mean a lesion around the root root, and the root root lesion may be induced by bacteria.
- tooth caries may refer to an infectious disease caused by bacteria that inhabit the tooth surface.
- the composition for preventing and treating pulp diseases may regenerate the pulp-dentin complex in the exposed pulp due to the pulp disease described above.
- the compositions can be operated around empty pulp cavity or other pathologically damaged tissue from which lesion dimensions of patients with pulp degeneration, pulp necrosis and pulp of pulp are removed.
- the content of the composition for the prevention and treatment of pulp disease may include the type of disease, the severity of the disease, the amount of other components contained in the composition, the type of formulation, and the age, body weight, general state of health, sex and diet, administration of the patient. It can be adjusted according to various factors including time, route of administration and rate of release of the composition, duration of treatment, and drugs used simultaneously.
- the subject of the method of treatment using the composition for preventing or treating pulp disease may be a mammal other than a human.
- composition according to an embodiment of the present invention may further include a radiographic contrast agent.
- radiocontrast means that the radiocontrast imparts radiopacity to enable observation of the material in the radiograph and may impart sufficient opacity to distinguish it from dentin.
- the radiographic agent is bismuth oxide, bismuth carbonate, strontium carbonate, strontium phosphate, barium sulfate, Tantalum oxide, cerium oxide, tin oxide and zirconium oxide, and combinations thereof.
- the present invention is not limited thereto, and more various materials may be used as the radiographic contrast agent.
- the radiographic agent may be used bismuth oxide and zirconium oxide, more preferably may be to use bismuth oxide.
- the radiographic contrast agent may be 20 wt% to 40 wt% with respect to the total weight of the composition.
- the present invention is not limited thereto and the contrast agent may be included in more various weight ratios with respect to the entire composition.
- the radiographic contrast agent may be included by 20 wt% to 30 wt% based on the total weight of the composition. Specifically, if the content of the radiocontrast is less than 20 wt% with respect to the total weight of the composition, there may be a problem in radiopacity. In addition, when the content of the radiographic contrast agent exceeds 40 wt% with respect to the total weight of the composition, problems such as curing delay may occur by reducing the content of the hydraulic binder.
- the content of the hydraulic binder and the radiocontrast in the present invention may be correlated with each other.
- the content of the hydraulic binder is high, the low content of the radiocontrast may maintain the appropriate clinical efficiency of the composition. That is, when both the hydraulic binder and the radiocontrast are high in content, the powder component may be excessive and complete curing may be delayed.
- composition according to an embodiment of the present invention may have a curing start time of 100 minutes or less.
- curing onset time may mean a time that is considered to be the onset of condensation of the composition.
- Fucoidan may be involved in shortening the curing start time of the composition.
- the curing start time of the composition may be dependent on the concentration of fucoidan.
- the measurement of curing initiation time can be performed according to the methodology proposed by the American Society for Testing and Materials (ASTM) and the International Organization for Standardization (IOS), specifically, Vicat needles and Gilmore needles can be used.
- ASTM American Society for Testing and Materials
- IOS International Organization for Standardization
- Vicat needles and Gilmore needles can be used.
- the present invention is not limited thereto, and the curing start time of the composition can be measured by various methods and various devices.
- shortening the curing initiation time may be more important than shortening the curing termination time in the pulp treatment, since the exposed pulp portion may be temporarily temporarily restored.
- composition according to an embodiment of the present invention may have a curing termination time of 250 minutes or less.
- curing termination time may mean a time when the condensation of the composition is completed.
- Fucoidan may be involved in shortening the curing start time of the composition.
- the curing termination time of the composition may be dependent on the concentration of fucoidan.
- the combined curing start time and curing end time may be the curing time.
- the measurement of curing end time was performed according to the methodology proposed by the American Society for Testing and Materials (ASTM), specifically, the Vicat needle opparatus and Gilmore needle device (Gilmore). needle opparatus) may be used.
- ASTM American Society for Testing and Materials
- the present invention is not limited thereto, and the curing termination time of the composition may be measured by various methods and various devices.
- composition according to an embodiment of the present invention may have a transmittance of 0.03% or more at a wavelength of 1350 (cm ⁇ 1 ) to 1450 (cm ⁇ 1 ).
- the term “transmittance” may refer to a specific peak value of the functional group.
- the transmittance may analyze chemical compositions of a sample using Fourier-transformed infrared spectroscopy (FT-IR), but is not limited thereto. can do.
- FT-IR Fourier-transformed infrared spectroscopy
- the composition is 1420 - may have more than 0.03%, the transmittance at a wavelength (cm 1).
- the composition 1420 (cm - 1) It represents the transmittance in a wavelength can mean that contains a functional group of "COO-".
- the catalyst composition is useful, 1220 (cm -1) to 1270 (cm - 1) in the wavelength can have a transmittance of 0.01% or greater.
- composition 860 (cm -1) to 880 (cm - 1) may have a transmittance of 0.01% or greater in the wavelength.
- the 860 (cm -1) to 880 (cm - 1) is intended to represent the transmittance at the wavelength of the can means, which includes a functional group of "COS", preferably, may mean that which contains fucoidan .
- composition according to an embodiment of the present invention may have at least 1.8 times mineralization compared to MTA.
- the cells treated with the composition may have at least 1.8 times the mineralization of the cells treated with the MTA, such that the biological activity of the cells treated with the composition is MTA It may mean higher than the treated cells.
- high biological activity may mean high bone formation ability, but is not limited thereto, and the cells treated with the composition may be interpreted as having higher biological activity than MTA treated cells.
- MTA means an inorganic trioxide aggregate. MTA can be used for dimensional demodulation. When MTAs are used in dimensional demodulation, they can be expensive compared to other dental materials and can be difficult to manipulate by a user. In addition, MTA may be soluble in body fluids and may lack activity to induce dentin or bone tissue formation.
- the "cells” can be osteoblasts.
- the present invention is not limited thereto, and more various cells can be treated with the composition and the MTA.
- the term "photooxidation ability” means the ability to produce minerals.
- the photoenhancement may be a process in which a substance is changed from organic to inorganic by mineral ion deposition and formation of mineral crystals, which may be a mechanism necessary for making hard tissues of the body.
- Teeth are complex tissues consisting of soft and hard tissues.
- Hard tissue consisting of enamel, dentin, chalk, and alveolar bone, provides the overall structure of the tooth and is associated with the functioning tooth.
- Hard tissues of these teeth are formed by mineralization such as enamel formation, odontogenesis, cementogenesis and osteogenicity. Mineralization can play an important role in differentiation mechanisms in tooth development and stem regeneration based on stem cells.
- the photosensitivity can be measured by Alizarin red staining method, quantitative analysis of Alizarin red, alkaline phosphatase (ALP) activity and RT-PCR (real time-PCR).
- ALP alkaline phosphatase
- RT-PCR real time-PCR
- the present invention is not limited thereto, and the photooxidation power may be measured by more various methods.
- the alizarin red staining can show the formation of minerals, induced into the composition.
- the fucoidan of 10 wt% or less with respect to the total weight of the composition is included as a composition for the prevention and treatment of pulp disease, the photochemical ability can be maximized. That is, it may mean that the biological activity of the composition under the aforementioned conditions is maximized.
- the use of the composition having a relatively high photochemical ability may have a higher effect of preventing and treating pulp disease than using MTA.
- cells 7 days after the treatment of the composition may have at least twice the ALP (alkaline phosphatase) activity compared to cells 7 days after the treatment of the MTA.
- ALP alkaline phosphatase
- composition-treated cells may have a relatively higher ALP activity than MTA-treated cells.
- ALP activity refers to the activity of alkaline phosphatase.
- ALP can be located on the osteoblast membrane and can be used as a marker of biomineralization.
- the present invention is not limited thereto, and various markers may be used as markers of bioluminescence.
- markers may be used as markers of bioluminescence.
- TRAP, OPG, CatK, RANK, RANKL, Osteocalcin, IL-6, DKK-1, MMP-8, TIMP-1, tPA, PAI-2, Cathepsin, bone sialoprotein (BSP) ), Markers from the TGF- ⁇ superfamily, bone morphogenetic proteins (BMPs), sclerostin and noggin, etc. can be used as markers of bioluminescence.
- ALP can increase the ALP activity as it unspecifically decomposes phosphate ions in the compound and the mineral crystals become larger. For this reason, the measurement of ALP activity may be one of the methods of measuring photosensitivity.
- p-nitrophenyl phosphate p-nitrophenyl phosphate
- high ALP activity may mean that the expression of a gene related to bone formation is increased.
- the cells 7 days after the composition is treated have at least twice as much ALP as the cells treated with the MTA than the cells treated with the MTA, indicating that the biological activity of the cells treated with the composition is higher than the cells treated with the MTA. can do. Specifically, it may mean that the bone formation ability is relatively high, but is not limited thereto and may be interpreted as having a higher variety of biological activities.
- ALP activity can be maximized. That is, it may mean that the biological activity of the composition under the aforementioned conditions is maximized.
- the use of the composition having a relatively high photochemical ability may have a higher effect of preventing and treating pulp disease than using MTA.
- a method for promoting dentinocyte differentiation comprising positioning a composition comprising fucoidan and a hydraulic binder in the dimensions of an animal other than a human.
- dentin hair differentiation promoting method when the dentin hair differentiation promoting method is applied to damaged dimensions, dentin bridges can be effectively formed and differentiation of dentin hair cells can be promoted. As a result, the regeneration of pulp can be promoted, so that the method for promoting dentinocyte differentiation according to an embodiment of the present invention can be used to prevent or treat pulp disease.
- the composition may further include a radiographic contrast agent.
- the present invention is not limited thereto, and may include more various additives.
- the additive may be a drug that the composition described above can modulate the regeneration and inflammatory response of the pulp-dentin complex.
- composition for preventing and treating pulp disease shortens the curing start time and the curing stop time, and exhibits the effect of increasing the photooxidative activity and ALP activity, and as a result, the activity of the dental hard tissue is increased, This can be used to prevent and treat pulp disease.
- composition according to an embodiment of the present invention may be provided in a method for promoting dentinocyte differentiation.
- 1 is an experimental result showing the curing time when treating the composition according to an embodiment of the present invention.
- Figure 2a is an experimental result showing the relative cell viability when treated with a composition comprising fucoidan in different weight ratios in the composition according to an embodiment of the present invention.
- Figure 2b is an experimental result showing the expression level of genes associated with cell adhesion when treated with a composition comprising fucoidan in each weight ratio of the composition according to an embodiment of the present invention.
- Figure 2c is an experimental result showing alizarin red stained cells for the photochemical analysis, when the composition containing each fucoidan in a different weight ratio in the composition according to an embodiment of the present invention.
- Figure 2d is an experimental result showing the results of measuring the photochemical power when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.
- Figure 2e is an experimental result showing the results of measuring the ALP activity when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.
- Figure 2f is an experimental result showing the expression of bone-associated genes when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.
- Figure 2g is an experimental result showing the degree of cell migration when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.
- Figure 3a is an experimental result showing the results of FE-SEM and EDX when the composition containing no fucoidan in the composition according to an embodiment of the present invention.
- Figure 3b is an experimental result showing the results of FE-SEM and EDX when the composition comprising 5 wt% fucoidan relative to the total weight of the composition according to an embodiment of the present invention.
- Figure 3c is an experimental result showing the results of FE-SEM and EDX when the composition comprising 10 wt% fucoidan relative to the total weight of the composition according to an embodiment of the present invention.
- Figure 4 is an experimental result showing the results of the FT-IR when the composition containing the fucoidan in each of the composition according to an embodiment of the present invention in a different weight ratio.
- the hydraulic binder as a portland cement in the composition for the prevention and treatment of pulp disease of the present invention and using a radiographic contrast agent as zirconium oxide, but not limited thereto.
- the biological activity of the cells treated with the composition for preventing and treating pulp diseases according to various embodiments of the present invention is increased, thereby providing the composition to various methods for treating pulp diseases, and for preventing and treating pulp diseases. It can also be provided as a composition.
- composition of composition for prevention and treatment of pulp disease Composition of composition for prevention and treatment of pulp disease
- compositions consisting of the following compositions. Specifically, Portland cement was used as the hydraulic binder of the composition for preventing and treating pulp diseases according to an embodiment.
- the portland cement has 80 wt% relative to the total weight of the composition.
- zirconium oxide was used as a radiocontrast of the composition, and zirconium oxide has 20 wt% relative to the total weight of the composition.
- the composition of the above-mentioned composition is composed of a composition containing no fucoidan, a composition containing 5 wt% fucoidan relative to the total weight of the composition, and a composition containing 10 wt% fucoidan relative to the total weight of the composition. It was divided into three groups.
- a composition containing no fucoidan is PZ (Portland cement 80 wt% + ZO 20 wt%), and a composition containing 5 wt% fucoidan relative to the total weight of the composition is PZF5 (Portland cement 80 wt% + ZO 20 wt% + Fucoidan 5 wt%), a composition containing 10 wt% fucoidan relative to the total weight of the composition is described by describing PZF10 (80 wt% Portland cement + 20 wt% ZO + 10 wt% Fucoidan).
- the curing time of the composition may mean that by combining the curing start time and the curing end time.
- the cure start time and cure end time of PZ, PZF5 and PZF10 were measured in a Teflon mold with an internal diameter of 10 mm and a height of 2 mm.
- the hardening start time and hardening end time were performed based on C266-03 proposed by the American Material Testing Association and 6876 proposed by the International Organization for Standardization.
- Determination of the curing onset time was performed by applying the starting needle with a weak force on the surfaces of PZ, PZF5 and PZF10. This procedure was repeated every 5 minutes, until no circular flaws from the starting needles appeared on the PZ, PZF5 and PZF10 surfaces. Specifically, when the starting needle was applied to each of the compositions, the time elapsed until the phenomenon of stirring and minor scratches on the surface of the composition stopped. This time was set as curing start time.
- the start end time was set by applying the end needle in place of the start needle in the same manner as the measurement of the curing start time described above.
- compositions PZF5 and PZF10 containing fucoidan in Example 1 described above showed shorter curing time than the composition PZ containing no fucoidan.
- the shortening of the initiation time of curing can be achieved by using a composition that does not use fucoidan in the pulp treatment since the exposed pulp portion can be immediately and temporarily restored after the application of PZF5 and PZF10 containing fucoidan to the dentin. It can be more effective than that.
- the osteoblasts were MG63 human osteoblasts, which were cultured in a minimal medium before the experiment.
- the minimal medium consisted of 10% fetal bovine serum, penicillin (100 units / mL) and streptomycin (100 units / mL).
- osteoblasts were inoculated with MG63 in a well containing osteogenic medium (OM: osteogenic medium) and incubated for 24 hours under conditions consisting of 5% CO2 and 95% air at 37 ° C. Cell adhesion was induced. Then PZ, PZF5, PZF10 and MTA were treated in each well.
- OM osteogenic medium
- the following six groups are applied in the experiments of measuring cell viability, measuring cell adhesion, measuring photooxidation, and measuring ALP activity.
- Four experimental groups consisted of osteoblasts treated with PZ, PZF5, PZF10, and MTA in bone formation medium, and two control groups were minimal of osteoblasts and no negative control treated with bone formation medium in positive control group. It is composed of untreated osteoblasts in the medium.
- HUVECs human umbilical vein endothelial cells
- HIVECs umbilical vein vascular endothelial cells
- Osteoblasts used for cell viability measurements were osteoblasts at a concentration of 1 ⁇ 10 4 (cells / well). Cell viability of osteoblasts 3 and 7 days after treatment with PZ, PZF5, PZF10 and MTA was measured. At this time, the osteoblasts treated with each composition were measured for optical density using a microplate absorbance reader at a wavelength of 570 nm.
- Figure 2a shows the cell viability of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. After PZF5 treatment, it was confirmed that the cell viability of osteoblasts on day 7 was increased.
- each osteoblasts treated with PZ, PZF5, PZF10 and MTA were transferred to EP tubes, and total RNA was extracted using RiboEX reagent. 200 ⁇ L of chloroform (Chloroform) was taken into the EP tube and centrifuged at 4 ° C. for 15 minutes. 1 ⁇ g was taken from RNA obtained after centrifugation and reverse transcribed using Maxime RT PreMix kit.
- the cDNA obtained was then amplified using Maxime RT PreMix kit. GAPDH was used as a housekeeping gene. Table 1 lists detailed primer sequences, RT-PCR conditions and cycles, and product size.
- PCR products were dissolved in 1.5% agarose gel, stained with RedSafe, and analyzed using a ChemiDoc imaging system (Imaging System).
- Figure 2b shows the expression level of integrin ⁇ 1 and integrin ⁇ 3 of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. Integrin ⁇ 1 was highly expressed in osteoblasts treated with PZF5, and integrin ⁇ 3 was highly expressed in both osteoblasts treated with PZF5 and PZF10, unlike other groups.
- the cells were treated in 10 mM sodium phosphate buffer containing 10% cetylpyridinium chloride for 15 minutes and incubated for 14 days.
- the optical density of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls was measured using a microplate reader.
- Figure 2c shows the results of staining with alizarin red of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. The high optical density in osteoblasts treated with PZF5 was confirmed.
- FIG. 2D shows the mineralization of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls.
- the photochemical capacity in the osteoblasts treated with PZF5 was the highest among six groups, and the photooxidative capacity in osteoblasts treated with PZF5 was high.
- the mineralization capacity of PZF5 treated osteoblasts was 1.8 times higher than that of MTA treated osteoblasts.
- P-nitrophenyl phosphate was used as a substrate for the measurement of ALP activity. Specifically, a solution containing p-nitrophenyl phosphate in 0.7 M 2-amino-methyl-1-propanol and 6.7 Mm magnesium chloride was used as the substrate active solution.
- the osteoblasts prepared by the method described above was incubated for 1 hour by treating the substrate active solution on a plate treated with PZ, PZF5, PZF10 and MTA.
- Cells 7 days after treatment and 14 days after treatment were measured for optical density using an enzyme-linked immunosorbent assay (ELISA) at a wavelength of 405 nm.
- ELISA enzyme-linked immunosorbent assay
- 2E shows ALP activity of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. It was confirmed that osteoblasts after 7 days of PZF5 treatment had higher ALP activity than those of the other five groups. In particular, the ALP activity of osteoblasts after 14 days of PZF5 treatment was higher than that of PZF10, and was confirmed to be two times higher than that of osteoblasts after 14 days of MTA treatment.
- osteocalcin OCN: osteocalcin
- DSPP dentin sialophosphoprotein
- asterix osterix
- Figure 2f shows the degree of expression of bone formation associated genes of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. In particular, it was confirmed that the expression of all three osteogenic genes in PZF5 treated osteoblasts was upregulated.
- human HUVECs at a concentration of 2.5 ⁇ 10 4 were passaged three times in a well plate. After 24 hours of embryos, the plate was filled with cells 90% of the area of the plate. A sterile pipette tip was used to mark the middle of the plate.
- the cells were then washed with phosphate-buffer.
- the washed cells were treated with PZ, PZF5, PZF10 and MTA.
- Figure 2g shows the degree of cell migration of PZ, PZF5, PZF10 and MTA treated HUVECs and controls. It was confirmed that the degree of cell migration of PZF5 and MTA treated HUVECs was higher than that of the other groups.
- Osteoblasts treated with PZF5 and PZF10 of the composition containing fucoidan as a result of measuring cell viability, measuring cell adhesion, measuring photooxidation, measuring ALP activity and measuring the degree of cell migration in Example 2 described above, It was confirmed that various biological activities were higher than osteoblasts treated with MTA.
- the composition containing fucoidan can prevent pulp disease caused by damage to dental hard tissue, especially dentin in dental hard tissue, and can increase the activity of dental hard tissue, thereby providing a composition for preventing and treating pulp disease.
- a composition according to one embodiment of the present invention may be more effective than using MTA for the prevention and treatment of pulp disease.
- a composition containing 10 wt% or less of fucoidan relative to the total weight of the composition according to an embodiment of the present invention is used for the prevention and treatment of pulp disease. It may be more desirable to use the composition as a method of promoting dentinogenesis differentiation in the effect of preventing or treating pulp disease.
- FE-SEM field emission-scanning electron microscope
- Figure 3a shows the results of analyzing the surface state of PZ by FE-SEM and EDX.
- Figure 3b shows the results of analyzing the surface state of PZF5 by FE-SEM and EDX.
- 3c shows the results of analyzing the surface state of PZF10 by FE-SEM and EDX.
- the surface of PZ had a surface rougher than PZF5 and PZF10.
- PZF5 contains 3.34 wt% of sulfur relative to the total weight of the elemental composition
- PZF10 contains 4.46 wt% of sulfur relative to the total weight of the elemental composition.
- PZF5 exhibits a transmission of about 0.03% and PZF10 exhibits a transmission of about 0.075%.
- Representing a peak at a wavelength of about 1420 (cm ⁇ 1 ) may mean having a functional group of “COO-”.
- PZF5 exhibits a transmittance of about 0.03% at a wavelength of PZF10 and a transmittance of about 0.06%.
- the peak at the wavelength of is meant to have a functional group of "C-O-S", which may be a result of inclusion of fucoidans of PZF5 and PZF10.
- PZF5 exhibits a transmission of about 0.015% at a wavelength of and PZF10 exhibits a transmission of about 0.02% at a wavelength of about 1236 (cm ⁇ 1 ).
- about 1252 (cm -1 ) And showing a peak at a wavelength of 1236 (cm ⁇ 1 ) may mean having a functional group of “S ⁇ O stretching vibration”.
- Example 2 the composition according to an embodiment of the present invention, it was confirmed that the difference in the chemical properties depending on the presence or absence of fucoidan. Furthermore, the method of Example 3 may provide information on the presence or absence of fucoidan in the composition.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Molecular Biology (AREA)
- Dermatology (AREA)
- Physics & Mathematics (AREA)
- Optics & Photonics (AREA)
- Inorganic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention provides a composition for preventing and treating a dental pulp disease. The pharmaceutical composition for preventing and treating a dental pulp disease according to an embodiment of the present invention reduces a curing start time and a curing finish time, is effective for increasing mineralization ability and ALP activity, and can thereby be used for preventing and treating a dental pulp disease.
Description
본 발명은 치수질환의 예방 및 치료용 조성물에 관한 것으로서, 보다 구체적으로 재료의 경화시간을 단축시키면서 치아 경조직의 활성능을 증가시킬 수 있는 치수질환 예방 및 치료용 조성물과 이러한 조성물을 이용한 상아질모세포 분화 촉진 방법에 관한 것이다.The present invention relates to a composition for preventing and treating pulp diseases, and more particularly, a composition for preventing and treating pulp diseases that can increase the activity of dental hard tissues while shortening the curing time of materials and differentiating dentin cells using such compositions. It is about a promotion method.
치수 (dental pulp) 는 치아의 내부에 있는 치수강을 채우고 있는 부드러운 결합조직으로, 신경과 혈관이 풍부하게 분포해 있다. 치수의 신경은 치수 최외층의 치아 상아질 (dentin) 내면에 접해 있는 상아아세포에서 신경총을 이루며, 그 가지가 상아질의 표층에까지 이르고 있다. The dental pulp is a soft connective tissue that fills the pulp cavity inside the tooth and is rich in nerves and blood vessels. The nerves of the pulp make up the plexus in the dentin cells in contact with the inner surface of the dental dentin of the outermost pulp, and the branches reach the dentin superficial layer.
치수는 상아질과 복합체를 형성하여 상아질 (치질) 의 재생과 치유를 담당하고 있다. 그러나, 상아질이 우식 및 외상 등으로 손상을 입으면 치수 염증 반응이나 조직 손상이 쉽게 일어날 수 있고, 결과적으로 치수질환이 유발될 가능성이 높아진다. 그러므로, 치아 경조직의 손상, 특히 치아 경조직 중 상아질의 손상에 의한 치수질환을 조기 예방하고 비가역적인 조직 손상을 막는 것이 중요하다. The pulp forms a complex with the dentin, which is responsible for the regeneration and healing of the dentin (hemorrhoids). However, if the dentin is damaged by caries, trauma, etc., pulp inflammatory reaction or tissue damage can easily occur, and as a result, pulp disease is more likely to be caused. Therefore, it is important to prevent pulp disease caused by damage to the hard tissue of the tooth, particularly dentin in the hard tissue of the tooth, and to prevent irreversible tissue damage.
따라서, 치수조직 손상의 예방과 가역성 손상을 받은 치수조직 치료에서는, 생물학적 안전성과 치수세포의 보호 및 산화적 손상 억제 효과가 우수한 치수 질환 예방 및 치료용 성분 개발이 요구되고 있다. Accordingly, in the prevention of pulp tissue damage and treatment of pulp tissue that has undergone reversible damage, development of components for preventing and treating pulp disease excellent in biological safety and protection of pulp cells and suppressing oxidative damage is required.
발명의 배경이 되는 기술은 본 발명에 대한 이해를 보다 용이하게 하기 위해 작성되었다. 발명의 배경이 되는 기술에 기재된 사항들이 선행기술로 존재한다고 인정하는 것으로 이해되어서는 안 된다.The background art of the invention has been created to facilitate understanding of the present invention. It should not be understood that the matters described in the background of the invention exist as prior art.
치수가 손상된 환자의 잔존 상아질 두께가 얇을 경우 또는 치수 감염이 일어나지 않은 상태에서 핀 포인트 출혈 (pin-point bleeding) 이 일어났을 경우 치수복조법 (pulp capping) 으로 환자의 치수조직을 보호할 수 있으며, 이에 MTA (mineral trioxide aggregate) 가 이용될 수 있다. MTA는 트리칼슘 실리케이트 (tricalcium silicate), 트리칼슘 알루미네이트 (tricalcium aluminate), 트리칼슘 옥사이드 (tricalcium oxide), 실리케이트 옥사이드 (silicate oxide) 가 주성분이며 수분과 접촉하면 4시간 이내에 경화하는 친수성의 미세분말로, 경화 후 pH는 약 12.5 이다. When the remaining dentin thickness of patients with damaged pulp is thin or pin-point bleeding occurs without pulp infection, pulp capping can protect the pulp tissue. MTA (mineral trioxide aggregate) can be used. MTA is composed of tricalcium silicate, tricalcium aluminate, tricalcium oxide, and silicate oxide, and is a hydrophilic fine powder that cures within 4 hours when contacted with moisture. , PH after curing is about 12.5.
또한, MTA는 경화 후 상대적으로 높은 안정성을 갖고 있으며, 상아질교의 형성을 유도할 뿐만 아니라, 일칼리성의 pH를 유지하여 복조된 치수에 존재 할 수 있는 박테리아를 제거할 수 있다.In addition, MTA has a relatively high stability after curing, not only induces dentin bridge formation, but also maintains a monocaloric pH to remove bacteria that may be present in the demodulated dimensions.
그러나 MTA를 이용하는 치수질환 치료과정에서, 초기 수화과정 동안 높은 알칼리성 pH를 띄어 상당한 초기 세포 독성을 수반하게 되며, 경화 시간이 길다는 단점이 있다. However, in the treatment of pulp disease using MTA, high alkaline pH during initial hydration is accompanied by significant initial cytotoxicity, and has a disadvantage of long curing time.
또한, MTA가 상대적으로 고가인 치과 재료이며 교반 과정에서 모래와 같은 물성 (sandy consistancy) 을 가지는 점은, MTA를 치수질환 치료제로 사용하는 데에서 큰 단점으로 지적되고 있다.In addition, the fact that MTA is a relatively expensive dental material and has sandy consistancy in the stirring process has been pointed out as a major disadvantage in using MTA as a treatment for pulp disease.
본 발명의 발명자들은 치수질환 예방 및 치료와 관련하여 인체에 안전성을 갖고 있는 물질을 탐색해왔으며, 치수복조법에 사용되는 수경성 결합재와 점성을 가지고 있는 갈조류 유래 다당류를 함께 이용하는 것을 통해 전술된 단점을 보완할 수 있을 것으로 인식하였다.The inventors of the present invention have searched for materials that are safe for the human body in connection with the prevention and treatment of pulp disease, and the above-mentioned disadvantages have been achieved through the use of the hydraulic binder and the brown algae-derived polysaccharide with viscosity. It was recognized that it could be supplemented.
이에 본 발명의 발명자들은 갈조류로부터 유래한 다당류 중 상대적으로 칼슘, 요오드 등 인체에 유익한 필수 미네랄, 비타민 등의 영양소가 많고 생리활성이 높은 후코이단 (fucoidan) 을 치수복조법에 이용할 수 있음을 착안하였다. Accordingly, the inventors of the present invention have focused on the use of fucoidan, which is rich in nutrients such as essential minerals and vitamins, which are beneficial to the human body, such as calcium and iodine, and which has high physiological activity, among polysaccharides derived from brown algae.
이에 본 발명이 해결하고자 하는 과제는 경화 시간이 단축되고, 골형성에 기여하는 치수질환의 예방 및 치료용 조성물을 제공하는 것이다.The problem to be solved by the present invention is to provide a composition for the prevention and treatment of pulp diseases that shorten the curing time and contribute to bone formation.
본 발명의 과제들은 이상에서 언급한 과제들로 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.The objects of the present invention are not limited to the above-mentioned objects, and other objects that are not mentioned will be clearly understood by those skilled in the art from the following description.
본 발명의 일 실시예에 따르면, 후코이단 및 수경성 결합재를 포함하는, 치수질환의 예방 및 치료용 조성물이 제공된다.According to one embodiment of the invention, there is provided a composition for preventing and treating pulp disease, comprising fucoidan and hydraulic binder.
그러나, 이에 제한되지 않고 후코이단과 함께 더 다양한 다당류가 치수질환의 예방 및 치료용 조성물로 제공될 수 있다. 예를 들어, 상기 다당류는 셀룰로오스, 알킬 셀룰로오스, 알킬히드록시알킬 셀룰로오스, 히드록시알킬 셀룰로오스, 셀룰로오스 설페이트, 카르복시메틸 셀룰로오스의 염, 카르복시메틸 셀룰로오스, 카르복시에틸 셀룰로오스, 키틴, 카르복시메틸 키틴, 히알루론산, 히알루론산의 염, 알기네이트, 알긴산, 프로필렌글리콜 알기네이트, 글리코겐, 덱스트란, 덱스트란 설페이트, 커들란(curdlan), 펙틴, 풀루란, 잔탄, 콘드로이틴 (chondroitin), 콘드로이틴 설페이트류, 카르복시메틸 덱스트란, 카르복시메틸 키토산, 키토산, 헤파린, 헤파린 설페이트, 헤파란 (heparan), 헤파란 설페이트, 데르마탄 설페이트, 케라탄 설페이트, 카라기난, 키토산, 전분, 아밀로오스, 아밀로펙틴, 폴리-N-글루코사민, 폴리만뉴로닉산(polymannuronic acid), 폴리글루쿠론산 (polyglucuronic acid), 폴리굴루론산(polyguluronic acid) 및 상기 다당류들의 유도체로 이루어진 군으로부터 선택된 적어도 하나 이상의 다당류에서 유래된 것일 수 있다. 바람직 하게는, 상기 다당류는 황산기를 가진 다당류일 수 있다. 또는 다양한 실시예에서, 치수질환의 예방 및 치료용 조성물은 후코이단이 아닌 전술된 다양한 다당류 중 하나 이상을 포함하도록 구성될 수도 있다.However, without being limited thereto, more various polysaccharides together with fucoidan may be provided as a composition for preventing and treating pulp diseases. For example, the polysaccharide is cellulose, alkyl cellulose, alkyl hydroxyalkyl cellulose, hydroxyalkyl cellulose, cellulose sulfate, salt of carboxymethyl cellulose, carboxymethyl cellulose, carboxyethyl cellulose, chitin, carboxymethyl chitin, hyaluronic acid, hyaluronic acid Salts of lonic acid, alginates, alginic acids, propylene glycol alginates, glycogen, dextran, dextran sulfate, curdlan, pectin, pullulan, xanthan, chondroitin sulfate, chondroitin sulfate, carboxymethyl dextran, Carboxymethyl Chitosan, Chitosan, Heparin, Heparin Sulfate, Heparan, Heparan Sulfate, Dermatan Sulfate, Keratan Sulfate, Carrageenan, Chitosan, Starch, Amylose, Amylopectin, Poly-N-Glucosamine, Polymannuronic Acid ( polymannuronic acid, polyglucuronic acid, poly Gulru may be one derived from at least one polysaccharide selected from the group consisting of acid (polyguluronic acid), and derivatives of said polysaccharides. Preferably, the polysaccharide may be a polysaccharide having a sulfate group. Or in various embodiments, the composition for the prevention and treatment of pulp disease may be configured to include one or more of the various polysaccharides described above, not fucoidan.
본 명세서에서 사용되는 용어, "후코이단"은 끈적끈적한 점질 구조의 황산염화한 다당류로서, 일반적으로 고미역, 다시마 등의 갈조류에 함유된 성분이며, 분자량은 평균 20 kDa으로 후코스 (Fucose) 라는 기본당과 황산기가 결합되어 있는 물질일 수 있다. 후코이단은 구체적으로 슈가켈프 (Laminaria saccharina), L.디지타타 (L.digitata), 태평양 모자반 (Fucus distichus), 오키나와 모즈쿠 (Cladosiphon okamuranus) 와 같은 해양갈조류에서 얻어질 수 있다.As used herein, the term "fucoidan" refers to a sulfated polysaccharide having a sticky viscous structure, and is generally contained in brown algae such as seaweed and kelp, and has an average molecular weight of 20 kDa. It may be a substance in which sugar and sulfate groups are combined. Fucoidan can be specifically obtained from marine brown algae such as sugar kelp (Laminaria saccharina), L. digitata, Fucus distichus, and Okinawa mozuku (Cladosiphon okamuranus).
본 명세서에서 사용되는 용어, "수경성"은 각종 시멘트가 물 또는 수용액과 반응하여 용해도가 작은 수화물을 생성하여 경화하는 성질을 의미한다. 상기 수경성 결합재는 수경성 시멘트가 이용될 수 있다. 예를 들어, 수경성 시멘트에는 포틀랜드 시멘트, 포틀랜드계 시멘트, 혼합시멘트 및 특수시멘트를 이용할 수 있다. 바람직하게는, 수경성 결합재로 포틀랜드 시멘트를 이용하는 것이 생체친화성이 우수할 수 있으나, 이에 제한되지 않고 다양한 재료들이 수경성 결합재로 이용될 수 있다. As used herein, the term "hydraulic" refers to a property that various cements react with water or an aqueous solution to produce hydrates with low solubility to cure. As the hydraulic binder, hydraulic cement may be used. For example, portland cement, portland cement, mixed cement, and special cement can be used for hydraulic cement. Preferably, using portland cement as a hydraulic binder may be excellent in biocompatibility, but various materials may be used as the hydraulic binder, without being limited thereto.
전술된, 후코이단 및 수경성 결합재를 치수질환의 예방 및 치료용 조성물로 제공하는데 있어서, 수경성 결합재는 상기 조성물의 총중량에 대해 15 wt% 내지 55 wt% 만큼 포함되는 것이 바람직할 수 있다. In providing the fucoidan and hydraulic binder described above as a composition for preventing and treating pulp diseases, the hydraulic binder may be included in an amount of 15 wt% to 55 wt% based on the total weight of the composition.
예를 들어, 수경성 결합재가 상기 조성물의 총중량에 대해 15 wt% 이하일 경우, 치수부분을 즉각적으로 임시 복원하는 것이 중요한 치수 치료에서 점도가 낮아져 경화시간이 너무 길어질 수 있다.For example, if the hydraulic binder is 15 wt% or less relative to the total weight of the composition, the curing time may be too long due to the low viscosity in the dimensional treatment where it is important to immediately temporarily restore the pulp portion.
또한, 수경성 결합재가 상기 조성물의 총중량에 대해 55 wt% 이상을 갖는 조성물일 경우, 점도가 높아져 조작하기 어려울 수 있어, 수경성 결합재는 상기 조성물의 총중량에 대해 55 wt% 이하로 포함되는 것이 바람직할 수 있다. In addition, when the hydraulic binder is a composition having 55 wt% or more relative to the total weight of the composition, the viscosity may be difficult to operate due to the high viscosity, so that the hydraulic binder may be included at 55 wt% or less relative to the total weight of the composition. have.
더 나아가, 수경성 결합재의 평균 입도 (D50) 는 3 μm 이하로 유지하는 것이 상기 결합재를 조작하고 높은 생물학적 활성을 유지하는 데 있어서 바람직하다.Furthermore, maintaining the average particle size (D50) of the hydraulic binder below 3 μm is desirable for manipulating the binder and maintaining high biological activity.
수경성 결합재는, 산화칼슘, 수산화칼슘 및 염화칼슘을 추가로 함유할 수 있다. 특히, 염화칼슘은 수경성 결합재의 경화시간을 단축하는데 관여할 수 있고, 생체친화성 및 밀폐성을 향상시킬 수 있다.The hydraulic binder may further contain calcium oxide, calcium hydroxide and calcium chloride. In particular, calcium chloride may be involved in shortening the curing time of the hydraulic binder, and may improve biocompatibility and sealability.
수경성 결합재는 치수질환의 예방 및 치료용 조성물에서 강도와 내구성을 부여하는 역할을 할 수 있다. The hydraulic binder may serve to impart strength and durability in the composition for preventing and treating pulp diseases.
본 명세서에서 사용되는 용어, "치수질환"은 치아의 치수에 생기는 병변을 의미한다. 예를 들어, 치수질환은 치수충혈, 치수염, 치수변성, 치수의 괴사, 치근단 병변 및 치아우식증을 포함할 수 있다. As used herein, the term "dimension disease" refers to a lesion occurring in the dimensions of a tooth. For example, pulp disease may include pulp redness, pulpitis, pulp degeneration, necrosis of pulp, root root lesion and dental caries.
치수질환의 예방 및 치료용 조성물은 전술된 치수충혈, 치수염 치수변성, 치수의 괴사, 치근단 병변 및 치아우식증으로 인한 치수의 손상을 치료하기 위하여 제한 없이 사용될 수 있다. 그러나, 전술된 병변에 제한되지 않고, 더 다양한 질환을 치료하거나 예방하는데 상기 조성물이 이용할 수 있다. Compositions for the prevention and treatment of pulp diseases can be used without limitation to treat pulp damage, pulpitis pulp degeneration, pulp necrosis, apical lesions and dental caries caused by dental caries. However, without limitation to the lesions described above, the compositions can be used to treat or prevent a wide variety of diseases.
본 명세서에서 사용되는 용어, "예방"은 상기 조성물의 투여로 치수질환을 억제시키거나 발병을 지연시키는 모든 행위를 의미할 수 있으며, "치료"는 상기 조성물의 투여로 치수질환의 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미할 수 있다. 구체적으로, 상기 조성물은 치수질환으로 인하여 공간이 생긴 치수에서 상아질교를 효과적으로 형성하고 상아질모세포의 분화를 촉진시킴으로써 치수의 재생을 촉진시켜 치수질환을 예방하거나 치료할 할 수 있다.As used herein, the term "prevention" may refer to any action that inhibits or delays the development of pulp disease by administration of the composition, and "treatment" means that symptoms of pulp disease are improved by administration of the composition. It can mean any action that is beneficially changed. Specifically, the composition can prevent or treat pulp disease by promoting the regeneration of pulp by effectively forming dentin glia and promoting the differentiation of dentin blasts in the pulp space due to pulp disease.
조성물은 치수 치료방법에 이용될 수 있다. 구체적으로, 치료방법에는 전술된 직접 치수복조법이 있다. 그러나, 치료방법은 이에 되지 않고 치수에 대한 다양한 치료방법, 예를 들어 치근단형성술 (apexification), 치수보호술식 (barrier technique), 간접 치수복조법 (indirect pulp capping), 치수절단술 (pulpotomy), 치근단 절제술 (pulpectomy), 치근단 주변의 경조직형성 (hard tissue formation) 유도, 골유도 재생술 (guided bony regeneration, GBR) 및 치근천공 수복 (perforation repair) 등에 이용될 수 있다. The composition can be used in methods of treating pulp. Specifically, the treatment method includes the direct pulp demodulation described above. However, the treatment method is not the same, but various treatment methods for the pulp, for example, apexification, barrier technique, indirect pulp capping, pulpotomy, and apical resection (pulpectomy), induction of hard tissue formation around the apical tip, guided bony regeneration (GBR) and perforation repair (perforation repair).
바람직하게는, 치아 신경이 노출됐을 때 상기 조성물을 손상된 신경부위에 도포하여 치유를 돕고 이차적인 감염을 막아주는 치료법인 직접 치수복조법에 이용할 때, 효과적으로 치수 질환을 치료할 수 있다.Preferably, when the dental nerves are exposed, the composition is applied to damaged nerves to aid in healing and to prevent secondary infection, when used in direct pulp demodulation, which can effectively treat pulp disease.
조성물은 치수-상아질 복합체의 재생 및 염증 반응을 조절할 수 있는 약물을 더 포함할 수 있다. 예를 들어, 약물은 히스톤 디아세틸라아제 (histone deacetylases) 저해제, 항산화제, 포스포리파아제 (phospholipases) 및 사이클로옥시게나아제 (cyclooxygenase) 저해를 주요 작용으로 하는 소염제, Wnt 신호전달조절제 및 항생제를 포함할 수 있다. 구체적으로, 추가 가능한 약물은 트리코스타틴 A (trichostatin A), 부틸레이트 (butyrate), 발프로익산 (valproic acid), 아피시딘 (apicidin); N-아세틸 시스테인(N-acetyl cysteine); 아스피린 (Aspirin), 타이레놀 (Tylenol), 이부프로펜 (ibuprofen), 디클로페낙 (Diclofenac), 인도메타신 (indomethacin), 케토프로펜 (Ketoprofen), 볼타렌 (Voltaren), 펠덴 (feldene), 모빅 (Mobic); 페니실린 (penicillin), 세팔로스포린 (cephalosporin), 카나마이신 (kanamycin), 겐타마이신 (gentamicin), 시소마이신 (sisomicin), 에리트로마이신 (erythromycin), 반코마이신 (vancomycin), 타이코플라닌 (teicoplanin), 퀴놀론 (quinoline), 이소옥사졸 (isoxazole) 유도체 및 리튬클로라이드 (lithium chloride)로 이루어진 군에서 선택된 하나 이상의 약물일 수 있다. The composition may further comprise a drug capable of modulating the regeneration and inflammatory response of the pulp-dentin complex. For example, drugs include histone deacetylases inhibitors, antioxidants, anti-inflammatory agents whose main action is inhibition of phospholipases and cyclooxygenases, Wnt signaling regulators and antibiotics. can do. Specifically, additional drugs include trichostatin A, butyrate, valproic acid, apicidin; N-acetyl cysteine; Aspirin, tylenol, ibuprofen, diclofenac, indomethacin, ketoprofen, voltaren, feldene, mobic; Penicillin, cephalosporin, kanamycin, gentamycin, gentamicin, sisomycin, erythromycin, vancomycin, icoplanin, quinolone ), Isoxazole derivative and lithium chloride (lithium chloride) may be one or more drugs selected from the group consisting of.
또한, 상기 조성물은 비수성 액체를 더 포함할 수 있다. 비수성 액체의 특성으로는 흡습성, 생체친화성, 보존 안정성, 흡습성, 계면활성 및 물과 쉽게 섞이는 성질이 있을 수 있다. 전술된 성질로, 비수성 액체는 수경성 결합재의 페이스트화에 관여할 수 있다. 비수성 액체는 수경성 결합재와 반응하여 수화 반응을 일으키는 물을 실질적으로 포함하지 않거나 경화를 일으키지 않는 수준의 최소한의 수분만을 포함하는 것이 바람직할 수 있다. 구체적으로, 비수성 액체는 상기 조성물의 총중량에 대해 15 wt% 내지 35 wt% 만큼 포함되는 것이 바람직할 수 있다. In addition, the composition may further comprise a non-aqueous liquid. Properties of the non-aqueous liquid may be hygroscopic, biocompatible, storage stability, hygroscopic, surfactant and easily mixed with water. With the properties described above, the non-aqueous liquid may be involved in the pasting of the hydraulic binder. It may be desirable for the non-aqueous liquid to contain only minimal moisture at a level that does not substantially contain water or cause curing to react with the hydraulic binder to cause the hydration reaction. Specifically, it may be preferable that the non-aqueous liquid is included by 15 wt% to 35 wt% with respect to the total weight of the composition.
예를 들어, 비수성 액체는 N-메틸-2-피롤리돈 (N-methyl-2-pyrrolidone, NMP), 폴리옥시에틸렌 소르비탄 모노라우레이트 (polyoxyethylene sorbitan monolaurate), 디메틸 이소소르바이드 (dimethyl isosorbide), 디에틸렌 글리콜 디메틸 에테르 (diethylene glycol dimethyl ether) 및 부틸렌 글리콜 (butylene glycol) 로 이루어진 군에서 선택된 하나 이상을 포함할 수 있다.For example, non-aqueous liquids include N-methyl-2-pyrrolidone (NMP), polyoxyethylene sorbitan monolaurate, dimethyl isosorbide ), Diethylene glycol dimethyl ether (diethylene glycol dimethyl ether) and butylene glycol (butylene glycol) may include one or more selected from the group consisting of.
본 발명의 일 실시예에 따른 상기 조성물에서 상기 후코이단은 상기 조성물의 총중량에 대해 5 wt% 내지 10 wt% 일 수 있다.The fucoidan in the composition according to an embodiment of the present invention may be 5 wt% to 10 wt% with respect to the total weight of the composition.
본 명세서에서 사용되는 용어, "총중량"은 후코이단 및 수경성 결합재를 포함하는 치수질환의 예방 및 치료용 조성물 전체의 중량을 의미할 수 있다.As used herein, the term "gross weight" may refer to the weight of the entire composition for preventing and treating pulp diseases including fucoidan and hydraulic binder.
상기 후코이단은 상기 조성물의 총중량에 대해 5 wt% 내지 10 wt%만큼 포함될 수 있다. The fucoidan may be included by 5 wt% to 10 wt% with respect to the total weight of the composition.
바람직하게는, 상기 조성물의 총중량에 대해 10 wt% 이하의 후코이단이 치수질환의 예방 및 치료용 조성물로 포함될 경우, 생물학적 활성 (biological activity) 이 극대화될 수 있다. 상기 생물학적 활성은, 생리학적 또는 약물학적 활성을 의미할 수 있으나, 이에 제한되는 것은 아니다. 예를 들어, 생물학적 활성은 골형성 활성, 항바이러스 활성, 세포 증식 유도 활성, 세포 접착력 향상 활성, 항진균 활성, 체내 안정성, 항산화 활성, 항염증 활성, 면역억제 활성 및 지혈성일 수 있다. 그러나 이에 제한되지 않고 조성물의 총중량에 대해 10 wt% 이하의 후코이단을 포함한 치수질환의 예방 및 치료용 조성물은 더 다양한 생물학적 활성을 가질 수 있다. Preferably, when 10 wt% or less of fucoidan, based on the total weight of the composition, is included as a composition for preventing and treating pulp diseases, biological activity may be maximized. The biological activity may mean physiological or pharmacological activity, but is not limited thereto. For example, the biological activity may be osteogenic activity, antiviral activity, cell proliferation inducing activity, cell adhesion enhancing activity, antifungal activity, body stability, antioxidant activity, anti-inflammatory activity, immunosuppressive activity and hemostatic. However, the present invention is not limited thereto, and the composition for preventing and treating pulp diseases including fucoidan of 10 wt% or less based on the total weight of the composition may have various biological activities.
또한, 조성물의 총중량에 대해 10 wt% 이하의 후코이단을 포함한 치수질환의 예방 및 치료용 조성물은 세포 증식 및 세포 주기 연관 단백질인 FAK 및 PI3K-Akt의 증가를 유도할 수 있으며, 세포 접착력 향상을 유도할 수 있다. In addition, the composition for the prevention and treatment of pulp disease, including fucoidan of 10 wt% or less relative to the total weight of the composition can induce an increase in cell proliferation and cell cycle associated proteins FAK and PI3K-Akt, and induces improved cell adhesion can do.
전술된 생물학적 활성으로, 상기 조성물은 질병의 예방 및 치료 용도로 적용될 수 있다. 바람직하게는, 치수질환의 예방 및 치료용 조성물로 이용할 수 있다. With the biological activity described above, the composition can be applied for the prevention and treatment of diseases. Preferably, it can be used as a composition for the prevention and treatment of pulp disease.
본 발명의 일 실시예에 따른 상기 조성물에서 상기 수경성 결합재는 천연 포틀랜드 시멘트, 포틀랜드계 시멘트, 혼합시멘트 및 특수시멘트 및 이들의 조합으로 이루어진 군에서 선택된 하나를 포함할 수 있다.The hydraulic binder in the composition according to an embodiment of the present invention may include one selected from the group consisting of natural portland cement, portland cement, mixed cement and special cement, and combinations thereof.
본 명세서에서 사용되는 용어, "천연 포틀랜드 시멘트"는 규산칼슘을 수경성 주광물로 하는 시멘트일 수 있다.As used herein, the term “natural portland cement” may be a cement having calcium silicate as the hydraulic main mineral.
예를 들어, 천연 포틀랜드 시멘트는 보통포틀랜드 시멘트, 중용열 포틀랜드 시멘트, 조강 포틀랜드 시멘트, 초조강 포틀랜드 시멘트 및 내황산염 포틀랜드 시멘트 및 이들의 조합으로 이루어진 군에서 선택된 하나의 시멘트일 수 있다. For example, the natural portland cement may be one cement selected from the group consisting of ordinary portland cement, medium heat portland cement, crude steel portland cement, crude steel portland cement and sulfate resistant portland cement, and combinations thereof.
본 명세서에서 사용되는 용어, "포틀랜드계 시멘트"는 포틀랜드 시멘트와 같은 계열의 시멘트를 의미할 수 있다. As used herein, the term "portland cement" may refer to a cement of a series such as Portland cement.
예를 들어, 포틀랜드계 시멘트는 백색 포틀랜드 시멘트, 유정시멘트 및 클로이드 시멘트 및 이들의 조합으로 이루어진 군에서 선택된 하나의 시멘트일 수 있다.For example, the portland cement may be one cement selected from the group consisting of white portland cement, well cement and clad cement, and combinations thereof.
본 명세서에서 사용되는 용어, "혼합시멘트"는 포틀랜드 시멘트의 클링커에 포졸란이나 급랭된 고로 슬래그를 조합하고, 석고를 가해 만든 시멘트일 수 있다.As used herein, the term "mixed cement" may be cement made by combining pozzolanic or quenched blast furnace slag with clinker of Portland cement and applying gypsum.
예를 들어, 혼합시멘트는 고로 시멘트, Fly-ash 시멘트, Silica 시멘트, 초저발열 시멘트, 지열정 시멘트 및 RCCP용 시멘트 및 이들의 조합으로 이루어진 군에서 선택된 하나의 시멘트일 수 있다.For example, the mixed cement may be one cement selected from the group consisting of blast furnace cement, fly ash cement, silica cement, ultra low heat cement, geothermal cement and RCCP cement, and combinations thereof.
본 명세서에서 사용되는 용어, "특수시멘트"는 전술된 천연 포틀랜드 시멘트, 포틀랜드계 시멘트 및 혼합시멘트를 제외한 나머지 시멘트를 의미할 수 있으며, 특수한 목적을 위해 사용되는 시멘트를 의미할 수 있다.As used herein, the term "special cement" may refer to cement other than the natural portland cement, portland cement, and mixed cement described above, and may refer to cement used for a specific purpose.
예를 들어, 특수시멘트는 알루미나 시멘트, 초속경 시멘트 및 GRC용 저알칼리 시멘트 및 이들의 조합으로 이루어진 군에서 선택된 하나의 시멘트일 수 있다. For example, the special cement may be one cement selected from the group consisting of alumina cement, cemented carbide and GRC low alkali cement, and combinations thereof.
본 발명의 일 실시예에 따른 상기 조성물에서 상기 치수질환은 상기 치수질환은 치수충혈, 치수염, 치수변성, 치수의 괴사, 치근단 병변 및 치아우식증 및 이들의 조합으로 이루어진 군에서 선택된 하나를 포함할 수 있다.The pulp disease in the composition according to an embodiment of the present invention, the pulp disease may comprise one selected from the group consisting of pulp red blood, pulpitis, pulp degeneration, pulp necrosis, anterior root lesion and dental caries and combinations thereof have.
본 명세서에서 사용되는 용어, "치수충혈"은 치수에 물리적, 화학적 또는 세균성의 자극이 가해지면 처음에는 치수의 혈관이 확장되어 유도되는 충혈을 의미할 수 있으나, 이에 제한되지 않고, 다양한 자극들이 치수충혈을 유도할 수 있다. As used herein, the term "dimensional congestion" may mean congestion in which blood vessels of the pulp are first expanded when physical, chemical or bacterial stimuli are applied to the pulp, but are not limited thereto. Induce redness.
본 명세서에서 사용되는 용어, "치수염"은 물리적, 화학적 또는 세균성의 자극이 가해지면 처음에는 치수의 혈관이 확장되어 유도되는 염증을 의미할 수 있으나, 이에 제한되지 않고, 다양한 자극들이 치수염을 유도할 수 있다.As used herein, the term "dentitis" may mean inflammation caused by the expansion of blood vessels in the pulp initially when physical, chemical or bacterial stimuli are applied, but are not limited thereto, and various stimuli may induce pulpitis. Can be.
본 명세서에서 사용되는 용어, "치수변성"은 전술된 자극에 의한 변화 또는 자극을 주지 않더라도 노화에 의해서 퇴행성 또는 위축성 변화가 발생하는 것을 의미할 수 있다.As used herein, the term "dimension degeneration" may mean that a degenerative or atrophic change occurs due to aging even without the change or stimulus caused by the aforementioned stimulus.
본 명세서에서 사용되는 용어, "치수의 괴사"는 치수괴사는 염증 등에 의해 순환장애가 일어나는 경우 치수조직이 괴사하는 질병을 의미할 수 있다.As used herein, the term "dimension necrosis" may refer to a disease in which pulp tissue necrosis when a circulatory disorder occurs due to inflammation or the like.
본 명세서에서 사용되는 용어, "치근단 병변"은 치근단 주위의 병변을 의미할 수 있으며, 치근단 병변은 세균에 의해 유도될 수 있다.As used herein, the term "root root lesion" may mean a lesion around the root root, and the root root lesion may be induced by bacteria.
본 명세서에서 사용되는 용어, "치아우식증"은 치아면에 서식하는 세균으로 인한 감염성 질환을 의미할 수 있다.As used herein, the term "teeth caries" may refer to an infectious disease caused by bacteria that inhabit the tooth surface.
구체적으로, 일 실시예에 따른 치수질환의 예방 및 치료용 조성물은 전술된 치수질환으로 인한 노출된 치수에서, 치수-상아질 복합체를 재생할 수 있다. 또한, 상기 조성물은 치수변성, 치수의 괴사 및 치수의 괴저를 가진 환자의 병변치수가 제거된 빈 치수강 또는 기타 병리학적으로 손상된 조직 주위에 작용될 수 있다. Specifically, the composition for preventing and treating pulp diseases according to one embodiment may regenerate the pulp-dentin complex in the exposed pulp due to the pulp disease described above. In addition, the compositions can be operated around empty pulp cavity or other pathologically damaged tissue from which lesion dimensions of patients with pulp degeneration, pulp necrosis and pulp of pulp are removed.
또한, 치수질환의 예방 및 치료용 조성물의 함량은 질환의 종류, 질환의 중증도, 조성물에 함유된 다른 성분의 함량, 제형의 종류, 및 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여시간, 투여 경로 및 조성물의 분비율, 치료기간, 동시 사용되는 약물을 비롯한 다양한 인자에 따라 조절될 수 있다.In addition, the content of the composition for the prevention and treatment of pulp disease may include the type of disease, the severity of the disease, the amount of other components contained in the composition, the type of formulation, and the age, body weight, general state of health, sex and diet, administration of the patient. It can be adjusted according to various factors including time, route of administration and rate of release of the composition, duration of treatment, and drugs used simultaneously.
상기 치수 질환의 예방 또는 치료용 조성물을 이용한 치료방법의 대상은 인간을 제외한 포유류일 수 있다.The subject of the method of treatment using the composition for preventing or treating pulp disease may be a mammal other than a human.
본 발명의 일 실시예에 따른 상기 조성물은 방사선 조영제를 더 포함할 수 있다. The composition according to an embodiment of the present invention may further include a radiographic contrast agent.
본 명세서에서 사용되는 용어, "방사선 조영제"는 방사선 조영제는 방사선 불투과성을 부여하여 방사선 사진에서 재료의 관찰이 가능하도록 하며 상아질과 구분되는 충분한 불투과도를 부여할 수 있다. As used herein, the term "radiocontrast" means that the radiocontrast imparts radiopacity to enable observation of the material in the radiograph and may impart sufficient opacity to distinguish it from dentin.
본 발명의 일 실시예에 따른 상기 조성물에서 상기 방사선 조영제는 비스무스 옥사이드 (bismuth oxide), 비스무스 카보네이트 (bismuth carbonate), 스트론튬 카보네이트 (strontium carbonate), 스트론튬 포스페이트 (strontium phosphate), 바륨 설페이트 (barium sulfate), 탄탈륨 옥사이드 (tantalum oxide), 세륨 옥사이드 (cerium oxide), 틴 옥사이드 (tin oxide) 및 지르코늄 옥사이드 (zirconium oxide) 및 이들의 조합으로 이루어진 군에서 선택된 하나를 포함할 수 있다.In the composition according to an embodiment of the present invention, the radiographic agent is bismuth oxide, bismuth carbonate, strontium carbonate, strontium phosphate, barium sulfate, Tantalum oxide, cerium oxide, tin oxide and zirconium oxide, and combinations thereof.
그러나, 이에 제한되지 않고, 더 다양한 물질이 방사선 조영제로 이용될 수 있다. 바람직하게는, 상기 방사선 조영제는 비스무스 옥사이드 및 지르코늄 옥사이드가 이용될 수 있으며, 더 바람직하게는 비스무스 옥사이드를 이용하는 것 일수 있다.However, the present invention is not limited thereto, and more various materials may be used as the radiographic contrast agent. Preferably, the radiographic agent may be used bismuth oxide and zirconium oxide, more preferably may be to use bismuth oxide.
본 발명의 일 실시예에 따른 상기 조성물에서 상기 방사선 조영제는 상기 조성물의 총중량에 대해 20 wt% 내지 40 wt% 일 수 있다.In the composition according to an embodiment of the present invention, the radiographic contrast agent may be 20 wt% to 40 wt% with respect to the total weight of the composition.
그러나, 이에 제한되지 않고 상기 조영제는 전체 조성물에 대해 더 다양한 중량비로 포함될 수 있다. 바람직하게는, 치수질환의 예방 및 치료용 조성물로 제공하는데 있어서, 상기 방사선 조영제는 상기 조성물의 총중량에 대해 20 wt% 내지 30 wt% 만큼 포함되는 것일 수 있다. 구체적으로, 방사선 조영제의 함량이 상기 조성물의 총중량에 대해 20 wt% 미만인 경우에는 방사선 불투과도에 문제가 있을 수 있다. 또한, 방사선 조영제의 함량이 상기 조성물의 총중량에 대해 40 wt% 를 초과하는 경우에는 수경성 결합재의 함량을 감소시켜 경화지연 등의 문제가 발생될 수 있다. However, the present invention is not limited thereto and the contrast agent may be included in more various weight ratios with respect to the entire composition. Preferably, in providing a composition for preventing and treating pulp disease, the radiographic contrast agent may be included by 20 wt% to 30 wt% based on the total weight of the composition. Specifically, if the content of the radiocontrast is less than 20 wt% with respect to the total weight of the composition, there may be a problem in radiopacity. In addition, when the content of the radiographic contrast agent exceeds 40 wt% with respect to the total weight of the composition, problems such as curing delay may occur by reducing the content of the hydraulic binder.
*또한, 본 발명에서의 수경성 결합재와 방사선 조영제의 함량은 서로 상관관계가 있을 수 있다. 수경성 결합재의 함량이 높은 경우에는, 방사선 조영제의 함량이 높지 않은 것이 상기 조성물의 적절한 임상 효율성을 유지시켜줄 수 있다. 즉, 수경성 결합재와 방사선 조영제의 함량이 모두 높은 경우, 분말 성분이 과하게 되어 오히려 완전 경화가 지연될 수 있다. 전술된 사항들을 고려한다면, 수경성 결합재 및 방사선 조영제의 중량의 합이 상기 조성물의 총중량에 대해 70 wt% 를 넘지 않도록 조절하는 것이 바람직할 수 있다.In addition, the content of the hydraulic binder and the radiocontrast in the present invention may be correlated with each other. When the content of the hydraulic binder is high, the low content of the radiocontrast may maintain the appropriate clinical efficiency of the composition. That is, when both the hydraulic binder and the radiocontrast are high in content, the powder component may be excessive and complete curing may be delayed. In view of the foregoing, it may be desirable to adjust the sum of the weights of the hydraulic binder and the radiocontrast not to exceed 70 wt% relative to the total weight of the composition.
본 발명의 일 실시예에 따른 상기 조성물은 경화 개시시간이 100분 이하일 수 있다.The composition according to an embodiment of the present invention may have a curing start time of 100 minutes or less.
본 명세서에서 사용되는 용어, "경화 개시시간"은 상기 조성물의 응결의 개시로 간주되는 시간을 의미할 수 있다.As used herein, the term "curing onset time" may mean a time that is considered to be the onset of condensation of the composition.
후코이단은 상기 조성물의 경화 개시시간을 단축시키는데 관여할 수 있다. 또한, 상기 조성물의 경화 개시시간은 후코이단의 농도에 의존적일 수 있다. 더 나아가, 경화 개시시간의 측정은 미국 재료시험협회 (ASTM: American Society for Testing and Materials) 및 국제표준화기구 (IOS: International Organization for Standardization) 에서 제시한 방법론에 의거하여 수행할 수 있는데, 구체적으로, 비카 (Vicat) 바늘 및 길모어 (Gilmore) 바늘이 이용될 수 있다. 그러나, 이에 제한되지 않고, 다양한 방법 및 다양한 장치로 상기 조성물의 경화 개시시간을 측정할 수 있다. Fucoidan may be involved in shortening the curing start time of the composition. In addition, the curing start time of the composition may be dependent on the concentration of fucoidan. Furthermore, the measurement of curing initiation time can be performed according to the methodology proposed by the American Society for Testing and Materials (ASTM) and the International Organization for Standardization (IOS), specifically, Vicat needles and Gilmore needles can be used. However, the present invention is not limited thereto, and the curing start time of the composition can be measured by various methods and various devices.
상아질에 상기 조성물이 적용된 이후, 노출된 치수부분은 즉각적으로 임시 복원될 수 있기 때문에, 경화 개시시간을 단축하는 것은 치수 치료에 있어서, 경화 종결시간을 단축하는 것보다 중요할 수 있다. After the composition has been applied to the dentin, shortening the curing initiation time may be more important than shortening the curing termination time in the pulp treatment, since the exposed pulp portion may be temporarily temporarily restored.
본 발명의 일 실시예에 따른 상기 조성물은 경화 종결시간이 250분 이하일 수 있다.The composition according to an embodiment of the present invention may have a curing termination time of 250 minutes or less.
본 명세서에서 사용되는 용어, "경화 종결시간"은 상기 조성물의 응결이 완결되는 시간을 의미할 수 있다.As used herein, the term "curing termination time" may mean a time when the condensation of the composition is completed.
후코이단은 상기 조성물의 경화 개시시간을 단축시키는데 관여할 수 있다. 또한, 상기 조성물의 경화 종결시간은 후코이단의 농도에 의존적일 수 있다. 전술된, 경화 개시시간 및 경화 종결시간을 합친 시간이 경화시간이 될 수 있다. Fucoidan may be involved in shortening the curing start time of the composition. In addition, the curing termination time of the composition may be dependent on the concentration of fucoidan. As mentioned above, the combined curing start time and curing end time may be the curing time.
더 나아가, 경화 종결시간의 측정은 미국 재료시험협회 (ASTM: American Society for Testing and Materials) 에서 제시한 방법론에 의거하여 수행하였는데, 구체적으로, 비캇 바늘 장치 (Vicat needle opparatus) 및 길모어 바늘 장치 (Gilmore needle opparatus) 가 이용될 수 있다. 그러나, 이에 제한되지 않고, 다양한 방법 및 다양한 장치로 상기 조성물의 경화 종결시간을 측정할 수 있다.Furthermore, the measurement of curing end time was performed according to the methodology proposed by the American Society for Testing and Materials (ASTM), specifically, the Vicat needle opparatus and Gilmore needle device (Gilmore). needle opparatus) may be used. However, the present invention is not limited thereto, and the curing termination time of the composition may be measured by various methods and various devices.
본 발명의 일 실시예에 따른 상기 조성물은 1350 (cm-1) 내지 1450 (cm-1) 의 파장에서 0.03 % 이상의 투과율을 가질 수 있다.The composition according to an embodiment of the present invention may have a transmittance of 0.03% or more at a wavelength of 1350 (cm −1 ) to 1450 (cm −1 ).
본 명세서에서 사용되는 용어, "투과율"은 작용기의 특이적인 피크(peak) 값을 나타낼 수 있다.As used herein, the term "transmittance" may refer to a specific peak value of the functional group.
상기 투과율은 푸리에 변환 적외선 분광법 (FT-IR: Fourier-transformed infrared spectroscopy) 을 이용하여 시료의 화학적 구성요소들 (chemical compositions) 을 분석할 수 있으나, 이에 제한되지 않고 더 다양한 방법으로 화학적 구성요소를 분석할 수 있다. The transmittance may analyze chemical compositions of a sample using Fourier-transformed infrared spectroscopy (FT-IR), but is not limited thereto. can do.
구체적으로, 상기 조성물은 1420 (cm-
1)의 파장에서 0.03 % 이상의 투과율을 가질 수 있다. 상기 조성물이 1420 (cm-
1)의 파장에서 투과율을 나타내는 것은 "COO-" 의 작용기를 포함하고 있는 것을 의미할 수 있다.Specifically, the composition is 1420 - may have more than 0.03%, the transmittance at a wavelength (cm 1). The composition 1420 (cm - 1) It represents the transmittance in a wavelength can mean that contains a functional group of "COO-".
또한, 상기 조성물은, 1220 (cm-1) 내지 1270 (cm-
1)의 파장에서도 0.01 % 이상의 투과율을 가질 수 있다. 상기 조성물이 1220 (cm-1) 내지 1270 (cm-
1)의 파장에 투과율을 나타내는 것은 "S=O" 의 작용기를 포함하고 있는 것을 의미할 수 있다. The catalyst composition is useful, 1220 (cm -1) to 1270 (cm - 1) in the wavelength can have a transmittance of 0.01% or greater. The composition 1220 (cm -1) to 1270 (cm - 1) It represents the transmittance at a wavelength of can mean that contains a functional group of "S = O".
더 나아가, 상기 조성물은 860 (cm-1) 내지 880 (cm-
1)의 파장에서도 0.01 % 이상의 투과율을 가질 수 있다. 상기 860 (cm-1) 내지 880 (cm-
1)의 파장에서 투과율을 나타내는 것은 "C-O-S" 의 작용기를 포함하고 있는 것을 의미할 수 있으며, 바람직하게는, 후코이단을 포함하고 있는 것을 의미할 수 있다. Moreover, the composition 860 (cm -1) to 880 (cm - 1) may have a transmittance of 0.01% or greater in the wavelength. The 860 (cm -1) to 880 (cm - 1) is intended to represent the transmittance at the wavelength of the can means, which includes a functional group of "COS", preferably, may mean that which contains fucoidan .
본 발명의 일 실시예에 따른 상기 조성물은 MTA에 비하여 적어도 1.8 배의 광화능 (mineralization) 을 가질 수 있다.The composition according to an embodiment of the present invention may have at least 1.8 times mineralization compared to MTA.
예를 들어, 일 실시예에 따른 조성물에서 상기 조성물이 처리된 세포는 MTA가 처리된 세포에 비하여 적어도 1.8 배의 광화능을 가질 수 있으며, 이러한 결과는 상기 조성물이 처리된 세포의 생물학적 활성이 MTA 처리된 세포보다 높은 것을 의미할 수 있다. 구체적으로, 생물학적 활성이 높은 것은, 골형성 능력이 높은 것을 의미할 수 있으나, 이에 제한되지 않고 상기 조성물이 처리된 세포는 MTA 처리된 세포보다 더 다양한 생물학적 활성이 높은 것으로 해석될 수 있다.For example, in a composition according to one embodiment the cells treated with the composition may have at least 1.8 times the mineralization of the cells treated with the MTA, such that the biological activity of the cells treated with the composition is MTA It may mean higher than the treated cells. Specifically, high biological activity may mean high bone formation ability, but is not limited thereto, and the cells treated with the composition may be interpreted as having higher biological activity than MTA treated cells.
본 명세서에서 사용되는 용어, "MTA"는 무기물 트리옥사이드 집합체를 의미한다. MTA는 치수복조법에 이용될 수 있다. MTA가 치수복조법에 이용될 경우, 다른 치과용 재료에 비해 고가일 수 있으며, 사용자에 의해 조작하기가 어려울 수 있다. 또한, MTA는 체액에 용해될 수 있으며, 상아질 또는 골조직을 형성을 유도하는 활성이 없을 수 있다.As used herein, the term "MTA" means an inorganic trioxide aggregate. MTA can be used for dimensional demodulation. When MTAs are used in dimensional demodulation, they can be expensive compared to other dental materials and can be difficult to manipulate by a user. In addition, MTA may be soluble in body fluids and may lack activity to induce dentin or bone tissue formation.
상기 "세포"는 조골세포일 수 있다. 그러나 이에 제한되지 않고, 더 다양한 세포에 상기 조성물 및 MTA를 처리할 수 있다. The "cells" can be osteoblasts. However, the present invention is not limited thereto, and more various cells can be treated with the composition and the MTA.
본 명세서에서 사용되는 용어, "광화능"은 무기물을 생산하는 능력을 의미한다. 구체적으로, 광화능은 물질이 미네랄 이온 침착 및 미네랄 결정체의 형성에 의해 유기물에서 무기물로 변화되는 과정일 수 있는데, 이 광화능은 신체의 경조직을 만드는데 필요한 메커니즘일 수 있다. 치아는 연조직과 경조직으로 이루어진 복합조직이다. 법랑질, 상아질, 백악질 및 치조골로 이루어진 경조직은 치아의 전반적인 구조를 제공하며 기능을 하는 치아와 모두 연관되어 있다. 이들 치아의 경조직은 법랑질 형성 (amelogenesis), 상아질형성 (odontogenesis), 백악질 형성 (cementogenesis) 및 골형성 (osteogenesis)과 같은 광화작용에 의해 형성된다. 광화작용은 치아 발달과 줄기세포에 기초한 치아 재생에 있어, 분화 메커니즘에 중요한 역할을 할 수 있다. As used herein, the term "photooxidation ability" means the ability to produce minerals. Specifically, the photoenhancement may be a process in which a substance is changed from organic to inorganic by mineral ion deposition and formation of mineral crystals, which may be a mechanism necessary for making hard tissues of the body. Teeth are complex tissues consisting of soft and hard tissues. Hard tissue, consisting of enamel, dentin, chalk, and alveolar bone, provides the overall structure of the tooth and is associated with the functioning tooth. Hard tissues of these teeth are formed by mineralization such as enamel formation, odontogenesis, cementogenesis and osteogenicity. Mineralization can play an important role in differentiation mechanisms in tooth development and stem regeneration based on stem cells.
상기 광화능은 알리자린 레드 (Alizarin red) 염색방법, 알리자린 레드의 정량분석, 알카린 포스파타아제 (ALP: alkaline phosphatase) 활성 및 RT-PCR (real time-PCR) 로 측정 될 수 있다. 그러나, 이에 제한되지 않고 더 다양한 방법으로 광화능을 측정할 수 있다. 또한, 상기 알리자린 레드 염색은 상기 조성물로 유도된, 무기물의 형성을 보여줄 수 있다. The photosensitivity can be measured by Alizarin red staining method, quantitative analysis of Alizarin red, alkaline phosphatase (ALP) activity and RT-PCR (real time-PCR). However, the present invention is not limited thereto, and the photooxidation power may be measured by more various methods. In addition, the alizarin red staining can show the formation of minerals, induced into the composition.
더 나아가, 상기 조성물의 총중량에 대해 10 wt% 이하의 후코이단이 치수질환의 예방 및 치료용 조성물로 포함될 경우, 광화능이 극대화될 수 있다. 즉, 전술된 조건에서의 조성물의 생물학적 활성이 극대화되는 것을 의미할 수 있다.Furthermore, when the fucoidan of 10 wt% or less with respect to the total weight of the composition is included as a composition for the prevention and treatment of pulp disease, the photochemical ability can be maximized. That is, it may mean that the biological activity of the composition under the aforementioned conditions is maximized.
또한, 치수질환의 예방 및 치료에 있어 광화능이 상대적으로 높은 상기 조성물을 이용하는 것이 MTA를 이용하는 것보다 치수질환의 예방 및 치료효과가 높을 수 있다. In addition, in the prevention and treatment of pulp disease, the use of the composition having a relatively high photochemical ability may have a higher effect of preventing and treating pulp disease than using MTA.
발명의 일 실시예에 따른 상기 조성물에서 상기 조성물이 처리된 후 7일이 지난 세포는 MTA가 처리된 후 7일이 지난 세포에 비하여 적어도 2 배의 ALP (alkaline phosphatase) 활성을 가질 수 있다. In the composition according to an embodiment of the present invention, cells 7 days after the treatment of the composition may have at least twice the ALP (alkaline phosphatase) activity compared to cells 7 days after the treatment of the MTA.
그러나, 이에 제한되지 않고 상기 조성물 및 MTA 처리 7일 이전에도, 상기 조성물 처리 세포는 MTA 처리 세포보다 상대적으로 ALP 활성이 높을 수 있다. However, without being limited thereto, even before 7 days of the composition and MTA treatment, the composition-treated cells may have a relatively higher ALP activity than MTA-treated cells.
본 명세서에서 사용되는 용어, "ALP 활성"은 알카린포스파타제의 활성을 의미한다. ALP는 조골세포 막에 위치할 수 있으며, 생광화 (biomineralization) 의 마커 (marker) 로 이용될 수 있다. 그러나 이에 제한되지 않고, 다양한 마커들이 생광화의 마커로 이용될 수 있다. 예를 들어, TRAP, OPG, CatK, RANK, RANKL, 오스테오칼신, IL-6, DKK-1, MMP-8, TIMP-1, tPA, PAI-2, 카텝신, 골 시알로단백질 (bone sialoprotein: BSP), TGF-β 상과 (superfamily) 로부터의 표지들, 골 형태형성 단백질(BMP)들, 스클레로스틴 (sclerostin) 및 노긴 등이 생광화의 마커로 이용될 수 있다.As used herein, the term "ALP activity" refers to the activity of alkaline phosphatase. ALP can be located on the osteoblast membrane and can be used as a marker of biomineralization. However, the present invention is not limited thereto, and various markers may be used as markers of bioluminescence. For example, TRAP, OPG, CatK, RANK, RANKL, Osteocalcin, IL-6, DKK-1, MMP-8, TIMP-1, tPA, PAI-2, Cathepsin, bone sialoprotein (BSP) ), Markers from the TGF-β superfamily, bone morphogenetic proteins (BMPs), sclerostin and noggin, etc. can be used as markers of bioluminescence.
ALP는 화합물에서 인산염 이온을 비특이적으로 분해하고 미네랄 결정체가 커짐에 따라 ALP 활성이 증가할 수 있다. 이러한 이유로, ALP 활성의 측정은 광화능의 측정 방법 중 하나일 수 있다. 이때, p-니트로페닐 포스페이트 (p-nitrophenyl phosphate) 을 기질로 이용하여 ALP 활성을 측정할 수 있다. 구체적으로, ALP 활성이 높은 것은 골형성 관련 유전자의 발현이 증가된 것을 의미할 수 있다. ALP can increase the ALP activity as it unspecifically decomposes phosphate ions in the compound and the mineral crystals become larger. For this reason, the measurement of ALP activity may be one of the methods of measuring photosensitivity. In this case, p-nitrophenyl phosphate (p-nitrophenyl phosphate) can be used as a substrate to measure the ALP activity. Specifically, high ALP activity may mean that the expression of a gene related to bone formation is increased.
일 실시예에 따른, 조성물이 처리된 후 7일이 지난 세포가 MTA가 처리된 세포에 비하여 적어도 2 배의 ALP를 가지는 것은 상기 조성물이 처리된 세포의 생물학적 활성이 MTA 처리된 세포보다 높은 것을 의미할 수 있다. 구체적으로, 골형성 능력이 상대적으로 높은 것을 의미할 수 있으나, 이에 제한되지 않고 더 다양한 생물학적 활성이 높은 것으로 해석될 수 있다. According to one embodiment, the cells 7 days after the composition is treated have at least twice as much ALP as the cells treated with the MTA than the cells treated with the MTA, indicating that the biological activity of the cells treated with the composition is higher than the cells treated with the MTA. can do. Specifically, it may mean that the bone formation ability is relatively high, but is not limited thereto and may be interpreted as having a higher variety of biological activities.
상기 조성물의 총중량에 대해 10 wt% 이하의 후코이단이 치수질환의 예방 및 치료용 조성물로 포함될 경우, ALP 활성이 극대화 될 수 있다. 즉, 전술된 조건에서의 조성물의 생물학적 활성이 극대화되는 것을 의미할 수 있다. When fucoidan of 10 wt% or less with respect to the total weight of the composition is included as a composition for the prevention and treatment of pulp disease, ALP activity can be maximized. That is, it may mean that the biological activity of the composition under the aforementioned conditions is maximized.
또한, 치수질환의 예방 및 치료에 있어 광화능이 상대적으로 높은 상기 조성물을 이용하는 것이 MTA를 이용하는 것보다 치수질환의 예방 및 치료효과가 높을 수 있다.In addition, in the prevention and treatment of pulp disease, the use of the composition having a relatively high photochemical ability may have a higher effect of preventing and treating pulp disease than using MTA.
본 발명의 일 실시예에 따르면, 인간을 제외한 동물의 치수에 후코이단 및 수경성 결합재를 포함하는, 조성물을 위치시키는 단계를 포함하는, 상아질모세포 분화 촉진 방법이 제공된다.According to one embodiment of the invention, there is provided a method for promoting dentinocyte differentiation, comprising positioning a composition comprising fucoidan and a hydraulic binder in the dimensions of an animal other than a human.
예를 들어, 상기 상아질모세포 분화 촉진 방법을 손상된 치수에 적용하였을 때, 상아질교가 효과적으로 형성되고, 상아질모세포의 분화가 촉진될 수 있다. 결과적으로 치수의 재생이 촉진될 수 있어, 본 발명의 일 실시예에 따른 상아질모세포 분화 촉진 방법은 치수질환을 예방하거나 치료하는데 이용될 수 있다.For example, when the dentin hair differentiation promoting method is applied to damaged dimensions, dentin bridges can be effectively formed and differentiation of dentin hair cells can be promoted. As a result, the regeneration of pulp can be promoted, so that the method for promoting dentinocyte differentiation according to an embodiment of the present invention can be used to prevent or treat pulp disease.
본 발명의 일 실시예에 따른 상아질모세포 분화 촉진 방법에서, 상기 조성물은 방사선 조영제를 더 포함할 수 있다. 그러나, 이에 제한되지 않고 더 다양한 첨가물을 포함할 수 있다. 예를 들어, 상기 첨가물은 전술한 조성물은 치수-상아질 복합체의 재생 및 염증 반응을 조절할 수 있는 약물일 수 있다. In the method of promoting odontoblast differentiation according to an embodiment of the present invention, the composition may further include a radiographic contrast agent. However, the present invention is not limited thereto, and may include more various additives. For example, the additive may be a drug that the composition described above can modulate the regeneration and inflammatory response of the pulp-dentin complex.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명한다. 다만, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것에 불과하므로 본 발명의 범위가 이들 실시예에 의해 한정되는 것으로 해석되어서는 아니된다.Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are only for illustrating the present invention by way of example, and the scope of the present invention should not be construed as being limited by these examples.
본 발명의 일 실시예에 따른 치수질환의 예방 및 치료용 조성물은 경화 개시시간 및 경화 종결시간을 단축시키며, 광화능 및 ALP 활성을 증가시키는 효능을 나타내어 결과적으로 치아 경조직의 활성능이 증가되고, 이에 의해 치수질환을 예방 및 치료하는데, 사용될 수 있다.The composition for preventing and treating pulp disease according to an embodiment of the present invention shortens the curing start time and the curing stop time, and exhibits the effect of increasing the photooxidative activity and ALP activity, and as a result, the activity of the dental hard tissue is increased, This can be used to prevent and treat pulp disease.
또한, 본 발명의 일 실시예에 따른 조성물은 상아질모세포 분화 촉진 방법에 제공될 수 있다. In addition, the composition according to an embodiment of the present invention may be provided in a method for promoting dentinocyte differentiation.
본 발명에 따른 효과는 이상에서 예시된 내용에 의해 제한되지 않으며, 더욱 다양한 효과들이 본 명세서 내에 포함되어 있다.The effects according to the present invention are not limited by the contents exemplified above, and more various effects are included in the present specification.
도 1은 본 발명의 일 실시예에 따른 조성물을 처리하였을 때, 경화시간을 나타내는 실험 결과이다.1 is an experimental result showing the curing time when treating the composition according to an embodiment of the present invention.
도 2a는 본 발명의 일 실시예에 따른 조성물 중 후코이단을 각각 다른 중량비로 포함하는 조성물을 처리하였을 때, 상대적인 세포 생존도를 나타내는 실험 결과이다. Figure 2a is an experimental result showing the relative cell viability when treated with a composition comprising fucoidan in different weight ratios in the composition according to an embodiment of the present invention.
도 2b는 본 발명의 일 실시예에 따른 조성물 중 후코이단을 각각 다른 중량비로 포함하는 조성물을 처리하였을 때, 세포유착과 관련된 유전자의 발현정도를 나타내는 실험 결과이다.Figure 2b is an experimental result showing the expression level of genes associated with cell adhesion when treated with a composition comprising fucoidan in each weight ratio of the composition according to an embodiment of the present invention.
도 2c는 본 발명의 일 실시예에 따른 조성물 중 후코이단을 각각 다른 중량비로 포함하는 조성물을 처리하였을 때, 광화능 분석을 위한, 알리자린 레드 염색한 세포를 나타내는 실험 결과이다. Figure 2c is an experimental result showing alizarin red stained cells for the photochemical analysis, when the composition containing each fucoidan in a different weight ratio in the composition according to an embodiment of the present invention.
도 2d는 본 발명의 일 실시예에 따른 조성물 중 후코이단을 각각 다른 중량비로 포함하는 조성물을 처리하였을 때, 광화능을 측정한 결과를 나타내는 실험 결과이다. Figure 2d is an experimental result showing the results of measuring the photochemical power when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.
도 2e는 본 발명의 일 실시예에 따른 조성물 중 후코이단을 각각 다른 중량비로 포함하는 조성물을 처리하였을 때, ALP 활성을 측정한 결과를 나타내는 실험 결과이다. Figure 2e is an experimental result showing the results of measuring the ALP activity when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.
도 2f는 본 발명의 일 실시예에 따른 조성물 중 후코이단을 각각 다른 중량비로 포함하는 조성물을 처리하였을 때, 골형성 연관 유전자의 발현을 나타내는 실험 결과이다.Figure 2f is an experimental result showing the expression of bone-associated genes when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.
도 2g는 본 발명의 일 실시예에 따른 조성물 중 후코이단을 각각 다른 중량비로 포함하는 조성물을 처리하였을 때, 세포이동의 정도를 나타내는 실험 결과이다.Figure 2g is an experimental result showing the degree of cell migration when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.
도 3a는 본 발명의 일 실시예에 따른 조성물 중 후코이단을 함유하지 않은 조성물을 처리하였을 때, FE-SEM 및 EDX 분석 결과를 나타내는 실험 결과이다. Figure 3a is an experimental result showing the results of FE-SEM and EDX when the composition containing no fucoidan in the composition according to an embodiment of the present invention.
도 3b는 본 발명의 일 실시예에 따른 조성물의 총중량에 대해 5 wt% 의 후코이단을 포함하는 조성물을 처리하였을 때, FE-SEM 및 EDX 분석 결과를 나타내는 실험 결과이다. Figure 3b is an experimental result showing the results of FE-SEM and EDX when the composition comprising 5 wt% fucoidan relative to the total weight of the composition according to an embodiment of the present invention.
도 3c는 본 발명의 일 실시예에 따른 조성물의 총중량에 대해 10 wt% 의 후코이단을 포함하는 조성물을 처리하였을 때, FE-SEM 및 EDX 분석 결과를 나타내는 실험 결과이다. Figure 3c is an experimental result showing the results of FE-SEM and EDX when the composition comprising 10 wt% fucoidan relative to the total weight of the composition according to an embodiment of the present invention.
도 4은 본 발명의 일 실시예에 따른 조성물 중 후코이단을 각각 다른 중량비로 포함하는 조성물을 처리하였을 때, FT-IR 분석 결과를 나타내는 실험 결과이다.Figure 4 is an experimental result showing the results of the FT-IR when the composition containing the fucoidan in each of the composition according to an embodiment of the present invention in a different weight ratio.
본 발명의 이점 및 특징, 그리고 그것들을 달성하는 방법은 첨부되는 도면과 함께 상세하게 후술되어 있는 실시예들을 참조하면 명확해질 것이다. 그러나, 본 발명은 이하에서 개시되는 실시예들에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 것이며, 단지 본 실시예들은 본 발명의 개시가 완전하도록 하며, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이며, 본 발명은 청구항의 범주에 의해 정의될 뿐이다.Advantages and features of the present invention and methods for achieving them will be apparent with reference to the embodiments described below in detail with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below, but may be implemented in various different forms, only the present embodiments to make the disclosure of the present invention complete, and common knowledge in the art to which the present invention pertains. It is provided to fully inform the person having the scope of the invention, which is defined only by the scope of the claims.
이하에서는, 본 발명의 치수질환의 예방 및 치료용 조성물 중 수경성 결합재를 포틀랜드 시멘트로 이용하는 것과 방사선 조영제를 지르코늄 옥사이드로 이용하는 것을 예시적으로 하여 설명하나 이에 제한되지 않는다. 또한, 본 발명의 다양한 실시예에 따른 치수질환의 예방 및 치료용 조성물을 처리한 세포의 생물학적 활성이 증가됨으로써, 상기 조성물을 다양한 치수질환 치료방법에 제공할 뿐만 아니라, 치수질환의 예방 및 치료용 조성물로도 제공할 수 있다.In the following, by using the hydraulic binder as a portland cement in the composition for the prevention and treatment of pulp disease of the present invention and using a radiographic contrast agent as zirconium oxide, but not limited thereto. In addition, the biological activity of the cells treated with the composition for preventing and treating pulp diseases according to various embodiments of the present invention is increased, thereby providing the composition to various methods for treating pulp diseases, and for preventing and treating pulp diseases. It can also be provided as a composition.
치수질환의 예방 및 치료용 조성물의 구성Composition of composition for prevention and treatment of pulp disease
이하의 실험들에서는 다음의 조성으로 이루어진 조성물을 이용하였다. 구체적으로, 일 실시예에 따른 치수질환의 예방 및 치료용 조성물의 수경성 결합재로는 포틀랜드 시멘트를 이용하였다. 상기 포틀랜드 시멘트는 상기 조성물의 총중량에 비하여 80 wt% 를 가지고 있다. 또한, 상기 조성물의 방사선 조영제로 지르코늄 옥사이드를 사용하였고, 지르코늄 옥사이드는 상기 조성물의 총중량에 비하여 20 wt% 를 가지고 있다. In the following experiments, a composition consisting of the following compositions was used. Specifically, Portland cement was used as the hydraulic binder of the composition for preventing and treating pulp diseases according to an embodiment. The portland cement has 80 wt% relative to the total weight of the composition. In addition, zirconium oxide was used as a radiocontrast of the composition, and zirconium oxide has 20 wt% relative to the total weight of the composition.
그 다음, 전술된 조성의 조성물에, 후코이단을 포함하지 않은 조성물과, 조성물의 총중량에 비하여 5 wt% 의 후코이단을 함유하는 조성물 및 조성물의 총중량에 비하여 10 wt% 의 후코이단을 함유하는 조성물로 이루어져있는 세개의 군으로 나누었다.Next, the composition of the above-mentioned composition is composed of a composition containing no fucoidan, a composition containing 5 wt% fucoidan relative to the total weight of the composition, and a composition containing 10 wt% fucoidan relative to the total weight of the composition. It was divided into three groups.
이하에서는, 후코이단을 포함하지 않은 조성물을 PZ (Portland cement 80 wt% + ZO 20 wt%) 로, 조성물의 총중량에 비하여 5 wt%의 후코이단을 함유하는 조성물을 PZF5 (Portland cement 80 wt% + ZO 20 wt% + Fucoidan 5 wt%) 로, 조성물의 총중량에 비하여 10 wt%의 후코이단을 함유하는 조성물을 PZF10 (Portland cement 80 wt% + ZO 20 wt% + Fucoidan 10 wt%) 로 기재하여 설명한다.Hereinafter, a composition containing no fucoidan is PZ (Portland cement 80 wt% + ZO 20 wt%), and a composition containing 5 wt% fucoidan relative to the total weight of the composition is PZF5 (Portland cement 80 wt% + ZO 20 wt% + Fucoidan 5 wt%), a composition containing 10 wt% fucoidan relative to the total weight of the composition is described by describing PZF10 (80 wt% Portland cement + 20 wt% ZO + 10 wt% Fucoidan).
통계학적 분석Statistical analysis
이하의 실험들에서는 일원 분산분석 (One-way analysis of variance) 법을 이용해 각각의 군들간의 통계학적 차이를 분석하였다. 구체적으로, 상기 분석은 Tukey 검정을 이용한 이원 비교법을 이용하여 수행되었다. In the experiments below, one-way analysis of variance was used to analyze statistical differences between groups. Specifically, the analysis was performed using a binary comparison method using Tukey's test.
실시예 1: PZ, PZF5 및 PZF10의 경화시간 측정Example 1 Measurement of Cure Time of PZ, PZF5 and PZF10
먼저, 일 실시예에 따른 조성물의 경화시간은 경화 개시시간 및 경화 종결시간을 측정하여, 합친 것을 의미할 수 있다. PZ, PZF5 및 PZF10의 경화 개시시간 및 경화 종결시간의 측정은 내부직경 10 mm 및 높이 2 mm인 테프론 몰드 (Teflon mold) 에서 수행되었다. 구체적으로, 경화 개시시간 및 경화 종결시간은 미국 재료시험협회에서 제시한 C266-03 과 국제표준화기구에서 제시한 6876 의거하여 수행하였다. First, the curing time of the composition according to one embodiment may mean that by combining the curing start time and the curing end time. The cure start time and cure end time of PZ, PZF5 and PZF10 were measured in a Teflon mold with an internal diameter of 10 mm and a height of 2 mm. Specifically, the hardening start time and hardening end time were performed based on C266-03 proposed by the American Material Testing Association and 6876 proposed by the International Organization for Standardization.
경화 개시시간의 측정에는 100g의 길모어 바늘을 이용하였는데, 상기 길모어 바늘은 2 mm 직경의 활성 팁 (tip) 을 가지고 있다. 또한, 개시 종결시간의 측정에는 400 g의 길모어 바늘을 이용하였으며, 상기 길모어 바늘은 1 mm 직경의 활성 팁을 가지고 있다. 이하에서는 설명의 간명함을 위해, 경화 개시시간의 측정에 사용된 바늘을 "개시 바늘", 개시 종결시간의 측정에 사용된 바늘을 "종결 바늘"이라고 명명하여 설명한다. 100 g of Gilmore needles were used to measure the curing start time, which had an active tip of 2 mm diameter. In addition, 400 g of Gilmore needles were used to measure the start end time, which had an active tip of 1 mm diameter. In the following description, for the sake of simplicity, the needle used for the measurement of the curing start time will be described as "starting needle" and the needle used for the measurement of the start end time as "termination needle".
경화 개시시간의 측정은 개시 바늘을 PZ, PZF5 및 PZF10의 표면에서 약한 힘으로 가하면서 수행되었다. 이 과정은 5분마다 반복되었는데, PZ, PZF5 및 PZF10 표면에서 개시 바늘로 인한 원형의 흠이 생기지 않을 때까지 수행하였다. 구체적으로, 각각의 조성물들에 개시 바늘을 가했을 때, 조성물의 표면에서 교반 및 미미한 흠이 나는 현상이 멈출 때까지의 경과시간을 기록하였고. 이 시간을 경화 개시시간이라고 설정하였다. Determination of the curing onset time was performed by applying the starting needle with a weak force on the surfaces of PZ, PZF5 and PZF10. This procedure was repeated every 5 minutes, until no circular flaws from the starting needles appeared on the PZ, PZF5 and PZF10 surfaces. Specifically, when the starting needle was applied to each of the compositions, the time elapsed until the phenomenon of stirring and minor scratches on the surface of the composition stopped. This time was set as curing start time.
전술된 경화 개시시간의 측정과 동일한 방법에 개시 바늘을 대신해서 종결 바늘을 적용하여, 개시 종결시간을 설정하였다.The start end time was set by applying the end needle in place of the start needle in the same manner as the measurement of the curing start time described above.
도 1은 PZ, PZF5 및 PZF10의 경화시간을 나타낸다. PZ에 비하여 PZF10에서 경화 개시시간이 약 50 %, 경화 종결시간이 약 20 % 단축된 것을 확인하였다. 이 결과로, 경화시간은 후코이단 농도에 의존적이며, 경화시간을 단축시키는 것을 인지하였다. 1 shows the curing time of PZ, PZF5 and PZF10. Compared to PZ, the curing start time was reduced by about 50% and the curing stop time was reduced by about 20% in PZF10. As a result, the curing time was dependent on the fucoidan concentration, and it was recognized that the curing time was shortened.
전술된 실시예 1에서의 후코이단을 함유한 조성물 PZF5 및 PZF10이 후코이단을 함유하지 않은 조성물 PZ에 비해 짧은 경화시간을 나타내는 결과를 확인하였다. 구체적으로, 경화 개시시간의 단축은, 상아질에 후코이단을 함유한 PZF5 및 PZF10이 적용된 이후, 노출된 치수부분이 즉각적으로 임시 복원될 수 있기 때문에, 치수 치료에 있어서, 후코이단을 사용하지 않는 조성물을 사용하는 것보다 효과적일 수 있다. 특히, 경화시간 단축에 있어서는 PZF10이 치수질환의 치료용 조성물로 이용되는 것이 효과적일 수 있다.The results showed that the compositions PZF5 and PZF10 containing fucoidan in Example 1 described above showed shorter curing time than the composition PZ containing no fucoidan. Specifically, the shortening of the initiation time of curing can be achieved by using a composition that does not use fucoidan in the pulp treatment since the exposed pulp portion can be immediately and temporarily restored after the application of PZF5 and PZF10 containing fucoidan to the dentin. It can be more effective than that. In particular, in shortening the curing time, it may be effective to use PZF10 as a composition for treating pulp diseases.
실시예 2: PZ, PZF5 및 PZF10의 생물학적 활성 측정Example 2: Determination of Biological Activity of PZ, PZF5 and PZF10
먼저, 이하에서는 PZ, PZF5 및 PZF10 조성물과 MTA의 생물학적 활성을 비교하여 나타낸다. 세포 생존도의 측정, 세포부착 측정, 광화능 측정 및 ALP 활성의 측정의 실험에서는 PZ, PZF5, PZF10 및 MTA를 처리한 조골세포를 비교한다.First, the biological activities of the PZ, PZF5 and PZF10 compositions and the MTA are shown below in comparison. In experiments of measuring cell viability, measuring cell adhesion, measuring photochemical capacity, and measuring ALP activity, osteoblasts treated with PZ, PZF5, PZF10 and MTA were compared.
상기 조골세포는 사람의 조골세포인 MG63를 이용했는데, 실험 진행 전에는, 최소배지에서 배양되었다. 상기 최소배지의 구성은 10 % 의 소태아혈청 (fetal bovine serum), 페니실린 (penicillin) (100 units/mL) 및 스트렙토마이신 (streptomycin) (100 units/mL) 으로 이루어졌다.The osteoblasts were MG63 human osteoblasts, which were cultured in a minimal medium before the experiment. The minimal medium consisted of 10% fetal bovine serum, penicillin (100 units / mL) and streptomycin (100 units / mL).
실험 진행 중에는 상기 조골세포를 골형성 배지 (OM: osteogenic medium) 가 포함되어 있는 웰 (well) 에 MG63을 접종한 후, 37 ℃ 의 5 % CO2 및 95 % 의 공기로 조성된 조건에서 24시간 동안 세포부착을 유도하였다. 그 다음, PZ, PZF5, PZF10 및 MTA을 각각의 웰에 처리하였다. During the experiment, the osteoblasts were inoculated with MG63 in a well containing osteogenic medium (OM: osteogenic medium) and incubated for 24 hours under conditions consisting of 5% CO2 and 95% air at 37 ° C. Cell adhesion was induced. Then PZ, PZF5, PZF10 and MTA were treated in each well.
이하 세포의 생존도 측정, 세포부착 측정, 광화능 측정 및 ALP 활성의 측정의 실험에서 적용되는 6개의 군들은 다음과 같다. 4개의 실험군으로는 골형성 배지에서 PZ, PZF5, PZF10 및 MTA가 처리된 조골세포로 조성되어 있고, 2개의 대조군으로는 양성 대조군의 골형성 배지에서 아무 것도 처리하지 않은 조골세포 및 음성 대조군의 최소 배지에서 아무것도 처리되지 않은 조골세포로 조성되어 있다. The following six groups are applied in the experiments of measuring cell viability, measuring cell adhesion, measuring photooxidation, and measuring ALP activity. Four experimental groups consisted of osteoblasts treated with PZ, PZF5, PZF10, and MTA in bone formation medium, and two control groups were minimal of osteoblasts and no negative control treated with bone formation medium in positive control group. It is composed of untreated osteoblasts in the medium.
세포이동의 정도 측정 실험에서는 제대정맥혈관내피세포 (HUVECs: human umbilical vein endothelial cell) 을 이용한다. 이하에서는 설명의 간명함을 위해 제대정맥혈관내피세포를 "HIVECs"로 명명한다. 세포이동의 정도 측정 실험에서 적용되는 실험군은 PZ, PZF5, PZF10 및 MTA가 처리된 HUVECs이며, 그 대조군은 아무것도 처리되지 않은 HUVECs가 된다. In the experiment of measuring the degree of cell migration, human umbilical vein endothelial cells (HUVECs) are used. In the following description, umbilical vein vascular endothelial cells are referred to as "HIVECs" for clarity of explanation. The experimental groups applied in the degree of cell migration were HUVECs treated with PZ, PZF5, PZF10 and MTA, and the control group was HUVECs without any treatment.
PZ, PZF5, PZF10 및 MTA 처리된 조골세포의 세포 생존도 측정Measurement of Cell Viability of Osteoblasts Treated with PZ, PZF5, PZF10 and MTA
세포 생존도 측정에 이용된 조골세포는 1 × 104 (cells/well) 농도의 조골세포를 이용하였고, PZ, PZF5, PZF10 및 MTA 처리 후 3일 및 7일이 지난 조골세포의 세포 생존도를 측정하였다. 이때, 각각의 조성물이 처리된 조골세포들은 570 nm의 파장에서 마이크로플레이트 흡광도 판독기 (microplate absorbance reader) 를 이용하여 광학밀도를 측정하였다.Osteoblasts used for cell viability measurements were osteoblasts at a concentration of 1 × 10 4 (cells / well). Cell viability of osteoblasts 3 and 7 days after treatment with PZ, PZF5, PZF10 and MTA was measured. At this time, the osteoblasts treated with each composition were measured for optical density using a microplate absorbance reader at a wavelength of 570 nm.
도 2a는 PZ, PZF5, PZF10 및 MTA 처리된 조골세포와 대조군들의 세포 생존도를 나타낸다. PZF5처리된 후 7일차의 조골세포의 세포 생존도가 증가한 것을 확인하였다. Figure 2a shows the cell viability of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. After PZF5 treatment, it was confirmed that the cell viability of osteoblasts on day 7 was increased.
PZ, PZF5, PZF10 및 MTA 처리된 조골세포의 세포부착 측정Adhesion Measurement of PZ, PZF5, PZF10 and MTA Treated Osteoblasts
먼저, 전술된 방법으로 준비된 조골세포에 PZ, PZF5, PZF10 및 MTA를 처리 한 후 24시간을 더 배양하였다. 세포부착 정도는 RT-PCR을 이용한, 인테그린 (integrin) β1 및 인테그린 β3 의 발현을 측정하여 분석하였다. First, after treatment with PZ, PZF5, PZF10 and MTA to osteoblasts prepared by the above-described method was further cultured for 24 hours. The degree of cell adhesion was analyzed by measuring the expression of integrin β1 and integrin β3 using RT-PCR.
구체적으로, PZ, PZF5, PZF10 및 MTA이 처리된 각각의 조골세포를 EP 튜브에 옮긴 후, RiboEX 시약을 이용해 총 RNA를 추출하였다. 200μL의 클로로포름 (Chloroform) 을 상기 EP 튜브에 취하고, 4 °C 에서 15분동안 원심분리하였다. 원심분리 후 수득된 RNA에서 1 μg을 취해, Maxime RT PreMix 키트를 이용해 역전사 하였다.Specifically, each osteoblasts treated with PZ, PZF5, PZF10 and MTA were transferred to EP tubes, and total RNA was extracted using RiboEX reagent. 200 μL of chloroform (Chloroform) was taken into the EP tube and centrifuged at 4 ° C. for 15 minutes. 1 μg was taken from RNA obtained after centrifugation and reverse transcribed using Maxime RT PreMix kit.
그 다음, 수득된 cDNA를 Maxime RT PreMix 키트를 이용해 증폭시켰다. 이때 GAPDH를 하우스키핑 유전자로 이용하였다. [표 1] 에서는 자세한 프라이머의 시퀀스, RT-PCR 조건 및 주기, 생성물 크기가 기재되어 있다. The cDNA obtained was then amplified using Maxime RT PreMix kit. GAPDH was used as a housekeeping gene. Table 1 lists detailed primer sequences, RT-PCR conditions and cycles, and product size.
유전자gene | 포워드 시퀀스Forward sequence | 리버스 시퀀스Reverse sequence | 어닐링 온도 (℃)Annealing Temperature (℃) | 주기수Frequency | 생성물 크기(bp)Product size (bp) |
인테그린β1Integrinβ1 | TCGGGGAGCCACAGACATTTCGGGGAGCCACAGACATT | GCTAAATGGGCTGGTGCAGTGCTAAATGGGCTGGTGCAGT | 5757 | 3535 | 282282 |
인테그린β2Integrinβ2 | CAACAATGGCAATGGGACCTCAACAATGGCAATGGGACCT | TGAGCACATCTCCCCCTTGTTGAGCACATCTCCCCCTTGT | 5757 | 3535 | 268268 |
오스테오칼신(OCN)Osteocalcin (OCN) | CCTCACACTCCTCGCCCTATTCCTCACACTCCTCGCCCTATT | TCCTGAAAGCCGATGTGGTCTCCTGAAAGCCGATGTGGTC | 5757 | 3535 | 264264 |
상아질시알로포스포프로틴 (DSPP)Dentinyl Allophosphoprotein (DSPP) | TGGTGTCCTGGTGCATGAAGTGGTGTCCTGGTGCATGAAG | TGTTTGTGGCTCCAGCATTGTGTTTGTGGCTCCAGCATTG | 5757 | 3535 | 281281 |
오스테릭스Asterix | ATCCATGCAGGCATTTCACCATCCATGCAGGCATTTCACC | TGCCCACTATTTCCCACTGCTGCCCACTATTTCCCACTGC | 5757 | 3535 | 290290 |
GAPDHGAPDH | ACTGGCGTCTTCACCACCATACTGGCGTCTTCACCACCAT | GGCCATCCACAGTCTTCTGGGGCCATCCACAGTCTTCTGG | 5757 | 3030 | 277277 |
PCR 생성물은 1.5 % 아가로즈 겔 (agarose gel) 에 용해시킨 후 레드세이프 (RedSafe) 로 염색한 후, ChemiDoc 이미징 시스템 (Imaging System) 을 이용하여 분석하였다. PCR products were dissolved in 1.5% agarose gel, stained with RedSafe, and analyzed using a ChemiDoc imaging system (Imaging System).
도 2b는 PZ, PZF5, PZF10 및 MTA 처리된 조골세포와 대조군들의 인테그린 β1 및 인테그린 β3의 발현정도를 나타낸다. 인테그린 β1는 PZF5가 처리된 조골세포에서 높게 발현되었으며, 특히 인테그린 β3는 다른 군들과 다르게, PZF5 및 PZF10가 처리된 조골세포 모두에서 높게 발현된 것을 확인하였다. Figure 2b shows the expression level of integrin β1 and integrin β3 of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. Integrin β1 was highly expressed in osteoblasts treated with PZF5, and integrin β3 was highly expressed in both osteoblasts treated with PZF5 and PZF10, unlike other groups.
PZ, PZF5, PZF10 및 MTA 처리된 조골세포의 광화능 측정Measurement of Photochemical Activity of Osteoblasts Treated with PZ, PZF5, PZF10 and MTA
먼저, 전술된 방법으로 준비된 조골세포에 PZ, PZF5, PZF10 및 MTA를 처리 한 후 24시간을 더 배양하였다. 그 다음 처리가 끝난 세포들은 70 % 의 에탄올로 상온에서 1시간동안 고정되었고, 1 % 의 알리자린 레드를 10 분 동안 처리하여, 염색이 끝난 세포들을 멸균수로 세척하였다. First, after treatment with PZ, PZF5, PZF10 and MTA to osteoblasts prepared by the above-described method was further cultured for 24 hours. The treated cells were then fixed with 70% ethanol for 1 hour at room temperature, treated with 1% alizarin red for 10 minutes, and the stained cells were washed with sterile water.
마지막으로 10 % 의 세틸피리디늄클로라이드 (cetylpyridinium chloride) 를 포함하는 10 mM의 소듐포스페이트 버퍼에 (sodium phosphate) 상기 세포들을 15분동안 처리하여 14일동안 배양하였다. 562 nm 의 파장에서, 마이크로 플레이트 리더를 이용해 PZ, PZF5, PZF10 및 MTA 처리된 조골세포 및 대조군의 광학밀도를 측정하였다. Finally, the cells were treated in 10 mM sodium phosphate buffer containing 10% cetylpyridinium chloride for 15 minutes and incubated for 14 days. At a wavelength of 562 nm, the optical density of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls was measured using a microplate reader.
도 2c는 PZ, PZF5, PZF10 및 MTA 처리된 조골세포 및 대조군들의 알리자린 레드로 염색한 결과를 나타낸다. PZF5가 처리된 조골세포에서의 높은 광학밀도를 확인하였다. Figure 2c shows the results of staining with alizarin red of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. The high optical density in osteoblasts treated with PZF5 was confirmed.
도 2d는 PZ, PZF5, PZF10 및 MTA 처리된 조골세포 및 대조군들의 광화능을 나타낸다. 도 4c의 결과와 마찬가지로, PZF5가 처리된 조골세포에서의 광화능이 6개 군들 중에서 가장 높았으며, 그 다음 PZF5가 처리된 조골세포에서의 광화능이 높게 확인되었다. 특히, MTA 처리 조골세포에 비하여 PZF5 처리 조골세포의 광화능이 1.8 배 이상인 것을 확인하였다. FIG. 2D shows the mineralization of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. As shown in the results of FIG. 4C, the photochemical capacity in the osteoblasts treated with PZF5 was the highest among six groups, and the photooxidative capacity in osteoblasts treated with PZF5 was high. In particular, it was confirmed that the mineralization capacity of PZF5 treated osteoblasts was 1.8 times higher than that of MTA treated osteoblasts.
PZ, PZF5, PZF10 및 MTA 처리된 조골세포의 ALP 활성의 측정Measurement of ALP Activity in PZ, PZF5, PZF10 and MTA Treated Osteoblasts
ALP 활성의 측정에는 p-니트로페닐 포스페이트를 기질로 이용하였다. 구체적으로, 0.7 M 의 2-아미노-메틸-1-프로판올 (2-amino-methyl-1-propanol) 및 6.7 Mm 의 마그네슘 클로라이드에 p-니트로페닐 포스페이트를 포함하는 용액을 기질활성용액으로 사용하였다. P-nitrophenyl phosphate was used as a substrate for the measurement of ALP activity. Specifically, a solution containing p-nitrophenyl phosphate in 0.7 M 2-amino-methyl-1-propanol and 6.7 Mm magnesium chloride was used as the substrate active solution.
그 다음, 전술된 방법으로 준비된 조골세포에 PZ, PZF5, PZF10 및 MTA를 처리 한 플레이트에 상기 기질활성용액을 처리하여 1시간동안 배양하였다. 처리 7일 후 및 처리 14일 후의 세포들은 405 nm의 파장에서, ELISA (enzyme-linked immunosorbent assay) 를 이용하여 광학밀도를 측정하였다.Then, the osteoblasts prepared by the method described above was incubated for 1 hour by treating the substrate active solution on a plate treated with PZ, PZF5, PZF10 and MTA. Cells 7 days after treatment and 14 days after treatment were measured for optical density using an enzyme-linked immunosorbent assay (ELISA) at a wavelength of 405 nm.
도 2e는 PZ, PZF5, PZF10 및 MTA 처리된 조골세포 및 대조군들의 ALP활성을 나타낸다. PZF5 처리 7일 후의 조골세포의 ALP 활성이 다른 5개 군의 처리 조골세포보다 높은 것을 확인하였다. 특히, PZF5 처리 14일 후의 조골세포의 ALP 활성은 PZF10보다 높았으며, MTA 처리 14일 후의 조골세포에 비하여 2 배이상 높은 것을 확인하였다. 2E shows ALP activity of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. It was confirmed that osteoblasts after 7 days of PZF5 treatment had higher ALP activity than those of the other five groups. In particular, the ALP activity of osteoblasts after 14 days of PZF5 treatment was higher than that of PZF10, and was confirmed to be two times higher than that of osteoblasts after 14 days of MTA treatment.
PZ, PZF5, PZF10 및 MTA 처리된 조골세포의 골형성 연관 유전자 발현의 측정Measurement of Osteoblastic Gene Expression in Osteoblasts Treated with PZ, PZF5, PZF10 and MTA
골형성 연관 유전자의 발현은 RT-PCR을 이용하여 측정되었다. 구체적으로, 골형성 연관 유전자로는 오스테오칼신 (OCN: osteocalcin) 상아질 시알로포스포프로틴 (DSPP: dentin sialophosphoprotein) 및 오스테릭스 (osterix) 를 이용하였다. The expression of bone formation associated genes was measured using RT-PCR. Specifically, osteocalcin (OCN: osteocalcin) dentin sialophosphoprotein (DSPP: dentin sialophosphoprotein) and asterix (osterix) were used.
*먼저, 전술된 방법으로 준비된 조골세포에 PZ, PZF5, PZF10 및 MTA를 처리 한 후 24시간동안 세포부착을 유도하고 7일간 배양하였다.* First, after treating PZ, PZF5, PZF10 and MTA to osteoblasts prepared by the above-described method, cell adhesion was induced for 24 hours and cultured for 7 days.
그 다음, 상기 골형성 연관 유전자들의 상대적 발현 수준을 RT-PCR을 이용해 측정하였다. 이때 GAPDH를 하우스키핑 유전자로 이용하였다. 전술된 [표 1] 에서는 골형성 연관 유전자들의 상대적 발현 수준측정에 이용한, 자세한 프라이머의 시퀀스, RT-PCR 조건 및 주기, 생성물 크기가 기재되어있다.The relative expression levels of these osteogenic genes were then measured using RT-PCR. GAPDH was used as a housekeeping gene. Table 1 above describes the detailed primer sequences, RT-PCR conditions and cycles, and product size used to determine the relative expression levels of the bone formation associated genes.
도 2f는 PZ, PZF5, PZF10 및 MTA 처리된 조골세포 및 대조군들의 골형성 연관 유전자의 발현정도를 나타낸다. 특히, PZF5를 처리한 조골세포에서 세가지 골형성 연관 유전자의 발현이 모두 상향조절된 것을 확인하였다. Figure 2f shows the degree of expression of bone formation associated genes of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. In particular, it was confirmed that the expression of all three osteogenic genes in PZF5 treated osteoblasts was upregulated.
PZ, PZF5, PZF10 및 MTA 처리된 HUVECs의 세포이동의 정도 측정Measurement of Cell Migration in PZ, PZF5, PZF10, and MTA Treated HUVECs
먼저, 2.5 × 104 (cells/well) 농도의 인간 HUVECs를 웰 플레이트 (well plate)에 3번 계대배양하였다. 배앙 24시간 후, 상기 플레이트는 플레이트의 면적의 90 % 가 세포로 채워졌다. 멸균된 바이펫 팁 (pipette tip) 을 이용하여 플레이트의 가운데 부분을 표시하였다. First, human HUVECs at a concentration of 2.5 × 10 4 (cells / well) were passaged three times in a well plate. After 24 hours of embryos, the plate was filled with cells 90% of the area of the plate. A sterile pipette tip was used to mark the middle of the plate.
그 다음 상기 세포를 포스페이트 버퍼 (phosphate-buffer) 로 세척하였다. 세척이 끝난 세포에 PZ, PZF5, PZF10 및 MTA를 처리하였다.The cells were then washed with phosphate-buffer. The washed cells were treated with PZ, PZF5, PZF10 and MTA.
상기 처리 12시간 후, 세포 이동이 유도된 세포는 현미경을 이용하여 관찰되었다. After 12 hours of treatment, cells in which cell migration was induced were observed using a microscope.
도 2g는 PZ, PZF5, PZF10 및 MTA 처리된 HUVECs 및 대조군의 세포이동의 정도를 비교하여 나타낸다. PZF5 및 MTA 처리된 HUVECs의 세포 이동 정도가 다른 군들에 비해 높은 것을 확인하였다. Figure 2g shows the degree of cell migration of PZ, PZF5, PZF10 and MTA treated HUVECs and controls. It was confirmed that the degree of cell migration of PZF5 and MTA treated HUVECs was higher than that of the other groups.
전술된 실시예 2에서 세포 생존도의 측정, 세포부착 측정, 광화능 측정, ALP 활성의 측정 및 세포이동의 정도 측정의 결과로, 후코이단을 함유한 조성물의 PZF5 및 PZF10을 처리한 조골세포는, MTA를 처리한 조골세포에 비하여 다양한 생물학적 활성이 높은 것을 확인할 수 있었다. 이에 의해 후코이단을 함유하는 조성물은 치아 경조직의 손상, 특히 치아 경조직 중 상아질의 손상에 의한 치수질환을 조기 예방하고, 치아 경조직의 활성능을 증가시킬 수 있어, 치수질환의 예방 및 치료용 조성물로 제공될 수 있다. 더 나아가, 본 발명의 일 실시예에 따른 조성물은 MTA를 치수질환의 예방 및 치료에 이용하는 것 보다 효과적일 수 있다. 또한, 후코이단을 함유한 조성물 중 PZF5가 PZF10 보다 생물학적 활성이 높았던 결과로, 본 발명의 일실시예에 따른 조성물 총 중량에 비하여 10 wt% 이하의 후코이단을 함유하는 조성물을 치수질환의 예방 및 치료용 조성물과 상아질모세포 분화 촉진 방법으로 이용하는 것이 치수질환의 예방 또는 치료의 효과에 있어 더 바람직할 수 있다. Osteoblasts treated with PZF5 and PZF10 of the composition containing fucoidan, as a result of measuring cell viability, measuring cell adhesion, measuring photooxidation, measuring ALP activity and measuring the degree of cell migration in Example 2 described above, It was confirmed that various biological activities were higher than osteoblasts treated with MTA. As a result, the composition containing fucoidan can prevent pulp disease caused by damage to dental hard tissue, especially dentin in dental hard tissue, and can increase the activity of dental hard tissue, thereby providing a composition for preventing and treating pulp disease. Can be. Furthermore, a composition according to one embodiment of the present invention may be more effective than using MTA for the prevention and treatment of pulp disease. Also, as a result of PZF5 having higher biological activity than PZF10 in a composition containing fucoidan, a composition containing 10 wt% or less of fucoidan relative to the total weight of the composition according to an embodiment of the present invention is used for the prevention and treatment of pulp disease. It may be more desirable to use the composition as a method of promoting dentinogenesis differentiation in the effect of preventing or treating pulp disease.
실시예 3: PZ, PZF5 및 PZF10의 화학적 특성Example 3: Chemical Properties of PZ, PZF5 and PZF10
PZ, PZF5 및 PZF10의 표면상태를 주사전자현미경 (FE-SEM: field emission-scanning electron microscope) 을 이용하여 촬영하였다. PZ, PZF5 및 PZF10의 원소 조성을 측정하기 위해, 에너지분산형 X-ray (EDX: energy dispersive X-ray) 분석을 수행하였다. FE-SEM을 이용한 분석은 10 kV의 전압에서 수행되었다. Surface states of PZ, PZF5 and PZF10 were photographed using a field emission-scanning electron microscope (FE-SEM). In order to determine the elemental composition of PZ, PZF5 and PZF10, energy dispersive X-ray (EDX) analysis was performed. Analysis using FE-SEM was performed at a voltage of 10 kV.
또한, PZ, PZF5 및 PZF10의 작용기 분석을 위해 전술된 FT-IR을 이용하여 파장 범위 4000 (cm-1) 내지 400 (cm-1) 에서 상기 분석을 수행하였다.In addition, the wavelength range 4000 (cm −1 ) to 400 (cm −1 ) using the FT-IR described above for the functional group analysis of PZ, PZF5 and PZF10 The analysis was performed at.
도 3a는 PZ의 표면상태를 FE-SEM 및 EDX로 분석한 결과를 나타낸다. 도 3b는 PZF5의 표면상태를 FE-SEM 및 EDX로 분석한 결과를 나타낸다. 도 3c는 PZF10의 표면상태를 FE-SEM 및 EDX로 분석한 결과를 나타낸다. 구체적으로, PZ의 표면은 PZF5 및 PZF10보다 거친 상태의 표면을 가지고 있는 것을 확인하였다. 또한, 표면 분석에서 PZF5는 원소 조성의 총중량에 비하여 3.34 wt% 의 황을, PZF10는 원소 조성의 총중량에 비하여 4.46 wt% 의 황을 포함하는 것을 알 수 있다.Figure 3a shows the results of analyzing the surface state of PZ by FE-SEM and EDX. Figure 3b shows the results of analyzing the surface state of PZF5 by FE-SEM and EDX. 3c shows the results of analyzing the surface state of PZF10 by FE-SEM and EDX. Specifically, it was confirmed that the surface of PZ had a surface rougher than PZF5 and PZF10. In addition, it can be seen from the surface analysis that PZF5 contains 3.34 wt% of sulfur relative to the total weight of the elemental composition, and PZF10 contains 4.46 wt% of sulfur relative to the total weight of the elemental composition.
도 4은 PZ, PZF5 및 PZF10의 작용기를 FT-IR로 분석한 결과를 나타낸다. PZ와 비교하여, 후코이단이 함유된 PZF5 및 PZF10에서는 특이적인 피크를 확인하였다. 4 shows the results of analyzing the functional groups of PZ, PZF5 and PZF10 by FT-IR. In comparison with PZ, specific peaks were identified in PZF5 and PZF10 containing fucoidan.
구체적으로, 약 1420 (cm-1) 의 파장에서, PZF5는 약 0.03 % 의 투과율을 나타내고, PZF10는 약 0.075 % 의 투과율을 나타낸다. 약 1420 (cm-1) 의 파장에서 피크를 나타내는 것은 "COO-" 의 작용기를 가지고 있는 것을 의미할 수 있다. Specifically, at a wavelength of about 1420 (cm −1 ), PZF5 exhibits a transmission of about 0.03% and PZF10 exhibits a transmission of about 0.075%. Representing a peak at a wavelength of about 1420 (cm −1 ) may mean having a functional group of “COO-”.
또한, 약 874 (cm-1) 의 파장에서 PZF5는 약 0.03 % 의 투과율을 나타내고, PZF10는 약 0.06 %의 투과율을 나타낸다. 약 874 (cm-1) 의 파장에서 피크를 나타내는 것은 "C-O-S" 의 작용기를 가지고 있는 것을 의미하며, PZF5 및 PZF10의 후코이단의 포함 의미하는 결과일 수도 있다. In addition, approximately 874 (cm-One) PZF5 exhibits a transmittance of about 0.03% at a wavelength of PZF10 and a transmittance of about 0.06%. Approximately 874 (cm-One) The peak at the wavelength of is meant to have a functional group of "C-O-S", which may be a result of inclusion of fucoidans of PZF5 and PZF10.
더 나아가, 약 1252 (cm-1) 의 파장에서 PZF5는 약 0.015 % 의 투과율을 나타내고, 약 1236 (cm-1) 의 파장에서 PZF10는 약 0.02 %의 투과율을 나타낸다. 약 1252 (cm-1) 및 1236 (cm-1) 의 파장 에서 피크를 나타내는 것은 "S=O 신축진동 (S=O stretching vibration)" 의 작용기를 가지고 있는 것을 의미할 수 있다.Furthermore, about 1252 (cm -1 ) PZF5 exhibits a transmission of about 0.015% at a wavelength of and PZF10 exhibits a transmission of about 0.02% at a wavelength of about 1236 (cm −1 ). About 1252 (cm -1 ) And showing a peak at a wavelength of 1236 (cm −1 ) may mean having a functional group of “S═O stretching vibration”.
이상의 실시예 2의 결과로, 본 발명의 일 실시예에 따른 조성물은 후코이단의 포함 유무에 따라, 화학적 특성의 차이가 나타나는 것으로 확인되었다. 더 나아가, 실시예 3의 방법으로 상기 조성물에 후코이단 포함 유무에 대한 정보를 제공할 수 있다. As a result of Example 2, the composition according to an embodiment of the present invention, it was confirmed that the difference in the chemical properties depending on the presence or absence of fucoidan. Furthermore, the method of Example 3 may provide information on the presence or absence of fucoidan in the composition.
이상 첨부된 도면을 참조하여 본 발명의 실시예들을 더욱 상세하게 설명하였으나, 본 발명은 반드시 이러한 실시예로 국한되는 것은 아니고, 본 발명의 기술사상을 벗어나지 않는 범위 내에서 다양하게 변형 실시될 수 있다. 따라서, 본 발명에 개시된 실시예들은 본 발명의 기술 사상을 한정하기 위한 것이 아니라 설명하기 위한 것이고, 이러한 실시예에 의하여 본 발명의 기술 사상의 범위가 한정되는 것은 아니다. 그러므로, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. 본 발명의 보호 범위는 아래의 청구범위에 의하여 해석되어야 하며, 그와 동등한 범위 내에 있는 모든 기술 사상은 본 발명의 권리범위에 포함되는 것으로 해석되어야 할 것이다.Although the embodiments of the present invention have been described in more detail with reference to the accompanying drawings, the present invention is not necessarily limited to these embodiments, and various modifications can be made without departing from the spirit of the present invention. . Therefore, the embodiments disclosed in the present invention are not intended to limit the technical idea of the present invention but to describe the present invention, and the scope of the technical idea of the present invention is not limited by these embodiments. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive. The protection scope of the present invention should be interpreted by the following claims, and all technical ideas within the equivalent scope should be interpreted as being included in the scope of the present invention.
Claims (13)
- 후코이단 및 수경성 결합재를 포함하는, 치수질환의 예방 및 치료용 조성물.A composition for preventing and treating pulp diseases, comprising fucoidan and a hydraulic binder.
- 제1항에 있어서,The method of claim 1,상기 후코이단은 상기 조성물의 총중량에 대해 5 wt% 내지 10 wt% 인, 치수질환의 예방 및 치료용 조성물.The fucoidan is 5 wt% to 10 wt% with respect to the total weight of the composition, the composition for the prevention and treatment of pulp disease.
- 제1항에 있어서,The method of claim 1,상기 수경성 결합재는 천연 포틀랜드 시멘트, 포틀랜드계 시멘트, 혼합시멘트 및 특수시멘트 및 이들의 조합으로 이루어진 군에서 선택된 하나를 포함하는, 치수질환의 예방 및 치료용 조성물.The hydraulic binder includes one selected from the group consisting of natural portland cement, portland cement, mixed cement and special cement, and combinations thereof, the composition for preventing and treating pulp diseases.
- 제1항에 있어서,The method of claim 1,상기 치수질환은 치수충혈, 치수염, 치수변성, 치수의 괴사, 치근단 병변 및 치아우식증 및 이들의 조합으로 이루어진 군에서 선택된 하나를 포함하는, 치수질환의 예방 및 치료용 조성물.The pulp disease comprises one selected from the group consisting of pulp red blood, pulpitis, pulp degeneration, pulp necrosis, root root lesion and dental caries, and combinations thereof, the composition for the prevention and treatment of pulp disease.
- 제1항에 있어서,The method of claim 1,상기 조성물은 방사선 조영제를 더 포함하는, 치수질환의 예방 및 치료용 조성물.The composition further comprises a radiographic agent, the composition for the prevention and treatment of pulp disease.
- 제5항에 있어서,The method of claim 5,상기 조영제는 비스무스 옥사이드 (bismuth oxide), 비스무스 카보네이트 (bismuth carbonate), 스트론튬 카보네이트 (strontium carbonate), 스트론튬 포스페이트 (strontium phosphate), 바륨 설페이트 (barium sulfate), 탄탈륨 옥사이드 (tantalum oxide), 세륨 옥사이드 (cerium oxide), 틴 옥사이드 (tin oxide) 및 지르코늄 옥사이드 (zirconium oxide) 및 이들의 조합으로 이루어진 군에서 선택된 하나를 포함하는, 치수질환의 예방 및 치료용 조성물.The contrast agent is bismuth oxide, bismuth carbonate, strontium carbonate, strontium phosphate, barium sulfate, tantalum oxide, cerium oxide ), Tin oxide and zirconium oxide (zirconium oxide) and a combination comprising one selected from the group consisting of, prevention and treatment of pulp disease.
- 제5항에 있어서,The method of claim 5,상기 조영제는 상기 조성물의 총중량에 대해 20 wt% 내지 40 wt% 인, 치수질환의 예방 및 치료용 조성물.The contrast agent is 20 wt% to 40 wt% with respect to the total weight of the composition, the composition for the prevention and treatment of pulp disease.
- 제1항에 있어서,The method of claim 1,상기 조성물은 경화 개시시간이 100분 이하인, 치수질환의 예방 및 치료용 조성물.The composition is a curing start time of 100 minutes or less, the composition for the prevention and treatment of pulp disease.
- 제1항에 있어서,The method of claim 1,상기 조성물은 경화 종결시간이 250분 이하인, 치수질환의 예방 및 치료용 조성물.The composition has a curing termination time of 250 minutes or less, the composition for the prevention and treatment of pulp disease.
- 제1항에 있어서,The method of claim 1,상기 조성물은 1350 (cm-1) 내지 1450 (cm-1) 의 파장에서 0.03 % 이상의 투과율을 가지는, 치수질환의 예방 및 치료용 조성물.The composition has a transmittance of 0.03% or more at a wavelength of 1350 (cm -1 ) to 1450 (cm -1 ), the composition for preventing and treating pulp diseases.
- 제1항에 있어서,The method of claim 1,상기 조성물의 광화능은 MTA (mineral trioxide aggregate) 에 비하여 적어도 1.8 배인, 치수질환의 예방 및 치료용 조성물.The photocatalytic ability of the composition is at least 1.8 times higher than that of MTA (mineral trioxide aggregate), the composition for the prevention and treatment of pulp disease.
- 제1항에 있어서,The method of claim 1,상기 조성물이 처리된 후 7일이 지난 세포는 MTA가 처리된 후 7일이 지난 세포에 비하여 적어도 2 배의 ALP (alkaline phosphatase) 활성을 갖는, 치수질환의 예방 및 치료용 조성물.Cells 7 days after the treatment of the composition has at least twice the ALP (alkaline phosphatase) ALP activity compared to cells 7 days after the MTA treatment, the composition for preventing and treating pulp disease.
- 제1항 내지 제12항 중 어느 한 항에 기재된 조성물을 치수에 위치시키는 단계를 포함하는, 상아질모세포 분화 촉진 방법.A method for promoting dentinogenesis differentiation, comprising the step of placing the composition of any one of claims 1 to 12 in dimensions.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020160109991A KR101829994B1 (en) | 2016-08-29 | 2016-08-29 | Compositions for preventing and treating of endodontic disease |
KR10-2016-0109991 | 2016-08-29 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2018043932A1 true WO2018043932A1 (en) | 2018-03-08 |
Family
ID=61301283
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2017/008437 WO2018043932A1 (en) | 2016-08-29 | 2017-08-04 | Composition for preventing and treating dental pulp disease |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR101829994B1 (en) |
WO (1) | WO2018043932A1 (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101932973B1 (en) | 2018-10-12 | 2018-12-27 | 성보경 | Composition for prevention and improvement of periodontal disease or periodontal disease |
KR102265378B1 (en) | 2018-10-12 | 2021-06-16 | 단국대학교 천안캠퍼스 산학협력단 | Method of manufacturing an implant for regenerating dental tissue |
KR102179902B1 (en) * | 2019-08-08 | 2020-11-17 | 단국대학교 천안캠퍼스 산학협력단 | Scaffolds for differentiation of odontoblast and method for differentiation of odontoblast using the same |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4647600A (en) * | 1985-04-05 | 1987-03-03 | G-C Dental Industrial Corp. | Dental cement compositions |
KR20090112473A (en) * | 2008-04-24 | 2009-10-28 | 장성욱 | Pozzolan cement for dental treatment |
KR20150100446A (en) * | 2014-02-25 | 2015-09-02 | 주식회사 마루치 | Dental hydraulic filler composition of single paste type |
JP2016065102A (en) * | 2007-02-09 | 2016-04-28 | デンツプライ インターナショナル インコーポレーテッド | Dental composition |
-
2016
- 2016-08-29 KR KR1020160109991A patent/KR101829994B1/en active IP Right Grant
-
2017
- 2017-08-04 WO PCT/KR2017/008437 patent/WO2018043932A1/en active Application Filing
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4647600A (en) * | 1985-04-05 | 1987-03-03 | G-C Dental Industrial Corp. | Dental cement compositions |
JP2016065102A (en) * | 2007-02-09 | 2016-04-28 | デンツプライ インターナショナル インコーポレーテッド | Dental composition |
KR20090112473A (en) * | 2008-04-24 | 2009-10-28 | 장성욱 | Pozzolan cement for dental treatment |
KR20150100446A (en) * | 2014-02-25 | 2015-09-02 | 주식회사 마루치 | Dental hydraulic filler composition of single paste type |
Also Published As
Publication number | Publication date |
---|---|
KR101829994B1 (en) | 2018-03-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2018043932A1 (en) | Composition for preventing and treating dental pulp disease | |
RU2241489C2 (en) | Matrix protein compositions for healing wound | |
JP5024866B2 (en) | Matrix protein composition for wound healing | |
JP2007291115A6 (en) | Matrix protein composition for wound healing | |
BRPI9710372B8 (en) | compound, and, pharmaceutical composition. | |
Miyaji et al. | Comparative biological assessments of endodontic root canal sealer containing surface pre-reacted glass-ionomer (S-PRG) filler or silica filler | |
WO2019177312A1 (en) | Dual-functional peptide having ability to reduce inflammation and ability to promote differentiation from stem cells to chondrocytes and use thereof | |
KR102277147B1 (en) | Use of peptides derived from fibroblast growth factor to promote osteogenic or chondrogenic differentiation | |
Qiu et al. | SrCuSi4O10/GelMA Composite Hydrogel‐Mediated Vital Pulp Therapy: Integrating Antibacterial Property and Enhanced Pulp Regeneration Activity | |
JPH04211019A (en) | Use of thrombospondine for accelerating wound healing | |
WO2011105869A2 (en) | Dental cleanser composition for improving the properties of adhering to teeth | |
WO2022019701A1 (en) | Anti-adhesion polymer composition | |
WO2023158092A1 (en) | Pharmaceutical compositions for hemostasis and wound healing in gastrointestinal tract | |
Gopika et al. | Histological evaluation of human pulp capped with light-cured calcium based cements: a randomized controlled clinical trial | |
WO2021101311A1 (en) | Wound dressing material for hemostasis and wound treatment, and method for preparing same | |
WO2021256751A1 (en) | Composition comprising fibroblast-derived extracellular vesicle as active ingredient for treating skin and mucosal wound | |
Pedrosa et al. | Response of periodontal ligament stem cells to lipopolysaccharide and calcium silicate-based materials | |
HUP9701016A2 (en) | Use of theophilline derivatives for the preparation of pharmaceutical compositions treating shock, new xantine compounds, process for producing them and pharmaceutical compositions containing them | |
WO2023172004A1 (en) | Peptide having restorative dentin regeneration activity and use thereof | |
WO2020067774A1 (en) | Synovium-derived mesenchymal stem cells and use thereof | |
Sulistyowati | Histone deacetylase inhibitor induces the odontogenic differentiation in human dental pulp cells: Comparison of trichostatin a (TSA) and suberoylanilide hydroxamic acid (SAHA) | |
WO2016175548A1 (en) | Anti-adhesion agent containing natural biocompatible polymer and dna fragment mixture, and preparation method therefor | |
WO2022138993A1 (en) | Composition for treating wound comprising dermal tissue-derived extracellular matrix and method for preparing same | |
WO2019112291A1 (en) | Composition for treating joint diseases or connective tissue diseases, containing dextran or poloxamer | |
WO2021215891A1 (en) | Hepatic regeneration promoting composition comprising 6-o-trans-feruloyl catalpol as active ingredient |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17846857 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 17846857 Country of ref document: EP Kind code of ref document: A1 |