WO2018043932A1 - Composition for preventing and treating dental pulp disease - Google Patents

Abstract

The present invention provides a composition for preventing and treating a dental pulp disease. The pharmaceutical composition for preventing and treating a dental pulp disease according to an embodiment of the present invention reduces a curing start time and a curing finish time, is effective for increasing mineralization ability and ALP activity, and can thereby be used for preventing and treating a dental pulp disease.

Description

Composition for prevention and treatment of pulp disease

The present invention relates to a composition for preventing and treating pulp diseases, and more particularly, a composition for preventing and treating pulp diseases that can increase the activity of dental hard tissues while shortening the curing time of materials and differentiating dentin cells using such compositions. It is about a promotion method.

The dental pulp is a soft connective tissue that fills the pulp cavity inside the tooth and is rich in nerves and blood vessels. The nerves of the pulp make up the plexus in the dentin cells in contact with the inner surface of the dental dentin of the outermost pulp, and the branches reach the dentin superficial layer.

The pulp forms a complex with the dentin, which is responsible for the regeneration and healing of the dentin (hemorrhoids). However, if the dentin is damaged by caries, trauma, etc., pulp inflammatory reaction or tissue damage can easily occur, and as a result, pulp disease is more likely to be caused. Therefore, it is important to prevent pulp disease caused by damage to the hard tissue of the tooth, particularly dentin in the hard tissue of the tooth, and to prevent irreversible tissue damage.

Accordingly, in the prevention of pulp tissue damage and treatment of pulp tissue that has undergone reversible damage, development of components for preventing and treating pulp disease excellent in biological safety and protection of pulp cells and suppressing oxidative damage is required.

The background art of the invention has been created to facilitate understanding of the present invention. It should not be understood that the matters described in the background of the invention exist as prior art.

When the remaining dentin thickness of patients with damaged pulp is thin or pin-point bleeding occurs without pulp infection, pulp capping can protect the pulp tissue. MTA (mineral trioxide aggregate) can be used. MTA is composed of tricalcium silicate, tricalcium aluminate, tricalcium oxide, and silicate oxide, and is a hydrophilic fine powder that cures within 4 hours when contacted with moisture. , PH after curing is about 12.5.

In addition, MTA has a relatively high stability after curing, not only induces dentin bridge formation, but also maintains a monocaloric pH to remove bacteria that may be present in the demodulated dimensions.

However, in the treatment of pulp disease using MTA, high alkaline pH during initial hydration is accompanied by significant initial cytotoxicity, and has a disadvantage of long curing time.

In addition, the fact that MTA is a relatively expensive dental material and has sandy consistancy in the stirring process has been pointed out as a major disadvantage in using MTA as a treatment for pulp disease.

The inventors of the present invention have searched for materials that are safe for the human body in connection with the prevention and treatment of pulp disease, and the above-mentioned disadvantages have been achieved through the use of the hydraulic binder and the brown algae-derived polysaccharide with viscosity. It was recognized that it could be supplemented.

Accordingly, the inventors of the present invention have focused on the use of fucoidan, which is rich in nutrients such as essential minerals and vitamins, which are beneficial to the human body, such as calcium and iodine, and which has high physiological activity, among polysaccharides derived from brown algae.

The problem to be solved by the present invention is to provide a composition for the prevention and treatment of pulp diseases that shorten the curing time and contribute to bone formation.

The objects of the present invention are not limited to the above-mentioned objects, and other objects that are not mentioned will be clearly understood by those skilled in the art from the following description.

According to one embodiment of the invention, there is provided a composition for preventing and treating pulp disease, comprising fucoidan and hydraulic binder.

However, without being limited thereto, more various polysaccharides together with fucoidan may be provided as a composition for preventing and treating pulp diseases. For example, the polysaccharide is cellulose, alkyl cellulose, alkyl hydroxyalkyl cellulose, hydroxyalkyl cellulose, cellulose sulfate, salt of carboxymethyl cellulose, carboxymethyl cellulose, carboxyethyl cellulose, chitin, carboxymethyl chitin, hyaluronic acid, hyaluronic acid Salts of lonic acid, alginates, alginic acids, propylene glycol alginates, glycogen, dextran, dextran sulfate, curdlan, pectin, pullulan, xanthan, chondroitin sulfate, chondroitin sulfate, carboxymethyl dextran, Carboxymethyl Chitosan, Chitosan, Heparin, Heparin Sulfate, Heparan, Heparan Sulfate, Dermatan Sulfate, Keratan Sulfate, Carrageenan, Chitosan, Starch, Amylose, Amylopectin, Poly-N-Glucosamine, Polymannuronic Acid ( polymannuronic acid, polyglucuronic acid, poly Gulru may be one derived from at least one polysaccharide selected from the group consisting of acid (polyguluronic acid), and derivatives of said polysaccharides. Preferably, the polysaccharide may be a polysaccharide having a sulfate group. Or in various embodiments, the composition for the prevention and treatment of pulp disease may be configured to include one or more of the various polysaccharides described above, not fucoidan.

As used herein, the term "fucoidan" refers to a sulfated polysaccharide having a sticky viscous structure, and is generally contained in brown algae such as seaweed and kelp, and has an average molecular weight of 20 kDa. It may be a substance in which sugar and sulfate groups are combined. Fucoidan can be specifically obtained from marine brown algae such as sugar kelp (Laminaria saccharina), L. digitata, Fucus distichus, and Okinawa mozuku (Cladosiphon okamuranus).

As used herein, the term "hydraulic" refers to a property that various cements react with water or an aqueous solution to produce hydrates with low solubility to cure. As the hydraulic binder, hydraulic cement may be used. For example, portland cement, portland cement, mixed cement, and special cement can be used for hydraulic cement. Preferably, using portland cement as a hydraulic binder may be excellent in biocompatibility, but various materials may be used as the hydraulic binder, without being limited thereto.

In providing the fucoidan and hydraulic binder described above as a composition for preventing and treating pulp diseases, the hydraulic binder may be included in an amount of 15 wt% to 55 wt% based on the total weight of the composition.

For example, if the hydraulic binder is 15 wt% or less relative to the total weight of the composition, the curing time may be too long due to the low viscosity in the dimensional treatment where it is important to immediately temporarily restore the pulp portion.

In addition, when the hydraulic binder is a composition having 55 wt% or more relative to the total weight of the composition, the viscosity may be difficult to operate due to the high viscosity, so that the hydraulic binder may be included at 55 wt% or less relative to the total weight of the composition. have.

Furthermore, maintaining the average particle size (D50) of the hydraulic binder below 3 μm is desirable for manipulating the binder and maintaining high biological activity.

The hydraulic binder may further contain calcium oxide, calcium hydroxide and calcium chloride. In particular, calcium chloride may be involved in shortening the curing time of the hydraulic binder, and may improve biocompatibility and sealability.

The hydraulic binder may serve to impart strength and durability in the composition for preventing and treating pulp diseases.

As used herein, the term "dimension disease" refers to a lesion occurring in the dimensions of a tooth. For example, pulp disease may include pulp redness, pulpitis, pulp degeneration, necrosis of pulp, root root lesion and dental caries.

 Compositions for the prevention and treatment of pulp diseases can be used without limitation to treat pulp damage, pulpitis pulp degeneration, pulp necrosis, apical lesions and dental caries caused by dental caries. However, without limitation to the lesions described above, the compositions can be used to treat or prevent a wide variety of diseases.

As used herein, the term "prevention" may refer to any action that inhibits or delays the development of pulp disease by administration of the composition, and "treatment" means that symptoms of pulp disease are improved by administration of the composition. It can mean any action that is beneficially changed. Specifically, the composition can prevent or treat pulp disease by promoting the regeneration of pulp by effectively forming dentin glia and promoting the differentiation of dentin blasts in the pulp space due to pulp disease.

 The composition can be used in methods of treating pulp. Specifically, the treatment method includes the direct pulp demodulation described above. However, the treatment method is not the same, but various treatment methods for the pulp, for example, apexification, barrier technique, indirect pulp capping, pulpotomy, and apical resection (pulpectomy), induction of hard tissue formation around the apical tip, guided bony regeneration (GBR) and perforation repair (perforation repair).

Preferably, when the dental nerves are exposed, the composition is applied to damaged nerves to aid in healing and to prevent secondary infection, when used in direct pulp demodulation, which can effectively treat pulp disease.

 The composition may further comprise a drug capable of modulating the regeneration and inflammatory response of the pulp-dentin complex. For example, drugs include histone deacetylases inhibitors, antioxidants, anti-inflammatory agents whose main action is inhibition of phospholipases and cyclooxygenases, Wnt signaling regulators and antibiotics. can do. Specifically, additional drugs include trichostatin A, butyrate, valproic acid, apicidin; N-acetyl cysteine; Aspirin, tylenol, ibuprofen, diclofenac, indomethacin, ketoprofen, voltaren, feldene, mobic; Penicillin, cephalosporin, kanamycin, gentamycin, gentamicin, sisomycin, erythromycin, vancomycin, icoplanin, quinolone ), Isoxazole derivative and lithium chloride (lithium chloride) may be one or more drugs selected from the group consisting of.

In addition, the composition may further comprise a non-aqueous liquid. Properties of the non-aqueous liquid may be hygroscopic, biocompatible, storage stability, hygroscopic, surfactant and easily mixed with water. With the properties described above, the non-aqueous liquid may be involved in the pasting of the hydraulic binder. It may be desirable for the non-aqueous liquid to contain only minimal moisture at a level that does not substantially contain water or cause curing to react with the hydraulic binder to cause the hydration reaction. Specifically, it may be preferable that the non-aqueous liquid is included by 15 wt% to 35 wt% with respect to the total weight of the composition.

For example, non-aqueous liquids include N-methyl-2-pyrrolidone (NMP), polyoxyethylene sorbitan monolaurate, dimethyl isosorbide ), Diethylene glycol dimethyl ether (diethylene glycol dimethyl ether) and butylene glycol (butylene glycol) may include one or more selected from the group consisting of.

The fucoidan in the composition according to an embodiment of the present invention may be 5 wt% to 10 wt% with respect to the total weight of the composition.

As used herein, the term "gross weight" may refer to the weight of the entire composition for preventing and treating pulp diseases including fucoidan and hydraulic binder.

The fucoidan may be included by 5 wt% to 10 wt% with respect to the total weight of the composition.

Preferably, when 10 wt% or less of fucoidan, based on the total weight of the composition, is included as a composition for preventing and treating pulp diseases, biological activity may be maximized. The biological activity may mean physiological or pharmacological activity, but is not limited thereto. For example, the biological activity may be osteogenic activity, antiviral activity, cell proliferation inducing activity, cell adhesion enhancing activity, antifungal activity, body stability, antioxidant activity, anti-inflammatory activity, immunosuppressive activity and hemostatic. However, the present invention is not limited thereto, and the composition for preventing and treating pulp diseases including fucoidan of 10 wt% or less based on the total weight of the composition may have various biological activities.

In addition, the composition for the prevention and treatment of pulp disease, including fucoidan of 10 wt% or less relative to the total weight of the composition can induce an increase in cell proliferation and cell cycle associated proteins FAK and PI3K-Akt, and induces improved cell adhesion can do.

With the biological activity described above, the composition can be applied for the prevention and treatment of diseases. Preferably, it can be used as a composition for the prevention and treatment of pulp disease.

The hydraulic binder in the composition according to an embodiment of the present invention may include one selected from the group consisting of natural portland cement, portland cement, mixed cement and special cement, and combinations thereof.

As used herein, the term “natural portland cement” may be a cement having calcium silicate as the hydraulic main mineral.

For example, the natural portland cement may be one cement selected from the group consisting of ordinary portland cement, medium heat portland cement, crude steel portland cement, crude steel portland cement and sulfate resistant portland cement, and combinations thereof.

As used herein, the term "portland cement" may refer to a cement of a series such as Portland cement.

For example, the portland cement may be one cement selected from the group consisting of white portland cement, well cement and clad cement, and combinations thereof.

As used herein, the term "mixed cement" may be cement made by combining pozzolanic or quenched blast furnace slag with clinker of Portland cement and applying gypsum.

For example, the mixed cement may be one cement selected from the group consisting of blast furnace cement, fly ash cement, silica cement, ultra low heat cement, geothermal cement and RCCP cement, and combinations thereof.

As used herein, the term "special cement" may refer to cement other than the natural portland cement, portland cement, and mixed cement described above, and may refer to cement used for a specific purpose.

For example, the special cement may be one cement selected from the group consisting of alumina cement, cemented carbide and GRC low alkali cement, and combinations thereof.

The pulp disease in the composition according to an embodiment of the present invention, the pulp disease may comprise one selected from the group consisting of pulp red blood, pulpitis, pulp degeneration, pulp necrosis, anterior root lesion and dental caries and combinations thereof have.

As used herein, the term "dimensional congestion" may mean congestion in which blood vessels of the pulp are first expanded when physical, chemical or bacterial stimuli are applied to the pulp, but are not limited thereto. Induce redness.

As used herein, the term "dentitis" may mean inflammation caused by the expansion of blood vessels in the pulp initially when physical, chemical or bacterial stimuli are applied, but are not limited thereto, and various stimuli may induce pulpitis. Can be.

As used herein, the term "dimension degeneration" may mean that a degenerative or atrophic change occurs due to aging even without the change or stimulus caused by the aforementioned stimulus.

As used herein, the term "dimension necrosis" may refer to a disease in which pulp tissue necrosis when a circulatory disorder occurs due to inflammation or the like.

As used herein, the term "root root lesion" may mean a lesion around the root root, and the root root lesion may be induced by bacteria.

As used herein, the term "teeth caries" may refer to an infectious disease caused by bacteria that inhabit the tooth surface.

Specifically, the composition for preventing and treating pulp diseases according to one embodiment may regenerate the pulp-dentin complex in the exposed pulp due to the pulp disease described above. In addition, the compositions can be operated around empty pulp cavity or other pathologically damaged tissue from which lesion dimensions of patients with pulp degeneration, pulp necrosis and pulp of pulp are removed.

In addition, the content of the composition for the prevention and treatment of pulp disease may include the type of disease, the severity of the disease, the amount of other components contained in the composition, the type of formulation, and the age, body weight, general state of health, sex and diet, administration of the patient. It can be adjusted according to various factors including time, route of administration and rate of release of the composition, duration of treatment, and drugs used simultaneously.

The subject of the method of treatment using the composition for preventing or treating pulp disease may be a mammal other than a human.

The composition according to an embodiment of the present invention may further include a radiographic contrast agent.

As used herein, the term "radiocontrast" means that the radiocontrast imparts radiopacity to enable observation of the material in the radiograph and may impart sufficient opacity to distinguish it from dentin.

In the composition according to an embodiment of the present invention, the radiographic agent is bismuth oxide, bismuth carbonate, strontium carbonate, strontium phosphate, barium sulfate, Tantalum oxide, cerium oxide, tin oxide and zirconium oxide, and combinations thereof.

However, the present invention is not limited thereto, and more various materials may be used as the radiographic contrast agent. Preferably, the radiographic agent may be used bismuth oxide and zirconium oxide, more preferably may be to use bismuth oxide.

In the composition according to an embodiment of the present invention, the radiographic contrast agent may be 20 wt% to 40 wt% with respect to the total weight of the composition.

However, the present invention is not limited thereto and the contrast agent may be included in more various weight ratios with respect to the entire composition. Preferably, in providing a composition for preventing and treating pulp disease, the radiographic contrast agent may be included by 20 wt% to 30 wt% based on the total weight of the composition. Specifically, if the content of the radiocontrast is less than 20 wt% with respect to the total weight of the composition, there may be a problem in radiopacity. In addition, when the content of the radiographic contrast agent exceeds 40 wt% with respect to the total weight of the composition, problems such as curing delay may occur by reducing the content of the hydraulic binder.

In addition, the content of the hydraulic binder and the radiocontrast in the present invention may be correlated with each other. When the content of the hydraulic binder is high, the low content of the radiocontrast may maintain the appropriate clinical efficiency of the composition. That is, when both the hydraulic binder and the radiocontrast are high in content, the powder component may be excessive and complete curing may be delayed. In view of the foregoing, it may be desirable to adjust the sum of the weights of the hydraulic binder and the radiocontrast not to exceed 70 wt% relative to the total weight of the composition.

The composition according to an embodiment of the present invention may have a curing start time of 100 minutes or less.

As used herein, the term "curing onset time" may mean a time that is considered to be the onset of condensation of the composition.

Fucoidan may be involved in shortening the curing start time of the composition. In addition, the curing start time of the composition may be dependent on the concentration of fucoidan. Furthermore, the measurement of curing initiation time can be performed according to the methodology proposed by the American Society for Testing and Materials (ASTM) and the International Organization for Standardization (IOS), specifically, Vicat needles and Gilmore needles can be used. However, the present invention is not limited thereto, and the curing start time of the composition can be measured by various methods and various devices.

After the composition has been applied to the dentin, shortening the curing initiation time may be more important than shortening the curing termination time in the pulp treatment, since the exposed pulp portion may be temporarily temporarily restored.

The composition according to an embodiment of the present invention may have a curing termination time of 250 minutes or less.

As used herein, the term "curing termination time" may mean a time when the condensation of the composition is completed.

Fucoidan may be involved in shortening the curing start time of the composition. In addition, the curing termination time of the composition may be dependent on the concentration of fucoidan. As mentioned above, the combined curing start time and curing end time may be the curing time.

Furthermore, the measurement of curing end time was performed according to the methodology proposed by the American Society for Testing and Materials (ASTM), specifically, the Vicat needle opparatus and Gilmore needle device (Gilmore). needle opparatus) may be used. However, the present invention is not limited thereto, and the curing termination time of the composition may be measured by various methods and various devices.

The composition according to an embodiment of the present invention may have a transmittance of 0.03% or more at a wavelength of 1350 (cm ⁻¹ ) to 1450 (cm ⁻¹ ).

As used herein, the term "transmittance" may refer to a specific peak value of the functional group.

The transmittance may analyze chemical compositions of a sample using Fourier-transformed infrared spectroscopy (FT-IR), but is not limited thereto. can do.

Specifically, the composition is 1420 ^- may have more than 0.03%, the transmittance at a wavelength (cm ^1). The composition 1420 (cm ^{- 1)} It represents the transmittance in a wavelength can mean that contains a functional group of "COO-".

The catalyst composition is useful, 1220 (cm ^-1) to 1270 (cm ^{- 1)} in the wavelength can have a transmittance of 0.01% or greater. The composition 1220 (cm ^-1) to 1270 (cm ^{- 1)} It represents the transmittance at a wavelength of can mean that contains a functional group of "S = O".

Moreover, the composition 860 (cm ^-1) to 880 (cm ^{- 1)} may have a transmittance of 0.01% or greater in the wavelength. The 860 (cm ^-1) to 880 (cm ^{- 1)} is intended to represent the transmittance at the wavelength of the can means, which includes a functional group of "COS", preferably, may mean that which contains fucoidan .

The composition according to an embodiment of the present invention may have at least 1.8 times mineralization compared to MTA.

For example, in a composition according to one embodiment the cells treated with the composition may have at least 1.8 times the mineralization of the cells treated with the MTA, such that the biological activity of the cells treated with the composition is MTA It may mean higher than the treated cells. Specifically, high biological activity may mean high bone formation ability, but is not limited thereto, and the cells treated with the composition may be interpreted as having higher biological activity than MTA treated cells.

As used herein, the term "MTA" means an inorganic trioxide aggregate. MTA can be used for dimensional demodulation. When MTAs are used in dimensional demodulation, they can be expensive compared to other dental materials and can be difficult to manipulate by a user. In addition, MTA may be soluble in body fluids and may lack activity to induce dentin or bone tissue formation.

The "cells" can be osteoblasts. However, the present invention is not limited thereto, and more various cells can be treated with the composition and the MTA.

As used herein, the term "photooxidation ability" means the ability to produce minerals. Specifically, the photoenhancement may be a process in which a substance is changed from organic to inorganic by mineral ion deposition and formation of mineral crystals, which may be a mechanism necessary for making hard tissues of the body. Teeth are complex tissues consisting of soft and hard tissues. Hard tissue, consisting of enamel, dentin, chalk, and alveolar bone, provides the overall structure of the tooth and is associated with the functioning tooth. Hard tissues of these teeth are formed by mineralization such as enamel formation, odontogenesis, cementogenesis and osteogenicity. Mineralization can play an important role in differentiation mechanisms in tooth development and stem regeneration based on stem cells.

The photosensitivity can be measured by Alizarin red staining method, quantitative analysis of Alizarin red, alkaline phosphatase (ALP) activity and RT-PCR (real time-PCR). However, the present invention is not limited thereto, and the photooxidation power may be measured by more various methods. In addition, the alizarin red staining can show the formation of minerals, induced into the composition.

Furthermore, when the fucoidan of 10 wt% or less with respect to the total weight of the composition is included as a composition for the prevention and treatment of pulp disease, the photochemical ability can be maximized. That is, it may mean that the biological activity of the composition under the aforementioned conditions is maximized.

In addition, in the prevention and treatment of pulp disease, the use of the composition having a relatively high photochemical ability may have a higher effect of preventing and treating pulp disease than using MTA.

In the composition according to an embodiment of the present invention, cells 7 days after the treatment of the composition may have at least twice the ALP (alkaline phosphatase) activity compared to cells 7 days after the treatment of the MTA.

However, without being limited thereto, even before 7 days of the composition and MTA treatment, the composition-treated cells may have a relatively higher ALP activity than MTA-treated cells.

As used herein, the term "ALP activity" refers to the activity of alkaline phosphatase. ALP can be located on the osteoblast membrane and can be used as a marker of biomineralization. However, the present invention is not limited thereto, and various markers may be used as markers of bioluminescence. For example, TRAP, OPG, CatK, RANK, RANKL, Osteocalcin, IL-6, DKK-1, MMP-8, TIMP-1, tPA, PAI-2, Cathepsin, bone sialoprotein (BSP) ), Markers from the TGF-β superfamily, bone morphogenetic proteins (BMPs), sclerostin and noggin, etc. can be used as markers of bioluminescence.

ALP can increase the ALP activity as it unspecifically decomposes phosphate ions in the compound and the mineral crystals become larger. For this reason, the measurement of ALP activity may be one of the methods of measuring photosensitivity. In this case, p-nitrophenyl phosphate (p-nitrophenyl phosphate) can be used as a substrate to measure the ALP activity. Specifically, high ALP activity may mean that the expression of a gene related to bone formation is increased.

According to one embodiment, the cells 7 days after the composition is treated have at least twice as much ALP as the cells treated with the MTA than the cells treated with the MTA, indicating that the biological activity of the cells treated with the composition is higher than the cells treated with the MTA. can do. Specifically, it may mean that the bone formation ability is relatively high, but is not limited thereto and may be interpreted as having a higher variety of biological activities.

When fucoidan of 10 wt% or less with respect to the total weight of the composition is included as a composition for the prevention and treatment of pulp disease, ALP activity can be maximized. That is, it may mean that the biological activity of the composition under the aforementioned conditions is maximized.

In addition, in the prevention and treatment of pulp disease, the use of the composition having a relatively high photochemical ability may have a higher effect of preventing and treating pulp disease than using MTA.

According to one embodiment of the invention, there is provided a method for promoting dentinocyte differentiation, comprising positioning a composition comprising fucoidan and a hydraulic binder in the dimensions of an animal other than a human.

For example, when the dentin hair differentiation promoting method is applied to damaged dimensions, dentin bridges can be effectively formed and differentiation of dentin hair cells can be promoted. As a result, the regeneration of pulp can be promoted, so that the method for promoting dentinocyte differentiation according to an embodiment of the present invention can be used to prevent or treat pulp disease.

In the method of promoting odontoblast differentiation according to an embodiment of the present invention, the composition may further include a radiographic contrast agent. However, the present invention is not limited thereto, and may include more various additives. For example, the additive may be a drug that the composition described above can modulate the regeneration and inflammatory response of the pulp-dentin complex.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are only for illustrating the present invention by way of example, and the scope of the present invention should not be construed as being limited by these examples.

The composition for preventing and treating pulp disease according to an embodiment of the present invention shortens the curing start time and the curing stop time, and exhibits the effect of increasing the photooxidative activity and ALP activity, and as a result, the activity of the dental hard tissue is increased, This can be used to prevent and treat pulp disease.

In addition, the composition according to an embodiment of the present invention may be provided in a method for promoting dentinocyte differentiation.

The effects according to the present invention are not limited by the contents exemplified above, and more various effects are included in the present specification.

1 is an experimental result showing the curing time when treating the composition according to an embodiment of the present invention.

Figure 2a is an experimental result showing the relative cell viability when treated with a composition comprising fucoidan in different weight ratios in the composition according to an embodiment of the present invention.

Figure 2b is an experimental result showing the expression level of genes associated with cell adhesion when treated with a composition comprising fucoidan in each weight ratio of the composition according to an embodiment of the present invention.

Figure 2c is an experimental result showing alizarin red stained cells for the photochemical analysis, when the composition containing each fucoidan in a different weight ratio in the composition according to an embodiment of the present invention.

Figure 2d is an experimental result showing the results of measuring the photochemical power when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.

Figure 2e is an experimental result showing the results of measuring the ALP activity when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.

Figure 2f is an experimental result showing the expression of bone-associated genes when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.

Figure 2g is an experimental result showing the degree of cell migration when the composition containing the fucoidan each of the composition according to an embodiment of the present invention in a different weight ratio.

Figure 3a is an experimental result showing the results of FE-SEM and EDX when the composition containing no fucoidan in the composition according to an embodiment of the present invention.

Figure 3b is an experimental result showing the results of FE-SEM and EDX when the composition comprising 5 wt% fucoidan relative to the total weight of the composition according to an embodiment of the present invention.

Figure 3c is an experimental result showing the results of FE-SEM and EDX when the composition comprising 10 wt% fucoidan relative to the total weight of the composition according to an embodiment of the present invention.

Figure 4 is an experimental result showing the results of the FT-IR when the composition containing the fucoidan in each of the composition according to an embodiment of the present invention in a different weight ratio.

Advantages and features of the present invention and methods for achieving them will be apparent with reference to the embodiments described below in detail with the accompanying drawings. However, the present invention is not limited to the embodiments disclosed below, but may be implemented in various different forms, only the present embodiments to make the disclosure of the present invention complete, and common knowledge in the art to which the present invention pertains. It is provided to fully inform the person having the scope of the invention, which is defined only by the scope of the claims.

In the following, by using the hydraulic binder as a portland cement in the composition for the prevention and treatment of pulp disease of the present invention and using a radiographic contrast agent as zirconium oxide, but not limited thereto. In addition, the biological activity of the cells treated with the composition for preventing and treating pulp diseases according to various embodiments of the present invention is increased, thereby providing the composition to various methods for treating pulp diseases, and for preventing and treating pulp diseases. It can also be provided as a composition.

Composition of composition for prevention and treatment of pulp disease

In the following experiments, a composition consisting of the following compositions was used. Specifically, Portland cement was used as the hydraulic binder of the composition for preventing and treating pulp diseases according to an embodiment. The portland cement has 80 wt% relative to the total weight of the composition. In addition, zirconium oxide was used as a radiocontrast of the composition, and zirconium oxide has 20 wt% relative to the total weight of the composition.

Next, the composition of the above-mentioned composition is composed of a composition containing no fucoidan, a composition containing 5 wt% fucoidan relative to the total weight of the composition, and a composition containing 10 wt% fucoidan relative to the total weight of the composition. It was divided into three groups.

Hereinafter, a composition containing no fucoidan is PZ (Portland cement 80 wt% + ZO 20 wt%), and a composition containing 5 wt% fucoidan relative to the total weight of the composition is PZF5 (Portland cement 80 wt% + ZO 20 wt% + Fucoidan 5 wt%), a composition containing 10 wt% fucoidan relative to the total weight of the composition is described by describing PZF10 (80 wt% Portland cement + 20 wt% ZO + 10 wt% Fucoidan).

Statistical analysis

In the experiments below, one-way analysis of variance was used to analyze statistical differences between groups. Specifically, the analysis was performed using a binary comparison method using Tukey's test.

Example 1 Measurement of Cure Time of PZ, PZF5 and PZF10

First, the curing time of the composition according to one embodiment may mean that by combining the curing start time and the curing end time. The cure start time and cure end time of PZ, PZF5 and PZF10 were measured in a Teflon mold with an internal diameter of 10 mm and a height of 2 mm. Specifically, the hardening start time and hardening end time were performed based on C266-03 proposed by the American Material Testing Association and 6876 proposed by the International Organization for Standardization.

100 g of Gilmore needles were used to measure the curing start time, which had an active tip of 2 mm diameter. In addition, 400 g of Gilmore needles were used to measure the start end time, which had an active tip of 1 mm diameter. In the following description, for the sake of simplicity, the needle used for the measurement of the curing start time will be described as "starting needle" and the needle used for the measurement of the start end time as "termination needle".

Determination of the curing onset time was performed by applying the starting needle with a weak force on the surfaces of PZ, PZF5 and PZF10. This procedure was repeated every 5 minutes, until no circular flaws from the starting needles appeared on the PZ, PZF5 and PZF10 surfaces. Specifically, when the starting needle was applied to each of the compositions, the time elapsed until the phenomenon of stirring and minor scratches on the surface of the composition stopped. This time was set as curing start time.

The start end time was set by applying the end needle in place of the start needle in the same manner as the measurement of the curing start time described above.

1 shows the curing time of PZ, PZF5 and PZF10. Compared to PZ, the curing start time was reduced by about 50% and the curing stop time was reduced by about 20% in PZF10. As a result, the curing time was dependent on the fucoidan concentration, and it was recognized that the curing time was shortened.

The results showed that the compositions PZF5 and PZF10 containing fucoidan in Example 1 described above showed shorter curing time than the composition PZ containing no fucoidan. Specifically, the shortening of the initiation time of curing can be achieved by using a composition that does not use fucoidan in the pulp treatment since the exposed pulp portion can be immediately and temporarily restored after the application of PZF5 and PZF10 containing fucoidan to the dentin. It can be more effective than that. In particular, in shortening the curing time, it may be effective to use PZF10 as a composition for treating pulp diseases.

Example 2: Determination of Biological Activity of PZ, PZF5 and PZF10

First, the biological activities of the PZ, PZF5 and PZF10 compositions and the MTA are shown below in comparison. In experiments of measuring cell viability, measuring cell adhesion, measuring photochemical capacity, and measuring ALP activity, osteoblasts treated with PZ, PZF5, PZF10 and MTA were compared.

The osteoblasts were MG63 human osteoblasts, which were cultured in a minimal medium before the experiment. The minimal medium consisted of 10% fetal bovine serum, penicillin (100 units / mL) and streptomycin (100 units / mL).

During the experiment, the osteoblasts were inoculated with MG63 in a well containing osteogenic medium (OM: osteogenic medium) and incubated for 24 hours under conditions consisting of 5% CO2 and 95% air at 37 ° C. Cell adhesion was induced. Then PZ, PZF5, PZF10 and MTA were treated in each well.

The following six groups are applied in the experiments of measuring cell viability, measuring cell adhesion, measuring photooxidation, and measuring ALP activity. Four experimental groups consisted of osteoblasts treated with PZ, PZF5, PZF10, and MTA in bone formation medium, and two control groups were minimal of osteoblasts and no negative control treated with bone formation medium in positive control group. It is composed of untreated osteoblasts in the medium.

In the experiment of measuring the degree of cell migration, human umbilical vein endothelial cells (HUVECs) are used. In the following description, umbilical vein vascular endothelial cells are referred to as "HIVECs" for clarity of explanation. The experimental groups applied in the degree of cell migration were HUVECs treated with PZ, PZF5, PZF10 and MTA, and the control group was HUVECs without any treatment.

Measurement of Cell Viability of Osteoblasts Treated with PZ, PZF5, PZF10 and MTA

Osteoblasts used for cell viability measurements were osteoblasts at a concentration of 1 × 10 ⁴ (cells / well). Cell viability of osteoblasts 3 and 7 days after treatment with PZ, PZF5, PZF10 and MTA was measured. At this time, the osteoblasts treated with each composition were measured for optical density using a microplate absorbance reader at a wavelength of 570 nm.

Figure 2a shows the cell viability of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. After PZF5 treatment, it was confirmed that the cell viability of osteoblasts on day 7 was increased.

Adhesion Measurement of PZ, PZF5, PZF10 and MTA Treated Osteoblasts

First, after treatment with PZ, PZF5, PZF10 and MTA to osteoblasts prepared by the above-described method was further cultured for 24 hours. The degree of cell adhesion was analyzed by measuring the expression of integrin β1 and integrin β3 using RT-PCR.

Specifically, each osteoblasts treated with PZ, PZF5, PZF10 and MTA were transferred to EP tubes, and total RNA was extracted using RiboEX reagent. 200 μL of chloroform (Chloroform) was taken into the EP tube and centrifuged at 4 ° C. for 15 minutes. 1 μg was taken from RNA obtained after centrifugation and reverse transcribed using Maxime RT PreMix kit.

The cDNA obtained was then amplified using Maxime RT PreMix kit. GAPDH was used as a housekeeping gene. Table 1 lists detailed primer sequences, RT-PCR conditions and cycles, and product size.

gene	Forward sequence	Reverse sequence	Annealing Temperature (℃)	Frequency	Product size (bp)
Integrinβ1	TCGGGGAGCCACAGACATT	GCTAAATGGGCTGGTGCAGT	57	35	282
Integrinβ2	CAACAATGGCAATGGGACCT	TGAGCACATCTCCCCCTTGT	57	35	268
Osteocalcin (OCN)	CCTCACACTCCTCGCCCTATT	TCCTGAAAGCCGATGTGGTC	57	35	264
Dentinyl Allophosphoprotein (DSPP)	TGGTGTCCTGGTGCATGAAG	TGTTTGTGGCTCCAGCATTG	57	35	281
Asterix	ATCCATGCAGGCATTTCACC	TGCCCACTATTTCCCACTGC	57	35	290
GAPDH	ACTGGCGTCTTCACCACCAT	GGCCATCCACAGTCTTCTGG	57	30	277

PCR products were dissolved in 1.5% agarose gel, stained with RedSafe, and analyzed using a ChemiDoc imaging system (Imaging System).

Figure 2b shows the expression level of integrin β1 and integrin β3 of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. Integrin β1 was highly expressed in osteoblasts treated with PZF5, and integrin β3 was highly expressed in both osteoblasts treated with PZF5 and PZF10, unlike other groups.

Measurement of Photochemical Activity of Osteoblasts Treated with PZ, PZF5, PZF10 and MTA

First, after treatment with PZ, PZF5, PZF10 and MTA to osteoblasts prepared by the above-described method was further cultured for 24 hours. The treated cells were then fixed with 70% ethanol for 1 hour at room temperature, treated with 1% alizarin red for 10 minutes, and the stained cells were washed with sterile water.

Finally, the cells were treated in 10 mM sodium phosphate buffer containing 10% cetylpyridinium chloride for 15 minutes and incubated for 14 days. At a wavelength of 562 nm, the optical density of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls was measured using a microplate reader.

Figure 2c shows the results of staining with alizarin red of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. The high optical density in osteoblasts treated with PZF5 was confirmed.

FIG. 2D shows the mineralization of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. As shown in the results of FIG. 4C, the photochemical capacity in the osteoblasts treated with PZF5 was the highest among six groups, and the photooxidative capacity in osteoblasts treated with PZF5 was high. In particular, it was confirmed that the mineralization capacity of PZF5 treated osteoblasts was 1.8 times higher than that of MTA treated osteoblasts.

Measurement of ALP Activity in PZ, PZF5, PZF10 and MTA Treated Osteoblasts

P-nitrophenyl phosphate was used as a substrate for the measurement of ALP activity. Specifically, a solution containing p-nitrophenyl phosphate in 0.7 M 2-amino-methyl-1-propanol and 6.7 Mm magnesium chloride was used as the substrate active solution.

Then, the osteoblasts prepared by the method described above was incubated for 1 hour by treating the substrate active solution on a plate treated with PZ, PZF5, PZF10 and MTA. Cells 7 days after treatment and 14 days after treatment were measured for optical density using an enzyme-linked immunosorbent assay (ELISA) at a wavelength of 405 nm.

2E shows ALP activity of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. It was confirmed that osteoblasts after 7 days of PZF5 treatment had higher ALP activity than those of the other five groups. In particular, the ALP activity of osteoblasts after 14 days of PZF5 treatment was higher than that of PZF10, and was confirmed to be two times higher than that of osteoblasts after 14 days of MTA treatment.

Measurement of Osteoblastic Gene Expression in Osteoblasts Treated with PZ, PZF5, PZF10 and MTA

The expression of bone formation associated genes was measured using RT-PCR. Specifically, osteocalcin (OCN: osteocalcin) dentin sialophosphoprotein (DSPP: dentin sialophosphoprotein) and asterix (osterix) were used.

* First, after treating PZ, PZF5, PZF10 and MTA to osteoblasts prepared by the above-described method, cell adhesion was induced for 24 hours and cultured for 7 days.

The relative expression levels of these osteogenic genes were then measured using RT-PCR. GAPDH was used as a housekeeping gene. Table 1 above describes the detailed primer sequences, RT-PCR conditions and cycles, and product size used to determine the relative expression levels of the bone formation associated genes.

Figure 2f shows the degree of expression of bone formation associated genes of PZ, PZF5, PZF10 and MTA treated osteoblasts and controls. In particular, it was confirmed that the expression of all three osteogenic genes in PZF5 treated osteoblasts was upregulated.

Measurement of Cell Migration in PZ, PZF5, PZF10, and MTA Treated HUVECs

First, human HUVECs at a concentration of 2.5 × 10 ⁴ (cells / well) were passaged three times in a well plate. After 24 hours of embryos, the plate was filled with cells 90% of the area of the plate. A sterile pipette tip was used to mark the middle of the plate.

The cells were then washed with phosphate-buffer. The washed cells were treated with PZ, PZF5, PZF10 and MTA.

After 12 hours of treatment, cells in which cell migration was induced were observed using a microscope.

Figure 2g shows the degree of cell migration of PZ, PZF5, PZF10 and MTA treated HUVECs and controls. It was confirmed that the degree of cell migration of PZF5 and MTA treated HUVECs was higher than that of the other groups.

Osteoblasts treated with PZF5 and PZF10 of the composition containing fucoidan, as a result of measuring cell viability, measuring cell adhesion, measuring photooxidation, measuring ALP activity and measuring the degree of cell migration in Example 2 described above, It was confirmed that various biological activities were higher than osteoblasts treated with MTA. As a result, the composition containing fucoidan can prevent pulp disease caused by damage to dental hard tissue, especially dentin in dental hard tissue, and can increase the activity of dental hard tissue, thereby providing a composition for preventing and treating pulp disease. Can be. Furthermore, a composition according to one embodiment of the present invention may be more effective than using MTA for the prevention and treatment of pulp disease. Also, as a result of PZF5 having higher biological activity than PZF10 in a composition containing fucoidan, a composition containing 10 wt% or less of fucoidan relative to the total weight of the composition according to an embodiment of the present invention is used for the prevention and treatment of pulp disease. It may be more desirable to use the composition as a method of promoting dentinogenesis differentiation in the effect of preventing or treating pulp disease.

Example 3: Chemical Properties of PZ, PZF5 and PZF10

Surface states of PZ, PZF5 and PZF10 were photographed using a field emission-scanning electron microscope (FE-SEM). In order to determine the elemental composition of PZ, PZF5 and PZF10, energy dispersive X-ray (EDX) analysis was performed. Analysis using FE-SEM was performed at a voltage of 10 kV.

In addition, the wavelength range 4000 (cm ⁻¹ ) to 400 (cm ⁻¹ ) using the FT-IR described above for the functional group analysis of PZ, PZF5 and PZF10 The analysis was performed at.

Figure 3a shows the results of analyzing the surface state of PZ by FE-SEM and EDX. Figure 3b shows the results of analyzing the surface state of PZF5 by FE-SEM and EDX. 3c shows the results of analyzing the surface state of PZF10 by FE-SEM and EDX. Specifically, it was confirmed that the surface of PZ had a surface rougher than PZF5 and PZF10. In addition, it can be seen from the surface analysis that PZF5 contains 3.34 wt% of sulfur relative to the total weight of the elemental composition, and PZF10 contains 4.46 wt% of sulfur relative to the total weight of the elemental composition.

4 shows the results of analyzing the functional groups of PZ, PZF5 and PZF10 by FT-IR. In comparison with PZ, specific peaks were identified in PZF5 and PZF10 containing fucoidan.

Specifically, at a wavelength of about 1420 (cm ⁻¹ ), PZF5 exhibits a transmission of about 0.03% and PZF10 exhibits a transmission of about 0.075%. Representing a peak at a wavelength of about 1420 (cm ⁻¹ ) may mean having a functional group of “COO-”.

In addition, approximately 874 (cm^-One) PZF5 exhibits a transmittance of about 0.03% at a wavelength of PZF10 and a transmittance of about 0.06%. Approximately 874 (cm^-One) The peak at the wavelength of is meant to have a functional group of "C-O-S", which may be a result of inclusion of fucoidans of PZF5 and PZF10.

Furthermore, about 1252 (cm ^-1 ) PZF5 exhibits a transmission of about 0.015% at a wavelength of and PZF10 exhibits a transmission of about 0.02% at a wavelength of about 1236 (cm ⁻¹ ). About 1252 (cm ^-1 ) And showing a peak at a wavelength of 1236 (cm ⁻¹ ) may mean having a functional group of “S═O stretching vibration”.

As a result of Example 2, the composition according to an embodiment of the present invention, it was confirmed that the difference in the chemical properties depending on the presence or absence of fucoidan. Furthermore, the method of Example 3 may provide information on the presence or absence of fucoidan in the composition.

Although the embodiments of the present invention have been described in more detail with reference to the accompanying drawings, the present invention is not necessarily limited to these embodiments, and various modifications can be made without departing from the spirit of the present invention. . Therefore, the embodiments disclosed in the present invention are not intended to limit the technical idea of the present invention but to describe the present invention, and the scope of the technical idea of the present invention is not limited by these embodiments. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive. The protection scope of the present invention should be interpreted by the following claims, and all technical ideas within the equivalent scope should be interpreted as being included in the scope of the present invention.

Claims (13)

1. A composition for preventing and treating pulp diseases, comprising fucoidan and a hydraulic binder.
2. The method of claim 1,

   The fucoidan is 5 wt% to 10 wt% with respect to the total weight of the composition, the composition for the prevention and treatment of pulp disease.
3. The method of claim 1,

   The hydraulic binder includes one selected from the group consisting of natural portland cement, portland cement, mixed cement and special cement, and combinations thereof, the composition for preventing and treating pulp diseases.
4. The method of claim 1,

   The pulp disease comprises one selected from the group consisting of pulp red blood, pulpitis, pulp degeneration, pulp necrosis, root root lesion and dental caries, and combinations thereof, the composition for the prevention and treatment of pulp disease.
5. The method of claim 1,

   The composition further comprises a radiographic agent, the composition for the prevention and treatment of pulp disease.
6. The method of claim 5,

   The contrast agent is bismuth oxide, bismuth carbonate, strontium carbonate, strontium phosphate, barium sulfate, tantalum oxide, cerium oxide ), Tin oxide and zirconium oxide (zirconium oxide) and a combination comprising one selected from the group consisting of, prevention and treatment of pulp disease.
7. The method of claim 5,

   The contrast agent is 20 wt% to 40 wt% with respect to the total weight of the composition, the composition for the prevention and treatment of pulp disease.
8. The method of claim 1,

   The composition is a curing start time of 100 minutes or less, the composition for the prevention and treatment of pulp disease.
9. The method of claim 1,

   The composition has a curing termination time of 250 minutes or less, the composition for the prevention and treatment of pulp disease.
10. The method of claim 1,

    The composition has a transmittance of 0.03% or more at a wavelength of 1350 (cm ^-1 ) to 1450 (cm ^-1 ), the composition for preventing and treating pulp diseases.
11. The method of claim 1,

    The photocatalytic ability of the composition is at least 1.8 times higher than that of MTA (mineral trioxide aggregate), the composition for the prevention and treatment of pulp disease.
12. The method of claim 1,

    Cells 7 days after the treatment of the composition has at least twice the ALP (alkaline phosphatase) ALP activity compared to cells 7 days after the MTA treatment, the composition for preventing and treating pulp disease.
13. A method for promoting dentinogenesis differentiation, comprising the step of placing the composition of any one of claims 1 to 12 in dimensions.

Images