WO2018030738A1 - 폴리락토사민 생합성 저해에 의한 n-결합 당쇄 안테나구조가 강화된 재조합 당단백질 제조방법 - Google Patents

폴리락토사민 생합성 저해에 의한 n-결합 당쇄 안테나구조가 강화된 재조합 당단백질 제조방법 Download PDF

Info

Publication number
WO2018030738A1
WO2018030738A1 PCT/KR2017/008521 KR2017008521W WO2018030738A1 WO 2018030738 A1 WO2018030738 A1 WO 2018030738A1 KR 2017008521 W KR2017008521 W KR 2017008521W WO 2018030738 A1 WO2018030738 A1 WO 2018030738A1
Authority
WO
WIPO (PCT)
Prior art keywords
recombinant
glycoprotein
gene
cell line
producing
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2017/008521
Other languages
English (en)
French (fr)
Inventor
김정회
이충근
곽찬영
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Korea Advanced Institute of Science and Technology KAIST
Original Assignee
Korea Advanced Institute of Science and Technology KAIST
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020170098912A external-priority patent/KR102002790B1/ko
Application filed by Korea Advanced Institute of Science and Technology KAIST filed Critical Korea Advanced Institute of Science and Technology KAIST
Publication of WO2018030738A1 publication Critical patent/WO2018030738A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins

Definitions

  • the present invention provides a method for inhibiting the expression of the ⁇ 3gnt2 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 2) gene by knocking down or knocking out the ⁇ 3gnt2 gene. It relates to a method for producing glycoproteins having increased half-life by inhibiting biosynthesis of samine.
  • UDP-GlcNAc betaGal beta-1,3-N-acetylglucosaminyltransferase 2
  • Glycosylation is a major post-translational formula in mammalian cells and is divided into two classes, N- and O-linked glycosylation.
  • N-linked glycosylation is attached to Asn (Asn-X-Ser / Thr motif) in many glycoproteins. Glycation affects enzyme activity, protein stability, and immunogenicity.
  • Sialic acid a generic term for acyl derivatives of neuraminic acid (Neu), is an essential component of the sugar precursor composition required for the saccharification process. So far, about 50 kinds of sialic acid added sugar chain precursors have been found in nature. It became. Sialic acid plays an important role in cellular phenomena in mammals, including intercellular interactions, the role of precursors in determining signals in cells, and the stabilization of glycoproteins. Sialic acid was first isolated from mucin in the bovine salivary gland by Blix in 1936 and is known as an acidic sugar consisting of 9 carbons and having a COOH- group.
  • sialic acid is reported to have 23 kinds of sialic acid due to differences in substituents, and these are known to exhibit a specific distribution in a species or tissue.
  • sialic acid is linked to ⁇ -glycosidic bonds by the action of sialic acid transferases specific for Gal, GlcNAc, GalNAc and sialic acid of glycoproteins, glycolipids, oligosaccharide sugar chains.
  • sialic acid of the complex sugar sugar chain is located at the far end of the sugar chain structure on the surface of the cell membrane, it is expected to be directly involved in contact between the cell and the extracellular environment, and long-lasting lifespan of blood cells or glycoproteins in body fluids It is known to be shortened by the removal of sialic acid.
  • sialic acid in erythrocyte membranes is removed, galactose is exposed to the cell surface and binds to a receptor lectin that specifically binds to galactose on the Kupffer cell surface, thereby receptor mediated receptors.
  • sialic acid-free asialo glycoproteins are also bound by lectins on the surface of hepatocytes and removed from the circulatory system in a similar way as red blood cells.
  • glycoproteins with sial binding, alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, factor VIII, and gamma- Glamma-glutamyltransferase, granulocyte colony-stimulating factor (G-CSF), and luteinizing hormone (LH) are not sialic acid bound for sialic acid-bound glycoproteins. It has been reported that the half-life of glycoproteins is significantly increased compared to that (Ngantung FA. Et al., 2006, Biotechnol. Bioeng 95 (1), 106-119).
  • EPO erythropoietin
  • Wild-type EPO has three N-linked sugar chains and one O-linked sugar chain, up to four sialic acids in one N-linked sugar chain, and up to two sialic acids in one O-linked sugar chain. It is possible to bind potentially one molecule of EPO to a total of 14 sialic acids.
  • sialic acid when sialic acid is bound to the sugar chain in the EPO protein, it prevents the degradation of EPO in the liver by preventing binding to the desialalo glycoprotein receptor present in the liver.
  • Polylactosamine is one of the basic structures of oligosaccharides present on glycoproteins as a structure (Galbeta1-4GlcNAcbeta1-3) n, in which N-acetylglucosamine (GlcNAc) and galactose (Galactose) are continuously repeated.
  • GlcNAc N-acetylglucosamine
  • Galactose galactose
  • polylactosamine accounts for about 10-20% of the total N-glycans.
  • polylactosamine-containing EPO is used for galactose on the surface of glycoproteins by sialic acid. It has been reported that body half-life is significantly reduced regardless of its protective effect.
  • restriction enzymes that recognize and cut specific sequences of DNA in the 1970s
  • genetic engineering has evolved rapidly over the years.
  • the limitation of genetic engineering techniques using restriction enzymes was clear.
  • the restriction enzyme has a problem that can distinguish only about 46 (4,096) sequence pairs because the length of the recognizable gene sequence is about 6 to 8 very short.
  • the CRISPR / CAS9 system lacks these limitations and can theoretically be applied to higher organisms beyond humans.
  • the CRISPR / CAS9 system is a genome editing method called the clustered regularly interspaced short palindromic repeat (CRISPR) gene shear, which is an RNA (gRNA) that specifically binds to a specific sequence and a scissors that cut a specific sequence. It consists of.
  • CRISPR / CAS9 system enables knock-out that can inhibit the function of specific genes by introducing plasmid DNA into cells or animals.
  • the CRISPR / CAS9 system was discovered by scientists just a few years ago and is a very old way for single-celled organisms, such as bacteria, to protect themselves from bacteriophages.
  • the organism evolved over millions of years, cutting off the DNA of the bacteriophage, attaching it to its own genes, and then surviving through adaptive immunity, which were studied in a simple and straightforward way that allows the lab to quickly edit the organism's DNA.
  • the original CRISPR / CAS9 system stores a portion of the virus's DNA previously invaded in its genome, and then retrieves the information when the virus invades and finds and cuts only the viral DNA. Protection mechanism.
  • a primer is produced that searches for the nucleotide sequence of a specific gene, paired with Cas9 enzyme, a cleavage enzyme, and attached to a target DNA nucleotide sequence to cause DNA cleavage. As a result, mutations occur during DNA repair.
  • the present inventors knock-down genes involved in polylactosamine synthesis by using siRNA to reduce the content of polylactosamine in glycoproteins as a method for enhancing the degradation resistance of glycoproteins and increasing the activity in the body.
  • the knock-down CHO cell line and the CRISPR / CAS9 system were used to construct a CHO cell line that knocked out genes involved in polylactosamine synthesis, and the glycoprotein produced therefrom was polylactosamine.
  • Tri- and / or tetra-antennary structures increased with the decrease, thereby increasing the half-life of the glycoprotein, thus completing the present invention by confirming that it may play a positive role in the efficacy of the glycoprotein. It was.
  • the present invention provides a method for producing a recombinant cell line producing a recombinant glycoprotein with increased half-life, comprising the step of inhibiting the biosynthesis of polylactosamine in the cell line producing a glycoprotein do.
  • the present invention also provides a recombinant cell line prepared by the above method.
  • the present invention also provides a recombinant glycoprotein with increased half-life, separated by the above method.
  • the present invention comprises a base sequence encoding any one guide RNA selected from the group consisting of SEQ ID NO: 10 to 13; And a Cas9 gene consisting of the nucleotide sequence set forth in SEQ ID NO: 14.
  • the present invention confirms the reduction of polylactosamine in recombinant human-derived erythropoietin produced from a cell line that inhibits (knocks down) the expression of the ⁇ 3gnt2 gene involved in the biosynthesis of polylactosamine or knocks out the ⁇ 3gnt2 gene.
  • a positive role is possible in increasing the half-life and glycoprotein efficacy of the glycoprotein.
  • the method of the present invention confirmed that the preparation of the recombinant glycoprotein with increased half-life is possible. .
  • FIG. 1 is a diagram comparing expression patterns of polylactosamine synthesis gene candidate groups ( ⁇ 3gnt 1 to 9) in CHO cells.
  • 2 is a diagram showing the position and sequence of siRNA for knock-down expression of ⁇ 3gnt2.
  • Figure 3 is a diagram confirming the results of siRNA-2 selection siRNA candidates through siRNA-1, siRNA-2 and siRNA-3 gene expression patterns and the resulting Western blotting results:
  • 3D Relative intensity confirming results of western blotting by siRNA-2.
  • siRNA-2 is a diagram confirming the quantitative change of the sugar chain structure by polylactosamine inhibition by siRNA-2:
  • 5B siRNA-2 treatment group.
  • FIG. 6 shows LC / MS results for identifying quantitative changes in polylactosamine structure by siRNA-2:
  • 6B siRNA-2 treatment group.
  • Figure 7 shows the results of knock-out of ⁇ 3gnt2 by gRNA-1, gRNA-2, gRNA-3 and gRNA-4:
  • T7E1 T7 Endonuclease 1
  • Fig. 7C Indel results of gene insertion (gRNA-1: 1, gRNA-2: 2, gRNA-3: 3, gRNA-4: 4) after T7 Endonuclease 1 (T7E1) assay.
  • FIG. 8B Sanger-sequencing results (delete, insert and PAM sequences (GGC, AGG, CCC, CCT)) after screening clones with confirmed indel compared to control (WT).
  • Figure 9 shows the decrease in expression of polylactosamine through knock-out of ⁇ 3gnt2:
  • 9A Western blotting of selected clones (Clone 1: 9 of gRNA-1 / Clone 2: 2 of gRNA-4 / Clone 3: 12 of gRNA-4 / Clone 4: 16 of gRNA-4);
  • the present invention provides a method for producing a recombinant cell line for producing a recombinant glycoprotein with increased half-life, comprising the step of inhibiting the biosynthesis of polylactosamine in a cell line producing a glycoprotein.
  • the glycoprotein is erythropoietin, thrombopoietin, thrombopoietin, alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, Factor VIII , Gamma-glutamyltransferase, granulocyte colony-stimulating factor (G-CSF) and luteinizing hormone (LH) may be any one selected from the group consisting of. And, specifically, it may be erythropoietin, but is not limited thereto.
  • knock-down expression of ⁇ 3gnt2 (UDP-GlcNAc: betaGal beta-1,3-N-acetylglucosaminyltransferase 2) gene or knock-down ⁇ 3gnt2 gene It may include knocking out.
  • the mRNA of the ⁇ 3gnt2 gene may be composed of the nucleotide sequence set forth in SEQ ID NO: 1.
  • the knock-down of the ⁇ 3gnt2 gene expression is specifically directed to a cell line producing glycoproteins, either selected from the group consisting of antisense nucleotides, siRNAs, shRNAs and miRNAs that process ⁇ 3gnt2 gene inhibitors or bind to ⁇ 3gnt2 mRNAs. It may be infectious, and more specifically, siRNA that binds to ⁇ 3gnt2 mRNA may be transfected into cell lines producing glycoproteins.
  • the siRNA may include any one base sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 6, but is not limited thereto.
  • the siRNA may comprise a single RNA strand of stem-loop structure comprising an independent sense RNA strand and a complementary antisense RNA strand homologous to the target sequence, or wherein the sense RNA strand and antisense RNA strand are connected by a loop.
  • the siRNA is not limited to completely paired double-chain RNA portion paired with RNA, and may have a hairpin structure that forms a stem-loop structure, in particular, shRNA (short hairpin RNA).
  • shRNA short hairpin RNA
  • the double chain or stem region may include a portion not paired by mismatch (corresponding base is not complementary), bulge (the base does not correspond to one chain) and the like.
  • the total length is 10 to 80 bases, preferably 15 to 60 bases, more preferably 20 to 40 bases.
  • the loop region has no special meaning in the sequence, and only has 3 to 10 bases in order to connect the sense sequence and the antisense sequence at appropriate intervals.
  • siRNAs examples that have conventionally been used as the loop region of siRNAs are as follows: AUG (Sui et al., Proc. Natl. Acad. Sci. USA 99 (8): 5515-5520, 2002), CCC, CCACC or CCACACC ( Paul et al., Nature Biotechnology 20: 505-508, 2002), UUCG (Lee et al., Nature Biotechnology 20: 500-505), CTCGAG, AAGCUU (Editors of Nature Cell Biology Whither RNAi, Nat Cell Biol. 5: 489-490, 2003), UUCAAGAGA (Yu et al., Proc. Natl. Acad. Sci.
  • siRNA terminal structures can be either blunt or cohesive.
  • the cohesive end structure can be both a 3 'protruding structure and a 5' end protruding structure, and the number of protruding bases is not limited.
  • the number of bases may be 1 to 8 bases, preferably 2 to 6 bases.
  • siRNA is a low-molecular RNA (for example, natural RNA molecules such as tRNA, rRNA, viral RNA or artificial RNA molecules such as tRNA, rRNA, viral RNA, etc.) in a range capable of maintaining the expression inhibitory effect of the target gene. ) May be included.
  • the siRNA terminal structure does not need to have a cleavage structure at both sides, and may be a stem loop type structure in which one terminal portion of the double chain RNA is connected by a linker RNA.
  • the length of the linker is not particularly limited as long as it does not interfere with pairing of stem portions.
  • siRNA according to the present invention it is possible for the sense RNA strand and / or antisense RNA strand to comprise at least one chemical modification in its sugar moiety, nucleobase moiety or internucleotide structure. Such modifications may make it possible to inhibit the destruction of siRNA by nucleases in vivo. All chemical modifications that can enhance the stability and biocompatibility of siRNA according to the present invention in vivo are included in the scope of the present invention.
  • the position 2 'of the ribose such as 2'-deoxy, 2'-fluoro, 2'-amino, 2'-thio, or 2'-0-alkyl
  • the position 2 'of the ribose such as 2'-deoxy, 2'-fluoro, 2'-amino, 2'-thio, or 2'-0-alkyl
  • nucleobases 5-bromo-uridine, 5-iodo-uridine, N3-methyl-uridine, 2,6-diaminopurine (DAP, 5-methyl-2'-deoxycytidine Bound to cholesterol or a modified base such as 5- (1-propynyl) -2'-deoxy-uridine (pdU), 5- (1-propynyl) -2'-deoxycytidine (pdC)
  • preferred modifications of the internucleotide backbone include substituting phosphodiester groups in the backbone by phosphorothioate, methylphosphonate, phosphorodiamidate groups.
  • a backbone consisting of N- (2-aminoethyl) -glycine (PNA, peptide nucleic acid) linked by peptide bonds.
  • PNA peptide nucleic acid
  • Various modifications base, sugar, backbone
  • base are modified nucleic acids of morpholino type. (Bases anchored to morpholine rings and linked by phosphorodiamidate groups) or PNA (peptides) Base attached to an N- (2-aminoethyl) -glycine unit linked by a bond).
  • the transfection is any one commercially available transfection reagent selected from the group consisting of Lipofectamine, Lijinfect, Dojindo's Hilymax, Fugene, jetPEI, Effectene and DreamFect; Calcium-phosphate, positively charged polymers, liposomes, nanoparticles, nucleofection, electroporation, heatshock, magnetofection It can be carried out using any one selected from the group.
  • the knock-out of the ⁇ 3gnt2 gene may specifically be a transformation of a recombinant vector capable of knocking out the ⁇ 3gnt2 gene into a cell line producing a glycoprotein.
  • the recombinant vector capable of knocking out the ⁇ 3gnt2 gene is specifically, nucleotide sequence encoding any one of the guide RNA (guide RNA; gRNA) selected from the group consisting of SEQ ID NO: 10 and SEQ ID NO: 14 It may include a Cas9 (CRISPR associated protein 9) gene consisting of a nucleotide sequence, the recombinant vector may include a structure in which a Cas9 gene and a gene encoding a fluorescent protein is combined.
  • the recombinant vector capable of knocking out the ⁇ 3gnt2 gene may include any one base sequence selected from the group consisting of SEQ ID NOs: 15 to 18, but is not limited thereto.
  • the cell line may use mammalian cells, yeast cells or insect cells, the mammalian cells are Chinese hamster ovary cells (CHO) ), HT-1080, human lymphoblastoid, SP2 / 0 (mouse myeloma), NS0 (mouse myeloma), baby hamster kidney cells (BHK), human embryonic kidney cells , HEK), PERC.6 (human retinal cells) and EC2-1H9 cells may be any one selected from the group consisting of, Chinese hamster ovary cells (Chinese hamster ovary cells, CHO) is most preferred, but not limited thereto. Do not.
  • ⁇ 3gnt2 gene was selected as the target gene to be most involved in polylactosamine structure synthesis.
  • Target siRNAs were constructed to inhibit expression (see FIGS. 1 and 2).
  • lactosaminyl repeat structure and specificity of EPO produced from siRNA-treated CHO cells Immunoblotting was performed using a lectin (LEL) which binds to the result.
  • EPO inhibited ⁇ 3gnt2 expression by siRNA-2 treatment showed a signal reduction of about 70% (see FIG. 3).
  • the present inventors confirmed a quantitative change in the sugar chain structure by polylactosamine inhibition, and as a result, the ratio of polylactosamine in total N-glycans was significantly reduced from about 19% to about 2%. (FIG. 4A), it was confirmed that the polylactosamine structure was reduced (FIGS. 5 and 6). In addition, it was confirmed that the ratio of tri- and tetra-antennary N-glycans was increased (see FIG. 4B).
  • the present inventors prepared ⁇ 3gnt2 gene knockout recombinant vector through the CRISPR / Cas9 system, and the result of performing the T7E1 assay to confirm the knockout efficiency by transforming the recombinant vector, the DNA of the inserted cells compared to the WT DNA is It was confirmed that the mismatched DNA region was cut by T7E1 to show multi bands (see FIG. 7B), and the knocked out sequences were confirmed by flow cytometry and Sanger-sequencing (see FIG. 8).
  • the present invention confirms the reduction of polylactosamine in recombinant human-derived erythropoietin produced from a cell line that inhibits (knocks down) the expression of the ⁇ 3gnt2 gene involved in the biosynthesis of polylactosamine or knocks out the ⁇ 3gnt2 gene.
  • the increase in the half-life and glycoprotein efficacy of the glycan protein was confirmed by confirming the increase in the triple and / or quadruple antenna structure of the compartment, and thus, the method of the present invention enables the production of recombinant glycoproteins having increased half-life. Confirmed.
  • the present invention also provides a recombinant cell line producing a recombinant glycoprotein with increased half-life produced by the above method.
  • the glycoproteins include erythropoietin, thrombopoietin, alpha-antitrypsin, cholinesterase, chorionic gonadotropin, CTLA4Ig, Factor VIII, gamma-glutamyltransferase, granulocyte colony stimulating factor and luteinizing hormone It may be any one selected from the group consisting of, specifically, it may be erythropoietin, but is not limited thereto.
  • the present invention also provides a recombinant glycoprotein with increased half-life, separated by the above method.
  • Recombinant glycoproteins with increased half-life isolated by the above method are characterized by an increase in triple- and / or tetra-antennary structures of N-glycans.
  • the present invention includes a base sequence encoding any one of the guide RNA (guide RNA; gRNA) selected from the group consisting of SEQ ID NO: 10 to 13; And it provides a recombinant vector comprising a Cas9 (CRISPR associated protein 9) gene consisting of the nucleotide sequence set forth in SEQ ID NO: 14.
  • guide RNA guide RNA; gRNA
  • Cas9 Cas9
  • the recombinant vector may include a structure in which a Cas9 gene and a gene encoding a fluorescent protein are combined, and specifically, the recombinant vector includes any one nucleotide sequence selected from the group consisting of SEQ ID NOs: 15 to 18. It may be, but is not limited thereto.
  • the present invention confirms the reduction of polylactosamine in recombinant human-derived erythropoietin produced from a cell line that inhibits (knocks down) the expression of the ⁇ 3gnt2 gene involved in the biosynthesis of polylactosamine or knocks out the ⁇ 3gnt2 gene.
  • the increase in the half-life and glycoprotein efficacy of the glycan protein was confirmed by confirming the increase in the triple and / or quadruple antenna structure of the compartment, and thus, the method of the present invention enables the production of recombinant glycoproteins having increased half-life. Confirmed.
  • polylactosamine involves 9 genes ( ⁇ 3gnt1-9) that bind ⁇ 1,3-GlcNAc to galactose, but the genes that are specifically involved in each tissue or cell type are not identical. Accordingly, qPCR was performed on three types of CHO cells (EC2-1H9, 1098-2, CGT II-4) to compare the expression patterns of nine gene candidate groups.
  • the ⁇ 3gnt2 gene was selected as a target gene that is most involved in polylactosamine structure synthesis, and a target siRNA was prepared to inhibit the expression of ⁇ 3gnt2.
  • siRNA sequences were designed and synthesized to produce siRNA of ⁇ 3gnt2 gene.
  • siRNA-499, siRNA-1101 and siRNA-970 Design siRNA sequences in three regions (siRNA-499, siRNA-1101 and siRNA-970) that inhibit hamster ⁇ 3gnt2 mRNA (GenBank accession no. XM_003502146.2; SEQ ID NO: 1) at the coding region location as shown in FIG. And synthesized. Oligonucleotides used in the siRNA are as described in Table 1.
  • siRNA name Oligonucleotide Name Oligonucleotide sequence Position on cDNA siRNA-1 S-siRNA (SEQ ID NO: 2) 5'-GAAGAAATGCGCAAAGAA-3 ' 499 A-siRNA (SEQ ID NO: 3) (target sequence) 5'-TTCTTTGCGCATTTCTTC-3 ' siRNA-2 S-siRNA (SEQ ID NO: 4) 5'-CTGGAATGTGCCTTCAGAA-3 ' 1101 A-siRNA (SEQ ID NO: 5) (target sequence) 5'-TTCTGAAGGCACATTCCAG-3 ' siRNA-3 S-siRNA (SEQ ID NO: 6) 5'-CATCCCAGAAGTCTTCTAT-3 ' 970 A-siRNA (SEQ ID NO: 7) (target sequence) 5'-ATAGAAGACTTCTGGGATG-3 '
  • SiRNA of ⁇ 3gnt2 gene prepared in Example ⁇ 1-2> was used to transfect human EPO producing CHO cell line.
  • EC2-1H9 a recombinant human EPO producing CHO cell line, Hyo Jeong Hong (Department of Systems Immunology, Kangwon National University, Chuncheon, Korea)
  • Cells were 10% dFBS (dialyzed fetal bovine serum; SAFC, US), 3.5 g / L glucose, 20 nM MTX (methotrexate; Sigma) , And 1% Ab-Am (Antibiotic-Antimycotic solution; Gibco) were incubated at 37 ° C., 5% CO 2 in MEM- ⁇ .
  • EC2-1H9 cells were ⁇ 3gnt2 specific or negative control using Lipofectamine® RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol.
  • RNAiMAX transfection reagent Invitrogen, Carlsbad, CA, USA
  • Transfected with 10 ⁇ M siRNA UGCG-specific siRNA.
  • the medium was exchanged with serum free medium (CHO-S-SFM II; Gibco) and incubated for additional 3 days at 37 ° C. in a 5% CO 2 environment.
  • RNA of recombinant CHO cells constructed in Example 2 was extracted using RNeasy® Mini (QIAGEN) according to the manufacturer's protocol. Reverse transcription to cDNA was performed using AccuPower RT-PCR PreMix (Bioneer, Korea) using 1.0 ⁇ g of RNA. cDNA was used as a template to identify ⁇ 3gnt2 mRNA transcript using qPCR.
  • rhEPO human-derived erythropoietin
  • culture supernatants containing rhEPO were collected and passed through a 0.45 ⁇ m-pore-size membrane. Passed culture medium was concentrated and exchanged with PBS buffer through ultrafiltration (AmiconUltra; Millipore, Bedford, Mass.). And, rhEPO was purified using an immunochromatography column (Mamunoaffinity chromatography column, MAiiA, Uppsala, Sweden).
  • rhEPO was eluted with 0.1 M glycine / 0.5 M NaCl, pH 2.8, the eluate immediately neutralized with 1.0 M Tris / HCl, pH 9.0.
  • Purified rhEPO was concentrated and dialyzed with distilled water using ultrafiltration (AmiconUltra; Millipore). The concentration of rhEPO was measured using Quant-iT TM protein assay kit (Invitrogen).
  • Lectin blot analysis was performed to confirm the expression level of polylactosamine. Specifically, for purified EPO blotting using Lycopersicon Esculentum Lectin (LEL), the purified 1 ⁇ g EPO was electrophoresed on 12.5% SDS PAGE and transferred to PVDF membranes (Millipore, Billerica, MA), and biotin-labeled. BEL (Vector Laboratories Inc, Burlingame, CA, USA). The PVDF membrane was blocked for 1 hour at room temperature with 5% BSA in TBS-T [TBS (140 mM NaCl, 10 mM Tris-HCl, pH 8.0) /0.05% Tween 20].
  • TBS-T TBS-T [TBS (140 mM NaCl, 10 mM Tris-HCl, pH 8.0) /0.05% Tween 20].
  • the membrane was incubated overnight at 4 ° C with biotin labeled lectins diluted 1: 500 in TBS-T. The membrane was then rinsed three times with TBS-T and incubated with ExtrAvidin-Peroxidase (2.0-2.5 mg / ml) diluted 1: 5,000 for 1 hour at room temperature, and finally rinsed five times with TBS-T for Supersignal The kit was processed.
  • the following experiment was performed for reblotting using anti-EPO antibody. Specifically, the same blots were subjected to reblotting using anti-EPO antibodies after lectin blots for controlling the number of EPO. That is, the membrane was incubated with stripping buffer (CANDOR Bioscience GmbH, Wangen imallgau, Germany) for 30 minutes at room temperature and washed five times with TBS-T. The membrane was incubated overnight with mouse anti-EPO antibody (100 ug / ml, Santa Cruz, CA) diluted 1 hour at room temperature with 5% BSA and diluted 1: 10,000 in TBS-T. After incubation, the membrane was washed 5 times with TBS-T and treated using a Supersignal kit. Blotting indices were calculated as band intensities in lectin blots and divided by riblot band intensities in western blots using anti-EPO antibodies.
  • stripping buffer CANDOR Bioscience GmbH, Wangen imallgau, Germany
  • N-glycan mass spectrometry using LC / MS and MALDI was performed to confirm the quantitative change in sugar chain structure by polylactosamine inhibition through siRNA of ⁇ 3gnt2 gene.
  • purified rhEPO was denatured by rapid thermal cycling (25-100 ° C.) in an aqueous solution of 100 mM ammonium bicarbonate and 5 mM dithiothreitol. After cooling, 2.0 ul (or 1000 U) of peptide N-glycosidase F was added, then mixed and incubated in a 37 ° C. water base for 16 hours.
  • the rhEPO digest was loaded into the cartridge and washed with pure water to remove salts and other buffer material. N-glycans were eluted in water (acidic fraction) by the addition of 40% acetonitrile / 0.05% trifluoroacetic acid. The sample was dried under vacuum.
  • rhEPO N-glycan fractions were redissolved in water and 1.0 ul (corresponding to 1 ug of rhEPO) was spotted on stainless steel target plates.
  • Neutral glycans were analyzed in cationic mode ([M + Na] + or [M + H] + ), while acidic glycans were analyzed in anionic mode ([M - H] - ).
  • Each acquired spectrum showed a combined signal from 800 laser shots at three random locations in the field (2400 laser shots in total). Mass spectra were recorded over a range of m / z 2000-4500. Maltooligosaccharide ladder was used for external mass calibration.
  • MS peaks were filtered with a signal-to-noise ratio of 5.0 and deconvolution was performed to obtain a list of compound masses and intensities.
  • the N-glycan fractions were combined and an amount of 2.0 ⁇ L (corresponding to 800 ng EPO) was injected into the porous graphite carbon nano-LC chip (Agilent) with an automatic sample injector.
  • Analytical column to elevate rapid glycan elution gradient from 6% to 100% B for 20 minutes using (A) 3.0% acetonitrile / 0.1% formic acid solution and (B) 90.0% acetonitrile / 0.1% formic acid solution was applied at 0.3 ⁇ L / min.
  • the remaining non-glycan compound was washed with 100% B and then equilibrated.
  • MS spectra were acquired in cation mode in the mass range of m / z 500-2000 with an acquisition time of 1.5 seconds per spectrum.
  • EC2-1H9 cells which are CHO cells that produce recombinant human EPO, Hyo Jeong Hong (Antibody Engineering Research Unit, Korea Research Institute of Bioscience and Biotechnology, Yuseong-gu, Daejeon, Korea).
  • Cells were supplemented with 10% (v / v) dFBS (Gibco), 3.5 g / L glucose, 20 nM MTX (methotrexate; Sigma), and 1% (v / v) Ab-Am (antibiotic-antimycotic solution; Gibco) was maintained in a humidified environment containing 37%, 5% CO 2 in MEM- ⁇ (Gibco).
  • gRNAs guide RNAs
  • gRNAs DNA sequences encoding gRNAs (guide RNAs) used to prepare recombinant vectors for knocking out the ⁇ 3gnt2 gene were obtained from CPRISPy, a web-based CRISPR design tool specific to the CHO-K1 genome.
  • gRNAs are DNA sequences (synthetic oligonucleotides) that encode the gRNA sequences that are specifically designed to recognize the ⁇ 3gnt2 gene of the Chinese hamster and each knock out the DNA strand of the ⁇ 3gnt2 gene. This is represented by SEQ ID NOs: 10 to 13 in Table 1 below.
  • DNA sequences encoding gRNA sequences include a UC promoter expressing gRNA and a G9 tagged Cas9 enzyme that recognizes the expressed gRNA.
  • -Guide-EF1a vector Origene, Rockville, Maryland was inserted. The vector was used as a template for generating gRNA from DNA represented by the nucleotide sequences of SEQ ID NOs: 10 to 13 and Cas9 mRNA from the Cas9 DNA sequence represented by the nucleotide sequences of SEQ ID NO: 14 during in vivo transcription.
  • the Cas9 gene is linked to a gene encoding GFP through a linker 2A peptide, so that Cas9 protein and GFP protein can be expressed at a time.
  • the cleavage map of the recombinant vector prepared through the above process is shown in FIG. 7, and the entire nucleotide sequence of the recombinant vector is represented by SEQ ID NOs: 15 to 18.
  • the prepared pCas-B3gnt2-EF1a vector was transformed into EC2-1H9 cells of Example ⁇ 3-1> using Lipofectamine TM 2000 (Invitrogen, Carlsbad, Calif.).
  • Non-homologous end-joining occurs in the genome region when a specific region of the genome is inserted by the CRISPR / Cas9 system. After denaturation of this type of DNA followed by hybridization by lowering the temperature, a hetero duplex is formed in which a non-inserted wild type (WT) DNA and an inserted clone's DNA bind in a mismatch form. ) And T7E1 recognizes and cuts these mismatched DNA regions.
  • WT wild type
  • T7E1 recognizes and cuts these mismatched DNA regions.
  • Example ⁇ 3-2> the frequency (Indel,%) of gene insertion / deletion by gRNA was measured prior to constructing a stable cell line in which the B3gnt2 gene was knocked out through the CRISPR / Cas9 system. T7E1 assay was performed.
  • genomic DNA was extracted and quantified from the transformed cells, and PCR was performed using 200 ng of genomic DNA as a template, and the primer pairs used cover all four kinds of gRNA recognition sites.
  • 849 bp (Forward: 5'- GCA TTG TGG ATC ACG TCA CCT ATA AAC-3 '(SEQ ID NO: 19) / Reverse: 5'- CCA GAT ATG AGA AAT GAG TGT TGG ACG -3' Number 20)).
  • 2 ⁇ l of PCR products were electrophoresed using 1.5% Agarose gel and purified using a kit (qiaquick pcr purification kit; Qiagen) after confirming the correct product size.
  • T7E1 T7 Endonuclease 1
  • Indel is the ratio of the intensity of the entire band (the band at the uncut WT position + the band of the fragments cut out) and the bands of the cut fragments (the bands of the fragments are created at two positions by cutting a specific position). (%, genome edition efficiency).
  • ⁇ Example 3> cells in which the ⁇ 3gnt2 gene was knocked out through the CRISPR / Cas9 system were selected for clones successfully transformed by flow cytometry (Beckman coulter Inc, Brea, CA) for 3 weeks ( 8a). Selected clones (clone 1: 9 of gRNA-1 / clone 2: gRNA-4 2 / clone 3: gRNA-4 / clone 4: gRNA-4 16) Sanger-sequencing according to PCR based on genomic DNA It was confirmed by (FIG. 8B).
  • EC2-1H9 cells 5.0x10 6 confirmed that the ⁇ 3gnt2 gene was knocked out were 10% (v / v) dFBS, 3.5 g / L glucose, 1% (v / v) Ab-Am solution, and 20 nM MTX Incubated in a T175 culture flask containing this supplemented MEM- ⁇ .
  • Culture medium containing recombinant human derived erythropoietin (rhEPO) was used for SDS-PAGE and then transferred to PVDF membrane (Millipore Corp., Bedford, Mass.).
  • the PVDF membrane was biotin-labeled lectin (Lycopersicon Esculentum Lectin; LEL) was incubated at 4 ° C. for 16 hours. After washing three times for 5 minutes using TBS-T, the membrane was incubated with ExtrAvidin-peroxidase (Sigma) at room temperature for 1 hour and then developed with an ECL kit (Thermo Scientific; Rockford, IL).
  • the membrane was stripped at room temperature for 1 hour using a stripping buffer (Candor Bioscience GmbH, Weissensberg, Germany). PVDF membranes were washed three times with TBS-T for 5 minutes and then incubated with RP labeled anti-mouse IgG antibody (Santa Cruz) diluted 1: 5000 for 1 hour at room temperature. The membrane was developed with ECL solution (Thermo Scientific; Rockford, IL).
  • clone 1 9 of gRNA-1 / clone 2: gRNA-4 2 / clone 3: gRNA-4 12 / clone 4: gRNA-4 All of the EPO isolated from 16) showed no reaction with LEL (FIG. 9A).
  • EC2-1H9 cells 5.0x10 6 confirmed that the ⁇ 3gnt2 gene was knocked out were 10% (v / v) dFBS, 3.5 g / L glucose, 1% (v / v) Ab-Am solution, and 20 nM MTX Incubated in a T175 culture flask containing this supplemented MEM- ⁇ . Culture medium was replaced with serum-free medium (CHO-S-SFM II; Gibco) within 3 days. After 2 days, the culture medium was collected, filtered with a 0.45 um filter (Sartorius, Gottingen, Germany) and dialyzed overnight at 4 ° C. with phosphate buffer saline (PBS, pH 7.4).
  • PBS phosphate buffer saline
  • EPO purification gel (MAIIA Diagnostics, Uppsala, Sweden). Purified rhEPO was dialyzed with distilled water overnight at 4 ° C. The concentration was measured using a Quant-iT TM protein assay kit (Invitrogen) and stored at -80 ° C until use.
  • purified rhEPO was denatured by rapid thermal cycling (25-100 ° C.) in an aqueous solution of 100 mM ammonium bicarbonate and 5 mM dithiothreitol. After cooling, 2.0 ul (or 1000 U) of peptide N-glycosidase F was added, then mixed and incubated in a 37 ° C. water base for 16 hours.
  • the rhEPO digest was loaded into the cartridge and washed with pure water to remove salts and other buffer material. N-glycans were eluted in water (acidic fraction) by the addition of 40% acetonitrile / 0.05% trifluoroacetic acid. The sample was dried under vacuum.
  • rhEPO N-glycan fractions were redissolved in water and 1.0 ul (corresponding to 1 ug of rhEPO) was spotted on stainless steel target plates.
  • Neutral glycans were analyzed in cationic mode ([M + Na] + or [M + H] + ), while acidic glycans were analyzed in anionic mode ([M - H] - ).
  • Each acquired spectrum showed a combined signal from 800 laser shots at three random locations in the field (2400 laser shots in total). Mass spectra were recorded over a range of m / z 2000-4500. Maltooligosaccharide ladder was used for external mass calibration.
  • MS peaks were filtered with a signal-to-noise ratio of 5.0 and deconvolution was performed to obtain a list of compound masses and intensities.
  • the N-glycan fractions were combined and an amount of 2.0 ⁇ L (corresponding to 800 ng EPO) was injected into the porous graphite carbon nano-LC chip (Agilent) with an automatic sample injector.
  • Analytical column to elevate rapid glycan elution gradient from 6% to 100% B for 20 minutes using (A) 3.0% acetonitrile / 0.1% formic acid solution and (B) 90.0% acetonitrile / 0.1% formic acid solution was applied at 0.3 ⁇ L / min.
  • the remaining non-glycan compound was washed with 100% B and then equilibrated.
  • MS spectra were acquired in cation mode in the mass range of m / z 500-2000 with an acquisition time of 1.5 seconds per spectrum.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은 폴리락토사민의 생합성에 관여하는 β3gnt2 유전자의 발현을 억제(녹다운)하거나 β3gnt2 유전자를 녹아웃시킨 세포주로부터 생산된 재조합 인간 유래 에리스로포이에틴에서 폴리락토사민의 감소를 확인, 그에 따른 N-글리칸의 삼중 및/또는 사중 안테나 구조 증가를 확인함으로써 당단백질의 반감기 증가 및 당단백질 효능에 긍정적인 역할이 가능함을 확인한 바, 본 발명의 방법을 통해 반감기를 증가시킨 재조합 당단백질의 제조가 가능함을 확인하였다.

Description

폴리락토사민 생합성 저해에 의한 N-결합 당쇄 안테나구조가 강화된 재조합 당단백질 제조방법
본 발명은 β3gnt2(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2) 유전자의 발현을 억제(knock-down), 또는 β3gnt2 유전자를 녹-아웃(knock-out)하는 단계를 통해 폴리락토사민의 생합성 억제함으로써 반감기가 증가된 당단백질(glycoproteins) 제조방법에 관한 것이다.
당화(glycosylation)는 포유동물 세포에서 주요한 번역 후 수식에 해당되고, 두 분류, N- 및 O- 연결 당화로 나뉜다. N-연결 당화는 다수의 당단백질에서 Asn(Asn-X-Ser/Thr 모티프)에 부착되어 있다. 당화는 효소 활성, 단백질 안정성, 및 면역원성에 영향을 준다.
뉴라민산(neuraminic acid; Neu)의 아실유도체의 총칭인 시알산(sialic acid)은 당화 과정에 요구되는 당전구체 구성의 필수 성분으로 지금까지 자연계에서 약 50 여종의 시알산이 부가된 당쇄 전구체들이 발견되었다. 시알산은 포유류에 있어서 세포간 상호작용, 세포 내의 시그널을 결정하는 전구체의 역할, 당단백질의 안정화 등 세포 내의 생물학적 현상에 중요한 역할을 한다. 시알산은 1936년 Blix에 의해 소 타액선(bovine salivary gland)의 뮤신(mucin)으로부터 최초로 분리되었고, 9개의 탄소로 구성되어 있으며 COOH- 기를 가지고 있는 산성당(acidic sugar)으로서 알려져 있다. 또한, 시알산은 치환기의 차이에 의해 23 종류의 시알산이 보고되어 있으며 이들은 생물종이나 조직에 특이적인 분포를 나타내고 있는 것으로 알려져 있다. 고등동물에서 시알산은 당단백질, 당지질, 올리고당 당쇄의 Gal, GlcNAc, GalNAc 및 시알산에 각각 특이적인 시알산 전이효소의 작용에 의해 α-글리코시드 결합으로 연결되어 있다.
복합당질 당쇄의 시알산은 세포막 표면에 존재하는 당쇄 구조에서 가장 말단에 위치하고 있기 때문에 세포와 세포외 환경과의 접촉에 직접적으로 관여하고 있을 것으로 예상되었고, 오래전부터 체액 중의 혈구세포나 당단백질의 수명이 시알산의 제거에 의해 단축되는 것으로 알려져 있다. 이러한 예로서 적혈구 세포막의 시알산이 제거되면(asialylation) 갈락토스가 세포 표면에 노출되어 쿱퍼(Kupffer) 세포 표면상의 갈락토스와 특이적으로 결합하는 수용체 렉틴(lectin)과 결합함으로써, 수용체 매개된 내포작용(receptor-mediated endocytosis)에 의해 순환계로부터 제거되며, 시알산이 제거된 아사이알로(asialo) 당단백질도 간세포(hepatocyte) 표면의 렉틴에 의해 결합되어 적혈구 세포와 비슷한 경로로 순환계로부터 제거된다. 또한, 시알로 결합을 가지는 당단백질인 알파-안티트립신(alpha-antitrypsin), 콜린에스테라제(cholinesterase), 융모성 고나도트로핀(chorionic gonadotropin), CTLA4Ig, 인자 VIII(Factor VIII), 감마-글루타밀트랜스퍼라아제(gamma-glutamyltransferase), 과립구 콜로니 자극인자(granulocyte colony-stimulating Factor, G-CSF) 및 황체형성호르몬(luteinizing hormone, LH)은 시알산이 결합된 당단백질의 경우 시알산이 결합되지 않은 것에 비해 당단백질의 반감기가 현저하게 증가하는 것으로 보고되었다(Ngantung FA. et al., 2006, Biotechnol. Bioeng 95(1), 106-119).
시알로 결합을 가진 당단백질 중에서 에리스로포이에틴(erythropoietin, EPO)은 적혈구 생성을 유도하는 당단백질 호르몬으로서, 재조합 EPO는 빈혈치료제로 이용되고 있다. 야생형의 EPO는 N- 결합 당쇄 3개 및 O- 결합 당쇄 1개를 가지며, 하나의 N- 결합 당쇄에는 최대 4개의 시알산(sialic acid)이, 하나의 O- 결합 당쇄에는 최대 2개의 시알산이 결합할 수 있어서 잠재적으로 한 분자의 EPO는 총 14개의 시알산이 결합할 수 있다. 상기 당단백질과 마찬가지로 EPO 단백질에서 시알산이 당쇄에 결합되어 있는 경우, 간에 존재하는 탈시알로당단백수용체와의 결합을 막아 간에서 EPO가 분해되는 것을 방지한다.
폴리락토사민은 N-아세틸글루코사민(N-acetylglucosamine, GlcNAc)와 갈락토오스(Galactose)가 연속적으로 반복되는 구조(Galbeta1-4GlcNAcbeta1-3)n로 당단백질 상에 존재하는 당사슬의 기초 구조 중의 하나이다. 일례로 EPO 같은 모델당단백질에서 폴리락토사민은 전체 N-글리칸 중 약 10 내지 20%를 차지하는데 마우스를 이용한 실험에서 폴리락토사민이 포함된 EPO는 상기 시알산에 의한 당단백질의 표면상의 갈락토오스 보호 효과와 무관하게 체내 반감기가 현저히 감소한다는 것이 보고 되었다.
Figure PCTKR2017008521-appb-I000001
(그림 1. 폴리락토사민의 구조적 특징)
1970년대 DNA의 특정 서열을 인지해 자르는 제한효소가 발견될 것을 시작으로 유전자 조작기술은 시대에 시대를 거듭하여 급격하게 발전해 왔다. 하지만 제한효소를 활용한 유전자 조작기술은 그 한계가 명확했다. 구체적으로, 제한효소는 6~8 개 정도의 인식할 수 있는 유전자 서열의 길이가 매우 짧아, 약 46(4,096) 개의 순서쌍 밖에 구분하지 못하는 문제가 존재했다. 반면에 CRISPR/CAS9 시스템은 이러한 한계가 없어 이론적으로 인간 이상의 고등 생명체에도 적용 가능하다.
CRISPR/CAS9 시스템은 크리스퍼(Clustered regularly interspaced short palindromic repeat, CRISPR) 유전자 가위라 불리는 게놈 편집 방법으로, 특정 염기서열에 특이적으로 결합하는 RNA(gRNA)와 특정한 염기서열을 자르는 가위 역할인 Cas9 nuclease로 구성된다. 이러한 CRISPR/CAS9 시스템을 이용하면 세포나 동물에 플라스미드(Plasmid) DNA를 도입하여 특정 유전자의 기능을 억제할 수 있는 녹-아웃(knock-out)이 가능하다.
CRISPR/CAS9 시스템은 불과 몇 년 전에 과학자들에 의해 발견된 것으로, 박테리아 등 단세포 유기체가 박테리오파지로부터 스스로를 지키는 아주 오래된 방법이다. 유기체가 박테리오파지의 DNA를 잘라 자신의 유전자에 붙여 기억하여 적응면역을 통해 살아남는 것으로 수백만 년에 걸쳐 진화되었고, 이것이 연구실에서 유기체의 DNA를 빠르게 편집할 수 있는 간단하고 명쾌한 방법으로 연구되었다. 구체적으로, 본래의 CRISPR/CAS9 시스템은 박테리아가 이전에 침입했던 바이러스의 DNA 일부를 자신의 유전체에 저장해둔 후, 바이러스가 침입할 때에 그 정보를 다시 꺼내어 바이러스 DNA만을 찾아 절단하는 데 쓰는 박테리아의 자기보호 메커니즘이다. 이를 유전체공학에 이용함으로써, 특정 유전자의 염기서열을 찾아가는 시발체(Primer)를 제작해 절단 효소인 Cas9 효소와 짝을 이루어 표적이 되는 DNA 염기서열에 달라붙어 DNA 절단이 일어난다. 따라서 DNA 복원(수선) 과정에서 돌연변이가 발생하게 된다.
이에 본 발명자들은 당단백질의 분해 저항성을 높여, 체내 활성을 높이기 위한 방법으로 당단백질에서 폴리락토사민(polylactosamine)의 함량을 줄이기 위해 siRNA를 이용하여 폴리락토사민 합성에 관여하는 유전자를 녹-다운(knock-down)시킨 CHO 세포주, 및 CRISPR/CAS9 시스템을 이용하여 폴리락토사민 합성에 관여하는 유전자를 녹-아웃(knock-out)시킨 CHO 세포주를 구축하였으며, 이로부터 생산된 당단백질은 폴리락토사민 감소에 따라 삼중(Tri-) 및/또는 사중 안테나(Tetra-antennary) 구조가 증가하였고, 이로 인한 당단백질의 반감기 증가는 당단백질의 효능에 긍정적인 역할을 할 수 있음을 확인함으로써 본 발명을 완성하였다.
본 발명의 목적은 폴리락토사민의 생합성이 억제된 세포주로부터 반감기가 증가된 당단백질의 제조방법을 제공하는 것이다.
상기 목적을 달성하기 위하여, 본 발명은 당단백질을 생성하는 세포주에서 폴리락토사민(Polylactosamine)의 생합성을 억제시키는 단계를 포함하는, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법을 제공한다.
또한, 본 발명은 상기 방법으로 제조된 재조합 세포주를 제공한다.
또한, 본 발명은
1) 상기 재조합 세포주를 배양하는 단계; 및
2) 상기 단계 1)의 배양액에서 재조합 당단백질을 분리하는 단계를 포함하는 반감기가 증가된 재조합 당단백질의 제조방법을 제공한다.
또한, 본 발명은 상기 방법으로 분리된, 반감기가 증가된 재조합 당단백질을 제공한다.
아울러, 본 발명은 서열번호 10 내지 13으로 구성된 군으로부터 선택되는 어느 하나의 가이드 RNA를 암호화하는 염기서열; 및 서열번호 14로 기재되는 염기서열로 구성되는 Cas9 유전자를 포함하는, 재조합 벡터를 제공한다.
본 발명은 폴리락토사민의 생합성에 관여하는 β3gnt2 유전자의 발현을 억제(녹다운)하거나 β3gnt2 유전자를 녹아웃시킨 세포주로부터 생산된 재조합 인간 유래 에리스로포이에틴에서 폴리락토사민의 감소를 확인, 그에 따른 N-글리칸의 삼중 및/또는 사중 안테나 구조 증가를 확인함으로써 당단백질의 반감기 증가 및 당단백질 효능에 긍정적인 역할이 가능함을 확인한 바, 본 발명의 방법을 통해 반감기를 증가시킨 재조합 당단백질의 제조가 가능함을 확인하였다.
도 1은, CHO 세포 내 폴리락토사민 합성 유전자 후보군(β3gnt 1∼9)의 발현 양상을 비교한 도이다.
도 2는, β3gnt2의 발현 억제(knock-down)를 위한 siRNA의 위치 및 서열을 나타낸 도이다.
도 3은, siRNA-1, siRNA-2 및 siRNA-3에 의한 유전자 발현 양상 및 그에 따른 웨스턴 블로팅 결과를 통해 siRNA 후보군 중 siRNA-2를 선정한 결과를 확인한 도이다:
도 3a: siRNA-1, siRNA-2 및 siRNA-3에 의한 유전자 발현 양상 확인 결과;
도 3b: siRNA-1, siRNA-2 및 siRNA-3에 의한 웨스턴 블로팅 결과;
도 3c: siRNA-2에 의한 웨스턴 블로팅 결과;
도 3d: siRNA-2에 의한 웨스턴 블로팅의 상대적 강도 확인 결과.
도 4는, siRNA-2에 의한 폴리락토사민 억제에 의한 당쇄 구조의 정량적 변화를 확인한 도이다:
도 4a: siRNA-2에 의한 폴리락토사민 비율 감소 확인;
도 4b: siRNA-2에 의한 삼중(Tri-) 및 사중 안테나(Tetra-antennary) N-글리칸의 증가 확인.
도 5는, siRNA-2에 의한 폴리락토사민 Glycan 구조들의 전체적인 프로파일 확인을 위한 MALDI-TOF MS 결과이다:
도 5a: 대조군;
도 5b: siRNA-2 처리군.
도 6은, siRNA-2에 의한 폴리락토사민 구조의 정량적 변화 확인을 위한 LC/MS 결과이다:
도 6a: 대조군;
도 6b: siRNA-2 처리군.
도 7은, gRNA-1, gRNA-2, gRNA-3 및 gRNA-4에 의해 β3gnt2의 녹-아웃(knock-out)된 결과를 나타낸 도이다:
도 7a: CRISPR/Cas9 시스템을 이용한 벡터의 개열 지도;
도 7b: T7 Endonuclease 1(T7E1) 어세이 후, 아가로스 겔 결과;
도 7c: T7 Endonuclease 1(T7E1) 어세이 후, 유전자의 삽입/결실 빈도(Indel) 결과(gRNA-1: 1, gRNA-2: 2, gRNA-3: 3, gRNA-4: 4).
도 8은, CRISPR/Cas9 시스템을 통해 β3gnt2 유전자가 녹아웃된 성공적으로 형질전환된 클론 선택 결과를 나타낸 도이다(1= gRNA-1, 2= gRNA-2, 3= gRNA-3, 4= gRNA-4):
도 8a: 유동세포계측법(Flow cytometry) 수행 결과;
도 8b: 대조군(WT)과 비교해서 인델(indel)이 확인된 클론들을 선별한 후 생거-시퀀싱(sanger-sequencing) 결과(삭제, 삽입 및 PAM 서열(GGC, AGG, CCC, CCT)).
도 9는, β3gnt2의 녹-아웃을 통한 폴리락토사민의 발현 감소 확인한 도이다:
도 9a: 선택된 클론(클론 1: gRNA-1의 9 / 클론 2: gRNA-4의 2 / 클론 3: gRNA-4의 12 / 클론 4: gRNA-4의 16)의 웨스턴 블로팅;
도 9b: 폴리락토사민 비율 감소 확인;
도 9c: 삼중(Tri-) 및 사중 안테나(Tetra-antennary) N-글리칸의 증가 확인.
이하, 본 발명을 상세히 설명한다.
본 발명은 당단백질을 생성하는 세포주에서 폴리락토사민(Polylactosamine)의 생합성을 억제시키는 단계를 포함하는, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법을 제공한다.
상기 당단백질은 에리스로포이에틴(erythropoietin), 트롬보포이에틴(thrombopoietin), 알파-안티트립신(alpha-antitrypsin), 콜린에스테라제(cholinesterase), 융모성 고나도트로핀(chorionic gonadotropin), CTLA4Ig, Factor VIII, 감마-글루타밀트랜스퍼라아제(gamma-glutamyltransferase), 과립구 콜로니 자극인자(granulocyte colony-stimulating Factor, G-CSF) 및 황체형성호르몬(luteinizing hormone, LH)으로 구성된 군으로부터 선택되는 어느 하나인 것일 수 있으며, 구체적으로는 에리스로포이에틴일 수 있으나, 이에 한정되지 않는다.
상기 폴리락토사민의 생합성 억제를 위해서 구체적으로는 β3gnt2(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2) 유전자의 발현을 녹-다운(knock-down)시키거나, β3gnt2 유전자를 녹-아웃(knock-out)시키는 단계를 포함하는 것일 수 있다.
상기 β3gnt2 유전자의 mRNA는 서열번호 1로 기재되는 염기서열로 구성될 수 있다.
상기 β3gnt2 유전자 발현의 녹-다운은, 구체적으로 β3gnt2 유전자 억제제를 처리하거나, 또는 β3gnt2 mRNA에 결합하는 안티센스 뉴클레오티드, siRNA, shRNA 및 miRNA로 구성된 군으로부터 선택되는 어느 하나를 당단백질을 생산하는 세포주에 형질감염시키는 것일 수 있으며, 더욱 구체적으로는 β3gnt2 mRNA에 결합하는 siRNA를 당단백질을 생산하는 세포주에 형질감염시키는 것일 수 있다.
상기 siRNA는 서열번호 2, 서열번호 4 및 서열번호 6으로 구성된 군으로부터 선택되는 어느 하나의 염기서열을 포함할 수 있으나, 이에 한정되지 않는다.
상기 siRNA는 상기 표적서열에 상동인 독립적인 센스 RNA 가닥 및 이에 상보적인 안티센스 RNA 가닥을 포함하거나 상기 센스 RNA 가닥 및 안티센스 RNA 가닥이 루프에 의해 연결된 스템-루프 구조의 단일 RNA 가닥일 수 있다.
상기 siRNA는 RNA끼리 짝을 이루는 이중사슬 RNA 부분이 완전히 쌍을 이루는 것에 한정되지 않고, 스템-루프(stem-loop)의 구조를 이루는 헤어핀 구조를 가질 수 있는데, 이를 특히 shRNA(short hairpin RNA)라 지칭한다. 한편, 상기 이중사슬 또는 스템 부위는 미스매치(대응하는 염기가 상보적이지 않음), 벌지(일방의 사슬에 대응하는 염기가 없음) 등에 의하여 쌍을 이루지 않는 부분이 포함될 수도 있다. 전체 길이는 10 내지 80 염기, 바람직하게는 15 내지 60 염기, 더욱 바람직하게는 20 내지 40 염기이다. 또한, 상기 루프 영역은 서열에 특별한 의미가 없으며, 단지 센스서열과 안티센스서열을 적당한 간격으로 연결하기 위하여 3-10 정도의 염기를 가지고 있으면 족하다. 종래에 siRNA의 루프 영역으로 많이 사용되어온 예들은 다음과 같다: AUG(Sui et al., Proc. Natl. Acad. Sci. USA 99(8):5515-5520, 2002), CCC, CCACC 또는 CCACACC(Paul et al., Nature Biotechnology 20:505-508, 2002), UUCG(Lee et al., Nature Biotechnology 20:500-505), CTCGAG, AAGCUU(Editors of Nature Cell Biology Whither RNAi, Nat Cell Biol. 5:489-490, 2003), UUCAAGAGA(Yu et al., Proc. Natl. Acad. Sci. USA 99(9):6047-6052, 2002) 및 TTGATATCCG(www.genscript.com의 default spacer). siRNA 말단 구조는 평활(blunt)말단 혹은 점착(cohesive) 말단 모두 가능하다. 점착 말단 구조는 3' 말단 돌출한 구조(protruding structure)와 5' 말단 쪽이 돌출한 구조가 모두 가능하고 돌출하는 염기 수는 한정되지 않는다. 예를 들어, 염기 수로는 1 내지 8 염기, 바람직하게는 2 내지 6 염기로 할 수 있다. 또한, siRNA는 표적유전자의 발현억제 효과를 유지할 수 있는 범위에서 예를 들어, 한쪽 말단의 돌출 부분에 저분자 RNA(예를 들어, tRNA, rRNA, 바이러스 RNA와 같은 천연의 RNA분자 또는 인공의 RNA분자)를 포함할 수 있다. siRNA 말단구조는 양측 모두 절단 구조를 가질 필요는 없고, 이중사슬 RNA의 일방의 말단 부위가 링커 RNA에 의하여 접속된 스템 루프형 구조일 수도 있다. 링커의 길이는 스템 부분의 쌍을 이루는 데 지장이 없는 길이면 특별히 한정되지 않는다.
더불어, 본 발명에 따른 siRNA에서, 센스 RNA 가닥 및/또는 안티센스 RNA가닥은 이의 당 부분, 뉴클레오베이스 부분 또는 인터뉴클레오타이드 구조 내에 최소한 1개의 화학적 변형을 포함하는 것이 가능하다. 이러한 변형은 생체 내에서 뉴클레아제에 의해 siRNA의 파괴를 저해하는 것을 가능하게 할 수 있다. 본 발명에 따른 siRNA의 안정성과 생적합성을 생체 내에서 향상시킬 수 있는 모든 화학적 변형이 본 발명의 범위에 포함된다. 당 부분 에 대한 바람직한 변형 중에서, 언급될 수 있는 것은 2'-데옥시, 2'-플루오로, 2'-아미노, 2'-티오, 또는 2'-O-알킬과 같은 리보오스의 포지션 2', 그리고 바람직하게는 리보뉴클레오타이드 상의 정상 2'-OH 그룹을 대체하는 2'-O-메틸 또는 LNA의 포지션 2' 및 4' 사이에 있는 메틸렌 브릿지의 존재에서 일어나는 변형이다. 뉴클레오베이스의 경우, 5-브로모-유리딘, 5-이오도-유리딘, N3-메틸-유리딘, 2,6-디아미노퓨린(DAP, 5-메틸-2'-데옥시시티딘, 5-(1-프로피닐)-2'-데옥시-유리딘(pdU), 5-(1-프로피닐)-2'-데옥시시티딘(pdC)과 같은 변형된 염기 또는 콜레스테롤과 결합한 염기를 이용하는 것이 가능하다. 마지막으로, 인터뉴클레오타이드 골격의 바람직한 변형은 포스포로티오에이트(phosphorothioate), 메틸포스포네이트, 포스포로디아미데이트 그룹에 의한 골격에 있는 포스포디에스터 그룹을 치환하는 것을 포함하거나, 펩타이드 결합에 의해 연결된 N-(2-아미노에틸)-글리신(PNA, 펩타이드 핵산)으로 구성되는 골격을 이용한다. 다양한 변형(염기, 당, 골격)은 몰포리노(morpholino) 타입의 변형된 핵산(몰포린 링에 고정되고 포스포로디아미데이트 그룹에 의해 연결된 염기) 또는 PNA(펩타이드 결합에 의해 연결된 N-(2-아미노에틸)-글리신 단위에 고정된 염기)에 결합될 수 있다.
상기 형질감염은 리포펙타민(Lipofectamine), Dojindo사의 Hilymax, Fugene, jetPEI, Effectene 및 DreamFect으로 이루어진 군으로부터 선택되는 어느 하나의 상용화된 형질도입용 시약; 칼슘-인산(calcium-phosphate), 양전하성 고분자, 리포좀, 나노입자, 뉴클레오펙션(nucleofection), 전기천공법(electroporation), 열충격(heatshock), 마그네토펙션(magnetofection)을 이용하는 방법을 이용하는 방법으로 이루어진 군으로부터 선택되는 어느 하나를 이용하여 수행될 수 있다.
상기 β3gnt2 유전자의 녹-아웃은 구체적으로, β3gnt2 유전자를 녹-아웃시킬 수 있는 재조합 벡터를 당단백질을 생성하는 세포주에 형질전환하는 것일 수 있다.
상기 β3gnt2 유전자를 녹-아웃시킬 수 있는 재조합 벡터는 구체적으로, 서열번호 10 내지 13으로 구성된 군으로부터 선택되는 어느 하나의 가이드 RNA(guide RNA; gRNA)를 암호화하는 염기서열 및 서열번호 14로 기재되는 염기서열로 구성되는 Cas9(CRISPR associated protein 9) 유전자를 포함하는 것일 수 있고, 상기 재조합 벡터는 Cas9 유전자와 형광단백질을 코딩하는 유전자가 결합되어 있는 구조를 포함하는 것일 수 있다.
구체적으로, 상기 β3gnt2 유전자를 녹-아웃시킬 수 있는 재조합 벡터는 서열번호 15 내지 18로 구성되는 군으로부터 선택되는 어느 하나의 염기서열을 포함할 수 있으나, 이에 한정되는 것은 아니다.
상기 방법에 있어서, 상기 세포주는 포유동물 세포(mammalian cells), 효모 세포(yeast cells) 또는 곤충 세포(insect cells)를 사용할 수 있고, 상기 포유동물 세포는 중국 햄스터 난소 세포(chinese hamster ovary cells, CHO), HT-1080, 인간 림프아구(human lymphoblastoid), SP2/0(마우스 골수종), NS0(마우스 골수종), 베이비 햄스터 신장세포(baby hamster kidney cells, BHK), 인간 배아 신장세포(human embryonic kidney cells, HEK), PERC.6(인간 망막세포) 및 EC2-1H9 세포로 구성된 군으로부터 선택되는 어느 하나인 것일 수 있으며, 중국 햄스터 난소 세포(Chinese hamster ovary cells, CHO)인 것이 가장 바람직하나 이에 한정되지 않는다.
본 발명의 구체적인 실시예에서, 폴리락토사민 합성 관련 9종류의 유전자 후보군의 발현양상을 확인한 결과, β3gnt2 유전자가 가장 발현량이 높아 폴리락토사민 구조 합성에 가장 크게 관여할 타겟 유전자로 선정하였으며, β3gnt2의 발현을 저해할 타겟 siRNA 를 제작하였다(도 1 및 도 2 참조). 본 발명에서 제작한 siRNA에 의한 β3gnt2 유전자의 발현 억제와 그로 인한 폴리락토사민의 합성저해를 확인하기 위해 siRNA 처리된 CHO 세포에서 생산된 EPO를 대상으로 락토사미닐 반복(lactosaminyl repeat) 구조와 특이적으로 결합하는 렉틴(LEL)을 이용해 면역 블로팅을 수행하였고, 그 결과 siRNA-2 처리에 의해 β3gnt2 발현이 저해된 EPO는 약 70%의 시그널 감소를 나타내는 것을 확인하였다(도 3 참조).
또한, 본 발명자들은 폴리락토사민 억제에 의한 당쇄 구조의 정량적 변화를 확인하였고, 그 결과 총 N-글리칸에서 폴리락토사민이 차지하는 비율이 기존의 약 19%에서 2% 가량으로 현저히 감소했음을 확인하였으며(도 4a), 폴리락토사민 구조가 줄어든 것을 확인할 수 있었다(도 5 및 도 6). 또한, 삼중(tri-) 및 사중 안테나(tetra-antennary) N-글리칸의 비율이 증가함을 확인하였다(도 4b 참조).
또한, 본 발명자들은 CRISPR/Cas9 시스템을 통한 β3gnt2 유전자 녹아웃 재조합 벡터를 제조하였고, 상기 재조합 벡터를 형질전환하여 녹아웃 효율을 확인하기 위해 T7E1 어세이를 수행한 결과 WT DNA에 비해 삽입된 세포의 DNA는 미스매치된 DNA 영역이 T7E1에 의해 잘려서 멀티 밴드(multi band)를 보이는 것을 확인하였으며(도 7b 참조), 유동세포계측법 및 생거-시퀀싱을 통해 녹아웃된 서열을 확인하였다(도 8 참조). 또한, β3gnt2 유전자가 녹아웃된 클론(클론 1: 15007-9 / 클론 2: 15402-2 / 클론 3: 15402-12 / 클론 4: 15402-16)으로부터 분리된 EPO는 모두 LEL와의 반응이 나타나지 않았으며(도 9a 참조), 총 N-글리칸에서 폴리락토사민이 차지하는 비율이 기존의 약 15%에서 2% 가량으로 현저히 감소했음을 확인하였다(도 9b 참조). 또한, 폴리락토사민이 감소함과 동시에 부가적으로 삼중(Tri-antennary) 및 사중 안테나(Tetra-antennary) N-글리칸의 비율이 증가함을 확인하였다(도 9c 참조).
따라서, 본 발명은 폴리락토사민의 생합성에 관여하는 β3gnt2 유전자의 발현을 억제(녹다운)하거나 β3gnt2 유전자를 녹아웃시킨 세포주로부터 생산된 재조합 인간 유래 에리스로포이에틴에서 폴리락토사민의 감소를 확인, 그에 따른 N-글리칸의 삼중 및/또는 사중 안테나 구조 증가를 확인함으로써 당단백질의 반감기 증가 및 당단백질 효능에 긍정적인 역할이 가능함을 확인한 바, 본 발명의 방법을 통해 반감기를 증가시킨 재조합 당단백질의 제조가 가능함을 확인하였다.
또한, 본 발명은 상기 방법으로 제조된 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주를 제공한다.
또한, 본 발명은
1) 상기 재조합 세포주를 배양하는 단계; 및
2) 상기 단계 1)의 배양액에서 재조합 당단백질을 분리하는 단계를 포함하는, 반감기가 증가된 재조합 당단백질의 제조방법을 제공한다.
상기 당단백질은 에리스로포이에틴, 트롬보포이에틴, 알파-안티트립신, 콜린에스테라제, 융모성 고나도트로핀, CTLA4Ig, Factor VIII, 감마-글루타밀트랜스퍼라아제, 과립구 콜로니 자극인자 및 황체형성호르몬으로 구성된 군으로부터 선택되는 어느 하나일 수 있고, 구체적으로는 에리스로포이에틴일 수 있으나, 이에 한정되지 않는다.
또한, 본 발명은 상기 방법으로 분리된, 반감기가 증가된 재조합 당단백질을 제공한다.
상기 방법으로 분리된 반감기가 증가된 재조합 당단백질은 N-글리칸(glycan)의 삼중(Tri-) 및/또는 사중-안테나(Tetra-antennary) 구조가 증가한 것을 특징으로 한다.
아울러, 본 발명은 서열번호 10 내지 13으로 구성된 군으로부터 선택되는 어느 하나의 가이드 RNA(guide RNA; gRNA)를 암호화하는 염기서열; 및 서열번호 14로 기재되는 염기서열로 구성되는 Cas9(CRISPR associated protein 9) 유전자를 포함하는, 재조합 벡터를 제공한다.
상기 재조합 벡터는 Cas9 유전자와 형광단백질을 코딩하는 유전자가 결합되어 있는 구조를 포함하는 것일 수 있으며, 구체적으로 상기 재조합 벡터는 서열번호 15 내지 18로 구성되는 군으로부터 선택되는 어느 하나의 염기서열을 포함하는 것일 수 있으나, 이에 한정되는 것은 아니다.
따라서, 본 발명은 폴리락토사민의 생합성에 관여하는 β3gnt2 유전자의 발현을 억제(녹다운)하거나 β3gnt2 유전자를 녹아웃시킨 세포주로부터 생산된 재조합 인간 유래 에리스로포이에틴에서 폴리락토사민의 감소를 확인, 그에 따른 N-글리칸의 삼중 및/또는 사중 안테나 구조 증가를 확인함으로써 당단백질의 반감기 증가 및 당단백질 효능에 긍정적인 역할이 가능함을 확인한 바, 본 발명의 방법을 통해 반감기를 증가시킨 재조합 당단백질의 제조가 가능함을 확인하였다.
이하, 본 발명을 실시예에 의해 상세히 설명한다.
단, 하기의 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기의 실시예에 한정되는 것은 아니다.
< 실시예 1> 폴리락토사민 ( Polylactosamine ) 합성 유전자의 siRNA의 제작
<1-1> 폴리락토사민 합성 관련 유전자의 확인
폴리락토사민의 합성은 갈락토스(galactose)에 β1,3-GlcNAc을 결합시키는 9종류(β3gnt1∼9)의 유전자가 관여하는데, 조직마다 혹은 세포종류마다 특이적으로 관여하는 유전자가 동일하지 않다. 이에 따라 9종류의 유전자 후보군의 발현양상을 비교하기 위해 3종류(EC2-1H9, 1098-2, CGT II-4)의 CHO 세포에서 qPCR을 수행하였다.
그 결과, 도 1에 나타낸 바와 같이 β3gnt2 유전자가 가장 발현량이 높아 폴리락토사민 구조 합성에 가장 크게 관여할 타겟 유전자로 선정하고, β3gnt2의 발현을 저해할 타겟 siRNA 를 제작하였다.
<1-2> β3gnt2 유전자의 siRNA 제작
β3gnt2 유전자의 siRNA를 제작하기 위해 siRNA 서열을 디자인하고 합성하였다.
도 2에 나타낸 바와 같이 코딩 영역 위치에서 햄스터 β3gnt2 mRNA (GenBank accession no. XM_003502146.2; 서열번호 1)를 억제하는 세 개의 영역(siRNA-499, siRNA-1101 및 siRNA-970)에서 siRNA 서열을 디자인 및 합성하였다. 상기 siRNA에 사용된 올리고뉴클레오티드는 표 1에 기재된 바와 같다.
siRNA 이름 올리고뉴클레오티드 이름 올리고뉴클레오티드 서열 cDNA 상 위치
siRNA-1 S-siRNA (서열번호 2) 5'-GAAGAAATGCGCAAAGAA-3' 499
A-siRNA (서열번호 3)(타겟서열) 5'-TTCTTTGCGCATTTCTTC-3'
siRNA-2 S-siRNA (서열번호 4) 5'-CTGGAATGTGCCTTCAGAA-3' 1101
A-siRNA (서열번호 5)(타겟서열) 5'-TTCTGAAGGCACATTCCAG-3'
siRNA-3 S-siRNA (서열번호 6) 5'-CATCCCAGAAGTCTTCTAT-3' 970
A-siRNA (서열번호 7)(타겟서열) 5'-ATAGAAGACTTCTGGGATG-3'
< 실시예 2> β3gnt2 유전자 넉다운 (knock-down) CHO 세포주의 구축
상기 실시예 <1-2>에서 제작한 β3gnt2 유전자의 siRNA를 이용하여 인간 EPO 생산 CHO 세포주에 형질감염하였다.
구체적으로, 재조합 인간 EPO 생산 CHO 세포주인 EC2-1H9는 Dr. Hyo Jeong Hong(Department of Systems Immunology, Kangwon National University, Chuncheon, Korea로부터 제공받았다. 세포는 10% dFBS (dialyzed fetal bovine serum; SAFC, US), 3.5 g/L glucose, 20 nM MTX (methotrexate; Sigma), 및 1% Ab-Am (Antibiotic-Antimycotic solution; Gibco)가 첨가된 MEM-α에서 37℃, 5% CO2의 환경에서 배양되었다.
상기 실시예 <1-2>에서 제작한 siRNA의 형질감염을 위해 EC2-1H9 세포는 제조업자의 프로토콜에 따라 Lipofectamine® RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA)를 이용하여 β3gnt2 특이적 또는 음성 대조군에 대한 siRNA(UGCG-specific siRNA) 10 μM로 형질감염하였다. 형질감염 24시간 후, 배지를 무혈청 배지(CHO-S-SFM II; Gibco)로 교환하고 37℃에서 5% CO2의 환경에서 추가적으로 3일간 배양하였다.
< 실험예 1> β3gnt2 발현 저해(knock-down)를 통한 폴리락토사민 합성 저해 확인
β3gnt2 유전자의 siRNA 처리에 의한 β3gnt2 유전자의 발현 억제와 그로 인한 폴리락토사민의 합성저해를 확인하기 위해 siRNA 처리된 CHO 세포에서 생산된 EPO를 대상으로 락토사미닐 반복(lactosaminyl repeat) 구조와 특이적으로 결합하는 렉틴(Lycopersicon Esculentum Lectin, LEL)을 이용해 면역브로팅(immunoblotting)을 수행하였다.
<1-1> β3gnt2 유전자 발현 확인
상기 <실시예 2>에서 구축한 재조합 CHO 세포의 총 RNA는 제조업자의 프로토콜에 따라 RNeasy® Mini (QIAGEN)를 이용하여 추출하였다. 1.0 ㎍의 RNA를 이용하여 AccuPower RT-PCR PreMix(Bioneer, Korea)을 이용하여 cDNA로의 역전사를 수행하였다. cDNA는 qPCR를 이용하여 β3gnt2의 mRNA 전사체를 확인하기 위한 템플레이트로 사용되었다. β3gnt2의 qPCR을 위해, 정방향(5'-CTG GCG ATT AAG TCC CTC ATT -3'; 서열번호 8) 및 역방향(5'-CTG GCG ATT AAG TCC CTC ATT -3'; 서열번호 9) 프라이머와 함께 iQTM SYBR® Green Supermix (Bio-Rad, Hercules, CA, USA)를 이용하였다.
<1-2> 재조합 인간 유래 에리스로포이에틴(recombinant human erythropoietin; rhEPO )의 분리
재조합 인간 유래 에리스로포이에틴(rhEPO)을 분리하기 위해, rhEPO를 포함하고 있는 배양 상등액을 취합하고, 0.45 μm-pore-size 멤브레인을 이용해 통과시켰다. 통과시킨 배양 배지는 농축하여 ultrafiltration(AmiconUltra; Millipore, Bedford, MA)을 통해 PBS 버퍼 교환하였다. 그리고, rhEPO는 면역크로마토그래피 컬럼(immunoaffinity chromatography column, MAiiA, Uppsala, Sweden)를 이용해 정제하였다. 샘플을 로딩한 후 PBS로 세척한 뒤, 잔존하는 rhEPO는 0.1 M glycine/0.5 M NaCl, pH 2.8로 용출하고, 용출액은 즉시 1.0 M Tris/HCl, pH 9.0로 중화하였다. 정제된 rhEPO는 농축한 뒤 ultrafiltration(AmiconUltra; Millipore)를 이용하여 증류수로 투석하였다. rhEPO의 농도는 Quant-iT™ protein assay kit(Invitrogen)를 이용하여 측정하였다.
<1-3> 폴리락토사민의 발현 확인을 위한 면역 블로팅
폴리락토사민의 발현 레벨을 확인하기 위해 렉틴 블랏(Lectin blot) 분석을 수행하였다. 구체적으로, Lycopersicon Esculentum Lectin(LEL)을 이용한 정제된 EPO 블로팅을 위해 상기 정제된 1 ㎍ EPO을 12.5% SDS PAGE에서 전기영동하고 PVDF 멤브레인(Millipore, Billerica, MA)로 옮겼으며, 바이오틴이 라벨된 LEL(Vector Laboratories Inc, Burlingame, CA, USA)로 블롯하였다. PVDF 멤브레인은 TBS-T[TBS(140 mM NaCl, 10 mM Tris-HCl, pH 8.0)/0.05% Tween 20]에서 5% BSA와 함께 1시간 동안 실온에서 블로킹(blocking)하였다. 블로킹 이후, 멤브레인은 TBS-T 내에서 1:500으로 희석된 바이오틴이 라벨된 렉틴과 함께 밤새 4℃에서 배양되었다. 이후 상기 멤브레인을 TBS-T로 3회 린스하고 1:5,000으로 희석된 ExtrAvidin-Peroxidase(2.0-2.5 mg/ml)와 함께 1시간 동안 실온에서 배양하여, 마지막으로 TBS-T로 5회 린스하여 Supersignal kit으로 처리하였다.
항-EPO 항체를 이용한 리블롯팅(Reblotting)을 위해 다음과 같은 실험을 수행하였다. 구체적으로, EPO의 개수 제어를 위해 렉틴 블롯 이후 같은 블롯은 항-EPO 항체를 이용하여 리블롯팅을 실시하였다. 즉, 멤브레인은 스트립핑 버퍼(stripping buffer)(CANDOR Bioscience GmbH, Wangen imallgau, Germany)와 함께 30분간 실온에서 배양하였으며 TBS-T로 5회 세척하였다. 상기 멤브레인은 5% BSA와 함께 1시간 동안 실온에서 블록하였고 TBS-T 에서 1:10,000로 희석한 마우스 항-EPO 항체(100 ug/ml, Santa Cruz, CA)와 함께 밤새 배양하였다. 배양 후, 상기 멤브레인은 TBS-T로 5회 세척하였으며, Supersignal kit을 이용하여 처리되었다. 블로팅 지수는 렉틴 블롯에서 밴드 강도로써 계산되었으며 항-EPO 항체를 이용하여 웨스턴 블롯에서 리블롯 밴드 강도에 의해 나뉘었다.
그 결과, 도 3에 나타낸 바와 같이 siRNA-1 처리보다 siRNA-2 및 siRNA-3에 의한 β3gnt2 발현 저해 효과가 큰 것을 확인하였으며(도 3a 및 도 3b), siRNA-2 처리에 의해 β3gnt2 발현이 저해된 EPO는 blotting 결과 약 70%의 시그널 감소를 나타내는 것을 확인하였다(도 3c 및 도 3d).
< 실험예 2> β3gnt2 발현 저해(knock-down)를 통한 rhEPO의 안테나( antennary ) 구조 증가 확인
β3gnt2 유전자의 siRNA를 통한 폴리락토사민 억제에 의한 당쇄 구조의 정량적 변화를 확인하기 위해 LC/MS 및 MALDI를 이용한 N-글리칸 질량분석을 수행하였다.
구체적으로, 정제된 rhEPO는 100 mM 중탄산 암모늄(ammonium bicarbonate) 및 5 mM 디티오트레이톨(dithiothreitol)의 수용액에서 급속 열 순환(25-100℃)에 의해 변성되었다. 냉각시킨 후, 2.0 ul(또는 1000 U)의 펩티드 N-글리코시다아제(glycosidase) F를 첨가한 후, 혼합하여 16시간 동안 37℃ 워터 베이스에서 배양하였다. rhEPO 분해물은 카트리지에 로딩해 두고 순수한 물로 염 및 다른 버퍼 물질을 제거하기 위해 씻어 내었다. N-글리칸은 40% 아세토니트릴(acetonitrile)/0.05% 트리플루오로 아세트산(trifluoroacetic acid)의 첨가에 의해 물(산성 분획물; acidic fraction)에서 용출되었다. 샘플은 진공 하에 건조시켰다. rhEPO N-글리칸 분획은 물에 재용해시키고, 1.0 ul(rhEPO 1ug에 해당)는 스테인리스 강 표적 플레이트에 스폿팅하였다. 중성 글리칸은 양이온 모드([M+Na]+ 또는 [M+H]+)에서 분석된 반면, 산성 글리칸은 음이온 모드([M-H]-)에서 분석되었다. 각각의 획득한 스펙트럼은 현장에서 3개의 임의의 위치(총 2400개의 레이저 샷)에서 800 레이저 샷으로부터 결합된 신호를 나타내었다. 질량 스펙트럼은 m/z 2000-4500의 범위에 걸쳐 기록되었다. 말토올리고당 래더(maltooligosaccharide ladder)는 외부 질량 교정에 사용하였다. MS 피크는 5.0의 신호 대 잡음비로 필터링하고, 화합물 질량 및 강도 목록을 얻기 위해 디콘볼루션을 수행하였다. N- 글리칸 분획을 합치고 2.0 μL(800 ng EPO에 해당)의 양을 자동 시료 주입기로 다공성 흑연 탄소 나노-LC 칩(Agilent)에 주입하였다. 급속 글리칸 용출 구배를 (A) 3.0% 아세토니트릴/0.1% 포름산 수용액 및 (B) 90.0% 아세토니트릴/0.1% 포름산 수용액을 사용하여, 20분 동안 6%에서 100% B로 상승하도록 분석용 칼럼에 0.3 μL/분으로 적용하였다. 남아있는 비-글리칸 화합물을 100% B로 씻어낸 다음 재평형시켰다. MS 스펙트럼은 스펙트럼 당 1.5초의 획득 시간으로 m/z 500-2000의 질량 범위에서 양이온 모드로 획득되었다.
그 결과, 도 4 내지 도 6에 나타낸 바와 같이 총 N-글리칸에서 폴리락토사민이 차지하는 비율이 기존의 약 19%에서 2% 가량으로 현저히 감소했음을 확인하였으며(도 4a), MALDI-TOF MS 및 LC/MS 결과 폴리락토사민 구조가 줄어든 것을 확인할 수 있었다(도 5 및 도 6).
또한, 폴리락토사민이 감소함과 동시에 부가적으로 삼중(tri-) 및 사중 안테나(tetra-antennary) N-글리칸의 비율이 증가함을 확인하였다(도 4b). 이는 폴리락토사민 합성에 사용될 구성성분(component)들이 안테나 분기(Antenna branching)에 사용되었기 때문으로 보인다. 문헌에 의하면, 이중 안테나(Bi-antennary) 당쇄구조를 갖는 EPO는 사중 안테나(Tetra-antennary) 당쇄 구조를 갖는 EPO에 비해 in-vivo 활성이 약 85% 감소하는 것으로 보고된 바 있다(Takeuchi et al, PNAS, 1989). 따라서, 폴리락토사민 감소와 그에 따른 사중 안테나 구조의 증가는 당단백질의 반감기 증가와 당단백질 효능에 긍정적인 역할을 할 수 있는 결과라 할 수 있다.
< 실시예 3> β3gnt2 유전자 넉아웃 (knock-out) CHO 세포주의 구축
<3-1> 재조합 인간 EPO를 생산하는 CHO 세포의 준비
재조합 인간 EPO를 생산하는 CHO 세포인 EC2-1H9 세포는 Dr. Hyo Jeong Hong (Antibody Engineering Research Unit, Korea Research Institute of Bioscience and Biotechnology, Yuseong-gu, Daejeon, Korea)로부터 제공받았다. 세포는 10% (v/v) dFBS (Gibco), 3.5 g/L glucose, 20 nM MTX (methotrexate; Sigma), 및 1% (v/v) Ab-Am (antibiotic-antimycotic solution; Gibco)로 보충된 MEM-α(Gibco)에서 37℃, 5%의 CO2를 포함하는 가습 환경에서 유지되었다.
<3-2> CRISPR / Cas9 시스템을 통한 β3gnt2 유전자 녹아웃 재조합 벡터의 제조 및 형질전환
β3gnt2 유전자를 녹아웃시키기 위한 재조합 벡터를 제조하기 위해 사용한 gRNA(guide RNA)를 암호화하는 DNA 서열은 CHO-K1 게놈에 특화된 웹 기반 CRISPR 디자인 툴인 CPRISPy로부터 얻었다. 이와 같은 gRNA는 차이니스 햄스터의 β3gnt2 유전자를 특이적으로 인식하여 각각이 β3gnt2 유전자의 DNA 가닥을 녹아웃하도록 고안된 gRNA 서열을 암호화하는 DNA 서열(합성 올리고뉴클레오티드)이다. 이는 하기 표 1의 서열번호 10 내지 13으로 나타내었다
유전자 내 위치 염기서열 서열번호
gRNA-1 15007 TGTTCCAGTACGCCCGGGAA (-) 서열번호 10
gRNA-2 15181 AGTCTTTAAATCTGTCCGGC (-) 서열번호 11
gRNA-3 15385 GTAGTGAGAGTCTTCTTGTT (+) 서열번호 12
gRNA-4 15402 GTTGGGCAAGACGCCCCCCG (+) 서열번호 13
gRNA 서열을 암호화하는 DNA 서열(gRNA-1, gRNA-2, gRNA-3, gRNA-4)은, gRNA를 발현하는 U6 프로모터 및 발현된 gRNA를 인식하는 GFP가 태그된 Cas9 효소를 포함하는, pCas-Guide-EF1a 벡터(Origene, Rockville, Maryland)로 삽입되었다. 상기 벡터는 생체 내 전사시에 서열번호 10 내지 13의 염기서열로 표시되는 DNA로부터 gRNA를, 서열번호 14의 염기서열로 표시되는 Cas9 DNA 서열로부터 Cas9 mRNA를 생성하는 주형으로 사용되었다. 이때 Cas9 유전자는 링커인 2A 펩타이드를 통해 GFP를 암호화하는 유전자와 연결되어 있어, 한 번에 Cas9 단백질과 GFP 단백질이 발현될 수 있다. 상기 과정을 통해 제작한 재조합 벡터의 개열 지도는 도 7에 나타내었으며, 재조합 벡터의 전체 염기서열은 서열번호 15 내지 18로 나타내었다.
상기 제조된 pCas-B3gnt2-EF1a 벡터는 Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA)를 이용하여 상기 실시예 <3-1>의 EC2-1H9 세포로 형질전환되었다.
< 실험예 3> β3gnt2 유전자 녹-아웃(knock-out) 결과
<3-1> T7E1 어세이(assay)
CRISPR/Cas9 시스템에 의해 지놈의 특정부위가 삽입(edition)되었을 때 해당 지놈 영역에 비상동성 말단 접합(Non Homologous end-joining; NHEJ)이 발생한다. 이런 형태의 DNA를 변성(denaturation)한 뒤 온도를 낮춰서 혼성화(hybridization)시키면 삽입되지 않은 와일드 타입(WT)의 DNA와 삽입된 클론의 DNA가 미스매치(Mismatch) 형태로 결합하는 이질성 염기쌍(hetero duplex)이 생기며 T7E1 은 이러한 미스매치된 DNA 영역을 인지하여 자르게 된다.
상기 실시예 <3-2>에서 CRISPR/Cas9 시스템을 통해 B3gnt2 유전자가 녹-아웃된 안정화된 세포주(stable cell line) 구축에 앞서 gRNA에 의한 유전자의 삽입/결실의 빈도(Indel, %)를 측정하는 T7E1 assay을 수행하였다.
구체적으로, 형질전환된 세포에서 Genomic DNA를 추출하여 정량한 뒤 200 ng의 genomic DNA를 주형(template)으로 하여 PCR을 수행하였고, 사용된 프라이머쌍은 4종류의 gRNA의 인식부위를 모두 커버하는 범위(849 bp)로 제작하였다(정방향 : 5'- GCA TTG TGG ATC ACG TCA CCT ATA AAC -3'(서열번호 19)/역방향: 5'- CCA GAT ATG AGA AAT GAG TGT TGG ACG -3'(서열번호 20)). 2 ㎕의 PCR products를 1.5% Agarose gel을 이용해 전기영동하였고 제대로 된 product 사이즈를 확인한 후 키트(qiaquick pcr purification kit; Qiagen)를 이용해 정제하였다. 정제된 PCR product의 DNA 농도를 정량한 뒤 10X NEB buffer 2 ul + PCR product 200 ng + DDW를 최종 19 ㎕으로 맞추었고 서모사이클러(thermocycler)를 이용해 DNA를 변성(denaturation) 및 혼성화(hybridization)하여 어닐링된(Annealed) DNA 단편(fragment)에 T7 Endonuclease 1(T7E1) 1㎕를 첨가한 뒤 37℃에서 15분 반응시켰다. 이후, proteinase K를 이용해 T7E1을 불활성화시키고 다시 1.5% Agarose gel에서 전기영동하여 대조군과 비교하였으며, 불완전하게 매치된(Non-perfectly matched) DNA가 T7E1에 의해 잘려진 비율이 어느정도 되는지 확인하였다. 전체 밴드의 세기(intensity)(잘려나가지 않은 WT 위치의 밴드 + 잘려나간 단편들의 밴드) 및 잘려나간 단편들(특정위치를 절단하므로 두 위치에서 단편들의 밴드가 생겨남)의 밴드의 세기의 비율을 Indel(%, genome edition efficiency)로 계산하였다.
그 결과, 도 7b에 나타낸 바와 같이 4종류의 gRNA를 이용한 녹-아웃 효율 확인 결과 T7E1에 의해 잘리지 않는 WT DNA에 비해 삽입된 세포의 DNA는 미스매치된 DNA 영역이 T7E1에 의해 잘려서 멀티 밴드(multi band)를 보이는 것을 확인하였다(도 7b). 즉, 4종류의 gRNA가 모두 녹-아웃 작동을 하였다는 것을 확인하였다.
<3-2> 생거 -시퀀싱( sanger -sequencing)
상기 <실시예 3>에서 CRISPR/Cas9 시스템을 통해 β3gnt2 유전자가 녹아웃된 세포는 유동세포계측법(Flow cytometry (Beckman coulter Inc, Brea, CA))을 통해 성공적으로 형질전환된 클론을 3주간 선택하였다(도 8a). 선택된 클론(클론 1: gRNA-1의 9 / 클론 2: gRNA-4의 2 / 클론 3: gRNA-4의 12 / 클론 4: gRNA-4의 16)은 게놈 DNA에 기초한 PCR에 따른 생거-시퀀싱에 의해 확인되었다(도 8b).
< 실험예 4> β3gnt2 유전자 녹-아웃을 통한 폴리락토사민 합성 저해 및 안테나 구조 증가 확인
<4-1> 폴리락토사민 합성 저해 확인
상기 β3gnt2 유전자가 녹-아웃 되었음이 확인된 EC2-1H9 세포 5.0x106는 10%(v/v) dFBS, 3.5 g/L glucose, 1% (v/v) Ab-Am solution, 및 20 nM MTX이 보충된 MEM-α를 포함하는 T175 배양 플라스크에 배양하였다. 재조합 인간 유래 에리스로포이에틴(rhEPO)을 포함하는 배양 배지를 SDS-PAGE에 사용되었고, 이어서 PVDF 멤브레인(Millipore Corp., Bedford, MA)으로 옮겼다. 5% BSA와 함께 TBS-T (140 mM NaCl, 10 mM Tris-HCl, with 0.05% Tween 20, pH 8.0)으로 실온에서 2시간 동안 블로킹 후, PVDF 멤브레인은 바이오틴이 라벨된 렉틴(Lycopersicon Esculentum Lectin; LEL)과 함께 4℃에서 16시간 동안 배양되었다. TBS-T를 이용하여 5분간 3회 세척한 후, 멤브레인은 1시간 동안 실온에서 ExtrAvidin-peroxidase (Sigma)와 함께 배양한 후 ECL 키트(Thermo Scientific; Rockford, IL)로 전개시켰다.
리블로팅(reblotting)을 위해, 상기 멤브레인은 스트립핑 버퍼(stripping buffer)(Candor Bioscience GmbH, Weissensberg, Germany)를 이용하여 1시간 동안 실온에서 스트립핑 시켰다. PVDF 멤브레인은 TBS-T로 5분 동안 3회 세척한 후, 1:5000으로 희석된 RP 라벨된 항-마우스 IgG 항체(Santa Cruz)와 함께 실온에서 1시간 동안 배양되었다. 멤브레인은 ECL 용액(Thermo Scientific; Rockford, IL)으로 전개시켰다.
그 결과, 도 9a에 나타낸 바와 같이 β3gnt2 유전자가 녹아웃된 클론(클론 1: gRNA-1의 9 / 클론 2: gRNA-4의 2 / 클론 3: gRNA-4의 12 / 클론 4: gRNA-4의 16)으로부터 분리된 EPO는 모두 LEL와의 반응이 나타나지 않았다(도 9a).
<4-2> 안테나 구조 증가 확인
상기 β3gnt2 유전자가 녹-아웃 되었음이 확인된 EC2-1H9 세포 5.0x106는 10%(v/v) dFBS, 3.5 g/L glucose, 1% (v/v) Ab-Am solution, 및 20 nM MTX이 보충된 MEM-α를 포함하는 T175 배양 플라스크에 배양하였다. 배양 배지는 3일 안에 혈청이 없는(serum-free) 배지(CHO-S-SFM II; Gibco)로 교체하였다. 2일 후, 배양 배지를 수집하여 0.45 um 필터(Sartorius, Gottingen, Germany)로 필터한 후, 인산 완충 생리식염수(phosphate buffer saline (PBS, pH 7.4))로 4℃에서 밤새 투석하였다. rhEPO를 정제하기 위해, 배양 배지는 EPO 정제 젤(MAIIA Diagnostics, Uppsala, Sweden)을 이용하였다. 정제된 rhEPO는 4℃에서 밤새 증류수로 투석되었다. 농도는 Quant-iT™ protein assay kit(Invitrogen)를 이용하여 측정하였으며, 사용시까지 -80℃에 보관하였다.
구체적으로, 정제된 rhEPO는 100 mM 중탄산 암모늄(ammonium bicarbonate) 및 5 mM 디티오트레이톨(dithiothreitol)의 수용액에서 급속 열 순환(25-100℃)에 의해 변성되었다. 냉각시킨 후, 2.0 ul(또는 1000 U)의 펩티드 N-글리코시다아제(glycosidase) F를 첨가한 후, 혼합하여 16시간 동안 37℃ 워터 베이스에서 배양하였다. rhEPO 분해물은 카트리지에 로딩해 두고 순수한 물로 염 및 다른 버퍼 물질을 제거하기 위해 씻어 내었다. N-글리칸은 40% 아세토니트릴(acetonitrile)/0.05% 트리플루오로 아세트산(trifluoroacetic acid)의 첨가에 의해 물(산성 분획물; acidic fraction)에서 용출되었다. 샘플은 진공 하에 건조시켰다. rhEPO N-글리칸 분획은 물에 재용해시키고, 1.0 ul(rhEPO 1ug에 해당)는 스테인리스 강 표적 플레이트에 스폿팅하였다. 중성 글리칸은 양이온 모드([M+Na]+ 또는 [M+H]+)에서 분석된 반면, 산성 글리칸은 음이온 모드([M-H]-)에서 분석되었다. 각각의 획득한 스펙트럼은 현장에서 3개의 임의의 위치(총 2400개의 레이저 샷)에서 800 레이저 샷으로부터 결합된 신호를 나타내었다. 질량 스펙트럼은 m/z 2000-4500의 범위에 걸쳐 기록되었다. 말토올리고당 래더(maltooligosaccharide ladder)는 외부 질량 교정에 사용하였다. MS 피크는 5.0의 신호 대 잡음비로 필터링하고, 화합물 질량 및 강도 목록을 얻기 위해 디콘볼루션을 수행하였다. N- 글리칸 분획을 합치고 2.0 μL(800 ng EPO에 해당)의 양을 자동 시료 주입기로 다공성 흑연 탄소 나노-LC 칩(Agilent)에 주입하였다. 급속 글리칸 용출 구배를 (A) 3.0% 아세토니트릴/0.1% 포름산 수용액 및 (B) 90.0% 아세토니트릴/0.1% 포름산 수용액을 사용하여, 20분 동안 6%에서 100% B로 상승하도록 분석용 칼럼에 0.3 μL/분으로 적용하였다. 남아있는 비-글리칸 화합물을 100% B로 씻어낸 다음 재평형시켰다. MS 스펙트럼은 스펙트럼 당 1.5초의 획득 시간으로 m/z 500-2000의 질량 범위에서 양이온 모드로 획득되었다.
그 결과, 도 9b에 나타낸 바와 같이 총 N-글리칸에서 폴리락토사민이 차지하는 비율이 기존의 약 15%에서 2% 가량으로 현저히 감소했음을 확인하였다(도 9b).
또한, 폴리락토사민이 감소함과 동시에 부가적으로 사중 안테나(tetra-antennary) N-글리칸의 비율이 증가함을 확인하였다(도 9c).
이는 폴리락토사민 합성에 사용될 구성성분(component)들이 안테나 분기(Antenna branching)에 사용되었기 때문으로 보인다. 문헌에 의하면, 이중 안테나(Bi-antennary) 당쇄구조를 갖는 EPO는 사중 안테나(Tetra-antennary) 당쇄 구조를 갖는 EPO에 비해 in-vivo 활성이 약 85% 감소하는 것으로 보고된 바 있다(Takeuchi et al, PNAS, 1989). 따라서, 폴리락토사민 감소와 그에 따른 사중 안테나 구조의 증가는 당단백질의 반감기 증가와 당단백질 효능에 긍정적인 역할을 할 수 있는 결과라 할 수 있다.

Claims (19)

  1. 당단백질을 생성하는 세포주에서 폴리락토사민(Polylactosamine)의 생합성을 억제시키는 단계를 포함하는, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  2. 제 1항에 있어서, 상기 폴리락토사민의 생합성을 억제시키는 단계는 β3gnt2(UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2) 유전자의 발현을 녹-다운(knock-down)시키거나, β3gnt2 유전자를 녹-아웃(knock-out)시키는 단계를 포함하는 것인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  3. 제 2항에 있어서, 상기 β3gnt2 유전자의 mRNA는 서열번호 1로 기재되는 염기서열로 구성되는 것인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  4. 제 2항에 있어서, 상기 β3gnt2 유전자 발현의 녹-다운은 β3gnt2 유전자 억제제를 처리하거나, 또는 β3gnt2 mRNA에 결합하는 안티센스 뉴클레오티드, siRNA, shRNA 및 miRNA로 구성된 군으로부터 선택되는 어느 하나를 당단백질을 생산하는 세포주에 형질감염시키는 것인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  5. 제 4항에 있어서, 상기 siRNA는 서열번호 2, 서열번호 4 및 서열번호 6으로 구성된 군으로부터 선택되는 어느 하나로 기재되는 염기서열을 포함하는 것인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  6. 제 2항에 있어서, 상기 β3gnt2 유전자의 녹-아웃은 재조합 벡터를 당단백질을 생성하는 세포주에 형질전환시키는 것인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법으로,
    여기서 상기 재조합 벡터는
    서열번호 10 내지 13으로 구성된 군으로부터 선택되는 어느 하나의 가이드 RNA(guide RNA; gRNA)를 암호화하는 염기서열; 및
    서열번호 14로 기재되는 염기서열로 구성되는 Cas9(CRISPR associated protein 9) 유전자를 포함하는 것인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  7. 제 6항에 있어서, 상기 재조합 벡터는 Cas9 유전자와 형광단백질을 코딩하는 유전자가 결합되어 있는 구조를 포함하는 것인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  8. 제 6항에 있어서, 상기 재조합 벡터는 서열번호 15 내지 18로 구성되는 군으로부터 선택되는 어느 하나의 염기서열을 포함하는 것인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  9. 제 1항에 있어서, 상기 당단백질은 에리스로포이에틴(erythropoietin), 트롬보포이에틴(thrombopoietin), 알파-안티트립신(alpha-antitrypsin), 콜린에스테라제(cholinesterase), 융모성 고나도트로핀(chorionic gonadotropin), CTLA4Ig, Factor VIII, 감마-글루타밀트랜스퍼라아제(gamma-glutamyltransferase), 과립구 콜로니 자극인자(granulocyte colony-stimulating Factor, G-CSF) 및 황체형성호르몬(luteinizing hormone, LH)으로 구성된 군으로부터 선택되는 어느 하나인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  10. 제 1항에 있어서, 상기 세포주는 포유동물 세포(mammalian cells), 효모 세포(yeast cells) 및 곤충 세포(insect cells)로 구성된 군으로부터 선택되는 어느 하나로부터 제조되는, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  11. 제 1항에 있어서, 상기 세포는 중국 햄스터 난소 세포(chinese hamster ovary cells; CHO), HT-1080, 인간 림프아구(human lymphoblastoid), SP2/0(마우스 골수종), NS0(마우스 골수종), 베이비 햄스터 신장세포(baby hamster kidney cells; BHK), 인간 배아 신장세포(human embryonic kidney cells; HEK), PERC.6(인간망막세포) 및 EC2-1H9로 구성된 군으로부터 선택되는 어느 하나인, 반감기가 증가된 재조합 당단백질을 생산하는 재조합 세포주의 제조방법.
  12. 제 1항의 방법으로 제조된, 반감기가 증가된 재조합 당단백질을 생산하는 세포주.
  13. 1) 제 12항의 재조합 세포주를 배양하는 단계; 및
    2) 상기 단계 1)의 배양액에서 재조합 당단백질을 분리하는 단계;
    를 포함하는, 반감기가 증가된 재조합 당단백질의 제조방법.
  14. 제 13항에 있어서, 상기 당단백질은 에리스로포이에틴, 트롬보포이에틴, 알파-안티트립신, 콜린에스테라제, 융모성 고나도트로핀, CTLA4Ig, Factor VIII, 감마-글루타밀트랜스퍼라아제, 과립구 콜로니 자극인자 및 황체형성호르몬으로 구성된 군으로부터 선택되는 어느 하나인, 반감기가 증가된 재조합 당단백질의 제조방법.
  15. 제 13항에 있어서, 상기 재조합 당단백질은 삼중(Tri-) 또는 사중-안테나(Tetra-antennary) 구조가 증가한 것인, 반감기가 증가된 재조합 당단백질의 제조방법.
  16. 서열번호 10 내지 13으로 구성된 군으로부터 선택되는 어느 하나의 가이드 RNA를 암호화하는 염기서열; 및
    서열번호 14로 기재되는 염기서열로 구성되는 Cas9 유전자를 포함하는, 재조합 벡터.
  17. 제 16항에 있어서, 상기 재조합 벡터는 Cas9 유전자와 형광단백질을 코딩하는 유전자가 결합되어 있는 구조를 포함하는 것인, 재조합 벡터.
  18. 제 16항에 있어서, 상기 재조합 벡터는 서열번호 15 내지 18로 구성되는 군으로부터 선택되는 어느 하나의 염기서열을 포함하는 것인, 재조합 벡터.
  19. 제 13항의 방법으로 분리된, 반감기가 증가된 재조합 당단백질.
PCT/KR2017/008521 2016-08-08 2017-08-07 폴리락토사민 생합성 저해에 의한 n-결합 당쇄 안테나구조가 강화된 재조합 당단백질 제조방법 Ceased WO2018030738A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20160100674 2016-08-08
KR10-2016-0100674 2016-08-08
KR10-2017-0098912 2017-08-04
KR1020170098912A KR102002790B1 (ko) 2016-08-08 2017-08-04 폴리락토사민 생합성 저해에 의한 n-결합 당쇄 안테나구조가 강화된 재조합 당단백질 제조방법

Publications (1)

Publication Number Publication Date
WO2018030738A1 true WO2018030738A1 (ko) 2018-02-15

Family

ID=61163280

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/008521 Ceased WO2018030738A1 (ko) 2016-08-08 2017-08-07 폴리락토사민 생합성 저해에 의한 n-결합 당쇄 안테나구조가 강화된 재조합 당단백질 제조방법

Country Status (1)

Country Link
WO (1) WO2018030738A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4119672A1 (en) * 2021-07-14 2023-01-18 Sartorius Stedim Cellca GmbH Method of modulating the extent of galactosylation of proteins in mammalian producer cells

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110092225A (ko) * 2010-02-08 2011-08-17 한국과학기술원 시알산 함량이 높은 재조합 당단백질의 제조 방법
KR20150145673A (ko) * 2014-06-18 2015-12-30 한국과학기술원 당지질 합성 회로 조절을 통한 고 시알산 함량의 재조합 당단백질 제조 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20110092225A (ko) * 2010-02-08 2011-08-17 한국과학기술원 시알산 함량이 높은 재조합 당단백질의 제조 방법
KR20150145673A (ko) * 2014-06-18 2015-12-30 한국과학기술원 당지질 합성 회로 조절을 통한 고 시알산 함량의 재조합 당단백질 제조 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
STANLEY, PAMELA: "What Have We Learned from Glycosyltransferase Knockouts in Mice?", JOURNAL OF MOLECULAR BIOLOGY, vol. 428, 31 March 2016 (2016-03-31), pages 3166 - 3182, XP029678754 *
SU , DONGMEI ET AL.: "Glycosylation-modified Erythropoietin with Improved Half-life and Biological Activity", INTERNATIONAL JOURNAL OF HEMATOLOGY, vol. 91, 2010, pages 238 - 244, XP055465403 *
TOGAYACHI, AKIRAETAL.: "Beta3GnT2 (B3GNT2), a Major Polylactosamine Synthase: Analysis of B3gnt2-deficient Mice", METHODS IN ENZYMOLOGY, vol. 479, 2010, pages 185 - 204, XP055465420 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4119672A1 (en) * 2021-07-14 2023-01-18 Sartorius Stedim Cellca GmbH Method of modulating the extent of galactosylation of proteins in mammalian producer cells
WO2023285215A1 (en) * 2021-07-14 2023-01-19 Sartorius Stedim Cellca Gmbh Method of modulating the extent of galactosylation of proteins in mammalian producer cells

Similar Documents

Publication Publication Date Title
JP7090421B2 (ja) Dna結合ドメイン、非フコシル化及び部分的フコシル化タンパク質、並びにその方法
Ngantung et al. RNA interference of sialidase improves glycoprotein sialic acid content consistency
Smith Transcription and processing of transfer RNA precursors
EP3022304B1 (en) Methods and compositions for producing double allele knock outs
EP2930245B1 (en) Cell line and methods for improved glycoprotein sialylation
WO2022124345A1 (ja) 化学修飾核酸を導入した安定型標的編集ガイドrna
KR102013712B1 (ko) O-글리칸 시알릴화된 재조합체 당단백질 및 이를 생산하기 위한 세포주
CN106661580A (zh) 用于治疗庞帕病的反义寡核苷酸
EP2802654B1 (en) Production of recombinant proteins with simple glycoforms
WO2022270969A1 (ko) 비천연 5&#39;-비번역 영역 및 3&#39;-비번역 영역 및 그의 용도
WO2013052523A1 (en) Modified nucleosides, nucleotides, and nucleic acids, and uses thereof
US20220411841A1 (en) Methods of synthesizing rna molecules
Marchfelder et al. In vitro processing of mitochondrial and plastid derived tRNA precursors in a plant mitochondrial extract
KR20260013456A (ko) Mgat1 결핍 세포 및 이의 용도
CN117904198A (zh) 一种利用嵌合pie系统体外制备环状rna的方法与应用
US10889845B2 (en) Production of N-glycoproteins for enzyme assisted glycomodification
Murray et al. Improved yield of full-length phaseolin cDNA clones by controlling premature anticomplementary DNA synthesis
WO2024054047A1 (ko) 자가 환형화 rna 구조체
CN119768533A (zh) 用于体外转录的改进的方法
Gerhart et al. Structural analysis of an RNA molecule involved in replication control of plasmid Rl
KR20150145673A (ko) 당지질 합성 회로 조절을 통한 고 시알산 함량의 재조합 당단백질 제조 방법
CN117126855A (zh) 一种构建Igf2bp1基因敲除小鼠胚胎干细胞系的方法
WO2023121131A1 (ko) 코로나바이러스 백신
Zipursky et al. In vitro DNA replication of recombinant plasmid DNAs containing the origin of progeny replicative form DNA synthesis of phage phi X174.
WO2017078461A1 (ko) 목적 단백질 생산을 위한 발현 벡터 및 이를 이용한 목적 단백질의 과발현 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17839756

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17839756

Country of ref document: EP

Kind code of ref document: A1