WO2018026248A1 - 프로그램화된 세포 사멸 단백질(pd-1)에 대한 신규 항체 및 이의 용도 - Google Patents

프로그램화된 세포 사멸 단백질(pd-1)에 대한 신규 항체 및 이의 용도 Download PDF

Info

Publication number
WO2018026248A1
WO2018026248A1 PCT/KR2017/008494 KR2017008494W WO2018026248A1 WO 2018026248 A1 WO2018026248 A1 WO 2018026248A1 KR 2017008494 W KR2017008494 W KR 2017008494W WO 2018026248 A1 WO2018026248 A1 WO 2018026248A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
heavy chain
light chain
variable region
chain variable
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2017/008494
Other languages
English (en)
French (fr)
Inventor
박재은
김수영
이현미
이시형
이현경
김혜난
윤진철
박범찬
임정채
조영규
박영우
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Y Biologics Inc
Original Assignee
Y Biologics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to AU2017306506A priority Critical patent/AU2017306506B2/en
Priority to RU2019105648A priority patent/RU2725950C1/ru
Priority to EP17837299.1A priority patent/EP3495390A4/en
Priority to BR112019002258-9A priority patent/BR112019002258A2/pt
Priority to CA3032783A priority patent/CA3032783C/en
Priority to MYPI2019000513A priority patent/MY189412A/en
Priority to CN201780055472.9A priority patent/CN110049998B/zh
Priority to US16/321,124 priority patent/US11248048B2/en
Application filed by Y Biologics Inc filed Critical Y Biologics Inc
Priority to JP2019528009A priority patent/JP6786722B2/ja
Priority to UAA201902239A priority patent/UA125395C2/uk
Priority claimed from KR1020170099672A external-priority patent/KR102048476B1/ko
Publication of WO2018026248A1 publication Critical patent/WO2018026248A1/ko
Priority to SA519401032A priority patent/SA519401032B1/ar
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants

Definitions

  • the present invention provides an antibody or antigen-binding fragment thereof for human programmed cell death protein (PD-1), a nucleic acid encoding the same, a vector comprising the nucleic acid, a recombinant microorganism transformed with the vector. It relates to a method for producing the antibody or antigen-binding fragment thereof, and to a composition for preventing or treating cancer comprising the same.
  • PD-1 programmed cell death protein
  • Immune anticancer agents called third-generation anticancer agents that overcome these problems, act on the signaling pathways of immune cells to activate immune cells to attack cancer cells to produce therapeutic effects.
  • the body's immune system can be used to treat various diseases including cancer, and side effects are also reported to be lower than conventional anticancer drugs.
  • PD-1 (also named CD279) is a 55 KD receptor protein associated with the CD28 / CTLA4 co-stimulatory / inhibitory receptor family (Blank et al., 2005 Cancer Immunol Immunother 54: 307- 314).
  • PD-1 Cloning genes and cDNAs encoding PD-1 have been characterized in mice and humans (Ishida et al., 1992 EMBO J 11: 3887-3395; Shinohara et al., 1994 Genomics 23: 704-706) .
  • Full length PD-1 contains 288 amino acid residues (NCBI accession number: NP_005009).
  • the extracellular domain consists of 1-167 amino acid residues and the cytoplasmic C-terminal tail comprises 191-288 residues, which are two hypothetical immune-modulating motifs, an immunoreceptor tyrosine based inhibitory motif (ITIM; Vivier et al. , 1997 Immunol Today 18: 286-291) and immunoreceptor tyrosine switch motifs (ITSM; Chemnitz et al., 2004 J Immunol 173: 945-954).
  • ITIM immunoreceptor tyrosine based inhibitory motif
  • ITMS immunoreceptor tyrosine switch
  • PD-1 PD-1 protein-binding protein-1
  • T-cells T-cells
  • B-cells B-cells
  • monocytes NK cells
  • PD-1 expression is often associated with the activity of immune cells.
  • PHA phytohaemagglutinin
  • phorbol ester (12-O-tetradecanoylphorbol-13-acetate or TPA)
  • TILs tumor-infiltrating lymphocytes
  • PD-1 ligand expression of tumor cells have been reported, and other types of tissues and organs such as lung, liver, stomach, kidney, Breast, ovary, pancreas, melanocytes and esophagus. More frequently, the expression of PD-1 and PD-L1 in these cancers is associated with poor prognosis for patient survival outcomes.
  • Transgenic mice that knocked out PD-1 genes to inhibit Xenograft cancer cell growth further explained the importance of PD-1 signaling in immune system regulation for cancer removal or tolerance.
  • Upregulation of PD-1 signaling leads to cancer proliferation of immune tolerance, as well as to viral infection and expansion in humans.
  • Pandemic liver infection viruses HBV and HCV induce overexpression of PD-1 ligand in hepatocytes and activate PD-1 signaling in effect T cells, resulting in T-cell depletion and tolerance to viral infection.
  • HIV infection frequently evades the human immune system with similar mechanisms.
  • Therapeutic regulation of PD-1 signaling by antagonist molecules can restore immune cells from tolerance and can be reactivated to eliminate cancer and chronic viral infections.
  • Drugs that target PD-1 include the monoclonal antibodies nivolumab and pembrolizumab, which are used as treatments for malignant melanoma and non-small cell lung cancer. It is reported that the largeness and the precise verification of the efficacy of treatment is required. Therefore, there is an urgent need for a new concept of PD-1 target therapy that overcomes the limitations of existing drugs.
  • Another object of the present invention is to provide a nucleic acid encoding the antibody or antigen-binding fragment thereof.
  • Another object of the present invention to provide a composition for preventing or treating cancer comprising the antibody or antigen-binding fragment thereof.
  • the present invention is a group consisting of a heavy chain CDR1, SEQ ID NO: 31 to SEQ ID NO: 56 comprising a sequence having a sequence homology of 90% or more with a sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 30
  • a heavy chain CDR2 comprising a sequence having at least 90% sequence homology with a sequence selected from among and a heavy chain CDR3 comprising a sequence having at least 90% sequence homology with a sequence selected from the group consisting of SEQ ID NOs: 57-SEQ ID NO: 79
  • a heavy chain variable region comprising a light chain and a light chain CDR1 comprising a sequence having at least 90% sequence homology with a sequence selected from the group consisting of SEQ ID NOs: 198 to 222, SEQ ID NO: 223 to SEQ ID NO: 241
  • a light chain CDR2 comprising a sequence having 90% or more sequence homology with a sequence to be sequenced, and SEQ ID NO: 242 to SEQ
  • the present invention also provides a nucleic acid encoding the antibody or antigen-binding fragment thereof.
  • the present invention also provides an expression vector comprising the nucleic acid.
  • the present invention also provides a cell transformed with the expression vector.
  • the present invention also provides a method for producing the antibody or antigen-binding fragment thereof comprising the following steps: (a) culturing the cells; And (b) recovering the antibody or antigen-binding fragment thereof from the cultured cells.
  • the present invention also provides a composition for preventing or treating cancer, containing the antibody or antigen-binding fragment thereof as an active ingredient.
  • FIG. 1 is a schematic diagram of a PD-1 expression vector fused with a human Fc or a mouse Fc at the carboxy-terminus.
  • 2A is a 10% SDS-PAGE gel of PD1-hFc. Results of protein identification under RE (reducing) and NR (non-reducing) conditions;
  • Figure 2b shows the G-3000 SWXL SEC-HPLC results. Flow rate is 1 ml / min and developing solvent is PBS;
  • 2C is a 10% SDS-PAGE gel of PD1-mFc. Results of protein identification under RE (reducing) and NR (non-reducing) conditions;
  • Figure 2d shows the G-3000 SWXL SEC-HPLC results.
  • the flow rate is 1 ml / min and the developing solvent is PBS.
  • Figure 3 shows the binding force of the antibody to PD-1 according to the number of panning.
  • Figure 4 shows the ELSIA results for measuring the binding capacity of mono phage to PD1-His.
  • Figure 6 shows the results of in vitro efficacy evaluation of PD-1 antibody.
  • Figure 7 shows the results of the concentration-dependent in vitro efficacy evaluation of the PD-1 antibody.
  • Figure 8 shows the binding capacity of the antibody bound concentration-dependently to the overexpressed human PD-1 using MFI (mean fluorescence intensity).
  • Figure 11 shows the results of a comparative analysis of the expression rate with the parent antibody.
  • Figure 12 shows the results of evaluating the in vitro efficacy of the PD1 antibody according to the present invention.
  • Figure 13 shows the results of evaluating the concentration-dependent in vitro efficacy of the PD1 antibody according to the present invention.
  • Figure 14 shows the results confirming the binding to PD-1 expressed on the cell surface of the monoclonal antibody to the selected PD1 antibody variants.
  • Figure 16 shows the results confirming the inhibitory effect of the antibody to block the formation of PD-1 / PD-L1 or PD-1 / PD-L2 complex using enzyme immunosorbent in the selected antibody.
  • Figure 17 shows the kinetics measurement results between PD1-hFc protein and PD1-45D6, 49A2 and 49A2 (2B9).
  • Figure 19 shows the results of confirming the binding force to the PD-1 variants through the enzyme immunosorbent of the selected phage (phage), the lower the binding force indicates a lower value.
  • Figure 20 shows the results confirming the binding capacity to the PD-1 variants through the enzyme immunosorbent of the selected antibody.
  • Figure 21 shows the results confirming the binding specificity through enzyme immunosorbent.
  • Figure 22 shows the result of comparing the transient expression productivity in HEK-293 cells.
  • Figure 23 shows the results confirmed that the increased activity in heterologous MLR (Mixed Lymphocyte Reaction) by PD1 monoclonal antibody.
  • the present invention is selected from the group consisting of heavy chain CDR1, SEQ ID NO: 31 to SEQ ID NO: 56 comprising a sequence having 90% or more sequence homology with the sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 30
  • a heavy chain CDR2 comprising a sequence having at least 90% sequence homology with the sequence
  • a heavy chain CDR3 comprising a sequence having at least 90% sequence homology with a sequence selected from the group consisting of SEQ ID NOs: 57-SEQ ID NO: 79
  • a light chain CDR1 comprising a heavy chain variable region and a sequence having at least 90% sequence homology with a sequence selected from the group consisting of SEQ ID NOs: 198 to 222, and a sequence selected from the group consisting of SEQ ID NOs: 223 to SEQ ID NO: 241;
  • a light chain CDR2 comprising a sequence having at least 90% sequence homology, and a sequence selected from the group consisting of SEQ ID NOs: 242 to
  • the present inventors have tried to develop an anti-cancer therapeutic antibody that binds to PD-1, which is known to be expressed in various cancers.
  • phage display technology was used to prepare an anti-PD-1 antibody that binds to PD-1 with high affinity, and confirmed that such anti-PD-1 antibody can inhibit the activity of PD-1.
  • PD-1 programmed cell death protein 1
  • antibody refers to an anti-PD-1 antibody that specifically binds to PD-1.
  • the scope of the present invention includes not only complete antibody forms that specifically bind PD-1, but also antigen binding fragments of such antibody molecules.
  • a complete antibody is a structure having two full length light chains and two full length heavy chains, each of which is linked by heavy and disulfide bonds.
  • the heavy chain constant region has gamma ( ⁇ ), mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ) and epsilon ( ⁇ ) types and subclasses gamma 1 ( ⁇ 1), gamma 2 ( ⁇ 2), and gamma 3 ( ⁇ 3). ), Gamma 4 ( ⁇ 4), alpha 1 ( ⁇ 1) and alpha 2 ( ⁇ 2).
  • the constant regions of the light chains have kappa ( ⁇ ) and lambda ( ⁇ ) types.
  • An antigen binding fragment or antibody fragment of an antibody means a fragment having an antigen binding function and includes Fab, F (ab '), F (ab') 2, Fv and the like.
  • Fab in the antibody fragment has a structure having a variable region of the light and heavy chains, a constant region of the light chain and the first constant region (CH1) of the heavy chain has one antigen binding site.
  • F (ab ') 2 antibodies are produced by disulfide bonds of cysteine residues in the hinge region of Fab'.
  • Double-chain Fv is a non-covalent bond in which a heavy chain variable region and a light chain variable region are linked, and a single chain Fv (single-chain Fv, scFv) is generally a variable region of the heavy chain and the light chain through a peptide linker.
  • This covalent linkage or the C-terminus is directly linked to form a dimer-like structure such as a double-chain Fv.
  • Such antibody fragments can be obtained using proteolytic enzymes (e.g., restriction digestion of the entire antibody with papain yields Fab and cleavage with pepsin yields F (ab ') 2 fragments). It can also be produced by recombinant technology.
  • the antibody according to the invention is in Fv form (eg scFv), Fab or fully antibody form.
  • the heavy chain constant region may be selected from any one isotype of gamma ( ⁇ ), mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ) or epsilon ( ⁇ ).
  • the constant region is gamma 1 (IgG1), gamma 3 (IgG3) or gamma 4 (IgG4).
  • the light chain constant region may be of kappa or lambda type.
  • the term “heavy chain” refers to a variable region domain VH comprising an amino acid sequence having sufficient variable region sequence to confer specificity to an antigen and a full length heavy chain comprising three constant region domains CH1, CH2 and CH3 And fragments thereof.
  • the term “light chain” as used herein refers to a full-length light chain and fragment thereof comprising a variable region domain VL and a constant region domain CL comprising an amino acid sequence having sufficient variable region sequence to confer specificity to the antigen. All means.
  • Antibodies of the invention include monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single chain Fvs (scFV), single chain antibodies, Fab fragments, F (ab ') fragments, disulfide-binding Fvs (sdFV) And anti-idiotype (anti-Id) antibodies, or epitope-binding fragments of the antibodies, and the like.
  • Said monoclonal antibody refers to the same except for possible naturally occurring mutations in which antibodies obtained from substantially homogeneous antibody populations, ie, individual antibodies in the population, may be present in trace amounts. Monoclonal antibodies are highly specific and are directed against a single antigenic site.
  • Non-human (eg murine) antibodies of the “humanized” form are chimeric antibodies that contain minimal sequences derived from non-human immunoglobulins.
  • humanized antibodies are non-human species (donor antibodies) that retain the desired specificity, affinity, and capacity for residues from the hypervariable region of the recipient, for example mice, rats, rabbits, or non-humans.
  • donor antibodies non-human species
  • Human immunoglobulins (receptor antibodies) replaced with residues from the hypervariable regions of primates.
  • human antibody refers to a molecule derived from human immunoglobulin, in which all amino acid sequences constituting the antibody including complementarity determining regions and structural regions are composed of human immunoglobulins.
  • While the heavy and / or light chain portions are the same or homologous to the corresponding sequences in an antibody derived from a particular species or belonging to a particular antibody class or subclass, the remaining chain (s) are derived from another species or another antibody class or Included are "chimeric" antibodies (immunoglobulins) that are identical or homologous to the corresponding sequences in antibodies belonging to the subclass, as well as fragments of such antibodies that exhibit the desired biological activity.
  • antibody variable domain refers to the light and heavy chain portions of an antibody molecule comprising the amino acid sequences of complementarity determining regions (CDRs; ie CDR1, CDR2, and CDR3), and framework regions (FR). .
  • CDRs complementarity determining regions
  • FR framework regions
  • VH refers to the variable domain of the heavy chain.
  • VL refers to the variable domain of the light chain.
  • CDRs Complementarity Determining Regions
  • ie CDR1, CDR2, and CDR3 refer to amino acid residues of antibody variable domains that are required for antigen binding, each variable domain typically identified as CDR1, CDR2 and CDR3. Three CDR regions.
  • the antibody or antigen-binding fragment thereof that binds to PD-1 is heavy chain CDR1 selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 30,
  • a heavy chain CDR2 selected from the group consisting of SEQ ID Nos: 31 to 56, and
  • a heavy chain variable region comprising a heavy chain CDR3 selected from the group consisting of SEQ ID NOs: 57 to 79, and
  • Light chain CDR1 selected from the group consisting of SEQ ID NOs: 198 to 222,
  • a light chain CDR2 selected from the group consisting of SEQ ID Nos: 223 to 241, and
  • It may include a light chain variable region comprising a light chain CDR3 selected from the group consisting of SEQ ID NO: 242 to SEQ ID NO: 269.
  • the antibody or antigen-binding fragment thereof that binds to PD-1 is a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 1, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 1, a heavy chain CDR2 of SEQ ID NO: 32, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 2, a heavy chain CDR2 of SEQ ID NO: 33, and a heavy chain CDR3 of SEQ ID NO: 59,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 2, a heavy chain CDR2 of SEQ ID NO: 33, and a heavy chain CDR3 of SEQ ID NO: 60,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 2, a heavy chain CDR2 of SEQ ID NO: 33, and a heavy chain CDR3 of SEQ ID NO: 61,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 2, a heavy chain CDR2 of SEQ ID NO: 33, and a heavy chain CDR3 of SEQ ID NO: 62,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 3, a heavy chain CDR2 of SEQ ID NO: 34, and a heavy chain CDR3 of SEQ ID NO: 63,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 4, a heavy chain CDR2 of SEQ ID NO: 35, and a heavy chain CDR3 of SEQ ID NO: 64,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 5, a heavy chain CDR2 of SEQ ID NO: 36, and a heavy chain CDR3 of SEQ ID NO: 65,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 6, a heavy chain CDR2 of SEQ ID NO: 37, and a heavy chain CDR3 of SEQ ID NO: 66,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 1, a heavy chain CDR2 of SEQ ID NO: 32, and a heavy chain CDR3 of SEQ ID NO: 67,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 7, a heavy chain CDR2 of SEQ ID NO: 38, and a heavy chain CDR3 of SEQ ID NO: 68,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 8, a heavy chain CDR2 of SEQ ID NO: 39, and a heavy chain CDR3 of SEQ ID NO: 69,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 9, a heavy chain CDR2 of SEQ ID NO: 40, and a heavy chain CDR3 of SEQ ID NO: 70,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 10, a heavy chain CDR2 of SEQ ID NO: 41, and a heavy chain CDR3 of SEQ ID NO: 71,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 11, a heavy chain CDR2 of SEQ ID NO: 42, and a heavy chain CDR3 of SEQ ID NO: 72,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 12, a heavy chain CDR2 of SEQ ID NO: 43, and a heavy chain CDR3 of SEQ ID NO: 73,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 13, a heavy chain CDR2 of SEQ ID NO: 44, and a heavy chain CDR3 of SEQ ID NO: 74,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 14, a heavy chain CDR2 of SEQ ID NO: 45, and a heavy chain CDR3 of SEQ ID NO: 75,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 15, a heavy chain CDR2 of SEQ ID NO: 46, and a heavy chain CDR3 of SEQ ID NO: 76,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 8, a heavy chain CDR2 of SEQ ID NO: 47, and a heavy chain CDR3 of SEQ ID NO: 77,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 16, a heavy chain CDR2 of SEQ ID NO: 48, and a heavy chain CDR3 of SEQ ID NO: 78,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 17, a heavy chain CDR2 of SEQ ID NO: 49, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 18, a heavy chain CDR2 of SEQ ID NO: 50, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 19, a heavy chain CDR2 of SEQ ID NO: 51, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 20, a heavy chain CDR2 of SEQ ID NO: 52, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 21, a heavy chain CDR2 of SEQ ID NO: 51, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 22, a heavy chain CDR2 of SEQ ID NO: 53, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 23, a heavy chain CDR2 of SEQ ID NO: 49, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 17, a heavy chain CDR2 of SEQ ID NO: 54, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 24, a heavy chain CDR2 of SEQ ID NO: 55, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 21, a heavy chain CDR2 of SEQ ID NO: 51, and a heavy chain CDR3 of SEQ ID NO: 58,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 25, a heavy chain CDR2 of SEQ ID NO: 56, and a heavy chain CDR3 of SEQ ID NO: 57,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 26, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 27, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 28, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 29, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 30, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57,
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 32, and the heavy chain CDR3 of SEQ ID NO: 79, or
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 32, and the heavy chain CDR3 of SEQ ID NO: 57 may be included.
  • the antibody or antigen-binding fragment thereof that binds to PD-1 includes a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 198, a light chain CDR2 of SEQ ID NO: 223, and a light chain CDR3 of SEQ ID NO: 242,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 199, a light chain CDR2 of SEQ ID NO: 224, and a light chain CDR3 of SEQ ID NO: 243,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 200, a light chain CDR2 of SEQ ID NO: 225, and a light chain CDR3 of SEQ ID NO: 244,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 201, a light chain CDR2 of SEQ ID NO: 226, and a light chain CDR3 of SEQ ID NO: 245,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 202, a light chain CDR2 of SEQ ID NO: 227, and a light chain CDR3 of SEQ ID NO: 246,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 203, a light chain CDR2 of SEQ ID NO: 228, and a light chain CDR3 of SEQ ID NO: 247,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 204, a light chain CDR2 of SEQ ID NO: 229, and a light chain CDR3 of SEQ ID NO: 248,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 249,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 206, a light chain CDR2 of SEQ ID NO: 231, and a light chain CDR3 of SEQ ID NO: 250,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 207, a light chain CDR2 of SEQ ID NO: 232, and a light chain CDR3 of SEQ ID NO: 251,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 208, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 252,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 209, a light chain CDR2 of SEQ ID NO: 233, and a light chain CDR3 of SEQ ID NO: 253,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 210, a light chain CDR2 of SEQ ID NO: 234, and a light chain CDR3 of SEQ ID NO: 254,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 211, a light chain CDR2 of SEQ ID NO: 235, and a light chain CDR3 of SEQ ID NO: 255,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 212, a light chain CDR2 of SEQ ID NO: 236, and a light chain CDR3 of SEQ ID NO: 256,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 213, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 257,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 214, a light chain CDR2 of SEQ ID NO: 237, and a light chain CDR3 of SEQ ID NO: 258,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 215, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 249,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 211, a light chain CDR2 of SEQ ID NO: 238, and a light chain CDR3 of SEQ ID NO: 259,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 216, a light chain CDR2 of SEQ ID NO: 238, and a light chain CDR3 of SEQ ID NO: 260,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 217, a light chain CDR2 of SEQ ID NO: 239, and a light chain CDR3 of SEQ ID NO: 261,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 218, a light chain CDR2 of SEQ ID NO: 240, and a light chain CDR3 of SEQ ID NO: 262,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 219, a light chain CDR2 of SEQ ID NO: 241, and a light chain CDR3 of SEQ ID NO: 263,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 220, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 252,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 215, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 252,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 264,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 265,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 221, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 266,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 252,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 267,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 257,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 220, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 267,
  • a light chain variable region comprising a light chain CDR1 of SEQ ID NO: 222, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 268, or
  • Light chain CDR1 comprising SEQ ID NO: 220, light chain CDR2 of SEQ ID NO: 230, and light chain CDR3 of SEQ ID NO: 269.
  • the antibody or antigen-binding fragment thereof according to the present invention may comprise the following heavy chain variable region and light chain variable region:
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 2, a heavy chain CDR2 of SEQ ID NO: 33, and a heavy chain CDR3 of SEQ ID NO: 62, a light chain CDR1 of SEQ ID NO: 201, a light chain CDR2 of SEQ ID NO: 226, and a light chain CDR3 of SEQ ID NO: 245;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 3, a heavy chain CDR2 of SEQ ID NO: 34, and a heavy chain CDR3 of SEQ ID NO: 63, a light chain CDR1 of SEQ ID NO: 202, a light chain CDR2 of SEQ ID NO: 227, and a light chain CDR3 of SEQ ID NO: 246;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 4, a heavy chain CDR2 of SEQ ID NO: 35, and a heavy chain CDR3 of SEQ ID NO: 64, a light chain CDR1 of SEQ ID NO: 203, a light chain CDR2 of SEQ ID NO: 228, and a light chain CDR3 of SEQ ID NO: 247;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 5, a heavy chain CDR2 of SEQ ID NO: 36, and a heavy chain CDR3 of SEQ ID NO: 65, a light chain CDR1 of SEQ ID NO: 204, a light chain CDR2 of SEQ ID NO: 229, and a light chain CDR3 of SEQ ID NO: 248;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 32, and the heavy chain CDR3 of SEQ ID NO: 58, the light chain CDR1 of SEQ ID NO: 205, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 249
  • a light chain variable region comprising;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 6, the heavy chain CDR2 of SEQ ID NO: 37, and the heavy chain CDR3 of SEQ ID NO: 66, the light chain CDR1 of SEQ ID NO: 206, the light chain CDR2 of SEQ ID NO: 231, and the light chain CDR3 of SEQ ID NO: 250;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 32, and the heavy chain CDR3 of SEQ ID NO: 67, the light chain CDR1 of SEQ ID NO: 207, the light chain CDR2 of SEQ ID NO: 232, and the light chain CDR3 of SEQ ID NO: 251;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 208, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 7, the heavy chain CDR2 of SEQ ID NO: 38, and the heavy chain CDR3 of SEQ ID NO: 68, the light chain CDR1 of SEQ ID NO: 209, the light chain CDR2 of SEQ ID NO: 233, and the light chain CDR3 of SEQ ID NO: 253;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 8, a heavy chain CDR2 of SEQ ID NO: 39, and a heavy chain CDR3 of SEQ ID NO: 69, a light chain CDR1 of SEQ ID NO: 210, a light chain CDR2 of SEQ ID NO: 234, and a light chain CDR3 of SEQ ID NO: 254;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 11, a heavy chain CDR2 of SEQ ID NO: 42, and a heavy chain CDR3 of SEQ ID NO: 72 and a light chain CDR1 of SEQ ID NO: 213, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 257
  • a light chain variable region comprising;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 32, and the heavy chain CDR3 of SEQ ID NO: 58, the light chain CDR1 of SEQ ID NO: 215, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 249
  • a light chain variable region comprising;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 13, a heavy chain CDR2 of SEQ ID NO: 44, and a heavy chain CDR3 of SEQ ID NO: 74, a light chain CDR1 of SEQ ID NO: 211, a light chain CDR2 of SEQ ID NO: 238, and a light chain CDR3 of SEQ ID NO: 259;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 15, a heavy chain CDR2 of SEQ ID NO: 46, and a heavy chain CDR3 of SEQ ID NO: 76, a light chain CDR1 of SEQ ID NO: 217, a light chain CDR2 of SEQ ID NO: 239, and a light chain CDR3 of SEQ ID NO: 336;
  • a light chain variable region comprising; or
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 8, the heavy chain CDR2 of SEQ ID NO: 47, and the heavy chain CDR3 of SEQ ID NO: 77, the light chain CDR1 of SEQ ID NO: 218, the light chain CDR2 of SEQ ID NO: 240, and the light chain CDR3 of SEQ ID NO: 337 Light chain variable region containing.
  • an antibody was further selected through an optimization process, and the antibody or antigen-binding fragment thereof according to the present invention may include the following heavy chain variable region and light chain variable region:
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 17, a heavy chain CDR2 of SEQ ID NO: 49, and a heavy chain CDR3 of SEQ ID NO: 58, a light chain CDR1 of SEQ ID NO: 220, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 252;
  • a light chain variable region comprising;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 18, a heavy chain CDR2 of SEQ ID NO: 50, and a heavy chain CDR3 of SEQ ID NO: 58, a light chain CDR1 of SEQ ID NO: 215, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 19, the heavy chain CDR2 of SEQ ID NO: 51, and the heavy chain CDR3 of SEQ ID NO: 58, the light chain CDR1 of SEQ ID NO: 218, the light chain CDR2 of SEQ ID NO: 240, and the light chain CDR3 of SEQ ID NO: 337 Light chain variable region containing
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 20, a heavy chain CDR2 of SEQ ID NO: 52, and a heavy chain CDR3 of SEQ ID NO: 58, a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 264;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 21, a heavy chain CDR2 of SEQ ID NO: 51, and a heavy chain CDR3 of SEQ ID NO: 58, a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 265;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 22, the heavy chain CDR2 of SEQ ID NO: 53, and the heavy chain CDR3 of SEQ ID NO: 58, the light chain CDR1 of SEQ ID NO: 221, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 266; Light chain variable region containing,
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 23, the heavy chain CDR2 of SEQ ID NO: 49, and the heavy chain CDR3 of SEQ ID NO: 58, the light chain CDR1 of SEQ ID NO: 205, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • Light chain variable region containing,
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 17, a heavy chain CDR2 of SEQ ID NO: 54, and a heavy chain CDR3 of SEQ ID NO: 58, a light chain CDR1 of SEQ ID NO: 215, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 249
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 24, a heavy chain CDR2 of SEQ ID NO: 55, and a heavy chain CDR3 of SEQ ID NO: 58, a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 267;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 21, a heavy chain CDR2 of SEQ ID NO: 51, and a heavy chain CDR3 of SEQ ID NO: 58, a light chain CDR1 of SEQ ID NO: 220, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 221, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 266 Light chain variable region containing,
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 205, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 205, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 215, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 205, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 220, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • Light chain variable region containing,
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 205, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 205, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 1, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 215, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 25, a heavy chain CDR2 of SEQ ID NO: 56, and a heavy chain CDR3 of SEQ ID NO: 57, a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 257
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 26, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57, a light chain CDR1 of SEQ ID NO: 220, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 267;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 27, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57, a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 28, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57, a light chain CDR1 of SEQ ID NO: 205, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 252;
  • a heavy chain variable region comprising the heavy chain CDR1 of SEQ ID NO: 29, the heavy chain CDR2 of SEQ ID NO: 31, and the heavy chain CDR3 of SEQ ID NO: 57, the light chain CDR1 of SEQ ID NO: 205, the light chain CDR2 of SEQ ID NO: 230, and the light chain CDR3 of SEQ ID NO: 252;
  • Light chain variable region comprising, or
  • a heavy chain variable region comprising a heavy chain CDR1 of SEQ ID NO: 30, a heavy chain CDR2 of SEQ ID NO: 31, and a heavy chain CDR3 of SEQ ID NO: 57, a light chain CDR1 of SEQ ID NO: 220, a light chain CDR2 of SEQ ID NO: 230, and a light chain CDR3 of SEQ ID NO: 267; Light chain variable region containing.
  • FRs Framework regions
  • Each variable domain typically has four FRs identified as FR1, FR2, FR3 and FR4.
  • the heavy chain variable region FR1 selected from the group consisting of SEQ ID NO: 80 to SEQ ID NO: 95,
  • a heavy chain variable region FR2 selected from the group consisting of SEQ ID NOs: 96 to 113,
  • a heavy chain variable region FR3 selected from the group consisting of SEQ ID NOs: 114 to 134, or
  • the heavy chain variable region FR4 selected from the group consisting of SEQ ID NOs: 135 to 145 may be included.
  • the light chain variable region FR1 selected from the group consisting of SEQ ID NO: 270 to SEQ ID NO: 294,
  • Light chain variable region FR2 selected from the group consisting of SEQ ID NOs: 295 to 315,
  • Light chain variable region FR3 selected from the group consisting of SEQ ID NOs: 316 to 355, or
  • Light chain variable region FR4 selected from the group consisting of SEQ ID NO: 356 to SEQ ID NO: 367.
  • Fv fragments are antibody fragments containing complete antibody recognition and binding sites. This region consists of a dimer of one heavy chain variable domain and one light chain variable domain tightly and covalently associated, for example, with scFv.
  • Fab fragments contain the variable and constant domains of the light chain and the variable and first constant domains (CH1) of the heavy chain.
  • F (ab ') 2 antibody fragments generally comprise a pair of Fab fragments covalently linked near their carboxy termini by hinge cysteines between them.
  • Single-chain Fv or “scFv” antibody fragments comprise the VH and VL domains of an antibody, which domains are present in a single polypeptide chain.
  • the Fv polypeptide may further comprise a polypeptide linker between the VH domain and the VL domain that allows the scFv to form the desired structure for antigen binding.
  • PD-1 antibodies are monovalent or bivalent and include single or double chains. Functionally, the binding affinity of the PD-1 antibody is in the range of 10 ⁇ 5 M to 10 ⁇ 12 M.
  • the binding affinity of PD-1 antibodies is 10 -6 M to 10 -12 M, 10 -7 M to 10 -12 M, 10 -8 M to 10 -12 M, 10 -9 M to 10 -12 M, 10 -5 M to 10 -11 M, 10 -6 M to 10 -11 M, 10 -7 M to 10 -11 M, 10 -8 M to 10 -11 M, 10 -9 M to 10 -11 M, 10 -10 M to 10 -11 M, 10 -5 M to 10 -10 M, 10 -6 M to 10 -10 M, 10 -7 M to 10 -10 M, 10 -8 M to 10 -10 M, 10 -9 M to 10 -10 M, 10 -5 M to 10 -9 M, 10 -6 M to 10 -9 M, 10 -7 M to 10 -9 M, 10 -8 M to 10 -9 M, 10 -5 M to 10
  • the antibody or antigen-binding fragment thereof that binds to PD-1 may comprise a heavy chain variable region comprising a sequence having 90% or more sequence homology with a sequence selected from the group consisting of SEQ ID NOs: 146 and 193.
  • the antibody or antigen-binding fragment thereof that binds to PD-1 may comprise a heavy chain variable region selected from the group consisting of SEQ ID NOs: 146 to SEQ ID NO: 193.
  • the heavy chain variable region of SEQ ID NOs: 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 163, 165, 166, 168, 169, or 171-188 It may include.
  • the light chain variable region comprising a sequence having 90% or more sequence homology with the sequence selected from the group consisting of SEQ ID NO: 368 to SEQ ID NO: 420.
  • the antibody or antigen-binding fragment thereof that binds to PD-1 may include a light chain variable region selected from the group consisting of SEQ ID NOs: 368 to 420.
  • the light chain variable region of SEQ ID NOs: 371 to 380, 383, 385, 386, 388, 389, or 391 to 415 may be included in the light chain variable region of SEQ ID NOs: 371 to 380, 383, 385, 386, 388, 389, or 391 to 415.
  • the heavy chain variable region of SEQ ID NO: 181 and the light chain variable region of SEQ ID NO: 405 may be included.
  • the part indicated by X or Xaa in the sequence according to the present invention indicates other amino acids not specified, indicating that any amino acid may be included.
  • Phase display is a technique for displaying variant polypeptides as fusion proteins with at least a portion of the envelope protein on the surface of a phage, eg, fibrous phage particles.
  • the utility of phage display lies in the fact that a large library of randomized protein variants can be targeted to quickly and efficiently classify sequences that bind with high affinity with a target antigen. Displaying peptide and protein libraries on phage has been used to screen millions of polypeptides to identify polypeptides with specific binding properties.
  • Phage display technology provided a powerful tool for generating and selecting new proteins that bind specific ligands (eg antigens). Phage display technology can be used to generate large libraries of protein variants and to quickly sort sequences that bind with high affinity to target antigens.
  • Nucleic acids encoding variant polypeptides are fused with nucleic acid sequences encoding viral envelope proteins, eg, gene III protein or gene VIII protein.
  • Monovalent phage display systems have been developed in which a nucleic acid sequence encoding a protein or polypeptide is fused with a nucleic acid sequence encoding a portion of a gene III protein. In monovalent phage display systems, gene fusions are expressed at low levels and wild type Gene III proteins are also expressed to maintain particle infectivity.
  • Phage display technology has several advantages over conventional hybridoma and recombinant methods for preparing antibodies with the desired characteristics. This technique allows the production of large antibody libraries with various sequences in a short time without the use of animals. The preparation of hybridomas or the production of humanized antibodies may require months of preparation. In addition, since no immunity is required at all, phage antibody libraries can produce antibodies against antigens that are toxic or low antigenic. Phage antibody libraries can also be used to generate and identify novel therapeutic antibodies.
  • Techniques for generating human antibodies from immunized, non-immunized human, germline sequences, or na ⁇ ve B cell Ig repertory using immunized phage display libraries can be used.
  • Various lymphoid tissues can be used to prepare na ⁇ ve or non-immune antigen binding libraries.
  • the ability to identify and isolate high affinity antibodies from phage display libraries is important for the isolation of novel therapeutic antibodies. Separation of high affinity antibodies from the library may depend on the size of the library, the efficiency of production in bacterial cells, and the diversity of the library.
  • the size of the library is reduced by inefficient folding of the antibody or antigen binding protein and inefficient production due to the presence of stop codons. Expression in bacterial cells can be inhibited if the antibody or antigen binding domain is not properly folded. Expression can be improved by alternating mutations at the surface of the variable / constant interface or at selected CDR residues.
  • the sequence of the backbone region is one element to provide proper folding when generating antibody phage libraries in bacterial cells.
  • CDR3 regions have been found to often participate in antigen binding.
  • the CDR3 regions on the heavy chains vary considerably in size, sequence, and structural conformation, and thus can be used to prepare a variety of libraries.
  • diversity can be generated by randomizing the CDR regions of the variable heavy and light chains using all 20 amino acids at each position.
  • the use of all twenty amino acids can result in highly variable variant antibody sequences and increase the chance of identifying new antibodies.
  • Antibodies or antibody fragments of the present invention may include not only the sequences of the anti-PD-1 antibodies of the present invention described herein, but also biological equivalents thereof, as long as they specifically recognize PD-1.
  • further changes can be made to the amino acid sequence of the antibody to further improve the binding affinity and / or other biological properties of the antibody.
  • Such modifications include, for example, deletions, insertions and / or substitutions of amino acid sequence residues of the antibody.
  • Such amino acid variations are made based on the relative similarity of amino acid side chain substituents such as hydrophobicity, hydrophilicity, charge, size, and the like.
  • arginine, lysine and histidine are all positively charged residues; Alanine, glycine and serine have similar sizes; It can be seen that phenylalanine, tryptophan and tyrosine have a similar shape.
  • arginine, lysine and histidine; Alanine, glycine and serine; Phenylalanine, tryptophan and tyrosine are biologically equivalent functions.
  • the present invention relates to a nucleic acid encoding the antibody or antigen-binding fragment thereof.
  • the nucleic acid encoding the antibody or antigen-binding fragment thereof of the present invention can be isolated to recombinantly produce the antibody or antigen-binding fragment thereof.
  • the nucleic acid is isolated and inserted into a replicable vector for further cloning (amplification of DNA) or for further expression. Based on this, the present invention relates to a vector comprising the nucleic acid in another aspect.
  • Nucleic acid is meant to encompass DNA (gDNA and cDNA) and RNA molecules inclusively, and the nucleotides that are the basic building blocks of nucleic acids include not only natural nucleotides but also analogs in which sugar or base sites are modified. .
  • the sequences of nucleic acids encoding heavy and light chain variable regions of the invention can be modified. Such modifications include addition, deletion, or non-conservative or conservative substitutions of nucleotides.
  • amino acid sequence for the antibody or antigen-binding fragment thereof of the present invention or nucleic acid encoding the same is interpreted to also include a sequence that exhibits a substantial identity with the sequence set forth in SEQ ID NO.
  • the above substantial identity is at least 90% when the sequences of the present invention are aligned as closely as possible with any other sequences, and the aligned sequences are analyzed using algorithms commonly used in the art.
  • a homology most preferably at least 95% homology, at least 96%, at least 97%, at least 98%, at least 99% homology.
  • the antibody or antigen-binding fragment thereof of the present invention is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% compared to the specified sequence or all described in the specification. , 99%, or more homology.
  • homology can be determined by sequence comparison and / or alignment by methods known in the art. For example, sequence comparison algorithms (ie, BLAST or BLAST 2.0), manual alignment, visual inspection can be used to determine the percent sequence homology of nucleic acids or proteins of the invention.
  • the DNA encoding the antibody is readily isolated or synthesized using conventional procedures (e.g., by using oligonucleotide probes capable of specifically binding to the DNA encoding the heavy and light chains of the antibody).
  • Many vectors are available.
  • Vector components generally include, but are not limited to, one or more of the following: signal sequence, origin of replication, one or more marker genes, enhancer elements, promoters, and transcription termination sequences.
  • the term "vector” refers to a plasmid vector as a means for expressing a gene of interest in a host cell; Cosmid vector; Viral vectors such as bacteriophage vectors, adenovirus vectors, retrovirus vectors, and adeno-associated virus vectors, and the like.
  • the nucleic acid encoding the antibody in the vector is operably linked with a promoter.
  • “Operatively linked” means a functional binding between a nucleic acid expression control sequence (eg, an array of promoters, signal sequences, or transcriptional regulator binding sites) and another nucleic acid sequence, whereby the regulatory sequence is the other nucleic acid. To control transcription and / or translation of the sequence.
  • a nucleic acid expression control sequence eg, an array of promoters, signal sequences, or transcriptional regulator binding sites
  • promoters capable of promoting transcription e.g., tac promoter, lac promoter, lacUV5 promoter, lpp promoter, pL ⁇ promoter, pR ⁇ promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.
  • ribosome binding sites for initiation of translation e.g., amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter, etc.
  • a promoter derived from the genome of a mammalian cell e.g., a metallothionine promoter, a ⁇ -actin promoter, a human heroglobin promoter and a human muscle creatine promoter
  • a mammal Promoters derived from animal viruses e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus (CMV) promoter, tk promoter of HSV, mouse breast tumor virus (MMTV) promoter, LTR promoter of HIV
  • a promoter derived from the genome of a mammalian cell e.g., a metallothionine promoter, a ⁇ -actin promoter, a human heroglobin promoter and a human muscle creatine promoter
  • a mammal Promoters derived from animal viruses e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40
  • the vector may be fused with other sequences to facilitate purification of the antibody expressed therefrom.
  • Sequences to be fused include, for example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6x His (hexahistidine; Quiagen, USA).
  • Such vectors include antibiotic resistance genes commonly used in the art as selectable markers and include, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline. There is a resistance gene.
  • the present invention relates to a cell transformed with the above-mentioned vector.
  • the cells used to produce the antibodies of the invention can be prokaryote, yeast or higher eukaryote cells, but are not limited thereto.
  • Bacillus strains such as Escherichia coli, Bacillus subtilis and Bacillus thuringiensis, Streptomyces, Pseudomonas (e.g. Pseudomonas putida), Proteus Prokaryotic host cells such as Proteus mirabilis and Staphylococcus (eg, Staphylocus carnosus) can be used.
  • Pseudomonas e.g. Pseudomonas putida
  • Proteus Prokaryotic host cells such as Proteus mirabilis and Staphylococcus (eg, Staphylocus carnosus) can be used.
  • examples of useful host cell lines are COS-7, BHK, CHO, CHOK1, DXB-11, DG-44, CHO / -DHFR, CV1, COS-7, HEK293, BHK, TM4, VERO, HELA, MDCK, BRL 3A, W138, Hep G2, SK-Hep, MMT, TRI, MRC 5, FS4, 3T3, RIN, A549, PC12, K562, PER.C6, SP2 / 0, NS-0 , U20S, or HT1080, but is not limited thereto.
  • the present invention (a) culturing the cells; And (b) recovering the antibody or antigen-binding fragment thereof from the cultured cells.
  • the cells can be cultured in various media. It can be used as a culture medium without limitation among commercial media. All other necessary supplements known to those skilled in the art may be included at appropriate concentrations. Culture conditions, such as temperature, pH, and the like, are already in use with host cells selected for expression, which will be apparent to those skilled in the art.
  • the term “transformation” means introducing a vector containing a nucleic acid encoding a target protein into a host cell so that the protein encoded by the nucleic acid can be expressed in the host cell. May include all of them as long as they can be expressed in the host cell, whether inserted into or located outside the chromosome of the host cell, and the nucleic acid includes DNA and RNA encoding the target protein. May be introduced in any form as long as it can be introduced into and expressed in a host cell, for example, the nucleic acid may be a gene structure of an expression cassette, which is a gene construct including all elements necessary for self-expression. Can be introduced into a host cell in which the expression cassette normally operates on the nucleic acid.
  • the expression cassette may be in the form of an expression vector capable of self-replicating, and the nucleic acid may be in its own form. It may be introduced into a host cell and operably linked with a sequence required for expression in the host cell.
  • the recovery of the antibody or antigen-binding fragment thereof can be removed by, for example, centrifugation or ultrafiltration, and the resultant can be purified using, for example, affinity chromatography or the like. Further other purification techniques such as anion or cation exchange chromatography, hydrophobic interaction chromatography, hydroxylapatite chromatography and the like can be used.
  • the present invention relates to a composition for preventing or treating cancer, comprising the antibody or antigen-binding fragment thereof as an active ingredient.
  • the present invention includes, for example, (a) a pharmaceutically effective amount of an antibody against PD-1 or an antigen binding fragment thereof according to the present invention; And (b) it may be a pharmaceutical composition for the prevention or treatment of cancer comprising a pharmaceutically acceptable carrier.
  • the present invention also relates to a method for the prevention or treatment of cancer comprising administering to a patient an effective amount necessary for an antibody against PD-1 or an antigen-binding fragment thereof according to the present invention.
  • the cancer is a group consisting of melanoma, lung cancer, liver cancer, glioblastoma, ovarian cancer, colon cancer, head and neck cancer, bladder cancer, kidney cancer, gastric cancer, breast cancer, metastatic cancer, Hodgkin's lymphoma, prostate cancer and pancreatic cancer It may be characterized in that it is selected from but is not limited thereto.
  • treatment in the present invention means not only inhibiting or alleviating cancer or one or more symptoms caused by administration of the composition, but also preventing the treatment of cancer or the progression of the cancer to reverse the symptoms of the disease.
  • prevention refers to any action that inhibits or delays the onset of cancer by administration of the composition.
  • the prophylaxis or treatment of cancer is achieved by binding the antibody obtained in the present invention to PD-1, and significantly inhibits its activity by binding to PD-1 to prevent or treat cancer.
  • the term "pharmaceutically acceptable carrier” refers to a carrier or diluent that does not irritate an organism and does not inhibit the biological activity and properties of the administered compound.
  • Acceptable pharmaceutical carriers in compositions formulated as liquid solutions are sterile and physiologically compatible, including saline, sterile water, Ringer's solution, buffered saline, albumin injectable solutions, dextrose solution, maltodextrin solution, glycerol, ethanol and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers and bacteriostatic agents may be added as necessary.
  • Diluents, dispersants, surfactants, binders and lubricants may also be added in addition to formulate into injectable formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like.
  • Cancer preventive or therapeutic composition comprising the antibody of the present invention and a pharmaceutically acceptable carrier can be applied to any formulation containing it as an active ingredient, it can be prepared in oral or parenteral formulations.
  • Pharmaceutical formulations of the invention may be oral, rectal, nasal, topical (including the cheek and sublingual), subcutaneous, vaginal or parenteral (intramuscular, subcutaneous). And forms suitable for administration by inhalation or insufflation.
  • Oral dosage forms containing the composition of the present invention as an active ingredient include, for example, tablets, troches, lozenges, water-soluble or oily suspensions, preparation powders or granules, emulsions, hard or soft capsules, syrups or elixirs. can do.
  • lactose For formulation into tablets and capsules, lactose, saccharose, sorbitol, mannitol, starch, amylopectin, binders such as cellulose or gelatin, excipients such as dicalcium phosphate, disintegrants such as corn starch or sweet potato starch, stearic acid masne It may include a lubricating oil such as calcium, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax, and in the case of a capsule, it may further contain a liquid carrier such as fatty oil in addition to the above-mentioned materials.
  • a lubricating oil such as calcium, calcium stearate, sodium stearyl fumarate or polyethylene glycol wax
  • a liquid carrier such as fatty oil in addition to the above-mentioned materials.
  • Formulations for parenteral administration comprising the composition of the present invention as an active ingredient, for injection, such as subcutaneous injection, intravenous injection or intramuscular injection, a suppository injection method or aerosol for spraying by inhalation through the respiratory system It can be formulated as.
  • the compositions of the present invention may be mixed in water with stabilizers or buffers to prepare solutions or suspensions, which may be formulated for unit administration of ampoules or vials.
  • solutions or suspensions which may be formulated for unit administration of ampoules or vials.
  • a rectal composition such as suppositories or enemas, including conventional suppository bases such as cocoa butter or other glycerides.
  • a propellant or the like may be combined with the additives to disperse the dispersed dispersion or wet powder.
  • the present invention relates to a method for preventing or treating cancer, comprising administering a composition for preventing or treating cancer comprising the antibody.
  • the term “administration” means introducing a pharmaceutical composition of the present invention to a patient in any suitable manner. It may be administered through, or specifically, can be administered in a conventional manner via oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial, transdermal, nasal, inhalation, intraocular or intradermal route. .
  • the treatment method of the present invention includes administering a composition for preventing or treating cancer of the present invention in a pharmaceutically effective amount.
  • a suitable total daily dose may be determined by the practitioner within the correct medical judgment.
  • the specific therapeutically effective amount for a particular patient may be based on the specific composition, including the type and severity of the reaction to be achieved, whether or not other agents are used in some cases, the age, weight, general health, sex and diet of the patient, time of administration, It is desirable to apply differently depending on the route of administration and the rate of release of the composition, the duration of treatment, and the various factors and similar factors well known in the medical arts, including drugs used with or concurrent with the specific composition. Therefore, the effective amount of the composition for preventing or treating cancer suitable for the purpose of the present invention is preferably determined in consideration of the above-mentioned matters.
  • the treatment method of the present invention is applicable to any animal in which diseases such as tumor development and angiogenesis may occur due to excessive activity of PD-1, and the animals are not only humans and primates, but also cattle, pigs, sheep And domestic animals such as horses, dogs and cats.
  • the present invention is a cancer diagnostic composition comprising a PD-1 antibody or an antigen-binding fragment thereof according to the present invention.
  • the present invention also relates to a method for diagnosing cancer by treating a PD-1 antibody or antigen-binding fragment thereof according to the present invention.
  • Cancer can be diagnosed by measuring the level of PD-1 expression in a sample via an antibody against PD-1 according to the invention.
  • Expression levels can be measured according to conventional immunoassay methods, radioimmunoassay using the antibody against PD-1, radioimmunoprecipitation, immunoprecipitation, immunohistochemical staining, enzyme-linked immunosorbant assay (ELISA), capture -ELISA, inhibition or hardwood analysis, sandwich analysis, flow cytometry, immunofluorescence staining and immunoaffinity purification can be measured, but is not limited thereto.
  • cancer By analyzing the final signal intensity by the immunoassay process, cancer can be diagnosed. That is, if the protein of the marker of the present invention is expressed high in a biological sample and the signal is stronger than that of the normal biological sample (eg, normal gastric tissue, blood, plasma or serum), the cancer is diagnosed.
  • the normal biological sample eg, normal gastric tissue, blood, plasma or serum
  • the present invention relates to a cancer diagnostic kit comprising the cancer diagnostic composition.
  • the kit according to the present invention includes an antibody against PD-1 according to the present invention, and can diagnose cancer by analyzing a signal indicated by the reaction between the sample and the antibody.
  • the signal may include, but is not limited to, an enzyme bound to the antibody, for example, alkaline phosphatase, ⁇ -galactosidase, horse radish peroxidase, luciferase or cytochrome P450.
  • the substrate for the enzyme is bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate (naphthol) as the substrate.
  • BCIP bromochloroindolyl phosphate
  • NBT nitro blue tetrazolium
  • naphthol-AS-B1-phosphate naphthol
  • Chloronaphthol aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin when color development reaction substrates such as -AS-B1-phosphate) and enhanced chemifluorescence (ECF) are used, and horse radish peroxidase is used (Bis-N-methylacridinium nitrate), resorphin benzyl ether, luminol, amplex red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyr ocatechol), TMB (tetramethylbenzidine), ABTS (2,2'-Azine-di [3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol / pyronine, glucose oxidase and t-NBT (nitroblue tetrazolium)
  • kits according to the invention may comprise a label which generates a detectable signal, said label comprising a chemical (eg biotin), an enzyme (alkaline phosphatase, ⁇ -galactosidase, horse radish). Peroxidase and cytochrome P450), radioactive materials (eg C14, I125, P32 and S35), fluorescent materials (eg fluorescein), luminescent materials, chemiluminescent and fluorescence resonance energy transfer (FRET) It may include, but is not limited thereto.
  • a chemical eg biotin
  • an enzyme alkaline phosphatase, ⁇ -galactosidase, horse radish
  • Peroxidase and cytochrome P450 cytochrome P450
  • radioactive materials eg C14, I125, P32 and S35
  • fluorescent materials eg fluorescein
  • luminescent materials eg fluorescein
  • FRET fluorescence resonance energy transfer
  • Measurement of the activity or signal of an enzyme used for cancer diagnosis can be carried out according to various methods known in the art. This allows for either qualitative or quantitative analysis of PD-1 expression.
  • Cloning of PD-1 was performed using the Jurkat cell cDNA library (Stratagene, USA), using primers for PD1 containing restriction enzyme Sfi I sites at 5 'and 3' to obtain only the extracellular domain (Table 1). Amplification was carried out by polymerase chain reaction (PCR). The amplified PCR product was prepared by fusing human Fc (SEQ ID NO: 196) and mouse Fc (SEQ ID NO: 197) to the carboxy-terminus using the N293F vector (Fig. 1).
  • Plasmid DNA was transfected into HEK-293F cells to express the antigen in animal cells.
  • the polyplex reaction solution for transfection was performed by mixing 25 ⁇ g of plasmid DNA in 3 ml of Freestyle 293 expression medium and further adding 2 mg / ml PEI (Polyethylenimine) (polyplUSA-transfection, USA). ) 50 ⁇ l and mix again.
  • the polyplex reaction solution was reacted at room temperature for 15 minutes, and then placed in a 40 ml culture medium incubated at 1 ⁇ 10 6 cells / ml and incubated at 120 rpm at 37 ° C. and 8% CO 2 for 24 hours.
  • the protein When using recombinant Protein A agarose resin, the protein was eluted with 0.1M glycine and neutralized with 500 ⁇ l of 1M Tris-HCl, and the first purified protein was a Superdex 200 (1.5 cm * 100 cm) gel. Secondary purification was performed using filtration chromatography.
  • Purified protein was purified by SDS-PAGE gel and size exclusion chromatography (TSK-GEL G-3000 SWXL Size-exclusion chromatography (SEC) (Tosoh)).
  • Blocking after coating 50 ⁇ g of PD1-hFc, PD1-mFc and PD1-his (Catalog Number, 10377-H08H) protein antigen prepared in Example 1 on an immunosorbent tube was performed.
  • Human antibody library phage infected the human scFv library with a diversity of 2.7 ⁇ 10 10 and then incubated the bacteria at 30 ° C. for 16 hours. After incubation, the supernatant was concentrated by PEG, and then dissolved in PBS buffer to prepare a human antibody library. After the library phage was put into the immunotube, the reaction was carried out at room temperature for 2 hours, and then washed with 1XPBS / T and 1XPBS to elute only scFv-phage specifically bound to the antigen.
  • a pool of positive phages is obtained through the panning process of infecting and eluting the eluted phages again, increasing the number of times in the PBST washing step with the amplified phages in the first round of panning. Round and three rounds of panning were performed.
  • ELISA Polyphage enzyme linked immunoassay
  • each well was washed with 0.2 ml of PBS / T, and then 100 ⁇ l of the first to third panning poly scFv-phage was added to each well and allowed to react at room temperature for 2 hours. Again, each well was washed four times with 0.2 ml of PBS / T, and then the secondary antibody anti-M13-HRP (Amersham 27-9421-01) was diluted 1: 2000 and reacted at room temperature for 1 hour. After washing with PBS / T, OPD tablet (sigma. 8787-TAB) was made into PC buffer, 100 ul / well each color developed for 10 minutes, and absorbance was measured with a spectrophotometer (Molecular Device) at 490 nm.
  • OPD tablet sigma. 8787-TAB
  • Colonies from high-binding polyclonal phage antibody groups were incubated for 16 hours at 37 ° C. in 1 ml 96-deep well plates (Bionia 90030) in 2 ⁇ YTCM, 2% glucose, 5 mM MgCl 2 medium. Take 100-200 ul of cells so that the value is 0.1 at OD 600 in these grown cells and place in 1 ml of 2xYTCM, 2% glucose, 5 mM MgCl 2 medium, and then measure the value at OD 600 at 37 ° C in a 96-deep well plate. Incubate for 2-3 hours so that it is 0.5-0.7. M1 helper phages were infected with a MOI of 1:20 and incubated for 16 hours at 30 ° C. in 2 ⁇ YTCMK, 5 mM MgCl 2 1 mM IPTG medium.
  • Each well was blocked using 4% skim milk dissolved in PBS after coating 100 ng of antigen PD1 per well for 16 hours at 4 ° C. in a 96 well immune plate.
  • 100 ⁇ l of monoclonal scFv-phage (100 scFv-phage) incubated for 16 hours washed with 0.2 ml PBS / T in each well was added to each well and allowed to react at room temperature for 2 hours.
  • Each well was washed four times with 0.2 ml PBS / T, and then the second antibody, anti-M13-HRP, was diluted to 1/2000 and reacted at room temperature for 1 hour. After washing with 0.2 ml PBS / T, color development was measured at 490 nm.
  • the selected clones were subjected to DNA-prep using a DNA purification kit (Qiagen, Germany) to obtain DNA and to request sequencing (solgent). Based on the results of the sequencing analysis, the CDR sites of V H and V L of the selected antibodies were identified, and the similarity between these antibodies and the germ line antibody group was determined by NCBI's web page http: //www.ncbi.nlm.nih.
  • the Ig BLAST program at .gov / igblast / was used to investigate. As a result, phage antibodies specific for 15 PD1 were obtained, which are summarized in Table 3 below.
  • the antibodies comprising the heavy and light chain CDRs, FR sequences, and the heavy chain variable region and the light chain variable region comprising the selected antibodies are shown in Tables 4 and 5.
  • PCR was performed on the heavy and light chains (iCycler iQ, BIO-RAD) to convert monoclonal phage antibodies against 15 selected PD1 phages into IgG whole vectors.
  • heavy and light chains were obtained, and the heavy and light chains of the vector and each clone were cleaved with restriction enzymes.
  • the vector and heavy chains were each eluted with a DNA-gel extraction kit (Qiagen).
  • Ligation is a mixture of vector 1 ul (10 ng) heavy chain (100-200 ng) 15 ul, 10x Buffer 2 ul, ligase (1 U / ul) 1 ul, distilled water and left at room temperature for 1-2 hours. , Transformed into cells (competent cells) (XL1-blue) and placed on ice for 5 minutes, gave a heat shock (heat shock) at 42 °C for 90 seconds.
  • the cloned pNATVH and pNATVL vectors were cotransfected (co-transfected) into HEK293F cells at a ratio of 6: 4, and the supernatant was collected on day 7 to remove cells and suspended solids through centrifugation and a 0.22 ⁇ m top-filter. The supernatants were collected and protein A affinity chromatography was performed to purify IgG antibodies. After purification, the antibody was isolated through glycine buffer, and the buffer was exchanged so that the final resuspension buffer became PBS. Purified antibodies were quantified by BCA and nano drop, and 15 antibodies were loaded at 5 ug each under reduced and non-reduced conditions, and subjected to SDS-PAGE analysis for purity and mobility of purified proteins. It was confirmed (Fig. 5).
  • the dilution of the PD1 / PD-L1 blocking bioassay was performed in a step-diluted manner to restore the reduced signal concentration-dependently.
  • the degree of recovery can be represented as EC50 (effective concentration of mAb at 50% level of Recovery signal) and analyzed using Graphpad Prism6 of EC50 in vitro efficacy inhibit recovery capability is shown in FIG.
  • the transgenic cell pool expressing PD-1 was transformed into HEK293E with a pcDNA3.1 plasmid containing human PD-1 (NM_005018.2), containing 150 ug / ml Zeocin (# R25001, Thermo Fisher). Screened in selective medium. Each cell pool was identified and selected by fluorescence activated cell sorting (FACS) analysis using each anti-PD-1 (# 557860, BD) and used for functional evaluation such as FACS binding assays or FACS competition assays.
  • FACS fluorescence activated cell sorting
  • Each pool of transformed cells expressing high human PD-1 was prepared with 0.5-1x10 ⁇ 6 cells per sample, and the antibodies were reacted with the prepared cells for 20 min at 4 ° C. by diluting the antibodies in successive dilutions. The cells were then washed three times with PBS (# LB001-02, welgene) containing 2% fetal bovine serum, and the anti-human IgG antibody (#ITC) bound to the fluorescein isothiocyanate (FITC) phosphor FI-3000, Vectorlabs) and reacted at 4 ° C.
  • PBS # LB001-02, welgene
  • ITC anti-human IgG antibody
  • FITC fluorescein isothiocyanate
  • the binding force of the antibody bound in a concentration-dependent manner to human PD-1 overexpressed on the cell surface can be known as mean fluorescence intensity (MFI).
  • Example 2 The same procedure as in Example 2 was further selected to have PD1-45D6, 49A2 similar sequence. Table 6 summarizes the characteristics.
  • PBST buffer was used to collect the sensogram data during the binding and dissociation process over time while flowing the antibody for 10 minutes at a flow rate of 30 ul / min at different concentrations (30 nM to 0.123 nM).
  • the equilibrium dissociation constant (KD) was calculated by plotting and fitting the sensogram data at equilibrium according to the concentration, and showed a high affinity for PD1 antigen with 45D6 of 0.001 nM and 49A2 of 0.019 nM ( 9).
  • Antibody optimization involves the addition of 10 5 -10 6 light chain (LC) pools retained by WBIOLOGICS to construct a new LC shuffling library, and LC shuffling, hydrophobicity of heavy chains. Mutations to conserved residues were compared with residues of structurally important sites such as hydrophobic cores, exposed residues, charge clusters, salt bridges, etc. Core packing + LC shuffling followed by LC shuffling, mutations in antibody variable regions can be frequently mutated during in vivo affinity maturation Mutational hot spots were randomly mutated, followed by three methods: CDR hotspot + LC shuffling.
  • LC genes of 45D6 and 49A2 antibodies were digested with BstX I and used as vectors, and library pools retained by WBIOLOGICS were digested with BstX I and used as inserts. After ligation with ligase, transformation was performed using the cells for electroporation transformation.
  • the antibody libraries were prepared by collecting the transformed cells in a square plate, and various libraries of about 1.5 ⁇ 10 7 were obtained. As a result of sequencing, all of the HC sequences were identical and the LC sequences were different.
  • the frame work (FR) portion of the 45D6, 49A2 antibody was replaced with a conserved amanoic acid sequence, followed by cutting the LC gene with BstX I and using it as a vector.
  • the library pool retained by Biologics was cut with BstX I and used as an insert.
  • transformation was performed using the cells for electroporation transformation.
  • the antibody libraries were prepared by collecting the transformed cells in a square plate, and various libraries of about 8.4 ⁇ 10 6 were obtained.
  • the sequencing analysis showed that the FR region of HC was replaced with the amanoic acid sequence that was conserved. This different thing was confirmed.
  • the frame work (FR) portion of the 45D6 antibody was replaced with a conserved amanoic acid sequence
  • the CDR1 hotspot library was cleaved with Sfi I and used as an insert, and then The library pool possessed by Biologics was cut into Sfi I and used as a vector.
  • transformation was performed using the electroporation transformation taxa.
  • the antibody libraries were prepared by collecting the transformed cells in a square plate, and various libraries of about 5.6x106 were obtained, and sequencing showed that the FR sites of HC were substituted with conserved amanoic acid sequences and hotspots of CDR1. It was confirmed that the amino acids of the sequence was randomly changed and the sequence of the LC is different.
  • Blocking was performed after coating PD1-hFc, PD1-mFc produced by YBIOLOGICS and 50 ug of PD1-his (Catalog Number, 10377-H08H) protein antigen purchased from Sino Biological Inc. in an immunosorb tube. .
  • Human Antibody Library Phage was infected with bacteria with a human scFv library of 2.7 ⁇ 10 10 diversity and then incubated at 30 ° C. for 16 hours. After incubation, the supernatant was concentrated by PEG, and then dissolved in PBS buffer to prepare a human antibody library. After the library phage was put into the immunotube, the reaction was carried out at room temperature for 2 hours, and then washed with 1XPBS / T and 1XPBS to elute only scFv-phage specifically bound to the antigen.
  • a pool of positive phages was obtained through a panning process in which the eluted phages were again infected with E. coli and amplified, and panning for antibody optimization was performed only the first round. As a result, it was confirmed that the number of phages bound to the antigen in the first round panning was slightly increased compared to the input as shown in Table 7.
  • Colonies from panning were incubated for 16 hours at 37 ° C. in 1 ml 96-deep well plate (Biononia 90030) in 2 ⁇ YTCM, 2% glucose, 5 mM MgCl 2 medium. Take 100-200 ul of cells so that the value is 0.1 at OD 600 in these grown cells and place in 1 ml of 2xYTCM, 2% glucose, 5 mM MgCl 2 medium, and then measure the value at OD 600 at 37 ° C in a 96-deep well plate. It was incubated for 2-3 hours so that it is 0.5-0.7. M1 helper phages were infected with a MOI of 1:20 and incubated for 16 hours at 30 ° C. in 2 ⁇ YTCMK, 5 mM MgCl 2 1 mM IPTG medium.
  • the selected monoclones were subjected to DNA-prep using a DNA purification kit (Qiagen, Germany) to obtain DNA and to request sequencing (solgent). Based on the results of the sequencing analysis, the CDR regions of V H and V L of the selected antibodies were identified, and the similarity between these antibodies and germ line antibody group was determined by NCBI's web page http://www.ncbi.nlm.nih.gov/igblast Investigation was carried out using the Ig BLAST program of / to obtain 25 specific phage antibodies with higher binding capacity than the parent antibody (49A2: 10, 45D6: 15), which are summarized in Table 8 below.
  • the antibodies comprising the heavy and light chain CDRs, FR sequences, and heavy and variable chain and light chain variable regions of the selected antibodies are shown in Tables 9 and 10 below.
  • PCR was performed on the heavy and light chains (iCycler iQ, BIO-RAD) to convert monoclonal phage antibodies against 25 selected PD1 phages into IgG whole vectors.
  • heavy and light chains were obtained, and the restriction enzymes cut the heavy and light chains of the vector and the individual clones.
  • Each vector and heavy chain was eluted with a DNA-gel extraction kit (Qiagen).
  • Ligation is a vector of 1 ul (10 ng) heavy chain (100-200 ng) 15 ul, 10x buffer 2 ul, ligase (1 U / ul) 1 ul, distilled water and mixed for 1 to 2 hours at room temperature Then, put into transformed cells (competent cells: XL1-blue) and placed on ice for 5 minutes, gave a heat shock (heat shock) at 42 °C for 90 seconds.
  • the cloned pNATVH and pNATVL vectors were cotransfected (co-transfected) into HEK293F cells at a ratio of 6: 4, and the supernatant was collected on day 7 to remove cells and suspended solids through centrifugation and a 0.22 ⁇ m top-filter.
  • the supernatants were collected and protein A affinity chromatography was performed to purify IgG antibodies. After purification, the antibody was isolated through glycine buffer, and the buffer was exchanged so that the final resuspension buffer became PBS.
  • Purified antibodies were quantified by BCA and nano drop, and 25 antibodies were loaded by 5 ug each in reducing and non-reducing conditions, followed by SDS-PAGE analysis for purity and mobility of purified proteins. The state was confirmed. In addition, a portion of the supernatant was loaded on SDS-PAGE to compare the expression rate with the parent antibody and most of the antibody expression rate was increased than the parent antibody, the results can be seen in FIG.
  • the activity evaluation experiments of the selected antibodies were conducted using the PD1 / PD-L1 block bioassay kit (promega, J1250).
  • CHO cell line with high expression of PD-L1 was plated in a 96-well plate, cultured for 16 hours or more, treated with each antibody serially diluted to a constant concentration, and Jurkat cell line with high expression of human PD-1 for 6 hours. Incubated together.
  • the extent of recovery of inhibition of the antibody was determined by the luminescence intensity of luciferase by breaking down the substrate and measured by spectrophotometer (SpectraMax M5 spectraphotometer, Molecular Devices, USA).
  • PD-1 antibodies confirmed the activity of the antibody to restore the reduced signal due to PD-1 / PD-L1 complex formation, and 45D6-3D2, 45D6-3H7, 45D6-5B2, 45D6 in the 45D6 antibody.
  • 49A2-1B2, 49A2-1H8, 49A2-2A6, 49A2-2B9 increased the activity against the parent antibody and showed similar activity to the control antibody in the 49A2 antibody (FIG. 12).
  • the transgenic cell pool expressing human PD-1 was transformed into HEK293E with a pcDNA3.1 plasmid containing human PD-1 (NM_005018.2) or human PD-L1 (NM_014143.2), and 400 ug / Selection was made in selective medium containing ml Zeocin (# R25001, Thermo Fisher). Each cell pool was identified and selected by fluorescence activated cell sorting (FACs) analysis using anti-PD-1 (# 557860, BD), respectively, and used for functional evaluation methods such as FACs binding assays or FACs competition assays. Was used.
  • FACs fluorescence activated cell sorting
  • Each pool of transformed cells expressing human PD1 was prepared with 0.5-1 ⁇ 10 6 cells per sample, and the antibodies were reacted with the prepared cells for 20 min at 4 ° C. by diluting the antibodies in successive dilutions. The cells were then washed three times with PBS (# LB001-02, welgene) containing 2% fetal bovine serum, and the anti-human IgG antibody (#ITC) bound to the fluorescein isothiocyanate (FITC) phosphor FI-3000, Vectorlabs) and reacted at 4 ° C.
  • PBS # LB001-02, welgene
  • ITC anti-human IgG antibody
  • FITC fluorescein isothiocyanate
  • Each pool of transformed cells expressing human PD-1 was prepared with 0.5x10 ⁇ 6 cells per sample, and the antibodies were continuously diluted with a constant dilution factor, and reacted with the prepared cells at 4 ° C. for 20 minutes. The cells were then washed three times with PBS (# LB001-02, welgene) containing 2% fetal bovine serum, and the anti-human IgG antibody (#ITC) bound to the fluorescein isothiocyanate (FITC) phosphor FI-3000, Vectorlabs) and reacted at 4 ° C.
  • PBS # LB001-02, welgene
  • ITC anti-human IgG antibody
  • FITC fluorescein isothiocyanate
  • Human PD-1-Fc (S1420, Y-Biologics) or PD-L2-Fc (# 10292-H02H, Sino) was added to the wells of a 96-well immunomicroplate (# 439454, Thermo). Fixed for 16 hours at °C, washed three times with PBS containing 0.05% tween-20 (# P9416, Sigma-Aldrich), followed by a wash solution containing 4% skim milk (# 232120, Becton, Dickinson and Company) Nonspecific binding was blocked by standing at room temperature for 1 hour.
  • each antibody serially diluted with a constant dilution factor and human PD-L1-His (S1479, Y-Biologics) or PD-1-His (S1352, Y-Biologics) were reacted at room temperature for 1 hour, and then prepared microplates. And leave for 1 hour at room temperature.
  • the anti-Biotin-His antibody (# MA1-21315-BTIN, Thermo) was diluted 1: 2000 and put in the well of the microplate and reacted at room temperature for 1 hour, and then washed in the same manner.
  • Streptavidin poly-HRP antibody (# 21140, Pierce) was diluted 1: 5000, put into a well of a microplate, and reacted at room temperature for 1 hour, and washed in the same manner.
  • Add 100 ul TMB substrate solution (# T0440, Sigma-Aldrich), block the light, leave at room temperature for 3 minutes, stop the reaction by adding 50 ul 2.5M sulfuric acid (# S1478, Samchun) and stop the reaction with spectrophotometer (# GM3000, Glomax ® Discover System Promega) was used to measure absorbance at 450 nm. The results are shown in FIG.
  • PBST buffer was used to collect the sensogram data during the binding and dissociation process over time while flowing the antibody for 10 minutes at a flow rate of 30 ul / min at different concentrations (30 nM to 0.123 nM).
  • the equilibrium dissociation constant (KD) was calculated by plotting and plotting the sensogram data at equilibrium according to the concentration, and 49A2 (2B9) showed 0.001 nM with high affinity for the PD1 antigen (Fig. 17).
  • Binding kinetics between human PD1 protein and selected antibodies Ab KD (M) Ka (1 / Ms) Kd (1 / s) PD1 49A2 2.371 ⁇ 10 -10 3.953 ⁇ 10 5 9.372 ⁇ 10 -5 PD1 49A2 1H8 1.245 ⁇ 10 -11 2.201 ⁇ 10 5 2.741 ⁇ 10 -6 PD1 49A2 1B2 1.659 ⁇ 10 -10 3.853 ⁇ 10 5 6.390 ⁇ 10 -5 PD1 49A2 2A6 6.907 ⁇ 10 -11 3.101 ⁇ 10 5 2.142 ⁇ 10 -5 PD1 49A2 2B9 1.0 ⁇ 10 -12 3.774 ⁇ 10 5 1.0 ⁇ 10 -7 PD1 45D6 1.0 ⁇ 10 -12 2.701 ⁇ 10 5 1.07 ⁇ 10 -7 PD1 45D6 3D2 1.0 ⁇ 10 -12 1.81 ⁇ 10 5 1.0 ⁇ 10 -7 PD1 45D6 3H7 2.5
  • Binding kinetics between monkey's PD1 protein and selected antibodies Ab KD (M) Ka (1 / Ms) Kd (1 / s) PD-1-49A2 1.0 ⁇ 10 -12 1.683 ⁇ 10 5 1.0 ⁇ 10 -7 PD-1-49A2-2B9 1.0 ⁇ 10 -12 1.853 ⁇ 10 5 1.0 ⁇ 10 -7 PD-1-45D6 1.0 ⁇ 10 -12 1.535 ⁇ 10 5 1.0 ⁇ 10 -7 PD-1-45D6-5B2 1.0 ⁇ 10 -12 2.078 ⁇ 10 5 1.0 ⁇ 10 -7
  • Binding kinetics measurement between PD1 protein and selected antibodies in mice Ab KD (M) Ka (1 / Ms) Kd (1 / s) PD-1-49A2-2B9 4.231 ⁇ 10 -9 1.478 ⁇ 10 5 6.252 ⁇ 10 -4 PD-1-45D6 2.391 ⁇ 10 -9 5.544 ⁇ 10 4 1.326 ⁇ 10 -4 PD-1-45D6-5B2 4.590 ⁇ 10 -9 1.879 ⁇ 10 5 8.626 ⁇ 10 -4
  • Monoclonal scFv-phage binding to the PD1 antigen was incubated for 16 hours at 37 °C in 2xYTCM, 2% glucose (glucose), 5 mM MgCl 2 medium.
  • Cells thus grown were placed in 2xYTCM, 2% glucose, 5 mM MgCl 2 medium to a value of 0.1 at OD 600 , and then incubated for 2 to 3 hours at 37 ° C. to a value of 0.5 to 0.7 at OD 6 00 .
  • M1 helper phages were infected with a MOI of 1:20 and incubated for 16 hours at 30 ° C. in 2 ⁇ YTCMK, 5 mM MgCl 2 1 mM IPTG medium.
  • Each well was digested using 4% skim milk dissolved in PBS after encoding antigen PD1 wild type (WT) or various variants (mutants: FIG. 18) at 4 ° C. for 16 hours in a 96-well immune-plate. Blocking. After washing with 0.2 ml PBS / T for each well, monoclonal scFv-phage (each 100 scFv-phage), which was incubated for 16 hours, was added to 100 ⁇ l of each well and reacted at room temperature for 2 hours.
  • each well was washed four times with 0.2 ml PBS / T, and then a second antibody (anti-M13-HRP) was diluted to 1/2000 and reacted at room temperature for 1 hour. After washing with 0.2 ml PBS / T, color development was measured at 490 nm.
  • WT antigen PD1 wild type
  • FIG. 18 several variants
  • the optimized antibody has a relatively uniform and high yield due to its excellent physical properties during production and purification through a temporary expression system. It can be seen that some antibodies have higher production than previously commercialized antibodies (FIG. 22).
  • novel antibodies or antigen-binding fragments thereof that bind to PD-1 of the present invention are useful in the development of immunotherapeutic agents for various diseases associated with PD-1 because they can bind to PD-1 and inhibit its activity.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 인간 프로그램화된 세포 사멸 단백질(Human Programmed Cell Death 1; PD-1)에 대한 항체 또는 이의 항원 결합 단편, 이를 코딩하는 핵산, 상기 핵산을 포함하는 벡터, 상기 벡터로 형질전환된 재조합 미생물, 상기 항체 또는 그의 항원 결합 단편의 제조방법, 및 이를 포함하는 암 예방 또는 치료용 조성물에 관한 것이다. 본 발명의 PD-1에 결합하는 신규한 항체 또는 이의 항원 결합 단편은 PD-1에 결합하여 그의 활성을 억제할 수 있으므로 PD-1과 연관된 다양한 질환의 면역 치료제의 개발에 유용하다.

Description

프로그램화된 세포 사멸 단백질(PD-1)에 대한 신규 항체 및 이의 용도
본 발명은 인간 프로그램화된 세포 사멸 단백질(Human Programmed Cell Death 1; PD-1)에 대한 항체 또는 이의 항원 결합 단편, 이를 코딩하는 핵산, 상기 핵산을 포함하는 벡터, 상기 벡터로 형질전환된 재조합 미생물, 상기 항체 또는 그의 항원 결합 단편의 제조방법, 및 이를 포함하는 암 예방 또는 치료용 조성물에 관한 것이다.
현재 널리 사용되고 있는 1세대 화학항암제, 2세대 표적항암제의 경우 항암제의 독성으로 인한 부작용과 약물의 내성 위험이 높고 특정 유전자 변이가 있는 환자에게만 투여할 수 있는 문제점이 있다. 이러한 문제점을 극복한 제3세대 항암제로 불리는 면역 항암제는 면역세포의 신호전달 경로에 작용하여 면역세포를 활성화시켜 암세포를 공격하여 치료효과를 낸다. 기존의 항암제와 달리 우리 몸의 면역체계를 이용하여 치료하는 방법으로 암을 포함한 다양한 질병에 적용할 수 있으며, 부작용 또한 기존 항암제보다 낮은 것으로 보고되고 있다.
PD-1 (CD279로도 명명됨)은 CD28/CTLA4 공동 자극/억제 수용체 패밀리 (co-stimulatory/inhibitory receptor family)와 관련된 55 KD의 수용체 단백질이다 (Blank et al., 2005 Cancer Immunol Immunother 54:307-314).
PD-1을 코딩하는 유전자 및 cDNA를 클로닝하여 마우스 및 인간에서의 특징을 살펴본 바 있다 (Ishida et al., 1992 EMBO J 11:3887-3395; Shinohara et al., 1994 Genomics 23:704-706). 전장 PD-1은 288개의 아미노산 잔기 (NCBI accession number: NP_005009)를 포함한다. 세포외 도메인은 1-167 아미노산 잔기로 구성되고, 세포질 C-말단 꼬리는 191-288 잔기를 포함하며, 이는 2개의 가설적 면역-조절 모티프인 면역수용체 티로신 기반 저해 모티프 (ITIM; Vivier et al., 1997 Immunol Today 18:286-291) 및 면역수용체 티로신 스위치 모티프 (ITSM; Chemnitz et al., 2004 J Immunol 173:945-954)를 포함한다.
지금까지, 2개의 서열 관련 리간드 PD-L1 (B7-H1) 및 PD-L2 (B7-DC)는 PD-1과 특이적으로 상호작용하여 세포 내 신호전달을 유도하고, CD3 및 CD28 매개 T-세포 활성화를 저해하는 것으로 확인되었으며(Riley, 2009 Immunol Rev 229:114-125), 결국 T-세포 활성을 조절 예를 들어, 기타 성장 인자 및 싸이토카인 분비 뿐 아니라, 세포성장, IL-2 및 IFN-γ 분비를 감소시키는 것이다.
PD-1의 발현은 T-세포, B-세포, 단핵세포 및 자연살해(NK) 세포와 같은 면역세포에서 빈번하게 확인되며, 기타 인간 조직, 예를 들어 근육, 상피, 신경 조직 등에서는 거의 발현되지 않는다. 또한, 고 수준의 PD-1 발현은 종종 면역세포의 활성과 관련이 있다. 예를 들어, 인간 T-세포주인 Jurkat이 PHA (phytohaemagglutinin) 또는 포르볼 에스테르 (12-O-tetradecanoylphorbol-13-acetate 또는 TPA)에 의해 활성화되면, 웨스턴 블랏에서 보이는바와 같이 PD-1의 발현이 상향 조절되었다. 항-CD3 항체의 자극에 의해, 자극된 마우스 T- 및 B-림프구와 1차 인간 CD4+ T 세포에서 동일한 현상이 관찰되었다. PD-1 발현 증가에 의해 효과 T세포를 자극하고, 활성화된 효과 T세포를 고갈 및 감소된 면역활성 방향으로 다시 안내한다. 따라서, PD-1 매개 저해 신호는 면역 관용에 중요한 역할을 하는 것으로 알려졌다.
다양한 암에서 종양 침윤 림프구 (tumor-infiltrating lymphocytes: TILs)의 PD-1 발현 및 종양 세포의 PD-1 리간드 발현 증가가 보고되었고, 다른 유형의 조직 및 기관 예를 들어 폐, 간, 위, 신장, 유방, 난소, 췌장, 멜라노사이트 및 식도가 포함된다. 더욱 빈번하게, 이러한 암에서 PD-1 및 PD-L1의 발현은 환자 생존 결과에 대한 좋지 못한 예후와 연관된다. PD-1 유전자를 넉아웃하여 이종이식 (Xenograft) 암 세포 성장을 억제한 형질전환 마우스를 통해, 암 제거 또는 관용을 위한 면역 시스템 조절에서의 PD-1 신호전달에 대한 중요성을 더욱 자세히 설명하였다.
PD-1 신호전달의 상향 조절에 의해 면역 관용의 암 증식으로 이어질 뿐 아니라, 인간의 바이러스 감염 및 확장으로도 이어진다. 유행성 간 감염 바이러스 HBV 및 HCV는 간세포에서 PD-1 리간드의 과발현을 유도하고 효과 T세포에서 PD-1 신호전달을 활성화하여, 바이러스 감염에 대한 T-세포 고갈 및 관용을 야기한다. 마찬가지로, HIV 감염은 유사한 기작으로 인간 면역 시스템을 빈번하게 회피한다. 길항 분자에 의해 PD-1 신호전달을 치료적으로 조절하여 관용으로부터 면역세포를 회복할 수 있고, 재활성시켜 암 및 만성 바이러스 감염을 제거할 수 있다.
PD-1을 표적으로 하는 약물로는 단일 클론 항체인 니볼루맙 (Nivolumab), 펨브롤리주맙 (Pembrolizumab)이 있으며, 악성 흑색종과 비소세포폐암의 치료제로 사용되고 있으나 생산 단가가 높아 환자의 경제적 부담이 크다는 것과 치료 효능에 대한 정확한 검증이 필요한 것으로 보고되고 있다. 따라서 기존 약물이 가진 한계를 극복한 새로운 개념의 PD-1 표적 치료제의 개발이 절실히 요구되고 있다.
이러한 기술적 배경 하에서, 본 출원의 발명자들은 PD-1에 특이적으로 결합하는 항암 치료용 항체를 개발하기 위하여 노력하였다. 그 결과, 본 발명자들은 파지 디스플레이 기술을 이용하여 PD-1에 높은 친화력으로 결합하는 항-PD-1 항체를 개발하고, 이러한 항-PD-1 항체가 PD-1/PD-L1의 복합체 형성을 현저히 저해시킬 수 있음을 확인하고, 본 발명을 완성하였다.
발명의 요약
본 발명의 목적은 PD-1에 대한 신규 항체 또는 그의 항원 결합 단편을 제공하는 데 있다.
본 발명의 다른 목적은 상기 항체 또는 그의 항원 결합 단편을 코딩하는 핵산을 제공하는 데 있다.
본 발명의 다른 목적은 상기 핵산을 포함하는 벡터, 상기 벡터가 도입된 재조합 미생물 및 이의 제조방법을 제공하는 데 있다.
본 발명의 또 다른 목적은 상기 항체 또는 그의 항원 결합 단편을 포함하는 암 예방 또는 치료용 조성물을 제공하는 데 있다.
상기 목적을 달성하기 위해, 본 발명은 서열번호 1 내지 서열번호 30으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 CDR1, 서열번호 31 내지 서열번호 56으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 CDR2, 및 서열번호 57 내지 서열번호 79로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 CDR3를 포함하는 중쇄 가변영역, 및 서열번호 198 내지 서열번호 222로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 CDR1, 서열번호 223 내지 서열번호 241로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 CDR2, 및 서열번호 242 내지 서열번호 269로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 CDR3를 포함하는 경쇄 가변영역을 포함하는, PD-1에 결합하는 항체 또는 이의 항원 결합단편을 제공한다.
본 발명은 또한, 상기 항체 또는 그의 항원 결합 단편을 코딩하는 핵산을 제공한다.
본 발명은 또한, 상기 핵산을 포함하는 발현벡터를 제공한다.
본 발명은 또한, 상기 발현 벡터로 형질전환된 세포를 제공한다.
본 발명은 또한, 다음 단계를 포함하는 상기 항체 또는 그의 항원 결합 단편의 제조방법을 제공한다: (a) 상기 세포를 배양하는 단계; 및 (b) 상기 배양된 세포에서 항체 또는 그의 항원 결합 단편을 회수하는 단계.
본 발명은 또한, 상기 항체 또는 그의 항원 결합 단편을 유효성분으로 함유하는 암 예방 또는 치료용 조성물을 제공한다.
도 1은 카복시-말단에 인간 Fc 또는 마우스 Fc를 융합시킨 PD-1 발현벡터의 모식도이다.
도 2는 PD-1 단백질 정제결과를 나타낸 것이다:
도 2a는 PD1-hFc의 10% SDS-PAGE gel. RE (reducing)과 NR (non-reducing) 조건에서의 단백질 확인 결과를 나타낸 것이다;
도 2b는 G-3000 SWXL SEC-HPLC 결과를 나타낸 것이다. 유속은 1 ml/min이고 전개용매는 PBS이다;
도 2c는 PD1-mFc의 10% SDS-PAGE gel. RE (reducing)과 NR (non-reducing) 조건에서의 단백질 확인 결과를 나타낸 것이다;
도 2d는 G-3000 SWXL SEC-HPLC 결과를 나타낸 것이다. 유속은 1 ml/min이고 전개용매는 PBS이다.
도 3은 패닝 횟수에 따른 PD-1에 대한 항체의 결합력을 나타낸 것이다.
도 4는 PD1-His에 대한 모노 파아지의 결합능 측정을 위한 ELSIA 결과를 나타낸 것이다.
도 5는 PD-1 항체의 순도 확인을 위한 SDS-PAGE 분석결과를 나타낸 것이다.
도 6은 PD-1 항체의 in vitro 효능 평가 결과를 나타낸 것이다.
도 7은 PD-1 항체의 농도 의존적인 in vitro 효능 평가 결과를 나타낸 것이다.
도 8은 세포표면에 과발현된 인간 PD-1에 대해 농도 의존적으로 결합된 항체의 결합력을 MFI(mean fluorescence intensity)을 이용하여 나타낸 것이다.
도 9는 PD1-hFc와 PD1-45D6, 49A2 간의 키네틱 (kinetics) 측정 결과를 나타낸 것이다.
도 10은 최적화 단일 클론을 선별한 결과를 나타낸 것이다.
도 11은 모항체와의 발현율 비교 분석한 결과를 나타낸 것이다.
도 12는 본 발명에 따른 PD1 항체의 in vitro 효능을 평가한 결과를 나타낸 것이다.
도 13은 본 발명에 따른 PD1 항체의 농도 의존적인 in vitro 효능을 평가한 결과를 나타낸 것이다.
도 14는 선별된 PD1 항체 변이체에 대한 단일 클론 항체의 세포 표면에 발현된 PD-1에 대한 결합을 확인한 결과를 나타낸 것이다.
도 15는 선별된 PD1 항체 변이체에 대한 단일 클론 항체의 세포 표면에 발현된 PD-1에 대한 결합 측정한 결과를 나타낸 것이다.
도 16은 선별된 항체에서 효소면역흡착을 이용한 PD-1/PD-L1 혹은 PD-1/PD-L2 복합체의 형성을 막는 항체의 저해 효과를 확인한 결과를 나타낸 것이다.
도 17은 PD1-hFc 단백질과 PD1-45D6, 49A2 및 49A2(2B9)간의 kinetics 측정 결과를 나타낸 것이다.
도 18은 PD1 변이체의 모식도를 나타낸 것이다.
도 19는 선별된 파지 (phage)의 효소면역흡착을 통한 PD-1 변이체들에 대한 결합력을 확인한 결과를 나타낸 것으로, 결합력이 낮을수록 낮은 값을 나타낸다.
도 20은 선별된 항체의 효소면역흡착을 통한 PD-1 변이체들에 대한 결합력을 확인한 결과를 나타낸 것이다.
도 21은 효소면역흡착을 통한 결합 특이성을 확인한 결과를 나타낸 것이다.
도 22는 HEK-293 세포에서의 임시 발현 생산성을 비교한 결과를 나타낸 것이다.
도 23은 PD1 단일 클론 항체에 의해 이종 MLR (Mixed Lymphocyte Reaction)에서 활성 증가를 나타냄을 확인한 결과이다.
발명의 상세한 설명 및 바람직한 구현예
달리 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로, 본 명세서에서 사용된 명명법 및 이하에 기술하는 실험 방법은 본 기술 분야에서 잘 알려져 있고 통상적으로 사용되는 것이다.
본 발명은 일 관점에서, 서열번호 1 내지 서열번호 30으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 CDR1, 서열번호 31 내지 서열번호 56으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 CDR2, 및 서열번호 57 내지 서열번호 79로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 CDR3를 포함하는 중쇄 가변영역, 및 서열번호 198 내지 서열번호 222로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 CDR1, 서열번호 223 내지 서열번호 241로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 CDR2, 및 서열번호 242 내지 서열번호 269로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 CDR3를 포함하는 경쇄 가변영역을 포함하는, PD-1에 결합하는 항체 또는 이의 항원 결합단편에 관한 것이다.
본 발명자들은 다양한 암에서 발현되는 것으로 알려진 PD-1에 결합하는 항암 치료용 항체를 개발하기 위하여 노력하였다. 그 결과, 파지 디스플레이 기술을 이용하여 PD-1에 높은 친화력으로 결합하는 항-PD-1 항체를 제조하고, 이러한 항-PD-1 항체가 PD-1의 활성을 억제시킬 수 있음을 확인하였다.
본 발명에서 “프로그램된 세포사멸 단백질 1 (programmed cell death 1, PD-1)”은 신호 전달 단백질로, T 세포의 활성화 및 기능을 조절하는 역할을 하는 것으로 알려져 있다. 종양 미세 환경 내에서 T 세포의 PD-1과 암세포로부터 발현되는 리간드인 PD-L1의 결합은 PD-1 신호전달 경로를 활성화시켜 결과적으로는 T 세포의 불활성화를 유도하며, 이러한 현상은 악성 흑색종, 비소세포폐암, 신장 세포 암 등 다양한 암에서 발견되고 있다.
본 명세서에서 사용된 용어, "항체(antibody)"는 PD-1에 특이적으로 결합하는 항-PD-1 항체를 의미한다. 본 발명의 범위에는 PD-1에 특이적으로 결합하는 완전한 항체 형태 뿐 아니라, 상기 항체 분자의 항원 결합 단편도 포함된다.
완전한 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 구조이며, 각각의 경쇄는 중쇄와 다이설파이드 결합으로 연결되어 있다. 중쇄 불변영역은 감마(γ), 뮤(μ), 알파(α), 델타(δ) 및 엡실론(ε) 타입을 가지고 서브클래스로 감마1(γ1), 감마2(γ2), 감마3(γ3), 감마4(γ4), 알파1(α1) 및 알파2(α2)를 가진다. 경쇄의 불변영역은 카파(κ) 및 람다(λ) 타입을 가진다.
항체의 항원 결합 단편 또는 항체 단편이란 항원 결합 기능을 보유하고 있는 단편을 의미하며, Fab, F(ab'), F(ab')2 및 Fv 등을 포함한다. 항체 단편 중 Fab는 경쇄 및 중쇄의 가변영역과 경쇄의 불변영역 및 중쇄의 첫 번째 불변영역(CH1)을 가지는 구조로 1개의 항원 결합 부위를 가진다. Fab'는 중쇄 CH1 도메인의 C-말단에 하나 이상의 시스테인 잔기를 포함하는 힌지 영역(hinge region)을 가진다는 점에서 Fab와 차이가 있다. F(ab')2 항체는 Fab'의 힌지 영역의 시스테인 잔기가 디설파이드 결합을 이루면서 생성된다. Fv는 중쇄 가변영역 및 경쇄 가변영역만을 가지고 있는 최소의 항체조각으로 Fv 단편을 생성하는 재조합 기술은 PCT 국제 공개특허출원 WO88/10649, WO88/106630, WO88/07085, WO88/07086 및 WO88/09344에 개시되어 있다. 이중쇄 Fv(two-chain Fv)는 비공유 결합으로 중쇄 가변영역과 경쇄 가변영역이 연결되어 있고 단쇄 Fv(single-chain Fv, scFv)는 일반적으로 펩타이드 링커를 통하여 중쇄의 가변영역과 경쇄의 가변영역이 공유결합으로 연결되거나 또는 C-말단에서 바로 연결되어 있어서 이중쇄 Fv와 같이 다이머와 같은 구조를 이룰 수 있다. 이러한 항체 단편은 단백질 가수분해 효소를 이용해서 얻을 수 있고(예를 들어, 전체 항체를 파파인으로 제한 절단하면 Fab를 얻을 수 있고 펩신으로 절단하면 F(ab')2 단편을 얻을 수 있다), 유전자 재조합 기술을 통하여 제작할 수도 있다.
일 실시예에서, 본 발명에 따른 항체는 Fv 형태(예컨대, scFv), Fab이거나, 완전한 항체 형태이다. 또한, 중쇄 불변영역은 감마(γ), 뮤(μ), 알파(α), 델타(δ) 또는 엡실론(ε) 중의 어느 한 이소타입으로부터 선택될 수 있다. 예를 들어, 불변영역은 감마1(IgG1), 감마 3(IgG3) 또는 감마 4(IgG4)이다. 경쇄 불변영역은 카파 또는 람다 형일 수 있다.
본 명세서에서 사용되는 용어, "중쇄"는 항원에 특이성을 부여하기 위한 충분한 가변영역 서열을 갖는 아미노산 서열을 포함하는 가변영역 도메인 VH 및 3 개의 불변영역 도메인 CH1, CH2 및 CH3을 포함하는 전체길이 중쇄 및 이의 단편을 모두 의미한다. 또한, 본 명세서에서 사용되는 용어, "경쇄"는 항원에 특이성을 부여하기 위한 충분한 가변영역 서열을 갖는 아미노산 서열을 포함하는 가변영역 도메인 VL 및 불변영역 도메인 CL을 포함하는 전체길이 경쇄 및 이의 단편을 모두 의미한다.
본 발명의 항체는 단일클론 항체, 다특이적 항체, 인간 항체, 인간화 항체, 키메라 항체, 단쇄 Fvs(scFV), 단쇄 항체, Fab 단편, F(ab') 단편, 다이설파이드-결합 Fvs(sdFV) 및 항-이디오타입(항-Id) 항체, 또는 상기 항체들의 에피토프-결합 단편 등을 포함하나, 이에 한정되는 것은 아니다.
상기 단일클론 항체는 실질적으로 동질적 항체 집단으로부터 수득한 항체, 즉 집단을 차지하고 있는 개개의 항체가 미량으로 존재할 수 있는 가능한 천연 발생적 돌연변이를 제외하고는 동일한 것을 지칭한다. 단일클론 항체는 고도로 특이적이어서, 단일 항원 부위에 대항하여 유도된다.
상기 "인간화" 형태의 비-인간 (예: 뮤린) 항체는 비-인간 면역글로불린으로부터 유래된 최소 서열을 함유하는 키메라 항체이다. 대부분의 경우, 인간화 항체는, 수용자의 초가변 영역으로부터의 잔기를 목적하는 특이성, 친화성 및 능력을 보유하고 있는 비-인간 종 (공여자 항체), 예를 들어 마우스, 랫트, 토끼 또는 비-인간 영장류의 초가변 영역로부터의 잔기로 대체시킨 인간 면역글로불린 (수용자 항체)이다.
상기 “인간 항체”는 인간 면역글로불린으로부터 유래하는 분자로서 상보성 결정영역, 구조 영역을 포함한 항체를 구성하는 모든 아미노산 서열 전체가 인간의 면역글로불린으로 구성되어 있는 것을 의미한다.
중쇄 및/또는 경쇄 일부가 특별한 종으로부터 유래되거나 특별한 항체 부류 또는 아부류에 속하는 항체 내의 상응하는 서열과 동일하거나 이와 상동성인 반면, 나머지 쇄(들)는 또 다른 종으로부터 유래되거나 또 다른 항체 부류 또는 아부류에 속하는 항체 내의 상응하는 서열과 동일하거나 이와 상동성인 "키메라" 항체 (면역글로불린) 뿐 아니라 목적하는 생물학적 활성을 나타내는 상기 항체의 단편이 포함된다.
본원에 사용된 바와 같은 "항체 가변 도메인"은 상보성 결정 영역 (CDR; 즉, CDR1, CDR2, 및 CDR3), 및 골격 영역 (FR)의 아미노산 서열을 포함하는 항체 분자의 경쇄 및 중쇄 부분을 지칭한다. VH는 중쇄의 가변 도메인을 지칭한다. VL은 경쇄의 가변 도메인을 지칭한다.
"상보성 결정 영역” (CDR; 즉, CDR1, CDR2, 및 CDR3)은 항원 결합을 위해 필요한 존재인, 항체 가변 도메인의 아미노산 잔기를 지칭한다. 각 가변 도메인은 전형적으로, CDR1, CDR2 및 CDR3으로서 확인된 3개의 CDR 영역을 갖는다.
본 발명에 있어, 상기 PD-1에 결합하는 항체 또는 이의 항원 결합단편은 서열번호 1 내지 서열번호 30으로 구성된 군에서 선택되는 중쇄 CDR1,
서열번호 31 내지 서열번호 56으로 구성된 군에서 선택되는 중쇄 CDR2, 및
서열번호 57 내지 서열번호 79로 구성된 군에서 선택되는 중쇄 CDR3를 포함하는 중쇄 가변영역, 및
서열번호 198 내지 서열번호 222로 구성된 군에서 선택되는 경쇄 CDR1,
서열번호 223 내지 서열번호 241로 구성된 군에서 선택되는 경쇄 CDR2, 및
서열번호 242 내지 서열번호 269로 구성된 군에서 선택되는 경쇄 CDR3를 포함하는 경쇄 가변영역을 포함할 수 있다.
구체적으로, 상기 PD-1에 결합하는 항체 또는 이의 항원 결합단편은 서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 2의 중쇄 CDR1, 서열번호 33의 중쇄 CDR2, 및 서열번호 59의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 2의 중쇄 CDR1, 서열번호 33의 중쇄 CDR2, 및 서열번호 60의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 2의 중쇄 CDR1, 서열번호 33의 중쇄 CDR2, 및 서열번호 61의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 2의 중쇄 CDR1, 서열번호 33의 중쇄 CDR2, 및 서열번호 62의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 3의 중쇄 CDR1, 서열번호 34의 중쇄 CDR2, 및 서열번호 63의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 4의 중쇄 CDR1, 서열번호 35의 중쇄 CDR2, 및 서열번호 64의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 5의 중쇄 CDR1, 서열번호 36의 중쇄 CDR2, 및 서열번호 65의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 6의 중쇄 CDR1, 서열번호 37의 중쇄 CDR2, 및 서열번호 66의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 67의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 7의 중쇄 CDR1, 서열번호 38의 중쇄 CDR2, 및 서열번호 68의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 8의 중쇄 CDR1, 서열번호 39의 중쇄 CDR2, 및 서열번호 69의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 9의 중쇄 CDR1, 서열번호 40의 중쇄 CDR2, 및 서열번호 70의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 10의 중쇄 CDR1, 서열번호 41의 중쇄 CDR2, 및 서열번호 71의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 11의 중쇄 CDR1, 서열번호 42의 중쇄 CDR2, 및 서열번호 72의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 12의 중쇄 CDR1, 서열번호 43의 중쇄 CDR2, 및 서열번호 73의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 13의 중쇄 CDR1, 서열번호 44의 중쇄 CDR2, 및 서열번호 74의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 14의 중쇄 CDR1, 서열번호 45의 중쇄 CDR2, 및 서열번호 75의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 15의 중쇄 CDR1, 서열번호 46의 중쇄 CDR2, 및 서열번호 76의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 8의 중쇄 CDR1, 서열번호 47의 중쇄 CDR2, 및 서열번호 77의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 16의 중쇄 CDR1, 서열번호 48의 중쇄 CDR2, 및 서열번호 78의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 17의 중쇄 CDR1, 서열번호 49의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 18의 중쇄 CDR1, 서열번호 50의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 19의 중쇄 CDR1, 서열번호 51의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 20의 중쇄 CDR1, 서열번호 52의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 21의 중쇄 CDR1, 서열번호 51의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 22의 중쇄 CDR1, 서열번호 53의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 23의 중쇄 CDR1, 서열번호 49의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 17의 중쇄 CDR1, 서열번호 54의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 24의 중쇄 CDR1, 서열번호 55의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 21의 중쇄 CDR1, 서열번호 51의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 25의 중쇄 CDR1, 서열번호 56의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 26의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 27의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 28의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 29의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 30의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 79의 중쇄 CDR3을 포함하는 중쇄 가변영역, 또는
서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역을 포함할 수 있다.
또한, 상기 PD-1에 결합하는 항체 또는 이의 항원 결합단편은 서열번호 198의 경쇄 CDR1, 서열번호 223의 경쇄 CDR2, 및 서열번호 242의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 199의 경쇄 CDR1, 서열번호 224의 경쇄 CDR2, 및 서열번호 243의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 200의 경쇄 CDR1, 서열번호 225의 경쇄 CDR2, 및 서열번호 244의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 201의 경쇄 CDR1, 서열번호 226의 경쇄 CDR2, 및 서열번호 245의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 202의 경쇄 CDR1, 서열번호 227의 경쇄 CDR2, 및 서열번호 246의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 203의 경쇄 CDR1, 서열번호 228의 경쇄 CDR2, 및 서열번호 247의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 204의 경쇄 CDR1, 서열번호 229의 경쇄 CDR2, 및 서열번호 248의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 249의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 206의 경쇄 CDR1, 서열번호 231의 경쇄 CDR2, 및 서열번호 250의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 207의 경쇄 CDR1, 서열번호 232의 경쇄 CDR2, 및 서열번호 251의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 208의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 209의 경쇄 CDR1, 서열번호 233의 경쇄 CDR2, 및 서열번호 253의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 210의 경쇄 CDR1, 서열번호 234의 경쇄 CDR2, 및 서열번호 254의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 211의 경쇄 CDR1, 서열번호 235의 경쇄 CDR2, 및 서열번호 255의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 212의 경쇄 CDR1, 서열번호 236의 경쇄 CDR2, 및 서열번호 256의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 213의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 257의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 214의 경쇄 CDR1, 서열번호 237의 경쇄 CDR2, 및 서열번호 258의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 215의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 249의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 211의 경쇄 CDR1, 서열번호 238의 경쇄 CDR2, 및 서열번호 259의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 216의 경쇄 CDR1, 서열번호 238의 경쇄 CDR2, 및 서열번호 260의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 217의 경쇄 CDR1, 서열번호 239의 경쇄 CDR2, 및 서열번호 261의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 218의 경쇄 CDR1, 서열번호 240의 경쇄 CDR2, 및 서열번호 262의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 219의 경쇄 CDR1, 서열번호 241의 경쇄 CDR2, 및 서열번호 263의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 215의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 264의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 265의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 221의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 266의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 267의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 257의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 267의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 222의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 268의 경쇄 CDR3를 포함하는 경쇄 가변영역, 또는
서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 269의 경쇄 CDR3를 포함하는 경쇄 가변영역을 포함할 수 있다.
구체적으로, 본 발명에 따른 항체 또는 이의 항원 결합단편은 다음의 중쇄 가변영역 및 경쇄 가변영역을 포함할 수 있다:
서열번호 2의 중쇄 CDR1, 서열번호 33의 중쇄 CDR2, 및 서열번호 62의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 201의 경쇄 CDR1, 서열번호 226의 경쇄 CDR2, 및 서열번호 245의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 3의 중쇄 CDR1, 서열번호 34의 중쇄 CDR2, 및 서열번호 63의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 202의 경쇄 CDR1, 서열번호 227의 경쇄 CDR2, 및 서열번호 246의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 4의 중쇄 CDR1, 서열번호 35의 중쇄 CDR2, 및 서열번호 64의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 203의 경쇄 CDR1, 서열번호 228의 경쇄 CDR2, 및 서열번호 247의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 5의 중쇄 CDR1, 서열번호 36의 중쇄 CDR2, 및 서열번호 65의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 204의 경쇄 CDR1, 서열번호 229의 경쇄 CDR2, 및 서열번호 248의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 249의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 6의 중쇄 CDR1, 서열번호 37의 중쇄 CDR2, 및 서열번호 66의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 206의 경쇄 CDR1, 서열번호 231의 경쇄 CDR2, 및 서열번호 250의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 67의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 207의 경쇄 CDR1, 서열번호 232의 경쇄 CDR2, 및 서열번호 251의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 208의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 7의 중쇄 CDR1, 서열번호 38의 중쇄 CDR2, 및 서열번호 68의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 209의 경쇄 CDR1, 서열번호 233의 경쇄 CDR2, 및 서열번호 253의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 8의 중쇄 CDR1, 서열번호 39의 중쇄 CDR2, 및 서열번호 69의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 210의 경쇄 CDR1, 서열번호 234의 경쇄 CDR2, 및 서열번호 254의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 11의 중쇄 CDR1, 서열번호 42의 중쇄 CDR2, 및 서열번호 72의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 213의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 257의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 215의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 249의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 13의 중쇄 CDR1, 서열번호 44의 중쇄 CDR2, 및 서열번호 74의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 211의 경쇄 CDR1, 서열번호 238의 경쇄 CDR2, 및 서열번호 259의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 15의 중쇄 CDR1, 서열번호 46의 중쇄 CDR2, 및 서열번호 76의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 217의 경쇄 CDR1, 서열번호 239의 경쇄 CDR2, 및 서열번호 336의 경쇄 CDR3를 포함하는 경쇄 가변영역; 또는
서열번호 8의 중쇄 CDR1, 서열번호 47의 중쇄 CDR2, 및 서열번호 77의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 218의 경쇄 CDR1, 서열번호 240의 경쇄 CDR2, 및 서열번호 337의 경쇄 CDR3를 포함하는 경쇄 가변영역.
본 발명의 일 실시예에 따라, 최적화 과정을 통해 항체를 추가 선별하였으며, 본 발명에 따른 항체 또는 이의 항원 결합단편은 다음의 중쇄 가변영역 및 경쇄 가변영역을 포함할 수 있다:
서열번호 17의 중쇄 CDR1, 서열번호 49의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역;
서열번호 18의 중쇄 CDR1, 서열번호 50의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 215의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역
서열번호 19의 중쇄 CDR1, 서열번호 51의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 218의 경쇄 CDR1, 서열번호 240의 경쇄 CDR2, 및 서열번호 337의 경쇄 CDR3를 포함하는 경쇄 가변영역
서열번호 20의 중쇄 CDR1, 서열번호 52의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 264의 경쇄 CDR3를 포함하는 경쇄 가변영역
서열번호 21의 중쇄 CDR1, 서열번호 51의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 265의 경쇄 CDR3를 포함하는 경쇄 가변영역
서열번호 22의 중쇄 CDR1, 서열번호 53의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 221의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 266의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 23의 중쇄 CDR1, 서열번호 49의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 17의 중쇄 CDR1, 서열번호 54의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 215의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 249의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 24의 중쇄 CDR1, 서열번호 55의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 267의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 21의 중쇄 CDR1, 서열번호 51의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 221의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 266의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 215의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 215의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 25의 중쇄 CDR1, 서열번호 56의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 257의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 26의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 267의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 27의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 28의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
서열번호 29의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역, 또는
서열번호 30의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3를 포함하는 중쇄 가변영역 및 서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 267의 경쇄 CDR3를 포함하는 경쇄 가변영역.
"골격 영역" (FR)은 CDR 잔기 이외의 가변 도메인 잔기이다. 각 가변 도메인은 전형적으로, FR1, FR2, FR3 및 FR4로서 확인된 4개의 FR을 가진다.
본 발명의 일 실시예에 따르면, 서열번호 80 내지 서열번호 95로 구성된 군에서 선택되는 중쇄 가변영역 FR1,
서열번호 96 내지 서열번호 113으로 구성된 군에서 선택되는 중쇄 가변영역 FR2,
서열번호 114 내지 서열번호 134로 구성된 군에서 선택되는 중쇄 가변영역 FR3, 또는
서열번호 135 내지 서열번호 145로 구성된 군에서 선택되는 중쇄 가변영역 FR4를 포함할 수 있다.
또한, 서열번호 270 내지 서열번호 294로 구성된 군에서 선택되는 경쇄 가변영역 FR1,
서열번호 295 내지 서열번호 315로 구성된 군에서 선택되는 경쇄 가변영역 FR2,
서열번호 316 내지 서열번호 355로 구성된 군에서 선택되는 경쇄 가변영역 FR3, 또는
서열번호 356 내지 서열번호 367로 구성된 군에서 선택되는 경쇄 가변영역 FR4를 포함할 수 있다.
"Fv" 단편은 완전한 항체 인식 및 결합 부위를 함유하는 항체 단편이다. 이러한 영역은 1개의 중쇄 가변 도메인과 1개의 경쇄 가변 도메인이, 예를 들어 scFv로 단단하게 사실상 공유적으로 연합된 이량체로 이루어진다.
"Fab" 단편은 경쇄의 가변 및 불변 도메인과, 중쇄의 가변 및 제1 불변 도메인 (CH1)을 함유한다. F(ab')2 항체 단편은 일반적으로 그들 사이에 힌지 시스테인에 의해 그들의 카복시 말단 근처에 공유적으로 연결되는 한 쌍의 Fab 단편을 포함한다.
"단일쇄 Fv" 또는 "scFv" 항체 단편은 항체의 VH 및 VL 도메인을 포함하는데, 이들 도메인은 단일 폴리펩티드 쇄 내에 존재한다. Fv 폴리펩티드는 scFv가 항원 결합을 위해 목적하는 구조를 형성할 수 있도록 하는 VH 도메인과 VL 도메인 사이에 폴리펩티드 링커를 추가로 포함할 수 있다.
PD-1 항체는 1가 또는 2가이고, 단쇄 또는 이중 쇄를 포함한다. 기능적으로, PD-1 항체의 결합 친화성은 10-5M 내지 10-12 M 범위 내에 있다. 예를 들어, PD-1 항체의 결합 친화성은 10-6 M 내지 10-12 M, 10-7 M 내지 10-12 M, 10-8 M 내지 10-12 M, 10-9 M 내지 10-12 M, 10-5 M 내지 10-11 M, 10-6 M 내지 10-11 M, 10-7 M 내지 10-11 M, 10-8 M 내지 10-11 M, 10-9 M 내지 10-11 M, 10-10 M 내지 10-11 M, 10-5 M 내지 10-10 M, 10-6 M 내지 10-10 M, 10-7 M 내지 10-10 M, 10-8 M 내지 10-10 M, 10-9 M 내지 10-10 M, 10-5 M 내지 10-9 M, 10-6 M 내지 10-9 M, 10-7 M 내지 10-9 M, 10-8 M 내지 10-9 M, 10-5 M 내지 10-8 M, 10-6 M 내지 10-8 M, 10-7 M 내지 10-8 M, 10-5 M 내지 10-7 M, 10-6 M 내지 10-7 M 또는 10-5 M 내지 10-6 M이다.
상기 PD-1에 결합하는 항체 또는 이의 항원 결합단편은 서열번호 146 내지 서열번호 193으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 가변영역을 포함할 수 있다. 상기 PD-1에 결합하는 항체 또는 이의 항원 결합단편은 서열번호 146 내지 서열번호 193으로 구성된 군에서 선택되는 중쇄 가변영역을 포함할 수 있다. 본 발명의 일 실시예에 따르면, 서열번호 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 163, 165, 166, 168, 169, 또는 171 내지 188의 중쇄 가변영역을 포함할 수 있다.
또한, 서열번호 368 내지 서열번호 420으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 가변영역을 포함할 수 있다. 상기 PD-1에 결합하는 항체 또는 이의 항원 결합단편은 서열번호 368 내지 서열번호 420으로 구성된 군에서 선택되는 경쇄 가변영역을 포함할 수 있다. 본 발명의 일 실시예에 따르면, 서열번호 371 내지 380, 383, 385, 386, 388, 389, 또는 391 내지 415의 경쇄 가변영역을 포함할 수 있다.
본 발명에 따른 구체적 실시예에서, 서열번호 151의 중쇄 가변영역 및 서열번호 371의 경쇄 가변영역;
서열번호 152의 중쇄 가변영역 및 서열번호 372의 경쇄 가변영역;
서열번호 153의 중쇄 가변영역 및 서열번호 373의 경쇄 가변영역;
서열번호 154의 중쇄 가변영역 및 서열번호 374의 경쇄 가변영역;
서열번호 155의 중쇄 가변영역 및 서열번호 375의 경쇄 가변영역;
서열번호 156의 중쇄 가변영역 및 서열번호 376의 경쇄 가변영역;
서열번호 157의 중쇄 가변영역 및 서열번호 377의 경쇄 가변영역;
서열번호 158의 중쇄 가변영역 및 서열번호 378의 경쇄 가변영역;
서열번호 159의 중쇄 가변영역 및 서열번호 379의 경쇄 가변영역;
서열번호 160의 중쇄 가변영역 및 서열번호 380의 경쇄 가변영역;
서열번호 163의 중쇄 가변영역 및 서열번호 383의 경쇄 가변영역;
서열번호 165의 중쇄 가변영역 및 서열번호 385의 경쇄 가변영역;
서열번호 166의 중쇄 가변영역 및 서열번호 386의 경쇄 가변영역;
서열번호 168의 중쇄 가변영역 및 서열번호 388의 경쇄 가변영역;
서열번호 169의 중쇄 가변영역 및 서열번호 389의 경쇄 가변영역;
서열번호 171의 중쇄 가변영역 및 서열번호 391의 경쇄 가변영역;
서열번호 172의 중쇄 가변영역 및 서열번호 392의 경쇄 가변영역;
서열번호 173의 중쇄 가변영역 및 서열번호 393의 경쇄 가변영역;
서열번호 174의 중쇄 가변영역 및 서열번호 394의 경쇄 가변영역;
서열번호 175의 중쇄 가변영역 및 서열번호 395의 경쇄 가변영역;
서열번호 176의 중쇄 가변영역 및 서열번호 396의 경쇄 가변영역;
서열번호 177의 중쇄 가변영역 및 서열번호 397의 경쇄 가변영역;
서열번호 178의 중쇄 가변영역 및 서열번호 398의 경쇄 가변영역;
서열번호 179의 중쇄 가변영역 및 서열번호 399의 경쇄 가변영역;
서열번호 180의 중쇄 가변영역 및 서열번호 400의 경쇄 가변영역;
서열번호 181의 중쇄 가변영역 및 서열번호 401의 경쇄 가변영역;
서열번호 181의 중쇄 가변영역 및 서열번호 402의 경쇄 가변영역;
서열번호 181의 중쇄 가변영역 및 서열번호 403의 경쇄 가변영역;
서열번호 181의 중쇄 가변영역 및 서열번호 404의 경쇄 가변영역;
서열번호 181의 중쇄 가변영역 및 서열번호 405의 경쇄 가변영역;
서열번호 182의 중쇄 가변영역 및 서열번호 406의 경쇄 가변영역;
서열번호 182의 중쇄 가변영역 및 서열번호 407의 경쇄 가변영역;
서열번호 182의 중쇄 가변영역 및 서열번호 408의 경쇄 가변영역;
서열번호 182의 중쇄 가변영역 및 서열번호 409의 경쇄 가변영역;
서열번호 183의 중쇄 가변영역 및 서열번호 410의 경쇄 가변영역;
서열번호 184의 중쇄 가변영역 및 서열번호 411의 경쇄 가변영역;
서열번호 185의 중쇄 가변영역 및 서열번호 412의 경쇄 가변영역;
서열번호 186의 중쇄 가변영역 및 서열번호 413의 경쇄 가변영역;
서열번호 187의 중쇄 가변영역 및 서열번호 414의 경쇄 가변영역; 또는
서열번호 188의 중쇄 가변영역 및 서열번호 415의 경쇄 가변영역.
구체적 실시예에서, 서열번호 155의 중쇄 가변영역 및 서열번호 375의 경쇄 가변영역;
서열번호 158의 중쇄 가변영역 및 서열번호 378의 경쇄 가변영역;
서열번호 165의 중쇄 가변영역 및 서열번호 385의 경쇄 가변영역;
서열번호 171의 중쇄 가변영역 및 서열번호 391의 경쇄 가변영역;
서열번호 175의 중쇄 가변영역 및 서열번호 395의 경쇄 가변영역;
서열번호 176의 중쇄 가변영역 및 서열번호 396의 경쇄 가변영역;
서열번호 178의 중쇄 가변영역 및 서열번호 398의 경쇄 가변영역;
서열번호 181의 중쇄 가변영역 및 서열번호 401의 경쇄 가변영역; 또는
서열번호 181의 중쇄 가변영역 및 서열번호 405의 경쇄 가변영역을 포함할 수 있다.
본 발명에 따른 서열에서 X 또는 Xaa로 표시된 부분은 특정되지 않은 기타 아미노산을 표시하며, 임의의 아미노산이 포함될 수 있음을 나타낸다.
"파지 디스플레이"는 변이체 폴리펩티드를 파지, 예를 들어 섬유상 파지 입자의 표면상에 외피 단백질의 적어도 일부와의 융합 단백질로서 디스플레이하는 기술이다. 파지 디스플레이의 유용성은 무작위화 단백질 변이체의 큰 라이브러리를 대상으로 하여, 표적 항원과 고 친화도로 결합하는 서열을 신속하고도 효율적으로 분류할 수 있다는 사실에 있다. 펩티드 및 단백질 라이브러리를 파지 상에 디스플레이하는 것은 특이적 결합 특성을 지닌 폴리펩티드를 알아보기 위해 수 백만개의 폴리펩티드를 스크리닝하는데 사용되어 왔다.
파지 디스플레이 기술은 특정 리간드 (예: 항원)와 결합하는 신규 단백질을 생성 및 선별하기 위한 강력한 도구를 제공하였다. 파지 디스플레이 기술을 사용하여, 단백질 변이체의 큰 라이브러리를 생성시키고, 표적 항원과 고 친화성으로 결합하는 서열을 신속하게 분류할 수 있다. 변이체 폴리펩티드를 암호화하는 핵산을 바이러스성 외피 단백질, 예를 들어 유전자 III 단백질 또는 유전자 VIII 단백질을 암호화하는 핵산 서열과 융합시킨다. 단백질 또는 폴리펩티드를 암호화하는 핵산 서열을 유전자 III 단백질의 일부를 암호화하는 핵산 서열과 융합시킨 1가 파지 디스플레이 시스템이 개발되었다. 1가 파지 디스플레이 시스템에서는, 유전자 융합물이 저 수준으로 발현되고 야생형 유전자 III 단백질이 또한 발현되어 입자 감염성이 유지된다.
섬유상 파지 표면상에서의 펩티드의 발현과 E. coli의 주변세포질에서의 기능성 항체 단편의 발현을 입증하는 것이 항체 파지 디스플레이 라이브러리를 개발하는 데에 있어 중요하다. 항체 또는 항원 결합성 폴리펩티드의 라이브러리는 수많은 방식, 예를 들어 무작위 DNA 서열을 삽입함으로써 단일 유전자를 변경시키는 방법 또는 관련 유전자 계열을 클로닝하는 방법으로 제조하였다. 라이브러리를 대상으로 하여, 목적하는 특징을 수반한 항체 또는 항원 결합성 단백질의 발현에 관하여 스크리닝할 수 있다.
파지 디스플레이 기술은 목적하는 특징을 지닌 항체를 제조하기 위한 통상적인 하이브리도마 및 재조합 방법에 비해 몇 가지 이점을 지니고 있다. 이러한 기술은 동물을 사용하지 않고서도 짧은 시간에 다양한 서열을 지닌 큰 항체 라이브러리를 생성시킬 수 있도록 한다. 하이브리도마의 제조나 인간화 항체의 제조는 수개월의 제조기간을 필요로 할 수 있다. 또한, 면역이 전혀 요구되지 않기 때문에, 파지 항체 라이브러리는 독성이거나 항원성이 낮은 항원에 대해서도 항체를 생성시킬 수 있다. 파지 항체 라이브러리를 또한 사용하여 신규한 치료적 항체를 생성 및 확인할 수 있다.
파지 디스플레이 라이브러리를 사용하여 면역시킨, 비-면역시킨 인간, 생식세포계 서열, 또는 미감작 B 세포 Ig 레퍼토리 (repertory)로부터 인간 항체를 생성시키는 기술을 사용할 수 있다. 각종 림프계 조직을 사용하여, 미감작 또는 비면역 항원 결합성 라이브러리를 제조할 수 있다.
파지 디스플레이 라이브러리로부터 고친화성 항체를 확인 및 분리할 수 있는 기술은 치료용 신규 항체 분리에 중요하다. 라이브러리로부터 고친화성 항체를 분리하는 것은 라이브러리의 크기, 세균성 세포 중에서의 생산 효율 및 라이브러리의 다양성에 좌우될 수 있다. 라이브러리의 크기는 항체 또는 항원 결합성 단백질의 부적절한 폴딩과 정지 코돈의 존재로 인한 비효율적 생산에 의해 감소된다. 세균성 세포에서의 발현은 항체 또는 항원 결합성 도메인이 적절하게 폴딩되지 않는 경우에는 억제될 수 있다. 발현은 가변/불변 계면의 표면이나 선별된 CDR 잔기에서의 잔기를 교대로 돌연변이시킴으로써 개선시킬 수 있다. 골격 영역의 서열은 세균성 세포에서 항체 파지 라이브러리를 생성시키는 경우에 적절한 폴딩을 제공하기 위한 하나의 요소이다.
고 친화성 항체 분리에서 항체 또는 항원 결합성 단백질의 다양한 라이브러리를 생성시키는 것이 중요하다. CDR3 영역은 이들이 종종 항원 결합에 참여하는 것으로 밝혀졌다. 중쇄 상의 CDR3 영역은 크기, 서열 및 구조적 입체 형태면에서 상당히 다양하므로, 이를 이용하여 다양한 라이브러리를 제조할 수 있다.
또한, 각 위치에서 20개 아미노산 모두를 사용하여 가변 중쇄 및 경쇄의 CDR 영역을 무작위화함으로써 다양성을 발생시킬 수 있다. 20개의 모든 아미노산을 사용하면 다양성이 큰 변이체 항체 서열이 생성되고 신규한 항체를 확인할 기회가 증가할 수 있다.
본 발명의 항체 또는 항체 단편은 PD-1을 특이적으로 인식할 수 있는 범위 내에서, 본 명세서에 기재된 본 발명의 항-PD-1 항체의 서열뿐만 아니라, 이의 생물학적 균등물도 포함할 수 있다. 예를 들면, 항체의 결합 친화도 및/또는 기타 생물학적 특성을 보다 더 개선시키기 위하여 항체의 아미노산 서열에 추가적인 변화를 줄 수 있다. 이러한 변형은 예를 들어, 항체의 아미노산 서열 잔기의 결실, 삽입 및/또는 치환을 포함한다. 이러한 아미노산 변이는 아미노산 곁사슬 치환체의 상대적 유사성, 예컨대, 소수성, 친수성, 전하, 크기 등에 기초하여 이루어진다. 아미노산 곁사슬 치환체의 크기, 모양 및 종류에 대한 분석에 의하여, 아르기닌, 라이신과 히스티딘은 모두 양전하를 띤 잔기이고; 알라닌, 글라이신과 세린은 유사한 크기를 가지며; 페닐알라닌, 트립토판과 타이로신은 유사한 모양을 갖는다는 것을 알 수 있다. 따라서, 이러한 고려 사항에 기초하여, 아르기닌, 라이신과 히스티딘; 알라닌, 글라이신과 세린; 그리고 페닐알라닌, 트립토판과 타이로신은 생물학적으로 기능 균등물이라 할 수 있다.
본 발명은 다른 관점에서, 상기 항체 또는 그의 항원 결합 단편을 코딩하는 핵산에 관한 것이다.
본 발명의 항체 또는 그의 항원 결합 단편을 코딩하는 핵산을 분리하여 항체 또는 그의 항원 결합 단편을 재조합적으로 생산할 수 있다. 핵산을 분리하고, 이를 복제 가능한 벡터 내로 삽입하여 추가로 클로닝하거나 (DNA의 증폭) 또는 추가로 발현시킨다. 이를 바탕으로, 본 발명은 또 다른 관점에서 상기 핵산을 포함하는 벡터에 관한 것이다.
"핵산"은 DNA(gDNA 및 cDNA) 및 RNA 분자를 포괄적으로 포함하는 의미를 가지며, 핵산에서 기본 구성단위인 뉴클레오타이드는 자연의 뉴클레오타이드 뿐만 아니라, 당 또는 염기 부위가 변형된 유사체(analogue)도 포함한다. 본 발명의 중쇄 및 경쇄 가변영역을 코딩하는 핵산의 서열은 변형될 수 있다. 상기 변형은 뉴클레오타이드의 추가, 결실, 또는 비보존적 치환 또는 보존적 치환을 포함한다.
본 발명의 항체 또는 이의 항원 결합 단편에 대한 아미노산 서열 또는 이를 코딩하는 핵산은 서열번호에 기재된 서열과 실질적인 동일성(substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기의 실질적인 동일성은, 상기한 본 발명의 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 90%의 상동성, 가장 바람직하게는 최소 95%의 상동성, 96% 이상, 97% 이상, 98% 이상, 99% 이상의 상동성을 나타내는 서열을 의미한다.
이에 기초하여, 본 발명의 항체 또는 그의 항원 결합 단편은 명세서에 기재된 명시된 서열 또는 전체와 비교하여 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 또는 그 이상의 상동성을 가질 수 있다. 이러한 상동성은 당업계에 공지된 방법에 의한 서열 비교 및/또는 정렬에 의해 결정될 수 있다. 예를 들어, 서열 비교 알고리즘(즉, BLAST 또는 BLAST 2.0), 수동 정렬, 육안 검사를 이용하여 본 발명의 핵산 또는 단백질의 퍼센트 서열 상동성을 결정할 수 있다.
상기 항체를 암호화하는 DNA는 통상적인 과정을 사용하여 (예를 들어, 항체의 중쇄와 경쇄를 암호화하는 DNA와 특이적으로 결합할 수 있는 올리고뉴클레오티드 프로브를 사용함으로써) 용이하게 분리 또는 합성한다. 많은 벡터가 입수 가능하다. 벡터 성분에는 일반적으로, 다음 중의 하나 이상이 포함되지만, 그에 제한되지 않는다: 신호 서열, 복제 기점, 하나 이상의 마커 유전자, 증강인자 요소, 프로모터, 및 전사 종결 서열.
본 명세서에서 사용되는 용어, "벡터"는 숙주세포에서 목적 유전자를 발현시키기 위한 수단으로 플라스미드 벡터; 코즈미드 벡터; 박테리오파지 벡터, 아데노바이러스 벡터, 레트로바이러스 벡터 및 아데노-연관 바이러스벡터 같은 바이러스 벡터 등을 포함한다. 상기 벡터에서 항체를 코딩하는 핵산은 프로모터와 작동적으로 연결되어 있다.
“작동적으로 연결”은 핵산 발현조절서열(예: 프로모터, 시그널 서열, 또는 전사조절인자 결합 위치의 어레이)과 다른 핵산 서열사이의 기능적인 결합을 의미하며, 이에 의해 상기 조절서열은 상기 다른 핵산 서열의 전사 및/또는 해독을 조절하게 된다.
원핵세포를 숙주로 하는 경우에는, 전사를 진행시킬 수 있는 강력한 프로모터(예컨대, tac 프로모터, lac 프로모터, lacUV5 프로모터, lpp 프로모터, pLλ 프로모터, pRλ프로모터, rac5 프로모터, amp 프로모터, recA 프로모터, SP6 프로모터, trp 프로모터 및 T7 프로모터 등), 해독의 개시를 위한 라이보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 또한, 예를 들어, 진핵 세포를 숙주로 하는 경우에는, 포유동물 세포의 지놈으로부터 유래된 프로모터(예: 메탈로티오닌 프로모터, β-액틴 프로모터, 인간 헤로글로빈 프로모터 및 인간 근육 크레아틴 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터(예: 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40프로모터, 사이토메갈로바이러스(CMV) 프로모터, HSV의 tk 프로모터, 마우스 유방종양 바이러스(MMTV) 프로모터, HIV의 LTR 프로모터, 몰로니 바이러스의 프로모터엡스타인바 바이러스(EBV)의 프로모터 및 로우스 사코마 바이러스(RSV)의 프로모터)가 이용될 수 있으며, 전사 종결 서열로서 폴리아데닐화 서열을 일반적으로 갖는다.
경우에 따라서, 벡터는 그로부터 발현되는 항체의 정제를 용이하게 하기 위하여 다른 서열과 융합될 수도 있다. 융합되는 서열은, 예컨대 글루타티온 S-트랜스퍼라제(Pharmacia, USA), 말토스 결합 단백질(NEB, USA), FLAG(IBI, USA) 및 6x His(hexahistidine; Quiagen, USA) 등이 있다.
상기 벡터는 선택표지로서 당업계에서 통상적으로 이용되는 항생제 내성 유전자를 포함하며, 예를 들어 암피실린, 겐타마이신, 카베니실린, 클로람페니콜, 스트렙토마이신, 카나마이신, 게네티신, 네오마이신 및 테트라사이클린에 대한 내성 유전자가 있다.
본 발명은 또 다른 관점에서, 상기 언급된 벡터로 형질전환된 세포에 관한 것이다. 본 발명의 항체를 생성시키기 위해 사용된 세포는 원핵생물, 효모 또는 고등 진핵생물 세포일 수 있으며, 이에 제한되는 것은 아니다.
에스케리치아 콜라이(Escherichia coli), 바실러스 서브틸리스 및 바실러스 츄린겐시스와 같은 바실러스 속 균주, 스트렙토마이세스(Streptomyces), 슈도모나스(Pseudomonas)(예를 들면, 슈도모나스 푸티다(Pseudomonas putida)), 프로테우스미라빌리스(Proteus mirabilis) 및 스타필로코쿠스(Staphylococcus)(예를 들면, 스타필로코쿠스 카르노수스(Staphylocus carnosus))와 같은 원핵 숙주세포를 이용할 수 있다.
다만, 동물 세포에 대한 관심이 가장 크며, 유용한 숙주 세포주의 예는 COS-7, BHK, CHO, CHOK1, DXB-11, DG-44, CHO/-DHFR, CV1, COS-7, HEK293, BHK, TM4, VERO, HELA, MDCK, BRL 3A, W138, Hep G2, SK-Hep, MMT, TRI, MRC 5, FS4, 3T3, RIN, A549, PC12, K562, PER.C6, SP2/0, NS-0, U20S, 또는 HT1080일 수 있으나, 이에 제한되는 것은 아니다.
본 발명은 또 다른 관점에서, (a) 상기 세포를 배양하는 단계; 및 (b) 상기 배양된 세포에서 항체 또는 그의 항원 결합 단편을 회수하는 단계를 포함하는 상기 항체 또는 그의 항원 결합 단편의 제조방법에 관한 것이다.
상기 세포는 각종 배지에서 배양할 수 있다. 시판용 배지 중 제한없이 배양 배지로서 사용할 수 있다. 당업자에게 공지되어 있는 기타 모든 필수 보충물이 적당한 농도로 포함될 수도 있다. 배양 조건, 예를 들어 온도, pH 등이 발현을 위해 선별된 숙주 세포와 함께 이미 사용되고 있고, 이는 당업자에게 명백할 것이다.
본 발명에서 용어 “형질전환"이란, 표적 단백질을 암호화하는 핵산을 포함하는 벡터를 숙주 세포 내에 도입하여 숙주 세포 내에서 상기 핵산이 암호화하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질 전환된 핵산은 숙주 세포 내에 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하든지 상관없이 이들 모두를 포함한다. 또한, 상기 핵산은 표적 단백질을 암호화하는 DNA 및 RNA를 포함한다. 상기 핵산은 숙주 세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 핵산은, 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (Expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 핵산에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결 신호, 리보좀 결합부위 및 번역 종결신호를 포함한다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 핵산은 그 자체의 형태로 숙주세포에 도입되어, 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있다.
상기 항체 또는 그의 항원 결합 단편의 회수는 예를 들어 원심분리 또는 한외여과에 의해 불순물을 제거하고, 그 결과물을 예를 들어 친화 크로마토그래피 등을 이용하여 정제할 수 있다. 추가의 기타 정제 기술 예를 들어 음이온 또는 양이온 교환 크로마토그래피, 소수성 상호 작용 크로마토그래피, 히드록실아파타이트 크로마토그래피 등이 사용될 수 있다.
본 발명은 또 다른 관점에서, 상기 항체 또는 그의 항원 결합 단편을 유효성분으로 포함하는 암 예방 또는 치료용 조성물에 관한 것이다.
본 발명은 예를 들어, (a) 본 발명에 따른 PD-1에 대한 항체 또는 그의 항원 결합 단편의 약제학적 유효량; 및 (b) 약학적으로 허용되는 담체를 포함하는 암의 예방 또는 치료용 약제학적 조성물일 수 있다. 본 발명은 또한, 환자에게 필요한 유효량으로 본 발명에 따른 PD-1에 대한 항체 또는 그의 항원 결합 단편을 투여하는 단계를 포함하는 암의 예방 또는 치료방법에 관한 것이다.
본 발명에 있어서, 상기 암은 흑색종, 폐암, 간암, 교세포종, 난소암, 대장암, 두경부암, 방광암, 신장암, 위암, 유방암, 전이암, 호지킨 림프종, 전립선암 및 췌장암으로 구성된 군으로부터 선택되는 것을 특징으로 할 수 있으나 이에 한정되는 것은 아니다.
본 발명에서 용어 "치료"란 조성물의 투여로 암이나 그로부터 야기된 하나 또는 그 이상의 증상을 억제하거나 완화하는 것뿐만 아니라 질환의 증상을 반전시키는 암의 치료 또는 암의 진행을 방지하는 것을 의미한다. 본 발명에서 용어 "예방"이란 조성물의 투여로 암을 억제시키거나 발병을 지연시키는 모든 행위를 의미한다. 본 발명에서 암의 예방 또는 치료는 본 발명에서 확보한 항체가 PD-1과 결합하여 이루어지는 것으로, PD-1에 결합하여 그의 활성을 유의하게 억제하여 암을 예방 또는 치료하는 것이다.
본 발명에서 용어, "약학적으로 허용 가능한 담체"란 생물체를 자극하지 않고 투여 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 말한다. 액상 용액으로 제제화되는 조성물에 있어서 허용되는 약제학적 담체로는, 멸균 및 생체에 적합한 것으로서, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 및 이들 성분 중 1 성분 이상을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액, 정균제 등 다른 통상의 첨가제를 첨가할 수 있다. 또한 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있다.
본 발명의 상기 항체 및 약학적으로 허용 가능한 담체를 포함하는 암 예방 또는 치료용 조성물은 이를 유효성분으로 포함하는 어떠한 제형으로도 적용가능하며, 경구용 또는 비경구용 제형으로 제조할 수 있다. 본 발명의 약학적 제형은 구강(oral), 직장(rectal), 비강(nasal), 국소(topical; 볼 및 혀 밑을 포함), 피하, 질(vaginal) 또는 비경구(parenteral; 근육내, 피하 및 정맥내를 포함) 투여에 적당한 것 또는 흡입 (inhalation) 또는 주입(insufflation)에 의한 투여에 적당한 형태를 포함한다.
본 발명의 조성물을 유효성분으로 포함하는 경구 투여용 제형으로는, 예를 들어 정제, 트로키제, 로렌지, 수용성 또는 유성현탁액, 조제분말 또는 과립, 에멀젼, 하드 또는 소프트 캡슐, 시럽 또는 엘릭시르제로 제제화할 수 있다. 정제 및 캡슐 등의 제형으로 제제화하기 위해, 락토오스, 사카로오스, 솔비톨, 만니톨, 전분, 아밀로펙틴, 셀룰로오스 또는 젤라틴과 같은 결합제, 디칼슘 포스페이트와 같은 부형제, 옥수수 전분 또는 고구마 전분과 같은 붕괴제, 스테아르산 마스네슘, 스테아르산 칼슘, 스테아릴푸마르산 나트륨 또는 폴리에틸렌글리콜 왁스와 같은 윤활유를 포함할 수 있으며, 캡슐제형의 경우 상기 언급한 물질 외에도 지방유와 같은 액체 담체를 더 함유할 수 있다.
본 발명의 조성물을 유효성분으로 포함하는 비경구 투여용 제형으로는, 피하주사, 정맥주사 또는 근육내 주사 등의 주사용 형태, 좌제 주입방식 또는 호흡기를 통하여 흡입이 가능하도록 하는 에어로졸제 등 스프레이용으로 제제화할 수 있다. 주사용 제형으로 제제화하기 위해서는 본 발명의 조성물을 안정제 또는 완충제와 함께 물에서 혼합하여 용액 또는 현탁액으로 제조하고, 이를 앰플 또는 바이알의 단위 투여용으로 제제화할 수 있다. 좌제로 주입하기 위해서는, 코코아버터 또는 다른 글리세라이드 등 통상의 좌약 베이스를 포함하는 좌약 또는 관장제와 같은 직장투여용 조성물로 제제화할 수 있다. 에어로졸제 등의 스프레이용으로 제형화하는 경우, 수분산된 농축물 또는 습윤 분말이 분산되도록 추진제 등이 첨가제와 함께 배합될 수 있다.
또 하나의 양태로서, 본 발명은 상기 항체를 포함하는 암 예방 또는 치료용 조성물을 투여하는 것을 포함하는, 암을 예방 또는 치료하는 방법에 관한 것이다.
본 발명에서 용어, “투여"는 어떠한 적절한 방법으로 환자에게 본 발명의 약제학적 조성물을 도입하는 것을 의미한다. 본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있으며, 구체적으로, 구강, 직장, 국소, 정맥내, 복강내, 근육내, 동맥내, 경피, 비측내, 흡입, 안구 내 또는 피내경로를 통해 통상적인 방식으로 투여될 수 있다.
본 발명의 치료방법은 본 발명의 암 예방 또는 치료용 조성물을 약학적 유효량으로 투여하는 것을 포함한다. 적합한 총 1일 사용량은 올바른 의학적 판단범위 내에서 처치의에 의해 결정될 수 있다는 것은 당업자에게 자명한 일이다. 특정 환자에 대한 구체적인 치료적 유효량은 달성하고자 하는 반응의 종류와 정도, 경우에 따라 다른 제제가 사용되는지의 여부를 비롯한 구체적 조성물, 환자의 연령, 체중, 일반 건강 상태, 성별 및 식이, 투여 시간, 투여 경로 및 조성물의 분비율, 치료기간, 구체적 조성물과 함께 사용되거나 동시 사용되는 약물을 비롯한 다양한 인자와 의약 분야에 잘 알려진 유사 인자에 따라 다르게 적용하는 것이 바람직하다. 따라서 본 발명의 목적에 적합한 암의 예방 또는 치료용 조성물의 유효량은 전술한 사항을 고려하여 결정하는 것이 바람직하다.
또한, 본 발명의 치료 방법은 PD-1의 과도한 활성으로 인하여 종양 발달과 신생혈관생성 등의 질병이 발생할 수 있는 임의의 동물에 적용가능하며, 동물은 인간 및 영장류뿐만 아니라, 소, 돼지, 양, 말, 개 및 고양이 등의 가축을 포함한다.
또 다른 관점에서, 본 발명은 본 발명에 따른 PD-1 항체 또는 이의 항원 결합 단편을 포함하는 암 진단용 조성물이다. 본 발명은 또한, 본 발명에 따른 PD-1 항체를 또는 이의 항원 결합 단편을 처리하여 암을 진단하는 방법에 관한 것이다.
본 발명에 따른 PD-1에 대한 항체를 통해 샘플에서의 PD-1 발현 수준을 측정함으로써 암을 진단할 수 있다. 발현 수준은 통상적인 면역분석 방법에 따라 측정할 수 있으며, 상기 PD-1에 대한 항체를 이용한 방사능면역분석, 방사능면역침전, 면역침전, 면역조직화학염색, ELISA (enzyme-linked immunosorbant assay), 캡처-ELISA, 억제 또는 경재 분석, 샌드위치 분석, 유세포 분석(flow cytometry), 면역형광염색 및 면역친화성 정제를 통해 측정할 수 있으나, 이에 한정되는 것은 아니다.
상기 면역분석 과정에 의한 최종적인 시그널의 세기를 분석함으로써, 암을 진단할 수 있다. 즉, 생물학적 시료에서 본 발명의 마커의 단백질이 고발현 되어 시그널이 정상 생물학적 시료(예컨대, 정상 위조직, 혈액, 혈장 또는 혈청) 보다 강하게 나오는 경우에는 암으로 진단된다.
또 다른 관점에서, 본 발명은 상기 암 진단용 조성물을 포함하는 암 진단용 키트에 관한 것이다. 본 발명에 따른 키트는 본 발명에 따른 PD-1에 대한 항체를 포함하고, 시료와 항체가 반응함으로써 나타내는 시그널을 분석하여, 암을 진단할 수 있다. 이 때, 상기 시그널은 항체에 결합된 효소 예를 들어 알칼린 포스파타아제, β-갈락토시다아제, 호스 래디쉬 퍼옥시다아제, 루시퍼라아제 또는 사이토크롬 P450을 포함할 수 있으나 이에 제한되는 것은 아니며, 이 때 효소에 대한 기질은 효소로서 알칼린 포스파타아제가 이용되는 경우에는, 기질로서 브로모클로로인돌일 포스페이트 (BCIP), 니트로 블루 테트라졸리움 (NBT), 나프톨-AS-B1-포스페이트 (naphthol-AS-B1-phosphate) 및 ECF (enhanced chemifluorescence)와 같은 발색반응 기질이 이용되고, 호스 래디쉬 퍼옥시다아제가 이용되는 경우에는 클로로나프톨, 아미노에틸카바졸, 디아미노벤지딘, D-루시페린, 루시게닌 (비스-N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스 레드 시약(10-아세틸-3,7-디하이드록시페녹사진), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2'-Azine-di[3-ethylbenzthiazoline sulfonate]), o-페닐렌디아민 (OPD) 및 나프톨/파이로닌, 글루코스 옥시다아제와 t-NBT (nitroblue tetrazolium) 및 m-PMS (phenzaine methosulfate)과 같은 기질이 이용될 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명에 따른 키트는 검출 가능한 시그널을 발생시키는 레이블을 포함할 수 있으며, 상기 레이블은 화학물질 (예컨대, 바이오틴), 효소 (알칼린 포스파타아제, β-갈락토시다아제, 호스 래디쉬 퍼옥시다아제 및 사이토크롬 P450), 방사능물질(예컨대, C14, I125, P32 및 S35), 형광물질 (예컨대, 플루오레신), 발광물질, 화학발광물질 (chemiluminescent) 및 FRET (fluorescence resonance energy transfer)을 포함할 수 있으나, 이에 제한되는 것은 아니다.
암 진단을 위해 사용되는 효소의 활성 측정 또는 시그널의 측정은 당업계에 공지된 다양한 방법에 따라 실시될 수 있다. 이를 통해 PD-1 발현을 정성적 또는 정량적으로 분석할 수 있다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1: PD-1 항원 발현 및 정제
1. PD-L1 단백질 발현 벡터 제작
PD-1의 클로닝은 Jurkat 세포 cDNA 라이브러리 (Stratagene, 미국)를 이용하여, 세포외 도메인만을 얻기 위해 5'과 3'에 제한효소 Sfi Ⅰ 사이트가 포함된 PD1에 대한 프라이머 (표 1)를 이용하여 중합효소연쇄반응 (polymerase chain reaction, PCR)에 의해 증폭시켰다. 증폭된 PCR 산물은 N293F 벡터를 이용하여 카복시-말단에 인간 Fc (서열번호 196), 마우스 Fc (서열번호 197)를 융합시켜 제작하였다 (도 1).
명칭 5'->3’ 서열 서열번호
PD1-F ccaggatggttcttagactcccc 194
PD1-R caccagggtttggaactggc 195
2. PD-1 항원의 발현 및 정제
항원을 동물세포에서 발현시키기 위해서 HEK-293F 세포에 플라스미드 DNA를 형질감염 (transfection)시켰다. 형질감염을 수행하기 위한 폴리플렉스 (polyplex) 반응액은 프리스타일 293 발현 배지 3 ml에 플라스미드 DNA를 25 μg을 넣어 섞어준 후, 추가로 2 mg/ml PEI (Polyethylenimine) (polyplUSA-형질감염, USA) 50 μl을 넣어 다시 한 번 섞어 주었다. 폴리플렉스 반응액은 15분 동안 상온에서 반응시킨 후, 1×106 cells/ml로 배양된 40 ml의 배양액에 넣어 120 rpm으로 37℃, 8% CO2에서 24시간 배양하였다. 형질감염 24시간 후에 보강제 (supplement)인 Soytone (BD, USA)을 최종 농도가 10 g/L가 되도록 첨가한다. 7일 동안 HEK-293F를 이용한 임시발현시스템을 이용하여 항체를 생산하였다. 배양액에서 항원을 얻기 위해 친화도 크로마토그래피 (affinity chromatography)를 수행하였다. 7일째 되는 날 회수한 배양액에서 세포와 세포 잔여물 (debris)을 제거하기 위해 5000 rpm에서 10분간 원심분리하여 상층액을 얻었다. 상층액을 DPBS로 세척한 재조합 단백질 A 아가로스 레진과 4℃에서 16시간 동안 반응시켰다.
재조합 단백질 A 아가로스 레진을 사용한 경우, 0.1M 글리신 (Glycine)으로 단백질을 용출시켰고 1M Tris-HCl 500 μl로 중화시켜 1차 정제하였고, 1차 정제된 단백질은 Superdex 200 (1.5cm*100cm) 겔 여과 크로마토그래피를 이용하여 2차 정제를 하였다.
정제된 단백질은 SDS-PAGE gel과 크기 배제 크로마토그래피 (TSK-GEL G-3000 SWXL Size-exclusion chromatography (SEC) (Tosoh)) 를 이용하여 순도를 확인하였다.
그 결과, 도 2a 내지 도 2d에 나타난 바와 같이, 정제된 PD1 단백질의 순도는 95% 이상의 순도를 가지는 것을 확인할 수 있었다.
실시예 2: PD-1 인간항체의 선별
1. 항원준비
실시예 1에서 제작한 PD1-hFc, PD1-mFc 및 Sino Biological Inc.에서 구입한 PD1-his (Catalog Number, 10377-H08H) 단백질 항원 50ug을 면역 흡착(immunosorb) 튜브에 코팅한 후 블로킹 (blocking)을 수행하였다.
2. 바이오패닝
인간항체 라이브러리 파아지는 2.7×1010의 다양성을 가진 인간 scFv 라이브러리를 박테리아에 감염 시킨 후 박테리아를 30℃에 16시간 동안 배양하였다. 배양 후 원심 분리하여 상층액을 PEG로 농축한 다음, 이를 PBS 완충용액에 녹여 인간항체 라이브러리를 준비하였다. 면역튜브에 라이브러리 파아지를 넣은 후, 실온에서 2시간 반응한 다음, 1XPBS/T와 1XPBS로 워싱 후 항원에 특이적으로 결합한 scFv-파아지들만 용출하였다.
용출된 파아지를 다시 대장균에 감염시켜 증폭시키는 패닝과정을 통해 양성 파아지의 풀 (pool)을 얻고, 첫 번째 라운드의 패닝에서 증폭된 파아지를 가지고 PBST 워싱 단계에서 횟수만 늘리고, 나머지는 동일한 방법으로 2라운드와 3라운드 패닝을 수행하였다.
그 결과 표 2에 나타난 바와 같이 3라운드 패닝에서 항원에 결합한 파아지 수가 유입 (input) 대비 결합 (output)이 다소 증가였음을 확인하였다.
패닝횟수 파지의 유입수 파지의 결합수
1회 2×1013 3.6×107
2회 1.2×1013 7×107
3회 2×1013 2×109
3. 폴리 파아지 ELISA
실시예 2의 각 라운드의 패닝 과정을 통해 수득한 양성 폴리 scFv-파아지 항체 풀에 대한 항원과의 특이성을 알아보기 위해 폴리 파아지 ELISA(enzyme linked immunoassay)를 수행하였다.
각 1차부터 3차까지 패닝하여 얼려두었던 세포 스톡(stock)을 5 ml의 2xYTCM, 2% 글루코오스, 5 mM MgCl2 배지에 OD600에서 0.1 되게 넣어준 다음, 37℃에서 2~3시간(OD600=0.5~0.7) 배양 후 M1 헬퍼 파지를 감염하여 2xYTCMK, 5 mM MgCl2 1mM IPTG 배지에 30℃에서 16시간 배양하였다. 배양한 세포를 원심분리 (4500 rpm, 15 min, 4℃) 후 상층액을 새 튜브로 옮겼다. (1차~3차 패닝 poly scFv-phage) 96 웰 면역-플레이트 (NUNC 439454)에 두 종류의 항원 각각을 웰 당 100 ng씩 4℃에서 16시간 정도 코팅버퍼 (coating buffer)로 코팅한 후 PBS에 녹인 4% 스킴 밀크 (skim milk)를 사용하여 각 웰을 블로킹 (blocking)하였다.
각 웰 마다 PBS/T 0.2 ㎖ 사용하여 씻어준 다음 1차~3차 패닝 폴리 scFv-파지를 각 웰에 100 ㎕씩 넣고 상온에서 2시간 동안 반응시켰다. 다시 각 웰마다 PBS/T 0.2 ㎖을 사용하여 4번 씻어준 후 이차 항체인 항-M13-HRP (Amersham 27-9421-01)를 1:2000으로 희석하여 실온에서 1시간 동안 반응하였다. PBS/T로 씻어준 후에 OPD tablet (sigma. 8787-TAB)을 PC 버퍼를 만들어 100 ul/well씩 넣어 10분 동안 발색 시킨 다음 흡광도 490 nm에서 분광광도계 (spectrophotometer : MolecularDevice)로 측정하였다.
그 결과를 도 3에 나타내었다. 도 3에 따르면, 항원에 대한 결합능이 두 가지 PD1 항원에 대해 3차 폴리 scFv-파지에서 증강(enrichment) 됨을 ELISA로 확인하였다.
4. 양성 파아지 선별
결합능이 큰 다클론 파아지 항체군 (3차 패닝)에서 얻은 콜로니를 2xYTCM, 2% 글루코스, 5 mM MgCl2 배지에 1 ml 96-깊은 웰 플레이트 (바이오니아 90030)에 37℃에서 16시간 배양하였다. 이렇게 키운 세포에서 OD600에서 값이 0.1이 되도록 100~200 ul를 취해 1 ml의 2xYTCM, 2% 글루코스, 5 mM MgCl2 배지에 넣은 다음, 96-깊은 웰 플레이트에 37℃에서 OD600에서 그 값이 0.5~0.7 되도록 2~3 시간 배양 하였다. M1 헬퍼 파지를 MOI값이 1:20 되도록 감염하여 2xYTCMK, 5 mM MgCl2 1 mM IPTG 배지에 30℃에서 16시간 배양 하였다.
96웰 면역 플레이트에 항원 PD1을 웰당 100 ng씩을 4℃에서 16시간 코팅한 후 PBS에 녹인 4% 스킴 밀크를 사용하여 각 웰을 블로킹하였다. 각 웰마다 0.2 ㎖ PBS/T 사용하여 씻어준 16시간 동안 배양한 단일클론 scFv-파지 (각각 100 scFv-phage)를 각 웰에 100 ㎕씩 넣고 상온에서 2시간 동안 반응시켰다. 다시 각 웰마다 0.2 ㎖ PBS/T을 사용하여 4번 씻어준 후 2차 항체인 항-M13-HRP를 1/2000로 희석하여 실온에서 1시간 동안 반응하였다. 0.2 ㎖ PBS/T로 씻어준 후에 발색하여 흡광도 490 nm에서 측정하였다.
그 결과, 도 4에 나타난 바와 같이, 각 항원에 대한 결합능이 강한 단일 파아지 클론들은 PD1에 대해 총 수 십개의 단일 파아지 클론을 얻었다.
5. 양성 파아지 항체의 염기서열 분석
상기 선별된 단일 클론에 대해 DNA 정제 키트 (Qiagen, 독일)를 이용하여 DNA-prep을 수행하여 DNA를 얻어 서열 분석을 의뢰하였다 (솔젠트). 서열 분석 결과를 보고, 선별된 항체의 VH와 VL의 CDR 부위를 확인하였고 이들 항체와 점라인 (germ line) 항체군의 유사성을 NCBI의 웹페이지 http://www.ncbi.nlm.nih.gov/igblast/의 Ig BLAST 프로그램을 이용하여 조사하였다. 그 결과 15종의 PD1에 특이적인 파아지 항체를 얻었고 이는 하기 표 3에 정리하여 제시하였다.
PD1 단일 클론의 특성
클론명 VH 유사성 VL 유사성 그룹
Nivolumab VH3-33 91.80% L6 98.90%
Pembrolizumab VH1-2 79.60% L25 80.80%
PD1-29A2 VH3-9 91.80% V2-17 86.50% 1
PD1-29H3 VH3-9 90.80% V1-11 88.50% 2
PD1-31F3 VH1-69 92.90% V1-13 93.90% 3
PD1-32A6 VH1-69 87.80% L5 91.60% 4
PD1-41C9 VH3-30 95.80% O1 92.10% 5
PD1-42G4 VH3-11 93.80% O2 93.80% 6
PD1-44B5 VH3-30 99.00% V1-16 85.60% 7
PD1-45D6 VH3-30 95.80% O1 93.10% 8
PD1-45F1 VH1-46 91.80% V2-13 93.80% 9
PD1-45F4 VH3-9 90.80% V2-1 77.70% 10
PD1-48A9 VH1-69 79.60% O1 96.00% 11
PD1-49B9 VH3-9 88.70% V1-2 93.90% 12
PD1-49A2 VH3-30 97.90% O1 93.10% 13
PD1-51D9 VH1-3 82.70% A3 94.00% 14
PD1-52E8 VH3-9 91.80% V2-17 90.50% 15
선별된 항체의 중쇄 및 경쇄 CDR, FR서열 및 이를 포함하는 중쇄 가변영역 및 경쇄 가변영역을 포함하는 항체는 다음 표 4 및 표 5와 같다.
Figure PCTKR2017008494-appb-T000001
Figure PCTKR2017008494-appb-I000001
Figure PCTKR2017008494-appb-I000002
Figure PCTKR2017008494-appb-I000003
Figure PCTKR2017008494-appb-T000002
Figure PCTKR2017008494-appb-I000004
Figure PCTKR2017008494-appb-I000005
실시예 3: PD-1 인간항체의 생산
1. scFv 형태를 IgG 형태로 전환 (conversion)
선별된 15종의 PD1에 대한 단일 클론 파아지 항체들을 파아지에서 IgG 전체 벡터 (whole vector)로 전환하기 위해 중쇄와 경쇄에 대해 PCR (iCycler iQ, BIO-RAD)을 수행 하였다. 그 결과, 중쇄와 경쇄를 얻었고, 제한 효소로 벡터와 각 클론의 중쇄, 경쇄를 절단하였다. 벡터와 중쇄 각각은 DNA-gel extraction kit (Qiagen)으로 DNA를 용출하였다. 라이게이션 (Ligation)은 vector 1 ul (10 ng) 중쇄 (100~200 ng) 15 ul, 10x Buffer 2 ul, ligase (1 U/ul) 1 ul, 증류수를 혼합하여 실온에서 1~2시간 방치 후, 형질전환 세포 (competent cell) (XL1-blue)에 넣어 얼음에 5분간 놓고, 42℃에서 90초간 열 충격 (heat shock)을 주었다.
열 충격 후 배지 1 ml을 넣은 뒤 1시간 동안 37℃에서 키운 후, LB Amp 플레이트에 스프레딩 (spreading)하여 37℃에 16시간 동안 배양하였다. 이렇게 얻은 콜로니를 취해 LB Amp 배지 5 ml을 접종하여 37℃에 16시간 동안 배양 후, DNA-prep kit (Nuclogen) 이용하여 DNA-prep을 수행하였다. 얻은 DNA는 서열 분석을 의뢰하였다 (솔젠트).
그 결과, 전체 IgG로 전환한 PD1에 대한 15개의 클론의 중쇄와 경쇄의 서열이 표 3의 15개의 클론의 파아지 항체의 서열과 일치됨을 확인하였다. HEK 293F 세포에 형질감염 하기 위해, 전체 IgG로 전환한 각 클론의 중쇄와 경쇄는 LB Amp 100 ml 배지에 키워 midi-prep kit (QIAgen)을 이용하여 DNA를 얻었다.
2. 인간항체 생산
클로닝된 pNATVH와 pNATVL 벡터는 6:4의 비율로 HEK293F 세포에 동시 형질감염(co-형질감염)하여 7일차 상층액을 수거하여 원심분리와 0.22 ㎛ Top-필터를 통해 세포와 부유물질을 제거한 후, 상층액을 모아 단백질 A 친화도 크로마토그래피를 수행하여 IgG 항체를 정제하였다. 정제 후 글리신 버퍼 (glycine buffer)를 통해 항체를 분리하고, 최종 재서스펜션 버퍼 (resuspension buffer)는 PBS가 되도록 버퍼를 교환하였다. 정제된 항체를 BCA 및 나노 드랍 (nano drop)을 통해 정량하였고, 15종의 항체를 환원, 비환원 조건에서 각 5 ug씩 로딩하여 SDS-PAGE 분석하여 정제 단백질의 순도 및 이동도 (mobility) 상태를 확인하였다 (도 5).
그 결과, 도 5에 따르면, 15종 항체 모두 비환원 조건에서는 150 kDa이상의 크기에서 검출되었고 대조 항체로 Nivolumab을 생산하였다.
실시예 4: PD-1 단일 클론 항체의 특성
1. 항체의 활성 평가
선별된 항체의 활성 평가 실험은 PD1/PD-L1 차단 바이오어세이 키트 (promega, J1250)을 사용하여 진행하였다. PD-L1이 고발현되어 있는 CHO 세포주를 96-웰 플레이트에 도말하고 16시간 이상 배양 후, 일정 농도로 연속 희석된 각 항체들을 처리하고, 인간 PD-1이 고발현되는 Jurkat 세포주를 6시간 동안 함께 배양하였다. 항체의 저해 회복 정도는 루시퍼라제 (luciferase)가 기질을 분해하여 나오는 발광세기로 알 수 있고 분광광도계 (SpectraMax M5 spectraphotometer, Molecular Devices, 미국)로 측정하였다. 대조 항체를 포함하는 16종의 PD-1 항체는 PD-1/PD-L1 복합체 형성으로 감소되어 있던 시그널을 회복시키는 값으로 항체의 활성을 확인하였고, 41C9, 45D6, 49A2가 대조 항체 대비 비슷한 활성도를 보였다 (도 6).
PD-1 항체 41C9, 45D6, 49A2의 활성 평가를 농도 의존적으로 측정하기 위해 단계 희석을 하여 PD1/PD-L1 차단 바이오어세이를 다시 진행한 결과 감소되어 있던 시그널을 농도 구배 의존적으로 회복시켰다. 그 회복 정도는 EC50 (effective concentration of mAb at 50% level of Recovery signal)으로 나타낼 수 있고 Graphpad Prism6를 이용하여 분석하였으며 EC50의 in vitro efficacy 저해회복능력은 도 7과 같다.
2. 과발현 세포에 대한 PD1 항체의 친화도
PD-1을 고발현하는 형질전환 세포 풀은 인간 PD-1 (NM_005018.2)을 포함하고 있는 pcDNA3.1 플라스미드를 HEK293E에 형질전환 시키고, 150 ug/ml Zeocin (#R25001, Thermo Fisher)이 들어있는 선택적 배지에서 선별하였다. 각 세포 풀은 각 anti-PD-1 (#557860, BD)을 이용한 FACS (fluorescence activated cell sorting) 분석을 통해 확인되고 선택되었고, FACS 결합 어세이나 FACS 경쟁 어세이와 같은 기능 평가법에 사용되었다.
인간 PD-1을 고발현하는 형질전환 세포 풀 각각을 시료당 0.5-1x10^6의 세포를 준비하고, 항체들을 각각 일정한 희석 배수로 연속적으로 희석하여 준비된 세포와 4℃에서 20분간 반응시켰다. 그 후, 세포는 2% 소태아혈청 (fetal bovine serum)이 포함된 PBS (#LB001-02, welgene)로 3차례 수세하고, FITC (fluorescein isothiocyanate) 형광물질이 결합된 항-인간 IgG 항체 (#FI-3000, Vectorlabs)를 사용하여 4℃에서 20분간 반응 후, 동일한 수세과정을 거치고 이후 0.5 ml의 2% FBS(#26140-079, Thermo fisher)가 든 PBS로 현탁 시킨 후, 유세포 분석기인 FACSCanto II flow cytometer (BD Biosciences, 미국)을 사용하여 분석하였다. 그 결과로 PD-1 항체 3종 모두 특이적으로 결합하였고, 그 결합력은 평형해리상수(equilibrium dissociation constant, Kd)를 Graphpad Prism6의 분석함수를 통하여 구하였다.
그 결과, 도 8에 따르면, 세포표면에 과발현된 인간 PD-1에 대해 농도 의존적으로 결합된 항체의 결합력을 MFI(mean fluorescence intensity)로 알 수 있다.
3. 양성 파아지 항체에서 PD1-45D6, 49A2 유사 서열을 가진 것을 선별
활성도 평가 및 FACS에서의 결합력이 우수한 것으로 평가된 41C9 이외에도 45D6과 49A2에 대하여 추가 항체 선별을 진행하였다.
실시예 2와 동일한 과정을 통해 PD1-45D6, 49A2 유사 서열을 가진 것을 추가적으로 선별하였다. 아래 표 6에 특성을 정리하였다.
추가적으로 선별된 45D6, 49A2 유사 항체 클론의 특성
클론명 VH 유사도 VL 유사도 2 그룹
PD1-72D10 VH3-30 96.90% 01 94.10% 1
PD1-74A11 VH3-30 97.96% 01 95.05% 2
PD1-75C10 VH3-30 96.94% 01 95.05% 3
PD1-74A01 VH3-30 95.92% 01 92.08% 4
PD1-74H12 VH3-30 94.90% 01 92.08% 5
4. ProteOn XPR36을 이용한 PD1 항체의 친화도
ProteOn XPR36 (BioRad) 기기를 통해 수행하였다. GLC 센서칩 (BioRad)을 기기에 장착하고 PBST 완충용액으로 세척을 한 후, EDC/sulfo-NHS 혼합액으로 카르복시메틸 덱스트란 표면을 활성화시켰다. 10 mM 소듐 아세테이트 (sodium acetate), pH 5.0, 완충액에 5 ug/ml 농도로 녹인 PD1-hFc을 주입시켜 GLC 센서칩에 고정화시켰다.
PD1 단백질과 반응하지 않고 남아있는 활성화된 카르복시 그룹을 비활성화시키기 위해 1 M 에탄올아민을 흘려주었고, 센서칩에 결합되지 않은 단백질을 세척하기 위해 10 mM glycine, pH2.0을 주입하였다. 이후 PBST 완충액을 이용하여 항체를 농도별 (30 nM ~ 0.123 nM)로 30 ul/min 유속으로 10분 흘려주면서 시간에 따른 결합과 해리과정 중의 센소그램 (sensogram) 데이터를 수집하였다.
평형상태에서의 센소그램 데이터를 농도에 따라 플로팅 (plotting) 및 피팅 (fitting)하여 평형 해리상수 (KD) 계산한 결과 45D6은 0.001 nM, 49A2는 0.019 nM로 PD1 항원에 대해 높은 친화도를 보였다 (도 9).
실시예 5: PD1항체 45D6, 49A2에 대한 항체 최적화
1. PD1-45D6, 49A2 항체의 최적화를 위한 라이브러리 제작
항체 최적화는 중쇄는 고정하고 와이바이오로직스에서 보유하고 있는 105-106 경쇄 (LC) 풀 (pool)을 넣어 새로운 LC 셔플링 라이브러리 (LC shuffling library)를 제작하고, LC 셔플링, 중쇄의 소수성 코어 (hydrophobic core), 노출 잔기 (exposed residue), 전하 클러스터 (charge cluster), 염 브릿지 (salt bridge)등과 같이 구조적으로 중요한 부위의 잔기들과 비교분석을 하여 보존된 잔기 (conserved residue)로 변이시킨 뒤 LC 셔플링을 진행하는 코어 패킹 (core packing) + LC 셔플링, 항체 가변 영역 (antibody variable region)의 DNA는 in vivo 친화도 성숙 (affinity maturation) 과정에서 빈번하게 변이 (mutation) 될 수 있는 변이 핫스팟 (mutational hot spot)을 랜덤하게 변이시킨 뒤 LC 셔플링을 진행하는 CDR 핫스팟 + LC 셔플링등 3가지 방법으로 진행을 하였다.
LC 셔플링 라이브러리를 제작하기 위해 45D6, 49A2 항체의 LC 유전자를 BstX I으로 절단한 다음 벡터로 사용하고, 와이바이오로직스에서 보유하고 있는 라이브러리 풀을 BstX I으로 절단하여 인서트로 사용하였다. 리가제로 라이게이션 후, 전기천공 형질전환용 세포를 이용하여 형질전환을 수행하였다. 사각 접시 (square plate)에 형질 전환된 세포를 모아 항체 라이브러리를 제조한 결과 약 1.5x107 의 다양한 라이브러리를 얻었고 염기 서열 분석 결과 HC의 서열은 모두 같으며 LC의 서열이 서로 다른 것을 확인하였다.
Core 패킹 + LC 셔플링 라이브러리를 제작하기 위해 45D6, 49A2 항체의 frame work (FR) 부분을 보존 (conserved)된 아마노산 서열로 치환한 뒤 LC 유전자를 BstX I으로 절단 한 다음 벡터로 사용하고, 와이바이오로직스에서 보유하고 있는 라이브러리 풀을 BstX I으로 절단하여 인서트로 사용하였다. 리가제로 라이게인션 후, 전기천공 형질전환용 세포를 이용하여 형질전환을 수행하였다. 사각 접시 (square plate)에 형질전환된 세포를 모아 항체 라이브러리를 제조한 결과 약 8.4x106 의 다양한 라이브러리를 얻었고 염기 서열 분석 결과 HC의 FR 부위가 보존 (conserved)된 아마노산 서열로 치환되었고 LC의 서열이 서로 다른 것을 확인하였다.
CDR 핫스팟 + LC 셔플링 라이브러리를 제작하기 위해 45D6 항체의 frame work (FR) 부분을 보존 (conserved)된 아마노산 서열로 치환한 뒤 CDR1의 핫스팟 라이브러리를 Sfi I으로 절단 한 다음 인서트로 사용하고, 와이바이오로직스에서 보유하고 있는 library pool을 Sfi I으로 절단하여 벡터로 사용하였다. 리가제로 라이게인션 후, 전기천공 형질전환용 세표를 이용하여 형질 전환을 수행 하였다. 사각 접시 (square plate)에 형질 전환 된 세포를 모아 항체 라이브러리를 제조한 결과 약 5.6x106의 다양한 라이브러리를 얻었고 염기 서열 분석 결과 HC의 FR 부위가 보존 (conserved)된 아마노산 서열로 치환되었고 CDR1의 핫스팟 서열의 아미노산이 랜덤하게 변이되었고 LC의 서열이 서로 다른 것을 확인하였다.
실시예 6: PD1 인간 항체의 선별
1. 항원 준비
와이바이오로직스에서 생산한 PD1-hFc, PD1-mFc와 Sino Biological Inc.에서 구입한 PD1-his (Catalog Number, 10377-H08H) 단백질 항원 50 ug을 immunosorb tube에서 코팅한 후 블로킹 (blocking)을 수행하였다.
2. 바이오-패닝
인간항체 라이브러리 파아지는 2.7×1010의 다양성을 가진 인간 scFv 라이브러리를 박테리아에 감염시킨 후 박테리아를 30℃에 16 시간 배양하였다. 배양 후 원심 분리하여 상층액을 PEG로 농축한 다음, 이를 PBS 완충용액에 녹여 인간항체 라이브러리를 준비하였다. 면역튜브에 라이브러리 파아지를 넣은 후, 실온에서 2시간 반응한 다음, 1XPBS/T와 1XPBS로 워싱 후 항원에 특이적으로 결합한 scFv-파아지들만 용출하였다.
용출된 파아지를 다시 대장균에 감염시켜 증폭시키는 패닝과정을 통해 양성 파아지의 풀 (pool)을 얻었고, 항체 최적화를 위한 패닝은 첫 번째 라운드만 진행하였다. 그 결과, 표 7과 같이 1라운드 패닝에서 항원에 결합한 파아지 수가 유입 (input) 대비 결합 (output)이 다소 증가였음을 확인 하였다.
최적화 패닝에 따른 항체의 역가비교
샘플 파지의 유입수 파지의 결합수
45D6 (LS) 1.3×1013 2.8×107
45D6 (Core packing +LS) 1.1×1013 4.8×107
45D6 (CDR hotspot +LS) 1.1×1013 3.6×106
49A2 (LS) 1.3×1013 1.8×107
49A2 (CDR hotspot +LS) 1.1×1013 1.6×106
3. 양성 파아지 선별
패닝에서 얻은 콜로니를 2xYTCM, 2% 글루코스, 5 mM MgCl2 배지에 1 ml 96-깊은 웰 플레이트 (96-deep well plate: 바이오니아 90030)에 37℃에서 16시간 배양 하였다. 이렇게 키운 세포에서 OD600에서 값이 0.1이 되도록 100~200 ul를 취해 1 ml의 2xYTCM, 2% glucose, 5 mM MgCl2 배지에 넣은 다음, 96-깊은 웰 플레이트에 37℃에서 OD600에서 그 값이 0.5~0.7 되도록 2~3 시간 배양하였다. M1 헬퍼 파지를 MOI값이 1:20 되도록 감염하여 2xYTCMK, 5 mM MgCl2 1 mM IPTG 배지에 30℃에서 16시간 배양하였다.
96웰 면역 플레이트에 항원 PD1을 well당 100 ng씩을 4℃에서 16시간 코팅한 후 PBS에 녹인 4% 스킴 밀크를 사용하여 각 웰을 블로킹하였다. 각 웰마다 0.2 ㎖ PBS/T 사용하여 씻어준 16시간 동안 배양한 단일클론 scFv-파지 (각각 100 scFv-phage)를 각 well에 1 ㎕씩 넣고 상온에서 2시간 동안 반응시켰다. 다시 각 웰마다 0.2 ㎖ PBS/T을 사용하여 4번 씻어준 후 2차 항체인 anti-M13-HRP를 1/2000로 희석하여 실온에서 1시간 동안 반응하였다. 0.2 ㎖ PBS/T로 씻어준 후에 발색하여 흡광도 490 nm에서 측정하였다.
그 결과, 모항체 (49A2 또는 45D6) 보다 각 항원에 대한 결합능이 강한 수 십개의 단일 파아지 클론을 얻었고, 도 10과 같다.
4. 양성 파아지 항체의 염기서열 분석
선별된 단일 클론에 대해 DNA 정제 키트 (Qiagen, 독일)를 이용하여 DNA-prep을 수행하여 DNA를 얻어 서열 분석을 의뢰하였다 (솔젠트). 서열 분석 결과를 보고, 선별된 항체의 VH와 VL 의 CDR region을 확인하였고 이들 항체와 germ line 항체군의 유사성을 NCBI 의 웹페이지 http://www.ncbi.nlm.nih.gov/igblast/ 의 Ig BLAST 프로그램을 이용하여 조사하여 그 결과 25종 (49A2: 10종, 45D6: 15종)의 모항체보다 결합력이 높은 특이적인 파아지 항체를 얻었고 이는 하기 표 8에서 정리하여 제시하였다.
Figure PCTKR2017008494-appb-T000003
선별된 항체의 중쇄 및 경쇄 CDR, FR서열 및 이를 포함하는 중쇄 가변영역 및 경쇄 가변영역을 포함하는 항체는 다음 표 9 및 표 10과 같다.
Figure PCTKR2017008494-appb-T000004
Figure PCTKR2017008494-appb-I000006
Figure PCTKR2017008494-appb-I000007
Figure PCTKR2017008494-appb-T000005
Figure PCTKR2017008494-appb-I000008
Figure PCTKR2017008494-appb-I000009
Figure PCTKR2017008494-appb-I000010
실시예 7: PD1 인간항체의 생산
1. scFv 형태를 IgG 형태로 전환 (conversion)
선별된 25종의 PD1에 대한 단일 클론 파아지 항체들을 파아지에서 IgG whole vector로 전환하기 위해 중쇄와 경쇄에 대해 PCR (iCycler iQ, BIO-RAD)을 수행하였다. 그 결과, 중쇄와 경쇄를 얻었고, 제한 효소로 벡터와 각 클론들의 중쇄, 경쇄를 절단하였다. 벡터와 중쇄 각각은 DNA-겔 추출 키트 (DNA-gel extraction kit : Qiagen)로 DNA 용출하였다. 라이게이션 (ligation)은 벡터 1 ul (10 ng) 중쇄 (100~200 ng) 15 ul, 10x 버퍼 2 ul, 리가아제 (1 U/ul) 1 ul, 증류수를 혼합하여 실온에서 1~2시간 방치 후, 형질전환 세포 (competent cell : XL1-blue)에 넣어 얼음에 5분간 놓고, 42℃에서 90초간 열 충격 (heat shock)을 주었다.
열 충격 후 배지 1 ml을 넣은 뒤 1시간 동안 37℃에서 키운 후, LB Amp 플레이트에 스프레딩하여 37℃ 에 16시간 동안 배양하였다. 이렇게 얻은 콜로니를 취해 LB Amp 배지 5 ml을 접종하여 37℃에 16시간 동안 배양 후, DNA-prep kit (Nuclogen) 이용하여 DNA-prep을 수행하였다. 얻은 DNA는 서열 분석을 의뢰하였다 (솔젠트).
그 결과, 전체 IgG로 전환한 PD1에 대한 25개의 클론의 중쇄와 경쇄의 서열이 파아지 항체의 서열과 일치됨을 확인하였다. HEK 293F 세포에 형질감염 하기 위해, 전체 IgG로 전환한 각 클론의 중쇄와 경쇄는 LB Amp 100 ml 배지에 키워 midi-prep kit (QIAgen)을 이용하여 DNA를 얻었다.
2. 인간항체 생산
클로닝된 pNATVH와 pNATVL 벡터는 6:4의 비율로 HEK293F 세포에 동시 형질감염(co-형질감염)하여 7일차 상층액을 수거하여 원심분리와 0.22 ㎛ Top-필터를 통해 세포와 부유물질을 제거한 후, 상층액을 모아 단백질 A 친화도 크로마토그래피를 수행하여 IgG 항체를 정제하였다. 정제 후 글리신 버퍼 (glycine buffer)를 통해 항체를 분리하고, 최종 재서스펜션 버퍼 (resuspension buffer)는 PBS가 되도록 버퍼를 교환하였다. 정제된 항체를 BCA 및 나노 드랍 (nano drop)을 통해 정량하였고, 25종의 항체를 환원, 비-환원 조건에서 각 5 ug씩 로딩하여 SDS-PAGE 분석하여 정제 단백질의 순도 및 이동도 (mobility) 상태를 확인하였다. 또한 상층액의 일부는 모항체와의 발현율을 비교하기 위해 SDS-PAGE에 로딩하였고 대부분 항체가 모항체보다 발현율이 증가하였고, 그 결과는 도 11에서 확인할 수 있다.
실시예 8: PD1 단일 클론 항체의 특성
1. 항체의 활성 평가
선별된 항체의 활성 평가 실험은 PD1/PD-L1 차단 바이오어세이 키트 (blockade bioassay kit :promega, J1250)을 사용하여 진행하였다. PD-L1이 고발현되어 있는 CHO 세포주를 96-웰 플레이트에 도말하고 16시간 이상 배양 후, 일정 농도로 연속 희석된 각 항체들을 처리하고, 인간 PD-1이 고발현되는 Jurkat 세포주를 6시간 동안 함께 배양하였다. 항체의 저해 회복 정도는 루시퍼라제가 기질을 분해하여 나오는 발광세기로 알 수 있고 분광광도계 (SpectraMax M5 spectraphotometer, Molecular Devices, 미국)로 측정하였다. 24종의 PD-1 항체는 PD-1/PD-L1 복합체 형성으로 감소되어 있던 시그널을 회복시키는 값으로 항체의 활성을 확인하였고, 45D6 항체에서는 45D6-3D2, 45D6-3H7, 45D6-5B2, 45D6-5B5가 49A2 항체에서는 49A2-1B2, 49A2-1H8, 49A2-2A6, 49A2-2B9가 모항체 대비 활성이 증가하였고 대조 항체 대비 비슷한 활성도를 보였다 (도 12).
PD-1 항체 8종(45D6-3D2, 45D6-3H7, 45D6-5B2, 45D6-5B5, 49A2-1B2, 49A2-1H8, 49A2-2A6, 49A2-2B9)에 대해 다시 활성 평가를 농도 의존적으로 측정하기 위해 단계 희석을 하여 PD1/PD-L1 차단 바이오어세이를 다시 진행한 결과 감소되어 있던 시그널을 농도 구배 의존적으로 회복시켰다. 그 회복 정도는 EC50 (effective concentration of mAb at 50% level of Recovery signal)으로 나타낼 수 있고 Graphpad Prism6를 이용하여 분석하였으며 EC50의 In vitro efficacy 저해 회복 능력은 49A2-1B2가 가장 높게 나왔다 (도 13, 표 11).
선별된 PD1 항체 변이체의 단일 클론의 활성
항체 EC50 [nM]
PD-1-41C9 3.91
PD-1-45D6 2
PD-1-45D6-A-3D2 2.16
PD-1-45D6-A-3G1 0.98
PD-1-45D6-A-3H4 1.67
PD-1-45D6-A-3H6 1.49
PD-1-45D6-A-3H7 1.98
PD-1-45D6-A-4C1 1.76
PD-1-45D6-A-4C9 2.72
PD-1-45D6-A-4D4 1.74
PD-1-45D6-A-4H6 1.19
PD-1-45D6-A-5A6 0.92
PD-1-45D6-A-5B12 0.8
PD-1-45D6-A-5B2 1.48
PD-1-45D6-A-5B5 1.68
PD-1-45D6-A-5C8 1.44
PD-1-45D6-A-5H9 2
PD-1-48A9 8.64
PD-1-49A2 3.78
PD-1-49A2-A-1B2 1.3
PD-1-49A2-A-1D11 2.89
PD-1-49A2-A-1F12 1.03
PD-1-49A2-A-1H4 0.84
PD-1-49A2-A-1H8 1.21
PD-1-49A2-A-2A11 0.79
PD-1-49A2-A-2A6 1.51
PD-1-49A2-A-2B10 0.65
PD-1-49A2-A-2B9 1.23
PD-1-51D9 ~ 4.695e+010
PD-1-52E8 8.43
PD-1-62E1 2.73
PD1-72D10 1.21
PD1-74A11 1.31
PD1-75C10 0.81
PD1-74A01 1.01
PD1-74H12 0.98
2. 과발현 세포에 대한 PD1 항체의 친화도
인간 PD-1을 고발현하는 형질전환 세포 풀은 인간 PD-1(NM_005018.2) 혹은 인간 PD-L1(NM_014143.2)을 포함하고 있는 pcDNA3.1 플라스미드를 HEK293E에 형질전환시키고, 400 ug/ml Zeocin (#R25001, Thermo Fisher)이 들어있는 선택적 배지에서 선별하였다. 각 세포 풀은 각각 anti-PD-1 (#557860, BD)을 이용한 FACs(fluorescence activated cell sorting) 분석을 통해 확인되고 선택되었고, FACs 결합 어세이나 FACs 경쟁 어세이 (Competition assay)와 같은 기능 평가법에 사용되었다. 인간 PD1을 고발현하는 형질전환 세포 풀 각각을 시료당 0.5-1x10^6의 세포를 준비하고, 항체들을 각각 일정한 희석 배수로 연속적으로 희석하여 준비된 세포와 4℃에서 20분간 반응시켰다. 그 후, 세포는 2% 소태아혈청 (fetal bovine serum)이 포함된 PBS (#LB001-02, welgene)로 3차례 수세하고, FITC (fluorescein isothiocyanate) 형광물질이 결합된 항-인간 IgG 항체 (#FI-3000, Vectorlabs)를 사용하여 4℃에서 20분간 반응 후, 동일한 수세과정을 거치고 이후 0.5 ml의 2% FBS(#26140-079, Thermo fisher)가 든 PBS로 현탁 시킨 후, 유세포 분석기인 FACSCanto II flow cytometer (BD Biosciences, 미국)을 사용하여 분석하였다.
인간의 PD-1을 고발현하는 형질전환 세포 풀 각각을 시료당 0.5x10^6의 세포를 준비하고, 항체들을 각각 일정한 희석배수로 연속적으로 희석하여 준비된 세포와 4℃에서 20분간 반응시켰다. 그 후, 세포는 2% 소태아혈청 (fetal bovine serum)이 포함된 PBS (#LB001-02, welgene)로 3차례 수세하고, FITC (fluorescein isothiocyanate) 형광물질이 결합된 항-인간 IgG 항체 (#FI-3000, Vectorlabs)를 사용하여 4℃에서 20분간 반응 후, 동일한 수세과정을 거치고 이후 0.5 ml의 2% FBS(#26140-079, Thermo fisher)가 든 PBS로 현탁시킨 후, 유세포 분석기인 FACsCanto II flow cytometer(BD Biosciences, 미국)을 사용하여 분석하였다. 결합력은 평형해리상수(equilibrium dissociation constant, Kd)를 Graphpad Prism6의 분석함수를 통하여 구하였다. 도 15에 따르면, 세포표면에 과발현된 인간 PD-1에 대해 농도 의존적으로 결합된 항체의 결합력을 MFI(mean fluorescence intensity)로 알 수 있다. 도 14 및 도 15에 따르면, 49A2 (Parent 49A2)를 제외한 나머지 항체들이 비슷한 결합력을 보였다.
3. 효소면역흡착을 이용한 PD-1/PD-L1 혹은 PD-1/PD-L2 복합체의 형성을 막는 항체의 저해능력
인간 PD-1-Fc(S1420, Y-Biologics) 혹은 PD-L2-Fc(#10292-H02H, Sino)를 96-웰 면역 마이크로플레이트 (96-well immuno microplate: #439454, Thermo)의 웰에 4℃에서 16시간 동안 고정시키고, 0.05% tween-20(#P9416, Sigma-Aldrich)이 들어있는 PBS로 3번 세척 후, 4% 스킴 밀크(#232120, Becton, Dickinson and Company)가 포함된 세척액으로 상온에서 1시간동안 방치함으로써 비특이적 결합을 차단하였다. 그 사이 일정 희석배수로 연속 희석된 각 항체와 인간 PD-L1-His (S1479, Y-Biologics) 혹은 PD-1-His(S1352, Y-Biologics)를 상온에서 1시간 동안 반응시킨 후, 준비된 마이크로플레이트에 넣어 상온에서 1시간 동안 방치시킨다. 동일한 세척방법을 적용한 이후, anti-Biotin-His 항체 (#MA1-21315-BTIN, Thermo)를 1:2000으로 희석하여 마이크로플레이트의 웰에 넣고 상온에서 1시간 반응시킨 후, 동일한 방법으로 세척한 뒤 Streptavidin poly-HRP 항체(#21140, Pierce)를 1: 5000으로 희석하여 마이크로플레이트의 웰에 넣고 상온에서 1시간 반응시킨 후, 동일한 방법으로 세척하였다. 100 ul TMB 기질용액 (#T0440, Sigma-Aldrich)을 넣고 빛을 차단한 뒤 상온에서 3분간 방치 후 50 ul 2.5M 황산(#S1478, Samchun)을 넣어 반응을 중단시키고 분광광도계(#GM3000, Glomax® Discover System Promega)를 이용하여 450nm에서 흡광도를 측정하였다. 그 결과를 도 16에 나타내었다.
4. ProteOn XPR36을 이용한 PD1 항체의 친화도
ProteOn XPR36 (BioRad) 기기를 통해 수행하였다. GLC 센서칩 (BioRad)을 기기에 장착하고 PBST 완충용액으로 세척을 한 후, EDC/sulfo-NHS 혼합액으로 카르복시메틸 덱스트란 표면을 활성화 시켰다. 10 mM 소듐 아세테이트 (sodium acetate), pH 5.0, 완충액에 5 ug/ml 농도로 녹인 PD1-hFc을 주입시켜 GLC 센서칩에 고정화시켰다.
PD1 단백질과 반응하지 않고 남아있는 활성화된 카르복시 그룹을 비활성화시키기 위해 1 M 에탄올아민을 흘려주었고, 센서칩에 결합되지 않은 단백질을 세척하기 위해 10 mM 글리신 (glycine), pH2.0을 주입하였다. 이후 PBST 완충액을 이용하여 항체를 농도별 (30 nM ~ 0.123 nM)로 30 ul/min 유속으로 10분 흘려주면서 시간에 따른 결합과 해리과정 중의 센소그램 (sensogram) 데이터를 수집하였다.
평형상태에서의 센소그램 데이터를 농도에 따라 플로팅 (plotting) 및 피팅 (fitting)을 하여 평형 해리상수 (KD)계산한 결과 49A2(2B9)은 0.001 nM로 PD1 항원에 대해 높은 친화도를 보였다 (도 17).
다른 항체의 인간 PD-1 단백질에 대한 친화도, 원숭이의 PD-1 단백질에 대한 친화도 및 생쥐의 PD-1 단백질에 대한 친화도는 표 12 내지 표 14에 기재한 바와 같다.
인간 PD1 단백질과 선별된 항체 간의 결합 kinetics
Ab KD(M) Ka(1/Ms) Kd(1/s)
PD1 49A2 2.371×10-10 3.953×105 9.372×10-5
PD1 49A2 1H8 1.245×10-11 2.201×105 2.741×10-6
PD1 49A2 1B2 1.659×10-10 3.853×105 6.390×10-5
PD1 49A2 2A6 6.907×10-11 3.101×105 2.142×10-5
PD1 49A2 2B9 1.0×10-12 3.774×105 1.0×10-7
PD1 45D6 1.0×10-12 2.701×105 1.07×10-7
PD1 45D6 3D2 1.0×10-12 1.81×105 1.0×10-7
PD1 45D6 3H7 2.53×10-11 3.076×105 7.781×10-6
PD1 45D6 5B2 5.818×10-11 3.315×105 1.928×10-5
PD1 45D6 5B5 4.773×10-11 2.96×105 1.413×10-5
원숭이의 PD1 단백질과 선별된 항체 간의 결합 kinetics
Ab KD(M) Ka(1/Ms) Kd(1/s)
PD-1-49A2 1.0×10-12 1.683×105 1.0×10-7
PD-1-49A2-2B9 1.0×10-12 1.853×105 1.0×10-7
PD-1-45D6 1.0×10-12 1.535×105 1.0×10-7
PD-1-45D6-5B2 1.0×10-12 2.078×105 1.0×10-7
생쥐의 PD1 단백질과 선별된 항체 간의 결합 kinetics 측정
Ab KD(M) Ka(1/Ms) Kd(1/s)
PD-1-49A2-2B9 4.231×10-9 1.478×105 6.252×10-4
PD-1-45D6 2.391×10-9 5.544×104 1.326×10-4
PD-1-45D6-5B2 4.590×10-9 1.879×105 8.626×10-4
실시예 9: PD1 단일 클론 항체의 에피토프 (epitope) 결정
PD1 항원에 결합하는 단일 클론 scFv-phage를 2xYTCM, 2% 글루코스 (glucose), 5 mM MgCl2 배지에 37℃에서 16시간 배양 하였다. 이렇게 키운 세포에서 OD600에서 값이 0.1이 되도록 2xYTCM, 2% 글루코스, 5 mM MgCl2 배지에 넣은 다음, 37℃에서 OD600에서 그 값이 0.5~0.7 되도록 2~3 시간 배양 하였다. M1 헬퍼 파지 (helper phage)를 MOI값이 1:20 되도록 감염하여 2xYTCMK, 5 mM MgCl2 1 mM IPTG 배지에 30℃에서 16시간 배양하였다.
96-웰 면역-플레이트에 항원 PD1 wild type (WT) 또는 여러 변이체 (mutants: 도 18)를 웰 당 100 ng씩 4 ℃에서 16시간 코딩한 후 PBS에 녹인 4% 스킴 밀크를 사용하여 각 웰을 차단 (blocking)하였다. 각 웰마다 0.2 ㎖ PBS/T 사용하여 씻어준 뒤 16시간 동안 배양한 단일클론 scFv-phage (each 100 scFv-phage)를 각 well에 100 ㎕씩 넣고 상온에서 2시간 동안 반응시켰다. 다시 각 웰마다 0.2 ㎖ PBS/T을 사용하여 4번 씻어준 후 2차 항체 (second antibody)인 anti-M13-HRP를 1/2000로 희석하여 실온에서 1시간 동안 반응하였다. 0.2 ㎖ PBS/T로 씻어준 후에 발색하여 흡광도 490 nm에서 측정하였다.
그 결과, 선택된 단일클론 scFv-phage, 대조 scFv-phage와 PD-1 변이체들에 대해 다른 결합양상을 보이므로 다른 에피토프를 갖는 것을 확인할 수 있었다 (도 19).
96-웰 면역-플레이트에 항원 PD1 야생형 (PD1 wild type : WT) 또는 여러 변이체들(도 18)을 웰당 100 ng씩을 4 ℃에서 16시간 코팅한 후 PBS에 녹인 4% 스킴 밀크를 사용하여 각 웰을 차단 (blocking)하였다. 각 웰마다 0.2 ㎖ PBS/T 사용하여 씻어준 뒤 16시간 동안 배양한 단일클론 항체를 각 웰에 100 ㎕(1ug/ml)씩 넣고 상온에서 2시간 동안 반응시켰다. 다시 각 웰마다 0.2 ㎖ PBS/T을 사용하여 4번 씻어준 후 이차 항체인 anti-Fab를 1/2000로 희석하여 실온에서 1시간 동안 반응하였다. 0.2 ㎖ PBS/T로 씻어준 후에 발색하여 흡광도 490 nm에서 측정하였다.
그 결과, 대조 항체와 PD-1 변이체들에 대해 다른 결합 양상을 보이므로 다른 에피토프를 갖는 것을 확인할 수 있었다 (도 20).
실시예 10: PD1 모항체의 특이적 결합 (specific binding)
PD1 모항체와 대조 항체 (Nivolumab)에 대해 PD1 항원 외에 다른 여러 항원(표 15)들과의 결합력을 보기 위해 정제된 90여 개의 불특정 항원들을 96 웰 면역-플레이트에 웰 당 100 ng씩을 4℃에서 16시 간 코팅한 후 PBS에 녹인 4% 스킴 밀크를 사용하여 각 웰을 차단 (blocking)하였다. 각 웰마다 0.2 ㎖ PBS/T 사용하여 씻어준 뒤 모항체 및 대조 항체를 각 웰에 100 ng씩 넣고 상온에서 2시간 동안 반응시켰다. 다시 각 웰마다 0.2 ㎖ PBS/T을 사용하여 4번 씻어준 후 이차 항체인 anti-kappa-HRP를 1/1000로 희석하여 실온에서 1시간 동안 반응하였다. 0.2 ㎖ PBS/T로 씻어준 후에 발색하여 흡광도 490 nm에서 측정하였다.
Figure PCTKR2017008494-appb-T000006
그 결과, 대조 항체와 모항체 모두 불특정 항원에는 결합을 하지 않고 PD1항원에만 특이적으로 결합하는 것을 확인할 수 있었다 (도 21).
실시예 11: PD1 단일 클론 항체의 임시 발현 시스템에서의 생산성 비교
최적화된 항체를 임시발현시스템을 통해 생산, 정제시에 뛰어난 물성으로 인해 비교적 균일하면서도 높은 생산량을 가지는 것을 알 수 있다. 일부 항체는 기존에 상용화된 항체보다 높은 생산을 가지는 것을 알 수 있다(도 22).
실시예 12: PD1 단일 클론 항체의 이종 MLR (allogenic MLR) 반응에서의 활성 증가
서로 다른 인간으로부터 분리된 단핵구 유래 수지상 세포 (monocyte derived dendritic cell)에 T 세포를 1: 10의 비율로 섞은 후에 5일 배양 후 배양액의 인터페론 감마의 양을 재어 보면 45D6, 49A2의 모항체를 넣어준 것에서 농도에 의존적으로 인터페론 감마의 양이 증가함을 확인하였다 (도 23).
실시예 13: PD1 단일 클론 항체의 열 안정성 테스트
항체 단백질을 DPBS에 희석하여 3uM, 45 ul를 만들고, 200x sypro orange dye(#S6650, Thermo) 5 ul와 섞어서 qPCR Tube(#B77009, B57651, bioplastics)에 50 ul씩 분주한다. Biorad CFX96 real time PCR 기기를 사용하여 qPCR을 실시하였다. qPCR 조건은 다음과 같이 25℃에서 30초 반응 후, 99℃까지 1도씩 증가시키되 각 온도에 1분간 반응시키고 마지막 25℃ 10초 반응을 시켜 마무리 하였다. 항체 구조가 풀리는 속도 상수로는 Tm (Melting temperature, 용융 온도)을 사용하였다. 그 결과는 아래 표 16과 같다.
Sample Tm
Pembrolizumab 63
Opdivo 64
45D6 63
49A2 63
49A2-2B9 64
본 발명의 PD-1에 결합하는 신규한 항체 또는 이의 항원 결합 단편은 PD-1에 결합하여 그의 활성을 억제할 수 있으므로 PD-1과 연관된 다양한 질환의 면역 치료제의 개발에 유용하다.
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.
전자파일 첨부하였음.

Claims (13)

  1. 서열번호 1 내지 서열번호 30으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 CDR1,
    서열번호 31 내지 서열번호 56으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 CDR2, 및
    서열번호 57 내지 서열번호 79로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 CDR3를 포함하는 중쇄 가변영역, 및
    서열번호 198 내지 서열번호 222로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 CDR1,
    서열번호 223 내지 서열번호 241로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 CDR2, 및
    서열번호 242 내지 서열번호 269로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 CDR3를 포함하는 경쇄 가변영역을 포함하는, PD-1에 결합하는 항체 또는 이의 항원 결합단편.
  2. 제 1항에 있어서,
    서열번호 1의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 2의 중쇄 CDR1, 서열번호 33의 중쇄 CDR2, 및 서열번호 59의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 2의 중쇄 CDR1, 서열번호 33의 중쇄 CDR2, 및 서열번호 60의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 2의 중쇄 CDR1, 서열번호 33의 중쇄 CDR2, 및 서열번호 61의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 2의 중쇄 CDR1, 서열번호 33의 중쇄 CDR2, 및 서열번호 62의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 3의 중쇄 CDR1, 서열번호 34의 중쇄 CDR2, 및 서열번호 63의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 4의 중쇄 CDR1, 서열번호 35의 중쇄 CDR2, 및 서열번호 64의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 5의 중쇄 CDR1, 서열번호 36의 중쇄 CDR2, 및 서열번호 65의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 6의 중쇄 CDR1, 서열번호 37의 중쇄 CDR2, 및 서열번호 66의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 67의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 7의 중쇄 CDR1, 서열번호 38의 중쇄 CDR2, 및 서열번호 68의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 8의 중쇄 CDR1, 서열번호 39의 중쇄 CDR2, 및 서열번호 69의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 9의 중쇄 CDR1, 서열번호 40의 중쇄 CDR2, 및 서열번호 70의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 10의 중쇄 CDR1, 서열번호 41의 중쇄 CDR2, 및 서열번호 71의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 11의 중쇄 CDR1, 서열번호 42의 중쇄 CDR2, 및 서열번호 72의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 12의 중쇄 CDR1, 서열번호 43의 중쇄 CDR2, 및 서열번호 73의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 13의 중쇄 CDR1, 서열번호 44의 중쇄 CDR2, 및 서열번호 74의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 14의 중쇄 CDR1, 서열번호 45의 중쇄 CDR2, 및 서열번호 75의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 15의 중쇄 CDR1, 서열번호 46의 중쇄 CDR2, 및 서열번호 76의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 8의 중쇄 CDR1, 서열번호 47의 중쇄 CDR2, 및 서열번호 77의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 16의 중쇄 CDR1, 서열번호 48의 중쇄 CDR2, 및 서열번호 78의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 17의 중쇄 CDR1, 서열번호 49의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 18의 중쇄 CDR1, 서열번호 50의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 19의 중쇄 CDR1, 서열번호 51의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 20의 중쇄 CDR1, 서열번호 52의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 21의 중쇄 CDR1, 서열번호 51의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 22의 중쇄 CDR1, 서열번호 53의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 23의 중쇄 CDR1, 서열번호 49의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 17의 중쇄 CDR1, 서열번호 54의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 24의 중쇄 CDR1, 서열번호 55의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 21의 중쇄 CDR1, 서열번호 51의 중쇄 CDR2, 및 서열번호 58의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 25의 중쇄 CDR1, 서열번호 56의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 26의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 27의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 28의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 29의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 30의 중쇄 CDR1, 서열번호 31의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역,
    서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 79의 중쇄 CDR3을 포함하는 중쇄 가변영역, 또는
    서열번호 1의 중쇄 CDR1, 서열번호 32의 중쇄 CDR2, 및 서열번호 57의 중쇄 CDR3을 포함하는 중쇄 가변영역을 포함하는 항체 또는 이의 항원 결합단편.
  3. 제 1항에 있어서,
    서열번호 198의 경쇄 CDR1, 서열번호 223의 경쇄 CDR2, 및 서열번호 242의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 199의 경쇄 CDR1, 서열번호 224의 경쇄 CDR2, 및 서열번호 243의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 200의 경쇄 CDR1, 서열번호 225의 경쇄 CDR2, 및 서열번호 244의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 201의 경쇄 CDR1, 서열번호 226의 경쇄 CDR2, 및 서열번호 245의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 202의 경쇄 CDR1, 서열번호 227의 경쇄 CDR2, 및 서열번호 246의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 203의 경쇄 CDR1, 서열번호 228의 경쇄 CDR2, 및 서열번호 247의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 204의 경쇄 CDR1, 서열번호 229의 경쇄 CDR2, 및 서열번호 248의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 249의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 206의 경쇄 CDR1, 서열번호 231의 경쇄 CDR2, 및 서열번호 250의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 207의 경쇄 CDR1, 서열번호 232의 경쇄 CDR2, 및 서열번호 251의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 208의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 209의 경쇄 CDR1, 서열번호 233의 경쇄 CDR2, 및 서열번호 253의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 210의 경쇄 CDR1, 서열번호 234의 경쇄 CDR2, 및 서열번호 254의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 211의 경쇄 CDR1, 서열번호 235의 경쇄 CDR2, 및 서열번호 255의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 212의 경쇄 CDR1, 서열번호 236의 경쇄 CDR2, 및 서열번호 256의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 213의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 257의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 214의 경쇄 CDR1, 서열번호 237의 경쇄 CDR2, 및 서열번호 258의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 215의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 249의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 211의 경쇄 CDR1, 서열번호 238의 경쇄 CDR2, 및 서열번호 259의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 216의 경쇄 CDR1, 서열번호 238의 경쇄 CDR2, 및 서열번호 260의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 217의 경쇄 CDR1, 서열번호 239의 경쇄 CDR2, 및 서열번호 261의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 218의 경쇄 CDR1, 서열번호 240의 경쇄 CDR2, 및 서열번호 262의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 219의 경쇄 CDR1, 서열번호 241의 경쇄 CDR2, 및 서열번호 263의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 215의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 264의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 265의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 221의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 266의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 252의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 267의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 205의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 257의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 267의 경쇄 CDR3를 포함하는 경쇄 가변영역,
    서열번호 222의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 268의 경쇄 CDR3를 포함하는 경쇄 가변영역, 또는
    서열번호 220의 경쇄 CDR1, 서열번호 230의 경쇄 CDR2, 및 서열번호 269의 경쇄 CDR3를 포함하는 경쇄 가변영역을 포함하는 항체 또는 이의 항원 결합단편.
  4. 제 1항에 있어서, 서열번호 80 내지 서열번호 95로 구성된 군에서 선택되는 중쇄 가변영역 FR1,
    서열번호 96 내지 서열번호 113으로 구성된 군에서 선택되는 중쇄 가변영역 FR2,
    서열번호 114 내지 서열번호 134로 구성된 군에서 선택되는 중쇄 가변영역 FR3, 또는
    서열번호 135 내지 서열번호 145로 구성된 군에서 선택되는 중쇄 가변영역 FR4를 포함하는 항체 또는 이의 항원 결합단편.
  5. 제 1항에 있어서, 서열번호 270 내지 서열번호 294로 구성된 군에서 선택되는 경쇄 가변영역 FR1,
    서열번호 295 내지 서열번호 315로 구성된 군에서 선택되는 경쇄 가변영역 FR2,
    서열번호 316 내지 서열번호 355로 구성된 군에서 선택되는 경쇄 가변영역 FR3, 또는
    서열번호 356 내지 서열번호 367로 구성된 군에서 선택되는 경쇄 가변영역 FR4를 포함하는 항체 또는 이의 항원 결합단편.
  6. 제 1항에 있어서, 서열번호 146 내지 서열번호 193으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 중쇄 가변영역을 포함하는 항체 또는 이의 항원 결합단편.
  7. 제 1항에 있어서, 서열번호 368 내지 서열번호 420으로 구성된 군에서 선택되는 서열과 90% 이상의 서열 상동성을 가지는 서열을 포함하는 경쇄 가변영역을 포함하는 항체 또는 이의 항원 결합단편.
  8. 제 1항 내지 제 7항 중 어느 한 항의 항체 또는 이의 항원 결합단편을 코딩하는 핵산.
  9. 제 8항의 핵산을 포함하는 발현벡터.
  10. 제 9항의 발현 벡터로 형질전환된 세포.
  11. 다음 단계를 포함하는 PD-1에 결합하는 항체 또는 그의 항원 결합 단편의 제조방법:
    (a) 제 10항의 세포를 배양하는 단계; 및
    (b) 상기 배양된 세포에서 항체 또는 그의 항원 결합 단편을 회수하는 단계.
  12. 제 1항 내지 제 7항 중 어느 한 항의 항체 또는 그의 항원 결합 단편을 유효성분으로 포함하는 암 예방 또는 치료용 조성물.
  13. 제 12항에 있어서, 상기 암은 흑색종, 폐암, 간암, 교세포종, 난소암, 대장암, 두경부암, 방광암, 신장세포암, 위암, 유방암, 전이암, 전립선암 및 췌장암으로 구성된 군으로부터 선택되는 것을 특징으로 하는 암 예방 또는 치료용 조성물.
PCT/KR2017/008494 2016-08-05 2017-08-07 프로그램화된 세포 사멸 단백질(pd-1)에 대한 신규 항체 및 이의 용도 Ceased WO2018026248A1 (ko)

Priority Applications (11)

Application Number Priority Date Filing Date Title
CN201780055472.9A CN110049998B (zh) 2016-08-05 2017-08-07 抗程序性细胞死亡1(pd-1)的抗体及其用途
EP17837299.1A EP3495390A4 (en) 2016-08-05 2017-08-07 NOVEL ANTIBODY AGAINST PROGRAMMED CELL DEATH PROTEIN (PD-1) AND USE OF IT
BR112019002258-9A BR112019002258A2 (pt) 2016-08-05 2017-08-07 anticorpo que se liga a pd-1 ou fragmento de ligação ao antígeno do anticorpo, método para produzir o mesmo e composição para prevenir ou tratar câncer
CA3032783A CA3032783C (en) 2016-08-05 2017-08-07 Antibody to programmed cell death 1 (pd-1) and use thereof
MYPI2019000513A MY189412A (en) 2016-08-05 2017-08-07 Antibody to programmed cell death 1 (pd-1) and use thereof
US16/321,124 US11248048B2 (en) 2016-08-05 2017-08-07 Antibody to programmed cell death 1 (PD-1) and use thereof
JP2019528009A JP6786722B2 (ja) 2016-08-05 2017-08-07 プログラム化された細胞死蛋白質（ｐｄ−１）に対する新規抗体及びその用途
AU2017306506A AU2017306506B2 (en) 2016-08-05 2017-08-07 Antibody to programmed cell death 1 (PD-1) and use thereof
RU2019105648A RU2725950C1 (ru) 2016-08-05 2017-08-07 Антитела против белка-1 запрограммированной клеточной смерти (pd-1) и их применение
UAA201902239A UA125395C2 (uk) 2016-08-05 2017-08-07 Антитіло проти білка-1 запрограмованої клітинної смерті (pd-1) і його застосування
SA519401032A SA519401032B1 (ar) 2016-08-05 2019-02-04 (pd-1) جسم مضاد لموت الخلية المبرمج1 واستخدامه

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2016-0100210 2016-08-05
KR20160100210 2016-08-05
KR10-2017-0099672 2017-08-07
KR1020170099672A KR102048476B1 (ko) 2016-08-05 2017-08-07 프로그램화된 세포 사멸 단백질(pd-1)에 대한 신규 항체 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2018026248A1 true WO2018026248A1 (ko) 2018-02-08

Family

ID=61073832

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/008494 Ceased WO2018026248A1 (ko) 2016-08-05 2017-08-07 프로그램화된 세포 사멸 단백질(pd-1)에 대한 신규 항체 및 이의 용도

Country Status (1)

Country Link
WO (1) WO2018026248A1 (ko)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019197979A1 (en) * 2018-04-10 2019-10-17 Y-Biologics Inc. Cell engaging binding molecules
US10633458B2 (en) 2018-04-10 2020-04-28 Y-Biologics Inc. Cell engaging binding molecules
WO2021006199A1 (ja) 2019-07-05 2021-01-14 小野薬品工業株式会社 Ｐｄ－１／ｃｄ３二重特異性タンパク質による血液がん治療
US10894830B2 (en) 2015-11-03 2021-01-19 Janssen Biotech, Inc. Antibodies specifically binding PD-1, TIM-3 or PD-1 and TIM-3 and their uses
WO2021025140A1 (ja) 2019-08-08 2021-02-11 小野薬品工業株式会社 二重特異性タンパク質
US12398209B2 (en) 2018-01-22 2025-08-26 Janssen Biotech, Inc. Methods of treating cancers with antagonistic anti-PD-1 antibodies

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140294852A1 (en) * 2005-05-09 2014-10-02 Ono Pharmaceutical Co., Ltd. Monoclonal antibodies to programmed death 1 (pd-1)
US20150203579A1 (en) * 2014-01-23 2015-07-23 Regeneron Pharmaceuticals, Inc. Human Antibodies to PD-1
WO2016015685A1 (zh) * 2014-07-30 2016-02-04 珠海市丽珠单抗生物技术有限公司 抗pd-1抗体及其应用
CN105566496A (zh) * 2015-11-26 2016-05-11 大庆东竺明生物技术有限公司 阻断人程序性死亡因子1(pd-1)功能的单克隆抗体及其编码基因和应用
US20160222113A1 (en) * 2013-09-10 2016-08-04 Medimmune Limited Antibodies Against PD-1 and Uses Thereof

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140294852A1 (en) * 2005-05-09 2014-10-02 Ono Pharmaceutical Co., Ltd. Monoclonal antibodies to programmed death 1 (pd-1)
US20160222113A1 (en) * 2013-09-10 2016-08-04 Medimmune Limited Antibodies Against PD-1 and Uses Thereof
US20150203579A1 (en) * 2014-01-23 2015-07-23 Regeneron Pharmaceuticals, Inc. Human Antibodies to PD-1
WO2016015685A1 (zh) * 2014-07-30 2016-02-04 珠海市丽珠单抗生物技术有限公司 抗pd-1抗体及其应用
CN105566496A (zh) * 2015-11-26 2016-05-11 大庆东竺明生物技术有限公司 阻断人程序性死亡因子1(pd-1)功能的单克隆抗体及其编码基因和应用

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP3495390A4 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10894830B2 (en) 2015-11-03 2021-01-19 Janssen Biotech, Inc. Antibodies specifically binding PD-1, TIM-3 or PD-1 and TIM-3 and their uses
US12173064B2 (en) 2015-11-03 2024-12-24 Janssen Biotech, Inc. Antibodies specifically binding PD-1, TIM-3 or PD-1 and TIM-3 and their uses
US12398209B2 (en) 2018-01-22 2025-08-26 Janssen Biotech, Inc. Methods of treating cancers with antagonistic anti-PD-1 antibodies
WO2019197979A1 (en) * 2018-04-10 2019-10-17 Y-Biologics Inc. Cell engaging binding molecules
US10633458B2 (en) 2018-04-10 2020-04-28 Y-Biologics Inc. Cell engaging binding molecules
US10640576B2 (en) 2018-04-10 2020-05-05 Y-Biologics Inc. Cell engaging binding molecules
US10654944B2 (en) 2018-04-10 2020-05-19 Y-Biologics Inc. Cell engaging binding molecules
US10836833B2 (en) 2018-04-10 2020-11-17 Y-Biologics Inc. Cell engaging binding molecules
WO2021006199A1 (ja) 2019-07-05 2021-01-14 小野薬品工業株式会社 Ｐｄ－１／ｃｄ３二重特異性タンパク質による血液がん治療
WO2021025140A1 (ja) 2019-08-08 2021-02-11 小野薬品工業株式会社 二重特異性タンパク質

Similar Documents

Publication Publication Date Title
WO2018026248A1 (ko) 프로그램화된 세포 사멸 단백질(pd-1)에 대한 신규 항체 및 이의 용도
WO2015058573A1 (zh) 拮抗抑制程序性死亡受体pd-1与其配体结合的单克隆抗体及其编码序列与用途
WO2021020845A1 (en) Anti-egfr/anti-4-1bb bispecific antibody and use thereof
WO2022039490A1 (en) Anti-b7-h4/anti-4-1bb bispecific antibodies and use thereof
WO2021020846A1 (en) Anti-her2/anti-4-1bb bispecific antibody and use thereof
WO2014090053A1 (zh) 拮抗抑制血管内皮细胞生长因子与其受体结合的单克隆抗体及其编码序列与用途
WO2016137108A1 (en) Novel antibody binding to tfpi and composition comprising the same
WO2014077648A1 (ko) 인간 및 마우스 ｌ１ｃａｍ 단백질에 특이적으로 결합하는 항체 및 이의 용도
WO2018194381A1 (ko) Lrig-1 단백질에 특이적인 결합 분자 및 이의 용도
WO2022035201A1 (ko) Il-12 및 항-fap 항체를 포함하는 융합단백질 및 이의 용도
WO2021071319A1 (ko) 다중 특이적 융합 단백질 및 이의 용도
WO2021101346A1 (en) Anti-ror1/anti-4-1bb bispecific antibodies and uses thereof
WO2022177394A1 (ko) Pd-l1 및 cd47에 대한 이중특이적 단일 도메인 항체 및 이의 용도
WO2023277361A1 (ko) 메소텔린 특이적 항체 및 이의 용도
WO2010047509A9 (ko) 친화도와 안정성이 향상된 항 ｄｒ5 항체, 및 이를 포함하는 암 예방 또는 치료용 조성물
WO2022124765A1 (ko) Gpc3에 특이적인 항체 및 이의 용도
WO2016200220A1 (ko) 분리된 비멘틴 유래 펩타이드에 특이적으로 결합하는 항체 또는 상기 펩타이드의 결합 단편
WO2020101365A1 (ko) 안정성이 향상된 항 c-met 항체 또는 그의 항원 결합 단편
WO2021101349A1 (ko) Ror1 및 b7-h3에 결합하는 항체, 이를 포함하는 항체-약물 접합체 및 그 용도
WO2023224429A1 (ko) Light 단백질 및 항-fap 항체를 포함하는 융합단백질 및 이의 용도
WO2018026249A1 (ko) 프로그램화된 세포 사멸 단백질 리간드-1 (pd-l1)에 대한 항체 및 이의 용도
WO2023090704A1 (ko) 인간화된 cd22에 특이적인 항체 및 이를 이용한 키메라 항원 수용체
WO2019125070A1 (ko) 악성 b 세포를 특이적으로 인지하는 항체 또는 그의 항원 결합 단편, 이를 포함하는 키메라 항원 수용체 및 이의 용도
WO2022085905A1 (ko) SARS-CoV-2 스파이크 단백질에 특이적으로 결합하는 항체 및 이의 용도
WO2020209645A1 (ko) 프로그램화된 세포 사멸 단백질 리간드-1 (pd-l1)에 대한 항체 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17837299

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 3032783

Country of ref document: CA

Ref document number: 2019528009

Country of ref document: JP

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112019002258

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 2017837299

Country of ref document: EP

Effective date: 20190305

ENP Entry into the national phase

Ref document number: 2017306506

Country of ref document: AU

Date of ref document: 20170807

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 112019002258

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20190204