WO2018018123A2

WO2018018123A2 - Human anti-tetanus monoclonal antibodies neutralising infection by c. tetani, method for obtaining said monoclonal antibodies and use thereof in immunotherapy in the case of accidents with possible infection by tetanus bacillus

Info

Publication number: WO2018018123A2
Application number: PCT/BR2017/050215
Authority: WO
Inventors: Ana Maria MORO; Jorge Elias Kalil Filho; Eduardo ALIPRANDINI
Original assignee: Fundação Butantan
Priority date: 2016-07-29
Filing date: 2017-07-28
Publication date: 2018-02-01
Also published as: AR125232A2; WO2018018123A3; AR125231A2; BR102016017782A2; PH12019500431A1; AR109221A1

Abstract

The present invention relates to human anti-tetanus monoclonal antibodies against C. tetani infection, obtained by genetic engineering techniques using the information about the gene sequence obtained from B lymphocytes in the peripheral blood of persons vaccinated with tetanus toxoid. The genetic information is inserted into vectors used for transfecting mammal cells, with the aim of generating cell lines producing anti-tetanus monoclonal antibodies. Another aspect of the present invention relates to immunological compositions containing said monoclonal antibody, and to the uses thereof for the treatment and/or immunotherapy of tetanus infection.

Description

Patent Descriptive Report for: "NEUTRALIZING HUMAN ANTITETANIC MONOCLONAL ANTIBODIES FOR C.TETANI INFECTION, METHOD FOR OBTAINING MONOCLONAL ANTIBODIES AND THEIR USE IN IMMUNOTHERAPY".

FIELD OF INVENTION

The present invention relates to neutralizing tetanus human monoclonal antibodies for C. tetani infection, method of obtaining said monoclonal antibodies and their use in immunotherapy for accidents susceptible to tetanus bacilli infection.

BACKGROUND OF THE INVENTION

[002] Tetanus is a neurological disease caused by the bacterial toxin Clostridium tetani, a sporulated gram-positive bacillus present in large amounts in soil, rusty instruments and dust (Collingridge, 1982). The active tetanus toxin (TxT) is a protein composed of a light (about 50 kDa) and a heavy (100 kDa) chain linked by disulfide bridges. Its synthesis in the bacterial cytoplasm occurs as a single polypeptide chain. When transported abroad, chain breakage occurs by enzymes present in the C. tetani cell wall generating the heavy and light chains mentioned above (Bizzini et al., 1970; Matsuda et al., 1974).

The major action of TxT involves blocking the release of inhibitory neurotransmitters (glycine and GABA-Y-aminobutyric acid) in spinal cord neurons (Humeau et al., 2000). As a result, it causes sustained muscle hypertonia, hyperreflexia and spasms. The light chain (domain A) contains zinc-binding motif that is responsible for the proteolytic action on a complex present in the vesicles. synaptic, called VAMP / synaptobrevine. VAMP, when intact, has the function of favoring the approach and fusion of the vesicle to the presynaptic membrane, ensuring the release of inhibitory neurotransmitters in the synapse (Schiavo et al., 1992a; Schiavo et al., 1992b).

The toxin heavy chain plays a role prior to this event. The domain present in the C-terminal portion of the heavy chain (known as the C fragment) is responsible for binding to the neuron through interaction with membrane gangliosides. Gangliosides are glycosphingolipids complexed with sialic acid (Chen et al., 2009). Another domain (domain B) of the heavy chain plays a role in translocation, which helps the toxin cross the neuronal membrane.

Once internalized, TxT is retrograde transported to spinal cord neurons, where it causes its toxic effects.

The toxic lethal dose (LD) of the toxin in mice is between 0.1 and 1 ng / kg body weight. The sensitivity in humans to this toxin is similar to that of mice. It is one of the most toxic substances known (Schiavo et al., 2000). Protection against toxin is ensured by vaccination with tetanus toxoid, which corresponds to tetanus anatoxin (AnT) adsorbed by aluminum hydroxide (Brasil, 2010). At Butantan Institute the toxin is obtained from bacterial cultivation by tangential filtration and ammonium sulfate precipitation, then detoxified by treatment with formaldehyde and glycine for 30 days, generating AnT (Sonobe et al., 2007). A study in São Paulo showed that 3% of the population has no protection against tetanus (antibody level < 0.01 IU / mL) and at 18%, the amount of circulating antibodies in the blood is between 0.01 and 0.1 U / mL, which represents a baseline level of protection (Divono-Goes et al., 2007).

[007] Tetanus lethality reaches 30% and mainly affects under-fives and the elderly (Ministry of Health, 2005). In older individuals, a greater number of people without vaccine protection are observed. A study published in 2006 evaluated the immunity of 98 elderly people from an asylum in São Paulo, SP, with an average age of 84 years through the tetanus antibody (anti-TT) dosage. The result showed that 94% of subjects tested were susceptible to tetanus, and after a booster dose of tetanus vaccine, that number decreased to 79%, still considered worrying (Weckx et al., 2006).

Table 1 shows data from confirmed cases of tetanus by region in Brazil.

Table 1: Incidence of tetanus (except neonatal)

confirmed by region.

Death

Region

Region Region Region Region Ign / by

Year Center- Total Cure Death

North Northeast Southeast South White other

West

cause

2010 29 109 59 66 25 288 145 88 51 4

2011 44 133 72 54 32 335 188 101 39 7

2012 42 108 70 55 44 319 176 108 31 4

2013 37 60 64 59 62 282 152 92 32 6

2014 41 89 65 46 32 273 148 75 45 5

2015 10 24 26 16 7 83 31 22 28 2

TOTAL 203 523 356 296 202 1580

Source: Ministry of Health (2015b)

1. Status of the July 2015 database

2. Excluding cases not resident in Brazil

3. Information concerning accidental tetanus, only [009] The incidence of neonatal tetanus is decreasing in Brazil. In 2001, 27 cases were registered throughout the country, which is considered elimination of the disease, since it is equivalent to less than one case per 1000 live births (FUNASA, 2001). In 2012 (last record found) two cases were registered in Brazil, one in Pará and another in Minas Gerais (Ministry of Health, 2015a).

Table 2 shows a comparison between neonatal tetanus and total tetanus during the years 2010 to 2014.

Perforation of the skin with contaminated objects is among the main causes for evolution to tetanus. Among the procedures for prophylaxis in these cases is the use of equine tetanus serum (SAT), produced by Butantan Institute. This serum is obtained from the inoculation of tetanus toxoid in horses. After complete immunization of the animals, a volume of plasma is collected by apheresis, from which the serum containing the anti-TT antibodies is processed. Immunoglobulins produced by the horse are administered to patients who have suffered a puncture accident and are at risk of contamination with C. tetani _f and have the function of binding to and neutralizing the toxin. Immunity against toxin is provided by vaccination and the disease does not confer immunity to the patient as TxT is a weak immunogen. What guarantees the immunogenicity of the toxoid in the vaccine is the presence of the adjuvant, which may be aluminum hydroxide gel, as in the case of the Butantan Institute vaccine (Lindley-Jones et al., 2004). In cases where SAT is administered, protection lasts one week on average. In addition to serum there is tetanus hyperimmune human immunoglobulin (IGHAT). It is made from the plasma of newly immunized donors with high antibody titers. IGHAT is indicated in cases of hypersensitivity to heterologous serum or past history of allergy or hypersensitivity reaction to the use of other heterologous sera (Funasa, 2001). The use of human immunoglobulins, although properly tested for contaminating viruses, is not completely without risk due to the potential to contain emerging or undetectable viruses.

The persistence of tetanus cases, when an efficient vaccine already exists, demands alternatives for treatment. In suspected cases, tetanus serum obtained from animals, usually horses, composed of polyclonal antibodies is used. However, it is known that the use of heterologous proteins can induce the formation of antibodies against these immunoglobulins, which limits their use in one dose and makes the possible treatment in other situations where heterologous antibodies are available. The use of hyperimmune human immunoglobulin obtained from human donors, although a good alternative, presents risks in cases of disease transmission and batch production is not homogeneous.

Mortality-causing infections by microorganisms are generally treated by passive immunotherapy by injecting neutralizing antibodies. In cases of accidents likely to be infected with the tetanus bacillus C. tetani _f , serotherapy with hyperimmune serum produced in horses is used or, in cases of hypersensitivity, hyperimmune human immunoglobulin is used. Serotherapy has a crucial therapeutic role in combating accidents that are likely to be infected with Clostridium tetani, which causes tetanus.

The Butantan Institute, for example, produces tetanus equine polyclonal serum that is effective but of heterologous origin.

[0015] Tetanus heterologous serum was proposed over a hundred years ago. Today there are technologies that allow to obtain more defined products, with production consistency and less immunogenicity.

The modern trend is the use of modern biological medicines, generally obtained by recombinant DNA technology.

Immunotherapy is proven effective when the antigen is known and antibodies are available that recognize it and perform some function, cytotoxic, blocking signaling pathways, adjuvant or neutralizing. Due to the proven therapeutic potential of antibodies, there is a continuing investment to make them more effective and safer. One challenge is the production of well-tolerated therapeutic molecules by patients. There is a great development in the area of monoclonal antibodies, to make them more human (humanized) when obtained from animals. There are companies that have genetically engineered mice, replacing their genes for immunoglobulin synthesis with human immunoglobulin genes, by the need to obtain antibodies with characteristics closer to humans.

Antibodies are molecules secreted by B lymphocytes whose antigen recognition region is equal to that of the rearranged receptor present on the membrane. They are formed by two chains: heavy and light, each being encoded on different chromosomes. The heavy chain (50 kDa) is formed by four regions, CHI, C3 which correspond to the constant region and V which corresponds to the variable region. The constant region determines the class and subclass to which the antibody belongs. The classes, known as isotypes, can be IgM (constant chain μ), IgG (γ), IgA (a), IgE (ε) and IgD (d), with each chain conferring different functions. The light chain (25 kDa) is composed of a constant region, CL, and a variable, VLH. There are two types of light chain: kappa (κ-gene located on chromosome 2) and lambda (λ - gene located on chromosome 22) which are differentiated by the C region. In humans, the relationship between kappa and lambda chains in the general repertoire of antibodies is about 60% kappa and 40% lambda (Abbas et al, 2012; Mcbride et al., 1982).

Monoclonal antibodies (AcMos) are important tools for treatment and diagnosis by their antigen binding specificity and homogeneous production in large quantities. Antibody studies gained encouragement in the 1970s, when it was developed the technique of producing hybridomas (Kohler; Milstein, 1976). Through this technique it was possible to immortalize an antibody-producing cell of interest by fusion with a murine myeloma cell. The hybridoma product can be cultured in vitro and yields the selected MAbs. Hybridoma technology has brought important advances in research related to the diagnosis of various pathologies. The diagnostic area has a dividing line before and after the introduction of AcMos, either alone or in kits. The target-oriented therapeutic approach provided by the AcMos required another wave of research innovation, creating chimeric or humanized antibodies. There are more than forty FDA-approved AcMos for the treatment of transplant rejection, breast cancer, colorectal cancer, lymphoma, leukemia, multiple sclerosis, among others (Deffar et al., 2009; FDA, 2015; Reichert, 2012).

Peripheral blood B lymphocyte capture technique from individuals infected with HIV (human immunodeficiency virus) was used to obtain monoclonal antibody gene sequences for passive immunotherapy of AIDS patients (acquired immunodeficiency syndrome). that monoclonal antibodies are in experimental clinical use (Tiller et al, 2008; Scheid et al, 2009a, b; Mouquet et al, 2010, 2011; Wardermann et al, 2013; Barbian et al, 2015; Zhou et Al, 2015).

The modern trend is to use monoclonal antibodies in humanized or human form whenever the defined antigen permits such an approach. The possibility exists for tetanus toxin, composed of 3 regions with 150 kDa molecular mass and known mode of action in the interference of communication transmission between inhibitory spinal neurons by blocking the release of inhibitory neurotransmitters. Chinese patent application CN 105153305, published December 16, 2015, on behalf of ANTAGEN BEIJING BIOTECHNOLOGIES CO LTD., Entitled: "FULLY HUMAN MONOCLONAL ANTIBODY AGAINST TETANUS AND DERIVATIVE THEREOF" to a fully human monoclonal antibody against tetanus toxin. The amino acid sequences of a heavy chain variable region and a light chain variable region of the monoclonal antibody are defined in SEQ ID NO: 3 and SEQ ID No. 4, respectively. Preferably, the heavy chain and light chain amino acid sequences of the monoclonal antibody are defined in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. Said Chinese patent application CN 105153305 further describes a method of preparing and applying the fully human monoclonal antibody against tetanus toxin and its derivative. The fully human monoclonal antibody against tetanus toxin provided by said document can eliminate the biological risks of anaphylactic reaction and viral contamination by having a sufficiently long half-life and high titer and in vivo activity that can be applied to large scale industrial production.

However, through the Basic Local Alignment Search Tool (BLAST) program, which was developed to perform searches comparing primary biological sequences against a database containing a gigantic amount of information it was observed that the sequences revealed in the patent application Chinese CN 105153305 have low percent identity with the sequences disclosed in present invention, showing that said Chinese patent application CN 105153305 and the present invention have completely different monoclonal antibodies.

[0024] Chinese Patent Application CN 102453091, published May 16, 2012, on behalf of SHANGHAI INSTITUTE OF BIOLOGICAL PRODUCTS CO., LTD, titled: "TETANUS TOXOID MONOCLONAL ANTIBODY AND PREPARATION METHOD AND APPLICATION THEREOF" discloses an antibody tetanus toxoid monoclonal antibody, a method of preparation and its application, in particular, to a monoclonal antibody against tetanus toxin. A complementarity determining region (CDR) of a monoclonal antibody heavy chain variable region comprises CDR1 shown as SEQ ID NO: 6, CDR2 shown as SEQ ID NO: 8 and / or CDR3 shown as SEQ ID NO: 10; and a light chain variable region CDR of the monoclonal antibody comprises CDR1 shown as SEQ ID NO: 12, CDR2 shown as SEQ ID NO: 14 and CDR3 shown as SEQ ID NO: 16. The invention described in said patent application Chinese CN 102453091 also provides a deoxyribonucleic acid (DNA) molecule to encode the sequence, an expression vector and a host cell.

However, through the Basic Local Alignment Search Tool (BLAST) program it has been observed that the sequences disclosed in Chinese patent application CN 102453091 have low percent identity with the sequences disclosed in the present invention, showing that said Chinese patent application CN 102453091 and the present invention have completely different monoclonal antibodies.

Japanese Patent JPH0257195, published February 26, 1990, in the name of MORINAGA & CO LTD, entitled: "HUMAN TYPE MONOCLONAL ANTIBODY OF ANTI-TETANUS TOXIN" refers to a type of human monoclonal antibody. which has high neutralizing capacity of tetanus toxin. The subject matter described in said document is used for the prevention and treatment of tetanus and being produced stably in a large amount, wherein in the first preparation lymphocytes having high tetanus toxin neutralizing antibody value and forming an IgG-like antibody is collected from human immunized against tetanus toxin (TT). The human lymphocyte derivative is then challenged with an antigen and fused to a parent cell. Next, a cell strain forming the above antibody is selected from the prepared hybridoma and the cell strain is produced.

As can be seen, the monoclonal antibodies of said Japanese patent JPH0257195 are obtained from the hybridoma technique. Said document does not describe any sequence (SEQ ID NO) in the definition of said monoclonal antibodies. Accordingly, Japanese patent JPH0257195 and the present invention have totally different monoclonal antibodies.

Japanese patent JPH1014570, published January 20, 1998, in the name of MATSUDA MORIHIRO and MORINAGA & CO LTD, entitled: "ANTIBODY DNA" refers to obtaining a cDNA containing a specific and useful nucleotide sequence. for antitoxic therapy and prevention of infectious diseases by Clostridium tetani and mass production of a human monoclonal antibody on an industrial scale by a genetic engineering technique. This cDNA, which encodes a variable region of an antibody heavy chain, in particular, encodes a human monoclonal antibody that contains a nucleotide sequence of the formula, is obtained by cloning the cDNA produced from mRNA. taken from a hybridoma [e.g. TTG6 hybridoma (FERM P-15719)]

As can also be seen, the monoclonal antibodies of said Japanese patent JPH1014570 are obtained from the hybridoma technique. Said document does not describe any specific sequence (SEQ ID NO) in the definition of said monoclonal antibodies. Accordingly, Japanese patent JPH1014570 and the present invention have totally different monoclonal antibodies.

European Patent EP 0562132, published September 29, 1993, in the name of MATSUDA MORIHIRO and MORINAGA & CO LTD, entitled: "MONOCLONAL ANTI-TETANUS TOXIN ANTIBODIES AND PHARMACEUTICAL CONTAINING THEM" refers to monoclonal antibodies against tetanus toxin that bind to the tetanus toxin light chain and neutralize the biological activity of tetanus toxin. In addition, binding antitetanus monoclonal antibodies are further disclosed for the tetanus toxin heavy chain fragment C. In addition, pharmaceutical compositions are described containing said monoclonal antibodies. In a preferred embodiment, these pharmaceutical compositions are for passive tetanus immunization.

Said European patent EP 0562132 does not disclose a sequence listing relating to said antibody. Therefore, one of ordinary skill in the art based on the teachings disclosed in European patent EP 0562132 could not be motivated to achieve the defined monoclonal antibody through the sequence listing of the present invention.

Obtaining human monoclonal tetanus antibodies represents a current trend of supplying biologics with consistency of production lots and zero or low immunogenicity. The present invention represents an innovation in the use of infectious disease immunotherapy, which began more than a century ago with the use of hyperimmune sera from immunized animals, and today can rely on biotechnology methods to obtain more consistent and safe immunobiologicals.

As can be seen, none of the prior art documents teach or much less suggest neutralizing tetanus human monoclonal antibodies to C. tetani infection as defined by the specific sequences disclosed by the present invention. Likewise, none of the prior art documents teach or much less suggest the method of obtaining the monoclonal antibodies disclosed by the present invention and their use in immunotherapy for accidents susceptible to tetanus bacilli infection.

SUMMARY OF THE INVENTION

In order to solve the above problems, the present invention will provide significant advantages over obtaining human monoclonal antibodies with neutralizing properties, enabling an increase in their performance and having a more favorable cost / benefit ratio.

The present invention proposes to obtain human monoclonal antibodies with neutralizing properties for the treatment of persons likely to develop tetanus. These are products that can be obtained homogeneously, with batch consistency and without causing immunogenicity.

The monoclonal antibodies of the present invention are obtained from engineering techniques. Genetics based on gene sequence information obtained from peripheral blood B lymphocytes from people immunized with tetanus toxoid. Genetic information is inserted into vectors used for mammalian cell transfection in order to generate cell lines that produce anti-tetanus monoclonal antibodies.

The present invention proposes a novel product which can be obtained homogeneously and consistently from human origin to prevent hypersensitivity and immunogenicity reactions.

The monoclonal antibodies of the present invention have unique nucleotide and amino acid sequences.

In another aspect, the present invention relates to the use of said human monoclonal antibodies for immunotherapy of accidental tetanus infection. Vaccination, although effective, shows decreased protection in the elderly, not recovered by revaccination. Also susceptible to tetanus infection are those injured who have not received a booster vaccine.

In another aspect of the present invention it relates to neonatal tetanus, carried by the umbilical cord cut, where the human monoclonal antibodies of the present invention could be used in infants born with the infection, as other monoclonal antibodies to fight Infectious agents are used in babies.

The neutralizing antibody gene sequences of the present invention will be used for generation of stable antibody producing cell lines, in productivity for staging and production. in bioreactors. The resulting product is an antibody with batch consistency, potency and effectiveness for use in accidents with potential tetanus infection. BRIEF DESCRIPTION OF DRAWINGS

[0042] The structure and operation of the present invention, together with further advantages thereof may be better understood by reference to the accompanying drawings and the following description:

Figure 1 is a flowchart showing the experimental strategy for obtaining the monoclonal antibodies of the present invention;

Figure 2 shows the qualitative ELISA result of antibody tetanus binding, where the antibodies of the present invention were tested at concentrations of 0.4 to 50 ng / mL. High neutralizing donor serum was used to validate the test as a positive control at the initial 1:50 dilution and 1: 5 serial dilutions. Plate sensitized with 100 pL of 5 pg / mL tetanus toxin;

Figure 3 shows the qualitative ELISA result of antibody binding to tetanus anatoxin. Antibodies of the present invention were tested at concentrations of 0.4 to 50 ng / mL. High neutralizing donor serum was used to validate the test as a positive control at the initial 1:50 dilution and 1: 5 serial dilutions. Sensitized plate with 100 pL tetanus anatoxin at 5 pg / mL; and

Figure 4 shows the result of in vivo tetanus toxin neutralization assay of the 243 + 143 + 120 monoclonal antibody mixture. ensured 100% survival of animals when 28 and 14 pg of said antibodies were used; and

Figure 5 shows the ELISA result of monoclonal antibodies 120, 143 and 243 of the present invention for diphtheria anatoxin binding assay. Antibodies tested at concentrations of 0.4 to 50 ng / mL at four 1: 5 serial dilutions. Human polyclonal serum was used as a positive control at the initial 1:50 dilution and 1: 5 serial dilutions. Sensitized plate with 100 pL of 2 pg / mL diphtheria anatoxin.

DETAILED DESCRIPTION OF THE INVENTION

Although the present invention may be susceptible to different embodiments, it is shown in the drawings and the following detailed discussion, a preferred embodiment with the understanding that the present embodiment should be considered an exemplification of the principles of the invention and is not intended to limit the present invention. invention as illustrated and described herein.

In a first aspect the present invention proposes to obtain human monoclonal antibodies with neutralizing properties for the treatment of persons likely to develop tetanus. These are products that can be obtained homogeneously, with batch consistency and without causing immunogenicity.

The monoclonal antibodies of the present invention are obtained from genetic engineering techniques based on gene sequence information obtained from peripheral blood B lymphocytes from persons immunized with tetanus toxoid. Genetic information is inserted into vectors used for mammalian cell transfection to generate strains cells producing anti-tetanus monoclonal antibodies.

In a second aspect the present invention proposes a novel product which can be obtained homogeneously and consistently from human origin to avoid hypersensitivity and immunogenicity reactions.

In another aspect, the present invention relates to the use of said human monoclonal antibodies for immunotherapy of accidental tetanus infection. Vaccination, although effective, shows diminished protection in the elderly, not recovered by revaccination. Also susceptible to tetanus infection are those injured who have not received a booster vaccine.

The neutralizing antibody gene sequences of the present invention will be used for generation of stable antibody-producing cell lines, in productivity for staging and production in bioreactors. The resulting product is a batch, potency, and effectiveness antibody for use in accidents with potential tetanus infection. The deployment of the human monoclonal antibody technology demonstrated in the present invention will open the way for the treatment of tetanus, as well as other infectious diseases such as diphtheria, rabies, zika, etc.

The tetanus vaccine is always given together with diphtheria (DT). In view of this, the antibodies of the present invention have been tested against diphtheria toxin and are unique against tetanus toxin.

PREFERRED EMBODIMENT OF THIS INVENTION

The present invention is based on the cloning and expression of immunoglobulin producing genes obtained directly from human B lymphocytes. By this technique, the immunoglobulin variable domain genes of a single human antibody-producing B lymphocyte are amplified and cloned into an expression vector upstream of the respective human constant region (heavy or light).

Thus, upon transfection, eukaryotic cells will produce an entire antibody molecule of identical structure to human. Antibody production by this methodology requires the collection of blood from donors that have circulating B cells against a given antigen and the purified antigen for identification of these cells by immunophenotyping.

[0060] The present invention has the objective of obtaining tetanus human monoclonal antibodies by capturing specific antibody-producing B lymphocytes using the antigen or by separating plasmablasts after vaccination enhancement. Cell separation from donors was performed by cell sorter equipment, which deposited a specific B cell in each well in 96 wells. The antibody variable regions were amplified and cloned into expression vectors that were used to transiently transfect HEK293-F cells. For the capture of rare specific B lymphocytes different strategies of labeling and cell sorting were used.

The use of independently conjugated tetanus toxin with two different markers, biotin and Alexa Fluor ^® 647, made possible the specific separation of tetanus-producing B lymphocytes, which were evaluated by ELISA, western blotting and inhibition of toxin binding. to GTlb ganglioside. The in vivo assay showed total protection of the animals when three monoclonal antibodies were used together, neutralizing the tetanus binding toxin and protecting the antigen challenged animals in an experiment in which polyclonal horse serum was used as a control.

The process of obtaining the monoclonal antibodies of the present invention is shown in Figure 1, and comprises the following steps:

1. Blood collection from donors with high tetanus toxin neutralizing antibody titers; 2. Separation of blood tetanus antibody-producing B lymphocytes from tetanus-vaccinated human volunteers;

3. Amplification of antibody variable regions of cells separated by cell sorting;

4. Cloning sequences in mammalian cell expression vectors;

5. Expression of recombinant antibodies, purification and use in activity testing. Peripheral blood mononuclear cells (PBMC) from six adult donors were isolated. The experiments related to the present invention were approved by the Research Ethics Committee Involving Human Beings of ICB from USP and the Pro-Blood Foundation, where blood bags were collected. From some, blood was collected different times after vaccination, from others blood was collected days after booster vaccination.

The in vivo neutralization test was performed according to the method used by the Butantan Institute Quality Control and the Brazilian Pharmacopoeia (Brazil 2010), in a project approved by the Butantan Institute Animal Use Ethics Committee.

Swiss mice of both sexes, between 17 and 22 grams, were used. In all, 250 animals from the Butantan Institute Biotery were divided into five experimental groups with 50 animals: one control with reference tetanus serum and four test groups. Each antibody was tested at five dilutions, 10 animals for each dilution.

Step 1 - Separation of blood tetanus antibody-producing B lymphocytes from tetanus-vaccinated human volunteers

Several sortings were performed with donor mononuclear cells (PBMC) to target single cell mode B lymphocyte separation by the use of immunophenotyping.

Isolated cells were used for PCR and gene sequencing of the light and heavy variable regions of the antibodies. Strategies for capturing B lymphocytes varied to obtain specific antibodies. The strategies have been refined for rare cell capture.

- Sorting 1 - biotin-conjugated tetanus toxoid was used.

- Sorting 2 - cells were separated by CD19 + / Streptavidin + phenotype.

- Sorting 3 - B lymphocytes were enriched from about 100x10 ⁶ PBMC.

- Sorting 4 - cells were collected after the donor received the dT vaccine booster.

- Sorting 5 - This sorting was performed with cells collected after the donor received the dT vaccine booster.

- Sorting 6 - cells collected after booster vaccination by CD19 ⁺ IgG ⁺ TxT ^Du P ^{l0 +} phenotype.

- Sorting 7 - same condition as sorting 6.

- Sorting 8 - cells collected after booster vaccination. The marking was done directly with about 100 x 10 ⁶ PBMCs without previous enrichment.

- Sorting 9 - Cells with CD19 ⁺ CD27 ⁺⁺ phenotype were separated into the wells. No tetanus antigen was used for labeling.

- Sorting 10 - Cell sorter was separated from cells after dT vaccine booster.

Table 2 shows the number of gene pairs obtained for the strategies used.

Table 2: Antibody pairs obtained in the sortings of cells separated with tetanus toxin and plasmablasts.

H + L pairs

Cells

Sorting Amplifieds

separated

Kappa Lambda

# 6 Linf. B memory 20 17 3

26

# 7 Linf. B memory

18 8

59

# 8 Linf. B memory

55 4

28

# 9 Plasmablasts

15 13

84

# 10 Plasmablasts

65 19

Step 2- Amplification of antibody variable regions of cells sorted by cell sorting

Reverse transcription was performed on the same plate where cells were separated by cell sorting. Controls performed in wells where there was no cell were: two negative controls with 1 pL of water added, one reverse transcription control with purified HeLa RNA and one PCR control of the variable regions containing 1000 B lymphocytes that had been previously separated.

To each well was added 3.5 pL of solution containing 0.5 pL of 300 ng / pL (150 ng) random hexameric oligonucleotides, 0.5 pL of 10% Igepal CA-630 (Sigma-Aldrich) in water, 6 U RNAsin ^® (Promega) (0.15 pL to 40 U / pL) and 2.35 pL sterile type 1 water. The 3.5 pL volume was distributed to each well using homogenized multichannel micropipetator and tip exchange to each column. The plate was sealed, rapidly centrifuged, incubated at 68 ° C for 60 seconds in the Mastercycler Nexus Gradient thermal cycler (Eppendorf, Hamburg, Germany) and immediately placed and kept on ice. They were added to each well 7 pL solution containing 3 æl of the enzyme reverse transcriptase SuperScript ^® buffer III (Invitrogen) 5-fold concentrated with 15 mM MgCl2, 12.5 nmols of each dNTP (0.5 pL of 25 mM solution of each dNTP), 100 nmols DTT (1 pL 100 mM DTT), 8 U RNAsin® ( Promega) (0.2 pL to 40 U / pL), 50 U of SuperScript ^® III reverse transcriptase enzyme (Invitrogen) (0.25 pL to 200 U / pL) and 2.05 pL of sterile type 1 water. The 7 pL volume was distributed to each well using homogenized multichannel micropipetator and nozzle changes to each column. The plate was sealed and centrifuged rapidly. The reaction occurred at 42 ° C for 5 min, 25 ° C for 10 min, 50 ° C for 60 min, 94 ° C for 5 min and finally held at 4 C. The obtained cDNA was aliquoted into four 96 - well plates new (3 pL per well), respecting the initial address of each well in the plate. Each plate was used for independent amplification of the variable regions of the heavy, light kappa, light lambda, and the β-actin control.

The reactions were performed with a nested PCR protocol, with the first reaction with the cDNA aliquoted on each plate. The components (Oligonucleotide 5 '/ Oligonucleotide Mixture 5' 50 pM, Oligonucleotide 3 '50 pM, MgCl2, dNTP, HotStarTaq® Plus DNA Polymerase and Sterile Water Type 1 qsp) were added to each well (final volume of 40 pL), the plate was sealed and the reaction performed with enzyme activation for 5 min at 95 ° C, followed by 50 cycles of 94 ° C for 30 s, 58 ° C (IgD / Igic / p-actin) or 60 ° C (IgA) for 30 s, 72 ° C for 55 s, and final extension at 72 ° C for 10 min. The second reaction (nested) was performed in another 3.5 pL plate of the first PCR product transferred with multichannel micropipetator respecting the initial position of each well and the components described above, in a final volume of 40 pL. The condition was: 5 min at 95 ° C, followed by 50 cycles of 94 ° C for 30 s, 58 ° C (IgH / IgK) or 60 ° C (IgÀ) for 30 s, 72 ° C for 45 s, and final extension at 72 ° C for 10 min. Reactions were performed on GeneAmp ^® PCR 9700 thermal cyclers (Applied Biosystems, Foster City, CA, USA) and Mastercycler Nexus Gradient (Eppendorf, Hamburg, Germany). The oligonucleotides used are described in the following table. Oligonucleotides used in amplifying immunoglobulin chain variable regions

Name of

Step Sequence of oligonucleotide 5'-oligonucleot d

3 'PCR

it's the

5 'L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG

5 'L-VH 3 AAGGTGTCCAGTGTGARGTGCAG

5 'L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG

I ^a

5 'L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG

Reaction

5 'IGHV1,7-X1 ATGGACTGGACCTGGAG

o - 5 'IGHV1-X1- Chain TCCTCTTTGTGGTGGCAGCAGC

041

The

5 'IGHV2-X1-weight TCCACGCTCCTGCTRCTGAC

036

The

5 'VH3 Leader- TAAAAGGTGTCCAGTGT Range

THE

5 'RM-IGHV4-X1 ATGAAACACCTGTGGTTCTTCC

3 'Cy CHI GGAAGGTGTGCACGCCGCTGGTC

2 ^to 5 'RMX2-A AGGTGCAGCTGCTGGAGTCKGG

Reaction

The -

3 'IgG

Chassis GTTCGGGGAAGTAGTCCTTGAC

Internai

The

heavy

lambd CTGCTACCGGTTCTCTCTCSCAGCYTGTGCTGAC

5 'Agel νλ 4/5

the TCA

CTGCTACCGGTTCTTGGGCCAATTTTATGCTGAC

5 'Agel νλ 6

TCAG

CTGCTACCGGTTCCAATTCYCAGRCTGTGGTGAC

5 'Agel νλ 7/8

YCAG

3 'Xhol CÀ CTCCTCACTCGAGGGYGGGAACAGAGTG

Source: BOSCARDIN (2013); WARDEMANN; KOFER (2013)

Control with β-actin was done in a single reaction with oligonucleotides.

5 'ηβ-actin 5' GAACCCCAAGGCCAACCGCGA and 3 'ηβ-actin 5' CACGCACGATTTCCCGCTC.

All samples were analyzed on 2% agarose gel with SyBr Safe (Invitrogen) and visualized using the Safe Imager ™ transilluminator (Invitrogen) and Gel Logic 112 photo-documenting system (Carestream). The expected size of the fragments was: 450 bp for I gD, 510 bp for I gx, 405 bp for IgA and 302 bp for β-actin.

[0073] Quantification of PCR products was performed on 2% agarose gel containing ^® SYBR Safe DNA Gel Stain (Invitrogen) to run in parallel with quantitative mass low DNA mass marker (Invitrogen). The analysis was performed using Carestream Molecular Imaging software according to the manufacturer's manual, identifying the quantitative mass marker bands, generating the standard curve and determining the DNA mass of the bands of each applied sample. Sequencing was performed on all amplified heavy chain and light chain fragments in whose well there was amplification of the heavy / light chain pair. Samples were purified with ExoSAP-IT ^® (Affymetrix) by mixing 5 pL PCR products and 2 pL ExoSAP-IT and incubating for 15 min at 37 ° C, followed by 15 min at 80 ° C.

Sequencing was done using the BigDye Kit (Applied Biosystems) in 3500 Genetic Analyzer Sequencer (Applied Biosystems, Foster City, CA, USA) with about 20 ng of DNA, along with 1.6 pmol of oligonucleotide 3 'from nested reaction of the respective chain. For the lambda chain a sequence-specific oligonucleotide, 3'ÀSeq -5 'ACTCGAGGGYGGGAACAGAGTG was synthesized. The reaction condition was: 40 cycles at 96 ° C for 10 s, 52 ° C for 20 s and 60 ° C for 4 min.

Sequence analysis was performed using the IgBlast database (http: // www. Ncbi. Nlm. Nih. Gov / igblast /) with the Kabat V domain delineation system. This analysis provides the classification of the V (D) J segments according to the highest identity with the germline sequences, besides the number and location of the somatic mutations. The CDR3 sequence was determined by counting amino acid residues subsequent to the framework 3 region to the tryptophan glycine (WG) motif conserved in the heavy chain sequences or the phenylalanine glycine (FG) motif in the light chain sequences (WARDEMANN; Kofer, 2013).

The heavy and light chains were paired as originally formed the corresponding pair.

Step 3- Cloning of sequences in mammalian cell expression vectors. An aliquot of chemocompetent Escherichia coli DH5 bacteria (Invitrogen) was plated on LB / agar medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 1.5% agar) and incubated at 37 ° C for 16-18 hours. One colony was inoculated into 10 mL of liquid LB medium for 16-18 hours at 37 ° C under 200 RPM shaking. 0.4 mL volume of the suspension was inoculated into 200 mL of liquid LB medium containing 40 mM glucose and 10 mM MgCl2 and incubated at 37 ° C with 200 RPM shaking until D0 ₆ to 0.8-0. 9

The culture was subdivided into tubes that were kept on ice for 20 min and then centrifuged at 2500 xg for 20 min at 4 ° C. The supernatant was discarded and the cells resuspended in 50 mL of ice-cold sterile 0.1 M MgCl2. It was incubated on ice for 20 min and centrifuged as indicated above. The pellet was resuspended in 25 mL of sterile ice-cold 0.1 M CaCl2, incubated on ice for 20 min and centrifuged as described. Finally, the bacteria were resuspended in 2.4 mL of sterile, ice-cold 0.1 M CaCl2 and the addition of 0.6 mL glycerol. After homogenization, the suspension was aliquoted in microtubes in an ice / ethanol bath and stored in the -80 ° C freezer. Transformation efficiency was determined using a control plasmid.

Vectors used for cloning and expression of antibodies were kindly provided by Dr. Hedda Wardemann of the Max Plank Institute. Each vector contains the sequence coding for the constant region of one of the human immunoglobulin chains: heavy γΐ, κ or λ. Upstream of the constant region is the cloning site for amplified variable chain insertion in the specific PCR (Tiller et al, 2008). The vectors were transformed into chemocompetent E. coli DH5 bacteria by mixing 2 ng of each vector (in 1 µl volume) independently into 10 µl of the bacterial suspension. The suspensions were incubated on ice for 30 min, followed by heat shock at 42 ° C for 45 min and again incubating on ice for 5 min. 100 µl SOC medium (20 g / L tryptone, 5 g / L yeast extract, 500 mg / L NaCl, 2.5 mM KCl, 10 mM MgCl ₂ and 20 mM glucose) were added to the bacteria suspension and incubated. for one hour at 37 ° C while stirring at 180 RPM. The entire suspension was inoculated on a LB / agar / ampicillin plate (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 1.5% agar, 100 pg / mL ampicillin) and incubated. at 37 ° C for 16-18 hours. One colony from each vector was individually inoculated into 4 mL TB / ampicillin medium (Terrific Broth - Tryptone 12 g / L, yeast extract 24 g / L, glycerol 4 mL / L, 17 mM KH ₂ P0 ₄ , K ₂ HP0 ₄ 72 mM, 75 pg / ml ampicillin) and incubated at 37 ° C for 16-18 hours under shaking at 200 RPM. Each suspension was divided into two 2 mL aliquots and were used for vector isolation using the Wizard ^® Plus SV Miniprep DNA Purification Kit (Promega). The concentration and purity of the vectors were determined by spectrophotometry at 260/280 nm.

Vectors were digested with their respective enzymes to be linearized:

[0083] plgD - SalI-RF and Agel-HF enzymes (NEB - New England Biolabs)

PgK - Agel-HF and BsiWI (NEB) enzymes

[0085] plgÀ - enzymes Xhol-EF and Agel (NEB)

Digestions were sequential, in the order described above with each enzyme at a ratio of 2 U / pg DNA for Agel and BsiWI enzymes and 10 U / pg for Sall enzymes and Xhol. Digestion was carried out for four hours at 37 ° C for Agel, Sall and Xhol and 55 ° C for BsiWI. The digested vectors were purified by agarose gel electrophoresis and Wizard ^® SV Gel and PCR Clean-Up System kit (Promega).

RT-PCR samples from the selected wells after analysis of the variable chain sequences were subjected to PCR with specific oligonucleotides. This step served to amplify the fragment with an oligonucleotide at each end, avoiding the insertion of mutations, and adding restriction sites for cloning into expression vectors. The first PCR product was used as a template with 5 'and 3' oligonucleotides specific for the V and J genes, respectively, containing specific restriction site.

Oligonucleotides used in specific PCR

Jail

Sequence Name of Amplified Oligonucleotide

5'-3 'oligonucleotide

The

5 'Agel VH 1/4/6 CTGCAACCGGTGTACATTCC [FRW1] 5' Agel VH 3/7 CTGCAACCGGTGTACATTCT [FRW1] 3 'Sall JH TGCGAAGTCGACGCTGAGGAGACGGTGAC

Jail

1/2/4/5 CAG

heavy

TGCGAAGTCGACGCTGAAGAGACGGTGAC

Range 3 'Sall JH 3

CATTG

TGCGAAGTCGACGCTGAGGAGACGGTGAC

3 'Sall JH 6

CGTG

5 'Agel VK

CTGCAACCGGTGTACAT [FRW1]

Specific chain

lightweight kappa GCCACCGTACGTTTGATYTCCACCTTGGT

3 'BsiWI Jk 1/4

Ç GCCACCGTACGTTTGATCTCCAGCTTGGT

3 'BsiWI Jk 2

Ç

GCCACCGTACGTTTGATATCCACTTTGGT

3 'BsiWI Jk 3

Ç

GCCACCGTACGTTTAATCTCCAGTCGTGT

3 'BsiWI Jk 5

Ç

CTGCTACCGGTTCCTGGGCCCAGTCTGTG

5 'Agel VÀ 1

CTGACKCAG

CTGCTACCGGTTCCTGGGCCCAGTCTGCC

5 'Agel VÀ 2

CTGACTCAG

CTGCTACCGGTTCTGTGACCTCCTATGAG

5 'Agel VÀ 3

CTGACWCAG chain

lightweight CTGCTACCGGTTCTCTCTCSCAGCYTGTG

5 'Agel VÀ 4/5

lambda CTGACTCA

CTGCTACCGGTTCTTGGGCCAATTTTATG

5 'Agel VÀ 6

CTGACTCAG

CTGCTACCGGTTCCAATTCYCAGRCTGTG

5 'Agel VÀ 7/8

GTGACYCAG

3 'Xhol CÀ CTCCTCACTCGAGGGYGGGAACAGAGTG

Underlined regions correspond to restriction sites. Source: WARDEMANN & KOFFER (2013).

Following specific PCR, amplification of the samples was confirmed by 2% agarose gel electrophoresis. The obtained fragments were purified with QIAquick ^® 96 PCR Purification Kit (Qiagen) according to the manufacturer's instructions, eluted with 60 pL of sterile type 1 water, digested with restriction enzymes whose sites were inserted during specific PCR, and cloned. expression vectors containing the constant regions of each antibody chain.

If the amplified fragment contained Following the restriction site of the enzymes used (verified prior to digestion via the site http: // www. restrict ionmapper. org / index. html), the enzyme was partially digested with serial enzyme dilutions and incubation by 2 min at the specific enzyme temperature (CAMPEAU, 2009).

Following digestion, the PCR products were further purified with QIAquick ^® 96 PCR Purification (Qiagen) and eluted with 60 µl of sterile type 1 water.

Binding of the fragment to the vector was done in a total volume of 10 pL with 8 pL of the digested and purified specific PCR product, 0.5 pL of the respective linearized vector at

50 ng / pL, 1 pL T4 DNA ligase enzyme buffer (NEB) and 0.5 pL T4 DNA ligase enzyme 400 U / pL (NEB). Incubation was two hours at 23 ° C. Transformation was performed as described in 3.11.2 using 10 µl of the chemocompetent bacteria suspension and 4.5 µl of the ligation product. The obtained colonies were screened by PCR.

Three colonies of each plate were tested for the presence of the insert. Screening was by PCR using oligonucleotides that anneal in the leader region upstream of the cloning site and in the constant region of the respective chain.

The PCR mixture used contained for each reaction: 125 pM of each dNTP, 400 nM of 5 'oligonucleotide, 400 nM of 3' oligonucleotide, 1.5 mM of MgCl2 and 1 U of recombinant Taq DNA polymerase ( Invitrogen) in 25 pL reaction. Oligonucleotides used to verify presence of insert in expression vector Sequence of

Oligonucleotide Name

5'-3 'oligonucleotide

5 'Ab sense GGTTCGTTAGAACGCGGCTAC

3 'IgG (intern) - for chain

GTTCGGGGAAGTAGTCCTTGAC

□

3 'CK 494 - for chain κ GTGCTGTCCTTGCTGTCCTGCT

CACCAGTGTGGCCTTGTTGGCTT

3 'CK - for chain λ

G

Source: WARDEMANN & KOFFER (2013).

The mixture was distributed into wells of a 96-well PCR plate. Using a sterile micropipette tip, an isolated colony was removed with the tip and transferred to a spare LB / agar / ampicillin petri dish. Then, the nozzle was immersed in the aliquoted PCR mixture in the 96-well plate. The petri dish was incubated at 37 ° C for 16-18 hours and stored in the refrigerator. The PCR reaction was as follows: 5 min 94 ° C; 27 cycles of 94 ° C for 30 s, 58 ° C for 30 s, 72 ° C for 60 s; and final extension at 72 ° C for 10 min. The PCR products were analyzed by 2% agarose electrophoresis, whose expected sizes were: 650 bp for IgD1, 700 bp for IgK and 590 bp for IgÀ. The positive fragments were purified with ExoSAP-IT (Affymetrix) and sequenced as described above. The oligonucleotide used for sequencing was 5 'Absense.

Sequences obtained from colony PCR were compared to those obtained from RT-PCR using the BLAST two or more sequence alignment tool (bl2seq - Align Sequence Nucleotide BLAST). The identity of the sequences was verified, disregarding the regions of oligonucleotide annealing and the colony containing the vector with the variable sequence identical to that obtained from RT-PCR was determined.

A portion of the selected colony was collected from the spare plate and inoculated into 4 mL of TB medium. The vector was isolated from one of the 2 mL aliquots of the bacterial suspension and the other was frozen after centrifugation at 10,000 xg for 5 min and removal of the supernatant. Isolation was performed with Wizard ^® Plus SV Miniprep DNA Purification kit (Promega) and concentration and purity determined by spectrophotometry at 260/280 nm.

Step 3- Transient Expression of Recombinant Antibodies

Antibody expression was done with transient cotransfection of the heavy and light chain vector corresponding to the pair obtained from the same well in RT-PCR.

FreeStyle ™ 293-F HEK 293f cells (Invitrogen) were cultured in suspension in FreeStyle ™ 293 Expression Medium (Invitrogen) in a 37 ° C greenhouse with 8% CO2 and shaking at 120 RPM. On the day prior to transfection, the suspension was prepared in a volume of 30 mL of suspension for each antibody to be transfected at a concentration of approximately 0.5 x ¹⁰⁶ cells / mL. On the day of transfection, the suspension was aliquoted in 30 mL volume in 125 mL conical flasks at a concentration between 0.9 and Ι, ΙχΙΟ ⁶ cells / mL for each antibody to be transfected.

The transfection DNA solution was prepared in final volume of 1.5 ml PBS. Initially, 30 pg of the vectors [15 pg each (heavy and light chain)] were added to PBS volume and incubated for 5 minutes at room temperature. 103 µl of stock solution was added. Polyethylenimine - PEI (Sigma-Aldrich) at 0.45 mg / ml and vortexed for 15 seconds and incubated again for a further 10 min at room temperature protected from light before dripping onto the cell suspension that was maintained. in cultivation for 72 hours. The supernatant was collected after centrifugation at 800 xg for 10 min in tube centrifuge (Sorvai Legend RT, Newtown, CT, USA).

Antibodies were purified by protein A affinity chromatography using the ÀKTA Purifier system (GE Healthcare, Sweden). The filtered supernatant was applied to the protein A-sepharose column (GE Healthcare, Sweden) equilibrated with 20 mM phosphate buffer pH 7. The column was washed with the same buffer. The first elution was made with 100 mM sodium citrate buffer pH 6 and the second with 100 mM sodium citrate buffer pH 3.2 for recovery of AcMos. The collected sample was neutralized with sufficient 1 M Tris solution. The purified and neutralized antibody was dialyzed against PBS and sterilized by filtration.

The concentration of each antibody was determined by absorbance at 280 nm using the coefficient A _0.1 % = 1.4.

With the modifications to the protocols it was possible to obtain clonally related sequences. Analysis of the repertoire of the VH fragments of the obtained antibodies and the somatic mutations. The most represented segments in the three donors are from the VH3 family, followed by V _H 1 and V _H 4.

Antibodies were tested for binding to available forms of the antigen: tetanus toxin and anatoxin, recombinant tetanus toxin fragment C. Figures 2 and 3 show the binding curves of antibodies against TxT and AnT.

Figure 2 shows the result of qualitative ELISA binding of antibodies to tetanus toxin, where antibodies of the present invention were tested at concentrations of 0.4 to 50 ng / ml. Donor serum was used to validate the test as a positive control at the initial 1:50 dilution and 1: 5 serial dilutions. The plate was sensitized with 100 µl of 5 pg / ml tetanus toxin;

Figure 3 shows the qualitative ELISA result of antibody binding to tetanus anatoxin. Antibodies of the present invention were tested at concentrations of 0.4 to 50 ng / mL. Donor serum was used to validate the test as a positive control at the initial 1:50 dilution and 1: 5 serial dilutions. The plate was sensitized with 100 pL of 5 pg / mL tetanus anatoxin.

Interaction of antibodies with tetanus toxin was tested by western blotting after SDS-PAGE in reduced and unreduced form. They were also tested for inhibition of toxin binding to the ganglioside GTlb. In vivo binding between TxT and GTlb is required for internalization of TxT in the neuron and generation of toxic effects.

Western blotting results were analyzed together with ELISA and GTlb binding inhibition assay results for the choice of some antibodies for in vivo animal assays to determine the ability of antibodies to tetanus toxin to be neutralized. recombinant humans.

[00109] The trial was conducted at the Butantan Institute Infectory, with the permission of the Ethics Committee for Use. Institute of Animals, according to the protocol described in the Brazilian Pharmacopoeia (Brazil 2010). Four antibody groups were tested:

Mixture of BUT-TT-120, BUT-TT-143 and BUT-TT-243 antibodies. All three antibodies interacted with the tetanus toxin in the ELISA, and in the western blotting assay had different responses: heavy chain binding, whole toxin and light chain, respectively.

Mixtures of the same amount of each antibody were prepared, tested on 50 animals in five groups of 10 mice for five dilution testing.

Composite mixtures of tetanus toxin were prepared at the same concentration and different amounts of the antibodies tested. After incubation at 37 ° C for one hour, 200 µl of each mixture was applied subcutaneously to 10 animals, which were kept under observation for 96 hours, during which time the number of healthy, dead or tetanus symptoms mice was verified.

Figure 4 shows the result of tetanus toxin neutralization assay in vivo: In D, mixture of BUT-TT-120, BUT-TT-143 and BUT-TT-243 antibodies. Mixing of the AcMos ensured the survival of 100% of the animals when 28 and 14 pg of antibodies were used, being able to neutralize the toxic action of tetanus toxin, ensuring the survival of all animals in the groups with 28 and 14 pg of antibody.

Obtaining human monoclonal antibodies has great biotechnological importance, being biopharmaceuticals with valuable therapeutic potential due to the low probability of immunogenic response.

[00115] With the present invention it has been possible to obtaining neutralizing human antibodies to tetanus toxin by modifying the labeling and capture protocols of the tetanus antibody-producing B lymphocytes and the strategy of gating establishment in the sortings, due to the low probability of tetanus memory B cells in the peripheral blood.

The proposed strategy of tetanus toxin separation and conjugation with two markers, Biotin, for capture with Streptavidin-PerCP-Cy ™ 5.5 and Alexa Fluor® 647, had two objectives:

- select relevant antibody-producing lymphocytes against toxin epitopes (for using the appropriate antigen) and

- increase the specificity of identification of tetanus antibody-producing cells (by decreasing the background of identifying the rare population of specific lymphocytes).

The strategy ensured obtaining clonally related sequences, suggestive of antigen selection.

Also indicative of the specificity of labeling was the smaller number of wells with one cell obtained when labeling with the conjugated toxins, compared to the sortings made with the initial strategies.

Generally, antibodies obtained from tetanus toxin labeling or from plasmablasts recognized the antigen in the assays performed.

[00120] The repertoire of VH segments detected in the sequences obtained seems to agree with that observed in other tetanus immunized donors (De Kruif et al., 2009), in addition to other diseases such as AIDS (Scheid et al., 2009a) and West Nile fever (Throsby et al., 2006), where the VH sequence classification of most antibodies were from families 1, 3 and 4, which correspond to the families with the largest number of representatives on chromosome 14 locus [17 segments of family VH I, 4 of VH2, 51 of VH3, 13 of VH4, 3 of VH5, 1 of VH6 and 6 of VH7 95 segments (Cook et al; 1995)].

[00121] The amount of somatic mutations detected in the variable regions was also similar to that observed in human anti-HIV AcMos (Scheid et al., 2009a).

There was agreement on the interaction of antibodies in ELISAs, and those who interacted with TxT also did so with AnT.

The three mAbs obtained in the present invention (243, 143 and 120) and which mixed protected Swiss mice against the action of TxT interact at different sites on the toxin, according to the western blotting result: heavy chain, light chain to whole toxin, does not reduce going.

It seems to be a consensus in the art to show that mixing more than one monoclonal antibody has a neutralizing effect, even if not individually, or that a larger amount of AcMo would be required to achieve the same effect.

Volk et al. (1984) showed that the combination of monoclonal antibodies was about two orders of magnitude more efficient in toxin neutralizing capacity than individually tested AcMos at equivalent concentration (total antibody concentration). It is proposed that, to keep the toxin neutralized, the antibody should be in quantity to avoid dissociation between AcMo and TxT.

According to the law of mass action, when in equilibrium, association and dissociation between antigen and antibody occurs, and if a toxin molecule becomes free, it will be available to perform its toxic function.

Thus, when mixed, two or more monoclonal antibodies can have synergistic effect and prevent release of free toxin to exert its toxic function.

However, it is necessary to consider that most of the prior art studies obtained anti-itetanic monoclonal antibodies from murine hybridomas after immunization and collection of spleen cells.

The monoclonal antibodies of the present invention were obtained from human peripheral blood cells after immunization. It has been shown that in humans, the frequency of antitetanic antibody-producing memory cells is higher in secondary lymphoid organs such as tonsils rather than in peripheral blood (Cao et al., 2010). Obtaining the Monoclonal Antibodies of the present Invention

Monoclonal Antibody 1-BUT-TT-120-VL

SEQ ID NO 1: BUT-TT-120 light chain variable region nucleotide sequence

SEQ ID NO 2: BUT-TT-120 antibody light chain variable region amino acid sequence Primers used:

Sequence Amplification:

PCR 1

5 'L-Vkl / 2 ATGAGGSTCCCYGCTCAGCTGCTGG 5 'L-Vk3 CTCTTCCTCCTGCTACTCTGGCTCCCAG

5 'L-Vk4 ATTTCTCTGTTGCTCTGGATCTCTG

3 'Ck543 GTTTCTCGTAGTCTGCTTTGCTCA

PCR 2

5 'Pan-Vk ATGACCCAGWCTCCABYCWCCCTG

3 'Ck494 GTGCTGTCCTTGCTGTCCTGCT

• Cloning

Monoclonal Antibody 1-BUT-TT-120-VH

SEQ ID NO 3: BUT-TT-120 antibody heavy chain variable region nucleotide sequence

SEQ ID NO 4: BUT-TT-120 antibody heavy chain variable region amino acid sequence Primers used:

Sequence Amplification

5 'L-VH1 ACAGGTGCCCACTCCCAGGTGCAG

5 'IGHV1,7-X1 ATGGACTGGACCTGGAG

5 'IGHV1-X1-041 TCCTCTTTGTGGTGGCAGCAGC

5 'IGHV2-X1-036 TCCACGCTCCTGCTRCTGAC

5'5'L-VH3 AAGGTGTCCAGTGTGARGTGCAG

5'VH3 Leader-A TAAAAGGTGTCCAGTGT

5 'L-VH4 / 6 CCCAGATGGGTCCTGTCCCAGGTGCAG

5 'RM-IGHV4-X1 ATGAAACACCTGTGGTTCTTCC

5 'L-VH5 CAAGGAGTCTGTTCCGAGGTGCAG

3 'Cg CHI (gamma) GGAAGGTGTGCACGCCGCTGGTC

PCR 2

5 'RMX2-A AGGTGCAGCTGCTGGAGTCKGG 3 'IgG-internal GTTCGGGGAAGTAGTCCTTGAC

• Cloning

5 'Agel VH4-39 CTGCAACCGGTGTACATTCCCAGCTGCAGCTGCAGGAG

3 'Sall JH 1/2/4/5 TGCGAAGTCGACGCTGAGGAGACGGTGACCAG

Monoclonal Antibody 2-BUT-TT-143-VL

SEQ ID NO 5: BUT-TT-143 antibody light chain variable region nucleotide sequence

SEQ ID NO 6: BUT-TT-143 antibody light chain variable region amino acid sequence

Primers Used:

Sequence Amplification:

PCR 1

• Cloning:

Monoclonal Antibody 2-BUT-TT-143-VH

SEQ ID NO 7: BUT-TT-143 antibody heavy chain variable region nucleotide sequence

SEQ ID NO 8: BUT-TT-143 antibody heavy chain variable region amino acid sequence Primers used:

• Sequence Amplification:

PCR 1: 5 'L-VH1 ACAGGTGCCCACTCCCAGGTGCAG

5 'IGHV1,7-X1 ATGGACTGGACCTGGAG

5 'IGHV1-X1-041 TCCTCTTTGTGGTGGCAGCAGC

5 'IGHV2-X1-036 TCCACGCTCCTGCTRCTGAC

5'5'L-VH3 AAGGTGTCCAGTGTGARGTGCAG

5'VH3 Leader-A TAAAAGGTGTCCAGTGT

5 'L-VH4 / 6 CCCAGATGGGTCCTGTCCCAGGTGCAG

5 'RM-IGHV4-X1 ATGAAACACCTGTGGTTCTTCC

5 'L-VH5 CAAGGAGTCTGTTCCGAGGTGCAG

3 'Cg CH1 (gamma) GGAAGGTGTGCACGCCGCTGGTC

PCR 2

5 'RMX2-A AGGTGCAGCTGCTGGAGTCKGG

3 'IgG-internal GTTCGGGGAAGTAGTCCTTGAC

• Cloning:

5 'Agel VH3-33 CTGCAACCGGTGTACATTCTCAGGTGCAGCTGGTGGAG

3 'Sall JH 3 TGCGAAGTCGACGCTGAAGAGACGGTGACCATTG

Monoclonal Antibody 3-BUT-TT-243-VL

SEQ ID NO 9: BUT-TT-243 antibody light chain variable region nucleotide sequence

SEQ ID NO 10: BUT-TT-243 antibody light chain variable region amino acid sequence Primer sequence:

• Sequence Amplification:

PCR 1

PCR 2 5 'Pan-Vk ATGACCCAGWCTCCABYCWCCCTG

3 'Ck494 GTGCTGTCCTTGCTGTCCTGCT

• Cloning:

Monoclonal Antibody 3-BUT-TT-243-VH

SEQ ID NO 11: BUT-TT-243 antibody heavy chain variable region nucleotide sequence

SEQ ID NO 12: BUT-TT-243 antibody heavy chain variable region amino acid sequence Primers used:

• Sequence Amplification:

PCR 1:

• Cloning: CTGCAACCGGTGTACATTCCCAGGTGCAGCTGGTGCA

5 'Agel VH1 G

3 'Sall JH 1/2/4/5 TGCGAAGTCGACGCTGAGGAGACGGTGACCAG

Monoclonal antibodies of the present invention

The monoclonal antibodies of the present invention were obtained from human peripheral blood cells of immunized individuals. It has been shown that in humans, the frequency of anti-tetanus antibody-producing memory cells is higher in secondary lymphoid organs, such as tonsils, rather than in peripheral blood (Cao et al., 2010).

1) l-BUT-TT-120 Monoclonal Antibody

The human tetanic antitoxin monoclonal antibody 1-BUT-TT-120 is a monoclonal antibody comprising a heavy chain variable region (VH) and light chain variable region (VL), wherein the VH heavy chain comprises a sequence of amino acids represented by SEQ ID NO: 4 and the light chain VL comprises an amino acid sequence represented by SEQ ID NO: 2.

SEQ ID NO: 2 - Human monoclonal antibody light chain variable region amino acid sequence # 1- BUT-TT-120-VL tetanus antitoxin

Glu lie Val Leu Thr Gln Ser Pro Gly Thr Read Leu Ser Pro Gly

1 5 10 15

Glu Arg Wing Thr Read Le Be Cys Arg Wing Be Gln Be Val Ser Be Thr

20 25 30

Tyr Leu Wing Trp Tyr Gln Gln Lys Pro Gly Gln Wing Pro Arg Leu Leu

35 40 45

lie Tyr Wing Ala Ser Be Arg Wing Thr Gly Lie Pro Asp Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Arg Leu Glu 65 70 75 80

Pro Glu Asp Phe Wing Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Leu

85 90 95

Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys

100 105

SEQ ID NO: 4 Human monoclonal antibody heavy chain variable region amino acid sequence # 1-

BUT-TT-120 Tetanus Anti-Toxin

Gln Leu Gln Leu Gln Glu Be Gly Pro Gly Leu Val Lys Pro Be Glu

1 5 10 15

Thr Read Be Read Thr Thr Cys Wing Val Be Gly Gly Be Val Ser Be Wing

20 25 30

Thr Tyr Tyr Trp Gly Trp Ile Arg Gln Ser Pro Gly Lys Gly Leu Glu

35 40 45

Trp Ile Gly Be Thr His Phe Be Gly Be Thr Tyr Asn Pro Be Read 50 55 60

Thr Gly Arg Val Thr Ile Be Val Asp Thr Be Lys Asn Gln Phe Ser

65 70 75 80

Leu Lys Phe Asn Ser Val Thr Wing Asp Thr Wing Val Tyr Tyr Cys

85 90 95

Ser Val Gly Ile Arg Arg Phe Ala Val Leu Leu Ala Phe Asp Tyr Trp

100 105 110

Gly Gln Gly Wing Read Val Thr Val Ser Ser

115 120

2) 2-BUT-TT-143 Monoclonal Antibody

The human tetanic antitoxin 2-BUT-TT-143 monoclonal antibody is a monoclonal antibody comprising a heavy chain variable region (VH) and light chain variable region (VL), wherein the VH heavy chain comprises a sequence of amino acids represented by SEQ ID NO: 8 and the light chain VL comprises an amino acid sequence represented by SEQ ID NO: 6.

SEQ ID NO: 6 - Human monoclonal antibody light chain variable region amino acid sequence # 2- BUT-TT-143 tetanus toxin

Glu lie Val Leu Thr Gln Ser Pro Gly Thr Read Leu Ser Pro Gly

1 5 10 15

Glu Lys Wing Thr Read Le Be Cys Arg Wing Be Gln Arg Phe Gly Be Thr

20 25 30

Leu Leu Trp Wing Tyr Gln Arg Lys Pro Gly Gln Gly Pro Arg Leu Leu

35 40 45

lie Tyr Asp Ala Ser Be Arg Arg Ala Pro Gly lie Pro Asp Arg Phe Ser

50 55 60

Gly Ser Gly Ser Glu Thr Asp Phe Thr Leu Thr lie Asn Arg Leu Glu

65 70 75 80

Pro Glu Asp Phe Wing Val Tyr Tyr Cys Gln Gln Tyr Gly Asn Ser Pro

85 90 95

Read Thr Phe Gly Gly Gly Thr Lys

100 105

SEQ ID NO: 8 Human monoclonal antibody heavy chain variable region amino acid sequence # 2-

BUT-TT-143 Tetanus Anti-Toxin

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Gly

1 5 10 15

Be Read Arg Read Be Cys Val Wing Be Gly Phe Thr Phe Be Asp Tyr

20 25 30

Gly Met His Trp Val Arg Gln Pro Wing Gly Lys Gly Leu Glu Trp Val

35 40 45

Wing Phe lie Arg Tyr Asp Wing Ser Asn Lys Tyr Tyr Wing Asp Ser Val

50 55 60

Lys Gly Arg lie Thr Leu Be Arg Asp Asn Be Lys Asn Lie Met Tyr 65 70 75 80

Read Gln Read Asn Be Read Arg Pro Glu Asp Wing Ward Thr Tyr Tyr Cys

85 90 95

Lys Val Wing Ser Val Val Arg Wing Tyr Arg Tyr Wing Phe Asp Val Trp

100 105 110

Gly Gln Gly Met

115 120

3) 3-BUT-TT-243 Monoclonal Antibody

The 1-BUT-TT-243 tetanus human anti-toxin human monoclonal antibody is a monoclonal antibody comprising a heavy chain variable region (VH) and light chain variable region (VL), wherein the VH heavy chain comprises a sequence of amino acids represented by SEQ ID NO: 12 and the light chain VL comprises an amino acid sequence represented by SEQ ID NO: 10.

SEQ ID NO: 10 - Human monoclonal antibody light chain variable region amino acid sequence # 3- BUT-TT-243 tetanus toxin

Glu Ile Val Leu Thr Gln Be Pro Wing Thr Read Leu Be Pro Gly

1 5 10 15

Glu Arg Wing Thr Read Cyr Arg Wing Arg Be Gln Gly Ile Gly Leu Tyr

20 25 30

Leu Wing Trp Tyr Gln Gln Lys Pro Gly Gln Wing Pro Arg Leu Leu Ile

35 40 45

Tyr Asp Wing Be Val Arg Wing Thr Thr Gly Ile Pro Wing Arg Phe Be Gly 50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asn Pro Leu Glu Pro

65 70 75 80

Glu Asp Phe Wing Val Tyr Tyr Cys Gln

85 90 95

Read Thr Phe Gly Gly Gly Gly Thr Lys Val Glu Ile Lys 100 105

SEQ ID NO: 12 - Human monoclonal antibody light chain variable region amino acid sequence # 1- BUT-TT-243 tetanus toxin

Gln Val Gln Leu Val Gln Ser Gly Wing Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Be Val Lys Val Be Cys Lys Wing Phe Gly Gly Be Phe Be Ser Tyr

20 25 30

Gly Val Trp Wing Val Arg Gln Pro Wing Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Glu Met Phe Pro Ile Be Ala Ser Pro Gln Tyr Ala Gln Arg Phe

50 55 60

Gln Gly Arg Val Thr Read Leu Wing Asp Lys Wing Wing Arg Thr Wing Wing Tyr

65 70 75 80

Met Glu Leu Arg Gly Leu Lys Ser Asp Asp Thr Wing Val Tyr Tyr Cys

85 90 95

Wing Ile Wing Leu Val Arg Trp Leu Asp Pro Trp Gly Arg Gly Thr Leu

100 105 110

Val Thr Val Ser Ser

115

Monoclonal antibodies of the present invention have been tested against diphtheric toxin and are exclusive against tetanus toxin

BUT-TT-120, BUT-TT-143 and BUT-TT-243 monoclonal antibodies were also tested for binding to diphtheria anatoxin (AnD), as blood from some donors was collected a few days after booster dT vaccine, which is composed of tetanus and diphtheria toxoids. In addition, this antigen served as a binding test for a protein unrelated to tetanus toxin. Figure 5 shows the ELISA result of monoclonal antibodies 120, 143 and 243 of the present invention for diphtheria anatoxin binding assay. Antibodies tested at concentrations of 0.4 to 50 ng / mL at four 1: 5 serial dilutions. Human polyclonal serum was used as a positive control at the initial 1:50 dilution and 1: 5 serial dilutions. Sensitized plate with 100 pL of 2 pg / mL diphtheria anatoxin.

The results prove that monoclonal antibodies 120, 143 and 243 of the present invention were tested against diphtheria toxin and are unique against tetanus toxin.

PHARMACEUTICAL AND / OR IMMUNOLOGICAL COMPOSITIONS

The monoclonal antibodies of the present invention may be incorporated into pharmaceutical / immunological compositions suitable for administration to a subject.

Typically, the pharmaceutical / immunological composition of the present invention comprises a monoclonal antibody or monoclonal antibody portion of the present invention and a pharmaceutically acceptable carrier.

As used herein, "pharmaceutically acceptable carrier" includes any and all isotonic compatible solvents, dispersion media, coatings, absorption retarding agents and isotonic agents. Examples of pharmaceutically acceptable carriers include, but are not limited to, one or more of water, saline, phosphate buffered saline, dextrose, and the like, as well as combinations thereof. In many cases, it will be preferable to include amino acids or other salts. Pharmaceutically acceptable carriers may further comprise minor amounts of auxiliary substances, such as wetting or emulsifying agents, preservatives or buffers, which increase the half-life or effectiveness of the monoclonal antibody or monoclonal antibody portion of the present invention.

The immunological compositions of the present invention may be in a variety of forms.

The preferred form depends on the intended mode of administration and therapeutic application. Typical preferred compositions are in the form of injectable or infusion solutions, such as compositions similar to those used for passive immunization of humans with other antibodies. The preferred mode of administration is parenteral (e.g. intravenous, subcutaneous, intraperitoneal, intramuscular).

In a preferred embodiment, the monoclonal antibody of the present invention is administered by infusion or intravenous injection. In another preferred embodiment, the monoclonal antibody of the present invention is administered by intramuscular or subcutaneous injection.

Immunological compositions should typically be sterile and stable under the conditions of manufacture and storage.

Sterile injectable solutions may be prepared by incorporating the active compound (i.e. the monoclonal antibody or monoclonal antibody moiety) in the required amount in an appropriate solvent with one or a combination of ingredients listed above as required, followed by filter sterilization.

Generally, dispersions are prepared by incorporation of the active compound into a sterile vehicle containing a basic dispersion medium and the other necessary ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and lyophilization which produces a powder of the active ingredient plus any desired additional ingredient of a previously sterile filtration solution thereof.

Proper flowability of a solution may be maintained, for example, by the use of a coating such as lecithin, maintaining the particle size required in the case of dispersion and the use of surfactants. Monoclonal antibodies of the present invention may be administered by a variety of methods known in the art, although for many therapeutic applications, the preferred route / mode of administration is injection or infusion.

As will be appreciated by one of ordinary skill in the art, the route and / or mode of administration will vary depending upon the desired results.

In some embodiments, additional therapeutic agents is an agent or agents for the treatment of a disease or condition involving the tetanus toxin.

As used herein, the terms "treat" and "treatment" refer to therapeutic treatment, including prophylactic or preventative measures, wherein the purpose is to prevent or retard (decrease) an undesirable physiological change associated with a disease or disturb. Beneficial or desired clinical outcomes include, but are not limited to, symptom relief, decreased extent. of a disease or disorder, stabilization of a disease or disorder (ie, where the disease or disorder does not get worse), slowing or slowing the progression of a disease or disorder, amelioration or palliation of the disease or disorder, and remission (whether partial or total) of the disease or disorder, whether detectable or undetectable.

The term "treatment" may also mean prolonging survival compared to expected survival if not receiving treatment. Those in need of treatment include those already with the disease or disorder as well as those prone to have the disease or disorder or those in whom the disease or disorder is to be prevented.

The pharmaceutical compositions of the present invention may include a "therapeutically effective amount" or a "prophylactically effective amount" of a human tetanus antitoxin human monoclonal antibody of the present invention.

A "therapeutically effective amount" refers to an amount effective at the dosages and for periods of time necessary to achieve the desired therapeutic result.

A therapeutically effective amount of the monoclonal antibody of the present invention may vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of the antibody or antibody moiety to induce a desired response. in the individual.

A "therapeutically effective amount" is also one in which any toxic or detrimental effects of the antibody or antibody moiety are offset by the therapeutically beneficial effects.

A "prophylactically effective amount" refers to an amount effective, at dosages and for periods of time required, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects before or at an early stage of the disease, the prophylactically effective amount will be less than the therapeutically effective amount.

A non-limiting range for an effective therapeutically or prophylactically exemplary amount of the monoclonal antibody of the present invention is 0.4 to 50 ng / ml. Therefore, in the Swiss mouse trial this range proved sufficient.

It is to be noted that dosage values may vary with the type and severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and professional judgment of the person administering or supervising the administration of the compositions, and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition.

Therapeutic Uses of the Monoclonal Antibodies of the present Invention

Antibodies of the present invention may be used to treat any disease or disorder mediated by, associated with, or caused by action of the tetanus toxin.

For example, the monoclonal antibodies of the present invention may be used to treat a disease or disorder that results in tetanus. The monoclonal antibodies of the present invention may be used to treat a disease or disorder caused by localized tetanus, where onset of symptoms occurs with myalgia due to involuntary contractions of muscle groups near the injury and may be restricted to a particular limb.

The monoclonal antibodies of the present invention may be used to treat a disease or disorder caused by cephalic tetanus, which occurs due to injuries to the scalp, face, oral cavity and ear, leading to ipsilateral facial paralysis to the lesion, trismus, cranial nerve dysphagia and impairment iii, iv, ix, x, xii.

The monoclonal antibodies of the present invention may be used to treat a disease or disorder caused by generalized tetanus, which is characterized by trismus due to contraction of the facial mimic masseter and muscle causing sardonic laughter. Other muscle groups are affected, such as the rectus abdominis and paravertebral musculature, which may cause opisthotonus (characteristic of children). With the evolution of the disease, the other muscles of the body are progressively affected. Muscle contractures follow shortly and, depending on its intensity and frequency, tetanus may be less or more severe, worsening auditory, visual and tactile stimuli. Depending on their intensity, these spasms can progress even to vertebrae fractures or respiratory arrest. The tetanus patient, despite his severity, always remains lucid. Fever, when present, indicates poor prognosis or secondary infection. Among the manifestations of hyperactivity sympathetic, we have: tachycardia, labile arterial hypertension, profuse sweating, peripheral vasoconstriction, cardiac arrhythmias and even hypotension.

The monoclonal antibodies of the present invention may be used to treat a disease or disorder caused by neonatal tetanus, where it is caused by the application of contaminated substances to the cord wound or cut. The incubation period is approximately seven days and its main characteristic is the opistoton. At first, the child may only have difficulty eating. It usually occurs in children of unvaccinated or inadequately vaccinated prenatal mothers.

The monoclonal antibodies of the present invention may be used in immunotherapy for accidents susceptible to tetanus bacilli infection.

The monoclonal antibodies of the present invention may be used for the treatment of persons likely to develop tetanus. These are products that can be obtained homogeneously, with batch consistency and without causing immunogenicity.

Thus, the present invention includes methods for treating a disease or disorder mediated by, associated with, or caused by action of the tetanus toxin. The methods comprise administering to a patient in need thereof a therapeutically or prophylactically amount of the monoclonal antibody as disclosed herein.

The term "monoclonal antibody" as disclosed herein is intended to mean any monoclonal antibody comprising any of the VH regions and / or VL regions defined herein by their identifying sequences (SEQ ID), as well as any antibody. monoclonal comprising a variant of any of the VH regions set by the identifying sequences (SEQ ID) and / or a variant of any of the VL regions set forth herein.

Thus, while only a few embodiments of the present invention have been shown, it will be understood that various omissions, substitutions and changes in tetanus human monoclonal antibodies for infection with c.tetani can be made by one of ordinary skill in the art without departing of the spirit and scope of the present invention.

Unless otherwise defined, all scientific and technical terms are understood to have the same meanings commonly used in the art to which they belong. For the purpose of this disclosure, the following terms are defined.

It is expressly provided that all combinations of elements that perform the same function in substantially the same way to achieve the same results are within the scope of the invention. Substitutions of elements from one described embodiment to another are also fully intended and contemplated.

[00184] One must also understand that the drawings are not necessarily to scale, but that they are only of a conceptual nature. The intent is therefore to be limited as indicated by the scope of the appended claims. REFERENCES

Abbas, A. K. ; Lichtman, A.H. ; Pillai, S. Cellular and Molecular Immunology. 7th ed. Elsevier Saunders, 2012. 545 p.

Barbian, HJ et. al. Neutralization properties of simian immunodeficiency viruses infecting chimpanzees and gorillas. MBio, v. 21; 6 (2), 2015.

Birlea, M. et al. Human Anti-Varicella-Zoster Virus (VZV) Recombinant Monoclonal Antibody Produced after Zostavax Immunization Recognizes the gH / gL Complex and Neutralizes VZV Infection. J. Virol., V. 87, no. 1, p. 415-421, 2013.

Bizzini, B. et al. Chemical Characterization of Tetanus Toxin and Toxoid. Eur. J. Biochem, v. 17, p. 100-105, 1970.

[00189] Brazil. Brazilian Pharmacopoeia. 5th ed. Brasília: Fiocruz, 2010. 852 p.

Cao, Y. et al. An optimized assay for the enumeration of antigen-specific memory B cells in different compartments of the human body. Journal of Immunological Methods, v. 358, no. 1-2, p. 56-65, 2010.

Chen, C. et al. Gangliosides as High Affinity Receptors for Tetanus Neurotoxin. Journal of Biological Chemistry, v. 284, no. 39, p. 26569-26577, 2009.

Collingridge, G.L. ; Davies, J. The in vitro inhibition of GABA release by tetanus toxin. Neurophar macology, v. 21, no. 9, p. 851-855, 1982.

Cook, G. P. ; Tomlinson, I. M. The human immunoglobulin VH repertoire. Immunology Today, v. 16, no. 5, p. 237-242, 1995.

From Kruif, J. et al. Human Immunoglobulin Repertoires against Tetanus Toxoid Contain a Large and Diverse Fraction of High-Affinity Promiscuous VH Genes. Journal of Molecular Biology, v. 387, no. 3, p. 548-558, 2009.

Divino-Goes, KG et al. Prevalence of diphtheria and tetanus antibodies and circulation of Corynebacterium diphtheriae in São Paulo, Brazil. Brazilian Journal of Medical and Biological Research, v. 40, p. 1681-1687, 2007.

Funasa. Procedures for Sera Administration. In: (ED.): Http: // portal. Cheers . go. br / portal / files / pdf / procedure s_soros.pdf, 2001, p.201-231.

Humeau, Y. et al. How botulinum and tetanus neurotoxins block neurotransmitter release. Biochimie, v. 82, no. 5, p. 427-446, 2000.

Kaur, K. et al. High affinity antibodies against Influenza characterize the response in SLE patients after vaccination. PLoS ONE, v. 10, no. 5, e0125618, 2015.

Lindley-Jones, M. et al. Recurrent tetanus. The Lancet, v. 363, no. 9426, p. 2048-2048, 2004.

Matsuda, M. et al. Characteristics of Toxin- Neutralization by Anti-Tetanus Human Monoclonal Antibodies Directed Against the Three Functional Domains [A], [B] and [C] of the Tetanus Toxin Molecule and a Reliable Method for Evaluating the Protective Effects of Monoclonal Antibodies.

European Journal of Epidemiology, v. 8, no. 1, p. 1-8, 1992.

McBride, O. W. et al. Chromosomal Location of Human Kappa and Lambda Immunoglobulin Light Chain Constant Region Genes. Journal of Experimental Medicine, v. 155, p. 1480-1490, 1982.

[00203] Ministry of Health. Epidemiological Surveillance Guide. 6th ed. Brasilia: Ministry of Health, 2005. 696-707 p.

Incidence of neonatal tetanus. Interagency Health Information Network - RIPSA. Available in :

http: // dtr2004. Cheers . go. br / sinanweb / 1abnet / dh? sinannet / tet anoacid / bases / tetacidbrnet. def. Date of access: May 19, 2015.

[00205] Incidence of tetanus in the world, according to World Health Organization

http: // www. who. int / immunization / monitoring_surveillance / rou tine / reporting / en /. Will give from last update: June 10, 2016.

Accidental Tetanus. Interagency Health Information Network - RIPSA. Available at: http: // dtr2004. Cheers . gov. br / sinanweb / 1abnet / dh? sinannet / tet anoacid / bases / tetacidbrnet. def. Date of access: March 19, 2015.

Mouquet, H. et al. Memory B Celi Antibodies to HIV-1 gpl40 Cloned from Individuals Infected with Clade A and B Viruses. PLoS ONE, v. 6, no. 8, p. e24078, 2011.

[00208] Polyreactivity increases the apparent affinity of anti-HIV antibodies by heteroligation. Nature, v. 467, no. 7315, p. 591-595, 2010.

Muellenbeck, M.F. et al. Atypical and classical memory B cells produce Plasmodium falciparum neutralizing antibodies. JEM, v. 210, no. 2, p. 389-399, 2013.

Scheid, JF et al. Broad diversity of neutralizing antibodies isolated from individual B cells in HlVinfected. Nature, v. 458, no. 7238, p. 636-640, 2009a. [00211] A method for identification of HIV gpl40 binding memory B cells in human blood. Journal of Immunological Methods, v. 343, no. 2, p. 65-67, 2009b.

Schiavo, G. et al. Tetanus and botulinum-B neurotoxins block neurotransmitter release by proteolytic cleavage of synaptobrevin. Nature v. 359, p. 832-835, 1992a.

Schiavo, G. et al. Neurotoxins Affecting Neuroexocytosis. Physiological Reviews, v. 80, no. 2, p. 717766, 2000.

Schiavo, G. et al. Tetanus toxin is a zinc protein and its inhibition of neurotransmitter release and protease activity depends on zinc. The EMBO Journal, v. 11, no. 10, p. 3577-3583, 1992b.

Smith, K. et al. Human monoclonal antibodies generated following vaccination with AVA provide neutralization by blocking furin cleavage but not by preventing oligomerization. Vaccine, v. 30, no. 28, p. 4276- 4283, 2012.

Sonobe, M.H. et al. Determination of low tetanus or diphtheria antitoxin titers in sera by a toxin neutralization assay and a modified toxin-binding inhibition test. Brazilian Journal of Medical and Biological Research, v. 40, p. 69-76, 2007.

Throsby, M. et al. Isolation and

Characterization of Human Monoclonal Antibodies from Individuals Infected with West Nile Virus. Journal of Virology, v. 80, no. 14, p. 6982-6992, 2006.

Tiller, T. et al. Efficient generation of monoclonal antibodies from human B cells by single cell RT-PCR and expression vector cloning. Journal of Immunological Methods, v. 329, p. 112-124, 2008. Volk, W. A. et al. Neutralization of Tetanus Toxin by Distinct Monoclonal Antibodies Binding to Multiple Epitopes on the Toxin Molecule. Infection and Immunity, v. 45, no. 3, p. 604-609, 1984.

Wardemann, H. ; Kofer, J. Expression Cloning of Human B Celi Immunoglobulins. In: KtJPPERS, R. (Ed.). Lymphoma: Humana Press, v.971, 2013. p.93-111. (Methods in Molecular Biology).

Weckx, L. Y. et al. Effect of a single tetanus diphtheria vaccine dose on the immunity of elderly people in Sao Paulo, Brazil. Brazilian Journal of Medical and Biological Research, v. 39, p. 5,119,223, 2006.

[00222] Zhou, T. et. al. Structural Repertoire of HIV-1-Neutralizing Antibodies Targeting the CD4 Supersite in 14 Donors. Celi .61 (6): 1280-92, 2015.

Claims

1. Human tetanus antitoxin human monoclonal antibody, characterized in that said antibody is a monoclonal antibody comprising a combination of heavy chain variable region (VH) and light chain variable region (VL) selected from the following possibilities: (i) ) to (iii):

(i) 1-BUT-TT-120 monoclonal antibody comprising heavy chain variable region VH comprises an amino acid sequence represented by SEQ ID NO: 4 and light chain variable region VL comprises an amino acid sequence represented by SEQ ID NO: 2 .

(ii) 2-BUT-TT-143 monoclonal antibody comprising VH heavy chain variable region comprises an amino acid sequence represented by SEQ ID NO: 8 and VL light chain variable region comprising an amino acid sequence represented by SEQ ID NO: 6 .

(iii) 3-BUT-TT-243 monoclonal antibody comprising VH heavy chain variable region comprises an amino acid sequence represented by SEQ ID NO: 12 and VL light chain variable region comprising an amino acid sequence represented by SEQ ID NO: 10 .

A conjugate comprising a combination of 1-BUT-TT-120 monoclonal antibody, 1-BUT-TT-143 monoclonal antibody and 1-BUT-TT-243 monoclonal antibody as defined by claim 1 coupled to a toxin, a radioisotope, drug or cytotoxic agent.

Immunological composition comprising a combination of l-BUT-TT-120 monoclonal antibody, l-BUT-TT-143 monoclonal antibody and l-BUT-TT-243 monoclonal antibody as defined by claim 1 is a pharmaceutically acceptable carrier.

Immunological composition comprising a conjugate as defined by claim 2 the pharmaceutically acceptable carrier.

Use of the monoclonal antibody as defined in claim 1, characterized in that it is for the preparation of an immunological composition for treating and / or preventing tetanus.

Use of the antibody according to claim 4, characterized in that said monoclonal antibody is for the treatment of persons likely to develop tetanus.

Use of the antibody according to claim 4, characterized in that it is for immunotherapy of accidental tetanus infection.

Use of the antibody according to claim 4, characterized in that it is for treating neonatal tetanus in infants affected by the infection, which is transmitted by cutting the umbilical cord.

Use of the antibody according to claim 4, characterized in that it is localized tetanus, cephalic tetanus or generalized tetanus.

Process for producing a monoclonal antibody characterized in that it comprises the following steps:

(a) collect blood from donors that have memory B cells circulating against a given antigen and the purified antigen for immunophenotyping of those cells; (b) separating blood tetanus antibody-producing B lymphocytes from tetanus-vaccinated humans;

(c) amplifying the antibody variable regions of cells separated by cell sorting;

(d) cloning sequences into mammalian cell expression vectors;

(e) express the recombinant antibodies transiently.

Process for producing a monoclonal antibody according to claim 9, characterized in that in step (b) the specific separation of tetanus-producing B-lymphocytes is used independently conjugated tetanus toxin with two different markers, biotin and Alexa Fluor ^® 647.

Process for producing a monoclonal antibody according to claim 9, characterized in that in step (b) the antibody-producing lymphocytes relevant to toxin epitopes are selected.

A method according to claim 9, wherein said monoclonal antibody is obtained from gene sequence information obtained from peripheral blood B lymphocytes of persons immunized with tetanus toxoid.

Process according to claim 9, characterized in that the genetic information is inserted into vectors used for transfection of mammalian cells to generate anti-tetanus monoclonal antibody producing cell lines.