CN111153988B

CN111153988B - Broad-spectrum neutralizing monoclonal antibody against enterovirus D68

Info

Publication number: CN111153988B
Application number: CN201811326695.7A
Authority: CN
Inventors: 黄忠; 张超; 代文龙
Original assignee: Institut Pasteur of Shanghai of CAS
Current assignee: Shanghai Institute of Immunology and Infection, Chinese Academy of Sciences
Priority date: 2018-11-08
Filing date: 2018-11-08
Publication date: 2022-11-04
Anticipated expiration: 2038-11-08
Also published as: CN111153988A

Abstract

The invention discloses a neutralizing monoclonal antibody for resisting enterovirus D68. Specifically, the invention discloses two monoclonal antibodies aiming at enterovirus D68, and the antibodies have obvious binding and neutralizing activities on the enterovirus D68.

Description

Broad-spectrum neutralizing monoclonal antibody against enterovirus D68

Technical Field

The invention belongs to the field of biological medicines, and particularly relates to two neutralizing monoclonal antibodies for resisting enterovirus D68.

Background

Enterovirus D68 (EVD 68) is a small non-enveloped virus belonging to the D family of enteroviruses within the picornaviridae family. Similar to other picornaviruses, it has an icosahedral capsid of-30 nm, consisting of 60 protomers, each composed of four subunit proteins, VP1, VP2, VP3 and VP 4. Based on the evolutionary analysis of VP1 nucleic acid sequences, circulating EVD68 strains can be divided into three major evolutionary lineages, namely a, B and C. EVD68 is increasingly associated with acute respiratory and/or severe neurological diseases in children, primarily acute relaxant myelitis (AFM). Over the past decade, EVD68 has spread widely throughout the world, continuously resulting in outbreaks and sporadic cases, which pose a serious threat to global public health.

To date, there is no commercial vaccine or antiviral drug against EVD68 infection. Recently, we have reported that recombinant virus-like particles (VLPs) of EVD68 can be produced in baculovirus/insect cells and pichia pastoris expression systems, respectively, and that VLPs induce high levels of neutralizing antibodies in mice and protect mice against lethal infection. Monoclonal antibodies (mabs) are a promising approach to the treatment of infectious diseases, as demonstrated by the successful commercialization of the humanized monoclonal antibody palivizumab against respiratory syncytial virus.

Therefore, there is a need in the art to develop therapeutic neutralizing antibodies with good affinity against enterovirus type D68 to address the need for EVD68 control.

Disclosure of Invention

The invention aims to provide a neutralizing monoclonal antibody of enterovirus D68 and application thereof.

In a first aspect of the present invention, there is provided a heavy chain variable region of an antibody, the heavy chain variable region having complementarity determining regions CDRs selected from the group consisting of:

VH-CDR1 shown in SEQ ID NO. 2,

VH-CDR2 shown in SEQ ID NO. 4,

VH-CDR3 shown in SEQ ID NO 6,

VH-CDR1 shown in SEQ ID NO. 22,

VH-CDR1 shown in SEQ ID NO:24, and

VH-CDR1 shown in SEQ ID NO. 26;

preferably, the heavy chain variable region has the amino acid sequence shown in SEQ ID NO 16 and/or SEQ ID NO 36.

In a second aspect of the invention, there is provided a heavy chain of an antibody, said heavy chain having a heavy chain variable region and a heavy chain constant region according to the first aspect of the invention.

In another preferred embodiment, the constant region of the heavy chain is of human or murine origin.

In another preferred embodiment, the heavy chain has the amino acid sequence shown in SEQ ID NO. 15 and/or SEQ ID NO. 35.

In a third aspect of the present invention, there is provided a light chain variable region of an antibody, said light chain variable region having Complementarity Determining Regions (CDRs) selected from the group consisting of:

VL-CDR1 shown in SEQ ID NO. 8,

VL-CDR2 shown in SEQ ID NO. 10,

VL-CDR3 shown in SEQ ID NO. 12;

VL-CDR1 shown in SEQ ID NO. 28,

VL-CDR2 shown in SEQ ID NO. 30, and

VL-CDR3 shown in SEQ ID NO. 32;

preferably, the light chain variable region has the amino acid sequence shown in SEQ ID NO 20 and/or SEQ ID NO 40.

In a fourth aspect of the invention, there is provided a light chain of an antibody, the light chain having a light chain variable region and a light chain constant region as described in the third aspect of the invention.

In another preferred embodiment, the light chain constant region is of human or murine origin.

In another preferred embodiment, the light chain has the amino acid sequence shown in SEQ ID NO 19 and/or SEQ ID NO 39.

In a fifth aspect of the invention, there is provided an antibody having:

(1) A heavy chain variable region according to the first aspect of the invention; and/or

(2) A light chain variable region according to the third aspect of the invention.

In another preferred embodiment, the antibody has: a heavy chain according to the second aspect of the invention; and/or a light chain according to the fourth aspect of the invention.

In another preferred embodiment, the antibody is specific to enterovirus D68.

In another preferred embodiment, the antibody comprises: a single chain antibody (scFv), a diabody, a monoclonal antibody, a chimeric antibody (e.g., a human-murine chimeric antibody), a murine antibody, or a humanized antibody.

In a sixth aspect of the present invention, there is provided a recombinant protein having:

(i) The sequence of a heavy chain variable region according to the first aspect of the invention, the sequence of a heavy chain according to the second aspect of the invention, the sequence of a light chain variable region according to the third aspect of the invention, the sequence of a light chain according to the fourth aspect of the invention, or the sequence of an antibody according to the fifth aspect of the invention; and

(ii) Optionally a tag sequence to facilitate expression and/or purification.

In another preferred embodiment, the tag sequence is selected from the group consisting of: 6 × His tag, GGGS sequence, FLAG tag.

In another preferred embodiment, the recombinant protein specifically binds to enterovirus type D68.

In a seventh aspect of the invention, there is provided a polynucleotide encoding a polypeptide selected from the group consisting of:

(1) A heavy chain variable region according to the first aspect of the invention, a heavy chain according to the second aspect of the invention, a light chain variable region according to the third aspect of the invention, a light chain according to the fourth aspect of the invention, or an antibody according to the fifth aspect of the invention; or

(2) A recombinant protein according to the sixth aspect of the invention.

In another preferred embodiment, the polynucleotide has the sequence shown in SEQ ID No.1, 3, 5, 7, 9, 11, 13, 14, 17, 18, 21, 23, 25, 27, 29, 31, 33, 34, 37 or 38.

In an eighth aspect of the invention, there is provided a vector comprising a polynucleotide according to the seventh aspect of the invention.

In another preferred embodiment, the carrier comprises: bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors.

According to a ninth aspect of the invention, there is provided a genetically engineered host cell comprising a vector or genome according to the eighth aspect of the invention into which has been integrated a polynucleotide according to the seventh aspect of the invention.

In a tenth aspect of the invention, there is provided an immunoconjugate comprising:

(a) A heavy chain variable region according to the first aspect of the invention, a heavy chain according to the second aspect of the invention, a light chain variable region according to the third aspect of the invention, a light chain according to the fourth aspect of the invention, or an antibody according to the fifth aspect of the invention, or a recombinant protein according to the sixth aspect of the invention; and

(b) A coupling moiety selected from the group consisting of: a detectable label, drug, toxin, cytokine, radionuclide, or enzyme.

In another preferred embodiment, the conjugate is selected from the group consisting of: fluorescent or luminescent labels, radioactive labels, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes capable of producing detectable products, radionuclides, biotoxins, cytokines (e.g., IL-2, etc.), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles/nanorods, viral particles, liposomes, nanomagnetic particles, prodrug-activating enzymes (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)), chemotherapeutic agents (e.g., cisplatin), or any form of nanoparticles, and the like.

In an eleventh aspect of the present invention, there is provided a pharmaceutical composition comprising:

(i) A heavy chain variable region according to the first aspect of the invention, a heavy chain according to the second aspect of the invention, a light chain variable region according to the third aspect of the invention, a light chain according to the fourth aspect of the invention, or an antibody according to the fifth aspect of the invention, or a recombinant protein according to the sixth aspect of the invention, or an immunoconjugate according to the tenth aspect of the invention; and

(ii) A pharmaceutically acceptable carrier.

In another preferred embodiment, the pharmaceutical composition is in the form of injection.

In another preferred embodiment, the pharmaceutical composition is used for preparing a medicament for treating enterovirus D68 infection.

In a twelfth aspect of the invention, there is provided a use of the heavy chain variable region according to the first aspect of the invention, the heavy chain according to the second aspect of the invention, the light chain variable region according to the third aspect of the invention, the light chain according to the fourth aspect of the invention, the antibody according to the fifth aspect of the invention, the recombinant protein according to the sixth aspect of the invention, or the immunoconjugate according to the tenth aspect of the invention for the manufacture of a medicament, a reagent, a detection plate or a kit.

In another preferred embodiment, the reagent, detection plate or kit is used for detecting enterovirus type D68.

In another preferred embodiment, the medicament is for the treatment or prevention of an enterovirus type D68 infection.

In another preferred embodiment, the reagent comprises a chip and immune microparticles coated with antibodies.

In a thirteenth aspect of the present invention, there is provided a method for detecting enterovirus type D68 in a sample, the method comprising the steps of:

(1) Contacting the sample with an antibody according to the fifth aspect of the invention;

(2) Detecting the formation of an antigen-antibody complex, wherein the formation of the complex is indicative of the presence of enterovirus type D68 in the sample.

In a fourteenth aspect of the present invention, there is provided a method of producing a recombinant polypeptide, the method comprising:

(a) Culturing a host cell according to the ninth aspect of the invention under conditions suitable for expression;

(b) Isolating a recombinant polypeptide from the culture, said recombinant polypeptide being an antibody according to the fifth aspect of the invention or a recombinant protein according to the sixth aspect of the invention.

In a fifteenth aspect of the present invention, there is provided a pharmaceutical combination comprising:

(i) A first active ingredient comprising an antibody 1 according to the fifth aspect of the invention, or a recombinant protein according to the sixth aspect of the invention, or an antibody conjugate according to the tenth aspect of the invention, or a pharmaceutical composition according to the eleventh aspect of the invention, or a combination thereof;

(ii) A second active ingredient comprising a second antibody, or an antiviral drug.

In another preferred embodiment, the second antibody is another anti-EVD 68 antibody (e.g., A6-1).

In another preferred embodiment, the antiviral agent is an anti-EVD 68 viral agent (e.g., pleconaril).

In a sixteenth aspect of the invention, there is provided the use of an antibody of the fifth aspect of the invention, or a recombinant protein of the sixth aspect of the invention, or an antibody conjugate of the tenth aspect of the invention, or a pharmaceutical composition of the eleventh aspect of the invention, together with a second antibody or an antiviral medicament, in the manufacture of a medicament for the treatment of a disease associated with EVD68 infection.

In a seventeenth aspect of the invention, there is provided a method of treating a disease associated with EVD68 infection by administering to a subject in need thereof an effective amount of an antibody according to the fifth aspect of the invention, or a recombinant protein according to the sixth aspect of the invention, or an antibody conjugate according to the tenth aspect of the invention, or a pharmaceutical composition according to the eleventh aspect of the invention, or a combination thereof.

In another preferred example, the disease associated with EVD68 infection includes EVD68 single virus infection and mixed infection.

In another preferred example, the mixed infection comprises EVD68 and EV71 mixed infection.

In another preferred embodiment, the method further comprises: administering to the subject a safe and effective amount of a second antibody before, during and/or after the administration of the first active ingredient.

In another preferred embodiment, the method further comprises: administering to the subject a safe and effective amount of an anti-EVD 68 viral drug before, during and/or after administration of the first active ingredient.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows the neutralizing activity of monoclonal antibodies against EVD 68. 100TCID50 of EVD68 strain US/MO/14-18947 with two-fold serial dilution of purified antibodies 2G10, 2H12, 4C11 and 8F12 were incubated for 1 hour, respectively, and then added to RD cells. Cell viability was determined 3 days post infection by CellTiter-Glo 2.0 kit and half maximal inhibitory concentration (IC 50) of each antibody was calculated using GraphPad Prism software. ZIKV-specific mab 1C11 and HCV-specific mab 1F4 were used as isotype controls. Data are presented as mean ± standard error of mean of triplicate wells.

FIG. 2 shows the specificity and affinity of monoclonal antibody binding to EVD68 antigen. (A-C) the reactivity of the mAbs (2G 10, 2H12, 4C11 and 8F 12) to EVD68VLP (A), EV71VLP (B) and CVA16VLP (C) was determined by ELISA. Mabs 1C11 and 1F were used as isotype controls. anti-EV 71 mAb D5 and anti-CVA 16 mAb 9B5 were used as positive controls in the detection of EV71VLP and CVA16VLP, respectively. (D and E) BLI determination of the binding affinity of mAbs to EVD68VLP (D) and EVD68US/MO/14-18947 virus (E). Binding affinity at steady state is expressed as the equilibrium dissociation constant (KD).

FIG. 3 shows an alignment of the complete amino acid sequences of the variable regions of EVD68 mAb. The coding sequences for the variable regions of the antibody heavy and light chains were determined by 5' RACE, respectively. (A and B) heavy chain variable region (V) of 2G10, 2H12, 4C11 and 8F12 antibodies _H ) (A) and light chain variable region (V) _L ) The amino acid sequence of (B). The positions of the Complementarity Determining Regions (CDRs) were identified and labeled using the IgBLAST tool. Dots represent amino acid residues identical to those of the monoclonal antibody 2G10 variable region, and red lines represent amino acid deletions compared to monoclonal antibody 2G 10.

Figure 4 shows the prophylactic efficacy of mabs 2H12 and 8F12 on EVD68 infection in neonatal mice. Groups of ICR mice (age <24h, n = 12-14/group) were intraperitoneally injected with PBS, 10 μ g/g of 2H12, 8F12 or isotype control mab (1C 11 or 1F 4) and infected with US/MO/14-18947 one day later. Infected mice were monitored daily for (a) survival rate and (B) clinical symptoms. Clinical symptoms were graded as follows: 0, health; 1, lethargy and bradykinesia; 2, weakness of limbs; 3, paralysis of limbs; and 4, death. Survival of mice in each antibody-treated group was compared to PBS control group. Statistical significance was as follows: ns, no significant difference, P is more than or equal to 0.05; * P <0.01; * P <0.001.

Figure 5 shows the efficacy of mabs in treating EVD68 infection in mice. One day large ICR mice (n = 13-27/group) were infected with US/MO/14-18947 (a-D) or US/KY/14-18953 (E and F). Mice were given PBS, 10. Mu.g/g 2H12, 10. Mu.g/g 8F12 or a mixture of the two mAbs (10. Mu.g/g each mAb) 1 day (A and B) or 3 days (C to F) post-infection. Survival and (B, D and F) clinical symptoms were then monitored daily (a, C and E). Clinical symptoms are graded as follows: 0, health; 1, sleepiness and mobility slowness; 2, weakness of limbs; 3, paralysis limbs; and 4, death. The survival of the antibody-treated mice was compared to mice in the PBS control group. Statistical significance was as follows: ns, no significant difference, P is more than or equal to 0.05; * P <0.05; * P <0.01; * P <0.001.

Detailed Description

The present inventors have made extensive and intensive studies to unexpectedly obtain two monoclonal antibodies against enterovirus type D68 (EVD 68). Specifically, the inventors prepared mabs with strong neutralizing activity against EVD68 and evaluated their therapeutic efficacy in EVD 68-infected neonatal mice. The results show that 2 neutralizing antibodies against EVD68 (designated BSD01 and BSD 02) were prepared from EVD68VLP immunized mice, and have significant binding activity against enterovirus type D68. Furthermore, the combination of mabs BSD01 and BSD02 may provide effective broad-spectrum neutralization and protection against each tested strain of EVD 68. The monoclonal antibodies BSD01 and BSD02 have the functions of preventing and treating EVD68 infection. On the basis of this, the present invention has been completed.

Before the present invention is described, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methodologies and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now exemplified.

Enterovirus D68

In the past 10 years, the prevalence of enterovirus type D68 (EVD 68) has become more and more prevalent around the world and is closely linked to severe respiratory infections, acute slow myelitis (AFM), and there is an urgent need to develop effective antiviral drugs.

EVD68 was first isolated in 1962 in four pediatric patients with pneumonia, bronchitis in the United states. Since then, EVD68 infection has only occurred in worldwide sporadic locations. For example, there are only 26 reports in the united states during the 36 th year from 1970 to 2005. However, during the last 10 years, the number of clinical cases of EVD68 infection has increased dramatically worldwide. In 2014, the united states reported the largest-scale outbreak of EVD68 infection with a total of 1153 infections from 8 months in 2014 to 1 month in 2015, with a large number of patients requiring treatment in intensive care units and 14 patients dying. This number of infections was significantly underestimated because most clinical laboratories at that time lacked a rapid EVD 68-specific molecular detection method. This outbreak quickly passed to canada, europe, and asia, with over 2000 EVD68 infections reported in a total of 20 countries in 2014. 2014. After a major outbreak of years, EVD68 continues to be prevalent in many countries in america, asia, and europe. These epidemiological investigations suggest that EVD68 is becoming an important pathogen for severe respiratory infections. In addition, 120 pediatric patients identified acute delayed paralysis (AFM) during the us EVD68 outbreak 2014, the major clinical features of which include muscle weakness and paralysis, with spinal motor neuron damage. This AFM outbreak suggested an association between EVD68 infection and AFM, a hypothesis further confirmed by many subsequent clinical cases and epidemiological investigations. Based on the evolutionary analysis of VP1, EVD68 can be divided into three lineages (clade) a, B and C, and the original Fermon line. Lineage B can further be divided into 3 sublines B1, B2 and B3. In recent years, EVD68 infection has been reported more and more in China, with severe pneumonia, severe neurological complications and death cases. Wang Jianwei and his team investigated the seropositivity rate of neutralizing antibodies between the years beijing 2004 and 2011, who found that EVD68 neutralizing antibody titers for all age groups in the sampled population were generally lower in 2004, but were significantly higher in 2009. Neutralizing antibodies against EVD68 increased significantly over time from 2007 to 2011. These findings indicate that EVD68 has spread widely in the chinese population in recent years. Beijing reported severe cases of pneumonia associated with EVD68 in 2014. In the same year, hong kong reports the first death cases related to EVD68 infection in China. Taiwan examined the first acute delayed paralysis cases related to EVD68 infection in china in 2016 month 8. Since China has not brought EVD68 into the national legislated infectious disease monitoring system, the public health burden due to EVD68 infection is underestimated. Indeed, EVD68 has become an important threat to public health, particularly in children. However, there is currently no effective vaccine or drug to prevent or treat EVD68 infection. There is an urgent need to develop corresponding vaccines and drugs to cope with the future possible EVD68 epidemic. Therefore, the screening of the neutralizing antibody of the anti-enterovirus D68 has great significance for the prevention and control of the neutralizing antibody.

BSD01 and BSD02

As used herein, the term "BSD01" is used interchangeably with "2H12", 2G10 "".

As used herein, the term "BSD02" is used interchangeably with "8F12", "4C 11".

Antibodies

As used herein, the term "antibody" or "immunoglobulin" is an isotetraglycan protein of about 150000 daltons with the same structural features, consisting of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide bonds varies between heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bonds. Each heavy chain has at one end a variable region (VH) followed by a plurality of constant regions. Each light chain has a variable domain (VL) at one end and a constant domain at the other end; the light chain constant region is opposite the first heavy chain constant region, and the light chain variable region is opposite the heavy chain variable region. Particular amino acid residues form the interface between the variable regions of the light and heavy chains.

As used herein, the term "variable" means that certain portions of the variable regions of an antibody differ in sequence, which results in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not evenly distributed throughout the antibody variable region. It is concentrated in three segments called Complementarity Determining Regions (CDRs) or hypervariable regions in the light and heavy chain variable regions. The more conserved portions of the variable regions are called Framework Regions (FR). The variable regions of native heavy and light chains each comprise four FR regions, which are in a substantially β -sheet configuration, connected by three CDRs that form a connecting loop, and in some cases may form part of a β -sheet structure. The CDRs in each chain lie closely together via the FR regions and form the antigen binding site of the antibody with the CDRs of the other chain (see Kabat et al, NIH Publ. No.91-3242, vol.I, p.647-669 (1991)). The constant regions are not directly involved in binding of the antibody to the antigen, but they exhibit different effector functions, such as participation in antibody-dependent cytotoxicity of the antibody.

The "light chains" of vertebrate antibodies (immunoglobulins) can be assigned to one of two distinct classes (termed kappa and lambda) based on the amino acid sequence of their constant regions. Immunoglobulins can be assigned to different classes based on the amino acid sequence of their heavy chain constant regions. There are mainly 5 classes of immunoglobulins: igA, igD, igE, igG and IgM, some of which can be further divided into subclasses (isotypes), such as IgG1, igG2, igG3, igG4, igA and IgA2. The heavy chain constant regions corresponding to different classes of immunoglobulins are referred to as α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known to those skilled in the art.

As used herein, the term "monoclonal antibody (mab)" refers to an antibody obtained from a substantially homogeneous population, i.e., the individual antibodies contained in the population are identical, except for a few naturally occurring mutations that may be present. Monoclonal antibodies are directed against a single antigenic site with high specificity. Moreover, unlike conventional polyclonal antibody preparations (typically having different antibodies directed against different determinants), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies are also advantageous in that they are synthesized by hybridoma culture and are not contaminated with other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.

The invention also comprises a monoclonal antibody with the corresponding amino acid sequence of the anti-enterovirus D68 monoclonal antibody, a monoclonal antibody with the variable region chain of the anti-enterovirus D68 monoclonal antibody, and other proteins or protein conjugates and fusion expression products with the chains. Specifically, the invention includes any protein or protein conjugate and fusion expression product (i.e., immunoconjugate and fusion expression product) having light and heavy chains with hypervariable regions (complementarity determining regions, CDRs) provided that the hypervariable regions are identical or at least 90% homologous, preferably at least 95% homologous, to the hypervariable regions of the light and heavy chains of the invention.

As known to those skilled in the art, immunoconjugates and fusion expression products include: drugs, toxins, cytokines, radionuclides, enzymes, and other diagnostic or therapeutic molecules are conjugated to the anti-enterovirus D68 monoclonal antibody or fragment thereof. The invention also comprises a cell surface marker or antigen combined with the anti-enterovirus D68 monoclonal antibody or the fragment thereof.

The invention includes not only intact monoclonal antibodies, but also immunologically active antibody fragments, such as Fab or (Fab ") ₂ A fragment; an antibody heavy chain; the light chain of the antibody.

As used herein, the terms "heavy chain variable region" and "V _H "may be used interchangeably.

As used herein, the term "variable region" is used interchangeably with "Complementary Determining Region (CDR)".

In a preferred embodiment of the present invention, the heavy chain variable region of the antibody BSD01 includes the following three complementarity determining regions CDRs:

VH-CDR1, the amino acid sequence of which is SEQ ID NO. 2, and the coding nucleotide sequence of which is SEQ ID NO. 1;

VH-CDR2, the amino acid sequence of which is SEQ ID NO. 4, and the coding nucleotide sequence of which is SEQ ID NO. 3;

VH-CDR3, the amino acid sequence of which is SEQ ID NO. 6, and the coding nucleotide sequence of which is SEQ ID NO. 5.

In another preferred embodiment, the amino acid sequence of the heavy chain variable region is SEQ ID NO 16 and the coding nucleotide sequence is SEQ ID NO 14.

In another preferred embodiment of the present invention, the heavy chain variable region of the antibody BSD02 includes the following three complementarity determining regions CDRs:

VH-CDR1, the amino acid sequence of which is SEQ ID NO. 22, and the coding nucleotide sequence of which is SEQ ID NO. 21;

VH-CDR2, the amino acid sequence of which is SEQ ID NO. 24, and the coding nucleotide sequence of which is SEQ ID NO. 23;

VH-CDR3, the amino acid sequence of which is SEQ ID NO. 26, and the coding nucleotide sequence of which is SEQ ID NO. 25.

In another preferred embodiment, the amino acid sequence of the heavy chain variable region is SEQ ID NO:36 and the coding nucleotide sequence is SEQ ID NO:34.

In a preferred embodiment of the invention, the heavy chain of the antibody comprises the above-described heavy chain variable region and a heavy chain constant region, which may be murine or human.

As used herein, the terms "light chain variable region" and "V _L "may be used interchangeably.

In a preferred embodiment of the present invention, the light chain variable region of the antibody BSD01 includes the following three complementarity determining regions CDRs:

VL-CDR1, the amino acid sequence of which is SEQ ID NO. 8, and the coding nucleotide sequence of which is SEQ ID NO. 7;

VL-CDR2, the amino acid sequence of which is SEQ ID NO. 10, and the coding nucleotide sequence of which is SEQ ID NO. 9;

VL-CDR3, the amino acid sequence of which is SEQ ID NO. 12, and the coding nucleotide sequence of which is SEQ ID NO. 11;

in another preferred embodiment, the variable region of the light chain has the amino acid sequence of SEQ ID NO. 20 and the coding nucleotide sequence of SEQ ID NO. 18.

In another preferred embodiment of the present invention, the light chain variable region of the antibody BSD02 includes the following three complementarity determining regions CDRs:

VL-CDR1, the amino acid sequence of which is SEQ ID NO. 28, and the coding nucleotide sequence of which is SEQ ID NO. 27;

VL-CDR2, the amino acid sequence of which is SEQ ID NO. 30, and the coding nucleotide sequence of which is SEQ ID NO. 29;

VL-CDR3, the amino acid sequence of which is SEQ ID NO. 32, and the coding nucleotide sequence of which is SEQ ID NO. 31;

in another preferred embodiment, the variable region of the light chain has the amino acid sequence of SEQ ID NO. 40 and the coding nucleotide sequence of SEQ ID NO. 38.

In a preferred embodiment of the invention, the light chain of the antibody comprises the light chain variable region and a light chain constant region, which may be murine or human.

In the present invention, the terms "antibody of the invention", "protein of the invention", or "polypeptide of the invention" are used interchangeably and all refer to an antibody that specifically binds to enterovirus D68 type, such as a protein or polypeptide having a heavy chain variable region (the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO:14 and/or SEQ ID NO: 34) and/or a light chain variable region (the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO:18 and/or SEQ ID NO: 38). They may or may not contain the starting methionine.

In another preferred embodiment, the antibody is a murine or human murine chimeric monoclonal antibody directed against enterovirus type D68, and its heavy chain constant region and/or light chain constant region can be humanized heavy chain constant region or light chain constant region. More preferably, the humanized heavy chain constant region or light chain constant region is human IgG1, igG2, etc. heavy chain constant region or light chain constant region.

The invention also provides other proteins or fusion expression products having an antibody of the invention. In particular, the invention includes any protein or protein conjugate and fusion expression product (i.e., immunoconjugate and fusion expression product) having heavy and light chains with variable regions, provided that the variable regions are identical or at least about 90% homologous, preferably at least about 95% homologous, to the variable regions of the heavy and light chains of the antibodies of the invention.

In general, the antigen binding properties of an antibody can be described by 3 specific regions in the heavy and light chain variable regions, called variable regions (CDRs), which are separated into 4 Framework Regions (FRs), the amino acid sequences of the 4 FRs being relatively conserved and not directly involved in the binding reaction. These CDRs form a loop structure, and the β -sheets formed by the FRs between them are spatially close to each other, and the CDRs on the heavy chain and the CDRs on the corresponding light chain constitute the antigen binding site of the antibody. The amino acid sequences of antibodies of the same type can be compared to determine which amino acids constitute the FR or CDR regions.

The variable regions of the heavy and/or light chains of the antibodies of the invention are of particular interest, since at least some of them are involved in binding to an antigen. Thus, the invention includes those molecules having the light and heavy chain variable regions of a monoclonal antibody with CDRs that are more than 90% (preferably more than 95%, most preferably more than 98%) homologous to the CDRs identified herein.

The invention includes not only complete monoclonal antibodies, but also fragments of antibodies with immunological activity or fusion proteins of antibodies with other sequences. Accordingly, the invention also includes fragments, derivatives and analogs of the antibodies.

As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as an antibody of the invention. A polypeptide fragment, derivative or analogue of the invention may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide in which the mature polypeptide is fused to another compound, such as a compound that extends the half-life of the polypeptide, e.g. polyethylene glycol, or (iv) a polypeptide in which an additional amino acid sequence is fused to the sequence of the polypeptide (e.g. a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein with a 6His tag). Such fragments, derivatives and analogs are well within the skill of those in the art in light of the teachings herein.

The antibody of the present invention refers to a polypeptide having enterovirus D68-type binding activity, which comprises the above-mentioned CDR regions. The term also includes variants of the polypeptides comprising the CDR regions described above that have the same function as the antibodies of the invention. These variants include (but are not limited to): deletion, insertion and/or substitution of one or more (usually 1 to 50, preferably 1 to 30, more preferably 1 to 20, most preferably 1 to 10) amino acids, and addition of one or several (usually up to 20, preferably up to 10, more preferably up to 5) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, the addition of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the function of the protein. The term also includes active fragments and active derivatives of the antibodies of the invention.

Variants of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridizes under high or low stringency conditions with DNA encoding an antibody of the invention, and polypeptides or proteins obtained using antisera raised against an antibody of the invention.

The invention also provides other polypeptides, such as fusion proteins comprising human antibodies or fragments thereof. In addition to almost full-length polypeptides, the invention also encompasses fragments of the antibodies of the invention. Typically, the fragment has at least about 50 contiguous amino acids of the antibody of the invention, preferably at least about 60 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids.

In the present invention, "conservative variants of the antibody of the present invention" refers to the substitution of up to 10, preferably up to 8, more preferably up to 5, and most preferably up to 3 amino acids with qualitatively similar or analogous amino acids compared to the amino acid sequence of the antibody of the present invention to form a polypeptide. These conservative variant polypeptides are preferably generated by amino acid substitutions according to Table 1.

TABLE 1

Initial residue(s)	Representative substitutions	Preferred substitutions
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

The invention also provides polynucleotide molecules encoding the above antibodies or fragments or fusion proteins thereof. The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to or a degenerate variant of the sequence of the coding region as shown in

SEQ ID NO

1, 3, 5, 7, 9, 11, 13, 14, 17, 18, 21, 23, 25, 27, 29, 31, 33, 34, 37 or 38. As used herein, "degenerate variant" refers in the present invention to nucleic acid sequences which encode a nucleic acid sequence having the same amino acid sequence as a polypeptide of the present invention, but which differs from the sequence of the coding region as set forth in

SEQ ID NO

1, 3, 5, 7, 9, 11, 13, 14, 17, 18, 21, 23, 25, 27, 29, 31, 33, 34, 37 or 38.

Polynucleotides encoding the mature polypeptides of the invention include: a coding sequence encoding only the mature polypeptide; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) for the mature polypeptide as well as non-coding sequences.

The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the polynucleotides of the present invention. In the present invention, "stringent conditions" mean: (1) Hybridization and elution at lower ionic strength and higher temperature, e.g., 0.2 XSSC, 0.1% SDS,60 ℃; or (2) adding a denaturing agent such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll,42 ℃ etc. at the time of hybridization; or (3) hybridization occurs only when the identity between two sequences is at least 90% or more, preferably 95% or more. Moreover, the polypeptides encoded by the hybridizable polynucleotides have the same biological functions and activities as the mature polypeptides shown in SEQ ID NO 16 and/or SEQ ID NO 36, SEQ ID NO 20 and/or SEQ ID NO 40.

The full-length nucleotide sequence of the antibody of the present invention or a fragment thereof can be obtained by a PCR amplification method, a recombinant method, or an artificial synthesis method. One possibility is to use synthetic methods to synthesize the sequence of interest, especially when the fragment length is short. Typically, long fragments are obtained by first synthesizing a plurality of small fragments and then ligating them together. In addition, the coding sequence of the heavy chain and an expression tag (e.g., 6 His) can be fused together to form a fusion protein.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods. The biomolecules (nucleic acid, protein, etc.) to which the present invention relates include biomolecules in an isolated form.

At present, DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) have been obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

The invention also relates to a vector comprising a suitable DNA sequence as described above and a suitable promoter or control sequence. These vectors may be used to transform an appropriate host cell so that it can express the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: escherichia coli, streptomyces; bacterial cells of salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf 9; CHO, COS7, 293 cell animal cells, etc.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl ₂ Methods, the steps used are well known in the art. The other methodBy using MgCl ₂ . If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, and the like.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by an appropriate method (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

The antibodies of the invention may be used alone or in combination or conjugated with detectable labels (for diagnostic purposes), therapeutic agents, PK (protein kinase) modifying moieties or combinations of any of the above.

Detectable labels for diagnostic purposes include, but are not limited to: a fluorescent or luminescent label, a radioactive label, an MRI (magnetic resonance imaging) or CT (computed tomography) contrast agent, or an enzyme capable of producing a detectable product.

Couplable therapeutic agents include, but are not limited to: insulin, IL-2, interferon, calcitonin, GHRH peptides, gut peptide analogs, albumin, antibody fragments, cytokines, and hormones.

Therapeutic agents that may also be conjugated or conjugated to the antibodies of the invention include, but are not limited to: 1. radionuclides (Koppe et al, 2005, cancer metastasis reviews (Cancer metastasis reviews) 24, 539); 2. biotoxicity (Chaudhary et al, 1989, nature 339, 394, epel et al, 2002, cancer Immunology and Immunotherapy) 51, 565); 3. cytokines such as IL-2 etc (Gillies et al, 1992, national institute of sciences (PNAS) 89, 1428, card et al, 2004, cancer Immunology and Immunotherapy) 53, 345, haiin et al, 2003, cancer Research (Cancer Research) 63, 3202; 4. gold nanoparticles/nanorods (Lapotko et al, 2005, cancer letters (Cancer letters) 239, 36, huang et al, 2006, journal of the American Chemical Society 128, 2115); 5. viral particles (Peng et al, 2004, gene therapy 11, 1234); 6. liposomes (Mamot et al, 2005, cancer research 65, 11631); 7. nano magnetic particles; 8. a prodrug activating enzyme (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 10. chemotherapeutic agents (e.g., cisplatin) or any form of nanoparticles, and the like.

The invention also provides a composition. In a preferred embodiment, the composition is a pharmaceutical composition comprising the above-described antibody or active fragment thereof or fusion protein thereof, and a pharmaceutically acceptable carrier. Generally, these materials will be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally from about 5 to about 8, preferably from about 6 to about 8, although the pH will vary depending on the nature of the material being formulated and the condition being treated. The formulated pharmaceutical compositions may be administered by conventional routes including, but not limited to: oral, respiratory, intratumoral, intraperitoneal, intravenous, or topical administration.

The pharmaceutical composition of the present invention can be directly used for binding enterovirus D68 type, and thus can be used for prolonging the half-life of the drug, and in addition, other therapeutic agents can be used simultaneously.

The pharmaceutical composition of the present invention comprises a safe and effective amount (e.g., 0.001-99wt%, preferably 0.01-90wt%, more preferably 0.1-80 wt%) of the monoclonal antibody (or conjugate thereof) of the present invention as described above and a pharmaceutically acceptable carrier or excipient. Such vectors include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical formulation should be compatible with the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as injections, solutions are preferably manufactured under sterile conditions. The amount of active ingredient administered is a therapeutically effective amount, for example, from about 1 microgram/kg body weight to about 10 milligrams/kg body weight per day. In addition, the polypeptides of the invention may also be used with other therapeutic agents.

In the case of pharmaceutical compositions, a safe and effective amount of the immunoconjugate is administered to the mammal, wherein the safe and effective amount is typically at least about 10 micrograms/kg body weight, and in most cases no more than about 8 mg/kg body weight, preferably the dose is from about 10 micrograms/kg body weight to about 1 mg/kg body weight. Of course, the particular dosage will also take into account such factors as the route of administration, the health of the patient, and the like, which are within the skill of the skilled practitioner.

Hybridoma cell strain

The invention also provides a hybridoma cell strain capable of producing the enterovirus D68 monoclonal antibody; preferably, the invention provides a hybridoma cell strain aiming at the enterovirus D68 monoclonal antibody with high titer.

After obtaining the hybridoma producing the enterovirus D68 monoclonal antibody of the present invention, those skilled in the art can conveniently prepare the antibody using the hybridoma cell line. In addition, the structure of the antibody of the present invention (such as the heavy chain variable region and the light chain variable region of the antibody) can be easily known by those skilled in the art, and then the monoclonal antibody of the present invention can be prepared by recombinant methods.

Preparation of monoclonal antibodies

The antibodies of the invention can be prepared by a variety of techniques known to those skilled in the art. For example, an antigen of the invention (e.g., EVD68 Virus Like Particle (VLP)) can be administered to an animal to induce the production of monoclonal antibodies. For Monoclonal Antibodies, they can be prepared using hybridoma technology (see Kohler et al, nature 256, 495,1975, kohler et al, eur.J.Immunol.6:511,1976; kohler et al, eur.J.Immunol.6:292,1976, hammerling et al, in Monoclonal Antibodies and T Cell hybrids, elsevier, N.Y., 1981) or can be prepared using recombinant DNA methods (U.S. Pat. No. 4,816, 567).

Representative myeloma cells are those that fuse efficiently, support stable high-level production of antibody by selected antibody-producing cells, and are sensitive to medium (HAT medium matrix), including myeloma Cell lines such as murine myeloma Cell lines, including myeloma Cell lines derived from MOPC-21 and MPC-11 mouse tumors (available from Salk Institute Cell Distribution Center, san diego, california, usa) and SP-2, NZ0, or X63-Ag8-653 cells (available from American Type Culture Collection, rockville, maryland, usa). Human myeloma and mouse-human hybrid myeloma cell lines have also been described for the production of human monoclonal antibodies [ Kozbor, j. Immunol.,133:3001 (1984); brodeur et al, monoclonal Antibodies Production Techniques and Applications (Monoclonal Antibodies Production Techniques and Applications), pp 51-63 (Marcel Dekker, inc., new York, 1987).

The medium in which the hybridoma cells are grown is assayed to detect the production of monoclonal antibodies of the desired specificity, e.g., by in vitro binding assays such as enzyme-linked immunosorbent assay (ELISA) or Radioimmunoassay (RIA). The location of the antibody-expressing cells can be detected by FACS. The hybridoma clones can then be subcloned by limiting dilution procedures (subcloned) and grown by standard methods (Goding, monoclonal Antibodies): principles and Practice (Principles and Practice), academic Press (1986) pp 59-103). Suitable media for this purpose include, for example, DMEM or RPMI-1640 medium. In addition, the hybridoma cells can grow in the animal as ascites tumors.

The monoclonal antibodies secreted by the subclones are suitably isolated from the culture medium, ascites fluid or serum by conventional immunoglobulin purification procedures, such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis or affinity chromatography.

The invention provides a monoclonal antibody aiming at enterovirus D68, in particular to a monoclonal antibody aiming at enterovirus D68. In a preferred embodiment of the invention, the monoclonal antibody is prepared by a method for producing the monoclonal antibody from ascites of a BALB/C mouse.

The main advantages of the invention are:

(1) The invention provides two monoclonal antibodies BSD01 and BSD02 which can be specifically combined with enterovirus D68;

(2) The combination of the monoclonal antibodies BSD01 and BSD02 shows broad-spectrum and extremely high neutralization activity on various subtypes of the enterovirus D68 type;

(3) The monoclonal antibody of the invention is easy to express and purify;

(4) The combination of the monoclonal antibodies BSD01 and BSD02 can effectively prevent and treat the infection of the enterovirus D68 on a mouse model.

The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Materials and methods

The experimental materials used in the examples of the present invention are commercially available without specific reference.

1.1 cells and viruses

Human Rhabdomyosarcoma (RD) cells are cultured as described in the literature ¹ . Mouse myeloma cell line SP2/0 supplemented with 10% fetal bovineSerum (FBS) in RPMI 1640 medium (Life technologies, usa). The EVD68 strains comprise a prototype strain Fermon and two clinical isolates, namely US/MO/14-18947 and US/KY/14-18953 ² . All viruses were expanded in RD cells and titrated by the 50% tissue culture infectious dose (TCID 50) method ³ 。

1.2 antigens

EVD68 VLPs are produced in insect cells, as described in the literature ⁴ . Methods for amplification and purification of EVD68US/MO/14-18947 viral particles are described in the literature ⁵ 。

1.3 monoclonal antibody preparation

Animal studies were approved by the animal welfare and use committee of the shanghai pasteur institute. All mice were purchased from Shanghai laboratory animal center (SLAC, china).

Purified EVD68VLP (5. Mu.g/dose) was mixed well with aluminum hydroxide adjuvant (500. Mu.g/dose; invivogen, USA) prior to immunization. Aluminum-adsorbed VLP antigen was intraperitoneally injected at

weeks

0, 2, and 4 into 6-8 week old female BALB/c mice. Then, 10 μ g of VLP was injected via tail vein for boosting. Three days after the boost, splenocytes were harvested and fused with SP2/0 myeloma cells under the action of polyethylene glycol (PEG) 1450 (Sigma, USA). Fused cells were cultured for 8 days in hypoxanthine, aminopterin and thymidine (HAT; sigma) selective growth medium. Hybridoma supernatants were tested for the ability to neutralize EVD68 infection by neutralization as described below. Positive hybridoma cells were cloned 2 to 4 times by limiting dilution to obtain a monoclonal cell line. Selected hybridoma clones were amplified and subsequently injected intraperitoneally into liquid paraffin-induced BALB/c mice. Ascites were then collected and HiTrap was used ^TM The mAb was purified on a rProtein A FF affinity chromatography column (GE Healthcare, USA).

Similarly, ZIKV-specific mab 1C11 was prepared from mice immunized with the extracellular domain of recombinant ZIKV virus (ZIKV) E protein (E80), and HCV-specific mab 1F4 was prepared from mice immunized with the soluble Hepatitis C Virus (HCV) E2 protein (sE 2) (unpublished data). Both mabs served as isotype controls.

1.4 neutralization assay

The neutralizing activity of hybridoma supernatants and purified mabs against EVD68 was determined by a microneutralization assay, as described in the literature ² . The neutralizing concentration of the mab was defined as the lowest concentration of antibody that completely inhibited the cytopathic effect. Immediately after the cytopathic effect was observed, cell viability was determined using the CellTiter-Glo 2.0 kit (Promega, USA) according to the manufacturer's instructions. The percent neutralization was calculated according to the following formula: 100 × (fluorescence of given sample-fluorescence of the control sample of simplex virus)/(fluorescence of control sample of simplex cells-luminescence of the control sample of simplex virus). The median inhibitory concentration (IC 50) of each mab was calculated by non-linear regression using GraphPad Prism software. IC50 is defined as the concentration of antibody required to inhibit 50% of viral infection compared to infection in a simple viral control sample.

1.5 enzyme-linked immunosorbent assay (ELISA)

The antibody type of the mAb was identified by ELISA using the SBA Clonotyping System-HRP kit (Southern Biotech, USA) according to the manufacturer's instructions.

To determine the specificity of monoclonal antibody binding, 50 ng/well of EVD68VLP, enterovirus 71 (EV 71) VLP were coated on a miniprep ELISA plate (Nunc, USA) ⁶ Or coxsackievirus A16 (CVA 16) VLP ⁶ Overnight at 4 ℃. Blocking was then performed with 5% skim milk powder in PBS-Tween20 (PBST). After washing with PBST, 50. Mu.L/well of two-fold serial dilutions of purified mAb were added, followed by incubation at 37 ℃ for 2 hours. After washing, horseradish peroxidase (HRP) -conjugated anti-mouse IgG (1. After development, absorbance at 450nm was monitored using a microplate reader.

1.6 biofilm interferometry (BLI) assay

Prior to the BLI assay, purified EVD68VLP and US/MO/14-18947 virions were labeled with EZ-Link TM Sulfo-NHS-LC-LC-biotin kit (Thermo Fisher Scientific, USA), respectively, according to the manufacturer's instructions, and then used with Zeba ^TM A desalting column (Thermo Fisher Scientific) was centrifuged to remove excess unreacted biotin. To determine the binding affinity of the antibody to EVD68BLI measurements were performed on an Octet RED96 machine (PallFort Bio, USA) according to the manufacturer's instructions. Briefly, biotinylated EVD68VLP or US/MO/14-18947 was immobilized on a streptavidin-coated biosensor (PallForte Bio) until saturation. The antigen-bound biosensor was placed in a well containing a series of diluted mab samples to allow antigen-antibody binding, and then dissociated by immersion in dissociation buffer (0.01M PBS supplemented with 0.1% bovine serum albumin and 0.02% tween 20). The equilibrium dissociation constant (KD) was calculated using Octet data analysis software (pallfortebio).

1.7 determination and analysis of monoclonal antibody sequences

To identify the antibody sequences, total RNA was isolated from hybridoma cells using TRIzol reagent (Invitrogen, usa). First strand cDNA was then synthesized, purified and tailed using a 5'RACE System (Invitrogen) according to the manufacturer's instructions. The tailed cDNA was amplified by PCR using Ex Taq enzyme (Takara, japan) and then cloned into pMD19-T vector (Takara) for sequencing to obtain the 5' terminal sequences of the heavy and light chains of the mAb.

Determination of Complementarity Determining Region (CDR) positions using IgBLAST tools ⁷ 。

1.8 in vivo protective Capacity assay

Evaluation of the prophylactic and therapeutic efficacy of anti-EVD 68 neutralizing mAbs on a mouse model of EVD68 infection ⁵ . For the prevention experiments, groups of ICR mice (age)<24h) P.i. injection of PBS, 10. Mu.g/g anti-EVD 68 mab (2H 12 or 8F 12) or 10. Mu.g/g isotype control mab (1C 11 or 1F 4), respectively, and infection of the abdominal cavity by 8.0X 10 after one day ⁴ TCID ₅₀ US/MO/14-18947. For the treatment experiment, multiple groups of ICR mice aged one day were injected intraperitoneally with 8.0 × 10 ⁴ TCID ₅₀ US/MO/14-18947 or 1.0X 10 ⁶ TCID ₅₀ US/KY/14-18953, injected intraperitoneally 24 hours or 72 hours after infection with PBS, 10. Mu.g/g of 2H12, 10. Mu.g/g of 8F12 or a mixture of mAbs 2H12 and 8F12 (10. Mu.g/g of each mAb), respectively. Survival and clinical symptoms of all mice were observed daily for two weeks post infection. The clinical scoring grading criteria were as follows: 0, health; 1, lethargy and mobility difficulties; 2, weakness of limbs; 3, paralysis of limbs; and 4, death.

Results

2.1 preparation and neutralization of anti-EVD 68 monoclonal antibody

To prepare monoclonal antibodies against EVD68, splenocytes from EVD68VLP immunized mice were fused with SP2/0 myeloma cells to obtain hybridomas. Hybridoma cells were screened by a neutralization assay to test their ability to inhibit infection by the EVD68 clinical strain US/MO/14-18947 (EVD 68B type). Positive hybridoma cells were subcloned by limiting dilution. Finally, 4 stable clones (2G 10, 2H12, 4C11 and 8F 12) were obtained. mAbs 2G10 and 2H12 belong to the IgG2a subtype, whereas mAbs 4C11 and 8F12 belong to the IgG2b subtype (Table 2). The neutralizing effect of the four mabs on strain US/MO/14-18947 was determined by a neutralization assay. As shown in Table 2, mAbs 2G10, 2H12, 4C11 and 8F12 were all capable of neutralizing US/MO/14-18947 at neutralizing concentrations (the lowest antibody concentration required to completely inhibit the cytopathic effect) of 1.95, 0.12 and 0.06. Mu.g/mL, respectively.

The median inhibitory concentrations (IC 50; the concentration of antibody required to reduce cytopathic lesions by 50%) of 2G10, 2H12, 4C11 and 8F12 were determined to be 0.337, 0.412, 0.004. Mu.g/mL, respectively (FIG. 1). These results indicate that mAbs 4C11 and 8F12 neutralize the US/MO/14-18947 strain more effectively than mAbs 2G10 and 2H 12. In contrast, monoclonal antibody 1C11 specific to zika virus (ZIKV) (IgG 2a isotype control) and monoclonal antibody 1F4 specific to Hepatitis C Virus (HCV) (IgG 2b isotype control) did not exhibit any neutralization at the maximum concentration tested (500 μ g/mL) (table 2).

TABLE 2 characterization of anti-EVD 68 mAbs

^a And ^b : KD (equilibrium) values for the interaction of mAbs with EVD68VLP (a) or US/MO/14-18947 virus (b) were determined by BLI (see FIG. 2).

^c The neutralizing concentration of the mab is defined as the minimum antibody concentration required to completely inhibit the appearance of cytopathic effects.

^d anti-EVD 68 monoclonal antibodies 2H12 and 8F12Mixing the raw materials in a ratio of 1:1 in combination.

The results show that: the combination of BSD01 and BSD02 can effectively neutralize all EVD68 strains to be tested (see section 2.4 below).

2.2 binding Properties of anti-EVD 68 monoclonal antibodies

The ability of the mabs to recognize different antigens was tested by ELISA, including EVD68 VLPs, enterovirus 71 (EV 71) VLPs and coxsackievirus a16 (CVA 16) VLPs. The results showed that mabs 2G10, 2H12, 4C11 and 8F12 were able to react with EVD68 VLPs but not other proteins, indicating that all 4 mabs were EVD68 specific; while the corresponding isotype control antibodies 1C11 and 1F4 were completely non-reactive (fig. 2A, 2B, 2C). Furthermore, mabs 2G10 and 2H12 showed stronger binding activity to EVD68 VLPs than mabs 4C11 and 8F12 (fig. 2A).

To quantify the binding affinity of the four anti-EVD 68 mabs, a biofilm interference assay (BLI) assay was performed. In this experiment, EVD68 VLPs were immobilized onto sensors and then allowed to interact with different concentrations of anti-EVD 68 mab. 2G10 has an equilibrium dissociation constant (KD) of 5.4nM; the KD value of 2H12 is 9.9nM; the KD value of 4C11 is 22nM; the KD value for 8F12 was 28nM (FIG. 2D). Apparently, mabs 2G10 and 2H12 had higher affinity for EVD68 VLPs than mabs 4C11 and 8F12, consistent with the ELISA results described above (fig. 2A).

There appears to be a contradiction between the relatively low binding affinity of mAbs 4C11 and 8F12 to the VLP immunogen and their highly potent neutralizing activity against US/MO/14-18947. To explain this discrepancy, we determined the binding affinity of monoclonal antibodies to US/MO/14-18947 virus by BLI. As shown in FIG. 2E, the affinities of mAbs 4C11 and 8F12 for US/MO/14-18947 were significantly higher than for the VLP immunogen, with KD values below 5nM; and monoclonal antibodies 2G10 and 2H12 show lower affinity to US/MO/14-18947, and KD values are both larger than 29nM. Thus, differences in neutralizing activity of the mAbs may be explained in part by differences in the affinity of the mAbs for the US/MO/14-18947 virus.

2.3 sequence of anti-EVD 68 monoclonal antibody

To determine the antibody sequence, RNA was extracted from hybridoma cells and then subjected to rapid amplification of the 5 'end of the cDNA (5' RACE). Sequencing result display sheetanti-2G 10 and 2H12 have the same sequence, while mabs 4C11 and 8F12 have the same sequence (fig. 3). These results indicate that clones 2G10 and 2H12 were from the same parental hybridoma cell, while clones 4C11 and 8F12 were from another single clone, although all four were initially screened in different wells. For simplicity and convenience, mAbs 2H12 and 8F12 were selected for subsequent analysis. Sequence comparison analysis showed that the variable regions of the heavy chains of mAb 2H12 and mAb 8F12 (V) _H ) Has 79% similarity with the amino acid sequence of the monoclonal antibody, and the variable region of the monoclonal antibody 2H12 and the variable region of the monoclonal antibody 8F12 light chain (V) _L ) With 57% sequence similarity.

2.4 Cross-neutralization Capacity of monoclonal antibodies

The inventors also tested the cross-neutralizing potential of mabs against other EVD68 strains. As shown in Table 2, monoclonal antibodies 2G10 and 2H12 effectively neutralized clinical strain US/KY/14-18953 (EVD 68A type), and the neutralization concentration was less than 0.5. Mu.g/mL, but the neutralization effect on prototype strain Fermon was very weak or not. In contrast, 4C11 and 8F12 weakly neutralized US/KY/14-18953 but strongly neutralized Fermon at a concentration of less than 1.0. Mu.g/mL. The isotype control antibodies 1C11 and 1F4 did not show any neutralization at the maximum concentration tested (500. Mu.g/mL) for both Fermon and US/KY/14-18953 strains.

To neutralize EVD68 broadly, the inventors selected antibodies 2H12 and 8F12 and used 1:1 are combined together. As expected, this antibody combination showed a wider neutralization breadth than any single antibody (table 2). In addition, the antibody combination of the neutralizing concentration is given to a given strain with the strongest neutralizing activity of monoclonal antibody neutralizing concentration of 1/2 or 1/4. For example, the neutralization concentrations of mAbs 2H12 and 8F12 to US/KY/14-18953 were 0.12 and 125. Mu.g/mL, respectively, while the neutralization concentration of the mixture of the two antibodies to the same strain was determined to be 0.24. Mu.g/mL, which is half the neutralization concentration of mAb 2H12, indicating that only one component of the mixture, mAb 2H12, was responsible for the major effect in US/KY/14-18953. These results indicate that there is no interference or synergy in neutralization when mabs 2H12 and 8F12 are combined.

2.5 preventive efficacy of monoclonal antibodies against EVD68 infection

Established before the inventorModel of EVD68 infection-related paralysis mice ⁵ The efficacy of in vivo protection of anti-EVD 68 monoclonal antibodies was evaluated above, and this animal model was based on the highly lethal strain US/MO/14-18947. To assess the prophylactic efficacy of the mabs, groups of neonatal ICR mice were injected with PBS, 10. Mu.g/g of anti-EVD 68 mab (2H 12 or 8F 12), or 10. Mu.g/g of isotype control mab (1C 11 or 1F 4), respectively. One day later, US/MO/14-18947 infection. As shown in fig. 4, the milk mice in the PBS group and the control antibody group began to develop clinical symptoms 3 days after infection, and 69-77% of these mice eventually died. In contrast, the survival rates of neonatal mice treated with mab 2H12 and 8F12 were 92% and 100%, respectively. These results indicate that mabs 2H12 and 8F12 are effective in preventing lethal EVD68 infection in mice.

2.6 therapeutic efficacy of monoclonal antibodies against EVD68 infection

To assess the therapeutic efficacy of the mAbs, one day old ICR mice were infected with US/MO/14-18947 and 24 or 72 hours later were injected with a single needle of PBS, 10. Mu.g/g mAb 2H12, 10. Mu.g/g mAb 8F12, or a mixture of both mAbs (20. Mu.g/g total, 10. Mu.g/g of each mAb). Survival and clinical symptoms were monitored daily after infection. PBS-treated neonatal mice started to become sick at 3 days post-infection, with 74-86% of mice eventually dying from infection (fig. 5A, 5B, 5C, 5D). In contrast, mab 2H12 treatment protected 100% (13/13) and 85% (11/13) mice from lethal challenge at 1 or 3 days post-infection, respectively. Similarly, mice injected with

8F12 mab

1 or 3 days post-infection were well protected with 100% and 92% survival rates, respectively. Furthermore, mice treated with 8F12 mab showed less clinical symptoms than mice treated with 2H12 mab (fig. 5A, 5B, 5C, 5D). In addition, treatment with a mixture of antibodies 2H12 and 8F12 at 3 days post-infection protected 92% of the suckling mice from death, which was comparable to the effect of mab 8F12 treatment (fig. 5C and 5D). These results indicate that post-infection treatment with mAb 2H12, 8F12 or a combination of both mAbs can provide effective protection of mice against challenge with US/MO/14-18947.

The inventors also tested anti-EVD 68 monoclonal antibody against another lethal EVD68 strain US/KY/14-18953 ⁵ The protective effect of (1). Administered 3 days after US/KY/14-18953 infectionThe suckling mice were injected with a single dose of PBS, mAb 2H12 (10. Mu.g/g), mAb 8F12 (10. Mu.g/g) or a mixture of both mAbs (10. Mu.g/g of 2H12 and 10. Mu.g/g of 8F 12). As shown in fig. 5E and 5F, most neonatal mice treated with PBS or mab 8F12 developed symptoms of paralysis or weakness of limbs, with a final mortality of 38% and 21% in both groups, respectively. In contrast, all suckling mice receiving mab 2H12 or antibody cocktail survived without showing any signs of acroparalysis, indicating that mab 2H12 is more effective than mab 8F12 in protecting mice from US/KY/14-18953 infection. Taken together, these findings indicate that the combination of antibodies 2H12 and 8F12 can be effective in treating infection with different EVD68 strains.

All documents mentioned in this application are incorporated by reference in this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence information of the antibodies of the invention

TABLE 3 amino acid and nucleotide sequences of heavy chain CDR1-3 (VH-CDR 1, VH-CDR2, VH-CDR 3) and light chain CDR1-3 (VL-CDR 1, VL-CDR2, VL-CDR 3) of BSD01, 2H12 and their sequence numbers (SEQ ID NO.: SEQ ID NO.)

Nucleotide sequence of 2H12 heavy chain of 13 monoclonal antibody of SEQ ID NO

Note: wherein the leader peptide sequence is underlined + italicized, and the constant region sequence is underlined

Nucleotide sequence of variable region of 2H12 heavy chain of 14 monoclonal antibody SEQ ID NO

caggtccaactgcagcagcctggggctgagcttgtgatgcctggggcttcagtgaagatgtcctgcaaggcttctggctacac attcactgactactggatgcactgggtgaagcagaggcctggacaaggccttgagtggatcggagcgattgatacttctgata gttatactacctacaatcgaaagttcaagggcaaggccacattgactgtagacgaatcctccagcacagcctacatgcagct catcagcctgacatctgaggactctgcggtctattactgcgcaagaggaggggggggtaactctccttttgcttactggggcca agggactctggtcactgtctctgca

SEQ ID NO. 15 monoclonal antibody 2H12 heavy chain amino acid sequence

Note: wherein leader peptide sequences are underlined + italicized, constant region sequences are underlined,

* Is a stop codon. Bold + underlined are Complementarity Determining Regions (CDRs).

Amino acid sequence of variable region of 2H12 monoclonal antibody of SEQ ID NO. 16

Nucleotide sequence of 17 monoclonal antibody 2H12 light chain

Nucleotide sequence of variable region of 18 monoclonal antibody 2H12 light chain

gacatccagatgacccagtctccatcctccttatctgcctctctgggagaaagagtcagtctcacttgtcgggcaagtcaggac attggtagtagtttaaactggcttcagcaggaaccagatggaactattaaacgcctgatctacgccacatccagtttagattctg gtgtccccaaaaggttcagtggcagtaggtctgggtcagattattctctcaccatcagcagccttgaatctgaagattttgtaga ctattactgtctacaatatgctagttttccgctcacgttcggtgctgggaccaagctggagctgaaa

Amino acid sequence of 19 monoclonal antibody 2H12 light chain of SEQ ID NO

Note: wherein underlined + italicized indicates leader peptide sequences, underlined indicates constant region sequences,

SEQ ID NO. 20 monoclonal antibody 2H12 light chain variable region amino acid sequence

TABLE 4 heavy chain CDR1-3 (VH-CDR 1, VH-CDR2, VH-CDR 3) and of BSD02, 8F12

Amino acid sequence and nucleotide sequence of light chain CDR1-3 (VL-CDR 1, VL-CDR2, VL-CDR 3) and sequence number thereof (SEQ ID NO.:)

Nucleotide sequence of 8F12 heavy chain of 33 monoclonal antibody SEQ ID NO

Wherein the leader peptide sequence is underlined + italicized, and the constant region sequence is underlined

Nucleotide sequence of variable region of 8F12 heavy chain of 34 monoclonal antibody SEQ ID NO

caggtccaactgcagcagcctgggactgagctggtgaggcctggagcttcagtgaagctgtcctgcaaggcttctggctact ccttcaccagctactggatgaactgggtgaagcagaggcctggacaaggccttgagtggattggcatgattcatccttccgat agtgaaactaggttaaatcagaggttcaaggacaaggccacattgactgtagacaaatcctccaacacagcctacatgcaa ctcagcagcccgacatctgaggactctgcggtctattactgcgcaagagaggggtatgattacgacgggtttgcttattgggg ccaagggactctggtcactgtctctgca

Amino acid sequence of 8F12 heavy chain of 35 monoclonal antibody SEQ ID NO

Amino acid sequence of variable region of 8F12 heavy chain of 36 monoclonal antibody

SEQ ID No. 37 nucleotide sequence of monoclonal antibody 8F12 light chain

Nucleotide sequence of variable region of 8F12 light chain of 38 monoclonal antibody SEQ ID NO

caaattgttctcacccagtctccagcagccatgtctgcatctccaggggagaaggtcaccatgacctgcagtgccagctcaa gtgtgatttacatgtactggtaccagcagaagccaggatcctcccccagactcctgatttatgacacatccaacctggcttctg gagtccctgttcgcttcagtggcagtgggtctgggacctcttactctctcacaatcagccgaatggaggctgaagatgctgcca cttattactgccagcagtggagtagtttcccgtacacgttcggaggggggaccaagctggaaataaaa

SEQ ID NO. 39 monoclonal antibody 8F12 light chain amino acid sequence

SEQ ID NO. 40 amino acid sequence of monoclonal antibody 8F12 light chain variable region

Reference documents

1.Ku Z,Shi J,Liu Q,Huang Z.Development of murine monoclonal antibodies with potent neutralization effects on enterovirus 71.J Virol Methods 2012；186:193-7.

2.Zhang C et al.Enterovirus D68virus-like particles expressed in Pichia pastoris potently induce neutralizing antibody responses and confer protection against lethal viral infection in mice.Emerg Microbes Infect 2018；7:3.

3.Reed LJ,Muench H.A simple method of estimating fifty per cent endpoints. Am J Epidemiol 1938；27:493-7.

4.Dai W et al.A virus-like particle vaccine confers protection against enterovirus D68lethal challenge in mice.Vaccine 2018；36:653-9.

5.Zhang C et al.A Mouse Model of Enterovirus D68Infection for Assessment of the Efficacy of Inactivated Vaccine.Viruses 2018；10.

6.Zhang W et al.A virus-like particle-based tetravalent vaccine for hand,foot, and mouth disease elicits broad and balanced protective immunity.Emerg Microbes Infect 2018；7:94.

7.Ye J,Ma N,Madden TL,Ostell JM.IgBLAST:an immunoglobulin variable domain sequence analysis tool.Nucleic Acids Res 2013；41:W34-40.

Sequence listing

<110> Shanghai Pasteur institute of Chinese academy of sciences

<120> broad-spectrum neutralizing monoclonal antibody against enterovirus D68 type

<130> P2018-1895

<160> 40

<170> PatentIn version 3.5

<210> 1

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 1

ggctacacat tcactgacta ctgg 24

<210> 2

<211> 8

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 2

Gly Tyr Thr Phe Thr Asp Tyr Trp

1 5

<210> 3

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 3

attgatactt ctgatagtta tact 24

<210> 4

<211> 8

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 4

Ile Asp Thr Ser Asp Ser Tyr Thr

1 5

<210> 5

<211> 36

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

gcaagaggag gggggggtaa ctctcctttt gcttac 36

<210> 6

<211> 12

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 6

Ala Arg Gly Gly Gly Gly Asn Ser Pro Phe Ala Tyr

1 5 10

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

caggacattg gtagtagt 18

<210> 8

<211> 6

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 8

Gln Asp Ile Gly Ser Ser

1 5

<210> 9

<211> 9

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

gccacatcc 9

<210> 10

<211> 3

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 10

Ala Thr Ser

1

<210> 11

<211> 27

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

ctacaatatg ctagttttcc gctcacg 27

<210> 12

<211> 9

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 12

Leu Gln Tyr Ala Ser Phe Pro Leu Thr

1 5

<210> 13

<211> 1407

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

atgagatgga gctgtatcat cctcttcttg gtagcaacag ctacaggtgt caactcccag 60

gtccaactgc agcagcctgg ggctgagctt gtgatgcctg gggcttcagt gaagatgtcc 120

tgcaaggctt ctggctacac attcactgac tactggatgc actgggtgaa gcagaggcct 180

ggacaaggcc ttgagtggat cggagcgatt gatacttctg atagttatac tacctacaat 240

cgaaagttca agggcaaggc cacattgact gtagacgaat cctccagcac agcctacatg 300

cagctcatca gcctgacatc tgaggactct gcggtctatt actgcgcaag aggagggggg 360

ggtaactctc cttttgctta ctggggccaa gggactctgg tcactgtctc tgcagccaaa 420

acaacagccc catcggtcta tccactggcc cctgtgtgtg gagatacaac tggctcctcg 480

gtgactctag gatgcctggt caagggttat ttccctgagc cagtgacctt gacctggaac 540

tctggatccc tgtccagtgg tgtgcacacc ttcccagctg tcctgcagtc tgacctctac 600

accctcagca gctcagtgac tgtaacctcg agcacctggc ccagccagtc catcacctgc 660

aatgtggccc acccggcaag cagcaccaag gtggacaaga aaattgagcc cagagggccc 720

acaatcaagc cctgtcctcc atgcaaatgc ccagcaccta acctcttggg tggaccatcc 780

gtcttcatct tccctccaaa gatcaaggat gtactcatga tctccctgag ccccatagtc 840

acatgtgtgg tggtggatgt gagcgaggat gacccagatg tccagatcag ctggtttgtg 900

aacaacgtgg aagtacacac agctcagaca caaacccata gagaggatta caacagtact 960

ctccgggtgg tcagtgccct ccccatccag caccaggact ggatgagtgg caaggagttc 1020

aaatgcaagg tcaacaacaa agacctccca gcgcccatcg agagaaccat ctcaaaaccc 1080

aaagggtcag taagagctcc acaggtatat gtcttgcctc caccagaaga agagatgact 1140

aagaaacagg tcactctgac ctgcatggtc acagacttca tgcctgaaga catttacgtg 1200

gagtggacca acaacgggaa aacagagcta aactacaaga acactgaacc agtcctggac 1260

tctgatggtt cttacttcat gtacagcaag ctgagagtgg aaaagaagaa ctgggtggaa 1320

agaaatagct actcctgttc agtggtccac gagggtctgc acaatcacca cacgactaag 1380

agcttctccc ggactccggg taaatga 1407

<210> 14

<211> 357

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

caggtccaac tgcagcagcc tggggctgag cttgtgatgc ctggggcttc agtgaagatg 60

tcctgcaagg cttctggcta cacattcact gactactgga tgcactgggt gaagcagagg 120

cctggacaag gccttgagtg gatcggagcg attgatactt ctgatagtta tactacctac 180

aatcgaaagt tcaagggcaa ggccacattg actgtagacg aatcctccag cacagcctac 240

atgcagctca tcagcctgac atctgaggac tctgcggtct attactgcgc aagaggaggg 300

gggggtaact ctccttttgc ttactggggc caagggactc tggtcactgt ctctgca 357

<210> 15

<211> 468

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 15

Met Arg Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly

1 5 10 15

Val Asn Ser Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Met

20 25 30

Pro Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe

35 40 45

Thr Asp Tyr Trp Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu

50 55 60

Glu Trp Ile Gly Ala Ile Asp Thr Ser Asp Ser Tyr Thr Thr Tyr Asn

65 70 75 80

Arg Lys Phe Lys Gly Lys Ala Thr Leu Thr Val Asp Glu Ser Ser Ser

85 90 95

Thr Ala Tyr Met Gln Leu Ile Ser Leu Thr Ser Glu Asp Ser Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Gly Gly Gly Gly Asn Ser Pro Phe Ala Tyr Trp

115 120 125

Gly Gln Gly Thr Leu Val Thr Val Ser Ala Ala Lys Thr Thr Ala Pro

130 135 140

Ser Val Tyr Pro Leu Ala Pro Val Cys Gly Asp Thr Thr Gly Ser Ser

145 150 155 160

Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Pro Val Thr

165 170 175

Leu Thr Trp Asn Ser Gly Ser Leu Ser Ser Gly Val His Thr Phe Pro

180 185 190

Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu Ser Ser Ser Val Thr Val

195 200 205

Thr Ser Ser Thr Trp Pro Ser Gln Ser Ile Thr Cys Asn Val Ala His

210 215 220

Pro Ala Ser Ser Thr Lys Val Asp Lys Lys Ile Glu Pro Arg Gly Pro

225 230 235 240

Thr Ile Lys Pro Cys Pro Pro Cys Lys Cys Pro Ala Pro Asn Leu Leu

245 250 255

Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Ile Lys Asp Val Leu

260 265 270

Met Ile Ser Leu Ser Pro Ile Val Thr Cys Val Val Val Asp Val Ser

275 280 285

Glu Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu

290 295 300

Val His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr

305 310 315 320

Leu Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Met Ser

325 330 335

Gly Lys Glu Phe Lys Cys Lys Val Asn Asn Lys Asp Leu Pro Ala Pro

340 345 350

Ile Glu Arg Thr Ile Ser Lys Pro Lys Gly Ser Val Arg Ala Pro Gln

355 360 365

Val Tyr Val Leu Pro Pro Pro Glu Glu Glu Met Thr Lys Lys Gln Val

370 375 380

Thr Leu Thr Cys Met Val Thr Asp Phe Met Pro Glu Asp Ile Tyr Val

385 390 395 400

Glu Trp Thr Asn Asn Gly Lys Thr Glu Leu Asn Tyr Lys Asn Thr Glu

405 410 415

Pro Val Leu Asp Ser Asp Gly Ser Tyr Phe Met Tyr Ser Lys Leu Arg

420 425 430

Val Glu Lys Lys Asn Trp Val Glu Arg Asn Ser Tyr Ser Cys Ser Val

435 440 445

Val His Glu Gly Leu His Asn His His Thr Thr Lys Ser Phe Ser Arg

450 455 460

Thr Pro Gly Lys

465

<210> 16

<211> 119

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 16

Gln Val Gln Leu Gln Gln Pro Gly Ala Glu Leu Val Met Pro Gly Ala

1 5 10 15

Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr

20 25 30

Trp Met His Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Ala Ile Asp Thr Ser Asp Ser Tyr Thr Thr Tyr Asn Arg Lys Phe

50 55 60

Lys Gly Lys Ala Thr Leu Thr Val Asp Glu Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Gln Leu Ile Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Gly Gly Gly Asn Ser Pro Phe Ala Tyr Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Val Ser Ala

115

<210> 17

<211> 705

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 17

atgagggctc ctgcacagat ttttggcttc ttgttgctct tgtttccagg taccagatgt 60

gacatccaga tgacccagtc tccatcctcc ttatctgcct ctctgggaga aagagtcagt 120

ctcacttgtc gggcaagtca ggacattggt agtagtttaa actggcttca gcaggaacca 180

gatggaacta ttaaacgcct gatctacgcc acatccagtt tagattctgg tgtccccaaa 240

aggttcagtg gcagtaggtc tgggtcagat tattctctca ccatcagcag ccttgaatct 300

gaagattttg tagactatta ctgtctacaa tatgctagtt ttccgctcac gttcggtgct 360

gggaccaagc tggagctgaa acgggctgat gctgcaccaa ctgtatccat cttcccacca 420

tccagtgagc agttaacatc tggaggtgcc tcagtcgtgt gcttcttgaa caacttctac 480

cccaaagaca tcaatgtcaa gtggaagatt gatggcagtg aacgacaaaa tggcgtcctg 540

aacagttgga ctgatcagga cagcaaagac agcacctaca gcatgagcag caccctcacg 600

ttgaccaagg acgagtatga acgacataac agctatacct gtgaggccac tcacaagaca 660

tcaacttcac ccattgtcaa gagcttcaac aggaatgagt gttag 705

<210> 18

<211> 321

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 18

gacatccaga tgacccagtc tccatcctcc ttatctgcct ctctgggaga aagagtcagt 60

ctcacttgtc gggcaagtca ggacattggt agtagtttaa actggcttca gcaggaacca 120

gatggaacta ttaaacgcct gatctacgcc acatccagtt tagattctgg tgtccccaaa 180

aggttcagtg gcagtaggtc tgggtcagat tattctctca ccatcagcag ccttgaatct 240

gaagattttg tagactatta ctgtctacaa tatgctagtt ttccgctcac gttcggtgct 300

gggaccaagc tggagctgaa a 321

<210> 19

<211> 234

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 19

Met Arg Ala Pro Ala Gln Ile Phe Gly Phe Leu Leu Leu Leu Phe Pro

1 5 10 15

Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser

20 25 30

Ala Ser Leu Gly Glu Arg Val Ser Leu Thr Cys Arg Ala Ser Gln Asp

35 40 45

Ile Gly Ser Ser Leu Asn Trp Leu Gln Gln Glu Pro Asp Gly Thr Ile

50 55 60

Lys Arg Leu Ile Tyr Ala Thr Ser Ser Leu Asp Ser Gly Val Pro Lys

65 70 75 80

Arg Phe Ser Gly Ser Arg Ser Gly Ser Asp Tyr Ser Leu Thr Ile Ser

85 90 95

Ser Leu Glu Ser Glu Asp Phe Val Asp Tyr Tyr Cys Leu Gln Tyr Ala

100 105 110

Ser Phe Pro Leu Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg

115 120 125

Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln

130 135 140

Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr

145 150 155 160

Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln

165 170 175

Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr

180 185 190

Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg

195 200 205

His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro

210 215 220

Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

225 230

<210> 20

<211> 107

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 20

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly

1 5 10 15

Glu Arg Val Ser Leu Thr Cys Arg Ala Ser Gln Asp Ile Gly Ser Ser

20 25 30

Leu Asn Trp Leu Gln Gln Glu Pro Asp Gly Thr Ile Lys Arg Leu Ile

35 40 45

Tyr Ala Thr Ser Ser Leu Asp Ser Gly Val Pro Lys Arg Phe Ser Gly

50 55 60

Ser Arg Ser Gly Ser Asp Tyr Ser Leu Thr Ile Ser Ser Leu Glu Ser

65 70 75 80

Glu Asp Phe Val Asp Tyr Tyr Cys Leu Gln Tyr Ala Ser Phe Pro Leu

85 90 95

Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys

100 105

<210> 21

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 21

ggctactcct tcaccagcta ctgg 24

<210> 22

<211> 8

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 22

Gly Tyr Ser Phe Thr Ser Tyr Trp

1 5

<210> 23

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 23

attcatcctt ccgatagtga aact 24

<210> 24

<211> 8

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 24

Ile His Pro Ser Asp Ser Glu Thr

1 5

<210> 25

<211> 36

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 25

gcaagagagg ggtatgatta cgacgggttt gcttat 36

<210> 26

<211> 12

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 26

Ala Arg Glu Gly Tyr Asp Tyr Asp Gly Phe Ala Tyr

1 5 10

<210> 27

<211> 15

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 27

tcaagtgtga tttac 15

<210> 28

<211> 5

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 28

Ser Ser Val Ile Tyr

1 5

<210> 29

<211> 9

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 29

gacacatcc 9

<210> 30

<211> 3

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 30

Asp Thr Ser

1

<210> 31

<211> 27

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 31

cagcagtgga gtagtttccc gtacacg 27

<210> 32

<211> 9

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 32

Gln Gln Trp Ser Ser Phe Pro Tyr Thr

1 5

<210> 33

<211> 1425

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 33

atgggatgga gctctatcat cctcttcttg gtagcaacag ctacaggtgt ccactcccag 60

gtccaactgc agcagcctgg gactgagctg gtgaggcctg gagcttcagt gaagctgtcc 120

tgcaaggctt ctggctactc cttcaccagc tactggatga actgggtgaa gcagaggcct 180

ggacaaggcc ttgagtggat tggcatgatt catccttccg atagtgaaac taggttaaat 240

cagaggttca aggacaaggc cacattgact gtagacaaat cctccaacac agcctacatg 300

caactcagca gcccgacatc tgaggactct gcggtctatt actgcgcaag agaggggtat 360

gattacgacg ggtttgctta ttggggccaa gggactctgg tcactgtctc tgcagccaaa 420

acaacacccc catcagtcta tccactggcc cctgggtgtg gagatacaac tggttcctcc 480

gtgactctgg gatgcctggt caagggctac ttccctgagt cagtgactgt gacttggaac 540

tctggatccc tgtccagcag tgtgcacacc ttcccagctc tcctgcagtc tggactctac 600

actatgagca gctcagtgac tgtcccctcc agcacctggc caagtcagac cgtcacctgc 660

agcgttgctc acccagccag cagcaccacg gtggacaaaa aacttgagcc cagcgggccc 720

atttcaacaa tcaacccctg tcctccatgc aaggagtgtc acaaatgccc agctcctaac 780

ctcgagggtg gaccatccgt cttcatcttc cctccaaata tcaaggatgt actcatgatc 840

tccctgacac ccaaggtcac gtgtgtggtg gtggatgtga gcgaggatga cccagacgtc 900

cagatcagct ggtttgtgaa caacgtggaa gtacacacag ctcagacaca aacccataga 960

gaggattaca acagtactat ccgggtggtc agcaccctcc ccatccagca ccaggactgg 1020

atgagtggca aggagttcaa atgcaaggtc aacaacaaag acctcccatc acccatcgag 1080

agaaccatct caaaaattaa agggctagtc agagctccac aagtatacat cttgccgcca 1140

ccagcagagc agttgtccag gaaagatgtc agtctcactt gcctggtcgt gggcttcaac 1200

cctggagaca tcagtgtgga gtggaccagc aatgggcata cagaggagaa ctacaaggac 1260

accgcaccag tcctggactc tgacggttct tacttcatat atagcaagct caatatgaaa 1320

acaagcaagt gggagaaaac agattccttc tcatgcaacg tgagacacga gggtctgaaa 1380

aattactacc tgaagaagac catctcccgg tctccgggta aatga 1425

<210> 34

<211> 357

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 34

caggtccaac tgcagcagcc tgggactgag ctggtgaggc ctggagcttc agtgaagctg 60

tcctgcaagg cttctggcta ctccttcacc agctactgga tgaactgggt gaagcagagg 120

cctggacaag gccttgagtg gattggcatg attcatcctt ccgatagtga aactaggtta 180

aatcagaggt tcaaggacaa ggccacattg actgtagaca aatcctccaa cacagcctac 240

atgcaactca gcagcccgac atctgaggac tctgcggtct attactgcgc aagagagggg 300

tatgattacg acgggtttgc ttattggggc caagggactc tggtcactgt ctctgca 357

<210> 35

<211> 474

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 35

Met Gly Trp Ser Ser Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly

1 5 10 15

Val His Ser Gln Val Gln Leu Gln Gln Pro Gly Thr Glu Leu Val Arg

20 25 30

Pro Gly Ala Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Ser Phe

35 40 45

Thr Ser Tyr Trp Met Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu

50 55 60

Glu Trp Ile Gly Met Ile His Pro Ser Asp Ser Glu Thr Arg Leu Asn

65 70 75 80

Gln Arg Phe Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn

85 90 95

Thr Ala Tyr Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val

100 105 110

Tyr Tyr Cys Ala Arg Glu Gly Tyr Asp Tyr Asp Gly Phe Ala Tyr Trp

115 120 125

Gly Gln Gly Thr Leu Val Thr Val Ser Ala Ala Lys Thr Thr Pro Pro

130 135 140

Ser Val Tyr Pro Leu Ala Pro Gly Cys Gly Asp Thr Thr Gly Ser Ser

145 150 155 160

Val Thr Leu Gly Cys Leu Val Lys Gly Tyr Phe Pro Glu Ser Val Thr

165 170 175

Val Thr Trp Asn Ser Gly Ser Leu Ser Ser Ser Val His Thr Phe Pro

180 185 190

Ala Leu Leu Gln Ser Gly Leu Tyr Thr Met Ser Ser Ser Val Thr Val

195 200 205

Pro Ser Ser Thr Trp Pro Ser Gln Thr Val Thr Cys Ser Val Ala His

210 215 220

Pro Ala Ser Ser Thr Thr Val Asp Lys Lys Leu Glu Pro Ser Gly Pro

225 230 235 240

Ile Ser Thr Ile Asn Pro Cys Pro Pro Cys Lys Glu Cys His Lys Cys

245 250 255

Pro Ala Pro Asn Leu Glu Gly Gly Pro Ser Val Phe Ile Phe Pro Pro

260 265 270

Asn Ile Lys Asp Val Leu Met Ile Ser Leu Thr Pro Lys Val Thr Cys

275 280 285

Val Val Val Asp Val Ser Glu Asp Asp Pro Asp Val Gln Ile Ser Trp

290 295 300

Phe Val Asn Asn Val Glu Val His Thr Ala Gln Thr Gln Thr His Arg

305 310 315 320

Glu Asp Tyr Asn Ser Thr Ile Arg Val Val Ser Thr Leu Pro Ile Gln

325 330 335

His Gln Asp Trp Met Ser Gly Lys Glu Phe Lys Cys Lys Val Asn Asn

340 345 350

Lys Asp Leu Pro Ser Pro Ile Glu Arg Thr Ile Ser Lys Ile Lys Gly

355 360 365

Leu Val Arg Ala Pro Gln Val Tyr Ile Leu Pro Pro Pro Ala Glu Gln

370 375 380

Leu Ser Arg Lys Asp Val Ser Leu Thr Cys Leu Val Val Gly Phe Asn

385 390 395 400

Pro Gly Asp Ile Ser Val Glu Trp Thr Ser Asn Gly His Thr Glu Glu

405 410 415

Asn Tyr Lys Asp Thr Ala Pro Val Leu Asp Ser Asp Gly Ser Tyr Phe

420 425 430

Ile Tyr Ser Lys Leu Asn Met Lys Thr Ser Lys Trp Glu Lys Thr Asp

435 440 445

Ser Phe Ser Cys Asn Val Arg His Glu Gly Leu Lys Asn Tyr Tyr Leu

450 455 460

Lys Lys Thr Ile Ser Arg Ser Pro Gly Lys

465 470

<210> 36

<211> 119

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 36

Gln Val Gln Leu Gln Gln Pro Gly Thr Glu Leu Val Arg Pro Gly Ala

1 5 10 15

Ser Val Lys Leu Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Ser Tyr

20 25 30

Trp Met Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp Ile

35 40 45

Gly Met Ile His Pro Ser Asp Ser Glu Thr Arg Leu Asn Gln Arg Phe

50 55 60

Lys Asp Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Asn Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Pro Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Glu Gly Tyr Asp Tyr Asp Gly Phe Ala Tyr Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Val Ser Ala

115

<210> 37

<211> 708

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 37

atggattttc aagtgcagat tttcagcttc ctgctaatca gtgcctcagt catactgtcc 60

agaggacaaa ttgttctcac ccagtctcca gcagccatgt ctgcatctcc aggggagaag 120

gtcaccatga cctgcagtgc cagctcaagt gtgatttaca tgtactggta ccagcagaag 180

ccaggatcct cccccagact cctgatttat gacacatcca acctggcttc tggagtccct 240

gttcgcttca gtggcagtgg gtctgggacc tcttactctc tcacaatcag ccgaatggag 300

gctgaagatg ctgccactta ttactgccag cagtggagta gtttcccgta cacgttcgga 360

ggggggacca agctggaaat aaaacgggct gatgctgcac caactgtatc catcttccca 420

ccatccagtg agcagttaac atctggaggt gcctcagtcg tgtgcttctt gaacaacttc 480

taccccaaag acatcaatgt caagtggaag attgatggca gtgaacgaca aaatggcgtc 540

ctgaacagtt ggactgatca ggacagcaaa gacagcacct acagcatgag cagcaccctc 600

acgttgacca aggacgagta tgaacgacat aacagctata cctgtgaggc cactcacaag 660

acatcaactt cacccattgt caagagcttc aacaggaatg agtgttag 708

<210> 38

<211> 318

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 38

caaattgttc tcacccagtc tccagcagcc atgtctgcat ctccagggga gaaggtcacc 60

atgacctgca gtgccagctc aagtgtgatt tacatgtact ggtaccagca gaagccagga 120

tcctccccca gactcctgat ttatgacaca tccaacctgg cttctggagt ccctgttcgc 180

ttcagtggca gtgggtctgg gacctcttac tctctcacaa tcagccgaat ggaggctgaa 240

gatgctgcca cttattactg ccagcagtgg agtagtttcc cgtacacgtt cggagggggg 300

accaagctgg aaataaaa 318

<210> 39

<211> 235

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 39

Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser

1 5 10 15

Val Ile Leu Ser Arg Gly Gln Ile Val Leu Thr Gln Ser Pro Ala Ala

20 25 30

Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser

35 40 45

Ser Ser Val Ile Tyr Met Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Ser

50 55 60

Pro Arg Leu Leu Ile Tyr Asp Thr Ser Asn Leu Ala Ser Gly Val Pro

65 70 75 80

Val Arg Phe Ser Gly Ser Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile

85 90 95

Ser Arg Met Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp

100 105 110

Ser Ser Phe Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

115 120 125

Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu

130 135 140

Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe

145 150 155 160

Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg

165 170 175

Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser

180 185 190

Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu

195 200 205

Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser

210 215 220

Pro Ile Val Lys Ser Phe Asn Arg Asn Glu Cys

225 230 235

<210> 40

<211> 106

<212> PRT

<213> Artificial sequence (Artificial sequence)

<400> 40

Gln Ile Val Leu Thr Gln Ser Pro Ala Ala Met Ser Ala Ser Pro Gly

1 5 10 15

Glu Lys Val Thr Met Thr Cys Ser Ala Ser Ser Ser Val Ile Tyr Met

20 25 30

Tyr Trp Tyr Gln Gln Lys Pro Gly Ser Ser Pro Arg Leu Leu Ile Tyr

35 40 45

Asp Thr Ser Asn Leu Ala Ser Gly Val Pro Val Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr Ile Ser Arg Met Glu Ala Glu

65 70 75 80

Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp Ser Ser Phe Pro Tyr Thr

85 90 95

Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

Claims

1. An antibody specific for enterovirus type D68, said antibody having a heavy chain variable region and a light chain variable region, wherein,

(1) The heavy chain variable region has Complementarity Determining Regions (CDRs) as shown below:

VH-CDR1 shown in SEQ ID NO. 2,

VH-CDR2 of SEQ ID NO 4, and

VH-CDR3 shown in SEQ ID NO. 6;

and the light chain variable region has complementarity determining regions CDRs as shown below:

VL-CDR1 shown in SEQ ID NO. 8,

VL-CDR2 shown in SEQ ID NO. 10, and

VL-CDR3 shown in SEQ ID NO. 12;

or

(2) The heavy chain variable region has the complementarity determining regions CDRs as shown below:

VH-CDR1 shown in SEQ ID NO. 22,

VH-CDR2 shown in SEQ ID NO:24, and

VH-CDR3 shown in SEQ ID NO. 26;

VL-CDR1 shown in SEQ ID NO 28,

VL-CDR2 of SEQ ID NO. 30, and

VL-CDR3 shown in SEQ ID NO. 32.

2. The antibody of claim 1, wherein the heavy chain variable region of said antibody has the amino acid sequence set forth in SEQ ID No. 16 and the light chain variable region of said antibody has the amino acid sequence set forth in SEQ ID No. 20; or

The heavy chain variable region of the antibody has the amino acid sequence shown in SEQ ID NO. 36, and the light chain variable region of the antibody has the amino acid sequence shown in SEQ ID NO. 40.

3. The antibody of claim 1, wherein the heavy chain of said antibody has the amino acid sequence set forth in SEQ ID No. 15 and the light chain of said antibody has the amino acid sequence set forth in SEQ ID No. 19; or

The heavy chain of the antibody has an amino acid sequence shown in SEQ ID NO. 35, and the light chain of the antibody has an amino acid sequence shown in SEQ ID NO. 39.

4. The antibody of claim 1, wherein said antibody has a heavy chain constant region and a light chain constant region, wherein said heavy chain constant region or light chain constant region is human or murine.

5. The antibody of claim 1, wherein said antibody comprises: a single chain antibody, a diabody, a monoclonal antibody, a chimeric antibody, a murine antibody, or a humanized antibody.

6. The antibody of claim 5, wherein said chimeric antibody is a human murine chimeric antibody.

7. A recombinant protein, said recombinant protein having:

(i) The antibody of claim 1; and

(ii) Optionally a tag sequence to assist expression and/or purification.

8. The recombinant protein according to claim 7, wherein said tag sequence is selected from the group consisting of: 6' His label, GGGS sequence and FLAG label.

9. The recombinant protein according to claim 7 or 8, wherein said recombinant protein specifically binds enterovirus type D68.

10. A polynucleotide encoding a polypeptide selected from the group consisting of:

(1) The antibody of claim 1; or

(2) The recombinant protein of claim 6.

11. The polynucleotide of claim 10, wherein said polynucleotide encodes a heavy chain variable region and a light chain variable region of said antibody,

(1) The nucleotide sequence for coding the heavy chain variable region is shown as SEQ ID NO. 14, and the nucleotide sequence for coding the light chain variable region is shown as SEQ ID NO. 18; or

(2) The nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO. 34, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID NO. 38.

12. The polynucleotide of claim 10, wherein said polynucleotide encodes a heavy chain and a light chain of said antibody, wherein,

(1) The nucleotide sequence encoding the heavy chain is shown as SEQ ID NO. 13, and the nucleotide sequence encoding the light chain is shown as SEQ ID NO. 17; or

(2) The nucleotide sequence encoding the heavy chain is shown as SEQ ID NO. 33, and the nucleotide sequence encoding the light chain is shown as SEQ ID NO. 37.

13. A vector comprising the polynucleotide of claim 10.

14. The vector of claim 13, wherein the vector is selected from the group consisting of: a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus, or a mammalian cell virus.

15. The vector of claim 14, wherein the mammalian cell virus comprises an adenovirus or a retrovirus.

16. A genetically engineered host cell comprising the vector of claim 13 or having the polynucleotide of claim 10 integrated into its genome.

17. An immunoconjugate, comprising:

(a) The antibody of claim 1, or the recombinant protein of claim 7; and

(b) A coupling moiety selected from the group consisting of: a detectable label, drug, toxin, or enzyme.

18. The immunoconjugate of claim 17, wherein the detectable label comprises a radionuclide.

19. The immunoconjugate of claim 17, wherein the drug comprises a cytokine.

20. The immunoconjugate of claim 17, wherein the conjugate is selected from the group consisting of: fluorescent or luminescent labels, radioactive labels, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, enzymes capable of producing a detectable product, biological toxins, cytokines, antibodies, antibody Fc fragments, antibody scFv fragments, viral particles, liposomes, prodrug activating enzymes, chemotherapeutic agents, or nanoparticles in any form.

21. The immunoconjugate of claim 19 or 20, wherein the cytokine comprises IL-2.

22. The immunoconjugate of claim 20, wherein the nanoparticle of any form comprises a gold nanoparticle or nanorod, a nanomagnet.

23. The immunoconjugate of claim 20, wherein the prodrug activating enzyme is DT-diaphorase or a biphenyl hydrolase-like protein.

24. The immunoconjugate of claim 20, wherein the chemotherapeutic agent comprises cisplatin.

25. A pharmaceutical composition comprising:

(i) The antibody of claim 1, or the recombinant protein of claim 7, or the immunoconjugate of claim 17, or a combination thereof; and

(ii) A pharmaceutically acceptable carrier.

26. The pharmaceutical composition of claim 25, wherein the pharmaceutical composition is in an injectable dosage form.

27. The pharmaceutical composition of claim 25, wherein the pharmaceutical composition is for use in the preparation of a medicament for treating an enterovirus type D68 infection.

28. Use of the antibody of claim 1, the recombinant protein of claim 7, or the immunoconjugate of claim 17, for the preparation of a medicament, a reagent, a detection plate, or a kit.

29. The use of claim 28, wherein the reagent, test panel or kit is for the detection of enterovirus type D68; the medicament is for use in the treatment and/or prevention of enterovirus type D68 infection.

30. The use of claim 28, wherein the reagent comprises a chip, antibody-coated immunoparticles.

31. A method for non-disease diagnostic detection of enterovirus type D68 in a sample, said method comprising the steps of:

(1) Contacting a sample with the antibody of claim 1; and

32. A method of producing a recombinant polypeptide, the method comprising:

(a) Culturing the host cell of claim 16 under conditions suitable for expression;

(b) Isolating a recombinant polypeptide from the culture, said recombinant polypeptide being the antibody of claim 1 or the recombinant protein of claim 7.

33. A pharmaceutical combination, comprising:

(i) A first active ingredient comprising: the antibody of claim 1, the recombinant protein of claim 7, the immunoconjugate of claim 17, the pharmaceutical composition of claim 25, or a combination thereof; and

(ii) A second active ingredient comprising a second antibody, an antiviral drug.

34. Use of the antibody of claim 1, the recombinant protein of claim 7, the immunoconjugate of claim 17, or the pharmaceutical composition of claim 25 in combination with a second antibody or an antiviral drug, in the manufacture of a medicament for treating EVD68 single virus infection or a mixed virus infection thereof.

35. The use of claim 34, wherein the mixed viral infection comprises a mixed EVD68 and EV71 infection.

36. The use of claim 34, wherein the second antibody is an additional anti-EVD 68 antibody; the antiviral drug is an EVD68 virus resistant drug.

37. The use of claim 36, wherein said anti-EVD 68 antibody comprises A6-1.

38. The use of claim 36, wherein said anti-EVD 68 viral agent comprises pleconanil (pleconaril).