WO2018008852A1 - Il-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법 - Google Patents

Il-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법 Download PDF

Info

Publication number
WO2018008852A1
WO2018008852A1 PCT/KR2017/005693 KR2017005693W WO2018008852A1 WO 2018008852 A1 WO2018008852 A1 WO 2018008852A1 KR 2017005693 W KR2017005693 W KR 2017005693W WO 2018008852 A1 WO2018008852 A1 WO 2018008852A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
mrna
screening
skin
gene
Prior art date
Application number
PCT/KR2017/005693
Other languages
English (en)
French (fr)
Inventor
이애영
이혜진
김지영
Original Assignee
동국대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 동국대학교 산학협력단 filed Critical 동국대학교 산학협력단
Publication of WO2018008852A1 publication Critical patent/WO2018008852A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/52—Assays involving cytokines
    • G01N2333/54—Interleukins [IL]
    • G01N2333/545—IL-1

Definitions

  • the present invention relates to a composition for screening skin irritation substances comprising IL-1ra and a method for screening skin irritation substances using the same.
  • Topical phenolic materials including hydroquinone (HQ) and non-phenolic materials, including retinoids, are used to treat hyperpigmentation.
  • Topical hydroquinones are the best known therapeutic agents and are familiarly used in combination therapies such as in combination with topical retinoids and corticosteroids, including all trans-retinoic acids.
  • HQ is used for whitening of skin pigmentation, but skin irritation is one of its side effects.
  • topical retinoic acid (RA) the most common side effect is stimulus response to stimuli of varying intensities such as dryness, scaling, erythema, burning or / and wounding. Because skin irritation can cause post-inflammatory hyperpigmentation, efforts are being made to reduce the potential for potential irritation without losing efficiency as a drug of retinoic acid.
  • Skin irritation is one of the common side effects of environmental hazards that are harmful to humans.
  • One repetitive, continuous irritant causes irritant dermatitis.
  • the most common of these stimulants are compounds. All substances are somewhat irritant.
  • Skin irritation can be induced through a variety of mechanisms associated with skin barrier destruction, induction of cytokinin cascades and oxidative stress networks. Different classes of substances cause skin irritation through different mechanisms.
  • Potential stimulants are associated with reduced cell viability. However, cytotoxicity studies do not necessarily predict stimulants or non-irritants. In the extracellular experiments, there is no standardized experimental protocol for assessing stimulation, so it is necessary to observe the molecular and cellular responses induced by the stimulant (see Korean Patent No. 10-1134088).
  • the present invention has been made to solve the above-mentioned problems in the prior art, the inventors of the present invention, hydroquinone (HQ), retinoic acid (RA) and SLS (sodium lauryl sulfate) when treating keratinocytes, IL-1
  • HQ hydroquinone
  • RA retinoic acid
  • SLS sodium lauryl sulfate
  • an object of the present invention is 1) treating the skin stimulation candidates on keratinocytes; 2) measuring the expression level of the mRNA or protein of the IL-1ra gene from the cells of step 1); And 3) comparing the expression level of the mRNA or protein of the gene with the expression level of the mRNA or protein of the control group treated with hydroquinone (HQ), retinoic acid (RA), SLS or ursiol in keratinocytes.
  • HQ hydroquinone
  • RA retinoic acid
  • SLS ursiol
  • the present invention comprises the steps of: 1) treating the skin stimulation candidates on keratinocytes; 2) measuring the expression level of the mRNA or protein of the IL-1ra gene from the cells of step 1); And 3) comparing the expression level of the mRNA or protein of the gene with the expression level of the mRNA or protein of the control group treated with hydroquinone (HQ), retinoic acid (RA), SLS or ursiol in keratinocytes.
  • HQ hydroquinone
  • RA retinoic acid
  • SLS ursiol
  • the expression level of the mRNA or protein of the IL-1ra gene in step 3 when the expression level of the mRNA or protein of the IL-1ra gene in step 3) is similar or higher than at least one of the control, it can be determined as a skin irritant.
  • the method for measuring the mRNA expression level is reverse transcriptase (RT-PCR), competitive reverse transcriptase (Competitive RT-PCR), real time reverse transcriptase (Realtime RT-PCR) And one or more methods selected from the group consisting of RNase protection assay (RPA), Northern blotting, and DNA chips.
  • RT-PCR reverse transcriptase
  • Competitive RT-PCR competitive reverse transcriptase
  • Realtime RT-PCR real time reverse transcriptase
  • RPA RNase protection assay
  • Northern blotting DNA chips.
  • the method for measuring the expression level of the protein is Western blot, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, ouktero Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, fluorescence activated cell sorter (FACS) and protein chip (FACS) protein chip) may be one or more methods selected from the group consisting of.
  • the present invention also provides a composition for screening a skin irritant, comprising an agent for measuring the expression level of the mRNA or protein of the IL-1ra gene.
  • the present invention also provides a skin irritant screening kit comprising the composition.
  • the present invention relates to a composition for screening a skin irritant comprising IL-1ra and a method for screening a skin irritant using the same, wherein the IL-1ra gene is a skin irritant such as hydroquinone (HQ), retinoic acid (RA) or
  • HQ hydroquinone
  • RA retinoic acid
  • the expression level is increased, so that harmful skin irritants can be screened using the gene. Therefore, animal testing of cosmetic raw materials is prohibited and can be usefully used as a method for screening skin irritants that can replace them.
  • FIG. 1 shows the real time-PCR of IL-1 ⁇ , IL-1 ⁇ and IL-1ra when hydroquinone (a), retinoic acid (b), SLS (c) or ursiol (d) were treated to keratinocytes. The figure which shows the result of.
  • Figures 2a to 2c shows the results of confirming the expression of IL-1ra protein by Western blot analysis (a and b) and ELISA (c) after hydroquinone, retinoic acid or SLS treated keratinocytes It is also.
  • Figure 3a to 3d is treated with hydroquinone, retinoic acid or SLS to keratinocytes, cell viability according to the MTT test (a and b), TUNEL test (c) to confirm the dead cells, Western Blot analysis (d) was performed to confirm the cleaved caspase-3 expression effect.
  • Figures 4a to 4d shows the treatment of hydroquinone, retinoic acid or SLS to keratinocytes, followed by Western blot analysis (a and b) and ELISA (c and d) to perform intracellular / extracellular IL-1 ⁇ and IL- This figure confirms the effect of rhIL-1ra on 1 ⁇ expression.
  • the present inventors based on the fact that when treated with a typical hydroquinone (HQ), retinoic acid (RA) or SLS as a skin irritant to keratinocytes in the embodiment, the mRNA or protein expression of the IL-1ra gene is increased IL-1ra mRNA expression and intracellular / extracellular IL-1ra protein expression were specifically identified, and the present invention was completed based on this.
  • HQ hydroquinone
  • RA retinoic acid
  • the present invention comprises the steps of: 1) treating the skin stimulation candidates to keratinocytes; 2) measuring the expression level of the mRNA or protein of the IL-1ra gene from the cells of step 1); And 3) comparing the expression level of the mRNA or protein of the gene with the expression level of the mRNA or protein of the control group treated with hydroquinone (HQ), retinoic acid (RA), SLS or ursiol in keratinocytes.
  • HQ hydroquinone
  • RA retinoic acid
  • SLS ursiol
  • the expression level of the mRNA or protein of the IL-1ra gene in step 3) of the present invention is similar or higher than at least one of the control, it can be determined as a skin irritant.
  • the "IL-1ra gene” is an antagonist of IL-1 ⁇ and IL-1 ⁇ , and IL-1ra is chronic for stimulation, whereas upon stimulation exposure, IL-1 ⁇ is increased by a single exposure to stimulation. Since the expression amount increases upon repeated exposure to phosphorus, it can be used more effectively in consideration of the stimulus that appears during repeated long-term use. In addition, the role of endogenous antagonists of IL-1ra against IL-1 ⁇ and IL-1 ⁇ in skin irritation is rarely observed, but the antagonism of IL-1ra and IL-1 ⁇ released from cells is It can reduce the killing of keratinocytes induced by chemicals.
  • mRNA expression level measurement is a process of confirming the presence and expression level of mRNA of the gene in keratinocytes, by measuring the amount of mRNA.
  • Analytical methods for this include, for example, reverse transcriptase (RT-PCR), competitive reverse transcriptase (RT) PCR, real time reverse transcriptase (Realtime RT-PCR), RNase protection assay (RPA; RNase protection assay, Northern blotting, DNA chip, and the like, but are not limited thereto.
  • Antisense oligonucleotides refers to a sequence of nucleotide bases in which an antisense oligomer hybridizes with a target sequence in RNA by Watson-Crick base pairing, thereby allowing formation of mRNA and RNA: oligomeric heterodimers, typically within the target sequence. And oligomers having backbones between subunits. The oligomer may have exact sequence complementarity or approximate complementarity to the target sequence. These antisense oligomers can alter or process the processing of mRNA, which blocks or inhibits translation of mRNA and produces splice variants of the mRNA.
  • primer refers to a short nucleic acid sequence that can form a base pair with a complementary template with a nucleic acid sequence having a short free 3-terminal hydroxyl group and that serves as a starting point for template strand copying. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures.
  • probe refers to a nucleic acid fragment such as RNA or DNA corresponding to short bases of several hundred bases and hundreds of bases capable of specific binding with mRNA and is labeled to indicate the presence or absence of a specific mRNA. You can check it. Probes can be made in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes and the like. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.
  • genes of the present invention have nucleic acid sequences registered in the gene bank, those skilled in the art can design antisense oligonucleotides, primer pairs or probes that specifically amplify specific regions of these genes based on the sequences.
  • Antisense oligonucleotides, primers or probes of the present invention can be chemically synthesized using the phosphor amidite solid support method, or other well known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution with one or more homologs of natural nucleotides, and modifications between nucleotides, eg, uncharged linkages such as methyl phosphonate, phosphoester, phosphoro Modifications to armidae, carbamate, etc.) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.).
  • measurement of protein expression level refers to a process of confirming the presence and expression level of a protein expressed from a gene of the present invention in keratinocytes in order to screen a candidate material for skin stimulation.
  • Western blot ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis , Tissue immunity staining, immunoprecipitation assay, complement fixation assay, fluorescence activated cell sorter (FACS), protein chip, and the like, but are not limited thereto.
  • Agents for measuring protein expression levels in the present invention are preferably antibodies.
  • antibody refers to a specific protein molecule directed against an antigenic site.
  • an antibody refers to an antibody that specifically binds to a marker protein and includes all polyclonal antibodies, monoclonal antibodies and recombinant antibodies.
  • the mRNA expression of the IL-1ra gene was found to increase (see Example 3).
  • the IL-1ra gene according to the present invention can be used for various purposes and uses requiring screening of harmful skin irritants using the gene, as the expression thereof is increased when the skin irritants are treated.
  • the present invention provides a composition for screening a skin irritant comprising an agent for measuring the expression level of mRNA or protein of the IL-1ra gene.
  • the present invention also provides a skin irritant screening kit comprising the composition.
  • kits of the present invention can screen skin irritants by confirming the expression level of mRNA or protein of IL-1ra gene.
  • Kits of the present invention may further comprise one or more other component compositions, solutions, or devices suitable for analytical methods, as well as primers, probes, antibodies, etc., for screening skin irritants, preferably RT-PCR It may be in the form of a kit, a microarray chip kit, a DNA chip kit, a protein chip kit, but is not limited thereto.
  • the kit for measuring the mRNA expression level of the gene in the present invention may be a kit containing the necessary elements necessary to perform RT-PCR.
  • RT-PCR kits include test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC- Water (DEPC-water), sterile water and the like.
  • the kit of the present invention may be a kit including essential elements necessary for performing a microarray.
  • the microarray kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached with a probe, and the substrate may include a cDNA corresponding to a quantitative control gene or a fragment thereof, using a gene of the present invention. It can be easily prepared by the manufacturing method commonly used in the art.
  • the substrate of the microarray chip is preferably coated with an active group selected from the group consisting of amino-silane, poly-L-lysine and aldehyde, but is not limited thereto.
  • the substrate is preferably selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane and nitrocellulose membrane, but is not limited thereto.
  • the kit of the present invention may be a kit containing essential elements necessary for carrying out the DNA chip.
  • the DNA chip kit may include a substrate on which a cDNA or oligonucleotide corresponding to a gene or a fragment thereof is attached, and a reagent, an agent, an enzyme, or the like for preparing a fluorescent probe.
  • the substrate may also comprise cDNA or oligonucleotide corresponding to the control gene or fragment thereof.
  • keratinocyte culture individual epidermal cells were suspended in EpiLife medium (Invitrogen, Carlsbad, CA) to which bovine pituitary extract, bovine insulin, hydrocortisone, human epidermal growth factor and bovine transferrin (Invitrogen) were added. .
  • the harvested cells were resuspended in each medium at 7.5 ⁇ 10 4 cells / mL and seeded at 6 ⁇ well plates at 1.5 ⁇ 10 5 cells per well. After 1 day of inoculation, chemicals of each concentration were added and after 1 day each chemical of appropriate concentration was added. After 2 days, keratinocytes were harvested and subjected to cell viability test, TUNEL test, real time PCR, Western blot analysis and ELISA.
  • mice Eight-week-old female C57BL / 6 mice purchased from Orient Bio (Gyeonggi-do, South Korea) were maintained under uncontrolled normal air conditions in experimental animal breeding rooms at Dongguk University School of Medicine. The local animal testing ethics committee approved all described protocols.
  • the hair on the back of the mouse was shaved using an electric shaver, and then treated with a skin hair remover (Iron Pharmaceuticals) .After 1 day, a patch was applied using a 2 cm diameter gauze patch and shaved. Each appropriate concentration of chemical was infiltrated on the dorsal skin. The procedure was repeated twice for 48 hours.
  • the chemically treated full thickness skin samples were biopsied and stored at ⁇ 80 ° C. until used for immunohistochemistry.
  • hydroquinone HQ, Sigma Aldrich, St Louis, MO, USA
  • retinoic acid RA, Sigma Aldrich
  • DMSO sodium lauryl sulfate
  • SLS sodium lauryl sulfate
  • Creams were prepared by adding 10% and 20% HQ and 0.1% and 0.5% RA to the petrolatum base for in vivo studies.
  • Recombinant human interleukin-1 receptor antagonist rhIL-1 receptor antagonist (ra) was purchased from R & D Systems (Minneapolis, Mass.).
  • TUNEL assay to detect dead cells was performed using Apo-BrdU TUNEL assay kit (A23210, Invitrogen) processed according to manufacturer's instructions. Cells were fixed in 2% paraformaldehyde and 70% ice cold ethanol and the stained cells were observed under fluorescence microscopy. Four random fields were taken from dead cells for quantitative analysis of cell death and total cells were counted.
  • CDNA was synthesized from total RNA using the First Strand cDNA Synthesis Kit for RT-PCR (AMV, Boehringer Mannheim, Germany), and the amount of target mRNA was quantified using a Light Cycler RT-PCR instrument (Roche, Penzberg, Germany). .
  • the relative amount of mRNA is the ratio of each target to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primer sequences for real time PCR are shown in Table 1 below.
  • the same amount of extracted protein was dissolved and delivered to the nitrocellulose membrane.
  • the membrane was incubated with antibodies against IL-1 ⁇ and IL-1 ⁇ (Santa Cruz Biotechnology, Santa Cruz, Calif.), IL-1ra and Cleaved caspase-3 (Cell Signaling Technology, Beverly, Mass.). After incubation with an appropriate anti-mouse or anti-rabbit horseradish peroxidase-conjugated antibody (Thermo) and enhanced chemiluminescent solution (Thermo), signal on an image input device (LAS-3000, Fuji Photo Film, Tokyo, Japan) was captured. To monitor the amount of protein loaded in each lane, the membrane was re-probed with mouse monoclonal anti- ⁇ -actin antibody (Sigma) and processed as described above. Protein bands were then analyzed by density measurement.
  • Example 1-2 normal human keratinocytes cultured in Example 1-2 were treated with different doses of the drug in Examples 1-4. Experiment was as follows.
  • the stimulation concentrations were 70 to 80% and 40 to 50% cell survival in the range of 20 to 40 ⁇ M HQ, 0.5 to 1.5 ⁇ M RA, 8 to 12 ⁇ M SLS and 1 to 2 ⁇ M urushiol, respectively. Indicated.
  • IL-1ra mRNA expression was found to increase in these chemicals in a time and dose dependent manner.
  • the absolute level of IL-1ra mRNA expression is lower than that of IL-1 ⁇ and IL-1 ⁇ , the fold increase of IL-1ra by each chemical is typically compared to the corresponding solvents. Higher than the fold increase of -1 ⁇ .
  • the fold increase in IL-1ra mRNA was more constant compared to the positive controls IL-1 ⁇ and IL-1 ⁇ mRNA, which was more pronounced in the ursiol treated cells (D).
  • Example 3 Based on the mRNA expression results of Example 3, Western blot analysis for IL-1ra protein expression in cells (Examples 1-7) and ELISA analysis for IL-1ra protein released to cells (Examples 1-8) ) was performed 48 hours after treatment with HQ, RA and SLS at the same cytotoxic dose (70-80% and 40-50% cell survival). In addition, immunofluorescence staining (Examples 1-9) was performed on erythema-induced mouse skin samples treated with different concentrations of HQ or RA.
  • Example 5 rhIL - 1ra (Recombinant human IL- 1ra Reduction of apoptosis of keratinocytes by treatment
  • Example 4 it was confirmed that the expression of IL-1ra protein was increased in keratinocytes and mouse skin by the cytotoxic dose of the chemical agent (FIGS. 2A to 2C). Based on the action of IL-1ra by binding, experiments were performed as in Example 1-5 to confirm the effect of rhIL-1ra on the survival of keratinocytes.
  • rhIL-1ra in a broad concentration range up to 500 ng / ml did not reduce the number of viable cells in primary cultured human keratinocytes.
  • FIGS. 3A-3D rhIL-1ra in a broad concentration range up to 500 ng / ml (Conti et al., 1997) did not reduce the number of viable cells in primary cultured human keratinocytes.
  • FIG. 3A the rhIL-1ra dose-dependently increased the number of viable cells that were reduced by the cytotoxic dose of chemical
  • the number of TUNEL-positive keratinocytes increased by the cytotoxic dose of chemical was decreased by rhIL-1ra (FIG. 3C), and the expression level of Cleaved caspase-3 was also decreased in the presence of rhIL-1ra.
  • FIGS. 3A-3D rhIL-1ra in a broad concentration range up to 500 ng / ml
  • Example 6 rhIL - 1ra (Recombinant human IL- 1ra Chemical stimulation-induced IL- by treatment 1 ⁇ And IL- 1 ⁇ Confirmation of the effect of reducing expression
  • IL-1ra is known to inhibit IL-1 ⁇ and IL-1 ⁇ activity by competitively inhibiting the binding of cell surface IL-1 receptors (Arend et al., 1998). Therefore, Western blot analysis (Examples 1-7) and ELISA (Examples 1-8) were performed to confirm the effects of rhIL-1ra on intracellular / extracellular IL-1 ⁇ and IL-1 ⁇ expression.
  • FIGS. 4A-4D Western blot analysis showed that 500 ng / ml of rhIL-1ra increased the levels of IL-1 ⁇ and IL-1 ⁇ that were increased by the cytotoxic dose of chemicals.
  • FIGS. 4A and 4B Western blot analysis showed that IL-1 ⁇ was increased by the cytotoxic dose of the chemical, even though the level of RA-treated IL-1 ⁇ was rather high.
  • intracellular levels of IL-1 ⁇ were shown to be reduced by rhIL-1ra (FIGS. 4C and 4D).
  • IL-1ra released from cells can reduce the killing of keratinocytes induced by chemicals by antagonism against IL-1 ⁇ and IL-1 ⁇ . it means.
  • the present invention relates to a composition for screening a skin stimulant comprising IL-1ra and a method for screening a skin stimulant using the same
  • the IL-1ra gene is a skin stimulant, hydroquinone (HQ), retinoic acid (RA),
  • HQ hydroquinone
  • RA retinoic acid
  • the expression level is increased, so that harmful skin irritants can be screened using the gene. Therefore, animal testing of cosmetic raw materials is prohibited and is expected to be usefully used as a method for screening skin irritants that can replace them.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법에 관한 것으로, 본 발명의 IL-1ra 유전자는 피부자극 물질로 일반적인 하이드로퀴논, 레티논산, SLS, 또는 우르시올을 처리하는 경우, 발현량이 증가하거나 감소함으로써, 상기 유전자를 이용하여 유해한 피부 자극 물질을 스크리닝할 수 있다.

Description

IL-1RA를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법
본 발명은 IL-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법에 관한 것이다.
하이드로퀴논 (hydroquinone; HQ)을 포함하는 국소 페놀계 물질 및 레티노이드 (retinoid)를 포함하는 비-페놀계 물질은 과색소 침착 치료에 이용된다. 국소 하이드로퀴논은 가장 잘 알려진 치료제이고, 모든 트랜스-레티노산을 포함하는 국소 레티노이드 및 코르티코스테로이드와 조합하는 것과 같은 조합 치료에 친숙하게 이용되고 있다.
또한, HQ는 피부 색소침착에 대한 미백에 대하여 사용되고 있으나, 피부 자극은 그 부작용 중 하나이다. 국소 레티노산 (RA)에서, 가장 일반적인 부작용은 건조함, 스케일링 (scaling), 홍반, 마찰 (burning) 또는/및 상처를 주는 것과 같은 다양한 강도의 자극에 대한 자극반응에 있다. 피부자극은 후기-염증 과색소침착 (post-inflammatory hyperpigmentation)을 일으킬 수 있기 때문에, 레티노산의 약물로서 효율성을 잃지 않으면서, 잠재적인 자극 가능성을 줄이기 위한 노력들이 시도되고 있다.
피부 자극은 인간에게 유해한 환경적 위험에 대한 일반적인 부작용 중 하나이다. 반복적이고, 계속되는 하나의 자극제는 자극성 피부염을 유발한다. 상기 자극제의 가장 일반적인 것은 화합물이다. 모든 물질은 어느 정도 자극제의 성격을 갖고 있다. 피부 자극은 피부 방어벽 파괴, 사이토키닌 캐스캐이드의 유도 및 산화적 스트레스 네트워크와 관련성이 있는 다양한 기전을 통하여 유발될 수 있다. 다른 형 (class)의 물질은 다른 기전을 통하여 피부 자극을 일으킨다. 잠재적인 자극제는 세포 생존율 감소와 관련이 있다. 그러나, 세포독성실험으로 반드시 자극제 또는 비-자극제를 예측할 수 있는 것은 아니다. 세포 외 실험에서는 자극성을 평가하는 표준화된 실험 프로토콜이 존재하지 않아, 자극제에 의하여 유도되는 분자적 반응 및 세포적 반응을 관찰하는 것이 필요하다(한국등록특허 제10-1134088호 참조).
본 발명은 상기와 같은 종래 기술상의 문제점을 해결하기 위해 안출된 것으로서, 본 발명자들은 하이드로퀴논 (HQ), 레티노산 (RA) 및 SLS (sodium lauryl sulfate)를 각질형성세포에 처리 시, IL-1 receptor antagonist (IL-1ra) 유전자 발현이 증가함을 확인함으로써, 본 발명을 완성하였다.
이에, 본 발명의 목적은 1) 각질형성세포에 피부 자극 후보물질을 처리하는 단계; 2) 상기 1) 단계의 세포로부터 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준을 측정하는 단계; 및 3) 상기 유전자의 mRNA 또는 단백질의 발현 수준을 각질형성세포에 하이드로퀴논 (HQ), 레티노산 (RA), SLS 또는 우르시올을 처리한 대조군의 mRNA 또는 단백질의 발현 수준과 비교하는 단계를 포함하는, 피부 자극물질의 스크리닝 방법을 제공하는 것이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.
상기 목적을 달성하기 위하여, 본 발명은 1) 각질형성세포에 피부 자극 후보물질을 처리하는 단계; 2) 상기 1) 단계의 세포로부터 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준을 측정하는 단계; 및 3) 상기 유전자의 mRNA 또는 단백질의 발현 수준을 각질형성세포에 하이드로퀴논(HQ), 레티노산 (RA), SLS 또는 우르시올을 처리한 대조군의 mRNA 또는 단백질의 발현 수준과 비교하는 단계를 포함하는, 피부 자극물질의 스크리닝 방법을 제공한다.
본 발명의 일 구현예로, 상기 3) 단계에서 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준이 대조군 중 적어도 어느 하나 대비 유사 또는 높게 나타나는 경우, 피부자극물질로 판단할 수 있다.
본 발명의 다른 구현예로, 상기 mRNA 발현 수준을 측정하는 방법은 역전사 중합효소반응(RT-PCR), 경쟁적 역전사 중합효소반응(Competitive RT-PCR), 실시간 역전사 중합효소반응(Realtime RT-PCR), RNase 보호 분석법(RPA; RNaseprotection assay), 노던 블롯팅(Northern blotting) 및 DNA 칩으로 이루어진 군에서 선택된 1개 이상의 방법일 수 있다.
본 발명의 또 다른 구현예로, 상기 단백질의 발현 수준을 측정하기 위한 방법은 웨스턴 블롯, ELISA(enzyme linked immunosorbent assay), 방사선면역분석(RIA: Radioimmunoassay), 방사 면역 확산법(radioimmunodiffusion), 오우크테로니(Ouchterlony) 면역확산법, 로케트(rocket) 면역전기영동, 조직 면역 염색, 면역침전 분석법(Immunoprecipitation Assay), 보체 고정 분석법(Complement Fixation Assay), 유세포분석(Fluorescence Activated Cell Sorter, FACS) 및 단백질 칩(protein chip)으로 이루어진 군에서 선택된 1개 이상의 방법일 수 있다.
또한, 본 발명은 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준을 측정하는 제제를 포함하는, 피부 자극물질 스크리닝용 조성물을 제공한다.
또한, 본 발명은 상기 조성물을 포함하는 피부 자극물질 스크리닝 키트를 제공한다.
본 발명은 IL-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법에 관한 것으로, IL-1ra 유전자는 피부 자극물질로 일반적인 하이드로퀴논 (HQ), 레티노산 (RA) 또는 SLS를 처리하는 경우, 발현량이 증가함으로써, 상기 유전자를 이용하여 유해한 피부 자극물질을 스크리닝할 수 있다. 따라서, 화장품 원료물질의 동물실험이 금지되어 이를 대체할 수 있는 피부 자극물질을 스크리닝하는 방법으로 유용하게 사용할 수 있다.
도 1은 하이드로퀴논 (a), 레티노산 (b), SLS (c) 또는 우르시올 (d)을 각질형성세포에 처리한 경우, IL-1α, IL-1β 및 IL-1ra의 real time-PCR의 결과를 나타내는 도이다.
도 2a 내지 도 2c는 하이드로퀴논, 레티노산 또는 SLS를 각질형성세포에 처리한 후, 웨스턴 블롯 분석 (a 및 b) 및 ELISA (c)를 수행하여 IL-1ra 단백질의 발현양상을 확인한 결과를 나타내는 도이다.
도 3a 내지 도 3d는 하이드로퀴논, 레티노산 또는 SLS를 각질형성세포에 처리한 후, MTT 검사 (a 및 b)에 따른 세포 생존능을, TUNEL 검사 (c)를 수행하여 사멸 세포를 확인하고, 웨스턴 블롯 분석 (d)을 수행하여 Cleaved caspase-3 발현 효과를 확인한 도이다.
도 4a 내지 도 4d는 하이드로퀴논, 레티노산 또는 SLS를 각질형성세포에 처리한 후, 웨스턴 블롯 분석 (a 및 b) 및 ELISA (c 및 d)를 수행하여 세포 내/외 IL-1α 및 IL-1β 발현에 대한 rhIL-1ra의 효과를 확인한 도이다.
본 발명자들은, 실시예에서 각질형성세포에 피부 자극물질로 일반적인 하이드로퀴논 (HQ), 레티노산 (RA) 또는 SLS를 처리하는 경우, IL-1ra 유전자의 mRNA 또는 단백질 발현량이 증가한다는 점에 기반하여 IL-1ra mRNA 발현 및 세포 내/외 IL-1ra 단백질 발현 등을 구체적으로 확인하고, 이에 기초하여 본 발명을 완성하였다.
이하 본 발명을 상세히 설명한다.
본 발명은 1) 각질형성세포에 피부 자극 후보물질을 처리하는 단계; 2) 상기 1) 단계의 세포로부터 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준을 측정하는 단계; 및 3) 상기 유전자의 mRNA 또는 단백질의 발현 수준을 각질형성세포에 하이드로퀴논 (HQ), 레티노산 (RA), SLS 또는 우르시올을 처리한 대조군의 mRNA 또는 단백질의 발현 수준과 비교하는 단계를 포함하는, 피부 자극물질의 스크리닝 방법을 제공한다.
구체적인 일례로서, 본 발명의 상기 3) 단계에서 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준이 대조군 중 적어도 어느 하나 대비 유사 또는 높게 나타나는 경우, 피부자극물질로 판단할 수 있다.
본 발명에서 “IL-1ra 유전자”는 IL-1α 및 IL-1β의 길항제로서, 자극 노출시, IL-1α이 자극에 대한 한 번의 노출에 의해 증가되는 것과는 달리, IL-1ra는 자극에 대한 만성적인 반복 노출시 그 발현량이 증가하므로, 반복하여 장기간 사용시 나타나는 자극을 반영하여 보다 효과적으로 사용될 수 있다. 또한, 피부 자극에 있어, IL-1ra의 IL-1α 및 IL-1β에 대한 내인성 길항제의 역할은 거의 관찰되지 않으나, 세포로부터 방출된 IL-1ra의 IL-1α 및 IL-1β에 대한 길항 작용은 화학 물질에 의해 유도되는 각질형성세포의 사멸을 감소시킬 수 있다.
본 발명에서 "mRNA 발현 수준 측정"이란 각질형성세포에서 상기 유전자의 mRNA 존재 여부와 발현 정도를 확인하는 과정으로, mRNA의 양을 측정하여 이루어진다. 이를 위한 분석 방법으로는 예를 들어, 역전사 중합효소반응 (RT-PCR), 경쟁적 역전사 중합효소반응 (Competitive RT-PCR), 실시간 역전사 중합효소반응 (Realtime RT-PCR), RNase 보호 분석법 (RPA; RNase protection assay), 노던 블랏팅 (Northern blotting), DNA 칩 등이 있으나, 이에 제한되는 것은 아니다.
본 발명에서 유전자의 mRNA 수준을 측정하는 제제는 바람직하게는 안티센스 올리고뉴클레오티드, 프라이머 쌍 또는 프로브이다. 본 발명에서 "안티센스"는 안티센스 올리고머가 왓슨-크릭 염기쌍 형성에 의해 RNA 내의 표적 서열과 혼성화되어, 표적서열 내에서, 전형적으로 mRNA와 RNA:올리고머 헤테로이중체의 형성을 허용하는, 뉴클레오티드염기의 서열 및 서브 유닛간 백본을 갖는 올리고머를 지칭한다. 올리고머는 표적 서열에 대한 정확한 서열 상보성 또는 근사 상보성을 가질 수 있다. 이 안티센스 올리고머는 mRNA의 번역을 차단 또는 저해하고 mRNA의 스플라이스 변이체를 생산하는 mRNA의 프로세싱 과정을 변화시킬 수 있다.
본 발명에서 "프라이머"는 짧은 자유 3말단 수산화기를 가지는 핵산 서열로 상보적인 주형 (template)과 염기쌍을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응 (즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다.
본 발명에서 "프로브"란 mRNA와 특이적 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며 표지 (Labelling)되어 있어서 특정 mRNA의 존재 유무를 확인할 수 있다. 프로브는 올리고 뉴클레오티드 프로브, 단쇄 DNA (single stranded DNA) 프로브, 이중쇄 DNA (double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 적당한 프로브의 선택 및 혼성화 조건은 당업계에 공지된 것을 기초로 변형할 수 있다.
본 발명의 유전자는 핵산 서열이 유전자 은행에 등록되어 있으므로 당업자는 상기 서열을 바탕으로 이들 유전자의 특정 영역을 특이적으로 증폭하는 안티센스 올리고뉴클레오티드, 프라이머 쌍 또는 프로브를 디자인할 수 있다.
본 발명의 안티센스 올리고뉴클레오티드, 프라이머 또는 프로브는 포스포르 아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체 (예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미 데이트, 카바메이트 등) 또는 하전된 연결체 (예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.
본 발명에서 "단백질 발현 수준 측정"이란 피부 자극 후보 물질을 스크리닝하기 위하여 각질형성세포에서 본 발명의 유전자로부터 발현된 단백질의 존재 여부와 발현 정도를 확인하는 과정으로, 단백질의 양을 측정하여 이루어진다. 이를 위한 분석 방법으로는 웨스턴 블랏, ELISA (enzyme linked immunosorbent assay), 방사선면역분석 (RIA: Radioimmunoassay), 방사 면역 확산법 (radioimmunodiffusion), 오우크테로니 (Ouchterlony) 면역확산법, 로케트 (rocket) 면역전기영동, 조직면역 염색, 면역침전 분석법 (Immunoprecipitation Assay), 보체 고정 분석법 (Complement Fixation Assay), 유세포분석 (Fluorescence Activated Cell Sorter, FACS), 단백질 칩 (protein chip) 등이 있으나 이로 제한되는 것은 아니다. 본 발명에서 단백질 발현 수준을 측정하는 제제는 바람직하게는 항체이다.
본 발명에서, "항체"란 항원성 부위에 대해서 지시되는 특이적인 단백질 분자를 의미한다. 본 발명의 목적상, 항체는 마커 단백질에 대해 특이적으로 결합하는 항체를 의미하며, 다클론 항체, 단클론 항체 및 재조합 항체를 모두 포함한다.
본 발명의 일실시예에서는, 피부 자극물질에 의한 IL-1ra 유전자 발현 여부를 확인하기 위해, 각질형성세포에 피부 자극물질을 처리하여 이를 확인한 결과, 각질형성세포에 피부 자극물질로 일반적인 하이드로퀴논 (HQ), 레티노산 (RA), SLS 또는 우르시올을 처리하는 경우, IL-1ra 유전자의 mRNA 발현량이 증가한다는 것을 알 수 있었다 (실시예 3 참조).
따라서, 본 발명에 따른 IL-1ra 유전자는 피부 자극물질 처리 시, 그 발현이 증가되는 바, 상기 유전자를 이용하여 유해한 피부 자극 물질의 스크리닝이 요구되는 다양한 목적 및 용도로 사용될 수 있다.
이에, 본 발명은 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준을 측정하는 제제를 포함하는, 피부 자극물질 스크리닝용 조성물을 제공한다.
또한, 본 발명은 상기 조성물을 포함하는 피부 자극물질 스크리닝 키트를 제공한다.
본 발명의 키트는 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준을 확인함으로써 피부 자극 물질을 스크리닝 할 수 있다. 본 발명의 키트에는 피부 자극 물질을 스크리닝하기 위한 프라이머, 프로브, 항체 등 뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액, 또는 장치가 더 포함될 수 있으며, 바람직하게는 RT-PCR 키트, 마이크로어레이 칩 키트, DNA 칩 키트, 단백질 칩 키트의 형태일 수 있으나 이에 제한되지 않는다.
구체적인 일례로서, 본 발명에서 상기 유전자의 mRNA 발현 수준을 측정하기 위한 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드 (dNTPs), Taq-중합 효소 및 역전사효소와 같은 효소, DNase, RNase 억제제, DEPC-물 (DEPC-water), 멸균수 등을 포함할 수 있다.
또한, 본 발명의 키트는 마이크로어레이를 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. 마이크로어레이 키트는, 유전자 또는 그의 단편에 해당하는 cDNA가 프로브로 부착되어 있는 기판을 포함하고 기판은 정량 대조구 유전자 또는 그의 단편에 해당하는 cDNA를 포함할 수 있으며, 본 발명의 유전자를 이용하여 당업계에서 통상적으로 사용되는 제조 방법에 의하여 용이하게 제조될 수 있다. 마이크로어레이를 제작하기 위해서, 상기 탐색된 마커를 탐침 DNA 분자로 이용하여 DNA 칩의 기판상에 고정화시키기 위해 파이조일렉트릭 (piezoelectric) 방식을 이용한 마이크로피펫팅 (micropipetting)법 또는 핀 (pin) 형태의 스폿터 (spotter)를 이용한 방법 등을 사용하는 것이 바람직하나 이에 제한되지 않는다. 상기 마이크로어레이 칩의 기판은 아미노-실란 (amino-silane), 폴리-L-라이신 (poly-Llysine) 및 알데히드 (aldehyde)로 이루어진 군에서 선택되는 활성기가 코팅된 것이 바람직하나, 이에 제한되지 않는다. 또한, 상기 기판은 슬라이드 글래스, 플라스틱, 금속, 실리콘, 나일론 막 및 니트로셀룰로스 막 (nitrocellulose membrane)으로 이루어진 군에서 선택되는 것이 바람직하나 이에 제한되지 않는다.
또한, 본 발명의 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. DNA 칩 키트는 유전자 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드 (oligonucleotide)가 부착되어 있는 기판, 및 형광표식 프로브를 제작하기 위한 시약, 제제, 효소 등을 포함할 수 있다. 또한 기판은 대조군 유전자 또는 그의 단편에 해당하는 cDNA 또는 올리고뉴클레오티드를 포함할 수 있다.
이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 하기 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.
[ 실시예 ]
실시예 1. 실험 준비 및 실험 방법
1-1. 세포 배양
제왕절개 수술 및 포경 수술시 수득된 성인 피부 시료들을 세포 배양에 사용하였다. 각질형성세포 배양을 위해, 소 뇌하수체 추출물, 소 인슐린, 하이드로코티손 (hydrocortisone), 인간 표피 성장 인자 및 소 트랜스페린 (Invitrogen)이 첨가 된 EpiLife 배지 (Invitrogen, Carlsbad, CA)에 개개의 표피 세포를 현탁하였다. 상기 수확된 세포를 각각의 배지에 7.5×104 cell/mL로 재현탁하고, 6-well 플레이트에 웰당 1.5×105 cell로 접종하였다. 접종 1일 후, 각 농도의 화학약품을 첨가하였으며, 다시 1일 후에 적절한 농도의 각각의 화학약품을 첨가하였다. 2일 후, 각질형성세포를 수확하고, 세포 생존능 검사, TUNEL 검사, 실시간 PCR, 웨스턴 블롯 분석 및 ELISA에 적용하였다.
1-2. 마우스
Orient Bio (경기도, 대한민국)로부터 구입한 8주령 암컷 C57BL/6 마우스를 동국대학교 의과대학의 실험 동물 사육실에서 제어 받지 않은 통상적인 공기 조건 하에 유지하였다. 지역 동물실험 윤리 위원회는 모든 기술된 프로토콜을 승인하였다. 전기 면도기를 이용하여 상기 마우스의 등에 있는 모발을 깎아낸 후, 피부 모발 제거제 (일동제약)로 처리하였으며, 1일 후, 2cm 직경의 거즈 패치 (gauze patch)를 이용하여 패치를 도포하고, 면도 된 등쪽 피부 상에서 각각의 적절한 농도의 화학약품이 스며들게 하였다. 상기 절차를 48시간 동안 2회 반복하였다. 상기 화학적으로 처리된 전 두께 피부 시료를 생검하여, 면역조직화학 (immunohistochemistry) 용으로 사용할 때까지 -80℃에서 저장하였다.
1-3. 시약
시험관 내 (In vitro) 연구를 위해 하이드로퀴논 (HQ, Sigma Aldrich, St Louis, MO, USA) 및 레티노산 (RA, Sigma Aldrich)는 DMSO (Sigma Aldrich)를 이용하여 저장액 (stock solution)으로서 제조하고, Sodium lauryl sulfate (SLS, Sigma Aldrich)를 증류수에 용해하여 저장액을 만들었다. 생체 내 (In vivo) 연구를 위해 바셀린 베이스에 HQ를 10% 및 20%로 첨가하고, RA는 0.1% 및 0.5%로 첨가하여 크림을 제조하였다. 재조합 인간 인터류킨-1 수용체 길항제 (rhIL-1ra)는 R&D Systems (Minneapolis, MA)로부터 구입하였다.
1-4. MTT 분석
세포를 MTT로 4시간 동안 염색하고, 침전된 포르마잔 (formazan)을 증류수 및 DMSO에 용해하고, 광학 밀도는 분광 광도계를 이용하여 570nm (630nm background subtraction)에서 측정하였다. 세포 성장에 대한 HQ, RA, SLS 및 우르시올 (urshiol, Sigma Aldrich)의 효과는 용매인 DW 및 DMSO의 존재 시 세포 생존능에 대한 상기 세포 생존능의 비율로부터 산정하였으며, 자극 농도는 2일 이내에 세포 생존능 비율의 약 40 내지 50% 및 70 내지 80%를 나타내는 농도의 범위로서 결정되었다.
1-5. TUNEL 검사
사멸 세포를 검출하기 위한 TUNEL 검사는 제조사의 지침서에 따라 가공된 Apo-BrdU TUNEL 검사 키트 (A23210, Invitrogen)를 이용하여 수행되었다. 세포를 2% 파라포름알데히드 및 70% 빙냉 에탄올에 고정하고, 상기 염색된 세포를 형광 현미경 하에서 관찰하였다. 세포 사멸의 정량적 분석을 위해 사멸 세포로부터 4개의 랜덤 필드 (random field)를 촬영하고, 총 세포를 계수하였다.
1-6. RT-PCR
RT-PCR 용 First Strand cDNA Synthesis Kit (AMV, Boehringer Mannheim, 독일)를 이용하여 총 RNA로부터 cDNA를 합성하고, 표적 mRNA의 양은 Light Cycler RT-PCR 기기 (Roche, Penzberg, Germany)를 이용하여 정량화하였다. 상기 mRNA의 상대적인 양은 글리세르알데히드 3-인산 탈수소효소 (GAPDH)에 대한 각 표적의 비율을 산정한 것이다. 실시간 PCR용 프라이머 서열은 하기의 표 1과 같다.
구분 프라이머 서열 (5' - 3')
IL-1α 정방향 GGTTGAGTTTAAGCCAATCCA
역방향 TGCTGACCTAGGCTTGATGA
IL-1β 정방향 CCGGGACTCACAGCAAAA
역방향 GGACATGGAGAACACCACTTG
IL-1ra 정방향 TGGCTTTAGCTGACTTGTATGAAG
역방향 TTGCTGGATTTTCTCCCAGA
GAPDH 정방향 TCCACTGGCGTCTTCACC
역방향 GGCAGAGATGATGACCCTTT
1-7. 웨스턴 블롯 분석
동일한 양의 추출된 단백질을 용해시키고, 니트로셀룰로오스 멤브레인으로 전달하였다. 상기 멤브레인을 IL-1α 및 IL-1β에 대한 항체 (Santa Cruz Biotechnology, Santa Cruz, CA), IL-1ra 및 Cleaved caspase-3 (Cell Signaling Technology, Beverly, MA)와 함께 배양하였다. 적절한 항-마우스 또는 항-토끼 horseradish 과산화효소-접합 항체 (Thermo) 및 enhanced 화학발광 용액 (Thermo)와 함께 배양한 이후, 영상 입력장치 (LAS-3000, Fuji Photo Film, Tokyo, Japan) 상에 신호를 포획하였다. 각 레인에 적재된 단백질의 양을 모니터링하기 위해, 상기 멤브레인을 마우스 단클론성 항-β-액틴 항체 (Sigma)로 재-탐침하고, 상술한 바와 같이 가공하였다. 이어 단백질 밴드를 밀도 측정법에 의해 분석하였다.
1-8. ELISA
이전 실험의 모든 단계에서 배양된 각질 세포의 상층액을 수집하고, 제조사의 지침서에 따라 ELISA 키트 (R&D Systems)를 이용하여 상기 상층액 중의 인간 IL-1ra, IL-1α 및 IL-1β의 농도를 측정하였다.
1-9. 면역조직화학 분석
IL-1ra의 면역형광 염색을 위해, 탈색되고 정상적으로 유색된 고정 표피 샘플을 파라핀 왁스에 포매하고, 4 mm로 절편화하였다. 파라핀 제거 및 재수화 이후, 절편을 열판 상에서 10분 동안 시트레이트 (citrate) 용액 (100 mM, pH 6.0) 내에서 가열하였다. 상기 절편을 실온에서 1시간 동안 3% 소 혈청 알부민과 함께 재배양한 후, 4℃에서 하룻밤 동안 1:100 항-IL-1ra 항체와 반응시키고, 연속해서 실온에서 1시간 동안 Alexa Fluor-표지 염소 항-토끼 IgG (488, Molecular Probes, Eugene, OR)와 반응시켰다. 핵은 Hoechst 33258 (Sigma Aldrich)로 대비 염색하였다. 상기 염색된 시료는 Dp Manager 2.1 형광 현미경(Olympus Optical Co., Tokyo, Japan)을 이용하여 관측하였다.
실시예 2. 화학약품의 세포독성 효과
HQ, RA, SLS 및 대표적인 감광제인 우르시올 등 화학약품의 세포독성을 확인하기 위하여 실시예 1-2에서 배양된 정상 인간 각질형성세포에 상기 약품을 서로 다른 투여량으로 처리하여 실시예 1-4와 같이 실험하였다.
그 결과, 상기 자극 농도는 각각 HQ가 20 내지 40 μM, RA가 0.5 내지 1.5 μM, SLS가 8 내지 12 μM, 우르시올이 1 내지 2 μM의 범위에서 70 내지 80% 및 40 내지 50% 세포 생존을 나타냈다.
실시예 3. 각질형성세포에서의 IL-1ra mRNA 발현 확인
IL-1ra의 mRNA 발현, 나아가 IL-1α 및 IL-1β의 mRNA 발현을 확인하기 위하여 상기 실시예 1-6과 같이 실험하였다.
그 결과, 도 1에 나타낸 바와 같이, IL-1ra mRNA 발현은 이들 화학약품 중에서 시간 및 투여량 의존적 방식으로 증가하는 것으로 나타났다. 비록 IL-1ra mRNA 발현의 절대 수준이 IL-1α 및 IL-1β 보다 낮을지라도 각각의 화학약품에 의한 IL-1ra의 배수 증가 (fold increase)는 상응하는 용매와 비교하여 통상적으로 IL-1α 및 IL-1β의 배수 증가보다 높았다. IL-1ra mRNA에서 상기 배수 증가는 양성 대조군인 IL-1α 및 IL-1β mRNA와 비교하여 더욱 일정하였으며, 이는 우르시올 처리 세포에서 더욱 현저하였다(D).
실시예 4: 각질형성세포 내/외 IL-1ra 단백질 발현 확인
상기 실시예 3의 mRNA 발현 결과에 기초하여, 세포 내 IL-1ra 단백질 발현에 대한 웨스턴 블롯 분석 (실시예 1-7) 및 세포 외로 방출된 IL-1ra 단백질에 대한 ELISA 분석 (실시예 1-8)을 동일한 세포독성 투여량 (70 내지 80% 및 40 내지 50%의 세포 생존)의 HQ, RA 및 SLS에 의한 처리 48시간 이후에 수행하였다. 또한, 서로 다른 농도의 HQ 또는 RA로 처리하여 홍반을 유도한 마우스 피부 시료에서 면역 형광 염색 (실시예 1-9)을 수행하였다.
그 결과, 도 2a 내지 2c에 나타낸 바와 같이, 상기 세포 내 IL-1ra 단백질의 발현은 투여량 의존적으로 증가하였으며(도 2a). 또한 분비된 IL-1ra 단백질의 발현은 배양 상층액 내에서 투여량 의존적으로 증가하였다(도 2b). 또한, 면역 형광 염색에 따르면, 피부자극이 더욱 심한 각질층을 포함하는 표피에서 IL-1ra의 염색 세기가 더욱 큰 것으로 나타났다(도 2c).
실시예 5: rhIL - 1ra (Recombinant human IL- 1ra ) 처리에 의한 각질형성세포의 세포사멸 (Apoptosis) 감소
상기 실시예 4에서 화학약품의 세포 독성 투여량에 의해 각질형성세포 및 마우스 피부에서 IL-1ra 단백질의 발현이 증가함을 확인하였는 바 (도 2a 내지 도 2c), 세포 표면의 IL-1 수용체에 결합함으로써 이루어지는 IL-1ra의 작용에 기초하여, 각질형성세포의 생존에 대한 rhIL-1ra의 효과를 확인하기 위하여 실시예 1-5와 같이 실험하였다.
그 결과, 도 3a 내지 3d에 나타낸 바와 같이, 최고 500 ng/ml 의 광범위한 농도 범위 (Conti 등, 1997)의 rhIL-1ra는 1차 배양된 인간 각질 세포에서의 생존 가능한 세포의 개수를 감소시키지 않았으며 (도 3a), 상기 rhIL-1ra는 상기 세포 독성 투여량의 화학약품의 의해 감소되었던 생존 가능한 세포의 개수를 투여량 의존적으로 증가시켰다 (도 3b). 반면, 상기 세포 독성 투여량의 화학약품의 의해 증가하였던 TUNEL 양성 각질 세포의 개수는 rhIL-1ra에 의해 감소하였으며 (도 3c), 또한, Cleaved caspase-3의 발현 수준은 rhIL-1ra의 존재 하에 감소함을 확인하였다 (도 3d).
실시예 6: rhIL - 1ra (Recombinant human IL- 1ra ) 처리에 의한 화학적 자극-유도된 IL- 1α 및 IL- 1β의 발현 감소 효과 확인
IL-1ra는 세포 표면 IL-1 수용체의 결합을 경쟁적으로 억제함으로써 IL-1α 및 IL-1β 활성을 억제한다고 알려져있다 (Arend 등, 1998). 따라서 세포 내/외 IL-1α 및 IL-1β 발현에 대한 rhIL-1ra의 효과를 확인하기 위하여 웨스턴 블롯 분석 (실시예 1-7) 및 ELISA (실시예 1-8)를 실시하였다.
그 결과, 도 4a 내지 4d에 나타낸 바와 같이, 웨스턴 블롯 분석에 따르면, 500 ng/ml의 rhIL-1ra는 상기 세포 독성 투여량의 화학약품의 의해 증가되었던 IL-1α 및 IL-1β의 세포 내 수준을 감소시키는 것으로 나타났으며 (도 4a 및 4b), ELISA 분석에 따르면, 비록, RA 처리 IL-1β의 수준이 다소 높게 나타났더라도, 상기 세포 독성 투여량의 화학약품의 의해 증가되었던 IL-1α 및 IL-1β의 세포 내 수준은 rhIL-1ra에 의해 감소하는 것으로 나타났다 (도 4c 및 4d).
실시예 5 및 6의 결과를 종합한 결과, 세포로부터 방출된 IL-1ra는 IL-1α 및 IL-1β에 대한 길항 작용에 의하여 화학 물질에 의해 유도되는 각질형성세포의 사멸을 감소시킬 수 있음을 의미한다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명은 IL-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법에 관한 것으로, IL-1ra 유전자는 피부 자극물질로 일반적인 하이드로퀴논 (HQ), 레티노산 (RA), SLS, 또는 우르시올를 처리하는 경우 발현량이 증가함으로써, 상기 유전자를 이용하여 유해한 피부 자극물질을 스크리닝할 수 있다. 따라서, 화장품 원료물질의 동물실험이 금지되어 이를 대체할 수 있는 피부 자극물질을 스크리닝하는 방법으로 유용하게 이용이 가능할 것으로 기대된다.

Claims (6)

1) 각질형성세포에 피부 자극 후보물질을 처리하는 단계;
2) 상기 1) 단계의 세포로부터 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준을 측정하는 단계; 및
3) 상기 유전자의 mRNA 또는 단백질의 발현 수준을 각질형성세포에 하이드로퀴논 (HQ), 레티노산 (RA), SLS 또는 우르시올을 처리한 대조군의 mRNA 또는 단백질의 발현 수준과 비교하는 단계를 포함하는, 피부 자극물질의 스크리닝 방법.
제 1항에 있어서,
상기 3) 단계에서 IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준이 대조군 중 적어도 어느 하나 대비 유사 또는 높게 나타나는 경우 피부자극물질로 판단하는 것을 특징으로 하는, 피부 자극물질의 스크리닝 방법.
제1항에 있어서,
상기 mRNA 발현 수준을 측정하는 방법은 역전사 중합효소반응 (RT-PCR), 경쟁적 역전사 중합효소반응 (Competitive RT-PCR), 실시간 역전사 중합효소반응 (Realtime RT-PCR), RNase 보호 분석법 (RPA; RNaseprotection assay), 노던 블롯팅 (Northern blotting) 및 DNA 칩으로 이루어진 군에서 선택된 1개 이상의 방법인 것을 특징으로 하는, 피부 자극물질의 스크리닝 방법.
제1항에 있어서,
상기 단백질의 발현 수준을 측정하기 위한 방법은 웨스턴 블롯, ELISA (enzyme linked immunosorbent assay), 방사선면역분석 (RIA: Radioimmunoassay), 방사 면역 확산법 (radioimmunodiffusion), 오우크테로니 (Ouchterlony) 면역확산법, 로케트 (rocket) 면역전기영동, 조직 면역 염색, 면역침전 분석법 (Immunoprecipitation Assay), 보체 고정 분석법 (Complement Fixation Assay), 유세포분석 (Fluorescence Activated Cell Sorter, FACS) 및 단백질 칩 (protein chip)으로 이루어진 군에서 선택된 1개 이상의 방법인 것을 특징으로 하는, 피부 자극물질의 스크리닝 방법.
IL-1ra 유전자의 mRNA 또는 단백질의 발현 수준을 측정하는 제제를 포함하는, 피부 자극물질 스크리닝용 조성물.
제5항의 조성물을 포함하는, 피부 자극물질 스크리닝 키트.
PCT/KR2017/005693 2016-07-07 2017-05-31 Il-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법 WO2018008852A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020160086045A KR20180005856A (ko) 2016-07-07 2016-07-07 IL-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법
KR10-2016-0086045 2016-07-07

Publications (1)

Publication Number Publication Date
WO2018008852A1 true WO2018008852A1 (ko) 2018-01-11

Family

ID=60912737

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2017/005693 WO2018008852A1 (ko) 2016-07-07 2017-05-31 Il-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법

Country Status (2)

Country Link
KR (1) KR20180005856A (ko)
WO (1) WO2018008852A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050089520A1 (en) * 2001-11-09 2005-04-28 Dominique Bourel Antibody stimulating il-ira production
KR20090123049A (ko) * 2008-05-27 2009-12-02 (주)아모레퍼시픽 민감성 피부 진단용 바이오 마커 및 이를 이용한 진단 키트
KR101618950B1 (ko) * 2013-04-12 2016-05-09 동국대학교 산학협력단 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050089520A1 (en) * 2001-11-09 2005-04-28 Dominique Bourel Antibody stimulating il-ira production
KR20090123049A (ko) * 2008-05-27 2009-12-02 (주)아모레퍼시픽 민감성 피부 진단용 바이오 마커 및 이를 이용한 진단 키트
KR101618950B1 (ko) * 2013-04-12 2016-05-09 동국대학교 산학협력단 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BERNHOFER ET AL.: "IL , 1alpha and IL -1 ra Secretion from Epidermal Equivalents and the Prediction of the Irritation Potential of Mild Soap and Surfactant-based Consumer Products", TOXICOLOGY IN VITRO, vol. 13, 1999, pages 231 - 239, XP055451159 *
PERKINS ET AL.: "A Noninvasive Method to Assess Skin Irritation and Compromised Skin Conditions using Simple Tape Adsorption of Molecular Markers of Inflammation", SKIN RESEARCH AND TECHNOLOGY, vol. 7, 2001, pages 227 - 237, XP002260517 *

Also Published As

Publication number Publication date
KR20180005856A (ko) 2018-01-17

Similar Documents

Publication Publication Date Title
Bi et al. Stage-specific effects of Notch activation during skeletal myogenesis
Sessa et al. The Tbr2 molecular network controls cortical neuronal differentiation through complementary genetic and epigenetic pathways
US11912994B2 (en) Methods for reactivating genes on the inactive X chromosome
Danik et al. Frequent coexpression of the vesicular glutamate transporter 1 and 2 genes, as well as coexpression with genes for choline acetyltransferase or glutamic acid decarboxylase in neurons of rat brain
KR101618950B1 (ko) 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법
Ansere et al. Cellular hallmarks of aging emerge in the ovary prior to primordial follicle depletion
JP7134359B2 (ja) 卵巣の卵胞刺激ホルモン（ｆｓｈ）に対する反応性の診断用または予測用のバイオマーカー、及びその用途
KR20180044617A (ko) Uhrf1 및 dnmt1을 포함하는 세포 노화 진단용 바이오마커 조성물
US10017817B2 (en) Skin activation by acceleration of PDGF-BB activity
Vastagh et al. Differential gene expression in gonadotropin-releasing hormone neurons of male and metestrous female mice
WO2018008852A1 (ko) Il-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법
Timmer et al. The activin signaling pathway promotes differentiation of dI3 interneurons in the spinal neural tube
KR20120060442A (ko) 위암 진단용 마커로서 ｔｆｆ2의 용도
KR101897444B1 (ko) IL-1ra를 포함하는 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법
Dahia et al. Regulation of FSH receptor, PKIβ, IL-6 and calcium mobilization: possible mediators of differential action of FSH
Suzuki et al. Xenopus laevis il11ra. L is an experimentally proven interleukin-11 receptor component that is required for tadpole tail regeneration
Lööf et al. Plasticity of mammalian myotubes upon stimulation with a thrombin-activated serum factor
WO2015056970A1 (ko) 프로그래뉼린 억제제를 유효성분으로 함유하는 골다공증 예방 또는 치료용 조성물
WO2019225931A1 (ko) 조기폐경 진단을 위한 분석방법 및 키트
Leach et al. Ethanol Elevates c‐Myc Levels in Cultured Mouse Preimplantation Embryos
KR102202120B1 (ko) 알츠하이머 질환의 진단 또는 치료를 위한 Ｕｂｅ２ｈ의 용도
WO2023234586A1 (ko) 신규한 mfsd7-atp5l 융합유전자 및 이의 용도
Schmidt et al. FoxN3 knock-down alters spatio-temporal expression patterns of genes involved in cranial cartilage and muscle development in the African clawed-frog Xenopus laevis
WO2024054087A1 (ko) 고령 여성의 난임 진단을 위한 바이오마커 및 이의 용도
WO2013162286A1 (ko) 지방유래줄기세포 분화능력 탐지 마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17824408

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17824408

Country of ref document: EP

Kind code of ref document: A1