WO2017212315A1 - Arni pour la lutte contre des champignons par inhibition de gène cytb - Google Patents

Arni pour la lutte contre des champignons par inhibition de gène cytb Download PDF

Info

Publication number
WO2017212315A1
WO2017212315A1 PCT/IB2016/053376 IB2016053376W WO2017212315A1 WO 2017212315 A1 WO2017212315 A1 WO 2017212315A1 IB 2016053376 W IB2016053376 W IB 2016053376W WO 2017212315 A1 WO2017212315 A1 WO 2017212315A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sequence
instance
plant
gene
Prior art date
Application number
PCT/IB2016/053376
Other languages
English (en)
Inventor
Erico PERRELLA
Danilo ZAMPRONIO
Otto HERINGER
Original Assignee
Lotan Agrosciences Llc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Lotan Agrosciences Llc filed Critical Lotan Agrosciences Llc
Priority to PCT/IB2016/053376 priority Critical patent/WO2017212315A1/fr
Publication of WO2017212315A1 publication Critical patent/WO2017212315A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance

Definitions

  • Agriculture is one of the main engines of the world economy, not only with great relevance related to the amount of funds raised and number of employees, but also for generating most of the human food and animal feed in the world. Advances in agricultural technology as the invention of chemical pesticides and the introduction of genetically modified crops were essential to meet the growing global demand for agricultural products.
  • Brazil has significance in the global agricultural sector, one of the largest agricultural producers of various crops such as soybeans, beans, corn, sorghum, orange and cotton. With the position of major producer, is also brought to the position of world's largest consumer of pesticides, with approximately 20% of international pesticide consumption [1 ].
  • fungicides currently used and recommended by local agricultural bodies are mostly belonging to the class of inhibitors of ergosterol, which chemically inhibit the formation of cell membranes of various fungi; the class of the alumino-phosphates, with little known action method; the class of beta-tubulin inhibitors, which inhibit fungal reproduction; and finally, the most modern and more efficient, strobilurins, chemical pesticides based on blocking the electron transfer in fungi cytochrome, also called QoL fungicides (acronym referring to the oxidation of quinol).
  • RNA interference technology as a method of pest control aimed not only the obvious prevention and remediation of infestations, but also aimed at combating induced resistance in pests, mainly fungi, in the scope of this invention.
  • RNA interference technology is based on induced use of a natural mechanism that incorporates exogenous RNA sequences of nucleotides in an organism and use these oligonucleotide sequences to silence the production of certain molecules into the cell through the use of complementarity between these external RNA sequences to the mRNA sequences which would be read by the body and be used to produce molecules [2][3].
  • the mRNA molecules that bond with the exogenous RNA molecules can no longer be read by the body and are degraded by the cell, not generating the molecule that would be produced with the information contained in the mRNA molecule [4].
  • RNAi technology thus is based on a natural gene silencing mechanism and this mechanism can be observed in a wide range of organisms.
  • RNA sequences are chosen in a way that, once within the target organisms, will act in inhibiting the production of molecules of basic importance for the development and life of the target organism, eventually leading to atrophy and or death to the organism.
  • RNA sequences used for this purpose are double stranded RNA sequences of about 18-25 base pairs (bp) which are designed according to the transcriptome and genome of the target organism.
  • the present invention relates to use of interfering RNA targeting the cellular respiratory pathway.
  • the aforementioned pathway is the main source of ATP production, being crucial to the proper function of many cellular components, such as, for example, transmembrane transport and phosphorylation reaction.
  • the maintenance of a proton gradient between the inner mitochondrial and the cytosolic environment plays an important role in the ATP synthesis [8].
  • the proton gradient is coupled with the electron transmembrane transfer that takes place in the mitochondrial membrane.
  • the Complex III also known as Complex bd and Q-cytochrome-c-oxidoreductase is of particular interest. More specifically, the invention relates to the inhibition of the subunit b of the Complex III leading to cellular malfunction and myophaties.
  • the respiratory electron chain is present in all eukaryotes and its mechanism of action is strongly conserved throughout the species [9], including fungi and oomycetes.
  • Subunits of the enzymes taking part in the pathway are some of the targets aimed at by agricultural defensives, such as the tebuconazole, the carbendazim and the strobilurin pesticides .
  • agricultural defensives such as the tebuconazole, the carbendazim and the strobilurin pesticides .
  • the mechanism is conserved, the number of subunit proteins and their sequences varies when homologous proteins from distinct organism are compared. Taking advantage of these differences it is possible to design dsRNA sequences targeting a specific protein, such as complex III subunit cytochrome b, from a specific organism.
  • the subunit cytochrome b contain two heme groups designated heme bL (low affinity) and bH (high affinity) responsible for the electron transfer from the ubiquinol at the Q0 site of the Complex III to the quinone at the Qi site of the same complex.
  • the 3D structure of the protein consists of 8 transmembrane helix and the two heme binding sites aforementioned and is encoded by the mitochondrial gene called cyt b and in some fungi it is also called cob, which stands for cytochrome oxido reductase b.
  • RNA interference In the field of the present invention are shown methods and compositions for controlling fungi by using the technology of RNA interference, with inhibition of genes related to transfer of electrons in the complex d cytochrome B, also known as oxidation of quinol process.
  • the methods and compositions presently described include possible formulations for use in the field containing the specific sequences of RNA covered in this invention and include the incorporation of the generation of the sequences specific RNA by the plants themselves, within their cells so that pests incorporate these specific sequences RNAi while they parasite the plant.
  • the target gene is responsible for ATP production, thus being the chosen gene directly involved in one of the most fundamental operations for the life of most fungi. With the choice of that gene, and given its importance for life processes, the inventors intended to reduce the chances of occurrence of qualitative resistance.
  • RNAi or "RNA interference” as the natural mechanism of silencing for specific genes by incorporating exogenous dsRNA molecules and internal action on target organism of theses dsRNA molecules, and this dsRNA rest defined from now on as RNA sequences partially or fully double-stranded.
  • siRNA short interfering RNA
  • siRNA short interfering nucleic acid
  • miRNA miRNA
  • microRNA microRNA
  • ciRNA circular interfering RNA
  • shRNA short hairpin RNA
  • dsRNA sequences being made up of i) a single strand composed of a sequence of at least 18 nucleotides with high identity to at least 18 nucleotides of the target gene in a fungi; and 2) a second strand comprising a complementary nucleotide sequence to the sequence of the first strand.
  • nucleotides refers to portions of 18 nucleotides and may be variable numbers such as 18, 20, 21 , 22, 23, 24, 25, 50, 100, 200, 300, 400, 500, 1000-2000 consecutive nucleotides of the target gene.
  • the percentage identity between sequences is determined with the help of the ClustalWsoftware.
  • ClustalW can be downloaded from http://www.ebi.ac.uk/tools/clustalW2/index.html.
  • X version of ClustalW is used to determine the potential percentage of identity between the proteins presented in this invention and other possible proteins.
  • X version of ClustalW is used to determine the potential percentage of identity between nucleic acid sequences presented in this invention and other possible nucleic acid sequences.
  • “Complementarity” is defined in the scope of the invention as the base pairing capacity of both RNA and DNA, following the laws of complementary Watson-Crick bases. Two polynucleotide sequences can complement each other even if not fully complementary. Parts of sufficiently complementary nucleotide sequences may bind and form hybrids. Is defined so also “substantially complementary” as two sequences with at least 80% complementarity of their polynucleotides, they are also considered to be significantly complementary sequences with complementarity of 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100%.
  • the terms "DNA” and "RNA” to describe sequences of linear or branched nucleotides, single-stranded or double-stranded and several hybrids, including DNA RNA hybrids.
  • the first and second strand if complementary, are of identical size, but may also take the form where a strand is larger than the other and may this strand be the first or the second strand. In the case of a strand greater than the other, one of the ribbons may be 1 to 200 bases longer than the other.
  • dsRNA is also defined as a double stranded nucleotide sequence of at least 18 consecutive nucleotides of the complex III subunit cytochrome b gene which is the target gene of the invention.
  • SEQ ID 1 1 SEQ ID 13, SEQ ID 15, SEQ ID 17, SEQ ID 19, SEQ ID 21 , SEQ ID 23, SEQ ID 25, SEQ ID
  • SEQ ID 6 SEQ ID 8, SEQ ID 10, SEQ ID 12, SEQ ID 14, SEQ ID 16, SEQ ID 18, SEQ ID 20, SEQ ID 22, SEQ ID 24, SEQ ID 26, SEQ ID 28, SEQ ID 30, SEQ ID 32, SEQ ID 34, SEQ ID 36, SEQ ID 38, SEQ ID 40, SEQ ID 42, SEQ ID 44, SEQ ID 46;
  • polynucleotide having between at least 70%, more preferably at least 80%, and more preferably at least
  • polypeptide encoded by a polynucleotide having between at least 70%, more preferably at least 80%, and more preferably at least 90% identity with the polypeptide containing the sequence delimited bases by the sequences SEQ ID 2, SEQ ID 4, SEQ ID 6, SEQ ID 8, SEQ ID 10, SEQ ID 12, SEQ ID 14, SEQ ID 16, SEQ ID 18, SEQ ID 20, SEQ ID 22, SEQ ID 24, SEQ ID 26, SEQ ID 28, SEQ ID 30, SEQ ID 32, SEQ ID 34, SEQ ID 36, SEQ ID 38, SEQ ID 40, SEQ ID 42, SEQ ID 44, SEQ ID 46;
  • SEQ ID 30 SEQ ID 32, SEQ ID 34, SEQ ID 36, SEQ ID 38, SEQ ID 40, SEQ ID 42, SEQ ID 44, SEQ ID 46;
  • hybridizable under strict conditions as polynucleotides or nucleic acid sequences which hybridize under certain conditions to a reference nucleic acid in a custom cDNA library, being observed a signal generation for the reference nucleic acid much larger to the reference polynucleotide hybridizable under stringent conditions than the rest of the DNA samples contained in the cDNA library, indicating that the hybridization was successful to the polynucleotide in question [10].
  • the invention further presents in one particular aspect, a fragment of the nucleic acid sequence selected from the sequences SEQ ID 1 , SEQ ID 3, SEQ ID 5, SEQ ID 7, SEQ ID 9, SEQ ID 1 1 , SEQ ID 13, SEQ ID 15, SEQ ID 17, SEQ ID 19, SEQ ID 21 , SEQ ID 23, SEQ ID 25, SEQ ID 27, SEQ ID 29, SEQ ID 31 , SEQ ID 33, SEQ ID 35, SEQ ID 37, SEQ ID 39, SEQ ID 41 , SEQ ID 43, SEQ ID 45 or fragments of these sequences.
  • the fragment can be considered any sequence of consecutive nucleotides contained in the sequence SEQ ID 1 , SEQ ID 3, SEQ ID 5, SEQ ID 7, SEQ ID 9, SEQ ID 1 1 , SEQ ID 13, SEQ ID 15, SEQ ID 17, SEQ ID 19, SEQ ID 21 , SEQ ID 23, SEQ ID 25, SEQ ID 27, SEQ ID 29, SEQ ID 31 , SEQ ID 33, SEQ ID 35, SEQ ID 37, SEQ ID 39, SEQ ID 41 , SEQ ID 43, SEQ ID 43, SEQ ID 45.
  • the fragment is also defined by causing death, atrophy or slowing the development of a pathogen when provided in the form of dsRNA.
  • the invention also provides a ribonucleic acid expressed from any of the presented sequences, including a dsRNA.
  • the sequences shown were generated from the genetic code of one or more target pests. Genes were chosen to be deleted/silenced where they were able to kill or incapacitate the target pests.
  • the target gene is the complex III subunit cytochrome b gene.
  • the invention also provides a method of suppressing target gene in the plant diseases Alternaria solani, Alternaria spp, Aspergillus flavus, Bipolaris oryzae, Botrytis cinerea, Cercospora beticola, Cladosporium spp, Claviceps purpurea, Colletotrichum graminicola, Colletotrichum spp, Erysiphe necator, Eutypa lata, Fusarium circinatum, Fusarium culmorum, Fusarium gerlachii, Fusarium graminearum, Fusarium oxysporum, Gaeumannomyces graminis, Hemileia vastatrix, Leptosphaeria maculans, Magnaporthe oryzae, Monilinia laxa, Mycosphaerella fijiensis, Mycosphaerella graminicola, Penicillium expansum, Phaeosphaeria nodorum, Pha
  • the present invention characterize methods and compositions to fungi control for any particular grow crop.
  • the present invention implement recombinant DNA technology to post-transcriptionally inhibit in any degree a target gene sequence in cells of a described variety of fungi.
  • This effect is achieved by cell intake of regulatory double strands RNA (dsRNA) of any type, like micro RNA (miRNA), small interference (siRNA) and small hairpin RNA (shRNA), which sequence comes from a segment or from the entire target gene that promotes directly or indirectly the infestation. Therefore the present invention refers to pest's inhibition of expression of coding sequences by specific double strand RNA sequences to achieve desired infestation control levels.
  • dsRNA regulatory double strands RNA
  • miRNA micro RNA
  • siRNA small interference
  • shRNA small hairpin RNA
  • the present invention provides fragments or complements from portions of sequences that are examples of nucleic acid compositions homologue to selected sequences between SEQ ID 1 , SEQ ID 3, SEQ ID 5, SEQ ID 7, SEQ ID 9, SEQ ID 1 1 , SEQ ID 13, SEQ ID 15, SEQ ID 17, SEQ ID 19, SEQ ID 21 , SEQ ID 23, SEQ ID 25, SEQ ID 27, SEQ ID 29, SEQ ID 31 , SEQ ID 33, SEQ ID 35, SEQ ID 37, SEQ ID 39, SEQ ID 41 , SEQ ID 43, SEQ ID 45.
  • this invention present an active ingredient composition comprising an efficient amount of a dsRNA molecule here defined and an agriculturally adequate support, carrier, filler and/or surfactant.
  • a synthetic or engineered natural or inorganic compound with which the active compound is mixed signifies the expression "support”, even when combined or associated to make it simpler to apply to the parts of a plant.
  • This support is therefore and by large inert and ought to be agronomically satisfactory, and can be a solid or a fluid.
  • Samples of suitable supports incorporate clays, natural or engineered silicates, silica, resins, waxes, solid fertilizers, water, alcohols, organic solvents, mineral and plant oils and derivatives thereof. Blends of such supports can likewise be utilized.
  • composition as indicated by the invention can likewise contain extra components, for example, yet not restricted to, surfactant, protective colloids, adhesives, thickeners, thixotropic operators, penetration agents, stabilizers and/or sequestering agents. Consenting to the typical formulation methods, generally the mixes can be joined with any solid or fluid added substance.
  • the composition as indicated by the invention can contain from 0.05 to 99% by weight of active compound, ideally 10 to 70% by weight.
  • compositions as indicated by the invention can be utilized in many ways, for example: as a emulsifiable concentrate, emulsion oil in water, emulsion water in oil, dustable powder, wettable powder, oil dispersible powder, soluble powder, powder for dry seed treatment, water dispersible powder for slurry treatment, water dissolvable powder for seed treatment, granule, encapsulated granule, fine granule, macrogranule, microgranule, water dispersible granules or tablets, water dispersible granules or tablets, capsule suspension, ultra low volume (ULV) suspension, suspension concentrate (flowable concentrate), cold fogging concentrate, flowable concentrate for seed treatment, oil miscible flowable concentrate, hot fogging concentrate, dissolvable concentrate, seed covered with a pesticide, solution for seed treatment, oil miscible fluid, paste, plant rodlet, aerosol dispenser, pressurized gas, gas generating product, and ultra low volume (ULV) liquid.
  • UUV ultra low volume
  • the compounds can likewise be blended with one or more phytopharmaceutical or plant growth stimulator compound, for example, a nematicide, herbicide, acaricide, fungicide, insecticide, molluscicide, safeners, resistance inducer, signal compounds, pheromone active substance or different compounds with biological activity.
  • a phytopharmaceutical or plant growth stimulator compound for example, a nematicide, herbicide, acaricide, fungicide, insecticide, molluscicide, safeners, resistance inducer, signal compounds, pheromone active substance or different compounds with biological activity.
  • the blends therefore acquired have a widened range of activity, in particular blends with other insecticide and nematicide compounds are especially beneficial.
  • the dsRNA in a particular realization of the invention, may be processed by the plant cell containing RNAi processing machinery in small fragments (siRNAs) after its introduction or production inside the plant and can afterwards be distributed all over the plant.
  • Processed siRNA previously designed by its correspondent dsRNA, might also be inserted or produced inside the cells, without the need of processing by the natural cell machinery.
  • the cell-introduced or produced dsRNA or siRNA is alternatively constituted of a regulatory element or promoter that drives the dsRNA/siRNA expression in a tissue, in a spatial, temporal or inducible manner.
  • a chimeric gene or genetic construction that comprises one or more DNA sequences and heterologous regulatory elements upstream (in the 5' position) or downstream (in the 3' position) to the said DNA sequences, that are capable to be functional in a plant.
  • This functionality is characterized by the DNA sequence(s) being able to from the herein defined dsRNA(s) or it related forms (siRNA, miRNA or shRNA) when expressed in plants.
  • the chimeric gene or genetic construction comprises a functional plant cell gene expression regulatory sequence, also known as promoter, operating a DNA sequence, that in turn generates a RNA molecule when transcribed.
  • This said RNA molecule comprises one or more sense or antisense sequences which are at any rate partially complementary.
  • the mentioned sense sequence comprises at least a sequence identity of 18 contiguous nucleotides from the target gene and the aforementioned antisense sequence comprises a considerable complementarity to the said sense sequence.
  • the genetic construction or chimeric gene also comprises an optional terminator regulatory sequence.
  • the said embodiment may have a particular feature regarding one of the forms the dsRNA may be designed, in accord to this invention, with respect to the aforementioned DNA sequence, which is the so-called hairpin RNA or short (or small) hairpin RNA (shRNA).
  • the DNA sequence that may transcribe the shRNA may be constituted by the sense and antisense strand, relative to a part of the target gene to be silenced from the plant pathogen, separated by an intron or a spacer that does not have homology to any part of target gene.
  • Sense and antisense strands pair and the spacer or intron acts as a structural loop, resulting in the aforementioned shRNA molecule, which could also be detected by RT-PCR.
  • This form of dsRNA associates with an enzymatic complex called DICER and is degraded, forming siRNAs, another form of dsRNA, ranging the size from 18 to 25 contiguous nucleotides.
  • shRNA form of the dsRNA in accord to the invention, could also have its sense and antisense strands, which are essentially homologous to a section or the entire target gene, in any size and from any particular part from its homologous gene whose inhibition or repression aims to be achieved by the aforementioned mechanism involving DICER and the intracellular RNA silencing machinery.
  • Another particular embodiment of the genetic construct comprises: two regulatory sequences that regulates the promotion of transcription, the promoters, situated on the upstream region of the sense and antisense sequences.
  • One of the promoters operates the transcription of the correspondent DNA sequence generating at least one sense sequence.
  • the other promoter acts the same manner but generating at least one RNA antisense sequence, that might be partially or completely complementary to the sense sequence.
  • the sense sequence comprises at least 18 contiguous nucleotides of homology to the target gene and optionally regulatory transcription termination sequences, the terminators.
  • two chimeric genes may comprise the genetic construction.
  • the second chimeric gene comprises the regulatory sequence of the promoter that operates the transcription through the correspondent DNA to a RNA molecule that comprises in this case at least one antisense sequence of the gene to be targeted for silencing, with a sequence partly complementary to the sense sequence, and also optionally the previously mentioned terminator sequence.
  • the genetic construction may also be alternatively comprised as: a initial promoter that operates a sequence of double stranded DNA, in which one strand, when transcribed by this first promoter, generates a RNA molecule with at least a sense sequence considerably identical to 18 contiguous bases of the target gene.
  • This said sequence also might optionally comprises a regulatory transcription termination sequence.
  • the remaining strand is transcribed to RNA by the control of the second promoter, producing an antisense RNA sequence partly complementary to the sense sequence, and a optionally a regulatory transcription terminator sequence, and also a second promoter, in the direction opposite to the first promoter direction.
  • the two said regulatory transcription promoters may be identical or different.
  • the invention provides a genetic construct that comprises two regulatory promoter sequences: one functionally linked to the expression of a particular DNA sequence that when transcribed generates a sense RNA sequence; and other functionally linked to another DNA sequence which when transcribed generates an antisense RNA sequence complementary to the first sense RNA sequence.
  • Both sense and antisense molecules of generated RNA as described above can be complemented in sizes of at least 18-25 base pairs, forming molecules with sequences or fragments of the sequences set forth in the invention.
  • the genetic construct in question comprises two chimeric genes each containing a promoter regulatory sequence, a coding area and possibly a terminator sequence.
  • One chimeric gene will have a promoter regulatory sequence functionally linked to the expression of a particular DNA sequence that when transcribed generates a sense RNA sequence; and another chimeric gene contains a promoter regulatory sequence functionally linked to another DNA sequence which when transcribed generates an antisense RNA sequence complementary to the first sense RNA sequence.
  • Both sense and antisense molecules of the generated RNA as described above can be complemented in sizes of at least 18-25 base pairs, forming molecules with sequences or fragments of the sequences set forth in the invention.
  • the two genes are preferably inserted into the plant cell together so that it favors the complementation of sense and antisense sequences.
  • the genetic construct in question may be formed by a first promoter operably linked to a double stranded DNA sequence, where a strand is transcribed under control of this first promoter, generating a sense RNA sequence; and a second promoter which controls the transcription of the second strand, which operates in the opposite direction, generating an anti sense strand of RNA.
  • first promoter operably linked to a double stranded DNA sequence, where a strand is transcribed under control of this first promoter, generating a sense RNA sequence
  • a second promoter which controls the transcription of the second strand, which operates in the opposite direction, generating an anti sense strand of RNA.
  • the chimeric gene is defined as a nucleotide sequence containing a functional promoter regulatory sequence of plants or plant cells, a sequence encoding a protein or an RNA sequence and optionally a terminator. These different regions of the chimeric gene should be functionally linked, so that the promoter can in fact express the coding sequence within the plant cell or the organism concerned.
  • the term gene may refer to the term chimeric gene.
  • the term chimeric gene may also refer to a gene in which the coding sequence is not directly and sequentially linked to a regulatory promoter sequence, but is indirectly linked to a promoter that regulates multiple coding sequences.
  • promoter or regulatory promoter sequence refers to any regulatory sequence present in plant genes, preferably in some cases, genes expressed only in plant leaves. Promoters from bacteria, viruses and other organisms can also be suitable for expression of the sequences shown. The choice of suitable promoters for the expression of the coding sequence depends on where it is desired expression of the coding sequence.
  • Some possible promoters are the CaMV (19S or 35S), CsVMV [1 1], or the circovirus promoter or specific promoters seeds or tissues and specific plant areas such as the promoters of the napin, phaseolin , glutenin, heliathinina, albumin, and oleosin.
  • Sense sequence is defined as a nucleotide sequence that in the case of DNA, when transcribed generates a mRNA sequence, or in the case of an RNA, a sequence that can be translated into a protein.
  • Antisense sequences are also defined as the complementary sequences to the referred sense sequences.
  • terminator is also defined as a nucleotide sequence, possibly part of a gene, that functions as a blocking point during the phase of DNA transcription, possibly indicating the end of a gene.
  • Vectors or expression vectors in the context of biotechnology and genetic engineering are defined as circular DNA sequences, usually artificially designed to integrate exogenous DNA sequences in the genome of the target organism.
  • Plasmids are defined as DNA sequences, generally found in bacteria, that are capable of being integrated in the genome of the target organism; Natural and artificial plasmids are used to modify genetically bacteria and other microorganisms using techniques such as biolistic, electroporation, heat-shock and etc.
  • the plants that have undergone a transformation process have to go through a selection step so that the positive transformants can be identified.
  • the selection step can be carried out by virtue of the presence of a selectable gene in a construct as described in the present invention or in a plasmid used for the transformation of the plants or any other cell.
  • the gene used for selection may be presented in the form of a genetic construction with the following components: (i) a promoter functional in plant cells linked in the transcriptional direction; (ii) a sequence encoding a selectable gene marker suitable for transformant selection; (iii) a terminator functional in plant cells.
  • Markers that can be used for selection may be genes encoding easily and readily identified proteins, such as the Green Fluorescent Protein (GFP) and other fluorescent ones and other genes involved in the production of pigments [12].
  • GFP Green Fluorescent Protein
  • genes that contain markers for antibiotic resistance such as, for example, the aminoglycoside 3"-adenyltransierase producing gene (aadA) that confers resistance to spectinomycin and streptomycin [13]; the hygromycin phosphotransferase gene [14]; the neomycin phosphotransferase II gene that provides kanamycin resistance [15].
  • the present invention aiso relates to the a method of producing transgenic plants or plant cells able of expressing a dsRNA that inhibits a oomycetes or fungi complex III subunit cytochrome b gene, where the aforementioned method comprises the steps for transforming a plant ceil with a chimeric gene or genetic construct as described in the invention.
  • the plant cell may be from and the plant may be maize, soybean, common bean, tomato, cotton, rice, wheat.
  • the present invention relates aiso to the plants or part of plants that have gone through transformation process and their respective seeds, and aiso relates to the plants or part of plants derived from cultivating and/or crossing the aforementioned regenerated plants.
  • transformation method is the Electroporation, which consists in exposing the subject cell to be transformed and vectors to be inserted to an electric field [17][18]. Another method consists in directly injecting the vector into the cell or plant tissues via microinjection [19]. Another approach is to bring in the cell or tissue of the host plant/organism in contact with polyethylene glycol (PEG) and the vector to be inserted [20]. As another method of transformation one could use the bombarding into cell or tissue with particle onto which the vector to be inserted is adsorbed [21 ][22]. More preferably, the transformation can be carried out using Agrobacterium genus, such as A. rhizogenes [23] [24] and, preferably, A. tumefaciens [25][26].
  • Agrobacterium genus such as A. rhizogenes [23] [24] and, preferably, A. tumefaciens [25][26].
  • the present invention comprises part of these plants, as well as their progeny.
  • the term "part of these plants” here means any organ of the plant, what includes the portions above and under the ground.
  • progeny mean any seeds containing an embryo derived from the reproduction of with one another. This applies to all the next generations of seeds derived from crosses between plants transformed as according to the invention.
  • the invention therefore relates to a method for controlling plant pathogen, specially fungus and oomycete, through the use of dsRNA molecules according to the invention or a composition according to the invention applied to the soil where plants can grow or are capable of growing, to the leaves and/or the fruit of plants or to the seeds of the plants, wherein the said plant pathogen can be Alternaria solani, Aspergillus flavus, Fusarium graminearum, Phakopsora pachyrhizi, Puccinia graminis, Sclerotinia sclerotiorum, and the said plant can be maize, soybean, common bean, tomato, cotton, rice, wheat.
  • the application of the dsRNA molecules or a composition containing dsRNA molecules, both as specified in the invention, can be carried out using various methods of treatment such as: (i) spraying onto the aerial parts of the said plants a liquid comprising one of the said compositions; (ii) dusting, the incorporation into the soil of granules or powder, spraying, around the said plants and in the case of trees injection or daubing; (iii) coating or film-coating the seeds of the said plants with the aid of a plant-protection mixture comprising one of the said compositions.
  • the method presented in the invention can either be a preventing, eradicating or curing method.
  • a composition used in the method can be prepared beforehand by mixing two or more active compounds according to the invention.
  • dsRNA compound used in the method vary for each of application methods according to the invention. A person skilled in the art will know how to adapt the application doses according to the nature of the crop aim to be treated.
  • the active compound to be used successively, separately or simultaneously may be a phytopharmaceutical or a plant growth promoting compound, which may be a fungicide, insecticide, nematicide, herbicide, resistance inducer, safener or signal compound.
  • a person skilled in the art will know how to adapt the application doses according to the nature of the crop aim to be treated.
  • the crop to be treated with the pesticide composition or combination as described in the invention can be, for example, corn, soybean, cotton, Brassica oilseeds such as Brassica napus (e.g. canola), Brassica rapa, B. juncea (e.g. mustard) and Brassica carinata, rice, wheat, sugar beet, sugarcane, oats, rye, barley, millet, triticale, flax, vine and various fruits and vegetables of various botanical taxa such as Rosaceae sp.
  • Brassica oilseeds such as Brassica napus (e.g. canola), Brassica rapa, B. juncea (e.g. mustard) and Brassica carinata, rice, wheat, sugar beet, sugarcane, oats, rye, barley, millet, triticale, flax, vine and various fruits and vegetables of various botanical taxa such as Rosaceae sp.
  • Ribesioidae sp. for instance pip fruit such as apples and pears, but also stone fruit such as apricots, cherries, almonds and peaches, berry fruits such as strawberries
  • Ribesioidae sp. Jug andaceae sp.
  • Betulaceae sp. Anacardiaceae sp., Fagaceae sp., Moraceae sp,, O eaceae sp., Actinidaceae sp.. Lauraceae sp., usaceae sp. (for instance banana trees and plantings), Rubiaceae sp.
  • Theaceae sp. for instance coffee
  • Theaceae sp. Sterculiceae sp.
  • Rutaceae sp. for instance lemons, oranges and grapefruit
  • Solanaceae sp. for instance tomatoes, potatoes, peppers, eggplant
  • Liliaceae sp. Compositiae sp.
  • lettuce, artichoke and chicory - including root chicory, endive or common chicory for instance lettuce, parsley, celery and celeriac
  • Cucurbitaceae sp. for instance cucumber - including pickling cucumber, squash, watermelon, gourds and melons). Alliaceae sp.
  • Cruciferae sp. for instance white cabbage, red cabbage, broccoli, cauliflower, brussei sprouts, pak choi, kohlrabi, radish, horseradish, cress, Chinese cabbage
  • Leguminosae sp. for instance peanuts, peas and beans beans - such as climbing beans and broad beans
  • Chenopodiaceae sp. for instance mangold, spinach beet, spinach, beetroots).
  • Malvaceae for instance okra
  • Asparagaceae for instance asparagus
  • horticultural and forest crops ornamental plants; as well as genetically modified homologues of these crops
  • the method presented in the invention can also be used to treat propagation material and other parts of the plant such as, for example, rhizomes or tubers, seeds, seedlings or seedling pricking out, plants or plants pricking out, underground trunks, stems or stalks, leaves, flowers, fruits; basically any material that is susceptible to fungal infection.
  • the Invention further relates to a method of plant pathogen control, in particular oomycete and fungus complex III subunit cytochrome b gene, comprising three steps: (i) transforming a cell of a plant with a chimeric gene as described in the invention; (ii) putting the transformed cells under condition so they can expressed the gene in the said genetic construct; (iii) having the transformed gene expressing cell aforementioned in contact with the pathogen.
  • the method aforementioned according to the invention is inhibiting a oomycete or fungal complex III subunit cytochrome b gene, wherein said oomycete or fungus is a Alternaria solani, Alternaria spp, Aspergillus flavus, Bipolaris oryzae, Botrytis cinerea, Cercospora beticola, Cladosporium spp, Claviceps purpurea, Colletotrichum graminicola, Colletotrichum spp, Erysiphe necator, Eutypa lata, Fusarium circinatum, Fusarium culmorum, Fusarium gerlachii, Fusarium graminearum, Fusarium oxysporum, Gaeumannomyces graminis, Hemileia vastatrix, Leptosphaeria maculans, Magnaporthe oryzae, Monilinia laxa, Myco
  • the method according to the present invention can also be applied to genetically modified organism (GMO), like plants or seeds.
  • Plants that have been genetically modified also known as transgenic plants, are those that had a heterologous gene stably integrated to their genome.
  • the expression "heterologous gene” means the a gene is provided or assembled outside the plant and when introduced in the nuclear, mitochondrial or chloroplastic genome gives the plant the an improved agronomic feature by expressing a RNA or its respective protein or polypeptide or by silencing a other gene(s) present in the plant.
  • An heterologous gene inserted in a plant is called transgene.
  • plants and plants cultivar that are preferably to be treated include all plants which have genetic material which impart particularly advantageous useful traits to these plants, whether obtained by breeding and/or biotechnological means. More preferably to be treated according to the invention are plants which display resistance to one or more biotic stress such as, microbial pathogens, nematodes, insects, mites, phytopathogenic fungus, bacteria, viruses and/or viroids.
  • Plants and plant cultivar that may also be treated with the method according to the invention are those which present resistance against abiotic stress, such as, for example, cold temperature exposure, drought, heat exposure, high light exposure, flooding, ozone exposure, increased mineral exposure, increased soil salinity, limited availability of nitrogen and/or nutrients and/or phosphorus.
  • abiotic stress such as, for example, cold temperature exposure, drought, heat exposure, high light exposure, flooding, ozone exposure, increased mineral exposure, increased soil salinity, limited availability of nitrogen and/or nutrients and/or phosphorus.
  • Plants and plant cultivar that can also be treated with the method according to the invention are those characterized for its increased agronomic yield.
  • the enhanced yield obtained by these said plant may be a consequence of improved physiology, growth and development, e.g. high water usage efficiency, improved nitrogen source use, improved carbon assimilation.
  • the method of treatment according to the invention may also result in superadditive ("synergistic").
  • superadditive effects are: better plant growth, greener leaves, earlier flowering, increase tolerance to drought, increased tolerance to high and low temperature, which exceed the effects which were actually expected.
  • Cercospora beticola.Cladosporium spp Claviceps purpurea, Colletotrichum graminicola, Colletotrichum spp, Erysiphe necator, Eutypa lata.Fusarium circinatum, Fusarium culmorum, Fusarium gerlachii, Fusarium graminearum, Fusarium oxysporum, Gaeumannomyces graminis, Hemileia vastatrix, Leptosphaeria maculans, Magnaporthe oryzae, Monilinia laxa,
  • Mycosphaerella fijiensis Mycosphaerella graminicola, Penicillium expansum, Phaeosphaeria nodorum, Phakopsora meibomiae, Phakopsora pachyrhizi, Podosphaera leucotricha, Puccinia graminis, Puccinia striiformis, Pyrenophora teres, Ramularia collo-cygni, Rhizoctonia solani, Rhizopus oryzae, Rhizopus stolonifer, Rhynchosporium secalis, Sclerotinia sclerotiorum, Taphrina deformans, Venturia inaequalis, Verticillium dahliae, Magnaporthe grisea
  • Standard materials and methods for plant molecular biology are described in Croy R.D.D. (1 993, Plant Molecular Biology LabFax. BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (UK)).
  • Standard materials and methods for PGR Polymerase Chain Reaction
  • Dieffenbach and Dveksler (1 995, PGR Primer: A laboratory manual, Cold Spring Harbor Laboratory Press, NY) and in McPherson ef al. (2000, PGR - Basics: From background to bench, First edition, Springer Verlag, Germany).
  • Example 1 Preparation of Fusarium graminearum Fungal Macroconidia and in Vitro Silencing RNA Treatment.
  • Macroconidia were filtered through four layers of sterile mira-cloth, collected, and washed three times with sterile distilled water, and finally diluted to 100 macroconidia in a volume of 100 pL liquid SNA medium, and plated in a 96-well microtiter plate.
  • Different concentrations of dsRNA suspended in 2.5 pL of 50 ⁇ annealing buffer was added to fungal samples and equal volume of 50* annealing buffer was added to the control sample. Plates were incubated at room temperature. Microscopic studies were performed 72 h posttransplantation (hpt) with an inverted microscope (Leica DM IL).
  • CYTBRNA was amplified by gene-specific primers CYTB-F-Hindlll (AAGCTTCAGCAAGTTTGACGAGTC) and CYTB-R-Xmal (CCCGGGCATTGGAGCAGTCATAAACAA), and cloned right away into p7U10 binary vector, which contains the selectable marker gene bar under control of the Arabidopsis Ubiquitin-10 promoter (UBQ10) and inverted constitutive CaMV35s promoter .
  • Ubiquitin-10 promoter Ubiquitin-10 promoter
  • the resulting plasmid p7U10-CYTB-RNA was introduced into the A.
  • tumefaciens strain AGL1 (Lazo et al, 1991) by electroporation. Arabidopsis transformation and regeneration were performed as described ( Bechtold et al, 1993), and transformants were selected by Basta (7 mg-L-1 ; Duchefa Biochemie).
  • Biolistic transformation procedure was carried out as described by Rech et al (2008). Microparticles of tungsten were washed and sonicated as specified by Rech and then coated with a plasmid containing a plant promoter, such as the CaMV35S; coding sequence for the dsRNA targeting the cytochrome b gene with sequence as described in the present invention; and a terminator; and also a the £>ar gene that confers glyphosate resistance for transformant selection. Up to 300 soybean seeds to be transformed were decontaminated with 300ml 70% ethanol for 1 min followed by 20-30 min sodium hypochlorite wash. Embryonic axes were excised from the seeds and placed in a Petri dish.
  • Microparticle bombardment were carried with a PDS-1000/He System Bio-Rad following the specification of the equipment manufacturer. Immediately after bombardment the embryonic axes were then grown in a induction solution for multiple shoot development for 16h (dark) at 26°C and subsequently transferred to a selection/elongation solution for 16h (photoperiod) 28°C (Rech et al, 2008). Afterwards the roots plantlets were transferred to a greenhouse as described by Rech (2008).
  • Example 4 PCR Analysis for transformant plant cell selection in common bean Phaseolus vulgaris
  • DNA was isolated from leaf disks according to Edwards et al. (1991). Each PCR reaction was carried out in 25 ml of reaction mixture containing 10 mM Tris-HCI (pH 8.4), 50 mM KCI, 2 mM MgCI2, 160 mM of each dNTP, 200 nM of each primer, 2 U of Taq polymerase (Invitrogen, Carlsbad, CA, USA) and 10-20 ng of genomic DNA. The mixture was overlaid with mineral oil, denatured for 5 min at 95 8C and amplified for 35 cycles (95 8C for 1 min, 55 8C for 1 min, 72 8C for 1 min) with a final extension of 7 min at 72 8C.
  • the PCR reactions were carried out in a thermocycler (PTC-100, MJ Researcher, USA). The reaction mixture was then loaded directly onto a 1 % agarose gel, stained with ethidium bromide and visualized with UV light.
  • the primers CYTB-F (ATGAGAGATTTTAAGACACACC) and CYT-R (ATTCAGACAATTATATTCCTGC) were used to screen the transgenic plants forthe presence of the cyt b gene.
  • the primer pair T3 50 - CGCAATTAACCCTCACTAAAGGG-30
  • ACIvATG 50 - ACGCTTTGGTGGTGCCATGG-30
  • Primers BAR-1 50 -GGTCTGCACCATCGTCAACC-30
  • BAR-2 50 -CTGAAGTCCAGCTGCCAGAA-30
  • RNA samples Possible remaining genomic DNA was eliminated by DNase digestion of the RNA samples.
  • a PCR reaction was carried out using RNA to confirm DNA removal. Two micrograms of total RNA were used to produce cDNA using the reverse transcriptase Superscript II (Invitrogen, Carlsbad, CA, USA), according to the protocol suggested by the manufacturer. PCR reactions were carried out as described above except that 25 ng of cDNA [quantified using the DyNA Quant 200 fluorometer (Amershan Pharmacia Biotech, Buckinghamshire, UK)] was used as a template with 24 cycles of amplification.
  • the primers CYTB5-F (ATGAGAGATTTTAAGACACACC) and CYTB5-R (ATTCAGACAATTATATTCCTGC) were used to amplify a 779-bp sequence from the cytb gene.
  • the primers BAR-F (ATGAGCCCAGAACGACGCCC) and BAR-R (CCTGCCCGTCACCGAGATCTG) were used to amplify a 551 -bp sequence from the bar gene.
  • the primers rRNA1 50 -AACGGCTACCACATCCAAGG-30 )
  • the suspension was aliquoted into smaller batches, and an equal volume of TRIzol (Invitrogen) and one-fifth volume of chloroform were added.
  • the mixture was centrifuged at 15,000g for 15 min at 4°C.
  • the aqueous upper phase was recovered, one-half volume of isopropanol was added, and the mixture was consequently centrifuged at 15,000g for 10 min at 4°C.
  • the pellet was washed once with 70% ethanol and resuspended in RNase-free 18 V milli-Q water. LiCI was added to a final concentration of 2 M to precipitate ssRNA.
  • the samples were centrifuged at 15,000g for 30 min at 4°C.
  • the supernatant was collected, LiCI was added to a final concentration of 4 M, after which the samples were centrifuged as above.
  • the pellet was dissolved in RNase-free 18 V milli-Q water and precipitated again by adding 2.5 volumes of 96% ethanol. After incubation at20°C for 30 min, dsRNA was recovered by centrifugation at 15,000g for 20 min at 4°C.
  • the purified dsRNA pellet was dissolved in RNAse free 18 V milli-Q water and the concentration was determined by measuring absorption at 260 nm.
  • the dsRNA segments were separated by anion-exchange high-performance liquid chromatography (HPLC) using a Waters Gen-Pak FAX column (Waters).
  • dsRNA (90 mg) was injected onto the column in 25 mM Tris-HCI (pH 8.0), 1 mM EDTA. A linear gradient from 0 M NaCI to 1 M NaCI was applied (0.25 mL/min, 180 min), and fractions of 250 mL were collected. The segments eluted as separate peaks.
  • Sclerotinia sclerotiorum were cultivated on sterilized potato dextrose agar.
  • the media was prepared with 300g potatoes autoclaved (30min in 600ml distilled water), 15g agar (Sigma-Aldrich), 20g dextrose and distilled water (added to complete a 1 L total solution volume).
  • S. sclerotiorum was inoculated in the center of dextrose potato agar plates with a sterile rod and incubated at 25°C/90% humidity up to 3 weeks.

Abstract

L'invention concerne un procédé pour lutter contre des champignons par inhibition d'une ou plusieurs fonctions biologiques par inhibition ou réduction d'un degré quelconque de l'expression de gènes du cytochrome b avec un ou plusieurs ARN à double brin. L'invention concerne également une composition et des procédés pour obtenir un micro-organisme génétiquement modifié capable de produire un ARNdb selon l'invention, et des plantes transgéniques résistant audit champignon à l'aide des molécules ARN à double brin susmentionnées pour réaliser une telle lutte, ainsi que les plantes et graines ainsi générées.
PCT/IB2016/053376 2016-06-08 2016-06-08 Arni pour la lutte contre des champignons par inhibition de gène cytb WO2017212315A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/IB2016/053376 WO2017212315A1 (fr) 2016-06-08 2016-06-08 Arni pour la lutte contre des champignons par inhibition de gène cytb

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/IB2016/053376 WO2017212315A1 (fr) 2016-06-08 2016-06-08 Arni pour la lutte contre des champignons par inhibition de gène cytb

Publications (1)

Publication Number Publication Date
WO2017212315A1 true WO2017212315A1 (fr) 2017-12-14

Family

ID=60578410

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2016/053376 WO2017212315A1 (fr) 2016-06-08 2016-06-08 Arni pour la lutte contre des champignons par inhibition de gène cytb

Country Status (1)

Country Link
WO (1) WO2017212315A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10392620B2 (en) 2016-11-10 2019-08-27 Dow Agrosciences Llc Cytochrome B (CYTB) nucleic acid molecules that control pathogens
CN110484652A (zh) * 2019-09-26 2019-11-22 陕西师范大学 一种鲜榨苹果汁的鉴伪方法
WO2022151607A1 (fr) * 2021-01-17 2022-07-21 浙江师范大学 Utilisation d'une amélioration génétique pour la résistance à la moisissure grise de la tomate
CN114958841A (zh) * 2022-03-25 2022-08-30 南京农业大学 一种抑制稻瘟病菌的关键基因、dsRNA及其制备和应用

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBank [O] 1 January 2017 (2017-01-01), "Alternaria alternata cytochrome b (cytb) gene , partial cds", XP055444685, Database accession no. DQ209283.1 *
GRASSO ET AL.: "Cytochrome b gene structure and consequences for resistance to Qo inhibitor fungicides in plant pathogens", PEST MANAG SCI., vol. 62, no. 6, 2006, pages 465 - 472, XP055269748 *
KOCH ET AL.: "Host-induced gene silencing of cytochrome P450 lanosterol C14-demethylase- encoding genes confers strong resistance to Fusarium species", PROC NATL ACAD SCI USA, vol. 110, no. 48, 2013, pages 19324 - 19329, XP055106550 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10392620B2 (en) 2016-11-10 2019-08-27 Dow Agrosciences Llc Cytochrome B (CYTB) nucleic acid molecules that control pathogens
CN110484652A (zh) * 2019-09-26 2019-11-22 陕西师范大学 一种鲜榨苹果汁的鉴伪方法
WO2022151607A1 (fr) * 2021-01-17 2022-07-21 浙江师范大学 Utilisation d'une amélioration génétique pour la résistance à la moisissure grise de la tomate
JP2023513862A (ja) * 2021-01-17 2023-04-04 浙江師範大学 トマト灰色かび病抵抗性の向上のための遺伝子の使用
JP7383136B2 (ja) 2021-01-17 2023-11-17 浙江師範大学 トマト灰色かび病抵抗性の向上のための遺伝子の使用
CN114958841A (zh) * 2022-03-25 2022-08-30 南京农业大学 一种抑制稻瘟病菌的关键基因、dsRNA及其制备和应用

Similar Documents

Publication Publication Date Title
Spence et al. Crucial roles of abscisic acid biogenesis in virulence of rice blast fungus Magnaporthe oryzae
Shin et al. Transcriptome changes specifically associated with apple (Malus domestica) root defense response during Pythium ultimum infection
US20170044560A1 (en) Compositions and methods for reducing pathogen-induced citrus greening
US20190382770A1 (en) RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE
JP2021534817A (ja) 動物を病原性細菌から保護するならびに／または相利共生および片利共生細菌の有益な効果を促進するためのｒｎａベースの治療方法
JP2020511472A (ja) 植物病原体の生物的防除のための系および方法
WO2017212315A1 (fr) Arni pour la lutte contre des champignons par inhibition de gène cytb
Seifi et al. Spermine is a potent plant defense activator against gray mold disease on Solanum lycopersicum, Phaseolus vulgaris, and Arabidopsis thaliana
Jeyaraj et al. Utilization of microRNAs and their regulatory functions for improving biotic stress tolerance in tea plant [Camellia sinensis (L.) O. Kuntze]
Liu et al. Enhanced overall resistance to Fusarium seedling blight and Fusarium head blight in transgenic wheat by co-expression of anti-fungal peptides
Prabhavathi et al. Mannitol-accumulating transgenic eggplants exhibit enhanced resistance to fungal wilts
Hameed et al. Barley resistance to Fusarium graminearum infections: from transcriptomics to field with food safety concerns
Yıldırım et al. Genome editing for healthy crops: traits, tools and impacts
Abbas et al. Enhanced Nicotiana benthamiana immune responses caused by heterologous plant genes from Pinellia ternata
EP4061949A1 (fr) Procédés de lutte contre les insectes nuisibles multi-espèces
Russell et al. Progress in the development of transgenic cabbage, cauliflower and canola expressing stacked bts for caterpillar control and RNAi for aphid suppression.
Ghosh et al. Mechanisms involve in jute resistance to macrophomina phaseolina: strategies for developing resistant jute varieties
Jiang et al. Characterization and comparison of three transgenic Artemisia annua varieties and wild-type variety in environmental release trial
US20220290170A1 (en) Rna-based control of powdery mildew
Barman et al. Harnessing Perks of MiRNA Principles for Betterment of Agriculture and Food Security
US10920240B2 (en) Methods and compositions for the control of rust fungi by inhibiting expression of the HXT1 gene
Gupta Phyto-gene therapy using antisense oligonucleotides to control cereal fungal disease by silencing virulence factors and their regulators
Sánchez Sanuy Understanding the role of iron homeostasis in rice immunity and novel applications of miRNAs for crop protection
Das Laha et al. Impact of biotic stresses on the Brassicaceae family and opportunities for crop improvement by exploiting genotyping traits
Ghosh et al. Moleculer defence response in tomato against Alternaria blight: an over view.

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16904535

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16904535

Country of ref document: EP

Kind code of ref document: A1