WO2017212264A1 - Procédé d'intégration d'un adn donneur dans un adn cible - Google Patents

Procédé d'intégration d'un adn donneur dans un adn cible Download PDF

Info

Publication number
WO2017212264A1
WO2017212264A1 PCT/GB2017/051653 GB2017051653W WO2017212264A1 WO 2017212264 A1 WO2017212264 A1 WO 2017212264A1 GB 2017051653 W GB2017051653 W GB 2017051653W WO 2017212264 A1 WO2017212264 A1 WO 2017212264A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
integrase
dna
polypeptide
guided polypeptide
Prior art date
Application number
PCT/GB2017/051653
Other languages
English (en)
Inventor
Ryan Cawood
Thomas Payne
Lucia DUNAJOVA
Original Assignee
Oxford Genetics Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oxford Genetics Limited filed Critical Oxford Genetics Limited
Publication of WO2017212264A1 publication Critical patent/WO2017212264A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/10033—Use of viral protein as therapeutic agent other than vaccine, e.g. apoptosis inducing or anti-inflammatory
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/10041—Use of virus, viral particle or viral elements as a vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/10041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/10042—Use of virus, viral particle or viral elements as a vector virus or viral particle as vehicle, e.g. encapsulating small organic molecule

Definitions

  • the present invention relates to a method of integrating a donor DNA into a target DNA sequence.
  • the method involves the use of a nucleoprotein/integrase complex which comprises (i) a nucleic acid-guided polypeptide, (ii) a guide nucleic acid which interacts with (i) and which has a nucleic acid portion complementary to the target DNA sequence, and (iii) an integrase, preferably a retroviral integrase.
  • Retroviruses are useful tools for the insertion of DNA into eukaryotic genomes. They have been used in vitro for the modification of cells to express genes of interest and also as discovery tools because they insert their genome into eukaryotic cells' genomes at random, but with some preference for transcriptionally-active loci. They have been used in vivo and clinically for the random integration of DNA for developmental studies and for the introduction of new genes of interest. They have also been used in ex vivo applications for the modification of cells to introduce new genes, particularly for immunotherapy; for the production of T cell receptor (TCR) engineered T cells; and for the production of chimeric antigen receptor (CAR) T cells.
  • TCR T cell receptor
  • CAR chimeric antigen receptor
  • retro/lentivirus vectors used for transgene and RNA expression are typically disabled in a range of ways to remove their ability to replicate and cause disease, including by removing the genes required for virus production from the virus genome itself. This means that in order to generate a batch of infectious virus particles, capable of a single infection round in eukaryotic cells, for experimental or clinical use, it is necessary to provide several virus genes (and thereby virus proteins) that have been genetically removed from the virus genome at the same time into the cells used for virus packaging. These genes are generally provided in three or four separate plasmids, and co-transfected into cells.
  • the central component is a plasmid encoding the virus vector genome (including any transgenes and associated promoters to regulate transcription in target cells) containing packaging signals to direct the assembling virus particles to incorporate the corresponding RNA into the new virus particles.
  • virus ancillary proteins such as Gag- Pol, Tat and Rev genes are generally provided from other plasmids that are co- transfected, and yet another plasmid provides the glycoprotein to be incorporated into the envelope of newly-formed virus particles, that will direct their infectious tropism.
  • the gag-pol expression cassette encodes virus capsid and internal structural proteins as well as the protein bearing reverse transcriptase, protease and integrase activities.
  • the Rev gene acts to enhance nuclear export of retro/I enti virus genomes by binding to a specific region of the virus genome called the Rev Response Element (RRE).
  • RRE Rev Response Element
  • Lentivirus vector development has undergone a number of development phases.
  • the most recent, a so-called '3rd generation' lentiviral vector system consists of four plasmids each encoding the required components for lentivirus assembly (Gag-Pol, a glycoprotein, Rev protein and the virus genome).
  • the '3rd generation' system offers a number of advantages over previous versions (primarily by increasing the number of recombination events required to form replication-competent virus).
  • the '3rd generation' systems also have another significant advantage because they have a modified 5'LTR that includes an exogenous promoter, and hence transcription of the genome is not dependent on transcriptional activation by the Tat protein - thereby removing the need for Tat to be encoded in the system (a requirement in previous iterations). They do not contain the Tat protein on any of the plasmids used.
  • the Rev gene was also placed on an individual plasmid. Therefore, in 3rd generation systems, the four plasmids contain 1 : Gag-Pol, 2: a glycoprotein (most frequently VSV G), 3: Rev, and 4: a plasmid encoding a self-inactivating lentivirus genome containing the transgene or RNA of interest. With specific reference to the glycoprotein plasmid, several envelope glycoproteins are available and have been used, but the most widely used is the glycoprotein from Vesicular Stomatitis Virus, known as VSV G.
  • the expectation by users is that the virus will integrate its genomic DNA into a random site of the infected cells, with the caveat that regions that are more highly transcribed represent more frequent targets for integration. Random integration is not desirable because this can lead to mutagenesis of existing functional genomic loci and also heterogeneous transgene expression. A more sequence-specific method for the integration of a donor DNA is therefore desirable.
  • the invention herein aims to overcome many of these previous limitations.
  • a system has now been developed to allow nucleic acid-guided, sequence-specific genomic modification using proteins, preferably retroviral proteins.
  • a donor DNA e.g. a retroviral DNA
  • the invention allows the previously random integration of a retrovirus to be made sequence- and site-specific.
  • the invention provides a method of integrating a donor DNA into a target DNA sequence, the method comprising the steps:
  • nucleoprotein/integrase complex comprises: (i) a nucleic acid-guided polypeptide
  • nucleoprotein/integrase complex is directed to the target DNA sequence by the guide nucleic acid
  • nucleoprotein/integrase complex produces a double-stranded cut in the target DNA sequence
  • the invention provides a method of integrating a donor DNA into a target DNA sequence, the method comprising the steps:
  • ribonucleoprotein/integrase complex (a) contacting a target DNA sequence with a ribonucleoprotein/integrase complex, wherein the ribonucleoprotein/integrase complex comprises:
  • ribonucleoprotein/integrase complex is directed to the target DNA sequence by the guide RNA
  • ribonucleoprotein/integrase complex produces a double-stranded cut in the target DNA sequence
  • the integrase then inserts the donor DNA into the target DNA sequence.
  • the integrase is a retroviral integrase or retrotransposal integrase. The following terms are used herein:
  • Gene coding sequence or open reading frame (ORF) - Any sequence of DNA nucleotides that encodes an RNA, mRNA, non-coding RNA, short hairpin RNA or protein coding RNA.
  • ORF open reading frame
  • Expression cassette A combination of DNA sequences that enables a gene, mRNA or protein to be produced within a cell.
  • an expression cassette will contain a promoter, a coding sequence (gene) and an RNA polymerase termination sequence.
  • Restriction site or restriction enzyme binding site A region of DNA that is bound by an endonuclease restriction enzyme, typically, but not limited to, 4-8 nucleotides in length where said binding enables the restriction enzyme to cleave the DNA strand.
  • Restriction enzyme - A polypeptide that when folded produces a catalytic enzyme that can recognise and bind to a specific sequence within a DNA molecule and cleave the same DNA molecule at the restriction enzyme binding site
  • Nucleic acids - Polymeric macromolecules made from nucleotide monomers are adenine and guanine, while the pyrimidines are thymine and cytosine.
  • the Thymine bases are replaced by uracil.
  • Untranslated region or UTR The region of an mRNA molecule that does not encode a protein polypeptide that is either upstream (5') or downstream (3') of the start codon of the protein coding sequence.
  • the sequence of the 5' UTR in DNA is between the transcription initiation point and the start codon of a gene whilst the 3' UTR is the region between the stop codon and the RNA polymerase termination sequence.
  • Nucleotide - The structural base unit monomers of a DNA molecule that are composed of a deoxyribose sugar covalently linked at the 5' to a phosphate group and linked by a glycosidic bond to a base that that may be either a purine or a pyrimidine, typically consisting of either adenine or guanine or either thymine or cytosine, respectively.
  • Base pair BP - A pair of nucleotides in separate DNA strands in which the bases of the nucleotides are linked by hydrogen bonding.
  • promoter region or promoter refers to the promoter of the invention that is designed, and positioned within DNA embodying the invention, to drive the transcription of a gene.
  • transcription initiation site of a eukaryotic mRNA that is part of the promoter and recruits transcription factors and transcription initiation factors to the promoter region to initiate transcription.
  • KOZAK sequence The ribosomal binding and engagement point of an mRNA in eukaryotic cells, the consensus DNA sequence of which is ACCATGG wherein the start codon of a gene is denoted as the ATG in the same consensus sequence.
  • SEQ ID The terminology used herein to describe any example DNA sequence that may comprise either a component of the invention, or a complete DNA sequence required to exemplify the invention.
  • Plasmid, Vector, Plasmid Vector, Plasmid DNA expression vector, expression vector, DNA vector, DNA plasmid A circular DNA molecule capable of amplification in a prokaryotic host.
  • LTR The long terminal repeat region of a retrovirus.
  • Tropism The ability of a particular virus particle to infect specific cells defines its tropism. Tropism is typically determined by a virus glycoprotein. Pseudotyping - The incorporation of a non-endogenous surface glycoprotein into a virus particle. Typically, the non-endogenous glycoprotein will provide a new or expanded tropism when compared to the endogenous virus glycoprotein.
  • Constitutive - Constitutive gene or constitutive expression - a gene that is transcribed continually (as compared to a facultative gene which is only transcribed as needed).
  • Integrase - a protein capable of binding a reverse transcribed retrovirus genome (in DNA form) and integrating or inserting the retrovirus genome (in DNA form) into the genome of a eukaryotic genome.
  • Nucleoprotein - A nucleoprotein is a protein that contains nucleic acid, i.e. it is an association that combines nucleic acid and protein together (referred also as protein- nucleic acid complexes).
  • Ribonucleoprotein - A ribonucleoprotein is a protein that contains RNA, i.e. it is an association that combines ribonucleic acid and protein together (referred also as protein-RNA complexes).
  • RNA Ribonucleoprotein
  • a few known examples include the ribosome, the enzyme telomerase, vault ribonucleoproteins, RNase P, hnRNP and small nuclear RNPs
  • snRNPs which are implicated in pre-mRNA splicing (spliceosome) and are among the main components of the nucleolus.
  • Nucleic acid-guided DNA binding ribonucleoprotein - a protein that binds RNA and is capable of using said RNA to bind a region of DNA through complementary base pairing.
  • the protein may or may not cut, or nick, the DNA upon binding, or may solely bind.
  • Examples include Cas9, CPF1 , and nickase and deactivated (e.g. dCas9) variants.
  • Binding region - a region or domain of a protein that facilities the binding of two proteins through affinity between two protein regions, one on each protein.
  • this may involve the addition of a protein domain to a nucleic acid-guided DNA binding nucleoprotein (e.g. dCas9) to endow integrase binding activity, or the modification of both an integrase and a nucleic acid-guided DNA binding nucleoprotein to allow binding between them.
  • a nucleic acid-guided DNA binding nucleoprotein e.g. dCas9
  • the invention relates to a method of integrating a donor DNA into a target DNA.
  • the donor DNA may be any DNA which is desired to be inserted into the target DNA.
  • the donor DNA may be of viral, prokaryotic or eukaryotic origin; or it may be synthetic DNA.
  • the donor DNA may be cDNA or genomic DNA.
  • the donor DNA may or may not include introns.
  • the donor DNA may be linear DNA or circular DNA.
  • the donor DNA is linear DNA.
  • the donor DNA is double-stranded DNA.
  • the donor DNA has been produced by reverse transcription, more preferably it has been delivered to a cell in a retroviral vector.
  • the donor DNA may be one which has been reverse-transcribed from a retroviral RNA, preferably from a retroviral RNA genome.
  • the reverse-transcribed donor DNA will preferably contain one or more (preferably all of) long terminal repeats (LTRs), a packaging signal, a signal for nuclear export (e.g RRE), an exogenous promoter driving the expression of a gene of interest, and a poly- adenylation signal in the 3'-end of the genome.
  • LTRs long terminal repeats
  • RRE signal for nuclear export
  • the genome may also preferably contain a WPRE.
  • Said retroviral genome will preferably be incorporated into the target DNA sequence or genome.
  • the retroviral genome is one which comprises a transgene or heterologous nucleic acid sequence.
  • the transgene or heterologous nucleic acid sequence is one which encodes a polypeptide, preferably a eukaryotic or mammalian polypeptide, more preferably a human polypeptide.
  • This polypeptide may, for example, be a protein, e.g. an antibody (e.g. scFv), an enzyme, a cytokine, a blood-clotting factor, or T-cell or B-cell receptor.
  • this polypeptide is a soluble protein, cytosolic protein, secreted protein or membrane-bound protein.
  • the retroviral genome does not encode intact genes from HIV or other retroviruses.
  • the retroviral genome will not encode a DNA-binding protein.
  • the donor DNA becomes integrated into a target DNA sequence.
  • target DNA and “target DNA sequence” are used herein interchangeably.
  • the target DNA may be any desired DNA, but preferably will be a eukaryotic genome, and even more preferably a human or mouse genome.
  • the target DNA is preferably one which comprises a protospacer adjacent motif (PAM), e.g. the trinucleotide NGG.
  • PAM protospacer adjacent motif
  • An appropriate PAM should be present in the vicinity of the desired site in the target DNA where the donor DNA is to be integrated, i.e. within 1 -50 nucleotides of the desired integration site.
  • Other nucleic acid-guided systems have recently been discovered that do not require a PAM site (Gao et al., "DNA-guided genome editing using the Natronobacteri u m gregoryi Argonaute", Nature Biotech., published on-line 2 May 2016).
  • the target DNA may, for example, be chromosomal DNA, mitochondrial DNA, plastid DNA, plasmid DNA or vector DNA.
  • the target DNA is present in a cell-free system or cell-free extract.
  • the target DNA is present within a cell, for example, within a eukaryotic cell.
  • the method is preferably not carried out in vivo (i.e. it is not carried out within a living animal).
  • the method may be carried out within cells.
  • the cells may be isolated cells, e.g. they are not present in a living animal.
  • the cell in which the method may be carried out is preferably a eukaryotic cell, more preferably a mammalian cell.
  • mammalian cells include those from any organ or tissue from humans, mice, rats, hamsters, monkeys, rabbits, donkeys, horses, sheep, cows and apes.
  • the cell is a human cell.
  • the cell may be a primary or immortalised cell.
  • the target DNA is contacted with a nucleoprotein/integrase complex.
  • the nucleoprotein/integrase complex may be added to the target DNA in a cell-free system; or the nucleoprotein/integrase complex may be expressed in the vicinity of the target DNA (e.g. within the same cell).
  • the nucleoprotein/integrase complex comprises (i) a nucleic acid-guided polypeptide, e.g. a DNA-guided polypeptide or a RNA-guided polypeptide.
  • the nucleic acid-guided polypeptide is a polypeptide which is capable of interacting with the guide nucleic acid and capable of being directed by that guide nucleic acid to the target DNA.
  • the nucleoprotein/integrase complex is a ribonucleoprotein/integrase complex and the nucleic acid-guided polypeptide is a RNA-guided polypeptide which is capable of interacting with a guide RNA and capable of being directed by that guide RNA to the target DNA.
  • the nucleic acid-guided polypeptide may, for example, be a nucleic acid-guided DNA endonuclease.
  • the endonuclease may be one which is capable of producing blunt ends or staggered ends in the target DNA.
  • the nucleic acid-guided polypeptide e.g. a RNA-guided polypeptide
  • the nucleic acid-guided polypeptide is one which does not have endogenous nuclease activity.
  • the nucleic acid-guided polypeptide (e.g. a RNA-guided polypeptide) is preferably a bacterial polypeptide, e.g. from Streptococcus pyogenes.
  • the nucleic acid-guided polypeptide is Cas9 or CPF1 , or a variant or derivative thereof.
  • the Cas9 polypeptide may be, for example, from Streptococcus (e.g. Streptococcus pyogenes or Streptococcus aureus or Streptococcus thermophilus) or Neisseria (e.g. Neisseria meningitidis).
  • the CPF1 polypeptide may be, for example, from Streptococcus (e.g. Streptococcus pyogenes or Streptococcus aureus or Streptococcus thermophilus) or Neisseria (e.g. Neisseria meningitidis).
  • the CPF1 polypeptide may be, for example, from Streptococcus (e.g. Streptococcus pyogenes or Streptococcus aureus or Streptococcus thermophilus) or Neisseria (e.g. Neisseria meningitidis).
  • the CPF1 polypeptide may be, for
  • Cas9 is capable of inducing site-directed double strand breaks in DNA.
  • the Cas9 polypeptide has the amino acid sequence given in SEQ ID NO: 3 21 or 22 or 23, or a variant thereof having at least 50%, more preferably at least 60%, 70%, 80%, 85%, 90% or 95%, amino acid identity thereto having RNA-guiding capability and being capable inducing site-directed double strand breaks in DNA.
  • Variants of Cas9 are known what bind, but do not cleave, a target DNA.
  • the variant of Cas9 is dead Cas9 (i.e. dCas9).
  • This variant has mutations in catalytic residues of the RuvC and HNH domains which abolish all endonuclease activity of Cas9.
  • the dCas9 polypeptide has the amino acid sequence given in SEQ ID NO: 5, or a variant thereof having at least 50%, more preferably at least 60%, 70%, 80%, 90%, or 95%, amino acid identity thereto, having RNA-guiding capability and being capable inducing site-directed single strand nicks in DNA.
  • the Cas9 polypeptide is a Cas9 nickase which has the amino acid sequence given in SEQ ID NO: 4, or a variant thereof having at least 80%, more preferably at least 50%, 60%, 70%, 80%, 90%, or 95%, amino acid identity thereto having RNA-guiding capability and having no endonuclease activity.
  • Cas9 and Crispr methods may be obtained from "CRISPR-Cas: A Laboratory Manual", Edited by Jennifer Doudna, University of California, Berkeley; Prashant Mali, University of California, San Diego.
  • the Cpf1 polypeptide has the amino acid sequence given in SEQ ID NO: 24, or a variant thereof having at least 50%, more preferably at least 60%, 70%, 80%, 90%, or 95%, amino acid identity thereto, having RNA-guiding capability and being capable inducing site-directed single strand nicks in DNA.
  • the DNA-guided polypeptide may, for example, be a Natronobacterium gregoryi Argonaute endonuclease which is capable of using a single-stranded oligonucleotide as a guide DNA (e.g. Gao et al., "DNA-guided genome editing using the Natronobacterium gregoryi Argonaute", Nature Biotech., published online 2 May 2016).
  • a Natronobacterium gregoryi Argonaute endonuclease which is capable of using a single-stranded oligonucleotide as a guide DNA
  • the nucleic acid-guided polypeptide is an Argonaute endonuclease which is capable of interacting with a guide DNA and capable of being directed by that guide DNA to the target DNA.
  • the nucleic acid-guided polypeptide is an Argonaute protein in which the nuclease activity has been removed/is defective and which is capable of interacting with a guide DNA and capable of being directed by that guide DNA to the target DNA.
  • the nucleic acid-guided polypeptide additionally comprises an integrase binding domain, e.g. the integrase binding domain of LEDGF/p75.
  • the nucleic acid-guided polypeptide e.g. a RNA-guided polypeptide
  • integrase binding region may form a fusion polypeptide.
  • the nucleic acid-guided polypeptide and integrase binding region be joined contiguously or linked by one or more amino acids.
  • the integrase binding domain may be taken from the LEDGF/p75 protein sequence (PSIP1 isoform 1 - Uniprot ID 075475.) as described in J. Cell. Sci. (2005) 118: 1733-1743; doi: 10.1242/jcs.02299.
  • the invention also provides a fusion polypeptide comprising a nucleic acid-guided polypeptide as defined herein and an integrase binding domain, e.g. the integrase binding domain of LEDGF/p75; a nucleic acid molecule which codes for such a fusion polypeptide; and a vector or plasmid which comprises such a nucleic acid molecule.
  • the cell in which the method of the invention is carried out comprises an endogenous LEDGF/p75 gene whose expression has been reduced or eliminated.
  • the gene may comprise an insertion, mutation or deletion which prevents or significantly reduces gene expression. This reduces or avoids interference between the endogenous LEDGF/p75 polypeptide and the nucleic acid- guided polypeptide which comprises an integrase binding region of LEDGF/p75.
  • the nucleic acid-guided polypeptide additionally comprises a nuclear localisation signal (NLS) which directs the nucleic acid-guided polypeptide to the cell nucleus.
  • NLS nuclear localisation signal
  • the NLS may be a fusion with the nucleic acid-guided polypeptide, e.g. a 5' -fusion or a 3'-fusion. More than one NLS may be used.
  • the invention also provides a fusion polypeptide comprising a nucleic acid-guided polypeptide as defined herein and a NLS; a nucleic acid molecule which codes for such a fusion polypeptide; and a vector or plasmid which comprises such a nucleic acid molecule.
  • the nucleic acid-guided polypeptide comprises a fusion polypeptide comprising defective/dead Cas9-nuclear localisation sequence (NLS)-integrase binding domain (IBD), or defective/dead Cas9-IBD-NLS.
  • the invention also provides a fusion polypeptide comprising a nucleic acid-guided polypeptide as defined herein, a NLS, and an integrase binding domain; a nucleic acid molecule which codes for such a fusion polypeptide; and a vector or plasmid which comprises such a nucleic acid molecule.
  • this fusion polypeptide has the amino acid sequence given in SEQ ID NO: 6 or 7, or a variant thereof having at least 80%, more preferably at least 85%, 90%, or 95%, amino acid identity thereto having RNA-guiding capability and having no endonuclease activity.
  • the nucleic acid-guided polypeptide comprises a fusion polypeptide comprising a Cas9 polypeptide or variant or derivative thereof, and the Gag polypeptide.
  • the invention also provides a fusion polypeptide comprising a nucleic acid-guided polypeptide as defined herein and a Gag polypeptide; a nucleic acid molecule which codes for such a fusion polypeptide; and a vector or plasmid which comprises such a nucleic acid molecule.
  • the guide nucleic acid may be RNA or DNA.
  • the guide nucleic acid may consist of one or more parts (e.g. one or more, e.g. two, DNA or RNA sequences).
  • the guide nucleic acid will, in general, be single-stranded RNA or single-stranded DNA.
  • the guide RNA comprises a crRNA and a tracrRNA.
  • the crRNA may be a mature crRNA which has been processed from a pre-crRNA.
  • the crRNA will have a portion which is complementary to the sequence of the target DNA.
  • the tracrRNA may be a processed tracrRNA.
  • the crRNA and tracrRNA combine with a RNA-guided polypeptide (e.g. Cas9, CPF1 ) to direct the ribonucleoprotein/integrase complex to the target DNA.
  • the guide RNA is a chimeric RNA or small guide RNA (sgRNA).
  • the guide RNA comprises a portion which is complementary to the target DNA sequence (and which is derived from the crRNA) and a scaffold portion that interacts with the RNA-guided polypeptide (e.g. Cas9 or CPF1 ) (which is derived from the tracrRNA).
  • the RNA-guided polypeptide e.g. Cas9 or CPF1
  • the RNA portion whose sequence is complementary to the target DNA sequence is preferably 19-21 nucleotides, more preferably 20 nucleotides, in length.
  • the target DNA may also contain an adjacent PAM signal.
  • the portion which is complementary to the target DNA is at least 70%, more preferably at least 85% and most preferably 100%, complementary to the target DNA sequence.
  • the nucleoprotein/integrase complex also comprises (iii) an integrase.
  • the integrase may, for example, be a retroviral integrase or a retrotransposal integrase.
  • the integrase is a retroviral integrase.
  • Retroviral integrases are enzymes which are produced by retroviruses (e.g. HIV) that enable genetic material (e.g. donor DNA) to be integrated into a target DNA.
  • retroviruses e.g. HIV
  • genetic material e.g. donor DNA
  • Retroviral integrases comprise three canonical domains, connected by flexible linkers: an N-terminal HH-CC zinc-binding domain (a three-helical bundle stabilised by coordination of a Zn(ll) cation); a catalytic core domain (RNaseH fold); and a C-terminal DNA-binding domain (SH3 fold).
  • the retroviral integrase is preferably a wild-type retroviral integrase, i.e. it is not modified compared to a wild-type sequence.
  • the integrase is not modified, or if modifications are made, this is only to change the specificity of the integrase domain that binds to endogenous human chromatin-associated protein LEDGF/p75 to bind to another protein. Hence, the changes made to the integrase are minimal and unlikely to significantly affect virus yield. Moreover, if a change is made and virus yield is shown to be unaffected, no further changes would be required, regardless of the DNA to be targeted.
  • the integrase is modified to increase its binding affinity for the nucleic acid-guided polypeptide.
  • Retroviral integrases catalyse two reactions on viral genomes:
  • the strand transfer reaction in which the processed 3' ends of the viral DNA are covalently ligated to the target DNA (e.g. host chromosomal DNA).
  • target DNA e.g. host chromosomal DNA
  • the retroviral integrase is preferably one which is selected from the group of integrases from HIV, EIAV, MLV, MMTV, HTLV; more preferably, HIV or EIAV; and even more preferably from HIV.
  • the retroviral integrase is the HIV integrase.
  • the HIV integrase is a 32 kDa protein produced from the C-terminal portion of the HIV Pol gene product.
  • the HIV integrase may be provided in the method of the invention by the Pol gene product.
  • the retroviral integrase has the amino acid sequence given in SEQ ID NO: 1 , or a variant thereof having at least 80%, more preferably at least 85%, 90% or 95%, amino acid identity thereto and being capable of integrating a donor DNA into a target DNA.
  • the integrase of the invention may be derived from a
  • retrotransposon i.e. the integrase is a retrotransposal integrase.
  • Retrotransposons are mobile genetic elements that integrate into host genomic DNA and which then become transcribed to produce an RNA molecule that is reverse transcribed and integrated back into the host genome. This process distinguishes retrotransposons from DNA transposons. In eukaryotes, retrotransposons are divided into those containing an LTR (so-called LTR transposons) and Non-LTR transposons. In mammalian genomes, human endogenous retroviruses (HERVs) are a common type of LTR transposon. Non-LTR transposons are divided into three groups: these include Long Interspersed Nuclear Elements (LINEs); Short Interspersed Nuclear Elements (SINEs); and Alu Elements.
  • LINEs Long Interspersed Nuclear Elements
  • SINEs Short Interspersed Nuclear Elements
  • Alu Elements Alu Elements.
  • non-LTR containing elements do not normally encode an integrase protein and Alu elements do not encode any proteins.
  • LTR-containing transposons do contain integrases and these integrases function similarly to normal retroviral or lentiviral integrases.
  • the integrase in the nucleoprotein/integrase complex could be derived from an LTR transposon.
  • the integrase is preferably associated with the nucleic acid-guided polypeptide in the nucleoprotein/integrase complex.
  • association is intended to mean that the integrase and nucleic acid-guided polypeptide are coupled or joined, covalently or non-covalently, or permanently associated in some other way.
  • the nucleic acid-guided polypeptide is one which is modified to bind an integrase (preferably a retroviral integrase).
  • the integrase (preferably a retroviral integrase) is one which has been modified to bind a nucleic acid-guided polypeptide.
  • the integrase and/or nucleic acid-guided polypeptide are modified to increase the affinity of one for the other.
  • the integrase and nucleic acid-guided polypeptide may each be independently modified by the addition of a moiety to one and a specific binding partner of that moiety to the other.
  • the moiety and specific binding partner may both be peptides or polypeptides which have affinity for one another.
  • the integrase and nucleic acid-guided polypeptide may be linked via a linker.
  • the linker may, for example, be a peptide linker comprising e.g. 1 -10 amino acids, or a non- peptide linker.
  • non-peptide linkers include -(CH 2 ) n - wherein n is 1 -10.
  • the integrase and nucleic acid-guided polypeptide form a fusion polypeptide.
  • a fusion polypeptide comprising an integrase and nucleic acid-guided polypeptide as defined herein; a nucleic acid molecule which codes for such a fusion polypeptide; and a vector or plasmid which comprises such a nucleic acid molecule.
  • the nucleic acid-guided polypeptide is expressed from a plasmid or vector which comprises a nucleic acid sequence which codes for that polypeptide.
  • the plasmid or vector may contain a gene transcribed by RNA polymerase II to produce the nucleic acid-guided polypeptide.
  • This gene may contain a promoter to initiate transcription, a 5'-untranslated region (which may contain introns), a coding sequence encoding the nucleic acid-guided polypeptide, and a poly-adenylation signal. These sequences are necessary and sufficient to produce said polypeptide.
  • the nucleic acid-guided polypeptide may be expressed from a nucleic acid sequence (e.g. an expression cassette) which codes for that polypeptide and which is present within the genome of the cell in which the method of the invention takes place.
  • the nucleic acid-guided polypeptide e.g. Cas9 or dCas9 may be expressed
  • the nucleoprotein e.g. Cas9 or dCas9
  • the nucleoprotein may be produced in vitro, such that the nucleoprotein is complexed with the gRNA and transfected (i.e. as a protein/RNA complex) into the target cell population.
  • the nucleoprotein may also be co-transfected with the gRNA without any prior co-incubation.
  • the fusion polypeptide may be expressed from a plasmid or vector which comprises a nucleic acid sequence which codes for that fusion polypeptide.
  • the fusion polypeptide may be expressed from a nucleic acid sequence (e.g. an expression cassette) which codes for that fusion polypeptide and which is present within the genome of the cell in which the method of the invention takes place.
  • a nucleic acid sequence e.g. an expression cassette
  • the guide nucleic acid may be produced by a plasmid or vector which comprises a nucleic acid sequence which codes for that guide nucleic acid.
  • the plasmid or vector may contain an RNA expression cassette containing a promoter that may be bound by either RNA polymerase I or III, more preferably RNA polymerase III, and more preferably the promoter will be either a U6 or H1 promoter.
  • the expression cassette will encode the guide RNA.
  • the RNA expression cassette may also contain a terminator, typically consisting of a contiguous string of 5 or more thymidine residues.
  • a guide RNA may be expressed from a nucleic acid sequence (e.g. an expression cassette) which codes for that RNA and which is present within the genome of the cell in which the method of the invention takes place.
  • the gRNA can be produced by in vitro transcription methods and delivered to the cell either as RNA alone or complexed with the nucleoprotein.
  • nucleic acid sequences which code for the nucleic acid-guided polypeptide, integrase, fusion polypeptide and/or guide nucleic acid may independently comprise a promoter which is operably associated with the coding sequences for the nucleic acid- guided polypeptide, integrase, fusion polypeptide and/or guide nucleic acid, respectively.
  • the same or different promoters may be used.
  • the promoter may be a constitutive (non-inducible) promoter.
  • Suitable promoters include the CMV, SV40, PGK (human or mouse), HSV TK, SFFV, Ubiquitin, Elongation Factor Alpha, CHEF-1 , FerH, Grp78, RSV, Adenovirus E1A, CAG or CMV-Beta-Globin promoter, or a promoter derived therefrom.
  • the promoter is the Cytomegalovirus immediate early (CMV) promoter, or a promoter which is derived therefrom, or a promoter of equal or increased strength compared to the CMV promoter.
  • CMV Cytomegalovirus immediate early
  • the nucleoprotein/integrase complex comprises a signal for nuclear targeting and transport.
  • This signal can be positioned at any location within the nucleoprotein provided that the signal is exposed to the machinery for nuclear import and does not alter or reduce nucleoprotein activity.
  • the nuclear target signal is placed at the N- or C-terminus of a modified Cas9 protein.
  • the C-terminus is normally used due to the proximity of the Cas9 functional domain to the N-terminus, but the insertion may also be made between functional domains (e.g. between Cas9 and an integrase binding domain).
  • the nucleoprotein/integrase complex is present in a retroviral particle.
  • the retrovirus is a lentivirus.
  • the lentivirus is produced by standard methods, e.g. the 3 rd generation vector system, and the nucleic-acid guided polypeptide and gRNA are encoded by DNA delivered by a second virus.
  • the virus would be one with a similar tropism and infectivity to the accompanying lentivirus, but that would not integrate its genome into the target infected cells.
  • the donor DNA is provided, i.e. made available to the integrase, such that the integrase is capable of inserting the donor DNA into the target DNA sequence.
  • the term "providing” includes making the donor DNA available in the cell (e.g. transfecting the cell with the donor DNA).
  • the nucleoprotein/integrase complex is directed to the target DNA by the guide nucleic acid.
  • the portion of the guide nucleic acid which is complementary to the target DNA sequence will direct the nucleoprotein/integrase complex to the target DNA sequence.
  • the complex produces a double-stranded cut in the target DNA.
  • the cut will be produced by the integrase that will insert the donor DNA. In other embodiments, the cut or a single stranded nick will be produced by the nucleic acid guided polypeptide.
  • the integrase then inserts the donor DNA into the target DNA.
  • the ends of the donor DNA e.g. retroviral genome
  • the ends of the donor DNA are covalently ligated by the integrase to the ends of the (cut) target DNA.
  • the method is preferably carried out under conditions such that the
  • nucleoprotein/integrase complex is directed to the target DNA sequence by the guide nucleic acid, the nucleoprotein/integrase complex produces a double-stranded cut in the target DNA sequence, and the integrase then inserts the donor DNA into the target DNA sequence.
  • the method of the invention may be used for a number of different purposes.
  • the method may be used to disrupt a gene-coding sequence or to disrupt a promoter region.
  • the method may be used to insert DNA into a safe harbour locus, preferably AAVS1 , ROSA26 or GS, more preferably AAVS1.
  • the uses may be in vitro, ex vivo or in vivo.
  • the invention further provides a kit comprising:
  • an integrase preferably a retroviral integrase
  • the nucleic acid-guided polypeptide additionally comprises an integrase-binding domain to which the integrase (2) has affinity.
  • nucleic acid-guided polypeptide and integrase are linked by a linker or form a fusion polypeptide.
  • Percentage amino acid sequence identities and nucleotide sequence identities may be obtained using the BLAST methods of alignment (Altschul et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402; and www.ncbi.nlm.nih.gov/BLAST). Preferably the standard or default alignment parameters are used. Standard protein-protein BLAST (blastp) may be used for finding similar sequences in protein databases. Like other BLAST programs, blastp is designed to find local regions of similarity. When sequence similarity spans the whole sequence, blastp will also report a global alignment, which is the preferred result for protein identification purposes.
  • the standard or default alignment parameters are used.
  • the "low complexity filter” may be taken off.
  • Gapped BLAST in BLAST 2.0
  • PSI-BLAST in BLAST 2.0
  • the default parameters of the respective programs may be used.
  • MEGABLAST discontiguous-megablast, and blastn may be used to accomplish this goal.
  • the standard or default alignment parameters are used.
  • MEGABLAST is specifically designed to efficiently find long alignments between very similar sequences. Discontiguous MEGABLAST may be used to find nucleotide sequences which are similar, but not identical, to the nucleic acids of the invention.
  • blastn is more sensitive than MEGABLAST.
  • the word size is adjustable in blastn and can be reduced from the default value to a minimum of 7 to increase search sensitivity.
  • discontiguous megablast uses an algorithm which is similar to that reported by Ma et al. (Bioinformatics. 2002 Mar; 18(3): 440-5). Rather than requiring exact word matches as seeds for alignment extension, discontiguous megablast uses non-contiguous word within a longer window of template. In coding mode, the third base wobbling is taken into consideration by focusing on finding matches at the first and second codon positions while ignoring the mismatches in the third position. Searching in discontiguous
  • MEGABLAST using the same word size is more sensitive and efficient than standard blastn using the same word size.
  • Parameters unique for discontiguous megablast are: word size: 1 1 or 12; template: 16, 18, or 21 ; template type: coding (0), non-coding (1 ), or both (2).
  • Figure 1 Flow cytometry data indicating percentage of cells in population expressing GFP above background level. (A) and (B) indicate replicate samples.
  • Example 1 Use of dCas9-IBD fusion proteins to target retroviral genome
  • a HEK293 stable cell line whereby GFP was randomly integrated into the host cell genome was constructed by methods known in the art. Selection was provided by a puromycin resistance marker also present on the vector containing the GFP gene.
  • Day 0 Cells for HEK293 GFP stable cell line were seeded into 6-well plate at a predefined density, ready for transfection the following day. Cells were incubated overnight at 37°C, 8% C02 in a humidified incubator.
  • Day 1 Cells were transfected using lipofectamine reagent with either only 1 vector (dCas9, dCas9-NLS-IBD, or dCas9-IBD-NLS) or 2 vectors, whereby the gRNA targeting the GFP gene was also transfected.
  • Day 3 48hrs after transfection, a third-generation lentiviral vector preparation was added to the cells (all samples) whereby the genome encodes the dsRed gene.
  • Day 4 Cells are analysed for both green (GFP) and red (dsRed) fluorescence by flow cytometry.
  • Example 2 In vitro modification of AAV1S locus in HEK293 cell line
  • All DNA constructs are synthesised by de novo synthesis where required. This process involves thermodynamically-balanced inside out oligo assembly to allow full length constructs to be produced from smaller oligo-nucleotides (typically 4-50nt in length).
  • oligo-nucleotides typically 4-50nt in length.
  • a combination of type II restriction endonuclease cloning and assembly PCR are used for the joining of DNA molecules. The accuracy of each DNA construct is verified by restriction digestion and agarose electrophoresis and/or DNA sequencing using the Sanger method. All protocols are known to those in the art (e.g. "Molecular Cloning: A Laboratory Manual” (Fourth Edition), Michael R. Green, Joseph Sambrook, Cold Spring Harbor Laboratory Press).
  • Modified Cas9 expression vectors based on Cas9 from the bacterium Streptococcus pyogenes, have been designed to encode C-terminal fusion proteins comprising defective/dead Cas9-nuclear localisation sequence (NLS)-integrase binding domain (IBD), or Cas9-IBD-NLS.
  • the amino acid sequences of dCas9, dCas9-NLS-IBD and dCas9-IBD-NLS are shown in SEQ ID NOs: 5-7, respectively.
  • the IBD region was taken from the LEDGF/p75 protein sequence (PSIP1 isoform 1 - Uniprot ID 075475.) as described in J. Cell. Sci. (2005) 1 18: 1733-1743; doi:
  • DNA sequence for the full CMV-dCas9 expression vector is shown in SEQ ID NO: 8.
  • DNA sequences for the dCas9, dCas9-NLS-IBD and dCas9-IBD-NLS only regions are shown in SEQ ID NOS: 9-1 1 , respectively.
  • AAV1 S target sequences were taken from an early publication on CRISPR,
  • AAV1 S gRNA 1 - Genomic target - GTCCCCTCCACCCCACAGTGGGG SEQ ID NO: 12
  • AAV1 S gRNA 2 - Genomic target - GGGGCCACTAGGGACAGGATTGG SEQ ID NO: 13
  • gRNA expression vectors were generated to target the above sequences.
  • the DNA sequence for the full gRNA expression vector is show in SEQ ID NO: 14.
  • the DNA sequences for the expression cassettes for AAV1 S gRNA 1 and 2 are shown in SEQ ID NOS: 15-16, respectively.
  • HEK 293 cells are seeded at equal numbers in DMEM media (10% FCS) into three 6- well plates 24 hours prior to transfection so as to be at 80% confluence at the time of transfection 24 hours later.
  • DNA/PEI complexes are made up as follows: For lentivirus production, the following amounts of DNA/well are added to 395 ⁇ of Opti- MEM per well in a master solution:
  • pol gene may be modified from the wild type to enable binding to an RNA-guided DNA binding ribonucleoprotein (SEQ ID NO: 19)
  • VSV G plasmid SEQ ID NO: 20
  • Both the PEI and DNA solutions are filtered through a 0.2 micrometer sterile filter, and then the PEI solution is added dropwise to the DNA solution.
  • HEK 293 cells Additional cells of HEK 293 cells are also seeded to act as negative controls and others seeded to generate a GFP positive transfection control.
  • a transfection complex identical to that described above but using 7.4 ⁇ g of a CMV-GFP plasmid vector only is utilised.
  • transfection complexes are incubated for 20 minutes at room temperature in which time the seeded cells are washed with Opti-MEM medium. 835 ⁇ of each transfection complex is then added dropwise to the respective wells. Cells are left to incubate at 37°C, 5% CO 2 overnight and in the morning (approximately 16-18 hours after transfection), the media is changed for DMEM (10% FCS). Supernatant from each well is then harvested at 48 hrs post transfection and replaced with fresh media and harvested again at 72 hours after transfection. Supernatants are stored at -20°C.
  • Components of the lentiviral particles include the envelope protein (VSV-G), structural protein components (matrix and capsid), and non-structural protein components
  • RNA genome reverse transcriptase, protease and integrase
  • DMEM 50% FCS
  • DMEM 50% FCS
  • Two dilutions of harvested supernatant from each time point are used to infect the cells in triplicate wells. Dilutions as standard are 2/5 and 4/25 into DMEM (10% FCS). Cells are infected by removing the overnight media, and adding 500 ⁇ of diluted supernatant. In the instance where the virus integrase has been modified to no longer bind LEDGF/p75, this assay would need to be conducted in cells expressing the new binding partner (RNA-guided DNA binding ribonucleoprotein).
  • Cells are then incubated at 37°C, 5% C0 2 for 72 hours. After 72 hours post infection the cells are tested for GFP expression by flow cytometry (BD Accuri using an Argon 488 Laser), and gated for positivity against unstained HEK 293 cells. The level of GFP positive cells is then used to calculate virus titre.
  • dCas9 and dCas9-fusion vectors are co-transfected with individual gRNA vectors targeting the AAV1 S locus into HEK293 cells. This is carried out using standard PEI based transfection methods, as described above. Four days following transfection, cells are infected with lentivirus. On day six following transfection (day two following viral infection), cell samples are taken for analysis of GFP fluorescence by flow cytometry and for extraction of genomic DNA.
  • genomic DNA is prepared from the HEK293 cells.
  • Genomic DNA is prepared as described in preferred protocols, as for example, accompanying the DNeasy blood and cells kit (Qiagen).
  • Genomic DNA is used as a template in PCR reactions to identify whether or not the GFP expression cassette encoded in the Lentivirus has been delivered site-specifically to the AAV1 S locus. It is anticipated that integrase-directed insertion events will occur in the proximity of the region targeted by the Cas9/gRNA complex, in both positive and negative orientation.
  • PCRs are carried out using forward primers spaced every 1 kb upstream from the gRNA recognition site, up to a total distance of 10kb, with the corresponding reverse primer located on the reverse strand at the 5'-end of the GFP cassette.
  • the 3' vector-genome junction is identified by using a forward primer located at the 3'-end of the GFP cassette and reverse primers spaced every 1 kb downstream from the gRNA recognition sites, also up to 10kb, on the reverse strand.
  • Equivalent primers are utilised to take into account the fact that the insertion event may occur in both orientations.
  • the whole cassette is amplified from the genomic DNA. This is sequenced by standard Sanger methods to identify the nature of the insertion event and to confirm the fidelity of the incorporation.
  • PCR primers designed to only amplify regions of the inserted GFP cassette if two or more copies have been inserted in tandem. This is a common result of random integration at double strand breaks present in the genome.
  • qPCR is applied to look at copy number of the inserted GFP cassette relative to known single copy genes present in mammalian genomes (pre-defined examples such as RNaseP can be used, or cell line specific examples can be identified using NGS techniques). Preferred outcomes would be single insertion events within the AAV1 S locus.
  • Example 3 Ex vivo modification of T-cells for Chimeric Antigen Receptor (CAR) expression at AAV1S locus using lentiviral delivery and electroporation
  • lentivirus titre is assessed by techniques known in the art, such as quantitative PCR, with probe sets targeting regions of the viral genome.
  • T cells Isolation of T cells is carried out from peripheral blood using established methods, and cells are transfected with dCas9 and gRNA expression vectors by electroporation.
  • T cells are pre-activated prior to lentiviral infection.
  • genomic DNA is prepared from the T-cell population. Genomic DNA is prepared as described in preferred protocols, as for example, accompanying the DNeasy blood and cells kit (Qiagen).
  • Genomic DNA is used as a template in PCR reactions to identify whether or not the transgene encoded in the Lentivirus has been delivered site-specifically to the AAV1 S locus. It is anticipated that integrase-directed insertion events will occur in the proximity of the region targeted by the Cas9/gRNA complex, in both positive and negative orientation.
  • PCRs are carried out using forward primers spaced every 1 kb upstream from the gRNA recognition site, up to a total distance of 10kb, with the corresponding reverse primer located on the reverse strand at the 5'-end of the transgene cassette.
  • the 3' vector-genome junction is identified by using a forward primer located at the 3'-end of the transgene cassette and reverse primers spaced every 1 kb downstream from the gRNA recognition sites, also up to 10kb, on the reverse strand.
  • Equivalent primers are utilised to take into account the fact that the insertion event may occur in both orientations.
  • the whole cassette is amplified from the genomic DNA. This is sequenced by standard Sanger methods to identify the nature of the insertion event and to confirm the fidelity of the incorporation.
  • PCR analysis is carried out using PCR primers designed to only amplify regions of the inserted transgene cassette if two or more copies have been inserted in tandem. This is a common result of random integration at double strand breaks present in the genome.
  • qPCR is applied to look at copy number of the inserted transgene cassette relative to known single copy genes present in mammalian genomes (pre-defined examples such as RNaseP can be used, or cell line specific examples can be identified using NGS techniques). Preferred outcomes would be single insertion events within the AAV1 S locus.
  • Modified T-cells expressing the CAR are characterised by using cell-based assays to detect binding of the CAR to its labelled target.
  • Example 4 Ex vivo and/or in vivo modification of AAV1S locus using lentiviral and rAAV delivery
  • ex vivo applications may use similar methods for the delivery of lentiviral and CRISPR/Cas9 components to in vitro applications (i.e. infection and transfection respectively), as described in Example 3, the efficiency of transfection methods for large scale DNA delivery can be limited.
  • An alternative is the use of two different viruses to deliver the transgene (i.e. lentivirus containing the genome to be integrated, as well as the integrase) and CRISPR/Cas9 components (e.g. recombinant adeno-associated virus containing genome encoding dCas9 variant proteins, along with gRNA).
  • co-infection with lentivirus and rAAV will be described below.
  • Further alternatives include fusing the preferred dCas9-IBD fusion protein to a lentiviral protein such as gag, so that all components required for the integrase targeting event are present within the lentiviral particle.
  • Constructs and methods described in Example 2 may also be applicable to the generation of rAAV particles whereby the genome encodes the Cas9 (i.e. dCas9-NLS- IBD or dCas9-IBD-NLS) and sgRNA.
  • the advantage of using rAAV for the expression of Cas9 and sgRNA is that rAAV does not integrate into the genome of the host cell in the same way as the lentivirus genome, yet is still an efficient gene delivery method ex vivo and in vivo. In dividing cells, the rAAV genome would be lost during successive rounds of cell division. This allows stable integration of the transgene from the lentiviral genome and effectively transient delivery of the Cas9 and gRNA components via the rAAV genome.
  • rAAV rAAV
  • rAAV limited 'packaging capacity' for the transgene.
  • One way to avoid this issue is to use smaller Cas9 variants, and associated gRNAs, which fit within this capacity. Examples include Cas9 from Staphylococcus aureus, which has been shown to fit, along with the gRNA expression cassette with the 4.7kb limit (Ran ef al. (2015). "In vivo genome editing using Staphylococcus aureus Cas9", Nature, 520(7546), 186-190. http://doi.orq/10.1038/nature14299).
  • the dCas9 variant from S. aureus would be modified in the same way as described in Example 2 for dCas9 from S. pyogenes, i.e. by inclusion of an integrase binding domain at the C-terminus. rAAV production
  • rAAV particle production can be carried out using established vectors systems and methods, such as those offered by commercial companies such as Clontech and AMSbio.
  • rAAV and lentivirus titre can be assessed by techniques known in the art, such as quantitative PCR, with probe sets targeting regions of the viral genome.
  • Lentiviral and rAAV particles are co-delivered to targeted cells, either ex vivo or in vivo.
  • Potential target cells for ex-vivo modification include T-cells, mesenchymal stem cells (mSC) and hematopoietic stem cells (hSC), amongst others.
  • Genomic DNA is prepared from the cells or tissue in question. Genomic DNA is prepared as described in preferred protocols, as for example, accompanying the DNeasy blood and cells kit (Qiagen).
  • Genomic DNA is used as a template in PCR reactions to identify whether or not the transgene encoded in the Lentivirus has been delivered site-specifically to the AAV1 S locus. It is anticipated that integrase-directed insertion events will occur in the proximity of the region targeted by the Cas9/gRNA complex, in both positive and negative orientation.
  • PCRs are carried out using forward primers spaced every 1 kb upstream from the gRNA
  • the 3' vector-genome junction is identified by using a forward primer located at the 3'-end of the transgene cassette and reverse primers spaced every 1 kb downstream from the gRNA recognition sites, also up to 10kb, on the reverse strand.
  • Equivalent primers are utilised to take into account the fact that the insertion event may occur in both
  • the whole cassette is amplified from the genomic DNA. This is sequenced by standard Sanger methods to identify the nature of the insertion event and to confirm the fidelity of the incorporation.
  • PCR analysis is carried out using PCR primers designed to only amplify regions of the inserted transgene cassette if two or more copies have been inserted in tandem. This is a common result of random integration at double strand breaks present in the genome.
  • qPCR is applied to look at copy number of the inserted transgene cassette relative to known single copy genes present in mammalian genomes (pre-defined examples such as RNaseP can be used, or cell line specific examples can be identified using NGS techniques). Preferred outcomes would be single insertion events within the AAV1 S locus.
  • IBP dCas9-NLS-integrase binding domain
  • Cpfl is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.
  • Cell 163.3 (2015 ⁇ : 759-771. )

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un procédé d'intégration d'un ADN donneur dans une séquence d'ADN cible. Le procédé consiste à utiliser un complexe nucléoprotéine/intégrase comprenant: i) un polypeptide guidé par un acide nucléique; ii) un acide nucléique guide interagissant avec i) et possédant une partie d'acide nucléique complémentaire de la séquence d'ADN cible; et iii) une intégrase, de préférence une intégrase rétrovirale.
PCT/GB2017/051653 2016-06-08 2017-06-07 Procédé d'intégration d'un adn donneur dans un adn cible WO2017212264A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1610041.4 2016-06-08
GBGB1610041.4A GB201610041D0 (en) 2016-06-08 2016-06-08 Methods

Publications (1)

Publication Number Publication Date
WO2017212264A1 true WO2017212264A1 (fr) 2017-12-14

Family

ID=56508285

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2017/051653 WO2017212264A1 (fr) 2016-06-08 2017-06-07 Procédé d'intégration d'un adn donneur dans un adn cible

Country Status (2)

Country Link
GB (2) GB201610041D0 (fr)
WO (1) WO2017212264A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019165168A1 (fr) * 2018-02-23 2019-08-29 Pioneer Hi-Bred International, Inc. Nouveaux orthologues de cas9
US10934536B2 (en) 2018-12-14 2021-03-02 Pioneer Hi-Bred International, Inc. CRISPR-CAS systems for genome editing
US11236313B2 (en) 2016-04-13 2022-02-01 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
US11597924B2 (en) 2016-03-25 2023-03-07 Editas Medicine, Inc. Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
US11667911B2 (en) 2015-09-24 2023-06-06 Editas Medicine, Inc. Use of exonucleases to improve CRISPR/CAS-mediated genome editing
US11680268B2 (en) 2014-11-07 2023-06-20 Editas Medicine, Inc. Methods for improving CRISPR/Cas-mediated genome-editing
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150071898A1 (en) * 2013-09-06 2015-03-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20180080051A1 (en) * 2015-03-31 2018-03-22 Exeligen Scientific, Inc. Cas 9 retroviral integrase and cas 9 recombinase systems for targeted incorporation of a dna sequence into a genome of a cell or organism

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150071898A1 (en) * 2013-09-06 2015-03-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
BERND ZETSCHE ET AL: "Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System", CELL, vol. 163, no. 3, 1 October 2015 (2015-10-01), US, pages 759 - 771, XP055267511, ISSN: 0092-8674, DOI: 10.1016/j.cell.2015.09.038 *
D. C. SWARTS ET AL: "Argonaute of the archaeon Pyrococcus furiosus is a DNA-guided nuclease that targets cognate DNA", NUCLEIC ACIDS RESEARCH, vol. 43, no. 10, 29 April 2015 (2015-04-29), pages 5120 - 5129, XP055287460, ISSN: 0305-1048, DOI: 10.1093/nar/gkv415 *
DAAN C SWARTS ET AL: "The evolutionary journey of Argonaute proteins", NAT. STRUCT. MOL. BIOL., vol. 21, no. 9, 5 September 2014 (2014-09-05), pages 743 - 753, XP055287457, ISSN: 1545-9993, DOI: 10.1038/nsmb.2879 *
DAAN C. SWARTS ET AL: "DNA-guided DNA interference by a prokaryotic Argonaute", NATURE, vol. 507, no. 7491, 16 February 2014 (2014-02-16), pages 258 - 261, XP055156328, ISSN: 0028-0836, DOI: 10.1038/nature12971 *
DAVID CYRANOSKI: "Replications, ridicule and a recluse: the controversy over NgAgo gene-editing intensifies", NATURE, vol. 536, no. 7615, 1 January 2016 (2016-01-01), pages 136 - 137, XP055404381, ISSN: 0028-0836, DOI: 10.1038/536136a *
PARISA JAVIDI-PARSIJANI ET AL: "No evidence of genome editing activity from Natronobacterium gregoryi Argonaute (NgAgo) in human cells", PLOS ONE, vol. 12, no. 5, 11 May 2017 (2017-05-11), pages e0177444, XP055391567, DOI: 10.1371/journal.pone.0177444 *

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11680268B2 (en) 2014-11-07 2023-06-20 Editas Medicine, Inc. Methods for improving CRISPR/Cas-mediated genome-editing
US11667911B2 (en) 2015-09-24 2023-06-06 Editas Medicine, Inc. Use of exonucleases to improve CRISPR/CAS-mediated genome editing
US11597924B2 (en) 2016-03-25 2023-03-07 Editas Medicine, Inc. Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
US11236313B2 (en) 2016-04-13 2022-02-01 Editas Medicine, Inc. Cas9 fusion molecules, gene editing systems, and methods of use thereof
US11866726B2 (en) 2017-07-14 2024-01-09 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
WO2019165168A1 (fr) * 2018-02-23 2019-08-29 Pioneer Hi-Bred International, Inc. Nouveaux orthologues de cas9
CN112020554A (zh) * 2018-02-23 2020-12-01 先锋国际良种公司 新颖cas9直系同源物
US10934536B2 (en) 2018-12-14 2021-03-02 Pioneer Hi-Bred International, Inc. CRISPR-CAS systems for genome editing
US11807878B2 (en) 2018-12-14 2023-11-07 Pioneer Hi-Bred International, Inc. CRISPR-Cas systems for genome editing

Also Published As

Publication number Publication date
GB201709075D0 (en) 2017-07-19
GB201610041D0 (en) 2016-07-20
GB2556648A (en) 2018-06-06

Similar Documents

Publication Publication Date Title
WO2017212264A1 (fr) Procédé d'intégration d'un adn donneur dans un adn cible
EP3844272A1 (fr) Procédés et compositions pour moduler un génome
US20210047375A1 (en) Lentiviral-based vectors and related systems and methods for eukaryotic gene editing
US11976277B2 (en) Particle delivery systems
WO2019046540A1 (fr) Procédés et compositions comprenant crispr-cpf1 et des arn crispr de guidage appariés destinés à des délétions génomiques programmables
WO2023023515A1 (fr) Cellules immunitaires modifiées allogéniques persistantes et leurs procédés d'utilisation
CN114026240A (zh) 靶向基因编辑构建体及其使用方法
US20210340508A1 (en) Genome Editing by Directed Non-Homologous DNA Insertion Using a Retroviral Integrase-Cas9 Fusion Protein
WO2023081756A1 (fr) Édition précise du génome à l'aide de rétrons
US20240173432A1 (en) Compositions and Methods for Treatment of Myotonic Dystrophy Type 1 with CRISPR/SluCas9
AU2017225350A1 (en) Promoter
WO2022229851A1 (fr) Compositions et procédés d'utilisation de séquences d'échafaudage slucas9
JP2024509139A (ja) メタゲノム由来の新規のｃｒｉｓｐｒ－ｃａｓヌクレアーゼ
KR20220018410A (ko) 세포질에서 자가전사가 가능하고 유전체 편집을 제공하는 rna/dna 시스템
US20230405116A1 (en) Vectors, systems and methods for eukaryotic gene editing
US20240181084A1 (en) Genome Editing by Directed Non-Homologous DNA Insertion Using a Retroviral Integrase-Cas Fusion Protein and Methods of Treatment
US20240181081A1 (en) Compositions and Methods for Treatment of Myotonic Dystrophy Type 1 with CRISPR/SACAS9
Fan et al. Impact of the size of CRISPR-Cas gene cassettes on the packaging efficiency and transduction titer of lentiviral vectors
WO2023240027A1 (fr) Systèmes d'administration de particules
WO2024089629A1 (fr) Protéine cas12, système crispr-cas et leurs utilisations
WO2023172926A1 (fr) Excisions précises de parties d'exons pour le traitement de la dystrophie musculaire de duchenne
CN116218880A (zh) 一种提高病毒滴度的重组载体及其制备方法和应用
US20080274550A1 (en) Use Of Replicators To Prevent Gene Silencing

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17730544

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 17730544

Country of ref document: EP

Kind code of ref document: A1