WO2017207690A1 - Prognostic relevance of mir-422a in head and neck squamous cell carcinoma - Google Patents
Prognostic relevance of mir-422a in head and neck squamous cell carcinoma Download PDFInfo
- Publication number
- WO2017207690A1 WO2017207690A1 PCT/EP2017/063303 EP2017063303W WO2017207690A1 WO 2017207690 A1 WO2017207690 A1 WO 2017207690A1 EP 2017063303 W EP2017063303 W EP 2017063303W WO 2017207690 A1 WO2017207690 A1 WO 2017207690A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mir
- expression level
- hnscc
- seq
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Definitions
- the present invention concerns reduced expression levels of the microRNA-422a (miR-422a) present in head and neck squamous cell carcinoma (HNSCC) that are associated with an increased risk of relapse, in particular early loco-regional relapse.
- HNSCC head and neck squamous cell carcinoma
- the detection of the reduced expression levels of miR-422a, in particular in combination with miR21 allows identifying subjects having a reduced chance of relapse-free survival and, for example, selecting them for a more adapted therapy, such as, for example an anti- CD73 therapy.
- the present invention thus refers to a method of selecting a subject who suffers from head and neck squamous cell carcinoma (HNSCC), a method of determining the chance of relapse-free survival and a method for predicting a clinical outcome in response to a treatment of head and neck squamous cell carcinoma (HNSCC) in a subject suffering from head and neck squamous cell carcinoma (HNSCC).
- HNSCC head and neck squamous cell carcinoma
- the present invention further refers to a kit to implement said methods, a pharmaceutical composition comprising a miR-422a mimic reagent and the invention further refers to uses of nucleic acids specifically hybridizing to a CD73 nucleic acid sequence, to a miR-422a nucleic acid sequence and/or to a miR-422a nucleic acid sequence for the methods of the invention.
- HNSCC Head and neck squamous cell carcinoma
- the initially strategy was to prescribe intensified therapy to patients with a poor- predicted outcome. Meanwhile, dose de-escalation could be envisaged for patients with a good-predicted outcome to reduce the frequency of debilitating side effects (difficulties in swallowing, breathing, eating%), induced by the standard treatment.
- HPV Human Papilloma Virus
- the Human Papilloma Virus (HPV) infection - known to be predictive of good outcome - is more and more considered as a marker for dose de-escalation, with encouraging results considering reduced toxicity (NCT01530997).
- treatment intensification based on HPV stratification may not be an adequate treatment strategy, since intensity-modulated radiation therapy (IMRT) improves the survival irrespective of the HPV status, and biomarker for dose intensification are awaited.
- IMRT intensity-modulated radiation therapy
- biomarkers have highlighted the importance of biomarkers for hypoxia and positron emission tomography (PET) imaging, for prognosing, but they have so far not been routinely implemented in clinical applications.
- PET positron emission tomography
- HNSCC are heterogeneous tumors with different locations (oral cavity, oropharynx, nasopharynx, larynx and hypopharynx) and different biological histories and risk factors (viral infection, alcohol/tobacco intoxication).
- a tumoral heterogeneity of these cancers is challenging.
- genomic and transcriptomic (meta) analyses have characterized four molecular subclasses of HNSCC: Basal, Classical, Mesenchymal and Atypical. This signature has paved the way for the development of personalized treatments, but cannot, as such, be translated into clinical routine tests.
- Aim of the present invention is therefore to provide a prognosis and predictive marker in HNSCC which allows, on the one hand, prescribing intensified treatments based on standard chemo-radiotherapy approaches, and, on the other hand, is further associated with a novel therapeutic target that allows an improved treatment of HNSCC, in particular, an improved treatment in subjects suffering from HNSCC that have a negative prediction for the clinical outcome of HNSCC when being submitted to the standard HNSCC treatment.
- MicroRNA is a good candidate for such a strategy, since it can be easily analyzed in biological fluids and can be directly targeted by innovative therapies. Indeed, 6 clinical trials evaluating an anti-miR-122 strategy are on-going in the context of hepatic diseases, and among them one has already entered phase II testing (Santis Pharma Corp.). Furthermore, the identification of microRNA targets provide the opportunity to develop more conventional pharmacological approaches. Regarding the companion tests, these small RNA molecules are efficiently retrieved from (fixed or frozen) tumor samples or from biological fluids, such as blood, urine or saliva, and display high levels of stability over time and tissue specificity. Four miR-based panels dedicated to the diagnosis of lung and kidney cancers are already commercialized for clinical use (Rosetta Genomics).
- microRNA signatures with a prognostic or a diagnostic significance have recently been identified, but need to be confirmed by conducting independent studies.
- the heterogeneity in tumor location is a limiting factor in conducting such molecular studies to identify miRNAs as biomarkers in the case of HNSCC.
- the inventors of the present invention used a two- step approach wherein they identified the biomarker miR-422a and its target CD73 for HNSCC treatment strategies.
- the inventors initially identified the biomarker miR-422a and its target CD73 in a small yet highly homogenous cohort of patients in a step i), who were selected according to the location of the HNSCC, followed by (ii) confirming the biomarker miR-422a and its target CD73 in a larger HNSCC cohort encompassing different tumor locations.
- the inventors of the present invention targeted the oropharynx in step i) which is associated with a poor clinical outcome. While the frequency of hypopharynx and larynx tumors is decreasing, due to public policies against alcohol/tobacco consumption, the incidence of oropharynx tumors has gradually risen in the past two decades. Most of the oropharynx tumors in advanced stage are radio(chemo)resistant and recur within the first two years post-treatment, giving rise to secondary cancers, metastases or loco- regional recurrences.
- the inventors identified surprisingly the downregulation of miR-422a in NR tumors, thus identifying miR-422a as a biomarker for negative outcome in HNSCC tumours.
- the inventors further demonstrated that miR-422a inhibition in vitro increases cell proliferation and adhesion, which thus, firstly, explains the mechanism behind the methods of the invention, according to which downregulation of miR-422a indicates a higher risk of recurrence, in particular early loco-regional recurrence, for subjects suffering from HNSCC.
- miR-422a inhibition in vitro increases cell proliferation and adhesion the inventors of the present invention validated miR-422a itself as a therapeutic target.
- the inventors identified the biomarker miR-21 , which in combination with miR422a, even further improves the predictive value of miR-422a, in the oropharynx and TCGA cohorts, as demonstrated in the examples contained in the present application.
- the inventors identified the CD73/NT5E oncogene as target of miR- 422a. Indeed, modulation of the endogenous level of miR-422a inversely influences the expression and the enzymatic activity of CD73. Moreover, knocking down CD73 mimics the effects of miR-422a upregulation. Importantly, in tumors, miR-422a and CD73 expression levels are inversely correlated, and both as demonstrated by the inventors of the present invention are predictive of relapse free survival - especially considering loco(regional) recurrence - in two independent cohorts of advanced oropharynx or HNSCC (N 255) tumors. The inventors of the present invention thus reported, for the first time, that MiR-422a and its target CD73 are involved in early loco(regional) recurrence of HNSCC tumors and are new targets for personalized medicine.
- Head and neck cancer is a cancer that starts in the lip, oral cavity (mouth), nasal cavity (inside the nose), paranasal sinuses, pharynx, larynx or parotid glands. 90% of head and neck cancers are squamous cell carcinomas, called head and neck squamous cell carcinomas (HNSCC).
- HNSCC head and neck squamous cell carcinomas
- HNSCC Head and neck squamous cell carcinomas
- SCCHN squamous cell carcinoma of the head and neck
- “Squamous cells” are found in the outer layer of skin and in the mucous membranes, which are the moist tissues that line body cavities such as the airways.
- HNSCC is classified by its location: it can occur in the mouth (oral cavity), the middle part of the throat near the mouth (oropharynx), the space behind the nose (nasal cavity and paranasal sinuses), the upper part of the throat near the nasal cavity (nasopharynx), the voicebox (larynx), or the lower part of the throat near the larynx (hypopharynx).
- the HNSCC is selected from the group constituted of tumor in the oral cavity, tumor in the nasal cavity, tumor in the paranasal sinuses, nasopharynx tumor, larynx tumor, hypopharynx tumor and oropharynx tumor, preferably oropharynx tumor.
- the cancer can cause abnormal patches or open sores (ulcers) in the mouth and throat, unusual bleeding or pain in the mouth, sinus congestion that does not clear, sore throat, earache, pain when swallowing or difficulty swallowing, a hoarse voice, difficulty breathing, or enlarged lymph nodes.
- HNSCC can metastasize to other parts of the body, such as the lymph nodes or lungs. Once metastasized, the cancer has a worse prognosis.
- HNSCC during diagnosis, is preferably classified into different stages, mainly stages I, II, III and IV.
- the HNSCC in context of the present invention is a stage III or stage IV HNSCC.
- stage from the wording "stage I, II, II I and IV" herein refers to clinical stages.
- TAM tumor-node-metastasis
- stage I, II, III or stage IV HNSCC herein refers to stage I, II, III or stage IV HNSCC as defined by the TNM staging system.
- Tumor-node-metastasis staging system or “TNM staging system” in context of the present invention refers to a staging system first reported by Pierre Denoix in the 1940s, which is simply an anatomic staging system that describes and evaluates three primary factors relevant for the treatment: Tumor (T), Node (N) and Metastasis (M), wherein Tumor (T) refers to the size of the primary tumor and to which, if any, tissues in the oral cavity and oropharynx the cancer has spread; Node (N) describes the involvement of lymph nodes near the primary tumor. Lymph nodes are small, bean- shaped clusters of immune system cells that are a key to fighting infections and are usually one of the first sites in the body to which cancer spreads.
- Metastasis indicates whether the cancer has spread (metastasized) to other areas of the body. With oral cancer, for example, the most common site of metastases is the lungs, followed by the liver and bones.
- the TNM staging system thus describes the anatomic extent of the primary tumor as well as the involvement of regional lymph nodes and distant metastasis.
- the International Union against Cancer (UlCC) has established a structured process for continuous improvement of said TNM classification.
- the TNM staging system in context of the present invention refers to the sixth edition of the TNM staging system as further described, for example, in the article of Patel SG, Shah JP, 2005, CA Cancer J Clin. 55(4):242-258 or, for example, on the webpage https://cancerstaging.org/references-tools/Pages/What-is-Cancer-Staging.aspx, as accessible on 25 May 2016.
- nucleic acid as herein used generally refers to at least one molecule or strand of DNA, RNA, miRNA or a derivative or mimic thereof, comprising at least one nucleobase, such as, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., adenine "A,” guanine “G,” thymine “T,” and cytosine “C”) or RNA (e.g. A, G, uracil "U,” and C).
- nucleic acid encompasses the terms “oligonucleotide” and “polynucleotide”.
- a nucleic acid also encompasses the complementary strand of a depicted single strand.
- many variants of a nucleic acid may be used for the same purpose as a given nucleic acid.
- a nucleic acid also encompasses substantially identical nucleic acids and complements thereof.
- a single strand nucleic acid such as, a probe or a primer, may hybridize to the target sequence under stringent hybridization conditions.
- a nucleic acid also encompasses a probe or a primer that hybridizes under stringent hybridization conditions to a target sequence.
- oligonucleotide refers to at least one molecule of between about 3 and about 100 nucleobases in length.
- polynucleotide refers to at least one molecule of greater than about 100 nucleobases in length. These definitions generally refer to at least one single-stranded molecule, but in specific embodiments will also encompass at least one additional strand that is partially, substantially or fully complementary to the at least one single-stranded molecule. Thus, a nucleic acid may encompass at least one double-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a strand of the molecule.
- Gene used herein may be a genomic gene comprising transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (e.g., introns, 5'- and 3'-untranslated sequences).
- the coding region of a gene may be a nucleotide sequence coding for an amino acid sequence or a functional RNA, such as long and short non-coding RNA (as an example : tRNA, rRNA, catalytic RNA, and miRNA).
- a gene may also be an mRNA or cDNA corresponding to the coding regions (e.g., exons and miRNA) optionally comprising 5'- or 3'-untranslated sequences linked thereto.
- a gene may also be an amplified or synthetic nucleic acid molecule comprising all or a part of the coding region and/or 5'- or 3'-untranslated sequences linked thereto.
- stringent condition or “high stringency condition” is as defined herein below in the section “Use and Kit”.
- variant denotes nucleic acid sequences that have at least about 80% nucleic acid sequence identity with a nucleic acid sequence disclosed herein.
- a variant nucleic acid sequences will have at least about 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% amino acid sequence identity to a nucleic acid sequence or a fragment of a nucleic acid sequence as disclosed herein.
- Nucleic acid acid sequence identity is defined as the percentage of nucleic acids in the variant sequence that are identical with the nucleic acids in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Sequence identity may be determined over the full length of both variant and reference nucleic acid sequences.
- the "percentage of identity” is calculated using a global alignment (i.e. the two sequences are compared over their entire length). Methods for comparing the identity of two or more sequences are well known in the art.
- the "needle” program which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970 J. Mol. Biol. 48:443-453) to find the optimum alignment (including gaps) of two sequences when considering their entire length, may for example be used.
- the needle program is for example available on the ebi.ac.uk world wide web site.
- the percentage of identity in accordance with the invention is preferably calculated using the EMBOSS::needle (global) program with a "Gap Open” parameter equal to 10.0, a "Gap Extend” parameter equal to 0.5, and a Blosum62 matrix (for the alignment of proteins) or DNAfull (for the alignment of nucleotides).
- subject refers to an animal, preferably a non- human or human mammal.
- non-human mammals include rodents and primates.
- the subject is a human.
- the "subject” denotes herein an individual that is under medical care or treatment.
- the subject suffers from HNSCC, wherein HNSCC is as defined herein above.
- the subject suffers from an oropharynx tumor.
- methods to diagnose HNSCC include, but are not limited to, for example, physical examination/blood and urine tests, HPV testing, endoscopy, X-ray/barium swallow, panorex, ultrasound, computed tomography (CT or CAT) scan, magnetic resonance imaging (MRI), bone scan, positron emission tomography (PET) scan, biopsy and molecular testing of the tumor.
- CT or CAT computed tomography
- MRI magnetic resonance imaging
- PET positron emission tomography
- the subject suffers from stage III or IV HNSCC.
- the "subject having HNSCC" has been classified beforehand according to the TNM staging system, as defined herein above.
- the tumor of the subject in context of the present invention may or may not be positive for human papillomavirus (HPV).
- HPV human papillomavirus
- stage III and IV HNSCC is further classified into surgically resectable versus unresectable HNSCC.
- Step a) of the methods of the present invention refers to determining the expression level of the micro-RNA miR-422a.
- step a) of the methods of the present invention further comprises determining the expression level of the human micro-RNA miR-21 .
- said step a) further comprises determining the expression level of CD73.
- “Expression level” herein refers to the level of the gene product and thus refers to an amino acid sequence or a mRNA, or long and short non-coding RNA (such as tRNA, rRNA, catalytic RNA, miRNA.
- determining includes qualitative and/or quantitative detection (i.e. detecting and/or measuring the expression level) with or without reference to a control or a predetermined value.
- detecting means determining if the biomarker, i.e. microRNA miR-
- RNA RNA
- miR-21 RNA
- CD73 mRNA and/or protein
- the expression level of miRNA-422a, miR-21 and/or CD73 in step a) typically refers to a normalized expression level.
- Normalization herein refers to scaling data in such a way that different data sets obtained, for example, for different samples, can be compared. Normalization typically relies on genes whose expression does not change, so-called reference gene(s) or housekeeping gene(s).
- “Housekeeping genes” are involved in basic cell maintenance and, therefore, are expected to maintain constant expression levels in all cells and conditions. It will however be understood by the skilled in the art, that the housekeeping genes that are selected for normalization in context of the present invention may typically depend on the nature of the biological sample to be normalized, i.e if the biological sample is saliva, blood, tumor or urine. Furthermore, as it will be understood by the skilled in the art, methods to detect microRNA is different from methods to detect mRNA, accordingly, the housekeeping genes used for normalization of microRNAs preferably encode microRNAs and housekeeping genes used for normalization of mRNAs preferably encode mRNAs.
- At least one gene is used to normalize the expression level of miRNA-422a, miR-21 and/or CD73 in step a).
- At least one gene herein refers to at least one gene, at least two or three genes, more preferably three genes, most preferably one, two, or three genes, in particular three genes.
- the at least one gene used to normalize the expression level of miRNA-422a and/or miR-21 is selected from the group constituted of hsa-miR-143-5p, hsa-miR-574-3p, hsa-miR-15a-5p, hsa-miR-301 a-5p, hsa-miR-140-3p, hsa-miR-192-5p, hsa-miR-27b-5p, hsa-miR-708-5p, hsa-miR-345-5p, hsa-miR-212-5p, hsa-miR-130a-5p, hsa-miR-222-5p, hsa-miR-100-5p, hsa-miR-93-5p, hsa-miR-652-5p, hsa-miR-200b-5p, hsa-miR
- the at least one gene, preferably the three genes, used for normalization of miRNA-422a and/or miR-21 is selected from the group constituted of Let.7a, miR-26a, Let.7e.
- the at least one gene, preferably the three genes, used for normalization of CD73 is selected from the group constituted of RPL13A, ACTB, TUBB, RPL19, TBP, and GAPDH, preferably RPL19, TBP, and GAPDH.
- microRNA let-7a called “hsa-let-7a-5p” or “hsa-let-7a” has three potential precursors (hsa-let-7a-1 , hsa-let-7a-2 and hsa-let-7a-3) for one mature micro-RNA.
- Ha-let-7a-1 encoded on chromosome 9 from position 94175957 until 94176036 (reference genome GRCh38), and its gene sequence
- Hysa-let-7a-2 encoded on chromosome 1 1 from position 122146522 until 122146593 (reference genome GRCh38), and its gene sequence
- the "mature hsa-Let-7a", 22 bp long micro RNA, has the sequence
- microRNA miR-26a called “hsa-miR-26a-5p” or “hsa-miR-26a” has two potential precursors (hsa-miR-26a-1 and hsa-miR-26a-2) for one mature micro-RNA.
- hsa-mir-26a-1 encoded on chromosome 3 from position 37969404 until 37969480 (reference genome GRCh38), and its gene sequence 5'-GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUA UUCUUGGUUACUUGCACGGGGACGC-3' (SEQ ID NO : 26) is available from the miRbase database under the Gene ID number MI0000083 as accessible on 17 May 2016.
- the "mature has-miR-26a", 22 bp long micro RNA, has the sequence
- microRNA miR-let-7e is encoded by one precursor encoded on chromosome 19 from position 51692786 until 51692864 (reference genome GRCh38), and its gene sequence
- the "mature hsa-let-7e-5p", 22 bp long micro RNA, has the sequence 5 GAGGUAGGAGGUUGUAUAGUU-3' (SEQ ID NO: 30) and is accessible from the miRBase database under Reference Sequence number as MIMAT0000066 accessible on 17 May 2016.
- the gene "RPL13A” is located on chromosome 19 on position 49,487,554 until
- 49,492,308 (GRCh38) and its sequence is available from NCBI database under the reference sequence number ID 23521 . It produces a 1 181 bp long transcript, with the reference ID on NCBI database NP_036555.1 .
- ACTB is located on chromosome 7 on position 5,527,151 until 5,530,709 (GRCh38) and its sequence is available from NCBI database under the reference sequence number ID 60. It produces a 1917 bp long transcript, with the reference ID on NCBI database NM_001 101 .3.
- the gene "TUBB” is located on chromosome 6 on position 1 ,976,81 1 until
- TBP The gene "TBP” is located on chromosome 6 on position 170,554,333 until 170,572,869, (GRCh38) and its sequence is available from UCSC database under the reference sequence number NM 003194. It produces a 1921 bp long transcript, with the reference ID on NCBI database NM_003194.4
- GPDH The gene "GAPDH” is located on chromosome 12 on position 6,533,927 until
- the expression level of CD73 is typically normalized against the geometrical mean of, typically, three reference genes, such as RPL 19, TBP, and GAPDH.
- the "expression level" as referred to in context of the present invention is a normalized expression level.
- MiRNAs or “miRNAs” as referred to in context of the present invention are short non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs.
- MiRNAs are encoded by a gene and are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs).
- pri-miRNAs RNA polymerase II as part of capped and polyadenylated primary transcripts
- Pri-miRNAs may form a hairpin structure.
- the primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA (20-24 nt long) and antisense miRNA star (miRNA * ) products.
- pre-miRNA stem-loop precursor miRNA
- miRNA * antisense miRNA star
- miRNA-422a herein called “miR-422a”, also called “hsa-mir-422a” refers to the pri-miRNA 422a, pre-miRNA-422a, the mature miRNA-422a and the gene encoding miRNA-422a, preferably, miR-422a herein refers to the pri-miRNA 422a, pre-miRNA-422a and the mature miRNA-422a, more preferably to the mature miRNA-422a.
- microRNA-422a called “miR-422a” or “hsa-mir-422a” is encoded on chromosome 15 from position 63,870,930 until 63,871 ,019 (reference to genome hg38/Human) and its gene sequence
- pre-miR-422a is a 90 bp long micro RNA having the sequence
- the "mature miRNA-422a”, 22 bp long micro RNA, has the sequence
- MicroRNA-21 herein called “miR-21 ". also called “hsa-mir-21” refers to the pri- miRNA 21 , pre-miRNA-21 , the mature miRNA-21 -5p and the gene encoding miRNA-21 , preferably, to the pri-miRNA 21 , pre-miRNA-21 , the mature miRNA-21 -5p, more preferably to the mature miRNA-21 -5p.
- microRNA-21 is encoded on chromosome 17 from position 59841266 until 59841337 (reference to genome hg38/Human) and its gene sequence is available from the NCBI database under the Gene ID number : 406991 as accessible on 17 May 2016.
- pre-miR-21 is a 71 bp long micro RNA having the sequence
- the "mature miRNA-21 -5p", 22 bp long micro RNA, has the sequence
- determining the expression level of miR-422a or miR-21 refers to determining the expression level of at least one miRNA-422a selected from the group constituted of pri-miRNA 422a, pre-miRNA-422a and mature miRNA-422a or to determining the expression level of at least one miRNA-21 selected from the group constituted of pri-miRNA-21 , pre-miRNA-21 and mature miRNA-21 -5p.
- At least one miRNA-422a or at east one miRNA-21 herein refers to at least one, at least two, at least three, preferably one, two or three.
- determining the expression level of miR-422a herein refers to determining the expression level of pri-miRNA 422a, pre-miRNA-422a and mature miRNA-422a, preferably mature miRNA-422a.
- determining the expression level of miR-21 herein refers to determining the expression level of pri-miRNA-21 , pre-miRNA-21 and mature miRNA-21 -5p, preferably mature miRNA-21 -5p.
- the expression level of a microRNA such as miR-422a or miRNA-21 may be determined by methods known to the skilled in the art, for example by RT-qPCR and/or RNAsequencing performed on a biological sample and more particularly a stem-loop RT- PCR method as described in Chen et al., (2005) Nucleic Acids Res. 2005 Nov 27;33(20):e179. Methods such as RT-qPCR and/or RNAsequencing and stem-loop RT- PCR are generally known to the skilled in the art.
- the expression level of the micro-RNA miR-422a and/or miR-21 is measured by RT-qPCR, in situ hybridization or smallRNA sequencing, preferably RT- qPCR.
- RNA was typically extracted by using typically miRNeasy Mini Kit (Qiagen); quality was controlled by, for example, the small RNA kit for the Agilent Bioanalyzer (Bio-Rad).
- quality was controlled by, for example, the small RNA kit for the Agilent Bioanalyzer (Bio-Rad).
- 0 ⁇ g of total RNA were reverse transcribed using, for example, the TaqMan Advanced miRNA cDNA Synthesis Kit (Thermo Fisher Scientiffic), and analyzed using, for instance, specific TaqMan® Advanced miRNA Assays (Thermo Fisher Scientiffic) and the master mix TaqMan ® Universal Master Mix II, no UNG, on a, for instance, MxPro 3000 (Agilent).
- the expression data (delta 2 CT method) were typically normalized against the geometrical mean of, for example, three reference genes such as Let.7a, miR-26a, Let.7e.
- ISH in situ hybridization
- miRNA-422a and/or miR-21 may be measured using similar techniques as used to quantify gene transcript in particular, direct hybridization based assays, sequencing and amplification-based assays, with some experimental adaptation, well known in the art, due to the short sequences of the miRNAs.
- the reverse transcription of miRNA-422a and/or miR-21 to cDNA may be realized using hairloop primers hybridizing with the stem-loop of miRNA- 422a and miR-21 .
- nucleic acids having at least 10 nucleotides and exhibiting sequence complementarity or homology to miRNA-422a or miR-21 herein find utility as amplification primers, as further described herein below in the section 'Use and Kit". It is understood that such nucleic acids need not be identical, but are typically at least about 80% identical to the homologous region of comparable size, more preferably 85% identical and even more preferably 90-95% identical.
- Primers typically are shorter single-stranded nucleic acids, of between 10 to 25 nucleotides in length, designed to perfectly or almost perfectly match a nucleic acid of interest, to be amplified.
- the primers are "specific" to the nucleic acids they hybridize to, i.e. they preferably hybridize under high stringency hybridization conditions.
- nucleic acids in combination with appropriate means, such as a detectable label, for detecting hybridization.
- appropriate means such as a detectable label
- appropriate indicators include, fluorescent, radioactive, enzymatic or other ligands (e. g. avidin/biotin).
- step a) for determining the expression level of miR-422a and/or miR-21 in the methods of the invention further comprise in step a) the step of providing total RNAs extracted from a biological sample as defined herein below.
- Providing total RNAs herein refers to extracting total RNA. Methods to extract total RNA are known to the skilled in the art. Said total RNA extracted from a biological sample is then subjected to retro-transcription followed by amplification with miRNA-422a specific primers and/or miRNA-21 specific primers in step a), more particularly by means of a quantitative RT-PCR (RT-qPCR) as described above.
- RT-qPCR quantitative RT-PCR
- determining the expression level of miRNA-422a and/or miR-21 in step a) further contains normalizing said expression level as described herein above.
- CD73 cluster of differentiation 73
- ecto-5'-nucleotidase refers to an enzyme (EC 3.1 .3.5) that catalyzes the conversion at neutral pH of purine 5-prime mononucleotides to nucleosides, the preferred substrate being AMP.
- the protein CD73 is encoded by the gene NT5E.
- NT5E The human CD73 gene, NT5E, is found on chromosome 6 (Position 85,449,584 until 85,495,791 ) and has a total length of 46, 208 bases.
- Alternative splicing of the NT5E gene results in at least two transcript variants:
- CD73 Isoform 1 of which the mRNA is available from the UCSC database under accession number NM 002526 (SEQ ID NO: 1 ) and the representative protein sequence for CD73 isoform 1 called CD73L of 574 amino acids length is available under NCI database under the reference number ABA39834.1 (SEQ ID NO: 2) as accessible on 20 May 2016,
- CD73 Isoform 2 of which the RNA is available from the UCSC database under accession number NM 001204813 (SEQ ID NO: 3) and the representative protein sequence for CD73 isoform 2 called CD73S of 524 amino acids length, is available under the accession number NP_001 191742.1 (SEQ ID NO: 4) in the NCI database as accessible on 20 May 2016.
- CD73 herein refers to the transcription product(s) and/or translation product(s) of the gene NT5E.
- CD73 herein refers to the transcription product and/or translation product of CD37L and/or CD73S.
- determining the expression level of CD73 refers to determining the expression level of CD73L and/or CD73S.
- the expression level of CD73 refers to the protein expression level of CD73 and/or the mRNA expression level of CD73.
- the expression level of CD73 is determined by detecting transcription product(s) and/or translation product(s) of the gene NT5E.
- Determining the expression level of said NT5E gene can be performed by methods which are well known to the person skilled in the art, including in particular immunologic methods as further described herein below or quantitative methods, such as reverse transcriptase PCR (RT-PCR), such as real-time quantitative RT-qPCR, and methods involving the use of DNA arrays (macroarrays or microarrays), RNA sequencing or in situ hybridizations, in particular reverse transcriptase PCR (RT-PCR), such as real-time quantitative RT-qPCR, and methods involving the use of DNA arrays (macroarrays or microarrays) and RNA sequencing.
- RT-PCR reverse transcriptase PCR
- RT-PCR real-time quantitative RT-qPCR
- the expression level of CD73 is measured by RT- qPCR or RNA sequencing , preferably RT-qPCR.
- RNA quality was controlled by, for example, the for the Agilent Bioanalyzer (Bio-Rad).
- 0.5 ⁇ g of total RNA were retro-transcribed using, for example, the QantiTect RT kit (Qiagen).
- QPCR was prepared using, for instance, the QuantiTect SYBR® Green PCR Kit (ThermoFischer Scientific).
- the expression level of CD73 is determined using primers specific to CD73L (SEQ ID NO: 1 ) and CD73S (SEQ ID NO: 2), wherein the forward primer CD73-1 /2-F consists of the nucleic acid sequence 5'- TTATTGCACTGGGACATTCG -3' (SEQ ID NO: 8) and the reverse primer CD73-1 /2-R consists of the nucleic acid sequence 5'- AGGCCTGGACTACAGGAACC -3' (SEQ ID NO: 9).
- the expression level of CD73 is determined using primers specific to CD73S, wherein the forward primer CD73S-2-F consists of the nucleic acid sequence 5'-TGATGAACGCAACAATGGAAT-3' (SEQ ID NO: 10) and the reverse primer CD73S-2-R consists of the nucleic acid sequence 5'-TCTGGAACCCATCTCCACCA-3' (SEQ ID NO: 1 1 ).
- the expression level of CD73L is determined using primers specific to CD73L, wherein the forward primer CD73L-1 -F consists of the nucleic acid sequence 5'- ctcctctcaatcatgccgct -3' (SEQ ID NO: 20) and the reverse primer CD73L-1 -R consists of the nucleic acid sequence 5'- caaatgtgcctccaaagggc -3' (SEQ ID NO: 21 ).
- the expression level of CD73 in particular the protein expression level of CD73, will be determined by detecting the translation products using immunologic methods such as detection of CD73 using polyclonal or monoclonal antibodies.
- immunologic methods include immuno-histochemistry (IHC), enzyme linked immunoassays (ELISA), sandwich, direct, indirect, or competitive ELISA assays, enzyme linked immunospotassays (ELIspot), radio immunoassays (RIA), flow-cytometry assays (FACS), Western Blot, fluorescence resonance energy transfer (FRET) assays, protein chip assays using for example antibodies, antibody fragments, receptor ligands or other agents binding the CD73 proteins encoded by the NT5E gene.
- IHC immuno-histochemistry
- ELISA enzyme linked immunoassays
- sandwich direct, indirect, or competitive ELISA assays
- enzyme linked immunospotassays ELIspot
- RIA radio immunoassays
- FACS flow-cytometry assays
- FRET flu
- anti-CD73 antibodies for this purpose are commercially available.
- the expression level of CD73 is determined using immunohistochemistry, Western Blot.
- determining the expression level of CD73 further contains normalizing said expression level as described herein above.
- the expression level of CD73 is typically normalized against the geometrical mean of, typically, three reference genes, such as, for example, RPL 19, TBP, and GAPDH.
- the expression level of RPL19 is determined using primers specific to the mRNA of RPL19, wherein the forward primer RPL19-F consists of the nucleic acid sequence 5'-GGCACATGGGCATAGGTAAG-3' (SEQ ID NO: 12) and the reverse primer RPL19-R consists of the nucleic acid sequence 5'- CCATGAGAATCCGCTTGTTT-3' (SEQ ID NO: 13).
- the expression level of TBP is determined using primers specific to the mRNA of TBP, wherein the forward primer TBP-F consists of the nucleic acid sequence 5'-TATAATCCCAAGCGGTTTGC-3' (SEQ ID NO: 14) and the reverse primer TBP-R consists of the nucleic acid sequence 5'-CACAGCTCCCCACCATATTC-3' (SEQ ID NO: 15).
- the expression level of GAPDH is determined using primers specific to the mRNA of GAPDH, wherein the forward primer GAPDH -F consists of the nucleic acid sequence 5' GAGTCAACGGATTTGGTCGT-3' (SEQ ID NO: 16) and the reverse primer GAPDH-R consists of the nucleic acid sequence 5'- TTGATTTTGGAGGGATCTCG-3' (SEQ ID NO: 17).
- the expression level of miR-21 is higher than the miR-21 reference value
- the level of expression of the said biomarker as determined in the biological sample is superior to the miR-21 reference value, the difference between said values is typically statistically significant.
- the miR-21 reference value the median expression value of miR-21 in the whole cohort.
- the expression level of CD73 is higher than the CD73 reference value
- the level of expression of the said biomarker as determined in the biological sample is superior to the CD73 reference value, the difference between said values is typically statistically significant.
- the CD73 reference value is the median expression value of CD73 in the whole cohort.
- the level of the biomarkers i.e. of miR-422a, miR-21 and/or CD73 can be determined as a function of the reference value, and is thus higher or lower than said reference value.
- biological sample refers to a biological sample obtained for the purpose of in vitro evaluation.
- Biological samples that may be used for performing the methods according to the invention encompass any biological sample derived from a patient containing nucleic acids, in particular RNA and more particularly microRNA, including any fluids, tissues, cell samples, organs, biopsies, etc.
- the biological sample in context of the present inventions is selected from the group constituted of tissue sample, blood sample (e.g. whole blood sample), plasma, serum, saliva and urine, preferably, the biological sample is saliva.
- Biological samples such as blood samples, plasma, serum, saliva and urine are also referred to as a fluid samples.
- the biological sample is preferably a tumor sample.
- the term “reference value” refers to a miR-
- the miR-422a or miR-21 reference value or CD73 reference value are predetermined reference values and can be a threshold value or a range.
- the reference value can be any number of statistical measures to distinguish between a level indicative for reoccurrence of HNSCC, preferably early reoccurrence, i.e. a reference value obtained in subject(s) who experienced local (head and neck localization) and/or regional (nodes involvement) recurrence as a first event, within two years, and a level indicative that a subject has not or subjects have not relapsed or is(are) not at risk of relapsing, i.e. a reference value obtained in subject(s) who did not relapse during the first two years after surgery and radio(chemo)therapy, while including Median expression levels, and/or cut-off or threshold expression or fold change values as determined in an subject or a group of subjects.
- the inventors have determined if miR-422a is downregulated in tumor samples of responders and non-responders (R and NR) compared to healthy adjacent tissues (N).
- the miR-422a reference value, miR-21 reference value and/or the CD73 reference value is the expression level of the micro-RNA miR-422a, miR21 and/or the expression level of CD73, respectively, in a biological sample from healthy adjacent tissue of the same subject suffering from HNSCC.
- the miR-422a reference value, miR-21 reference value and/or the CD73 reference value herein refer to the median miR-422a expression level, median miR-21 expression level and/or the median CD73 expression level determined in biological samples obtained from a subject or a population of subjects suffering from HNSCC who did not relapse during at least first two years after surgery and radio(chemo)therapy.
- the inventors compared the expression level distribution of miR-442a observed in a group of subject having no reoccurrence of HNSCC within 2 years with the expression level distribution in subjects having a loco-regional relapse within 2 years and identified a cutoff value of 0.036.
- the miR-422a reference value is 0.036.
- the inventors identified in HNSCC tumors the microRNA miR-422a as a biomarker which, when downregulated, is associated with early recurrence of the HNSCC.
- the inventors further identified, that the combination of the biomarkers miR-422a with miR-21 , when respectively downregulated and upregulated, are associated with a further increased prognoses of early recurrence of the HNSCC.
- the inventors further demonstrated that the miR-422a targets the oncogene CD73/NT5E. Accordingly, the level of miR-422a and CD73 is inversely correlated, i.e., as demonstrated by the inventors, low levels of miR-422 correlate with high levels of CD73.
- the CD73 in HNSCC is therefore a promising target for anti-cancer therapy in subjects having a reduced level of miR-422a or a reduced level of miR-422a and an increased level of miR-21 and thereby belonging to a poor responder subgroup. Furthermore, the inventors demonstrated that exogenously added miR-422a decreases the expression of the oncogene CD73 thus further establishing a miR-422 mimic reagent as promising therapy for subjects suffering from HNSCC which have a low expression level of miR-422a.
- the invention thus concerns an in vitro method for selecting a subject who suffers from HNSCC which comprises:
- said method is for selecting a subject with HNSCC who is likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification, and said subject is selected as likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification if said subject has an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, said subject has an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value.
- Good responders are herein defined as subjects having an expression level of the micro-RNA miR-422a as determined in step a) higher than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) lower than the miR-21 reference value.
- - a subject having an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, or
- a subject is likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification because, said subject, as defined herein above, is likely not to respond to the standard HNSCC treatment, wherein the standard HNSCC treatment is as defined herein below in the section "Prediction of clinical outcome”.
- a CD73 inhibitor is in particular of interest for subjects having a reduced expression level of miR422, optionally an increased expression level of miR21 and an increased expression level of CD73.
- the in vitro method for selecting a subject further comprises determining in step a) the expression level of CD73 in said biological sample of said subject, and further comparing in step b) the expression level of CD73 with a CD73 reference value.
- a subject is selected as likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification if said subject has a measured expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and has a measured expression level of CD73 as determined in step a) that is higher than a CD73 reference value.
- a subject is selected as likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification if said subject has:
- compositions and therapeutic applications and a “CD73 inhibitor” and “treatment intensification” are as defined herein below in the section “Method of treatment”.
- the inventors further demonstrated that the level of miR-422a or miR-21 expression is predictive of RFS (LogRank test, p ⁇ 0.05), when considering loco-regional or local relapse (as demonstrated in Figure 2 and Figure 29), and that combination of both micro- RNA is predictive of RFS (LogRank test, p ⁇ 0.05) for all types of HNSCC, as demonstrated in the TCGA cohort and the oropharynx cohort.
- the invention thus further concerns an in vitro method for determining the chance of relapse-free survival in a subject suffering from HNSCC, comprising:
- an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value, and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value indicates that the subject has a reduced chance of relapse-free survival than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level and, optionally, who has an expression level of the micro- RNA miR-21 equal to or lower than the miR-21 reference level.
- the in vitro method for determining the chance of relapse-free survival further comprises determining in step a) the expression level of CD73 in said biological sample of said subject, and further comparing in step b) the expression level of CD73 with a CD73 reference value.
- an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR- 21 reference value, and a measured expression level of CD73 as determined in step a) that is higher than a CD73 reference value indicates that the subject has a reduced chance of relapse-free survival than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level and an expression level of CD73 as determined in step a) equal to or lower than the CD73 reference level and, optionally, an expression level of the micro-RNA miR-21 equal to or lower than the miR-21 reference level.
- a "reduced chance of relapse-free survival” defines that the subject has a l OOmonth relapse free survival (RFS) chance, preferably a 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 24, 30, 50, 60, 70, 80, 100, 1 10, 120, 130, 140, 150 month RFS chance, of less than 50%, in particular less than 40%, more particular less than 30%, for example less than 25%, for example between 1 % and 25%, particularly 20, 22, 24, 25, 26, 27, 28, 29 or 30%.
- RFS l OOmonth relapse free survival
- reduced chance of relapse-free survival herein refers to reduced relapse free survival (RFS).
- the patients have a 24-month relapse free survival chance of less than 33% (for example in the oropharynx cohort), and a 60-month relapse free survival chance of less than 40% (for example in the TCGA cohort).
- a reduced chance of relapse-free survival refers to a 100-month relapse free survival (RFS) chance of less than 30%, or a 24-month relapse free survival chance of less than 33%, or a 60-month relapse free survival chance of less than 40%.
- RFS relapse free survival
- Relapse-free survival is herein defined as the time of survival without any HNSCC recurrence and/or spread and/or second cancer after treatment onset. It therefore corresponds to the total amount of time that a subject survives after treatment onset, in particular without any relapse.
- the "relapse” is defined as the reoccurrence and/or spread of HNSCC and/or metastasis and/or second cancer appearance after the initial therapy.
- relapse is local-regional relapse. Prediction of clinical outcome
- clinical outcome refers to the risk of relapsing.
- the invention thus refers to an in vitro method for predicting a clinical outcome in response to a treatment of HNSCC in a subject suffering from HNSCC, comprising:
- step c) based on the comparison of step b), classifying the subject as being at an increased risk of relapse,
- the presence of an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR- 21 reference value indicates that the subject has an increased risk of relapse in response to a treatment of HNSCC than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level and, optionally, who has an expression level of the micro-RNA miR-21 equal to or lower than the miR-21 reference level.
- step a) the presence of an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro- RNA miR-21 as determined in step a) higher than the miR-21 reference value, or
- the subject has an increased risk of relapse in response to a treatment of HNSCC than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level and an expression level of the micro-RNA miR-21 equal to or lower than the miR-21 reference level.
- the in vitro method for for predicting a clinical outcome further comprises determining in step a) the expression level of CD73 in said biological sample of said subject, and further comparing in step b) the expression level of CD73 with a CD73 reference value.
- step a) an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, or
- step a) an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) lower than the miR-21 reference value, or
- step a) an expression level of the micro-RNA miR-422a as determined in step a) higher than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, and
- an "an increased risk of relapse” defines that the subject has a l OOmonth risk of relapse, preferably a 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 24, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150 month risk of relapse of more than 50%, in particular more than 60%, more particular more than 70%, for example more than 75%, for example between 99% and 75%, particularly 80, 78, 76, 74, 72, 70%.
- an an increased risk of relapse refers to a 100-month risk of relapse of more than 70%, or a 24 month risk of relapse of more than 67%, or a 60-month risk of relapse of more than 60%.
- the "risk of relapse” is herein defined as the % of subjects that suffer from HNSCC recurrence and/or spread and/or second cancer after treatment onset.
- treating means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
- treatment of HNSCC in the wording "a method for predicting a clinical outcome in response to a treatment of HNSCC” refers to the standard treatments usually used to treat HNSCC. It will be understood by the skilled in the art that the treatment of HNSCC used depends on the the type of HNSCC, its localization and its extend as typically defined using the TNM grading system and the performance status of the patient.
- the treatment of HNSCC typically comprises at least one therapy selected from the group consisting of surgery, radiation therapy and chemotherapy.
- tracheostomy is frequently used in most types of head and neck cancer in order to remove the cancerous cells entirely.
- HNSCC surgery might refer to vocal cord stripping, laser surgery, cordectomy, laryngectomy, partial laryngectomy, total laryngectomy, pharyngectomy, lymph node removal and tracheotomy, also called tracheostomy.
- Radiotherapy is the most common form of treatment and uses targeted energy (e.g., X-rays, radioactive substances) to destroy cancer cells, shrink tumors, and/or alleviate certain cancer-related symptoms.
- targeted energy e.g., X-rays, radioactive substances
- “Chemotherapy” is not generally used alone to cure the HNSCC as such, but instead, to limits tumor extension. It can be used as an induction treatment to reduce the tumor size before surgery and/or radiotherapy, or in combination with radiotherapy, or as an adjuvant treatment after radiotherapy to increase treatment efficiency.
- the invention further refers to at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-422a for use in the methods of the present invention and/or at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-21 for use in the methods of the present invention and/or at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding CD73 for use in the methods of the present invention.
- the invention further refers to the use of at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-422a in the methods of the present invention and/or the use of at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-21 in the methods of the present invention and/or the use of at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding CD73 in the methods of the present invention.
- nucleic acids in context of the invention are isolated.
- isolated in reference to a biological component (such as a nucleic acid, a vector or a protein) refers to a biological component that has been substantially separated or purified away from other biological components in the cell of the organism, or the organism itself, in which the component naturally occurs, such as other chromosomal and extra-chromosomal DNA and RNA, proteins, cells, and organelles.
- hybridize or “hybridization,” as known to those skilled in the art, refer to the binding of a nucleic acid molecule to a particular nucleotide sequence under suitable conditions, namely under stringent conditions.
- stringent condition or "high stringency condition” as used herein corresponds to conditions that are suitable to produce binding pairs between nucleic acids having a determined level of complementarity, while being unsuitable to the formation of binding pairs between nucleic acids displaying a complementarity inferior to said determined level.
- Stringent conditions are the combination of both hybridization and wash conditions and are sequence dependent. These conditions may be modified according to methods known from those skilled in the art (Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes, Part I, Chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York).
- high stringency conditions are selected to be about 5°C lower than the thermal melting point (Tm), preferably at a temperature close to the Tm of perfectly base-paired duplexes (Andersen, Nucleic acid Hybridization, Springer, 1999, p. 54).
- Hybridization procedures are well known in the art and are described for example in Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D.,Seidman, J.G., Smith, J. A., Struhl, K. eds. (1998) Current protocols in molecular biology. V.B. Chanda, series ed. New York: John Wiley & Sons.
- High stringency conditions typically involve hybridizing at about 50°C to about 68°C, wherein said temperature typically corresponds to the highest melting temperature T M of the nucleic acid to be hybridized with a target sequence, in 5x SSC/5x Denhardt's solution/1 .0% SDS, and washing in 0.2x SSC/0.1 % SDS at about 60°C to about 68°C.
- the at least one nucleic acid in context of the invention is a oligonucleotide, wherein the oligonucleotide is as defined herein above.
- the oligonucleotide comprises a nucleotide sequence of 10 to about 300 consecutive nucleotides.
- the at least one nucleic acid in context of the invention hybridizes specifically under high stringency conditions to a nucleic acid sequence comprising SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) and/or the at least one nucleic acid in context of the invention hybridizes specifically under high stringency conditions to a nucleic acid sequence comprising SEQ ID NO: 6 (pre-miR-422a) and/or a nucleic acid sequence comprising SEQ ID NO: 7(mature miR-422a) and/or the at least one nucleic acid in context of the invention hybridizes specifically under high stringency conditions to a nucleic acid sequence comprising SEQ ID NO: 18 (pre-miR-21 ) and/or a nucleic acid sequence comprising SEQ ID NO: 19 (mature miRNA-21 -5p).
- the at least one nucleic acid may comprise a nucleotide sequence of 8 to about 300 consecutive nucleotides of the nucleotide sequences of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (miRNA-21 -5p) or the complementary sequences thereof.
- the at least one nucleic acid may further comprise single nucleotides or a nucleotide sequence that do not hybridize with the nucleotide sequence of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR- 422a) and/or SEQ ID NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (miRNA-21 -5p) or the complementary sequences thereof.
- the isolated nucleic acid according to the invention comprises a sequence which corresponds (or is complementary to) a sequence having between 80% and 100% sequence identity with sequence SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S), or the isolated nucleic acid according to the invention comprises a sequence which corresponds (or is complementary to) a sequence having between 80% and 100% sequence identity with sequence SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7(mature miR-422a) or the isolated nucleic acid according to the invention comprises a sequence which corresponds (or is complementary to) a sequence having between 80% and 100% sequence identity with sequence SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miRNA-21 -5p).
- the isolated nucleic acid comprises a sequence which corresponds (or is complementary to) a sequence having between at least about 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% nucleic acid sequence identity with sequence SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miRNA-21 -5p) as disclosed herein.
- the isolated nucleic acid of the invention is a probe.
- the "probe” can be used for diagnosing or prognosing HNSCC in biological samples. Contacting nucleic acids of a biological sample, with the probe, under conditions which allow hybridization of the probe with its corresponding fragment in the nucleic acid, results in the formation of a nucleic acid/probe hybrid. The formation of this hybrid can be detected (e.g., via labeling of the nucleic acid or probe), whereby the formation of this hybrid indicates the presence of variation.
- identification methods based on hybridization with a specific probe (either on a solid phase carrier or in solution) have been described in the art.
- the specific probe is preferably a sequence which, under optimized conditions, hybridizes specifically to a region within the 5' or 3' flanking region of at least one variation and preferably also comprising part of the foreign DNA contiguous therewith (hereinafter referred to as "specific region").
- specific region a region within the 5' or 3' flanking region of at least one variation and preferably also comprising part of the foreign DNA contiguous therewith.
- Probes can be used for the methods of the invention by hybridizing to miR-422a or variants thereof or CD73 or variants thereof as described herein above.
- miR-422a comprising SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 6
- this hybrid can be detected (e.g., via labeling of the nucleic acid or probe), whereby the formation of this hybrid indicates the expression of the corresponding sequence.
- identification methods based on hybridization with a specific probe (either on a solid phase carrier or in solution) have been described in the art.
- the specific probe is preferably a sequence which, under optimized conditions, hybridizes specifically to SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p).
- the probe comprises a sequence which is at least 80%, preferably between 80 and 85%, more preferably between 85 and 90%, especially preferably between 90 and 95%, most preferably between 95% and 100% identical (or complementary) to the nucleotide sequence of a specific region, i.e. to the nucleotide sequence of miR-422a, miR21 or CD73.
- the probe will comprise a sequence of about 15 to about 40, or 20 to about 40 and notably, 15, 20, 25, 30, 35, 38, or all contiguous nucleotides identical (or complementary) to CD73, in particular, to the nucleic acid consisting of SEQ ID NO: 1 (CD73L) or SEQ ID NO: 3 (CD73S) or variants thereof, or to miR-422a, in particular, to the nucleic acid consisting of SEQ ID NO: 6 (pre-miR- 422a) and/or SEQ ID NO: 7 (mature miR-422a), or variants thereof or to miR-21 , in particular, to the nucleic acid consisting of SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p), or variants thereof.
- the probe comprises a sequence of about 15 to about 100, or 25 to about 80 contiguous nucleotides identical (or complementary) to SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p).
- the at least one isolated nucleic acid is at least two nucleic acids.
- the two nucleic acids are a set of primers.
- the invention concerns a pair of primers suitable for amplifying CD73 and/or a pair of primers suitable for amplifying miR-422a and/or a pair of primers suitable for amplifying miR-21 for use in the methods of the invention.
- the invention concerns the use of a pair of primers suitable for amplifying CD73 and/or the use of a pair of primers suitable for amplifying miR-422a and/or the use of a pair of primers suitable for amplifying miR-21 in the methods of the invention.
- probes or primers that target specific nucleic acids such as miR-422a, miR-21 or CD73
- miR- 422a, miR21 or CD73 are available from the NCBI sequence database and from annotated genes of genome sequencing projects. Nucleotide sequences can be aligned and probes or primers can be designed to target conserved regions of miR-422a, miR21 or CD73 nucleic acids separately.
- primer is meant for short nucleic acid molecules, such as a DNA oligonucleotide, which can be annealed to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand.
- a primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify a target nucleic acid molecule.
- Primer pairs can be used for amplification of a nucleic acid sequence, for example, by PCR, real-time PCR, or other nucleic-acid amplification methods known in the art. Methods for preparing and using primers are described for example, in Sambrook et at.
- Said primer may be a sense primer and/or an antisense primer, said sense primer comprising or consisting of 15 to 40 consecutive nucleotides of a nucleotide sequence that is identical to or substantially identical (i.e.
- nucleotide sequence of CD73, miR-21 or miR-422a in particular to the nucleotide sequence of CD73 consisting of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or a variant thereof, or the nucleotide sequence of miR-422a consisting of SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR-422a), or a variant thereof, or the nucleotide sequence of miR-21 consisting of SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p), or a variant thereof, and said antisense primer comprising or consisting of 15 to 40 consecutive nucleotides of a nucleotide sequence that is complementary to a nucleotide sequence that is identical to or substantially identical (i.e.
- primers may be less than 100, 50, 40, 25 or preferably 20 nucleotides long.
- the present invention further refers to the use of a nucleic acid specifically hybridizing to a CD73 nucleic acid sequence consisting of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or a nucleic acid specifically hybridizing to miR-422a nucleic acid sequence consisting of SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR- 422a) or a nucleic acid specifically hybridizing to miR-21 nucleic acid sequence consisting of SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p) in the methods of the invention, in particular for determining relapse-free survival in a subject suffering from HNSCC, for selecting a subject who suffers from HNSCC and for method for predicting a clinical outcome in response to a treatment of HNSCC.
- the primers specific to CD73 are the forward primer CD73-1/2-F consisting of the nucleic acid sequence 5'- TTATTCGACTGGGACATTCG-3' (SEQ ID NO: 8) and the reverse primer CD73-1/2-R consisting of the nucleic acid sequence 5'- AGGCCTGGACTACAGGAACC -3' (SEQ ID NO: 9).
- the primers specific to CD73, in particular CD73S are the forward primer CD73S-2-F consisting of the nucleic acid sequence 5'- TGATGAACGCAACAATGGAAT-3' (SEQ ID NO: 10) and the reverse primer CD73S-2-R consisting of the nucleic acid sequence 5'-TCTGGAACCCATCTCCACCA-3' (SEQ ID NO: 1 1 ).
- the primers specific to CD73, in particular CD73L are the forward CD73L-1 -F consisting of the nucleic acid sequence 5'- ctcctctcaatcatgccgct -3' (SEQ ID NO: 20) and the reverse primer CD73L-1 -R consisting of the nucleic acid sequence 5'- caaatgtgcctccaaagggc -3' (SEQ ID NO: 21 ).
- the invention also discloses a kit for the methods of the invention, i.e.
- kits for selecting a subject who suffers from HNSCC, for determining the chance of relapse-free survival in a subject suffering HNSCC and for predicting a clinical outcome in response to a treatment of HNSCC in a subject suffering from HNSCC, wherein said kit comprises at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-422a and/or at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-21 and/or at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding CD73, as defined above.
- the invention concerns a kit comprising means for determining the expression level of CD73 and/or means for determining the expression level of miR-422a, and/or means for determining the expression level of miR-21 .
- “Means for” herein refers to antibodies directed against a target protein sequence and/or nucleic acids as defined herein above, which specifically hybridize with a target sequence.
- said means may be anti-CD73 antibodies or nucleic acids of the invention, such as a pair of primers and/or probes according to the inventions as defined herein above.
- CD73 are the forward primer CD73-1 /2-F consisting of the nucleic acid sequence 5'- TTATTCGACTGGGACATTCG-3' (SEQ ID NO: 8) and the reverse primer CD73-1/2-R consisting of the nucleic acid sequence 5'- AGGCCTGGACTACAGGAACC -3' (SEQ ID NO: 9) and/or the forward primer CD73S-2-F consisting of the nucleic acid sequence 5'- TGATGAACGCAACAATGGAAT-3' (SEQ ID NO: 10) and the reverse primer CD73S-2-R consisting of the nucleic acid sequence 5'-TCTGGAACCCATCTCCACCA-3' (SEQ ID NO: 1 1 ) and/or the forward CD73L-1 -F consisting of the nucleic acid sequence 5'- ctcctctcaatcatgccgct -3' (SEQ ID NO: 20) and the reverse primer CD73L-1 -R consisting of the nucleic acid sequence 5'- caaatg
- said means are, in particular, nucleic acids of the invention, such as a pair of primers and/or probes, preferably primers, as defined herein above.
- the kit in context of the invention further comprises means for determining the expression level of at least one further gene to be used for normalization, as defined herein above in the section "Determining the expression level".
- the at least one gene is at least two, or at least three genes, at least four genes, at least five genes, at least six genes, preferably the at least one gene are three genes or six genes.
- the at least one further gene is selected from the group constituted of Let.7a, miR-26a, Let.7e, RPL 19, TBP, and GAPDH, as defined herein above.
- the kit further comprises at least one mean selected from the group constituted of a nucleic acid, a pair of primers or a probe, preferably a pair of primers specifically hybridizing to the nucleic acid sequence of Let.7a, miR-26a, Let.7e, RPL19, TBP, or GAPDH.
- the kit further comprises a pair of primers specifically hybridizing to the nucleic acid sequence of Let.7a, a pair of primers specifically hybridizing to the nucleic acid sequence of miR-26a and a pair of primers specifically hybridizing to the nucleic acid sequence of Let.7e.
- the kit further comprises:
- kits according to the invention are for use in the methods of the invention by determining the expression level of miR-422a, miR-21 and/or CD73.
- the kit of the invention may thus further comprise a combination of reagents allowing determining the expression level of miR-422a, miR-21 and/or CD73 and optionally the instructions of the manufacturer for use in the methods of the invention.
- the kit comprises, for miR-422a, miR-21 and/or for
- CD73 to be tested at least one probe and/or a pair of primers that selectively hybridize with said biomarker.
- the invention provides for a kit for the in vitro methods of the invention comprising at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR- 422a and/or at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding CD73 and/or at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR21 and at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to at least one further gene selected from the group constituted of Let.7a, miR-26a, Let.7e, RPL 19, TBP, and GAPDH.
- the kit according to the invention may further comprise at least one miR-422a reference value and/or at least one miR-21 reference value and/or at least one CD73 reference value.
- Said at least one miR-422a reference value may be for example a normal 422a reference value, an increased miR-422a reference value and decreased miR-422a reference value.
- Said at least one miR-21 reference value may be for example a normal miR-21 reference value, an increased miR-21 reference value and decreased miR-21 reference value.
- Said at least one CD73 reference value may be for example a normal CD73 reference value, an increased CD73 reference value and decreased CD73 reference value.
- said reference values are provided in form of a standard.
- a “standard” herein refers to a sample comprising a compound, such as a nucleic acid, in a known amount.
- compositions and therapeutic applications are provided.
- the inventors have demonstrated that the mRNA, protein and enzymatic activity of the CD73 nucleotidase, which is involved in the oncogenic processes, are modulated by miPi-422a, and that CD73 downregulation mimics the effects of miR-422a overexpression.
- the inventors demonstrated that overexpressing miR-422a increases the expression level of miR-422a and decreased the enzymatic activity of CD73 in the cell lines tested (see for example Figure 9 to 12).
- a miR-422a overexpression reduces the mRNA and protein level of the oncogene CD73 and inhibits its enzymatic activity.
- the invention relates to a pharmaceutical composition
- a pharmaceutical composition comprising a miR- 422a mimic reagent for use as a medicament.
- the invention also provides a pharmaceutical composition comprising a miR-422a mimic reagent for use in the treatment of HNSCC.
- treating means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
- treating or treatment refers to obtaining complete remission of the HNSCC in a subject in context of the invention.
- Complete remission herein refers to the absence of clinical signs and/or imaging signs, such as signs in PET scan and/or IRM, of residual HNSCC tumor and/or HNSCC metastasis and/or lymph node invasion of an HNSCC, or a second cancer. Sid complete remission is preferably evaluated 6- months after the end of treatment.
- a “miR-422a mimic reagent” in context of the present invention is a nucleic acid which acts to increase the level of a miR-422 gene product in a cell.
- microRNA mimic reagents As known by the skilled in the art, there exist different ways to administer a micro RNA mimic reagents, either administering microRNA formulations, either naked, coupled to a carrier, or delivered via a viral vector encoding the microRNA . Those methods are known to the skilled in the art and described for example in Ling, H et al. Nat Rev Drug Discov. 2013 Nov;12(1 1 ):847-65.
- miR-422a mimic reagent is a nucleic acid comprising a sequence of miR-422 or a variant thereof.
- the miR-422a mimic reagent is synthetic.
- the miR-422a mimic reagent comprises one or more stabilizing mutations.
- the miR-422a mimic reagent comprises at least one nucleic acid sequence of miR-422a selected from the group consisting of the miR-422a gene sequence of SEQ ID NO : 5, SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature- miR-422a), preferably the miR-422a gene sequence of SEQ ID NO : 5.
- the at least one nucleic acid refers to at least one, at least two, at least three, such as 1 , 2 or 3 nucleic acid sequences.
- a nucleic acid such as a miRNA
- a nucleic acid may be delivered to the cell in a vector.
- the miR-422a mimic reagent is a vector.
- said vector is an isolated vector.
- a “vector” herein refers to any vehicle capable of facilitating the transfer of the nucleic acid to the cell such that the nucleic acid can be processed and/or expressed in the cell.
- the vector may transport the nucleic acid to the cells with reduced degradation, relative to the extent of degradation that would result in the absence of the vector.
- the vector optionally includes gene expression sequences or other components able to enhance expression of the nucleic acid within the cell.
- said vector comprises a sequence of miR-422 or a variant thereof.
- the vector comprises the miR-422 sequence selected from the group consisting of the miR-422a gene sequence of SEQ ID NO : 5, SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature-miR-422a), preferably the miR-422a gene sequence of SEQ ID NO : 5.
- vectors useful in context of the present invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the nucleotide sequences (or precursor nucleotide sequences) of the invention.
- Vectors for use in context of the invention are well known in the art, as well as methods to prepare said vectors containing a specific sequence.
- the miR-422a mimic reagent is a RNA molecule.
- RNA molecule is double-stranded and/or blunt-ended RNA molecule, which means the molecule is double-stranded throughout the molecule and/or blunt-ended on both ends.
- the double stranded RNA molecule comprises an active strand and a fully complementary passenger.
- the double stranded RNA molecule comprises an active strand containing the mature miR-422a sequence of SEQ ID NO: 7.
- sequence of one strand of a double stranded RNA molecule consists of the sequence of a mature miR-422a sequence of SEQ ID NO: 7.
- a double-stranded molecule does not include a hairpin molecule, which is one strand or polynucleotide.
- the RNA molecule is blunt-ended on one or both ends.
- one or both strands may be 18, 19, 20, 21 , 22, 23, 24, or 25 nucleotides in length, or any range derivable therein.
- a double-stranded, blunt-ended molecule is 22 or 23 basepairs (bps) in length.
- a double-stranded RNA molecule contains two strands that are fully complementary to one another, which results in a molecule that is necessarily blunt-ended.
- an RNA molecule in context of the present invention has an active strand comprising a mature human miR-422a sequence of SEQ ID NO: 7 (22- mer).
- the mature miR-422a sequence consists of the sequence of SEQ ID NO: 7 and an at least one additional nucleotide at the 5' end and/or the 3' end, preferably at the 3 end, wherein the nucleotide is selected from A, C, G, or U.
- the mature miR-422a sequence consists of the sequence of SEQ ID NO: 7 and one additional U at the 3' end.
- the active strand has at least one modified nucleotide at one or more internal positions.
- the active strand has at two, at least three, at least four, at least 5, at least 6 modified nucleotide at one or more internal positions, for example the active strand may comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 modified nucleotides at 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 internal positions, respectively.
- modified nucleotide means a nucleotide or nucleoside (if referring to the nucleobase at the 5' position) with an additional moiety or a replacement moiety compared to an unmodified nucleotide.
- modified bases or modified nucleotide may refer to as heterocyclic base moieties, including other synthetic and natural nucleobases such as 5-methylcytosine (5- me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and
- Modified nucleotides further refer to nucleotides with sugar portions that correspond to naturally occurring sugars or modified sugars.
- Representative modified sugars include carbocyclic or acyclic sugars, sugars having substituent groups at one or more of their 2', 3' or 4' positions and sugars having substituents in place of one or more hydrogen atoms of the sugar.
- the sugar is modified by having a substituent group at the 2' position.
- the sugar is modified by having a substituent group at the 3' position.
- the sugar is modified by having a substituent group at the 4' position.
- a sugar may have a modification at more than one of those positions, or that the RNA molecule in context of the invention may have one or more nucleotides with a sugar modification at one position and also one or more nucleotides with a sugar modification at a different position.
- Sugar modifications contemplated in miRNA mimics include, but are not limited to, a sugar substituent group selected from: OH; F; O— , S— , or N-alkyl; O— , S— , or N- alkenyl; O— , S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl.
- a sugar substituent group selected from: OH; F; O— , S— , or N-alkyl; O— , S— , or N- alkenyl; O— , S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alky
- these groups may be chosen from: 0(CH2)xOCH3, 0((CH2)xO)yCH3, 0(CH2)xNH2, 0(CH2)xCH3, 0(CH2)xONH2, and 0(CH2)xON((CH2)xCH3)2, where x and y are from 1 to 10.
- one or more base or sugar modifications may be used to induce a 3'- endo sugar conformation.
- a nucleoside can incorporate synthetic modifications of the heterocyclic base, the sugar moiety or both to induce a desired 3'-endo sugar conformation. These modified nucleosides are used to mimic RNA-like nucleosides so that particular properties of an oligomeric compound can be enhanced while maintaining the desired 3'-endo conformational geometry (as further described for example in Patent Application Publication 2005/0261218).
- the RNA molecule in context of the invention has a modification particularly of the 5' terminal residue of specifically the strand having the sequence that is complementary to the mature miRNA.
- This strand is referred to as the "passenger" strand herein.
- the presence of a stable moiety other than a phosphate or hydroxyl at the 5' end of the complementary strand impairs or eliminates uptake of the passenger strand by the miRNA pathway complex and subsequently favors uptake of the active strand by the miRNA protein complex.
- 5' modifications include, but are not limited to, NH2, biotin, an amine group, a lower alkylamine group, a lower alkyl group, NHCOCH3, an acetyl group, 2' oxygen- methyl (2'O-Me), DMTO, fluorescein, a thiol, or acridine or any other group with this type of functionality.
- the miR-422a mimic reagent is a double-stranded, blunt-ended RNA molecule comprising:
- an active strand comprising sequence SEQ ID NO:8 from 5' to 3' and
- the fully complementary passenger strand referred to in b) comprises
- the terminal modification of the nucleotide at the 5' end may be referred to as 5' end modification.
- Such a terminal modification may be with respect to the nucleotide (or nucleoside if it lacks a phosphate group) at the 5' end.
- This terminal modification is specifically contemplated in some embodiments to be a modification that is not a modification of a sugar molecule. It is specifically contemplated that this modification may be one of the following: NH 2 , biotin, an amine group, a lower alkylamine group, NHCOCH 3 , an acetyl group, 2'0-Me, DMTO, fluorescein, a thiol, acridine, Spacer 18 (PEG) amidite (DMT- Hexa(ethylene glycol)), or any other group with this type of functionality.
- the 5' terminal modification on the passenger strand is a C6 amine linker.
- the nucleotide at the 5' end of the passenger strand may have both a non-sugar modification and a sugar modification, as defined herein above.
- the RNA molecule has an active strand with a sequence that is identical or that has 80% or more identical to SEQ ID NO: 7, preferably, 90% or more identical to SEQ ID NO: 7, for example 91 , 92, 93, 94, 95, 96, 97, 98, 99%. .
- Specific embodiments further include pharmaceutical compositions comprising one or more different miR-422a mimic reagents; the difference may relate to sequence and/or type or position of modification.
- the miR-422a mimic reagent is comprised in a lipid formulation.
- the miR-422a mimic reagent may be formulated with a liposome, polymer-based nanoparticle, cholesterol conjugate, cyclodextran complex, polyethylenimine polymer and/or a protein complex.
- a liposome polymer-based nanoparticle
- cholesterol conjugate cholesterol conjugate
- cyclodextran complex polyethylenimine polymer
- polyethylenimine polymer polyethylenimine polymer and/or a protein complex.
- different microRNA mimics such as MRG- 201 (Miragen Corp) or MRX34 (Mirna therapeutics) are developed and currently in clinical trials, thus demonstrating that techniques to formulate and administer microRNA mimics are known to the skilled in the art..
- composition of the present invention can be administered via any suitable route, such as by mucosal (intranasal), parenteral, or intramuscular administration, oral, intradermal, intraperitoneal, intravenous, or subcutaneous administration, preferably intravenous.
- the pharmaceutical composition of the present invention can be administered alone or with suitable pharmaceutical carriers, and can be in solid or liquid form such as, tablets, capsules, powders, solutions, suspensions, or emulsions.
- the miR-422a mimic reagent in context of the invention is advantageously formulated in a pharmaceutical composition, together with a pharmaceutically acceptable carrier.
- “Pharmaceutically” or “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate.
- a pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
- compositions for example, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the patient, etc.
- compositions of the invention can be formulated for a topical, oral, intraocular, intravenous, intramuscular or subcutaneous administration and the like.
- the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
- vehicles which are pharmaceutically acceptable for a formulation capable of being injected.
- These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.
- the doses used for the administration can be adapted as a function of various parameters, and in particular as a function of the mode of administration used, of the relevant pathology, or alternatively of the desired duration of treatment.
- the daily dosage of the products may be varied over a wide range from 0.01 to 1000 mg per adult per day.
- the compositions contain 0.01 , 0.05, 0.1 , 0.5, 1 .0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated.
- a medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient, more preferably from 1 mg to about 60 mg of the active ingredient.
- An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day, more preferably, from 1 mg/kg to 50mg/kg.
- the present invention also refers to a method for treating HNSCC in a subject in need thereof, comprising the steps of:
- the present invention refers to a method for treating HNSCC in a subject in need thereof, comprising the steps of:
- the measured expression level of the micro-RNA miR-422a determined in a) is lower than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is lower than the miR-21 reference value, or if the measured expression level of the micro-RNA miR-422a determined in a) is higher than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is higher than the miR-21 reference value,
- a therapeutically effective amount of a pharmaceutical composition comprising a miR-422a mimic reagent, a CD73 inhibitor and/or a treatment intensification.
- the present invention refers to a method for treating HNSCC in a subject in need thereof, comprising the steps of:
- the measured expression level of the micro-RNA miR-422a determined in a) is lower than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is lower than the miR-21 reference value, or
- the measured expression level of the micro-RNA miR-422a determined in a) is higher than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is higher than the miR-21 reference value, and
- a therapeutically effective amount of a pharmaceutical composition comprising a miR-422a mimic reagent, a CD73 inhibitor and/or a treatment intensification.
- composition comprising a miR-422a mimic reagent is as defined herein above in the section "composition and therapeutic applications”.
- an effective amount preferably a therapeutically effective amount of a miR-422a mimic reagent of the invention, or a CD73 inhibitor is administered.
- an “effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result.
- the effective amount may vary according to the drug with which the miR-422a mimic reagent and/or the CD73 inhibitor is co-administered.
- a "therapeutically effective amount" of a miR-422a mimic reagent in context of the invention and/or a CD73 inhibitor may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the miR-422a mimic reagent and/or the CD73 inhibitor to elicit a desired therapeutic result.
- a therapeutically effective amount encompasses an amount in which any toxic or detrimental effects of the miR-422a mimic reagent and/or the CD73 inhibitor are outweighed by the therapeutically beneficial effects.
- a therapeutically effective amount also encompasses an amount sufficient to confer benefit, e.g., clinical benefit.
- CD73 inhibitor herein refers to molecules having an inhibitory effect on CD73 activity.
- inhibitor refers to any statistically significant decrease in biological activity, including full blocking of the activity.
- inhibitor can refer to a decrease of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% in biological activity.
- the term refers to the ability of a CD73 inhibitor to statistically significantly decrease the 5'-nucleotidase activity of CD73 (catabolizing the hydrolysis of adenosine monophosphate, AMP, to adenosine), relative to the CD73-mediated 5'-nucleotidase activity in an untreated (control) cell.
- the cell which expresses CD73 can be a naturally occurring cell or cell line (e.g., a cancer cell) or can be recombinantly produced by introducing a nucleic acid encoding CD73 into a host cell.
- an anti-CD73 antibody or antigen-binding fragment thereof can statistically significantly decrease the 5'-nucleotidase activity of a soluble form of CD73 in a biological fluid.
- the CD73 inhibitor is a CD73 binding molecule or anti- adenosine receptor binding molecules.
- the anti-CD73 binding molecule may be selected from the group constituted of anti-CD73 antibody, antigen-binding fragment of an anti-CD73 antibody and anti-CD73 drugs.
- anti-CD73 clone TY/23 Stagg et al., 201 1 , Cancer research 71 , 2892-2900
- anti-CD73 clone AD2 Terp et al. The journal of immunology, 2013 oct
- antibody MEDI9447 JC Geoghegan et al., MAbs. 2016 Feb 8:1 -14
- antibody 7G2 Sabastian FM Hausler et al., Am J Transl Res. 2014; 6(2):129-139.
- Any known efficient anti-CD73 drugs may be used, for example the molecule Adenosine 5'-(a,3-methylene)diphosphate (CAS 3768-14-7).
- Any known efficient anti-adenosine receptor binding molecule, also called inhibitors of adenosine receptors, may be used, such as SCH58261 (Jin et al 2010, Journal of clinical investigation 121 , 2371 -2382)
- a “treatment intensification” herein refers to increase total dose of radiotherapy, to induction chemotherapy, to alternative radiation technics such as carbon hadrontherapy, radical surgery or concomitant biotherapy.
- Induction chemotherapy herein refers to a chemotherapy given to reduce tumor burden before surgery and/or radiotherapy.
- Chemotherapy is usually given to HNSCC subjects that have, preferably, metastasis.
- subjects having a poor prognosis, i.e. a high risk of relapse might be treated with an induction chemotherapy to avoid relapse.
- Carbon hadrontherapy refers to a form of external beam radiotherapy using carbon ions particles for cancer treatment.
- Radar surgery refers to the removal of a tumor or mass and ancillary lymph nodes that may drain the mass for diagnostic and/or treatment purposes, as in radical mastectomy.
- Biotherapy refers to a treatment that uses substances made from living organisms to treat a disease. These substances may occur naturally in the body or may be made in the laboratory. Some biotherapies stimulate or suppress the immune system to help the body fight cancer, infection, and other diseases. Other biotherapies attack specific cancer cells, which may help keep them from growing or kill them. They may also lessen certain side effects caused by some cancer treatments. Types of biotherapy include immunotherapy (such as vaccines, cytokines, and some antibodies), gene therapy, and some targeted therapies.
- the present invention also refers to a method for reducing expression levels of
- CD73 in a subject comprising administering a composition comprising a miR- 422a mimic reagent as defined herein above, thereby reducing expression levels of CD73 in a subject.
- the invention further refers to a method of treating HNSCC in a subject in need thereof, the method comprising administering a therapeutically effective amount of a miR- 422a mimic reagent as defined herein above, thereby treating HNSCC in the subject.
- the term “and/or” is a grammatical conjunction that is to be interpreted as encompassing that one or more of the cases it connects may occur.
- the wording "qualitative and/or quantitative detection” in the phrase “the term “determining” includes qualitative and/or quantitative detection” indicates that the term determining may refer to qualitative detection, or to quantitative detection, or to qualitative detection and to quantitative detection.
- SEQ ID NO: 1 shows the mRNA nucleotide sequence of CD73L as available from the UCSC database under accession number NM 002526.
- SEQ ID NO: 2 shows the amino acid sequence of CD73L as available from the NCI database under the reference number ABA39834.1 .
- SEQ ID NO: 3 shows the mRNA nucleotide sequence of CD73S as available from the UCSC database under accession number NM_001204813.
- SEQ ID NO: 4 shows the amino acid sequence of CD73S as available from the NCI database database under accession number NP 001 191742.1 .
- SEQ ID NO: 5 shows the nucleotide sequence of the gene encoding the microRNA-422a as available from the NCBI database under the Gene ID number 494334 as accessible on 17 May 2016.
- SEQ ID NO: 6 shows the nucleotide sequence of the 90bp long pre microRNA-422a as available from the miRBase database under Reference Sequence number MI0001444 as accessible on 17 May 2016.
- SEQ ID NO: 7 shows the nucleotide sequence of the mature microRNA-422a as available from the miRBase database under Reference Sequence number MIMAT0001339 as accessible on 17 May 2016.
- SEQ ID NO: 8 shows the nucleotide sequence of the forward primer CD73-1/2-F consisting of the nucleic acid sequence 5'-TTATTGCACTGGGACATTCG-3' which specifically hybridizes to CD73L and CD73S.
- SEQ ID NO: 9 shows the nucleotide sequence of the reverse primer CD73-1 /2-R consisting of the nucleic acid sequence 5'- AGGCCTGGACTACAGGAACC -3' which specifically hybridizes to CD73L and CD73S.
- SEQ ID NO: 10 shows the nucleotide sequence of the forward primer CD73S-2-F consisting of the nucleic acid sequence 5'-TGATGAACGCAACAATGGAAT-3' which specifically hybridizes to CD73S.
- SEQ ID NO: 11 shows the nucleotide sequence of the reverse primer CD73S-2-R consisting of the nucleic acid sequence 5'-TCTGGAACCCATCTCCACCA-3' which specifically hybridizes to CD73S.
- SEQ ID NO: 12 shows the nucleotide sequence of the forward primer RPL19-F consisting of the nucleic acid sequence 5'-GGCACATGGGCATAGGTAAG-3' which specifically hybridizes to RPL19.
- SEQ ID NO: 13 shows the nucleotide sequence of the reverse primer RPL19-R consisting of the nucleic acid sequence 5'-CCATGAGAATCCGCTTGTTT-3' which specifically hybridizes to RPL19.
- SEQ ID NO: 14 shows the nucleotide sequence of the forward primer TBP-F consisting of the nucleic acid sequence 5'-TATAATCCCAAGCGGTTTGC-3' which specifically hybridizes to TBP.
- SEQ ID NO: 15 shows the nucleotide sequence of the reverse primer TBP-R consisting of the nucleic acid sequence 5'-CACAGCTCCCCACCATATTC-3' which specifically hybridizes to TBP.
- SEQ ID NO: 16 shows the nucleotide sequence of the forward primer GAPDH-F consisting of the nucleic acid sequence 5'-GAGTCAACGGATTTGGTCGT-3' which specifically hybridizes to GAPDH.
- SEQ ID NO: 17 shows the nucleotide sequence of the reverse primer GAPDH-R consisting of the nucleic acid sequence 5'-TTGATTTTGGAGGGATCTCG-3' which specifically hybridizes to GAPDH.
- SEQ ID NO: 18 shows the nucleotide sequence of the 71 bp long pre-microRNA-21 as available from the NCBI database under NCBI Reference Sequence number: MI0000077 as accessible on 20 May 2016.
- SEQ ID NO: 19 shows the nucleotide sequence of the 20bp long mature microRNA-21 as available from the miRBase database under Reference Sequence number MIMAT0000076 as accessible on 20 May 2016.
- SEQ ID NO: 20 shows the nucleotide sequence of the forward primer CD73L-1 -F consisting of the nucleic acid sequence 5'- ctcctctcaatcatgccgct -3' which specifically hybridizes to CD73L.
- SEQ ID NO: 21 shows the nucleotide sequence of the reverse primer CD73L-1 -R consisting of the nucleic acid sequence 5'- caaatgtgcctccaaagggc -3' which specifically hybridizes to CD73L.
- SEQ ID NO: 22 shows the nucleotide sequence of the gene "Hsa-let-7a-1 ", which is one of the precursors encoding the microRNA-let7a as available from the miRbase database under the Gene ID number MI0000060 as accessible on 17 May 2016.
- SEQ ID NO: 23 shows the nucleotide sequence of the gene "Hsa-let-7a-2", which is one of the precursors encoding the microRNA-let7a as available from the miRbase database under the Gene ID number MI0000061 as accessible on 17 May 2016.
- SEQ ID NO: 24 shows the nucleotide sequence of the gene "Hsa-let-7a-3", which is one of the precursors encoding the microRNA-let7a as available from the miRbase database under the Gene ID number MI0000062 as accessible on 17 May 2016.
- SEQ ID NO: 25 shows the nucleotide sequence of the mature microRNA-7a "mature hsa- Let-7a" as available from the miRBase database under Reference Sequence number MIMAT0000062 as accessible on 17 May 2016.
- SEQ ID NO: 26 shows the nucleotide sequence of the gene "hsa-mir-26a-1 ", which is one of the precursors encoding the microRNA-26a as available from the miRbase database under the Gene ID number MI0000083 as accessible on 17 May 2016.
- SEQ ID NO: 27 shows the nucleotide sequence of the gene "hsa-mir-26a-2", which is one of the precursors encoding the microRNA-26a as available from the miRbase database under the Gene ID number MI0000750 as accessible on 17 May 2016.
- SEQ ID NO: 28 shows the nucleotide sequence of the mature microRNA-26 as available from the miRBase database under Reference Sequence number MIMAT0000082 as accessible on 17 May 2016.
- SEQ ID NO: 29 shows the nucleotide sequence of "hsa-let-7e-5p" encoding the microRNA-let-7e as available from the miRbase database under the Gene ID number MI0000066 as accessible on 17 May 2016.
- SEQ ID NO: 30 shows the nucleotide sequence of the mature miR-let-7e "hsa-let-7e-5p", as available from the miRBase database under Reference Sequence number as MIMAT0000066 accessible on 17 May 2016.
- R responders
- NR non-responders
- TCGA Cancer Genome Atlas
- GEO Global Environmental Outlook
- RPKM RNAseqV2 normalized read counts
- RPMM miRNASeq normalized read counts
- the expression data (delta 2 CT method) were normalized against the geometrical mean of three reference genes (Let.7a, miR-26a, LetJe) chosen according to the GeNorm instructions (https://genorm.cmgg.be/).
- ISH In situ hybridization
- miR-422a Custom RT-qPCR were conducted on miR-422a and the three reference genes using specific TaqMan® MicroRNA Assays and the same master mix, on a MxPro 3000 (Agilent).
- In situ hybridization (ISH) against miR-422a was carried out following the instructions of the miRCURY LNA microRNA ISH Optimization kit (Exiqon).
- CD73 quantification 0.5 ⁇ g of total RNA were retro-transcribed using the QantiTect RT kit and qPCR were prepared using the QuantiTect SYBR® Green PCR Kit (ThermoFischer Scientific).
- MirVana microRNA Mimics (ID: MC12541 ) and Inhibitors (ID: MH12541 ) specific for miR-422a, or a Mimic negative control (Ref: 4464058) were transfected under the following conditions for 100 000 cells: 6.7 ⁇ _ of Hiperfect (Qiagen), 0.3 nmol of oligonucleotides in 500 ⁇ _ of final complete medium. Clonogenic assays were conducted as previously described.
- Apoptosis was measured 48 hrs post-transfection, using the Annexin- V and propidium iodide Apoptosis Detection Kit APOAF (Sigma-Aldrich), on an LSRII (Beckman-Coulter) flow cytometer. The number of viable cells was determined by measuring their metabolic activity using the Cell Counting Kit-8 (CCK8) (Sigma-Aldrich).
- Silencer Selected siRNA (Life Technologies): one control and two targeting CD73 (ID: s9735#2; s9734#1 ), under the following conditions for 100 000 cells: 6.7 ⁇ of hiperfect, 12.5 pmol of siRNA in 500 ⁇ - of final complete medium. Two days after transfection, cells were lysed and protein extracted and analyzed by western-blotting as previously published (Bionda C et al. Biochem Pharmacol. 2008; 75(3):761 -772).
- Anti-CD73 (ab124525, Abeam) or anti-GAPDH (H86504M, Interchim) were used as primary antibodies and HRP-linked goat anti-rabbit (sc3837, SantaCruz) or goat anti-mouse (sc2031 , SantaCruz) as secondary antibodies.
- MiR-422a is significantly downregulated in oropharynx tumors from patients who experienced early loco(regional) recurrence.
- the expression level of 384 miRNA was determined by RT-qPCR (TaqMan low density microarray) in 75 stage lll-IV oropharynx tumors (36 from NR and 39 from R), and in 38 adjacent healthy tissues (N) (19 from NR and 19 from R). Overall, 13 miRNA were significantly deregulated in NR versus R (Wilcoxon test, p ⁇ 0.05) and were also predictive of relapse-free survival (RFS) (LogRank test, p ⁇ 0.05) (data not shown). The initial analysis was refined and it was searched for miRNA that could differentiate patients who exclusively experienced local (and not loco-regional) recurrence (Local Rec) from patients who did not recur (R).
- the inventors of the present invention initially evaluated whether the downregulation of miR- 422a was responsible for radio-resistance (as local recurrence is indicative of radio- resistance). To do so, clonogenic assays were carried out (standard test for radiosensitivity measurement, Figure 4) and analyzed cell viability using the CCK8 assay (Figure 5), after transfection and irradiation, but the inventors could not identify any effect of miR-422a modulation on cell sensitivity to X-ray irradiation. Strikingly, one parameter was constantly modified in the clonogenic assays, namely the plating efficiency (PE).
- PE plating efficiency
- the PE corresponds to the proportion of seeded cells able to produce a clone of at least 64 cells, after allowing sufficient time for 6 cellular divisions to occur in control cells.
- a significant decrease in the PE in the miRmim versus the miRCo condition in SCC61 and SQ20B cells was observed, but no modification was noted in HaCaT cells (Figure 6).
- Different hypotheses can account for this decrease in the PE: (i) an increase in basal cell death, (ii) a decrease in the initial cell adhesion, and (iii) a decrease in cell proliferation, as previously reported.
- the inventors first tested the level of spontaneous apoptosis, but observed no significant effect on the modulation of endogenous miR-422a levels in all the three cell lines (Figure 20).
- the maximal impedance signal (at time of full confluence) was measured using the xCELLigence device.
- Figure 7 A significant reduction in the adhesive capacity of cells in the miRmim subgroup in SCC61 and SQ20B cell lines only was noticed ( Figure 7).
- the morphology and the actin cytoskeleton of these cells were altered ( Figure 8), since they displayed either a loss of (SCC61 ) or a disorganized (SQ20B) actin polymerization at the inter-cellular junctions in the miRmim condition.
- the inventors of the present invention confirmed an increase in cell proliferation in the miRinhi condition and a decrease in the miRmim condition. This effect was clearly visible in SCC61 and SQ20B cells, and less noticeable in the case of HaCaT cells (but still significant). These findings suggest that miR-422a induces a combined downregulation of cell adhesion and proliferation, at least in two of the cell lines studied.
- MiR-422a targets the oncogene CD73/NT5E
- CD73 was barely detected in the HaCaT cell line ( Figure 23), the inventors thus focused the subsequent experiments exclusively on the SCC61 and SQ20B cell lines. Thereby, two bands corresponding to the very recently described isoforms of CD73 were observed: the full-length isoform 1 (CD73L, 63kDa) and the short isoform 2 (CD73S, 58 kDa), deprived of the catalytic domain. Isoform 2 is believed to be specifically deregulated in cancers (Snider NT et al. Mol Biol Cell. 2014; 25(25) :4024-4033).
- CD73 knocked-down experiments were conducted. First, the efficiency of the siRNAs at the protein and functional levels were validated ( Figure 23). Next, the adhesive function of CD73 was inquired and as expected, the results confirmed a decrease in the PE in SCC61 and SQ20B cell lines, but not in HaCaT cells, after CD73 knocking down ( Figure 5A). Furthermore, a decrease in cell proliferation was clearly noted in all three cell lines treated by siRNA targeting CD73 ( Figure 14).
- CD73 was recently shown to promote cortical actin polymerization and to increase the membranous localization of E-cadherin, ⁇ -catenin, and Na+K+ ATPase, thereby preserving epithelial integrity (Bowser JL et al. J Clin Invest. 2016; 126(1 ):220-238). This is in agreement with the observation in context of the present invention with regards to an increase in cortical actin polymerization in the miRinhi condition ( Figure 8). To go further, an increase in membranous E-cadherin labelling in SCC61 and SQ20B cell lines treated by miRinh was also noted ( Figure 24 and 25).
- miR-422a and CD73 have the inverse effects on cortical actin polymerization, and on cell adhesion and proliferation.
- CD73/miR-422a modulate cell adhesion and proliferation in a cell-type-specific manner?
- the median expression value of CD73 was set as a threshold to separate patients into "high CD73” or "low CD73” subgroups in our oropharynx cohort such as in the TCGA cohort.
- the inventors extracted expression data from the TCGA database for 255 patients with stage lll-IV tumors of different locations (oral cavity, oropharynx, larynx and pharynx).
- a significant (p 0.018) increase in the risk of recurrence in the "high CD73" subgroup ( Figure 16A and D) was observed.
- miR-422a expression level was available for 465 samples (of which 42 healthy tissues and 423 HNSCC tissues). However, only 5.8% of the samples were positive for miR-422a expression (maybe due to a lower sensitivity of the technic used), though a lower proportion of positive samples was observed in the tumors (4.7%) versus healthy tissues (16.7%), what confirmed our result.
- a biotherapy targeting miR-422a/CD73 may be highly beneficial for patients displaying miR-422aLow/CD73high tumors, to prevent loco-regional recurrence in HNSCC in advanced stages (all locations included).
- CD73S the splice variant of CD73L
- CD73S is expected to bear the same 3'UTR sequence, comprising the miR-422a binding sites. Since CD73S is presumed to play a major role during oncogenesis (Snider NT et al. Mol Biol Cell. 2014; 25(25):4024-4033), the inventors investigated its expression in tumors from the TCGA database and observed a linear correlation between the transcript levels of CD73S and CD73L (in agreement with a co-regulation of both transcripts by miR-422a) (Figure 27).
- miR-422a modulates the expression of both CD73S and CD73L, and CD73S bears the same predictive value (with even better p-value) with regards to RFS in Head and Neck tumors as compared with total CD73.
- MiR-422a is significantly down regulated and MiR21 is significantly upregulated in oropharynx tumors from patients who experienced early loco(regional) recurrence.
- the inventors identified that the combination of miR21 and miR422 testing even improves the stratification of subjects in comparison to miR-422a alone in both cohorts (oropharynx and TCGA), clearly defining three groups with different Disease Free survival (DFS), the poor DFS subgroup with low level of mir-422a and high level of miR-21 , the good DFS subgroup with high level of miR-422a and low level of miR-21 , and the intermediate subgroup (containing the other combinations, Figure 28).
- DFS Disease Free survival
- CD73 for each subgroup (the median expression level of CD73 (RT-qPCR) on the total population of TCGA was used as a threshold). It can be seen that 71 % of subjects having a low level of miR422a and a high level of miR21 are positive for CD73 (Table 5).
- miR-422a expression is significantly downregulated in oropharynx tumors from patients who have experienced early loco(regional) recurrence, as well as in tumor compared to normal tissues.
- MiR-422a downregulation is associated with earlier recurrence in vivo, which may be linked with the stronger cellular adhesion and higher rate of proliferation observed in vitro.
- the inventors have shown that the mRNA, protein and enzymatic activity of the CD73 nucleotidase, which is involved in the oncogenic processes, are modulated by miR-422a, and that CD73 downregulation mimics the effects of miR-422a overexpression.
- miR-422al CD73 has proven the predictive value of miR-422al CD73 regarding the loco-regional recurrence of stage lll-IV tumors in their oropharynx cohort, as well as in the TCGA cohort encompassing different tumor locations. From these observations, it is concluded that miR-422a downregulation promotes local recurrence in stage lll-IV HNSCC, by targeting CD73.
- NT5E/CD73 is an oncogene, which is involved in enzymatic and non-enzymatic activities.
- the adenosine receptor-dependent signaling is used by tumoral cells that overexpress CD73, to facilitate their immune escape (Jin D,et al.
- CD73 is also a signaling and an adhesion protein (Bowser JL et al. J Clin Invest. 2016; 126(1 ):220-238) involved in metastasis (Beavis PA,et al. Proc Natl Acad Sci U S A. 2013; 1 10(36):1471 1 -14716, Terp MG, et al. J Immunol. 2013; 191 (8):4165-4173), neovascularization (Koszatka P, et al. Int J Biochem Cell Biol.
- CD73 overexpression is predictive of a poor prognosis in colorectal, gastric, gallbladder and triple negative breast cancers, as well as in chronic lymphocytic leukemia (for review see (Gao ZW et al. Biomed Res Int. 2014; 2014:460654)).
- the results corroborate the pro-adhesive and pro-proliferative functions of CD73, along with its involvement in treatment resistance.
- a high level of CD73 appeared to be unrelated to the metastatic capacity in our cohort and in the TCGA dataset. Consistently, the results published in the literature are conflictual about the pro-migratory and the pro-metastatic function of CD73.
- the metastatic potential is inversely correlated with CD73 expression and activity.
- Pharmacological inhibition of CD73 reduces adhesion but increases the invasion/migration capacities in vitro (Bowser JL et al. J Clin Invest. 2016; 126(1 ):220-238), and treatment with adenosine (produced by CD73) inhibits cell migration and invasion. More recently, loss of CD73 has been involved in epithelial barrier misstructuration and endometrial tumor progression (Bowser JL et al. J Clin Invest. 2016; 126(1 ):220-238).
- CD73 upregulation (i) the interaction with the host immune function in vivo, (ii) its participation in enzymatic activities versus its function in adhesion/signaling, (iii) the destination of adenosine: receptor fixation (while A1 , A2A and A2B are pro-proliferative, A3 plays pro-apoptotic functions), or intracellular uptake (which inhibits cell growth and favors apoptosis), (iv) the intra-tumoral cellular subtype expressing CD73, (v) and the isoform that is upregulated.
- CD73S the short isoform
- Miravirsen a drug dedicated to the treatment of hepatitis C developed by Santaris Pharma, has completed a phase 2 trials.
- targeting miR-422a with this kind of molecules could represent a good therapeutic strategy for treating patients with an unfavorable-predicted response to standard radio(chemo)therapy, on the basis of their miR-422a value.
- FIG. 1 Graph demonstrating that the level of expression of miR-422a is downregulated in oropharynx tumors from patients who have experienced early loco-regional recurrence.
- the normalized expression level of miR-422a was determined on a TaqMan low density array (TLDA technology).
- MiR-422a is downregulated in tumor samples (R and NR) compared to healthy adjacent tissues (N), and in the NR versus the R subgroups (A). It is especially downregulated in NR patients exclusively with local recurrence (Local Rec.) (B). Wilcoxon tests were conducted, * p ⁇ 0.05, ** p ⁇ 0.01 , *** p ⁇ 0.001 .
- Figure 2 Kaplan Meier representations of Relapse Free Survival in oropharynx tumors from patients who have experienced early loco-regional recurrence. Loco- regional recurrence (A) or only local recurrence (B) are considered.
- Figure 3 Images of miR-422a localization by in situ hybridization in oropharynx tumors from patients who have experienced early loco-regional recurrence. Representative images (x200 magnification) of miR-422a localization by in situ hybridizationon 4 samples with low (D), high (A) or intermediate levels (B and C) of miR- 422a expression, as determined by RT-qPCR. An enhanced image of the outlined area (Bottom) shows an intense cytosolic and nuclear labelling in the high condition, and a faint cytosolic labelling in the "Low” condition, with intermediate levels in the "Medium” condition.
- FIG. 4 MiR-422a does not modulate cell response to irradiation.
- Clonogenic assays were conducted on three cell lines SCC61 (A), SQ20B (B) and HaCaT (C), transfected with either miRCo (control), miRmim (mimic) or miRinhi (inhibitor). The survival fraction is plotted as a function of the dose of X-rays irradiation.
- FIG. 5 MiR-422a does not modulate cell response to irradiation.
- Cells SCC61 (A), SQ20B (B) and HaCaT (C)
- SCC61 (A), SQ20B (B) and HaCaT (C) were irradiated (10Gy) 24hr post-transfection, and cell viability was determined using the CCK8 assay 5 days after irradiation (percentage of the non-irradiated condition are shown). No significant statistical differences were observed in both experiments.
- FIG. 6 MiR-422a modulates adhesion of SCC61 and SQ20B cells. Representation of the plating efficiency.
- Cells (SCC61 (A), SQ20B (B) and HaCaT (C)) were transfected with the different constructs and plated at a low density. All of the clones were fixed and counted, once the 64-cell stage had been reached in the miRCo condition. For each condition the ratio between the number of clones and the number of plated cells is shown.
- Figure 7 MiR-422a modulates adhesion of SCC61 and SQ20B cells. The strength of adhesion (maximal impedance signal) was determined using the xCELLigence assay. Cells (SCC61 (A), SQ20B (B) and HaCaT (C)) were transfected with the different constructs and plated, the signal was determined at full cellular confluence after 48 hr to 72 hr.
- FIG. 8 MiR-422a modulates adhesion of SCC61 and SQ20B cells. Fluorescence imaging of actin cytoskeleton and nucleus was conducted 48hr after transfection of the three cell lines (X40 magnification) (SCC61 (A), SQ20B (B) and HaCaT (C)).
- Figure 9 Graph demonstrating the correlation between CD73 expression level and miR-422a expression levels.
- the CD73 expression level was determined by RT-qPCR from the same samples as those used for measuring miR-422a expression levels, and was significantly inverse correlated with miR-422a.
- Figure 10 Representative images of immunohistochemically labelled CD73.
- the images show in grey the immunohistochemically labelled CD73 (original brown labelling), on the same samples used for ISH of Figure Figure 3, with low (A), high (D) or intermediate levels of expression of NT5E (B and C) (and High (A), medium (B and C), and low levels of miR-422a (D), respectively, as determined by RT- qPCR).
- Figure 11 Graphs demonstrating the impact of 422a expression levels on CD73 expression. Two days after transfection with the different miRNA constructs, cells were lysed and analyzed for CD73 and GAPDH content by Western blot analysis. The two isoforms (CD73 Long and short) are shown. The signal intensity was determined and normalized (GAPDH) for each isoform of CD73, the total intensity was set at 1 for the miPtCo condition.
- Figure 12 Graphs demonstrating the impact of 422a expression levels on CD73 enzymatic activity. Measurement of the enzymatic activity of CD73. Two days after transfection, cells were incubated with 2mM of AMP for 1 hr and the final concentration of the produced inorganic phosphate (Pi) was measured in the medium. The threshold for detecting Pi was determined and is represented by a dashed line. Wilcoxon tests were conducted, * p ⁇ 0.05, ** p ⁇ 0.01 , *** p ⁇ 0.001 .
- Figure 13 The silencing of CD73 phenocopies miR-422a mimic effect.
- the three cell lines SCC61 (A), SQ20B (B) and HaCaT (C)) were transfected with an irrelevant siRNA (Si Co) or with two siRNA targeting CD73 (Si#1 and Si#2), and plated in different conditions. The plating efficiency was determined for A, B and C.
- Figure 14 The silencing of CD73 phenocopies miR-422a mimic effect.
- the three cell lines SCC61 (A), SQ20B (B) and HaCaT (C)
- Si Co irrelevant siRNA
- Si#1 and Si#2 two siRNA targeting CD73
- Cell proliferation was quantified using the CCK8 assays at days 4 and 6 post- transfection.
- the luminescent signal is normalized for 1 000 seeded cells. Wilcoxon tests were conducted, * p ⁇ 0.05, ** p ⁇ 0.01 , *** p ⁇ 0.001 .
- FIG. 15 MiR-422a and CD73 expression levels are predictive of loco(regional) recurrence.
- RFS Relapse Free Survival
- FIG. 16 Kaplan Meier representation of Relapse Free Survival (RFS) in the TCGA HNSCC Cohort.
- RFS Relapse Free Survival
- was extracted from the TCGA database, for patients suffering from head and neck tumors (not restricted to oropharynx), at stages III and IV (N 255).
- LogRank tests were conducted to calculate the p-values.
- FIG 17 Kaplan Meier representation of Relapse Free Survival (RFS) in the TCGA HNSCC Cohort.
- LogRank tests were conducted to calculate the p-values.
- Figure 18 Confirmation of miR-422a downregulation in tumors from non-responder patients using custom-made RT-qPCR.
- FIG. 19 Basal characteristic of SCC61 , SQ20B and HaCaT cell lines. Basal expression levels of miR-422a (reference genes: Let.7a, miR-26a and Let.7b) (A) and CD73 (reference genes: GAPDH, RPL 19 and TBP) (B), as well as the basal plating efficiency (C), were analyzed in the three cell lines.
- miR-422a reference genes: Let.7a, miR-26a and Let.7b
- CD73 reference genes: GAPDH, RPL 19 and TBP
- C basal plating efficiency
- FIG. 20 MiR-422a modulates cell proliferation but does not influence cell viability.
- Flow cytometry determination of Annexin-V and propidium iodide (PI) negative (ANN-/IP-) population was conducted two days after transfection of the cells (SCC61 (A), SQ20B (B) and HaCaT (C)) with the different constructs (miRCo, miRinhi, miRmim).
- FIG. 21 MiR-422a modulates cell proliferation but does not influence cell viability.
- FIG. 22 Inverse correlation of MiR-422a and NTE5E/CD73.
- MiR-422a and NTE5E/CD73 expression levels are inversely correlated
- MiR-422a and NTE5E/CD73 expression levels are inversely correlated in an independent HNSCC cohort from the GEO dataset.
- Expression data of miR-422a and CD73 were extracted from the GSE33232 SuperSeries of HNSCC.
- FIG 23 Two specific siRNA efficiently inhibit CD73 expression and activity.
- Cells were transfected either with an irrelevant siRNA (Si Co) or with two different siRNAs (Si#1 and Si#2) targeting CD73.
- Two days after transfection the enzymatic activity of CD73 was determined after 3h of incubation with 2mM ATP (A), and the cellular content of CD73 was determined by Western blot analysis (20 ⁇ g of lysate was used for the SCC61 , 35 ⁇ g for SQ20B and 70 ⁇ g for HaCaT) (B).
- Figure 24 Inhibition of miR-422a intensifies the recruitment of F-actin and E- cadherin at the cellular cortex. Two days after transfection of SCC61 cell lines, by miRmim, miRinh or miRCo, cells were fixed and labelled for nuclei (blue, first column), actin (green, second column) and E-cadherin (red, third column). An overlay is shown on the last column.
- Figure 25 Inhibition of miR-422a intensifies the recruitment of F-actin and E- cadherin at the cellular cortex.
- Figure 26 CD73 knocking down only slightly impairs miR422a expression in SCC61 , SQ20B and HaCaT cell lines.
- the level of expression of miR-422a (reference genes: Let.7a, miR-26a and Let.7b) (A) and of CD73 (reference genes: ACTIN and TBP) (B) was assessed two days after transfection by a control siRNA (Si Co) or two siRNA targeting CD73 (Si#1 and Si#2).
- Figure 27 The expression of the short and long isoforms of CD73 are correlated in a linear manner. The level of expression of CD73S and CD73L extracted from the TGCA cohort, are depicted. Spearman-calculated p-value is given.
- Figure 28 Representation of Disease Free survival (DFS) as a function of miR- 21/miR422a subgrouping.
- FIG. 29 Representation of Disease Free survival (DFS) as a function of miR-21 or miR422a subgrouping.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention concerns the identification of new biomarkers in head and neck squamous cell carcinoma (HNSCC). Due to the diversity of HNSCC predicting the therapeutic response in patients is difficult. By initially studying a cohort off 75 stage III-IV oropharynx tumors, followed by the study of a larger cohort, the inventors identified miR-422a as a biomarker for negative outcome in HNSCC tumours. The inventors further identified the additional biomarker miR-21, which in combination with miR422a, further improves the predictive value of miR-422a. The present invention thus refers to a method of selecting a subject who suffers from head and neck squamous cell carcinoma (HNSCC), a method of determining the chance of relapse-free survival and a method for predicting a clinical outcome in response to a treatment of head and neck squamous cell carcinoma (HNSCC) in a subject suffering from head and neck squamous cell carcinoma (HNSCC). The present invention further refers to a kit and a pharmaceutical composition comprising a miR-422a mimic reagent.
Description
PROGNOSTIC RELEVANCE OF MIR-422a IN HEAD AND NECK SQUAMOUS CELL
CARCINOMA
The present invention concerns reduced expression levels of the microRNA-422a (miR-422a) present in head and neck squamous cell carcinoma (HNSCC) that are associated with an increased risk of relapse, in particular early loco-regional relapse. The detection of the reduced expression levels of miR-422a, in particular in combination with miR21 , allows identifying subjects having a reduced chance of relapse-free survival and, for example, selecting them for a more adapted therapy, such as, for example an anti- CD73 therapy. The present invention thus refers to a method of selecting a subject who suffers from head and neck squamous cell carcinoma (HNSCC), a method of determining the chance of relapse-free survival and a method for predicting a clinical outcome in response to a treatment of head and neck squamous cell carcinoma (HNSCC) in a subject suffering from head and neck squamous cell carcinoma (HNSCC). The present invention further refers to a kit to implement said methods, a pharmaceutical composition comprising a miR-422a mimic reagent and the invention further refers to uses of nucleic acids specifically hybridizing to a CD73 nucleic acid sequence, to a miR-422a nucleic acid sequence and/or to a miR-422a nucleic acid sequence for the methods of the invention. Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide. While tumors in stage l-ll are curable, two thirds of patients have tumors in advanced stages (lll-IV) at the time of diagnosis, and despite a treatment combining radio(chemo)therapy and surgery (when possible), nearly 80% will relapse within two years, due to their frequent radio(chemo)resistance. As a result, the 5-year overall survival (OS) rate is currently under 50%. More aggressive therapies, such as induction chemotherapy, carbon hadrontherapy, radical surgery or concomitant biotherapy, are available; however, their prescription without the support of predictive biomarkers has failed to improve survival but has increased toxicity. Hence, the identification of reliable prognosis/predictive biomarkers has been a matter of intense research in the last decade.
The initially strategy was to prescribe intensified therapy to patients with a poor- predicted outcome. Meanwhile, dose de-escalation could be envisaged for patients with a good-predicted outcome to reduce the frequency of debilitating side effects (difficulties in swallowing, breathing, eating...), induced by the standard treatment. In this field, the Human Papilloma Virus (HPV) infection - known to be predictive of good outcome - is more and more considered as a marker for dose de-escalation, with encouraging results
considering reduced toxicity (NCT01530997). However, treatment intensification based on HPV stratification may not be an adequate treatment strategy, since intensity-modulated radiation therapy (IMRT) improves the survival irrespective of the HPV status, and biomarker for dose intensification are awaited.
Studies on functional biomarkers have highlighted the importance of biomarkers for hypoxia and positron emission tomography (PET) imaging, for prognosing, but they have so far not been routinely implemented in clinical applications.
The difficulty is that HNSCC are heterogeneous tumors with different locations (oral cavity, oropharynx, nasopharynx, larynx and hypopharynx) and different biological histories and risk factors (viral infection, alcohol/tobacco intoxication...). Hence, dealing with the tumoral heterogeneity of these cancers is challenging. Recently, extensive genomic and transcriptomic (meta)analyses have characterized four molecular subclasses of HNSCC: Basal, Classical, Mesenchymal and Atypical. This signature has paved the way for the development of personalized treatments, but cannot, as such, be translated into clinical routine tests.
Aim of the present invention is therefore to provide a prognosis and predictive marker in HNSCC which allows, on the one hand, prescribing intensified treatments based on standard chemo-radiotherapy approaches, and, on the other hand, is further associated with a novel therapeutic target that allows an improved treatment of HNSCC, in particular, an improved treatment in subjects suffering from HNSCC that have a negative prediction for the clinical outcome of HNSCC when being submitted to the standard HNSCC treatment.
MicroRNA (miRNA) is a good candidate for such a strategy, since it can be easily analyzed in biological fluids and can be directly targeted by innovative therapies. Indeed, 6 clinical trials evaluating an anti-miR-122 strategy are on-going in the context of hepatic diseases, and among them one has already entered phase II testing (Santis Pharma Corp.). Furthermore, the identification of microRNA targets provide the opportunity to develop more conventional pharmacological approaches. Regarding the companion tests, these small RNA molecules are efficiently retrieved from (fixed or frozen) tumor samples or from biological fluids, such as blood, urine or saliva, and display high levels of stability over time and tissue specificity. Four miR-based panels dedicated to the diagnosis of lung and kidney cancers are already commercialized for clinical use (Rosetta Genomics).
With regards to HNSCC, microRNA signatures with a prognostic or a diagnostic significance have recently been identified, but need to be confirmed by conducting independent studies. Hence, the heterogeneity in tumor location is a limiting factor in
conducting such molecular studies to identify miRNAs as biomarkers in the case of HNSCC.
To circumvent such limitations, the inventors of the present invention used a two- step approach wherein they identified the biomarker miR-422a and its target CD73 for HNSCC treatment strategies. The inventors initially identified the biomarker miR-422a and its target CD73 in a small yet highly homogenous cohort of patients in a step i), who were selected according to the location of the HNSCC, followed by (ii) confirming the biomarker miR-422a and its target CD73 in a larger HNSCC cohort encompassing different tumor locations.
Therefore, the inventors of the present invention targeted the oropharynx in step i) which is associated with a poor clinical outcome. While the frequency of hypopharynx and larynx tumors is decreasing, due to public policies against alcohol/tobacco consumption, the incidence of oropharynx tumors has gradually risen in the past two decades. Most of the oropharynx tumors in advanced stage are radio(chemo)resistant and recur within the first two years post-treatment, giving rise to secondary cancers, metastases or loco- regional recurrences. Since the initial intra-tumoral context, which gives rise to secondary tumors, metastasis or to loco-regional recurrence is expected to differ, and could be a cause of molecular heterogeneity, the inventors included in their study 75 stage lll-IV oropharynx tumors without relapse (R) (no recurrence within the first two years) or with loco-regional relapse (non-responder, NR) within two years post-treatment.
The inventors identified surprisingly the downregulation of miR-422a in NR tumors, thus identifying miR-422a as a biomarker for negative outcome in HNSCC tumours. The inventors further demonstrated that miR-422a inhibition in vitro increases cell proliferation and adhesion, which thus, firstly, explains the mechanism behind the methods of the invention, according to which downregulation of miR-422a indicates a higher risk of recurrence, in particular early loco-regional recurrence, for subjects suffering from HNSCC. Secondly, by demonstrating that miR-422a inhibition in vitro increases cell proliferation and adhesion the inventors of the present invention validated miR-422a itself as a therapeutic target.
Moreover, the inventors identified the biomarker miR-21 , which in combination with miR422a, even further improves the predictive value of miR-422a, in the oropharynx and TCGA cohorts, as demonstrated in the examples contained in the present application.
Furthermore, the inventors identified the CD73/NT5E oncogene as target of miR- 422a. Indeed, modulation of the endogenous level of miR-422a inversely influences the expression and the enzymatic activity of CD73. Moreover, knocking down CD73 mimics the effects of miR-422a upregulation. Importantly, in tumors, miR-422a and CD73
expression levels are inversely correlated, and both as demonstrated by the inventors of the present invention are predictive of relapse free survival - especially considering loco(regional) recurrence - in two independent cohorts of advanced oropharynx or HNSCC (N=255) tumors. The inventors of the present invention thus reported, for the first time, that MiR-422a and its target CD73 are involved in early loco(regional) recurrence of HNSCC tumors and are new targets for personalized medicine.
Detailed description of the invention
"Head and neck cancer" is a cancer that starts in the lip, oral cavity (mouth), nasal cavity (inside the nose), paranasal sinuses, pharynx, larynx or parotid glands. 90% of head and neck cancers are squamous cell carcinomas, called head and neck squamous cell carcinomas (HNSCC).
"Head and neck squamous cell carcinomas (HNSCC)" also called "squamous cell carcinoma of the head and neck (SCCHN)" thus arises from squamous cells in the head and neck region. In the following head and neck squamous cell carcinomas will be mainly referred to as HNSCC.
"Squamous cells" are found in the outer layer of skin and in the mucous membranes, which are the moist tissues that line body cavities such as the airways.
HNSCC is classified by its location: it can occur in the mouth (oral cavity), the middle part of the throat near the mouth (oropharynx), the space behind the nose (nasal cavity and paranasal sinuses), the upper part of the throat near the nasal cavity (nasopharynx), the voicebox (larynx), or the lower part of the throat near the larynx (hypopharynx).
Accordingly, in one embodiment, the HNSCC is selected from the group constituted of tumor in the oral cavity, tumor in the nasal cavity, tumor in the paranasal sinuses, nasopharynx tumor, larynx tumor, hypopharynx tumor and oropharynx tumor, preferably oropharynx tumor.
Depending on the location, the cancer can cause abnormal patches or open sores (ulcers) in the mouth and throat, unusual bleeding or pain in the mouth, sinus congestion that does not clear, sore throat, earache, pain when swallowing or difficulty swallowing, a hoarse voice, difficulty breathing, or enlarged lymph nodes.
HNSCC can metastasize to other parts of the body, such as the lymph nodes or lungs. Once metastasized, the cancer has a worse prognosis.
HNSCC, during diagnosis, is preferably classified into different stages, mainly stages I, II, III and IV.
In one embodiment, the HNSCC in context of the present invention is a stage III or stage IV HNSCC.
The term "stage" from the wording "stage I, II, II I and IV" herein refers to clinical stages.
Methods to determine the different clinical stages (I, II, III, and IV) of HNSCC are known to the skilled in the art and the stages are typically determined using, for example, the tumor-node-metastasis (TNM) staging system.
Accordingly, in one embodiment, stage I, II, III or stage IV HNSCC herein refers to stage I, II, III or stage IV HNSCC as defined by the TNM staging system.
"Tumor-node-metastasis staging system" or "TNM staging system" in context of the present invention refers to a staging system first reported by Pierre Denoix in the 1940s, which is simply an anatomic staging system that describes and evaluates three primary factors relevant for the treatment: Tumor (T), Node (N) and Metastasis (M), wherein Tumor (T) refers to the size of the primary tumor and to which, if any, tissues in the oral cavity and oropharynx the cancer has spread; Node (N) describes the involvement of lymph nodes near the primary tumor. Lymph nodes are small, bean- shaped clusters of immune system cells that are a key to fighting infections and are usually one of the first sites in the body to which cancer spreads. Metastasis (M) indicates whether the cancer has spread (metastasized) to other areas of the body. With oral cancer, for example, the most common site of metastases is the lungs, followed by the liver and bones. The TNM staging system thus describes the anatomic extent of the primary tumor as well as the involvement of regional lymph nodes and distant metastasis. The International Union Against Cancer (UlCC) has established a structured process for continuous improvement of said TNM classification. In one example, the TNM staging system in context of the present invention refers to the sixth edition of the TNM staging system as further described, for example, in the article of Patel SG, Shah JP, 2005, CA Cancer J Clin. 55(4):242-258 or, for example, on the webpage https://cancerstaging.org/references-tools/Pages/What-is-Cancer-Staging.aspx, as accessible on 25 May 2016.
For instance, stages of the HNSCC are typically determined by an experienced physician using physical examination, including endoscopy, if appropriate, typically combined with medical imaging to record the precise local (T), regional nodal (N), and distant (M) extend of the tumor. The term "nucleic acid" as herein used generally refers to at least one molecule or strand of DNA, RNA, miRNA or a derivative or mimic thereof, comprising at least one
nucleobase, such as, for example, a naturally occurring purine or pyrimidine base found in DNA (e.g., adenine "A," guanine "G," thymine "T," and cytosine "C") or RNA (e.g. A, G, uracil "U," and C). The term "nucleic acid" encompasses the terms "oligonucleotide" and "polynucleotide".
As it will be appreciated by those skilled in the art, the depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. As it will also be appreciated by those skilled in the art, many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. As it will also be appreciated by those skilled in the art, a single strand nucleic acid, such as, a probe or a primer, may hybridize to the target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe or a primer that hybridizes under stringent hybridization conditions to a target sequence.
The term "oligonucleotide" refers to at least one molecule of between about 3 and about 100 nucleobases in length.
The term "polynucleotide" refers to at least one molecule of greater than about 100 nucleobases in length. These definitions generally refer to at least one single-stranded molecule, but in specific embodiments will also encompass at least one additional strand that is partially, substantially or fully complementary to the at least one single-stranded molecule. Thus, a nucleic acid may encompass at least one double-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a strand of the molecule.
"Gene" used herein may be a genomic gene comprising transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (e.g., introns, 5'- and 3'-untranslated sequences). The coding region of a gene may be a nucleotide sequence coding for an amino acid sequence or a functional RNA, such as long and short non-coding RNA (as an example : tRNA, rRNA, catalytic RNA, and miRNA). A gene may also be an mRNA or cDNA corresponding to the coding regions (e.g., exons and miRNA) optionally comprising 5'- or 3'-untranslated sequences linked thereto. A gene may also be an amplified or synthetic nucleic acid molecule comprising all or a part of the coding region and/or 5'- or 3'-untranslated sequences linked thereto.
The term "stringent condition" or "high stringency condition" is as defined herein below in the section "Use and Kit".
As used herein, the term "variant" denotes nucleic acid sequences that have at least about 80% nucleic acid sequence identity with a nucleic acid sequence disclosed
herein. Preferably, a variant nucleic acid sequences will have at least about 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% amino acid sequence identity to a nucleic acid sequence or a fragment of a nucleic acid sequence as disclosed herein. Nucleic acid acid sequence identity is defined as the percentage of nucleic acids in the variant sequence that are identical with the nucleic acids in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Sequence identity may be determined over the full length of both variant and reference nucleic acid sequences.
In the context of the present application, the "percentage of identity" is calculated using a global alignment (i.e. the two sequences are compared over their entire length). Methods for comparing the identity of two or more sequences are well known in the art. The "needle" program, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970 J. Mol. Biol. 48:443-453) to find the optimum alignment (including gaps) of two sequences when considering their entire length, may for example be used. The needle program is for example available on the ebi.ac.uk world wide web site. The percentage of identity in accordance with the invention is preferably calculated using the EMBOSS::needle (global) program with a "Gap Open" parameter equal to 10.0, a "Gap Extend" parameter equal to 0.5, and a Blosum62 matrix (for the alignment of proteins) or DNAfull (for the alignment of nucleotides).
Subject
In the context of the invention, "subject" refers to an animal, preferably a non- human or human mammal. Examples of non-human mammals include rodents and primates. Most preferably, the subject is a human.
More preferably, the "subject" denotes herein an individual that is under medical care or treatment.
In one embodiment, the subject suffers from HNSCC, wherein HNSCC is as defined herein above.
In one preferred embodiment, the subject suffers from an oropharynx tumor.
In context of the present invention, methods to diagnose HNSCC are known to the skilled in the art and include, but are not limited to, for example, physical examination/blood and urine tests, HPV testing, endoscopy, X-ray/barium swallow, panorex, ultrasound, computed tomography (CT or CAT) scan, magnetic resonance
imaging (MRI), bone scan, positron emission tomography (PET) scan, biopsy and molecular testing of the tumor.
In one particular embodiment, the subject suffers from stage III or IV HNSCC.
In one embodiment, the "subject having HNSCC" has been classified beforehand according to the TNM staging system, as defined herein above.
It will be understood by the skilled in the art that a subject having HNSCC has a tumor.
The tumor of the subject in context of the present invention may or may not be positive for human papillomavirus (HPV).
In one embodiment, stage III and IV HNSCC is further classified into surgically resectable versus unresectable HNSCC.
Determining the expression level
Step a) of the methods of the present invention refers to determining the expression level of the micro-RNA miR-422a.
In a preferred embodiment, step a) of the methods of the present invention further comprises determining the expression level of the human micro-RNA miR-21 .
In some embodiments, said step a) further comprises determining the expression level of CD73.
"Expression level" herein refers to the level of the gene product and thus refers to an amino acid sequence or a mRNA, or long and short non-coding RNA (such as tRNA, rRNA, catalytic RNA, miRNA.
As used herein, the term "determining" includes qualitative and/or quantitative detection (i.e. detecting and/or measuring the expression level) with or without reference to a control or a predetermined value.
As used herein, "detecting" means determining if the biomarker, i.e. microRNA miR-
422a (RNA), miR-21 (RNA) and/or CD73 (mRNA and/or protein), is present or not in a biological sample and "measuring" means determining the amount of said biomarker, i.e. the amount of miR-422a, miR-21 and/or CD73 (mRNA and/or protein) in a biological sample.
It will be understood by the skilled in the art, that the amount of miRNA-422a, miR-
21 and/or CD73 as determined in a biological sample in step a) of the methods of the invention depends on the amount, quality and the representativity of the biological sample used. It will therefore be understood by the skilled in the art that the expression level of miRNA-422a, miR-21 and/or CD73 in step a) typically refers to a normalized expression level.
"Normalization" herein refers to scaling data in such a way that different data sets obtained, for example, for different samples, can be compared. Normalization typically relies on genes whose expression does not change, so-called reference gene(s) or housekeeping gene(s).
"Housekeeping genes" are involved in basic cell maintenance and, therefore, are expected to maintain constant expression levels in all cells and conditions. It will however be understood by the skilled in the art, that the housekeeping genes that are selected for normalization in context of the present invention may typically depend on the nature of the biological sample to be normalized, i.e if the biological sample is saliva, blood, tumor or urine. Furthermore, as it will be understood by the skilled in the art, methods to detect microRNA is different from methods to detect mRNA, accordingly, the housekeeping genes used for normalization of microRNAs preferably encode microRNAs and housekeeping genes used for normalization of mRNAs preferably encode mRNAs.
In one embodiment, at least one gene is used to normalize the expression level of miRNA-422a, miR-21 and/or CD73 in step a).
"At least one gene" herein refers to at least one gene, at least two or three genes, more preferably three genes, most preferably one, two, or three genes, in particular three genes.
As it will be understood by the skilled in the art when three genes are used for normalization, typically the geometrical mean of said three genes is used for normalization.
In one embodiment, the at least one gene used to normalize the expression level of miRNA-422a and/or miR-21 is selected from the group constituted of hsa-miR-143-5p, hsa-miR-574-3p, hsa-miR-15a-5p, hsa-miR-301 a-5p, hsa-miR-140-3p, hsa-miR-192-5p, hsa-miR-27b-5p, hsa-miR-708-5p, hsa-miR-345-5p, hsa-miR-212-5p, hsa-miR-130a-5p, hsa-miR-222-5p, hsa-miR-100-5p, hsa-miR-93-5p, hsa-miR-652-5p, hsa-miR-200b-5p, hsa-miR-324-5p, hsa-miR-339-5p, hsa-miR-200a-5p, hsa-miR-148a-5p, hsa-miR-99b-5p, hsa-miR-205-5p, hsa-miR-141 -5p, hsa-miR-339-3p, hsa-miR-106b-5p, RNU44-5p, hsa- miR-500-5p, hsa-miR-491 -5p, hsa-miR-101 -5p, hsa-miR-130b-5p, hsa-miR-744-5p, hsa- miR-148b-5p, hsa-miR-25-5p, hsa-miR-191 -5p, hsa-miR-181 a-5p, hsa-miR-15b-5p, hsa- miR-27a-5p, hsa-miR-125b-5p, hsa-miR-200c-5p, hsa-miR-126-5p, hsa-miR-20a-5p, hsa- miR-19a-5p, , hsa-miR-29a-5p, hsa-miR-454-5p, hsa-miR-320-5p, hsa-miR-186-5p, hsa- miR-484-5p, hsa-miR-532-3p, hsa-miR-125a-5p, MammU6-5p, hsa-miR-92a-5p, hsa-miR- 374a-5p, hsa-let-7a-5p, hsa-miR-590-5p, hsa-let-7b-5p, hsa-miR-16-5p, hsa-miR-185-5p, hsa-miR-106a-5p, hsa-miR-17-5p, hsa-miR-660-5p, hsa-miR-195-5p, hsa-miR-324-3p, RNU48-5p, hsa-miR-30c-5p, hsa-miR-132-5p, hsa-miR-19b-5p, hsa-let-7d-5p, hsa-miR-
26b-5p, hsa-miR-425-5p, hsa-let-7e-5p, hsa-miR-532-5p, hsa-miR-28-5p, hsa-miR-34a- 5p, hsa-miR-28-3p, hsa-miR-103-5p, hsa-let-7g-5p, hsa-miR-140-5p, hsa-miR-24-5p, hsa- miR-340-5p, hsa-miR-331 -3p, hsa-miR-26a-5p, hsa-miR-374b-5p, hsa-miR-30b-5p.
In one preferred embodiment, the at least one gene, preferably the three genes, used for normalization of miRNA-422a and/or miR-21 is selected from the group constituted of Let.7a, miR-26a, Let.7e.
In a further particular embodiment, the at least one gene, preferably the three genes, used for normalization of CD73 is selected from the group constituted of RPL13A, ACTB, TUBB, RPL19, TBP, and GAPDH, preferably RPL19, TBP, and GAPDH.
The microRNA let-7a, called "hsa-let-7a-5p" or "hsa-let-7a" has three potential precursors (hsa-let-7a-1 , hsa-let-7a-2 and hsa-let-7a-3) for one mature micro-RNA.
"Hsa-let-7a-1 " encoded on chromosome 9 from position 94175957 until 94176036 (reference genome GRCh38), and its gene sequence
5'-UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGA UAACUAUACAAUCUACUGUCUUUCCUA-3' (SEQ ID NO : 22) is available from the miRbase database under the Gene ID number MI0000060 as accessible on 17 May 2016.
"Hsa-let-7a-2" encoded on chromosome 1 1 from position 122146522 until 122146593 (reference genome GRCh38), and its gene sequence
5'-AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGU ACAGCCUCCUAGCUUUCC-3' (SEQ ID NO : 23) is available from the miRbase database under the Gene ID number MI0000061 as accessible on 17 May 2016.
"Hsa-let-7a-3" encoded on chromosome 22 from position 461 12749 until 461 12822 (reference genome GRCh38), and its gene sequence
5'-GGGUGAGGUAGUAGGUUGUAUAGUUUGGGGCUCUGCCCUGCUAUGGGAUAAC UAUACAAUCUACUGUCUUUCCU-3' (SEQ ID NO : 24) is available from the miRbase database under the Gene ID number MI0000062 as accessible on 17 May 2016.
The "mature hsa-Let-7a", 22 bp long micro RNA, has the sequence
5'-UGAGGUAGUAGGUUGUAUAGUU-3' (SEQ ID NO: 25) and is accessible from the miRBase database under Reference Sequence number MIMAT0000062 as accessible on 17 May 2016.
The microRNA miR-26a, called "hsa-miR-26a-5p" or "hsa-miR-26a" has two potential precursors (hsa-miR-26a-1 and hsa-miR-26a-2) for one mature micro-RNA.
"hsa-mir-26a-1 " encoded on chromosome 3 from position 37969404 until 37969480 (reference genome GRCh38), and its gene sequence
5'-GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUA UUCUUGGUUACUUGCACGGGGACGC-3' (SEQ ID NO : 26) is available from the miRbase database under the Gene ID number MI0000083 as accessible on 17 May 2016.
"hsa-mir-26a-2" encoded on chromosome 12 from position 57824609 until 57824692 (reference genome GRCh38), and its gene sequence
5'- GGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCAUCUGUGAGGC CUAUUCUUGAUUACUUGUUUCUGGAGGCAGCU-3' (SEQ ID NO : 27) is available from the miRbase database under the Gene ID number MI0000750 as accessible on 17 May 2016.
The "mature has-miR-26a", 22 bp long micro RNA, has the sequence
5'-UUCAAGUAAUCCAGGAUAGGCU-3' (SEQ ID NO: 28) and is accessible from the miRBase database under Reference Sequence number MIMAT0000082 as accessible on 17 May 2016. The microRNA miR-let-7e, called "hsa-let-7e-5p" or "hsa-let-7e" is encoded by one precursor encoded on chromosome 19 from position 51692786 until 51692864 (reference genome GRCh38), and its gene sequence
5'- CCCGGGCUGAGGUAGGAGGUUGUAUAGUUGAGGAGGACACCCAAGGAGAUCA CUAUACGGCCUCCUAGCUUUCCCCAGG-3' (SEQ ID NO: 29) is available from the miRbase database under the Gene ID number MI0000066 as accessible on 17 May 2016.
The "mature hsa-let-7e-5p", 22 bp long micro RNA, has the sequence 5 GAGGUAGGAGGUUGUAUAGUU-3' (SEQ ID NO: 30) and is accessible from the miRBase database under Reference Sequence number as MIMAT0000066 accessible on 17 May 2016.
The gene "RPL13A" is located on chromosome 19 on position 49,487,554 until
49,492,308 (GRCh38) and its sequence is available from NCBI database under the reference sequence number ID 23521 . It produces a 1 181 bp long transcript, with the reference ID on NCBI database NP_036555.1 .
The gene "ACTB" is located on chromosome 7 on position 5,527,151 until 5,530,709 (GRCh38) and its sequence is available from NCBI database under the reference sequence number ID 60. It produces a 1917 bp long transcript, with the reference ID on NCBI database NM_001 101 .3.
The gene "TUBB" is located on chromosome 6 on position 1 ,976,81 1 until
1 ,980,539 (GRCh38) and its sequence is available from NCBI database under the reference sequence number ID: 203068. It produces a 2824bp long transcript, with the reference ID on NCBI database NM 001293212.1 .
The gene "RPL19" is located on chromosome 17 on position 39,200,283 until 39,204,727, (GRCh38) and its sequence is available from UCSC database under the reference sequence number NM 000981 . It produces a 748bp long transcript, with the reference ID on NCBI database NM_000981 .3
The gene "TBP" is located on chromosome 6 on position 170,554,333 until 170,572,869, (GRCh38) and its sequence is available from UCSC database under the reference sequence number NM 003194. It produces a 1921 bp long transcript, with the reference ID on NCBI database NM_003194.4
The gene "GAPDH" is located on chromosome 12 on position 6,533,927 until
6,538,371 , (GRCh38) and its sequence is available from UCSC database under the reference sequence number NM 002046. It produces a 1421 bp long transcript, with the reference ID on NCBI database NM_002046.5 For instance, the expression level of miRNA-422 and miR-21 was typically normalized against the geometrical mean of, typically, three reference genes, such as
Let.7a, miR-26a, and Let.7e.
For example, the expression level of CD73 is typically normalized against the geometrical mean of, typically, three reference genes, such as RPL 19, TBP, and GAPDH.
Accordingly, in one embodiment, the "expression level" as referred to in context of the present invention is a normalized expression level.
"MicroRNAs" or "miRNAs" as referred to in context of the present invention are short non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. MiRNAs are encoded by a gene and are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs). Pri-miRNAs may form a hairpin structure. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA (20-24 nt long) and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA.
The "MicroRNA-422a" herein called "miR-422a", also called "hsa-mir-422a" refers to the pri-miRNA 422a, pre-miRNA-422a, the mature miRNA-422a and the gene encoding
miRNA-422a, preferably, miR-422a herein refers to the pri-miRNA 422a, pre-miRNA-422a and the mature miRNA-422a, more preferably to the mature miRNA-422a.
The microRNA-422a, called "miR-422a" or "hsa-mir-422a" is encoded on chromosome 15 from position 63,870,930 until 63,871 ,019 (reference to genome hg38/Human) and its gene sequence
5'-GAGAGAAGCACTGGACTTAGGGTCAGAAGGCCTGAGTCTCTCTGCTGCAGATGG GCTCTCTGTCCCTGAGCCAAGCTTTGTCCTCCCTGG-3' (SEQ ID NO: 5) is available from the NCBI database under the Gene ID number 494334 as accessible on 17 May 2016.
The "pre-miR-422a" is a 90 bp long micro RNA having the sequence
5'-GAGAGAAGCACUGGACUUAGGGUCAGAAGGCCUGAGUCUCUCUGCUGCAGAUG GGCUCUCUGUCCCUGAGCCAAGCUUUGUCCUCCCUGG-3' (SEQ ID NO: 6) and is accessible from the miRBase database under Reference Sequence number MI0001444 as accessible on 17 May 2016.
The "mature miRNA-422a", 22 bp long micro RNA, has the sequence
5'-ACUGGACUUAGGGUCAGAAGGC-3' (SEQ ID NO: 7) and is accessible from the miRBase database under Reference Sequence number MIMAT0001339 as accessible on 17 May 2016. The "MicroRNA-21 " herein called "miR-21 ". also called "hsa-mir-21 " refers to the pri- miRNA 21 , pre-miRNA-21 , the mature miRNA-21 -5p and the gene encoding miRNA-21 , preferably, to the pri-miRNA 21 , pre-miRNA-21 , the mature miRNA-21 -5p, more preferably to the mature miRNA-21 -5p.
The microRNA-21 , called "miR-21 " or "hsa-mir-21 " is encoded on chromosome 17 from position 59841266 until 59841337 (reference to genome hg38/Human) and its gene sequence is available from the NCBI database under the Gene ID number : 406991 as accessible on 17 May 2016.
The "pre-miR-21 " is a 71 bp long micro RNA having the sequence
5'-UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACC AGUCGAUGGGCUGUCUGACA-3' (SEQ ID NO: 18) and is accessible from the miRBase
NCBI database under NCBI Reference Sequence number MI0000077, as accessible on
17 May 2016.
The "mature miRNA-21 -5p", 22 bp long micro RNA, has the sequence
5'- UAGCUUAUCAGACUGAUGUUGA-3'(SEQ ID NO: 19) and is accessible from the miRBase database under Reference Sequence number MIMAT0000076 as accessible on 17 May 2016.
In context of the present invention, determining the expression level of miR-422a or miR-21 refers to determining the expression level of at least one miRNA-422a selected from the group constituted of pri-miRNA 422a, pre-miRNA-422a and mature miRNA-422a or to determining the expression level of at least one miRNA-21 selected from the group constituted of pri-miRNA-21 , pre-miRNA-21 and mature miRNA-21 -5p.
In one embodiment, at least one miRNA-422a or at east one miRNA-21 herein refers to at least one, at least two, at least three, preferably one, two or three.
In one particular embodiment, determining the expression level of miR-422a herein refers to determining the expression level of pri-miRNA 422a, pre-miRNA-422a and mature miRNA-422a, preferably mature miRNA-422a.
In one particular embodiment, determining the expression level of miR-21 herein refers to determining the expression level of pri-miRNA-21 , pre-miRNA-21 and mature miRNA-21 -5p, preferably mature miRNA-21 -5p.
Typically, the expression level of a microRNA such as miR-422a or miRNA-21 may be determined by methods known to the skilled in the art, for example by RT-qPCR and/or RNAsequencing performed on a biological sample and more particularly a stem-loop RT- PCR method as described in Chen et al., (2005) Nucleic Acids Res. 2005 Nov 27;33(20):e179. Methods such as RT-qPCR and/or RNAsequencing and stem-loop RT- PCR are generally known to the skilled in the art.
In one embodiment, the expression level of the micro-RNA miR-422a and/or miR-21 is measured by RT-qPCR, in situ hybridization or smallRNA sequencing, preferably RT- qPCR.
For instance, total RNA was typically extracted by using typically miRNeasy Mini Kit (Qiagen); quality was controlled by, for example, the small RNA kit for the Agilent Bioanalyzer (Bio-Rad). For example, 0^g of total RNA were reverse transcribed using, for example, the TaqMan Advanced miRNA cDNA Synthesis Kit (Thermo Fisher Scientiffic), and analyzed using, for instance, specific TaqMan® Advanced miRNA Assays (Thermo Fisher Scientiffic) and the master mix TaqMan® Universal Master Mix II, no UNG, on a, for instance, MxPro 3000 (Agilent). The expression data (delta 2 CT method) were typically normalized against the geometrical mean of, for example, three reference genes such as Let.7a, miR-26a, Let.7e.
In one example, in situ hybridization (ISH) against miR-422a was carried out following the instructions of the, for example, miRCURY LNA microRNA ISH Optimization kit (Exiqon).
It is known by the skilled in the art, that expression level of miRNA-422a and/or miR-21 may be measured using similar techniques as used to quantify gene transcript in particular, direct hybridization based assays, sequencing and amplification-based assays, with some experimental adaptation, well known in the art, due to the short sequences of the miRNAs. For example, the reverse transcription of miRNA-422a and/or miR-21 to cDNA may be realized using hairloop primers hybridizing with the stem-loop of miRNA- 422a and miR-21 .
For instance, nucleic acids having at least 10 nucleotides and exhibiting sequence complementarity or homology to miRNA-422a or miR-21 herein find utility as amplification primers, as further described herein below in the section 'Use and Kit". It is understood that such nucleic acids need not be identical, but are typically at least about 80% identical to the homologous region of comparable size, more preferably 85% identical and even more preferably 90-95% identical.
Primers typically are shorter single-stranded nucleic acids, of between 10 to 25 nucleotides in length, designed to perfectly or almost perfectly match a nucleic acid of interest, to be amplified. The primers are "specific" to the nucleic acids they hybridize to, i.e. they preferably hybridize under high stringency hybridization conditions.
In certain embodiments, it will be advantageous to use nucleic acids in combination with appropriate means, such as a detectable label, for detecting hybridization. A wide variety of appropriate indicators are known in the art including, fluorescent, radioactive, enzymatic or other ligands (e. g. avidin/biotin).
It will be understood by the skilled in the art, that for determining the expression level of miR-422a and/or miR-21 in the methods of the invention further comprise in step a) the step of providing total RNAs extracted from a biological sample as defined herein below.
"Providing total RNAs" herein refers to extracting total RNA. Methods to extract total RNA are known to the skilled in the art. Said total RNA extracted from a biological sample is then subjected to retro-transcription followed by amplification with miRNA-422a specific primers and/or miRNA-21 specific primers in step a), more particularly by means of a quantitative RT-PCR (RT-qPCR) as described above.
As mentioned above, in one embodiment, determining the expression level of miRNA-422a and/or miR-21 in step a) further contains normalizing said expression level as described herein above.
For instance, the expression level of miRNA-422 and/or miR-21 was typically normalized against the geometrical mean of, typically, three reference genes, such as, for example, Let.7a, miR-26a, and Let.7e.
The protein "cluster of differentiation 73 (CD73)" also called "5'-nucleotidase" or "ecto-5'-nucleotidase" refers to an enzyme (EC 3.1 .3.5) that catalyzes the conversion at neutral pH of purine 5-prime mononucleotides to nucleosides, the preferred substrate being AMP. The protein CD73 is encoded by the gene NT5E. The human CD73 gene, NT5E, is found on chromosome 6 (Position 85,449,584 until 85,495,791 ) and has a total length of 46, 208 bases. Alternative splicing of the NT5E gene results in at least two transcript variants:
- a first transcript "CD73 Isoform 1 " of which the mRNA is available from the UCSC database under accession number NM 002526 (SEQ ID NO: 1 ) and the representative protein sequence for CD73 isoform 1 called CD73L of 574 amino acids length is available under NCI database under the reference number ABA39834.1 (SEQ ID NO: 2) as accessible on 20 May 2016,
- a transcript "CD73 Isoform 2" of which the RNA is available from the UCSC database under accession number NM 001204813 (SEQ ID NO: 3) and the representative protein sequence for CD73 isoform 2 called CD73S of 524 amino acids length, is available under the accession number NP_001 191742.1 (SEQ ID NO: 4) in the NCI database as accessible on 20 May 2016.
Accordingly, in one embodiment, CD73 herein refers to the transcription product(s) and/or translation product(s) of the gene NT5E.
In one embodiment, CD73 herein refers to the transcription product and/or translation product of CD37L and/or CD73S.
In context of the present invention, determining the expression level of CD73 refers to determining the expression level of CD73L and/or CD73S. In one example, the expression level of CD73 refers to the protein expression level of CD73 and/or the mRNA expression level of CD73.
Accordingly, in one embodiment, the expression level of CD73 is determined by detecting transcription product(s) and/or translation product(s) of the gene NT5E.
Determining the expression level of said NT5E gene can be performed by methods which are well known to the person skilled in the art, including in particular immunologic methods as further described herein below or quantitative methods, such as reverse transcriptase PCR (RT-PCR), such as real-time quantitative RT-qPCR, and methods involving the use of DNA arrays (macroarrays or microarrays), RNA sequencing or in situ hybridizations, in particular reverse transcriptase PCR (RT-PCR), such as real-time
quantitative RT-qPCR, and methods involving the use of DNA arrays (macroarrays or microarrays) and RNA sequencing.
In one particular embodiment, the expression level of CD73 is measured by RT- qPCR or RNA sequencing , preferably RT-qPCR.
For instance, total RNA was extracted by using typically miRNeasy Mini Kit
(Qiagen); quality was controlled by, for example, the for the Agilent Bioanalyzer (Bio-Rad). Typically, 0.5 μg of total RNA were retro-transcribed using, for example, the QantiTect RT kit (Qiagen). For example, QPCR was prepared using, for instance, the QuantiTect SYBR® Green PCR Kit (ThermoFischer Scientific). Primers were designed to amplify the CD73 isoforms 1 and 2 (Fd : 5'-TTATTGCACTGGGACATTCG-3' (SEQ ID NO: 8), Rs : 5'- AGGCCTGGACTACAGGAACC-3' (SEQ ID NO: 9)), the CD73 isoform 2 (Fd: 5'- TGATGAACGCAACAATGGAAT-3' (SEQ ID NO: 10), Rs:5'- TCTGGAACCCATCTCCACCA-3' (SEQ ID NO: 1 1 )), the CD73 isoform 1 (Fd: 5'- ctcctctcaatcatgccgct-3' (SEQ ID NO: 20), Rs: 5'- caaatgtgcctccaaagggc-3' (SEQ ID NO: 21 )), the TATA-box binding protein ( TBP) (Fd : 5'-TATAATCCCAAGCGGTTTGC-3' (SEQ ID NO: 14), Rs :5'-CACAGCTCCCCACCATATTC-3' (SEQ ID NO: 15), the ribosomal protein L19 (RPL 19) (Fd :5'-GGCACATGGGCATAGGTAAG-3' (SEQ ID NO: 12), Rs : 5'- CCATGAGAATCCGCTTGTTT-3' (SEQ ID NO: 13)) and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Fd : 5' GAGTCAACGGATTTGGTCGT-3' (SEQ ID NO: 16), Rs : 5'- TTGATTTTGGAGGGATCTCG-3' (SEQ ID NO: 17)). The expression level was typically normalized against the geometrical mean of three reference genes (RPL 19, TBP, and GAPDH).
Accordingly, in one embodiment, the expression level of CD73 is determined using primers specific to CD73L (SEQ ID NO: 1 ) and CD73S (SEQ ID NO: 2), wherein the forward primer CD73-1 /2-F consists of the nucleic acid sequence 5'- TTATTGCACTGGGACATTCG -3' (SEQ ID NO: 8) and the reverse primer CD73-1 /2-R consists of the nucleic acid sequence 5'- AGGCCTGGACTACAGGAACC -3' (SEQ ID NO: 9).
In a further embodiment, the expression level of CD73 is determined using primers specific to CD73S, wherein the forward primer CD73S-2-F consists of the nucleic acid sequence 5'-TGATGAACGCAACAATGGAAT-3' (SEQ ID NO: 10) and the reverse primer CD73S-2-R consists of the nucleic acid sequence 5'-TCTGGAACCCATCTCCACCA-3' (SEQ ID NO: 1 1 ).
In a further embodiment, the expression level of CD73L is determined using primers specific to CD73L, wherein the forward primer CD73L-1 -F consists of the nucleic acid sequence 5'- ctcctctcaatcatgccgct -3' (SEQ ID NO: 20) and the reverse primer
CD73L-1 -R consists of the nucleic acid sequence 5'- caaatgtgcctccaaagggc -3' (SEQ ID NO: 21 ).
In a further embodiment, the expression level of CD73, in particular the protein expression level of CD73, will be determined by detecting the translation products using immunologic methods such as detection of CD73 using polyclonal or monoclonal antibodies. Suitable immunologic methods include immuno-histochemistry (IHC), enzyme linked immunoassays (ELISA), sandwich, direct, indirect, or competitive ELISA assays, enzyme linked immunospotassays (ELIspot), radio immunoassays (RIA), flow-cytometry assays (FACS), Western Blot, fluorescence resonance energy transfer (FRET) assays, protein chip assays using for example antibodies, antibody fragments, receptor ligands or other agents binding the CD73 proteins encoded by the NT5E gene.
As known by the skilled in the art anti-CD73 antibodies for this purpose are commercially available.
Accordingly, in a one embodiment, the expression level of CD73 is determined using immunohistochemistry, Western Blot.
As mentioned above, in one embodiment, determining the expression level of CD73 further contains normalizing said expression level as described herein above.
The expression level of CD73 is typically normalized against the geometrical mean of, typically, three reference genes, such as, for example, RPL 19, TBP, and GAPDH.
In one embodiment, the expression level of RPL19 is determined using primers specific to the mRNA of RPL19, wherein the forward primer RPL19-F consists of the nucleic acid sequence 5'-GGCACATGGGCATAGGTAAG-3' (SEQ ID NO: 12) and the reverse primer RPL19-R consists of the nucleic acid sequence 5'- CCATGAGAATCCGCTTGTTT-3' (SEQ ID NO: 13).
In one embodiment, the expression level of TBP is determined using primers specific to the mRNA of TBP, wherein the forward primer TBP-F consists of the nucleic acid sequence 5'-TATAATCCCAAGCGGTTTGC-3' (SEQ ID NO: 14) and the reverse primer TBP-R consists of the nucleic acid sequence 5'-CACAGCTCCCCACCATATTC-3' (SEQ ID NO: 15).
In one embodiment, the expression level of GAPDH is determined using primers specific to the mRNA of GAPDH, wherein the forward primer GAPDH -F consists of the nucleic acid sequence 5' GAGTCAACGGATTTGGTCGT-3' (SEQ ID NO: 16) and the reverse primer GAPDH-R consists of the nucleic acid sequence 5'- TTGATTTTGGAGGGATCTCG-3' (SEQ ID NO: 17).
The term "the expression level of miR-422a is lower than the miR-422a reference value" as used herein, means that the level of expression of the said biomarker as determined in the biological sample is inferior to the miR-422a reference value, the difference between said values is typically statistically significant. For instance, in the oropharynx cohort, the miR-422a reference value is the median expression value of miR- 422a in the whole cohort.
The term "the expression level of miR-21 is higher than the miR-21 reference value" as used herein, means that the level of expression of the said biomarker as determined in the biological sample is superior to the miR-21 reference value, the difference between said values is typically statistically significant. For instance, in the oropharynx cohort, the miR-21 reference value the median expression value of miR-21 in the whole cohort.
The term "the expression level of CD73 is higher than the CD73 reference value" as used herein, as used herein, means that the level of expression of the said biomarker as determined in the biological sample is superior to the CD73 reference value, the difference between said values is typically statistically significant. For instance, in the oropharynx cohort, the CD73 reference value is the median expression value of CD73 in the whole cohort.
In some embodiment, the level of the biomarkers, i.e. of miR-422a, miR-21 and/or CD73 can be determined as a function of the reference value, and is thus higher or lower than said reference value.
"Statistically significant" typically refers to a p value that is smaller than 0.05.
Biological sample
The term "biological sample" refers to a biological sample obtained for the purpose of in vitro evaluation. Biological samples that may be used for performing the methods according to the invention encompass any biological sample derived from a patient containing nucleic acids, in particular RNA and more particularly microRNA, including any fluids, tissues, cell samples, organs, biopsies, etc.
In one embodiment, the biological sample in context of the present inventions is selected from the group constituted of tissue sample, blood sample (e.g. whole blood sample), plasma, serum, saliva and urine, preferably, the biological sample is saliva.
Biological samples such as blood samples, plasma, serum, saliva and urine are also referred to as a fluid samples.
In some embodiments, wherein the expression level of miR-422a, and optionally miR-21 and the expression level of CD73 is determined in step a) the biological sample is preferably a tumor sample.
Reference value
In context of the present invention, the term "reference value" refers to a miR-
422a or miR-21 reference value or a CD73 reference value.
In one embodiment, the miR-422a or miR-21 reference value or CD73 reference value are predetermined reference values and can be a threshold value or a range.
The reference value can be any number of statistical measures to distinguish between a level indicative for reoccurrence of HNSCC, preferably early reoccurrence, i.e. a reference value obtained in subject(s) who experienced local (head and neck localization) and/or regional (nodes involvement) recurrence as a first event, within two years, and a level indicative that a subject has not or subjects have not relapsed or is(are) not at risk of relapsing, i.e. a reference value obtained in subject(s) who did not relapse during the first two years after surgery and radio(chemo)therapy, while including Median expression levels, and/or cut-off or threshold expression or fold change values as determined in an subject or a group of subjects.
In context of the present invention, the inventors have determined if miR-422a is downregulated in tumor samples of responders and non-responders (R and NR) compared to healthy adjacent tissues (N).
Accordingly, in some embodiments, the miR-422a reference value, miR-21 reference value and/or the CD73 reference value is the expression level of the micro-RNA miR-422a, miR21 and/or the expression level of CD73, respectively, in a biological sample from healthy adjacent tissue of the same subject suffering from HNSCC.
In a preferred embodiment, the miR-422a reference value, miR-21 reference value and/or the CD73 reference value herein refer to the median miR-422a expression level, median miR-21 expression level and/or the median CD73 expression level determined in biological samples obtained from a subject or a population of subjects suffering from HNSCC who did not relapse during at least first two years after surgery and radio(chemo)therapy.
For instance, the inventors compared the expression level distribution of miR-442a observed in a group of subject having no reoccurrence of HNSCC within 2 years with the expression level distribution in subjects having a loco-regional relapse within 2 years and identified a cutoff value of 0.036.
Accordingly in one particular embodiment, the miR-422a reference value is 0.036.
A method for selecting a subject
The inventors identified in HNSCC tumors the microRNA miR-422a as a biomarker which, when downregulated, is associated with early recurrence of the HNSCC.
The inventors further identified, that the combination of the biomarkers miR-422a with miR-21 , when respectively downregulated and upregulated, are associated with a further increased prognoses of early recurrence of the HNSCC. The inventors further demonstrated that the miR-422a targets the oncogene CD73/NT5E. Accordingly, the level of miR-422a and CD73 is inversely correlated, i.e., as demonstrated by the inventors, low levels of miR-422 correlate with high levels of CD73. The CD73 in HNSCC is therefore a promising target for anti-cancer therapy in subjects having a reduced level of miR-422a or a reduced level of miR-422a and an increased level of miR-21 and thereby belonging to a poor responder subgroup. Furthermore, the inventors demonstrated that exogenously added miR-422a decreases the expression of the oncogene CD73 thus further establishing a miR-422 mimic reagent as promising therapy for subjects suffering from HNSCC which have a low expression level of miR-422a.
The invention thus concerns an in vitro method for selecting a subject who suffers from HNSCC which comprises:
a) determining the expression level of the micro-RNA miR-422a and, optionally, of miR-21 in a biological sample of said subject,
b) comparing the expression level of micro-RNA miR-422a with a miR-422a reference value and, optionally, comparing the expression level of micro-RNA miR-21 with a miR-21 reference value,
wherein said method is for selecting a subject with HNSCC who is likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification, and said subject is selected as likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification if said subject has an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, said subject has an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value.
The inventors demonstrated in the examples that the standard treatment suits the, so called "good responders". "Good responders" are herein defined as subjects having an expression level of the micro-RNA miR-422a as determined in step a) higher than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) lower than the miR-21 reference value.
The inventors further demonstrated in the examples that subjects, so called "no responders" or "poor responders", wherein "poor responders" herein refers to subjects
having an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, as well as the "intermediates", wherein "intermediates" herein refers to subjects having an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) lower than the miR-21 reference value, or subjects having an expression level of the micro-RNA miR-422a as determined in step a) higher than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, have an increased relapse after standard HNSCC treatment and are thus subjects in need of an alternative treatment, such as a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification.
Accordingly, in one embodiment:
- a subject having an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, or
- a subject having an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) lower than the miR-21 reference value,
is likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification.
It will be understood by the skilled in the art, that in context of the present invention, a subject is likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification because, said subject, as defined herein above, is likely not to respond to the standard HNSCC treatment, wherein the standard HNSCC treatment is as defined herein below in the section "Prediction of clinical outcome".
As it will be further understood by the skilled in the art, a CD73 inhibitor is in particular of interest for subjects having a reduced expression level of miR422, optionally an increased expression level of miR21 and an increased expression level of CD73.
Accordingly, in one embodiment, the in vitro method for selecting a subject further comprises determining in step a) the expression level of CD73 in said biological sample of said subject, and further comparing in step b) the expression level of CD73 with a CD73 reference value.
In a related embodiment, a subject is selected as likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification if said subject has a measured expression level of the micro-RNA miR-422a as determined in step a) lower
than the miR-422a reference value and has a measured expression level of CD73 as determined in step a) that is higher than a CD73 reference value.
In a further related embodiment, a subject is selected as likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification if said subject has:
- an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, or
- an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) lower than the miR-21 reference value, and
- an expression level of CD73 as determined in step a) higher than a CD73 reference value. The "miR-422a mimic reagent" is as defined herein below in the section
"compositions and therapeutic applications" and a "CD73 inhibitor" and "treatment intensification" are as defined herein below in the section "Method of treatment".
Chance of relapse-free survival
The inventors further demonstrated that the level of miR-422a or miR-21 expression is predictive of RFS (LogRank test, p<0.05), when considering loco-regional or local relapse (as demonstrated in Figure 2 and Figure 29), and that combination of both micro- RNA is predictive of RFS (LogRank test, p<0.05) for all types of HNSCC, as demonstrated in the TCGA cohort and the oropharynx cohort.
The invention thus further concerns an in vitro method for determining the chance of relapse-free survival in a subject suffering from HNSCC, comprising:
a) determining the expression level of the micro-RNA miR-422a and, optionally, miR- 21 in a biological sample of said subject,
b) comparing the expression level of micro-RNA miR-422a with a miR-422a reference value and, optionally, comparing the expression level of micro-RNA miR-21 with a miR-21 reference value,
wherein an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value, and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, indicates that the subject has a reduced chance of relapse-free survival than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than
the miR-422a reference level and, optionally, who has an expression level of the micro- RNA miR-21 equal to or lower than the miR-21 reference level.
In one embodiment, the in vitro method for determining the chance of relapse-free survival further comprises determining in step a) the expression level of CD73 in said biological sample of said subject, and further comparing in step b) the expression level of CD73 with a CD73 reference value.
In a related embodiment, an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR- 21 reference value, and a measured expression level of CD73 as determined in step a) that is higher than a CD73 reference value indicates that the subject has a reduced chance of relapse-free survival than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level and an expression level of CD73 as determined in step a) equal to or lower than the CD73 reference level and, optionally, an expression level of the micro-RNA miR-21 equal to or lower than the miR-21 reference level.
In the context of the present invention a "reduced chance of relapse-free survival" defines that the subject has a l OOmonth relapse free survival (RFS) chance, preferably a 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 24, 30, 50, 60, 70, 80, 100, 1 10, 120, 130, 140, 150 month RFS chance, of less than 50%, in particular less than 40%, more particular less than 30%, for example less than 25%, for example between 1 % and 25%, particularly 20, 22, 24, 25, 26, 27, 28, 29 or 30%.
For instance, in the oropharynx cohort, 66.7% of the patients were identified as "poor responders" having relapsed 2 years after the treatment onset versus 23.8% in the good responder group. A poor responder is as as defined herein above.
In a further example, in the TCGA cohort, nearly 60% of the patients in the poor responder group have relapsed 5 years after the treatment onset versus 0% in the good responder group.
In one embodiment, reduced chance of relapse-free survival herein refers to reduced relapse free survival (RFS).
As an example, the patients have a 24-month relapse free survival chance of less than 33% (for example in the oropharynx cohort), and a 60-month relapse free survival chance of less than 40% (for example in the TCGA cohort).
Accordingly, in one particular embodiment, a reduced chance of relapse-free survival refers to a 100-month relapse free survival (RFS) chance of less than 30%, or a
24-month relapse free survival chance of less than 33%, or a 60-month relapse free survival chance of less than 40%.
"Relapse-free survival" (RFS) is herein defined as the time of survival without any HNSCC recurrence and/or spread and/or second cancer after treatment onset. It therefore corresponds to the total amount of time that a subject survives after treatment onset, in particular without any relapse.
The "relapse" is defined as the reoccurrence and/or spread of HNSCC and/or metastasis and/or second cancer appearance after the initial therapy.
In one embodiment, relapse is local-regional relapse. Prediction of clinical outcome
In the context of the invention, the term "clinical outcome" refers to the risk of relapsing.
The invention thus refers to an in vitro method for predicting a clinical outcome in response to a treatment of HNSCC in a subject suffering from HNSCC, comprising:
a) determining the expression level of the micro-RNA miR-422a and, optionally, miR-21 in a biological sample of said subject,
b) comparing the expression level of micro-RNA miR-422a with a miR-422a reference value and, optionally, miR-21 with a miR-21 reference value,
c) based on the comparison of step b), classifying the subject as being at an increased risk of relapse,
wherein the presence of an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR- 21 reference value, indicates that the subject has an increased risk of relapse in response to a treatment of HNSCC than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level and, optionally, who has an expression level of the micro-RNA miR-21 equal to or lower than the miR-21 reference level.
As mentioned herein above in the section "A method for selecting a subject the inventors demonstrated in the examples that the standard treatment suits the, so called "good responders" which are subjects having an expression level of the micro-RNA miR- 422a as determined in step a) higher than the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) lower than the miR-21 reference value but no the "intermediates" and "poor responders".
Accordingly, in one further embodiment,
- the presence of an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro- RNA miR-21 as determined in step a) higher than the miR-21 reference value, or
- the presence of an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and an expression level of the micro-RNA miR- 21 as determined in step a) lower to the miR-21 reference value, or
- the presence of an expression level of the micro-RNA miR-422a as determined in step a) higher to the miR-422a reference value and an expression level of the micro-RNA miR-21 as determined in step a) higher than miR-21 reference value ,
indicates that the subject has an increased risk of relapse in response to a treatment of HNSCC than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level and an expression level of the micro-RNA miR-21 equal to or lower than the miR-21 reference level.
In one embodiment, the in vitro method for for predicting a clinical outcome further comprises determining in step a) the expression level of CD73 in said biological sample of said subject, and further comparing in step b) the expression level of CD73 with a CD73 reference value.
In a related embodiment, the presence of
- an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, or
- an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) lower than the miR-21 reference value, or
- an expression level of the micro-RNA miR-422a as determined in step a) higher than the miR-422a reference value and, optionally, an expression level of the micro-RNA miR-21 as determined in step a) higher than the miR-21 reference value, and
- an expression level of CD73 as determined in step a) that is higher than a CD73 reference value,
indicates that the subject has an increased risk of relapse than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level and an expression level of CD73 equal to or lower than the CD73 reference level.
In the context of the invention an "an increased risk of relapse" defines that the subject has a l OOmonth risk of relapse, preferably a 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16,
18, 20, 24, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150 month risk of relapse of more than 50%, in particular more than 60%, more particular more than 70%, for example more than 75%, for example between 99% and 75%, particularly 80, 78, 76, 74, 72, 70%.
Accordingly, in one particular embodiment, an an increased risk of relapse refers to a 100-month risk of relapse of more than 70%, or a 24 month risk of relapse of more than 67%, or a 60-month risk of relapse of more than 60%.
In analogy to the relapse-free survival (RFS) the "risk of relapse" is herein defined as the % of subjects that suffer from HNSCC recurrence and/or spread and/or second cancer after treatment onset.
In the context of the invention, the term "treating" or "treatment", as used herein, means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
The "treatment of HNSCC" in the wording "a method for predicting a clinical outcome in response to a treatment of HNSCC" refers to the standard treatments usually used to treat HNSCC. It will be understood by the skilled in the art that the treatment of HNSCC used depends on the the type of HNSCC, its localization and its extend as typically defined using the TNM grading system and the performance status of the patient.
The treatment of HNSCC typically comprises at least one therapy selected from the group consisting of surgery, radiation therapy and chemotherapy.
"Surgery" is frequently used in most types of head and neck cancer in order to remove the cancerous cells entirely. Depending on the type of HNSCC surgery might refer to vocal cord stripping, laser surgery, cordectomy, laryngectomy, partial laryngectomy, total laryngectomy, pharyngectomy, lymph node removal and tracheotomy, also called tracheostomy.
"Radiation therapy" is the most common form of treatment and uses targeted energy (e.g., X-rays, radioactive substances) to destroy cancer cells, shrink tumors, and/or alleviate certain cancer-related symptoms. There are different forms of radiation therapy, including 3D conformal radiation therapy, intensity-modulated radiation therapy, and brachytherapy. Radiation therapy might be used after surgery or instead of surgery when surgery is not possible. Radiotherapy can be led alone or in combination with chemotherapy.
"Chemotherapy" is not generally used alone to cure the HNSCC as such, but instead, to limits tumor extension. It can be used as an induction treatment to reduce the
tumor size before surgery and/or radiotherapy, or in combination with radiotherapy, or as an adjuvant treatment after radiotherapy to increase treatment efficiency.
Use and kit
The invention further refers to at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-422a for use in the methods of the present invention and/or at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-21 for use in the methods of the present invention and/or at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding CD73 for use in the methods of the present invention.
The invention further refers to the use of at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-422a in the methods of the present invention and/or the use of at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-21 in the methods of the present invention and/or the use of at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding CD73 in the methods of the present invention.
In one embodiment, the nucleic acids in context of the invention are isolated.
The term "isolated" in reference to a biological component (such as a nucleic acid, a vector or a protein) refers to a biological component that has been substantially separated or purified away from other biological components in the cell of the organism, or the organism itself, in which the component naturally occurs, such as other chromosomal and extra-chromosomal DNA and RNA, proteins, cells, and organelles.
"Isolated nucleic acids" or "isolated vectors" include nucleic acid molecules purified by standard purification methods. These terms also encompass nucleic acids and vectors prepared by amplification and/or cloning, as well as chemically synthesized nucleic acids and vectors.
As used herein, the terms "hybridize" or "hybridization," as known to those skilled in the art, refer to the binding of a nucleic acid molecule to a particular nucleotide sequence under suitable conditions, namely under stringent conditions.
The term "stringent condition" or "high stringency condition" as used herein corresponds to conditions that are suitable to produce binding pairs between nucleic acids having a determined level of complementarity, while being unsuitable to the formation of
binding pairs between nucleic acids displaying a complementarity inferior to said determined level. Stringent conditions are the combination of both hybridization and wash conditions and are sequence dependent. These conditions may be modified according to methods known from those skilled in the art (Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes, Part I, Chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York). Generally, high stringency conditions are selected to be about 5°C lower than the thermal melting point (Tm), preferably at a temperature close to the Tm of perfectly base-paired duplexes (Andersen, Nucleic acid Hybridization, Springer, 1999, p. 54). Hybridization procedures are well known in the art and are described for example in Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D.,Seidman, J.G., Smith, J. A., Struhl, K. eds. (1998) Current protocols in molecular biology. V.B. Chanda, series ed. New York: John Wiley & Sons.
High stringency conditions typically involve hybridizing at about 50°C to about 68°C, wherein said temperature typically corresponds to the highest melting temperature TM of the nucleic acid to be hybridized with a target sequence, in 5x SSC/5x Denhardt's solution/1 .0% SDS, and washing in 0.2x SSC/0.1 % SDS at about 60°C to about 68°C.
In one embodiment, the at least one nucleic acid in context of the invention is a oligonucleotide, wherein the oligonucleotide is as defined herein above. Preferably, the oligonucleotide comprises a nucleotide sequence of 10 to about 300 consecutive nucleotides.
In one embodiment, the at least one nucleic acid in context of the invention hybridizes specifically under high stringency conditions to a nucleic acid sequence comprising SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) and/or the at least one nucleic acid in context of the invention hybridizes specifically under high stringency conditions to a nucleic acid sequence comprising SEQ ID NO: 6 (pre-miR-422a) and/or a nucleic acid sequence comprising SEQ ID NO: 7(mature miR-422a) and/or the at least one nucleic acid in context of the invention hybridizes specifically under high stringency conditions to a nucleic acid sequence comprising SEQ ID NO: 18 (pre-miR-21 ) and/or a nucleic acid sequence comprising SEQ ID NO: 19 (mature miRNA-21 -5p).
In one further embodiment, the at least one nucleic acid may comprise a nucleotide sequence of 8 to about 300 consecutive nucleotides of the nucleotide sequences of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (miRNA-21 -5p) or the complementary sequences thereof.
In one embodiment, the at least one nucleic acid may further comprise single nucleotides or a nucleotide sequence that do not hybridize with the nucleotide sequence of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR- 422a) and/or SEQ ID NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (miRNA-21 -5p) or the complementary sequences thereof.
In one embodiment, the isolated nucleic acid according to the invention comprises a sequence which corresponds (or is complementary to) a sequence having between 80% and 100% sequence identity with sequence SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S), or the isolated nucleic acid according to the invention comprises a sequence which corresponds (or is complementary to) a sequence having between 80% and 100% sequence identity with sequence SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7(mature miR-422a) or the isolated nucleic acid according to the invention comprises a sequence which corresponds (or is complementary to) a sequence having between 80% and 100% sequence identity with sequence SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miRNA-21 -5p).
Preferably, the isolated nucleic acid comprises a sequence which corresponds (or is complementary to) a sequence having between at least about 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% nucleic acid sequence identity with sequence SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miRNA-21 -5p) as disclosed herein.
In another one embodiment the isolated nucleic acid of the invention is a probe. As used herein, the "probe" can be used for diagnosing or prognosing HNSCC in biological samples. Contacting nucleic acids of a biological sample, with the probe, under conditions which allow hybridization of the probe with its corresponding fragment in the nucleic acid, results in the formation of a nucleic acid/probe hybrid. The formation of this hybrid can be detected (e.g., via labeling of the nucleic acid or probe), whereby the formation of this hybrid indicates the presence of variation. Such identification methods based on hybridization with a specific probe (either on a solid phase carrier or in solution) have been described in the art. The specific probe is preferably a sequence which, under optimized conditions, hybridizes specifically to a region within the 5' or 3' flanking region of at least one variation and preferably also comprising part of the foreign DNA contiguous therewith (hereinafter referred to as "specific region"). Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, for example, in Sambrook et al. (( 1989) Molecular Cloning; A Laboratory Manual, Cold Spring Harbor).
Probes in context of the invention are preferably at least 12, 15, 20, 25, or 30 nucleotide long. Probes may be less than 60, 50, 40 or, preferably, 35 nucleotide long.
Probes can be used for the methods of the invention by hybridizing to miR-422a or variants thereof or CD73 or variants thereof as described herein above.
In one example, miR-422a comprising SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID
NO: 7 (mature miR-422a) and/or CD73 comprising SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miRNA-21 -5p) or variants thereof are over-expressed in a biological sample compared with a control sample or a reference value. Contacting a total RNA sample (transcriptome) of a biological sample, with the probe(s) of the invention, under conditions which allow hybridization of the probe(s) with its corresponding fragment in the nucleic acid, results in the formation of a nucleic acid/probe hybrid. The formation of this hybrid can be detected (e.g., via labeling of the nucleic acid or probe), whereby the formation of this hybrid indicates the expression of the corresponding sequence. Such identification methods based on hybridization with a specific probe (either on a solid phase carrier or in solution) have been described in the art.
In one embodiment, the specific probe is preferably a sequence which, under optimized conditions, hybridizes specifically to SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p).
Preferably, the probe comprises a sequence which is at least 80%, preferably between 80 and 85%, more preferably between 85 and 90%, especially preferably between 90 and 95%, most preferably between 95% and 100% identical (or complementary) to the nucleotide sequence of a specific region, i.e. to the nucleotide sequence of miR-422a, miR21 or CD73. Preferably, the probe will comprise a sequence of about 15 to about 40, or 20 to about 40 and notably, 15, 20, 25, 30, 35, 38, or all contiguous nucleotides identical (or complementary) to CD73, in particular, to the nucleic acid consisting of SEQ ID NO: 1 (CD73L) or SEQ ID NO: 3 (CD73S) or variants thereof, or to miR-422a, in particular, to the nucleic acid consisting of SEQ ID NO: 6 (pre-miR- 422a) and/or SEQ ID NO: 7 (mature miR-422a), or variants thereof or to miR-21 , in particular, to the nucleic acid consisting of SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p), or variants thereof.
In one embodiment, the probe comprises a sequence of about 15 to about 100, or 25 to about 80 contiguous nucleotides identical (or complementary) to SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID
NO: 7 (mature miR-422a) or SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p).
In a preferred embodiment the at least one isolated nucleic acid is at least two nucleic acids.
In one embodiment the two nucleic acids are a set of primers.
Accordingly, in one embodiment, the invention concerns a pair of primers suitable for amplifying CD73 and/or a pair of primers suitable for amplifying miR-422a and/or a pair of primers suitable for amplifying miR-21 for use in the methods of the invention.
In a further embodiment, the invention concerns the use of a pair of primers suitable for amplifying CD73 and/or the use of a pair of primers suitable for amplifying miR-422a and/or the use of a pair of primers suitable for amplifying miR-21 in the methods of the invention.
Methods to create probes or primers that target specific nucleic acids, such as miR-422a, miR-21 or CD73, are well-known to one of skill in the art. In particular, miR- 422a, miR21 or CD73, are available from the NCBI sequence database and from annotated genes of genome sequencing projects. Nucleotide sequences can be aligned and probes or primers can be designed to target conserved regions of miR-422a, miR21 or CD73 nucleic acids separately.
The term "primer" is meant for short nucleic acid molecules, such as a DNA oligonucleotide, which can be annealed to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand. A primer can be extended along the target nucleic acid molecule by a polymerase enzyme. Therefore, primers can be used to amplify a target nucleic acid molecule. Primer pairs can be used for amplification of a nucleic acid sequence, for example, by PCR, real-time PCR, or other nucleic-acid amplification methods known in the art. Methods for preparing and using primers are described for example, in Sambrook et at. ((1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York). Said primer may be a sense primer and/or an antisense primer, said sense primer comprising or consisting of 15 to 40 consecutive nucleotides of a nucleotide sequence that is identical to or substantially identical (i.e. at least 75%, 80%, 90%, 95% or 98% identical) to the nucleotide sequence of CD73, miR-21 or miR-422a, in particular to the nucleotide sequence of CD73 consisting of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or a variant thereof, or the nucleotide sequence of miR-422a consisting of SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR-422a), or a variant thereof, or the nucleotide sequence of miR-21 consisting of SEQ ID NO: 18 (pre-miR-21 )
and/or SEQ ID NO: 19 (mature miR-21 -5p), or a variant thereof, and said antisense primer comprising or consisting of 15 to 40 consecutive nucleotides of a nucleotide sequence that is complementary to a nucleotide sequence that is identical to or substantially identical (i.e. at least 75%, 80%, 90%, 95% or 98% identical) to the nucleotide sequence of CD73, miR-21 or miR-422a, in particular to the nucleotide sequence of CD73 consisting of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or the nucleotide sequence of miR-422a consisting of SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR- 422a) or a variant thereof, or the nucleotide sequence of miR-21 consisting of SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p) or a variant thereof. Preferably, primers may be less than 100, 50, 40, 25 or preferably 20 nucleotides long.
The present invention further refers to the use of a nucleic acid specifically hybridizing to a CD73 nucleic acid sequence consisting of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S) or a nucleic acid specifically hybridizing to miR-422a nucleic acid sequence consisting of SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature miR- 422a) or a nucleic acid specifically hybridizing to miR-21 nucleic acid sequence consisting of SEQ ID NO: 18 (pre-miR-21 ) and/or SEQ ID NO: 19 (mature miR-21 -5p) in the methods of the invention, in particular for determining relapse-free survival in a subject suffering from HNSCC, for selecting a subject who suffers from HNSCC and for method for predicting a clinical outcome in response to a treatment of HNSCC.
In one example, the primers specific to CD73, in particular CD73L and CD73S are the forward primer CD73-1/2-F consisting of the nucleic acid sequence 5'- TTATTCGACTGGGACATTCG-3' (SEQ ID NO: 8) and the reverse primer CD73-1/2-R consisting of the nucleic acid sequence 5'- AGGCCTGGACTACAGGAACC -3' (SEQ ID NO: 9).
In a further example, the primers specific to CD73, in particular CD73S are the forward primer CD73S-2-F consisting of the nucleic acid sequence 5'- TGATGAACGCAACAATGGAAT-3' (SEQ ID NO: 10) and the reverse primer CD73S-2-R consisting of the nucleic acid sequence 5'-TCTGGAACCCATCTCCACCA-3' (SEQ ID NO: 1 1 ).
In a further example, the primers specific to CD73, in particular CD73L are the forward CD73L-1 -F consisting of the nucleic acid sequence 5'- ctcctctcaatcatgccgct -3' (SEQ ID NO: 20) and the reverse primer CD73L-1 -R consisting of the nucleic acid sequence 5'- caaatgtgcctccaaagggc -3' (SEQ ID NO: 21 ).
The invention also discloses a kit for the methods of the invention, i.e. for selecting a subject who suffers from HNSCC, for determining the chance of relapse-free survival in a subject suffering HNSCC and for predicting a clinical outcome in response to a treatment of HNSCC in a subject suffering from HNSCC, wherein said kit comprises at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-422a and/or at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-21 and/or at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding CD73, as defined above.
In other words, the invention concerns a kit comprising means for determining the expression level of CD73 and/or means for determining the expression level of miR-422a, and/or means for determining the expression level of miR-21 .
"Means for" herein refers to antibodies directed against a target protein sequence and/or nucleic acids as defined herein above, which specifically hybridize with a target sequence.
In context with CD73, said means may be anti-CD73 antibodies or nucleic acids of the invention, such as a pair of primers and/or probes according to the inventions as defined herein above.
In one particular embodiment, the means for determining the expression level of
CD73 are the forward primer CD73-1 /2-F consisting of the nucleic acid sequence 5'- TTATTCGACTGGGACATTCG-3' (SEQ ID NO: 8) and the reverse primer CD73-1/2-R consisting of the nucleic acid sequence 5'- AGGCCTGGACTACAGGAACC -3' (SEQ ID NO: 9) and/or the forward primer CD73S-2-F consisting of the nucleic acid sequence 5'- TGATGAACGCAACAATGGAAT-3' (SEQ ID NO: 10) and the reverse primer CD73S-2-R consisting of the nucleic acid sequence 5'-TCTGGAACCCATCTCCACCA-3' (SEQ ID NO: 1 1 ) and/or the forward CD73L-1 -F consisting of the nucleic acid sequence 5'- ctcctctcaatcatgccgct -3' (SEQ ID NO: 20) and the reverse primer CD73L-1 -R consisting of the nucleic acid sequence 5'- caaatgtgcctccaaagggc -3' (SEQ ID NO: 21 ).
In context with miR-422a or miR-21 , said means are, in particular, nucleic acids of the invention, such as a pair of primers and/or probes, preferably primers, as defined herein above.
In one embodiment, the kit in context of the invention further comprises means for determining the expression level of at least one further gene to be used for normalization, as defined herein above in the section "Determining the expression level".
In one particular embodiment, the at least one gene is at least two, or at least three genes, at least four genes, at least five genes, at least six genes, preferably the at least one gene are three genes or six genes.
In one embodiment the at least one further gene is selected from the group constituted of Let.7a, miR-26a, Let.7e, RPL 19, TBP, and GAPDH, as defined herein above.
In one preferred embodiment, the kit further comprises at least one mean selected from the group constituted of a nucleic acid, a pair of primers or a probe, preferably a pair of primers specifically hybridizing to the nucleic acid sequence of Let.7a, miR-26a, Let.7e, RPL19, TBP, or GAPDH.
In one preferred embodiment, the kit further comprises a pair of primers specifically hybridizing to the nucleic acid sequence of Let.7a, a pair of primers specifically hybridizing to the nucleic acid sequence of miR-26a and a pair of primers specifically hybridizing to the nucleic acid sequence of Let.7e.
In a further embodiment, the kit further comprises:
- the forward primer RPL19-F consisting of the nucleic acid sequence of SEQ ID NO: 12 and the reverse primer RPL19-R consisting of the nucleic acid sequence of SEQ ID NO: 13, and/or
- the forward primer TBP-F consisting of the nucleic acid sequence of SEQ ID NO: 14 and the reverse primer TBP-R consisting of the nucleic acid sequence of SEQ ID NO:
15, and/or
- the forward primer GAPDH -F consisting of the nucleic acid sequence of SEQ ID NO: 16 and the reverse primer GAPDH-R consisting of the nucleic acid sequence of SEQ ID NO: 17.
The kits according to the invention are for use in the methods of the invention by determining the expression level of miR-422a, miR-21 and/or CD73.
The kit of the invention may thus further comprise a combination of reagents allowing determining the expression level of miR-422a, miR-21 and/or CD73 and optionally the instructions of the manufacturer for use in the methods of the invention.
Accordingly, in one embodiment, the kit comprises, for miR-422a, miR-21 and/or for
CD73 to be tested, at least one probe and/or a pair of primers that selectively hybridize with said biomarker.
In one particular embodiment, the invention provides for a kit for the in vitro methods of the invention comprising at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR- 422a and/or at least one isolated nucleic acid which comprises a sequence that hybridizes
specifically under high stringency conditions to nucleic acids encoding CD73 and/or at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR21 and at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to at least one further gene selected from the group constituted of Let.7a, miR-26a, Let.7e, RPL 19, TBP, and GAPDH.
The kit according to the invention may further comprise at least one miR-422a reference value and/or at least one miR-21 reference value and/or at least one CD73 reference value.
Said at least one miR-422a reference value may be for example a normal 422a reference value, an increased miR-422a reference value and decreased miR-422a reference value.
Said at least one miR-21 reference value may be for example a normal miR-21 reference value, an increased miR-21 reference value and decreased miR-21 reference value.
Said at least one CD73 reference value may be for example a normal CD73 reference value, an increased CD73 reference value and decreased CD73 reference value.
In one embodiment, said reference values are provided in form of a standard.
A "standard" herein refers to a sample comprising a compound, such as a nucleic acid, in a known amount.
Compositions and therapeutic applications
The inventors have demonstrated that the mRNA, protein and enzymatic activity of the CD73 nucleotidase, which is involved in the oncogenic processes, are modulated by miPi-422a, and that CD73 downregulation mimics the effects of miR-422a overexpression. In particular, the inventors demonstrated that overexpressing miR-422a increases the expression level of miR-422a and decreased the enzymatic activity of CD73 in the cell lines tested (see for example Figure 9 to 12). To conclude, a miR-422a overexpression reduces the mRNA and protein level of the oncogene CD73 and inhibits its enzymatic activity.
Thus, the invention relates to a pharmaceutical composition comprising a miR- 422a mimic reagent for use as a medicament.
The invention also provides a pharmaceutical composition comprising a miR-422a mimic reagent for use in the treatment of HNSCC.
In the context of the invention, the term "treating" or "treatment", as used herein, means reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition.
In one preferred embodiment, treating or treatment refers to obtaining complete remission of the HNSCC in a subject in context of the invention.
"Complete remission" herein refers to the absence of clinical signs and/or imaging signs, such as signs in PET scan and/or IRM, of residual HNSCC tumor and/or HNSCC metastasis and/or lymph node invasion of an HNSCC, or a second cancer. Sid complete remission is preferably evaluated 6- months after the end of treatment.
A "miR-422a mimic reagent" in context of the present invention is a nucleic acid which acts to increase the level of a miR-422 gene product in a cell.
As known by the skilled in the art, there exist different ways to administer a micro RNA mimic reagents, either administering microRNA formulations, either naked, coupled to a carrier, or delivered via a viral vector encoding the microRNA . Those methods are known to the skilled in the art and described for example in Ling, H et al. Nat Rev Drug Discov. 2013 Nov;12(1 1 ):847-65.
Accordingly, in one embodiment, miR-422a mimic reagent is a nucleic acid comprising a sequence of miR-422 or a variant thereof.
In one embodiment, the miR-422a mimic reagent is synthetic.
In a further embodiment, the miR-422a mimic reagent comprises one or more stabilizing mutations.
In one embodiment, the miR-422a mimic reagent comprises at least one nucleic acid sequence of miR-422a selected from the group consisting of the miR-422a gene sequence of SEQ ID NO : 5, SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature- miR-422a), preferably the miR-422a gene sequence of SEQ ID NO : 5.
In one particular embodiment, the at least one nucleic acid refers to at least one, at least two, at least three, such as 1 , 2 or 3 nucleic acid sequences.
As it is known by the skilled in the art, a nucleic acid, such as a miRNA, may be delivered to the cell in a vector.
Accordingly, in one embodiment, the miR-422a mimic reagent is a vector.
In one embodiment said vector is an isolated vector.
A "vector" herein refers to any vehicle capable of facilitating the transfer of the nucleic acid to the cell such that the nucleic acid can be processed and/or expressed in the cell. The vector may transport the nucleic acid to the cells with reduced degradation, relative to the extent of degradation that would result in the absence of the vector. The
vector optionally includes gene expression sequences or other components able to enhance expression of the nucleic acid within the cell.
In context of the present invention, said vector comprises a sequence of miR-422 or a variant thereof.
In a further embodiment, the vector comprises the miR-422 sequence selected from the group consisting of the miR-422a gene sequence of SEQ ID NO : 5, SEQ ID NO: 6 (pre-miR-422a) and/or SEQ ID NO: 7 (mature-miR-422a), preferably the miR-422a gene sequence of SEQ ID NO : 5.
In general, vectors useful in context of the present invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the nucleotide sequences (or precursor nucleotide sequences) of the invention. Vectors for use in context of the invention are well known in the art, as well as methods to prepare said vectors containing a specific sequence.
In a preferred embodiment, the miR-422a mimic reagent is a RNA molecule.
In one embodiment the RNA molecule is double-stranded and/or blunt-ended RNA molecule, which means the molecule is double-stranded throughout the molecule and/or blunt-ended on both ends.
In one embodiment, the double stranded RNA molecule comprises an active strand and a fully complementary passenger.
In one embodiment, the double stranded RNA molecule comprises an active strand containing the mature miR-422a sequence of SEQ ID NO: 7.
In certain embodiments, the sequence of one strand of a double stranded RNA molecule consists of the sequence of a mature miR-422a sequence of SEQ ID NO: 7.
A double-stranded molecule does not include a hairpin molecule, which is one strand or polynucleotide. In some embodiments, the RNA molecule is blunt-ended on one or both ends. In a double-stranded RNA molecule, one or both strands may be 18, 19, 20, 21 , 22, 23, 24, or 25 nucleotides in length, or any range derivable therein. In certain embodiments, a double-stranded, blunt-ended molecule is 22 or 23 basepairs (bps) in length. In some embodiments a double-stranded RNA molecule contains two strands that are fully complementary to one another, which results in a molecule that is necessarily blunt-ended.
In certain embodiments, an RNA molecule in context of the present invention has an active strand comprising a mature human miR-422a sequence of SEQ ID NO: 7 (22- mer). In certain embodiments, the mature miR-422a sequence consists of the sequence
of SEQ ID NO: 7 and an at least one additional nucleotide at the 5' end and/or the 3' end, preferably at the 3 end, wherein the nucleotide is selected from A, C, G, or U.
In a particular embodiment, the mature miR-422a sequence consists of the sequence of SEQ ID NO: 7 and one additional U at the 3' end.
In some embodiments, the active strand has at least one modified nucleotide at one or more internal positions.
In further embodiments, the active strand has at two, at least three, at least four, at least 5, at least 6 modified nucleotide at one or more internal positions, for example the active strand may comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 modified nucleotides at 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 internal positions, respectively.
The term "internal positions" herein refer to a position that is neither the first nor last position in the strand.
The term "modified nucleotide" means a nucleotide or nucleoside (if referring to the nucleobase at the 5' position) with an additional moiety or a replacement moiety compared to an unmodified nucleotide.
Modified nucleotides are known to the skilled in the art and are described for example in detail in the American patent application US 8,586,727.
For instance, the natural or unmodified bases in RNA are adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U) (DNA has thymine (T)). In contrast, modified bases or modified nucleotide, may refer to as heterocyclic base moieties, including other synthetic and natural nucleobases such as 5-methylcytosine (5- me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (including 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines), 7- methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8- azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3- deazaadenine.
Modified nucleotides further refer to nucleotides with sugar portions that correspond to naturally occurring sugars or modified sugars. Representative modified sugars include carbocyclic or acyclic sugars, sugars having substituent groups at one or more of their 2', 3' or 4' positions and sugars having substituents in place of one or more hydrogen atoms of the sugar. In certain embodiments, the sugar is modified by having a
substituent group at the 2' position. In additional embodiments, the sugar is modified by having a substituent group at the 3' position. In other embodiments, the sugar is modified by having a substituent group at the 4' position. It is also contemplated that a sugar may have a modification at more than one of those positions, or that the RNA molecule in context of the invention may have one or more nucleotides with a sugar modification at one position and also one or more nucleotides with a sugar modification at a different position.
Sugar modifications contemplated in miRNA mimics include, but are not limited to, a sugar substituent group selected from: OH; F; O— , S— , or N-alkyl; O— , S— , or N- alkenyl; O— , S— or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. In some embodiments, these groups may be chosen from: 0(CH2)xOCH3, 0((CH2)xO)yCH3, 0(CH2)xNH2, 0(CH2)xCH3, 0(CH2)xONH2, and 0(CH2)xON((CH2)xCH3)2, where x and y are from 1 to 10.
In particular, one or more base or sugar modifications may be used to induce a 3'- endo sugar conformation. A nucleoside can incorporate synthetic modifications of the heterocyclic base, the sugar moiety or both to induce a desired 3'-endo sugar conformation. These modified nucleosides are used to mimic RNA-like nucleosides so that particular properties of an oligomeric compound can be enhanced while maintaining the desired 3'-endo conformational geometry (as further described for example in Patent Application Publication 2005/0261218).
In some embodiments, the RNA molecule in context of the invention has a modification particularly of the 5' terminal residue of specifically the strand having the sequence that is complementary to the mature miRNA. This strand is referred to as the "passenger" strand herein. Without being bound to theory, it appears that the presence of a stable moiety other than a phosphate or hydroxyl at the 5' end of the complementary strand impairs or eliminates uptake of the passenger strand by the miRNA pathway complex and subsequently favors uptake of the active strand by the miRNA protein complex. 5' modifications include, but are not limited to, NH2, biotin, an amine group, a lower alkylamine group, a lower alkyl group, NHCOCH3, an acetyl group, 2' oxygen- methyl (2'O-Me), DMTO, fluorescein, a thiol, or acridine or any other group with this type of functionality. In other embodiments, there is a Spacer 18 (PEG) amidite (DMT- Hexa(ethylene glycol)). In other embodiments, there is an alkylamine or alkyl group of 40 carbons or fewer. In embodiments involving a "lower" alkylamine or alkyl group, "lower" will be understood to refer to a molecule with 20 or fewer carbons.
In one particular embodiment, the miR-422a mimic reagent is a double-stranded, blunt-ended RNA molecule comprising:
a) an active strand comprising sequence SEQ ID NO:8 from 5' to 3' and
b) a fully complementary passenger strand.
In a further embodiment, the fully complementary passenger strand referred to in b) comprises
i) modified nucleotides in the first and last two nucleotides of the passenger strand and/or
ii) a terminal modification of the nucleotide at the 5' end.
In one embodiment, "the terminal modification" of the nucleotide at the 5' end may be referred to as 5' end modification.
Such a terminal modification may be with respect to the nucleotide (or nucleoside if it lacks a phosphate group) at the 5' end. This terminal modification is specifically contemplated in some embodiments to be a modification that is not a modification of a sugar molecule. It is specifically contemplated that this modification may be one of the following: NH2, biotin, an amine group, a lower alkylamine group, NHCOCH3, an acetyl group, 2'0-Me, DMTO, fluorescein, a thiol, acridine, Spacer 18 (PEG) amidite (DMT- Hexa(ethylene glycol)), or any other group with this type of functionality.
In specific embodiments, the 5' terminal modification on the passenger strand is a C6 amine linker.
In further embodiments, the nucleotide at the 5' end of the passenger strand may have both a non-sugar modification and a sugar modification, as defined herein above.
In some embodiments, the RNA molecule has an active strand with a sequence that is identical or that has 80% or more identical to SEQ ID NO: 7, preferably, 90% or more identical to SEQ ID NO: 7, for example 91 , 92, 93, 94, 95, 96, 97, 98, 99%. .
Identity is as defined herein above.
Specific embodiments further include pharmaceutical compositions comprising one or more different miR-422a mimic reagents; the difference may relate to sequence and/or type or position of modification. In certain embodiments, the miR-422a mimic reagent is comprised in a lipid formulation.
In other embodiments, the miR-422a mimic reagent may be formulated with a liposome, polymer-based nanoparticle, cholesterol conjugate, cyclodextran complex, polyethylenimine polymer and/or a protein complex.
As it is known by the skilled in the art, different microRNA mimics such as MRG- 201 (Miragen Corp) or MRX34 (Mirna therapeutics) are developed and currently in clinical trials, thus demonstrating that techniques to formulate and administer microRNA mimics are known to the skilled in the art..
The pharmaceutical composition of the present invention can be administered via any suitable route, such as by mucosal (intranasal), parenteral, or intramuscular administration, oral, intradermal, intraperitoneal, intravenous, or subcutaneous administration, preferably intravenous.
The pharmaceutical composition of the present invention can be administered alone or with suitable pharmaceutical carriers, and can be in solid or liquid form such as, tablets, capsules, powders, solutions, suspensions, or emulsions.
The miR-422a mimic reagent in context of the invention is advantageously formulated in a pharmaceutical composition, together with a pharmaceutically acceptable carrier.
"Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
The form of the pharmaceutical compositions, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the patient, etc.
The pharmaceutical compositions of the invention can be formulated for a topical, oral, intraocular, intravenous, intramuscular or subcutaneous administration and the like.
Preferably, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.
The doses used for the administration can be adapted as a function of various parameters, and in particular as a function of the mode of administration used, of the relevant pathology, or alternatively of the desired duration of treatment. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage
until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1000 mg per adult per day. Preferably, the compositions contain 0.01 , 0.05, 0.1 , 0.5, 1 .0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient, more preferably from 1 mg to about 60 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day, more preferably, from 1 mg/kg to 50mg/kg.
Method of treatment
The present invention also refers to a method for treating HNSCC in a subject in need thereof, comprising the steps of:
a) determining the expression level of the micro-RNA miR-422a in a biological sample of said subject,
b) comparing the expression level of micro-RNA miR-422a with a miR-422a reference value,
c) if the measured expression level of the micro-RNA miR-422a determined in a) is lower than the miR-422a reference value, administering a therapeutically effective amount of a pharmaceutical composition comprising a miR-422a mimic reagent, a CD73 inhibitor and/or a treatment intensification.
In one embodiment, the present invention refers to a method for treating HNSCC in a subject in need thereof, comprising the steps of:
a) determining the expression level of the micro-RNA miR-422a and miR21 in a biological sample of said subject,
b) comparing the expression level of micro-RNA miR-422a with a miR-422a reference value and comparing the expression level of micro-RNA miR-21 with a miR-21 reference value,
c) if the measured expression level of the micro-RNA miR-422a determined in a) is lower than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is higher than the miR-21 reference value, or
if the measured expression level of the micro-RNA miR-422a determined in a) is lower than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is lower than the miR-21 reference value, or
if the measured expression level of the micro-RNA miR-422a determined in a) is higher than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is higher than the miR-21 reference value,
administering a therapeutically effective amount of a pharmaceutical composition comprising a miR-422a mimic reagent, a CD73 inhibitor and/or a treatment intensification.
In a preferred embodiment, the present invention refers to a method for treating HNSCC in a subject in need thereof, comprising the steps of:
a) determining the expression level of miR-422a, miR21 and CD73 in a biological sample of said subject,
b) comparing the expression level of miR-422a with a miR-422a reference value, the expression level of micro-RNA miR-21 with a miR-21 reference value and comparing the expression level of CD73 with a CD73 reference value,
c) if the measured expression level of the micro-RNA miR-422a determined in a) is lower than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is higher than the miR-21 reference value, or
if the measured expression level of the micro-RNA miR-422a determined in a) is lower than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is lower than the miR-21 reference value, or
if the measured expression level of the micro-RNA miR-422a determined in a) is higher than the miR-422a reference value and if the measured expression level of the micro-RNA miR-21 determined in a) is higher than the miR-21 reference value, and
if the measured expression level of CD73 determined in a) is higher than the CD73 reference value,
administering a therapeutically effective amount of a pharmaceutical composition comprising a miR-422a mimic reagent, a CD73 inhibitor and/or a treatment intensification.
The pharmaceutical composition comprising a miR-422a mimic reagent is as defined herein above in the section "composition and therapeutic applications".
Preferably, an effective amount, preferably a therapeutically effective amount of a miR-422a mimic reagent of the invention, or a CD73 inhibitor is administered.
An "effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result. The effective amount may vary according to the drug with which the miR-422a mimic reagent and/or the CD73 inhibitor is co-administered.
A "therapeutically effective amount" of a miR-422a mimic reagent in context of the invention and/or a CD73 inhibitor may vary according to factors such as the disease state,
age, sex, and weight of the individual, and the ability of the miR-422a mimic reagent and/or the CD73 inhibitor to elicit a desired therapeutic result. A therapeutically effective amount encompasses an amount in which any toxic or detrimental effects of the miR-422a mimic reagent and/or the CD73 inhibitor are outweighed by the therapeutically beneficial effects. A therapeutically effective amount also encompasses an amount sufficient to confer benefit, e.g., clinical benefit.
A "CD73 inhibitor" herein refers to molecules having an inhibitory effect on CD73 activity.
The terms "inhibit," "block," "suppress," and grammatical variants thereof are used interchangeably herein and refer to any statistically significant decrease in biological activity, including full blocking of the activity. For example, "inhibition" can refer to a decrease of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% in biological activity. Accordingly, when the terms "inhibition" or "suppression" are applied to describe, e.g., an effect on the enzymatic activity of CD73, the term refers to the ability of a CD73 inhibitor to statistically significantly decrease the 5'-nucleotidase activity of CD73 (catabolizing the hydrolysis of adenosine monophosphate, AMP, to adenosine), relative to the CD73-mediated 5'-nucleotidase activity in an untreated (control) cell. The cell which expresses CD73 can be a naturally occurring cell or cell line (e.g., a cancer cell) or can be recombinantly produced by introducing a nucleic acid encoding CD73 into a host cell. In some aspects, an anti-CD73 antibody or antigen-binding fragment thereof can statistically significantly decrease the 5'-nucleotidase activity of a soluble form of CD73 in a biological fluid.
In one embodiment, the CD73 inhibitor is a CD73 binding molecule or anti- adenosine receptor binding molecules.
In one embodiment, the anti-CD73 binding molecule may be selected from the group constituted of anti-CD73 antibody, antigen-binding fragment of an anti-CD73 antibody and anti-CD73 drugs.
Any known efficient anti-CD73 antibody may be used and they are described, for example, described in Antonioli, L. et al. Trends in cancer, 2016 Feb vol. 2, for instance, anti-CD73 clone TY/23 (Stagg et al., 201 1 , Cancer research 71 , 2892-2900), anti-CD73 clone AD2 (Terp et al. The journal of immunology, 2013 oct), antibody MEDI9447 (JC Geoghegan et al., MAbs. 2016 Feb 8:1 -14) or antibody 7G2 (Sabastian FM Hausler et al., Am J Transl Res. 2014; 6(2):129-139).
Any known efficient anti-CD73 drugs may be used, for example the molecule Adenosine 5'-(a,3-methylene)diphosphate (CAS 3768-14-7).
Any known efficient anti-adenosine receptor binding molecule, also called inhibitors of adenosine receptors, may be used, such as SCH58261 (Jin et al 2010, Journal of clinical investigation 121 , 2371 -2382)
A "treatment intensification" herein refers to increase total dose of radiotherapy, to induction chemotherapy, to alternative radiation technics such as carbon hadrontherapy, radical surgery or concomitant biotherapy.
"Induction chemotherapy" herein refers to a chemotherapy given to reduce tumor burden before surgery and/or radiotherapy. As mentioned above Chemotherapy is usually given to HNSCC subjects that have, preferably, metastasis. In context of the present invention, subjects having a poor prognosis, i.e. a high risk of relapse might be treated with an induction chemotherapy to avoid relapse.
"Carbon hadrontherapy" refers to a form of external beam radiotherapy using carbon ions particles for cancer treatment.
"Radical surgery" refers to the removal of a tumor or mass and ancillary lymph nodes that may drain the mass for diagnostic and/or treatment purposes, as in radical mastectomy.
"Biotherapy" refers to a treatment that uses substances made from living organisms to treat a disease. These substances may occur naturally in the body or may be made in the laboratory. Some biotherapies stimulate or suppress the immune system to help the body fight cancer, infection, and other diseases. Other biotherapies attack specific cancer cells, which may help keep them from growing or kill them. They may also lessen certain side effects caused by some cancer treatments. Types of biotherapy include immunotherapy (such as vaccines, cytokines, and some antibodies), gene therapy, and some targeted therapies.
The present invention also refers to a method for reducing expression levels of
CD73 in a subject, the method comprising administering a composition comprising a miR- 422a mimic reagent as defined herein above, thereby reducing expression levels of CD73 in a subject.
The invention further refers to a method of treating HNSCC in a subject in need thereof, the method comprising administering a therapeutically effective amount of a miR- 422a mimic reagent as defined herein above, thereby treating HNSCC in the subject.
Throughout the instant application, the term "and/or" is a grammatical conjunction that is to be interpreted as encompassing that one or more of the cases it connects may occur. For example, the wording "qualitative and/or quantitative detection" in the phrase "the term "determining" includes qualitative and/or quantitative detection" indicates that the
term determining may refer to qualitative detection, or to quantitative detection, or to qualitative detection and to quantitative detection.
As used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural references, such as a plurality of the object referred to, unless the content clearly dictates otherwise.
Throughout the instant application, the term "comprising" is to be interpreted as encompassing all specifically mentioned features as well optional, additional, unspecified ones. As used herein, the use of the term "comprising" also discloses the embodiment wherein no features other than the specifically mentioned features are present (i.e. "consisting of").
The invention will now be described in more detail with reference to the following examples. All literature and patent documents cited herein are hereby incorporated by reference. While the invention has been illustrated and described in detail in the foregoing description, the examples are to be considered illustrative or exemplary and not restrictive.
BRIEF DESCRIPTION OF THE SEQUENCES
SEQ ID NO: 1 shows the mRNA nucleotide sequence of CD73L as available from the UCSC database under accession number NM 002526.
SEQ ID NO: 2 shows the amino acid sequence of CD73L as available from the NCI database under the reference number ABA39834.1 .
SEQ ID NO: 3 shows the mRNA nucleotide sequence of CD73S as available from the UCSC database under accession number NM_001204813.
SEQ ID NO: 4 shows the amino acid sequence of CD73S as available from the NCI database database under accession number NP 001 191742.1 .
SEQ ID NO: 5 shows the nucleotide sequence of the gene encoding the microRNA-422a as available from the NCBI database under the Gene ID number 494334 as accessible on 17 May 2016.
SEQ ID NO: 6 shows the nucleotide sequence of the 90bp long pre microRNA-422a as available from the miRBase database under Reference Sequence number MI0001444 as accessible on 17 May 2016.
SEQ ID NO: 7 shows the nucleotide sequence of the mature microRNA-422a as available from the miRBase database under Reference Sequence number MIMAT0001339 as accessible on 17 May 2016.
SEQ ID NO: 8 shows the nucleotide sequence of the forward primer CD73-1/2-F consisting of the nucleic acid sequence 5'-TTATTGCACTGGGACATTCG-3' which specifically hybridizes to CD73L and CD73S.
SEQ ID NO: 9 shows the nucleotide sequence of the reverse primer CD73-1 /2-R consisting of the nucleic acid sequence 5'- AGGCCTGGACTACAGGAACC -3' which specifically hybridizes to CD73L and CD73S.
SEQ ID NO: 10 shows the nucleotide sequence of the forward primer CD73S-2-F consisting of the nucleic acid sequence 5'-TGATGAACGCAACAATGGAAT-3' which specifically hybridizes to CD73S.
SEQ ID NO: 11 shows the nucleotide sequence of the reverse primer CD73S-2-R consisting of the nucleic acid sequence 5'-TCTGGAACCCATCTCCACCA-3' which specifically hybridizes to CD73S.
SEQ ID NO: 12 shows the nucleotide sequence of the forward primer RPL19-F consisting of the nucleic acid sequence 5'-GGCACATGGGCATAGGTAAG-3' which specifically hybridizes to RPL19.
SEQ ID NO: 13 shows the nucleotide sequence of the reverse primer RPL19-R consisting of the nucleic acid sequence 5'-CCATGAGAATCCGCTTGTTT-3' which specifically hybridizes to RPL19.
SEQ ID NO: 14 shows the nucleotide sequence of the forward primer TBP-F consisting of the nucleic acid sequence 5'-TATAATCCCAAGCGGTTTGC-3' which specifically hybridizes to TBP.
SEQ ID NO: 15 shows the nucleotide sequence of the reverse primer TBP-R consisting of the nucleic acid sequence 5'-CACAGCTCCCCACCATATTC-3' which specifically hybridizes to TBP.
SEQ ID NO: 16 shows the nucleotide sequence of the forward primer GAPDH-F consisting of the nucleic acid sequence 5'-GAGTCAACGGATTTGGTCGT-3' which specifically hybridizes to GAPDH.
SEQ ID NO: 17 shows the nucleotide sequence of the reverse primer GAPDH-R consisting of the nucleic acid sequence 5'-TTGATTTTGGAGGGATCTCG-3' which specifically hybridizes to GAPDH.
SEQ ID NO: 18 shows the nucleotide sequence of the 71 bp long pre-microRNA-21 as available from the NCBI database under NCBI Reference Sequence number: MI0000077 as accessible on 20 May 2016.
SEQ ID NO: 19 shows the nucleotide sequence of the 20bp long mature microRNA-21 as available from the miRBase database under Reference Sequence number MIMAT0000076 as accessible on 20 May 2016.
SEQ ID NO: 20 shows the nucleotide sequence of the forward primer CD73L-1 -F consisting of the nucleic acid sequence 5'- ctcctctcaatcatgccgct -3' which specifically hybridizes to CD73L.
SEQ ID NO: 21 shows the nucleotide sequence of the reverse primer CD73L-1 -R consisting of the nucleic acid sequence 5'- caaatgtgcctccaaagggc -3' which specifically hybridizes to CD73L.
SEQ ID NO: 22 shows the nucleotide sequence of the gene "Hsa-let-7a-1 ", which is one of the precursors encoding the microRNA-let7a as available from the miRbase database under the Gene ID number MI0000060 as accessible on 17 May 2016.
SEQ ID NO: 23 shows the nucleotide sequence of the gene "Hsa-let-7a-2", which is one of the precursors encoding the microRNA-let7a as available from the miRbase database under the Gene ID number MI0000061 as accessible on 17 May 2016.
SEQ ID NO: 24 shows the nucleotide sequence of the gene "Hsa-let-7a-3", which is one of the precursors encoding the microRNA-let7a as available from the miRbase database under the Gene ID number MI0000062 as accessible on 17 May 2016.
SEQ ID NO: 25 shows the nucleotide sequence of the mature microRNA-7a "mature hsa- Let-7a" as available from the miRBase database under Reference Sequence number MIMAT0000062 as accessible on 17 May 2016.
SEQ ID NO: 26 shows the nucleotide sequence of the gene "hsa-mir-26a-1 ", which is one of the precursors encoding the microRNA-26a as available from the miRbase database under the Gene ID number MI0000083 as accessible on 17 May 2016.
SEQ ID NO: 27 shows the nucleotide sequence of the gene "hsa-mir-26a-2", which is one of the precursors encoding the microRNA-26a as available from the miRbase database under the Gene ID number MI0000750 as accessible on 17 May 2016.
SEQ ID NO: 28 shows the nucleotide sequence of the mature microRNA-26 as available from the miRBase database under Reference Sequence number MIMAT0000082 as accessible on 17 May 2016.
SEQ ID NO: 29 shows the nucleotide sequence of "hsa-let-7e-5p" encoding the microRNA-let-7e as available from the miRbase database under the Gene ID number MI0000066 as accessible on 17 May 2016.
SEQ ID NO: 30 shows the nucleotide sequence of the mature miR-let-7e "hsa-let-7e-5p", as available from the miRBase database under Reference Sequence number as MIMAT0000066 accessible on 17 May 2016.
Example
1. Material and Methods: Clinical specimens
Fresh frozen samples of oropharynx stage III- IV tumors were obtained from the CRLCC Paul Strauss Center Tumor Bank (Strasbourg, France). Written informed consent was obtained from all patients and the study was approved by the local Committee on Human Research. Clinico-pathological and follow-up information were available for all patients (Table 1 ). Patients had been treated by surgery (the sample are pieces of the surgical resection) and radiotherapy (with or without chemotherapy). Only tissues with high cellularity (over 70%) were included. Patients were all negative for metastasis at the time of diagnosis. Patients who did not relapse during the first two years after surgery and radio(chemo)therapy, were considered as responders (R), while patients who experienced local (head and neck localization) and/or regional (nodes involvement) recurrence as a first event, within two years, were considered as non-responders (NR); patients with metastasis as a first event were excluded from the NR group.
Data mining from TCGA and GEOset databases
The Cancer Genome Atlas (TCGA) data portal and the Global Environmental Outlook (GEO) data portal (http://www.ncbi.nlm.nih.gov/geo) was queried. To test for an inverse correlation in the expression levels of miR-422a and CD73, the GSE33232 series including 44 HNSCC and 25 healthy tissues from uvulo-palato-pharyngoplasty was used. To assess relapse-free survival (RFS), the 'TCGA2STAT' R package to download RNAseqV2 normalized read counts (RPKM), as well as miRNASeq normalized read counts (RPMM) were used. Both expression and clinical data were available for 473 HNSCC tumors (from different locations: oral cavity, oropharynx, larynx, and pharynx). RFS for stage lll-IV tumors (with or without metastasis at the time of diagnosis) was available for 255 patients; among them, 179 did not relapse, 40 relapsed loco-regionally, 31 developed metastasis and 4 developed another cancer, as a first relapse event. Molecular biology
Total RNA was extracted by using miRNeasy Mini Kit (Qiagen); quality was controlled by the small RNA kit for the Agilent Bioanalyzer (Bio-Rad). 0^g of total RNA were reverse transcribed and analyzed using the TaqMan Low density (TLDA) technology (human microRNA panel V2.0) as previously published. The expression data (delta 2 CT method) were normalized against the geometrical mean of three reference genes (Let.7a,
miR-26a, LetJe) chosen according to the GeNorm instructions (https://genorm.cmgg.be/). Custom RT-qPCR were conducted on miR-422a and the three reference genes using specific TaqMan® MicroRNA Assays and the same master mix, on a MxPro 3000 (Agilent). In situ hybridization (ISH) against miR-422a was carried out following the instructions of the miRCURY LNA microRNA ISH Optimization kit (Exiqon). Regarding CD73 quantification, 0.5 μg of total RNA were retro-transcribed using the QantiTect RT kit and qPCR were prepared using the QuantiTect SYBR® Green PCR Kit (ThermoFischer Scientific). Primers were designed to amplify Primers were designed to amplify the CD73 isoforms 1 and 2 (Fd : 5'-TTATTGCACTGGGACATTCG-3' (SEQ ID NO: 8), , Rs : 5'- AGGCCTGGACTACAGGAACC-3' (SEQ ID NO: 9)), the CD73 isoform 2 (Fd: 5'- TGATGAACGCAACAATGGAAT-3' (SEQ ID NO: 10), Rs:5'- TCTGGAACCCATCTCCACCA-3' (SEQ ID NO: 1 1 )), the CD73 isoform 1 (Fd: 5'- ctcctctcaatcatgccgct-3' (SEQ ID NO: 20), Rs: 5'- caaatgtgcctccaaagggc-3' (SEQ ID NO: 21 )), the TATA-box binding protein ( TBP) (Fd : 5'-TATAATCCCAAGCGGTTTGC-3' (SEQ ID NO: 14), Rs :5'-CACAGCTCCCCACCATATTC-3' (SEQ ID NO: 15)), the ribosomal protein L19 (RPL 19) (Fd :5'-GGCACATGGGCATAGGTAAG-3' (SEQ ID NO: 12), Rs : 5'- CCATGAGAATCCGCTTGTTT-3' (SEQ ID NO: 13)) and the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Fd : 5' GAGTCAACGGATTTGGTCGT-3' (SEQ ID NO: 16), Rs : 5'- TTGATTTTGGAGGGATCTCG-3' (SEQ ID NO: 17)). The expression level was normalized against the geometrical mean of three reference genes (RPL 19, TBP, and GAPDH).
Cell viability and proliferation
HaCaT, SQ20B and SCC61 cell lines derived from human normal epithelium, larynx and oropharynx tumors, respectively, were cultured as described previously (Bionda C et al. Biochem Pharmacol. 2008; 75(3):761 -772). MirVana microRNA Mimics (ID: MC12541 ) and Inhibitors (ID: MH12541 ) specific for miR-422a, or a Mimic negative control (Ref: 4464058) were transfected under the following conditions for 100 000 cells: 6.7 μΙ_ of Hiperfect (Qiagen), 0.3 nmol of oligonucleotides in 500 μΙ_ of final complete medium. Clonogenic assays were conducted as previously described. The surviving fraction was calculated using the formula S(D)= n(D)/PE.N(D) where n is the number of colonies, N the seeded-cell number for a given dose (D) and PE the plating efficiency (PE= n/N, at 0 Gy). Apoptosis was measured 48 hrs post-transfection, using the Annexin- V and propidium iodide Apoptosis Detection Kit APOAF (Sigma-Aldrich), on an LSRII (Beckman-Coulter) flow cytometer. The number of viable cells was determined by measuring their metabolic activity using the Cell Counting Kit-8 (CCK8) (Sigma-Aldrich).
Cells were seeded at different concentrations after transfection in a 96-well plate (4 wells per condition), and cell number was evaluated using the CCK8 on a Luminoskan Ascent Microplate Luminometer (Thermo-Scientific) at day 4 and 6 post-transfection, according to the manufacturer's protocol. Signal (Arbitrary Unit) was normalized for 1 000 seeded cells. Cell adhesion
To assess the strength of cellular adhesion, cells were seeded after transfection onto a 16-well E-plate (4 wells per condition), and impedance was measured for 3 days on the xCELLigence RTCA DP device (Ozyme). The maximum signal intensity reached at the time of maximum cell confluence, was set as the adhesion strength. Microscopic imaging was conducted two days post-transfection. Cells were fixed and stained as previously described (Bionda C et al. Biochem Pharmacol. 2008; 75(3)761 -772). The actin cytoskeleton was labelled using phalloidin-FITC (Sigma-Aldrich), and the DNA using Hoechst 33258 (Sigma-Aldrich). Observations were done on an Imager Z2 (Zeiss).
Determination of CD73 activity and protein level
Cells were transfected with Silencer Selected siRNA (Life Technologies): one control and two targeting CD73 (ID: s9735#2; s9734#1 ), under the following conditions for 100 000 cells: 6.7 μί of hiperfect, 12.5 pmol of siRNA in 500 μ\- of final complete medium. Two days after transfection, cells were lysed and protein extracted and analyzed by western-blotting as previously published (Bionda C et al. Biochem Pharmacol. 2008; 75(3):761 -772). Anti-CD73 (ab124525, Abeam) or anti-GAPDH (H86504M, Interchim) were used as primary antibodies and HRP-linked goat anti-rabbit (sc3837, SantaCruz) or goat anti-mouse (sc2031 , SantaCruz) as secondary antibodies. Immunohistochemistry (IHC) against CD73 was performed using a Ventana Autostainer Automat (Ventana Medical Systems). Slides prepared from formalin-fixed paraffin-embedded tumor specimens were incubated with an anti-CD73 antibody (ab124525, Abeam; dilution: 1/100). Signals were detected using the ultraView Universal DAB Detection Kit (Ventana Medical Systems), according to the manufacturer's instructions. Nucleotidase activity was determined as previously published (Bavaresco L, et al. Mol Cell Biochem. 2008; 319(1 - 2):61 -68). Briefly, after three washes, cells were incubated for 1 to 3 hrs in a medium containing 2mM ATP. The concentration in inorganic phosphate of the supernatant was then analyzed using the malachite green colorimetric reaction. Standard dilutions of KH2P04 solution (10 to 100 mM) were used to calculate the inorganic phosphate concentration.
Statistical analyses
Survival analyses were performed with the R survival package software (R software: Language and Environment for Statistical Computing, R Foundation for Statistical Computing, http://www.R-project.org). Cox proportional hazard models provided estimates of the hazard ratios (HRs). For each covariate, the inventors of the present invention have checked that no evidence of violation of the proportional hazards assumption was found by plotting the scaled Schoenfeld residuals generated by the cox.zph function). A Wilcoxon test was used for mean comparison, while linear correlations were conducted using the spearman test. Considering the relapse free survival analysis: LogRank and Kaplan Meier curve drawings, were done using the SPSS software (IBM, France).
2. Results:
MiR-422a is significantly downregulated in oropharynx tumors from patients who experienced early loco(regional) recurrence.
The expression level of 384 miRNA was determined by RT-qPCR (TaqMan low density microarray) in 75 stage lll-IV oropharynx tumors (36 from NR and 39 from R), and in 38 adjacent healthy tissues (N) (19 from NR and 19 from R). Overall, 13 miRNA were significantly deregulated in NR versus R (Wilcoxon test, p<0.05) and were also predictive of relapse-free survival (RFS) (LogRank test, p<0.05) (data not shown). The initial analysis was refined and it was searched for miRNA that could differentiate patients who exclusively experienced local (and not loco-regional) recurrence (Local Rec) from patients who did not recur (R). Among the 13 miRNA initially identified, only the downregulation of miR-422a was associated with an exclusively local recurrence (Figurel A). Furthermore, the level of miR-422a expression was also predictive of RFS (LogRank test, p<0.05), when considering loco-regional or local relapse (Figure 2). Regarding the healthy adjacent tissues, a significantly higher level of miR-422a compared to tumor samples was observed (Figurel A, Left part). The RT-qPCR data were confirmed by conducting subject custom- made RT-qPCR experiments (Suppl. Figurel ) and by carrying out in situ hybridization (Figure 3). Indeed, the intensity of the cytoplasmic and nuclear labelling of the cancer cells (and not of the stromal cells) increased as a function of miR-422a expression levels, determined by RT-qPCR (low, medium and high) in the same tumors (Figure 3). Together with the high cellularity (over 70%) of our samples, this observation confirms a tumor- specific dysregulation of miR-422a expression.
MiR-422a modulates cell adhesion and proliferation but not radio-sensitivity.
To better characterize the function of miR-422a, in vitro experiments on three cell lines were conducted: SCC61 and SQ20B derived from human HNSCC, as well as HaCaT derived from normal epithelial cells (all the three expressing miR-422a (Figure 19)). Cells were transiently transfected with modified oligonucleotides, either mimic (miRmim) or inhibiting (miRinhi) the endogenous expression of miR-422a. An irrelevant construct was used as a control (miRCo). The efficiency of the transfections was assessed using a fluorescent miRNA, and repeatedly reached 98% (data not shown). The inventors of the present invention initially evaluated whether the downregulation of miR- 422a was responsible for radio-resistance (as local recurrence is indicative of radio- resistance). To do so, clonogenic assays were carried out (standard test for radiosensitivity measurement, Figure 4) and analyzed cell viability using the CCK8 assay (Figure 5), after transfection and irradiation, but the inventors could not identify any effect of miR-422a modulation on cell sensitivity to X-ray irradiation. Strikingly, one parameter was constantly modified in the clonogenic assays, namely the plating efficiency (PE). The PE corresponds to the proportion of seeded cells able to produce a clone of at least 64 cells, after allowing sufficient time for 6 cellular divisions to occur in control cells. Hence, a significant decrease in the PE in the miRmim versus the miRCo condition in SCC61 and SQ20B cells was observed, but no modification was noted in HaCaT cells (Figure 6). Different hypotheses can account for this decrease in the PE: (i) an increase in basal cell death, (ii) a decrease in the initial cell adhesion, and (iii) a decrease in cell proliferation, as previously reported. The inventors first tested the level of spontaneous apoptosis, but observed no significant effect on the modulation of endogenous miR-422a levels in all the three cell lines (Figure 20). In order to determine the strength of adhesion of cells, the maximal impedance signal (at time of full confluence) was measured using the xCELLigence device. A significant reduction in the adhesive capacity of cells in the miRmim subgroup in SCC61 and SQ20B cell lines only was noticed (Figure 7). Furthermore, the morphology and the actin cytoskeleton of these cells were altered (Figure 8), since they displayed either a loss of (SCC61 ) or a disorganized (SQ20B) actin polymerization at the inter-cellular junctions in the miRmim condition. The resulting fibroblastic or round-shaped cells observed in the SCC61 and SQ20B, respectively, is concordant with a reduction in the strength of cell adhesion. Inversely, in the miRinhi condition, a more intense labelling at the inter-cellular junctions in the SCC61 and SQ20B cell lines was noticed. Moreover, no obvious modifications in actin polymerization or cell morphology were visible in the HaCaT cell line. Finally, the consequence of miR-422a expression on cell proliferation was tested in the cell lines SC661 , SQ20B and HaCaT,
and conducted CCK8 assays (Figure 21 ). The inventors of the present invention confirmed an increase in cell proliferation in the miRinhi condition and a decrease in the miRmim condition. This effect was clearly visible in SCC61 and SQ20B cells, and less noticeable in the case of HaCaT cells (but still significant). These findings suggest that miR-422a induces a combined downregulation of cell adhesion and proliferation, at least in two of the cell lines studied.
MiR-422a targets the oncogene CD73/NT5E
Among the predicted targets of miR-422a by miR-map (http://mirmap.ezlab.org/app/) and miRecord (http://mirecords.biolead.org/), the inventors searched for oncogenes known to modulate the adhesion and proliferation processes and tested their level of expression in our tumor samples. Among them, the focus was on CD73. This ecto-5'-nucleotidase (also referred as NT5E) is a GPI-anchored cell surface protein, which plays enzymatic and non-enzymatic activities. Its oncogenic property partly relies on the modulation of cell adhesion and proliferation (Gao ZW et al. Biomed Res Int. 2014; 2014:460654). Interestingly, an inverse correlation (p<0.01 ) between the levels of expression of miR-422a and CD73 (Figure 9) was demonstrated. Next, this inverse correlation was confirmed by analyzing an independent public dataset (Geoset GS33232), with expression data available for 44 HNSCC tumors and 25 normal tissues (from uvulo- palato-pharyngoplasty) (Figure 22). Using IHC, an inverse correlation (Figure 10) was also observed between the level of expression of miR-422a determined by RT-qPCR and the intensity of CD73 labelling (the IHC were done on the same four patients as for the ISH). Doing western-blot experiments in basal condition, CD73 was barely detected in the HaCaT cell line (Figure 23), the inventors thus focused the subsequent experiments exclusively on the SCC61 and SQ20B cell lines. Thereby, two bands corresponding to the very recently described isoforms of CD73 were observed: the full-length isoform 1 (CD73L, 63kDa) and the short isoform 2 (CD73S, 58 kDa), deprived of the catalytic domain. Isoform 2 is believed to be specifically deregulated in cancers (Snider NT et al. Mol Biol Cell. 2014; 25(25) :4024-4033). As expected, a clear increase in the total amount of CD73 was noticed after the inhibition of endogenous miR-422a (miRinhi, Figure 1 1 ) and a decrease (at least in the short isoform) in miRmim in the two cell lines. Next, the inventors measured the enzymatic activity of CD73 in SCC61 cells, and confirmed a clear increase in the case of miRinhi and a decrease in the miRmim condition (Figure 12). The effect was also visible in the miRinhi condition in SQ20B cells, despite a ten-fold lower basal activity (in relation with a much lower basal protein level). To conclude, miR-422a directly impacts the mRNA and protein level of CD73, as well as its enzymatic activity.
To confirm the implication of CD73 on cell adhesion and proliferation in the tested cell lines, CD73 knocked-down experiments were conducted. First, the efficiency of the siRNAs at the protein and functional levels were validated (Figure 23). Next, the adhesive function of CD73 was inquired and as expected, the results confirmed a decrease in the PE in SCC61 and SQ20B cell lines, but not in HaCaT cells, after CD73 knocking down (Figure 5A). Furthermore, a decrease in cell proliferation was clearly noted in all three cell lines treated by siRNA targeting CD73 (Figure 14). Regarding the cell morphology, CD73 was recently shown to promote cortical actin polymerization and to increase the membranous localization of E-cadherin, β-catenin, and Na+K+ ATPase, thereby preserving epithelial integrity (Bowser JL et al. J Clin Invest. 2016; 126(1 ):220-238). This is in agreement with the observation in context of the present invention with regards to an increase in cortical actin polymerization in the miRinhi condition (Figure 8). To go further, an increase in membranous E-cadherin labelling in SCC61 and SQ20B cell lines treated by miRinh was also noted (Figure 24 and 25).
To summarize, miR-422a and CD73 have the inverse effects on cortical actin polymerization, and on cell adhesion and proliferation.
Why does CD73/miR-422a modulate cell adhesion and proliferation in a cell-type- specific manner?
Next, the differential effect observed on cell adhesion in SCC61 and SQ20B cells versus HaCaT cells were investigated. A ten-fold reduction in the level of CD73 mRNA in SQ20B and HaCaT cells (Figure 19) was observed, which resulted in similar basal enzymatic activities (Figure 23). Since the CD73 protein was hardly detected on Western blots of HaCaT cells, compared to SQ20B cells, this suggests (i) that an additional post- translational control of CD73 exists in HaCaT cells, and (ii) that most of the CD73 protein is dedicated to enzymatic functions in HaCaT cells. As adhesion is believed to be controlled by the non-enzymatic activity of CD73, the inventors propose that the residual CD73 protein detected in HaCaT cells may play a minor role in cellular adhesion. However, HaCaT cells have a much stronger basal adhesion than SCC61 and SQ20B cells (Figure 19), thus indicating that this function mainly relies on a different pathway in this cell line. Altogether, these findings explain the absence of measurable effect of miR- 422alCD73 modulation on cell adhesion, despite a slight effect on cell proliferation, specifically reported in the HaCaT cell line.
A high level of CD73 expression is associated with early loco(regional) recurrence in two independent cohorts of patients suffering from HNSCC.
In the ensuing set of experiments, the median expression value of CD73 (and rni'R- 422a) was set as a threshold to separate patients into "high CD73" or "low CD73" subgroups in our oropharynx cohort such as in the TCGA cohort.
Regarding the oropharynx cohort, a shorter RFS in the "high CD73" subgroup was confirmed (All recur., Figure 15A and C), although this correlation was not significant (p=0.149). Since it was demonstrated (above) that CD73 increases the strength of cell adhesion, the inventors speculated that its levels may be lower in tumors with an inclination to produce metastasis. The RFS analysis were thus refined by removing five patients who concomitantly displayed loco-regional recurrence and metastasis (Locoregional, Figure 15B and D), and observed a significant predictive effect of CD73 expression level on RFS (with an even higher predictive value for miR-422a) (Figure 15). It is worth noting that due to the initial inclusion criterion (half NR, half R), the cohort is biased towards a higher proportion of responder patients. Since target therapies have been much-awaited for treating patients who are in advanced stage of the disease, irrespective of the initial metastatic status or tumor localization, it was thus necessary to confirm the present observations on a non-biased independent cohort of stage lll-IV HNSCC tumors.
To do so, the inventors extracted expression data from the TCGA database for 255 patients with stage lll-IV tumors of different locations (oral cavity, oropharynx, larynx and pharynx). A significant (p=0.018) increase in the risk of recurrence in the "high CD73" subgroup (Figure 16A and D) was observed. The significance is maintained when only loco-regional recurrence is included (p=0.020), but is lost when only considering metastasis (p=0.154), as first event of recurrence. This strengthens the hypothesis that a high expression of CD73 favors loco-regional recurrence, but may be deleterious for the metastatic process. Using the same TCGA database, miR-422a expression level was available for 465 samples (of which 42 healthy tissues and 423 HNSCC tissues). However, only 5.8% of the samples were positive for miR-422a expression (maybe due to a lower sensitivity of the technic used), though a lower proportion of positive samples was observed in the tumors (4.7%) versus healthy tissues (16.7%), what confirmed our result. Selecting the stage lll-IV patients (N=205) and despite a very low number of miR-422a positive specimens (N=9), the RFS curves were drawn and a clear tendency (obviously not significant) to a longer survival time without recurrence was observed (Figure 16). Hence, a biotherapy targeting miR-422a/CD73 may be highly beneficial for patients
displaying miR-422aLow/CD73high tumors, to prevent loco-regional recurrence in HNSCC in advanced stages (all locations included).
Table 2. Influence of clinical parameter on RFS.
Oropharynx stage lll-IV HNSCC stage III IV (TCGA)
HR (CI) p HR (CI) p
Gender 0.83 (0.37 - 1 .86) 0.646 0.89 (0.5 - 1 .58) 0.716
Age 1 (0.97 - 1 03) 0.901 1 (0.63 - 1 59) 0.998
Stage 2.38 (0.92 - 6.12) 0.073 1 .58 (0.91 - 2.75) 0.106
Margin 1 .59 (1 .14 - 2.23) 0.007 ** 1 .54 (1 .18 - 2) 0.001 **
Alcohol/tobacco 0.8 (0.24 - 2.61 ) 0.708 1 .01 (0.64 - 1 .61 ) 0.963
HPV 0.43 (0.13 - 1 .41 ) 0.165 0.36 (0.05 - 2.74) 0.327
NT5E 0.64 (0.35 - 1 .18) 0.151 0.6 (0.38 - 0.94) 0.027*
MiR-422a 1 .99 (1 .07 - 3.7) 0.030 * 3.03 (0.42 - 21 .93) 0.271
CD73S, the splice variant of CD73L, is expected to bear the same 3'UTR sequence, comprising the miR-422a binding sites. Since CD73S is presumed to play a major role during oncogenesis (Snider NT et al. Mol Biol Cell. 2014; 25(25):4024-4033), the inventors investigated its expression in tumors from the TCGA database and observed a linear correlation between the transcript levels of CD73S and CD73L (in agreement with a co-regulation of both transcripts by miR-422a) (Figure 27). Moreover CD73S is predictive of RFS considering all types of recurrences (p=0.004) or loco-regional recurrences (p=0.010), but is not predictive of metastasis (p=0.104) (Figure 17). To conclude, miR-422a modulates the expression of both CD73S and CD73L, and CD73S bears the same predictive value (with even better p-value) with regards to RFS in Head and Neck tumors as compared with total CD73.
Regarding the influence of the clinico-pathological criteria by Cox modeling, a significant effect of the resection quality (with a higher risk of recurrence after incomplete resection as expected) in both cohorts is reported (Table 2, above). The inventors also determined the HPV status in the oropharynx tumors but failed to note any significant effect of this criterion, in both cohorts. This may either be due to a misdetection of the virus or to a low percentage of HPV-positive tumors in the two cohorts (oropharynx cohort 13% - N=75, TCGA 27% - N=67). Nevertheless, specific studies addressing the
microRNA signature associated with the HPV status in oropharynx did not retrieve rni'R- 422a.
MiR-422a is significantly down regulated and MiR21 is significantly upregulated in oropharynx tumors from patients who experienced early loco(regional) recurrence.
Moreover, the inventors identified that the combination of miR21 and miR422 testing even improves the stratification of subjects in comparison to miR-422a alone in both cohorts (oropharynx and TCGA), clearly defining three groups with different Disease Free survival (DFS), the poor DFS subgroup with low level of mir-422a and high level of miR-21 , the good DFS subgroup with high level of miR-422a and low level of miR-21 , and the intermediate subgroup (containing the other combinations, Figure 28).
Proceeding in this way, the percentage or patients still alive without relapse at 2, 5 and 10 years after the initial treatment onset was determined in the two cohorts, and a clear inclination to treatment resistance in the miR-422al_ow/miR21 High subgroup (Poor responder) was noticed, and an intermediate risk in the "intermediate" subgroup, and a good response to standard treatment in the miR-422aHigh/miR21 Low subgroup (Good responder).
Table 3: Disease Free survival (DFS) in Oropharynx cohort
Table 4: Disease Free survival (DFS) in TCGA cohort
To conclude, an alternative treatment should be proposed to the poor responder, and maybe also to the intermediate subgroup, while the standard treatment suits to the good responder subgroup.
In the examples above the inventors demonstrated the clear link between miR- 422a and CD73, the patients in the "poor responder" subgroup (with low levels of miR- 422a and optionally high levels of miR21 ) should be addressed for CD73 targeting therapy, provided that they are indeed positive for CD73 expression level.
The inventors tested the cohorts for the percentage of patients with a high level of
CD73 for each subgroup (the median expression level of CD73 (RT-qPCR) on the total population of TCGA was used as a threshold). It can be seen that 71 % of subjects having a low level of miR422a and a high level of miR21 are positive for CD73 (Table 5).
Table 5: CD73 expression in the Orpharynx cohort
3. Discussion
In the present study the inventors have demonstrated that miR-422a expression is significantly downregulated in oropharynx tumors from patients who have experienced early loco(regional) recurrence, as well as in tumor compared to normal tissues. MiR-422a downregulation is associated with earlier recurrence in vivo, which may be linked with the stronger cellular adhesion and higher rate of proliferation observed in vitro. The inventors have shown that the mRNA, protein and enzymatic activity of the CD73 nucleotidase, which is involved in the oncogenic processes, are modulated by miR-422a, and that CD73 downregulation mimics the effects of miR-422a overexpression. Furthermore, the inventors have proven the predictive value of miR-422al CD73 regarding the loco-regional recurrence of stage lll-IV tumors in their oropharynx cohort, as well as in the TCGA cohort encompassing different tumor locations. From these observations, it is concluded that miR-422a downregulation promotes local recurrence in stage lll-IV HNSCC, by targeting CD73.
The level of expression of miR-422a in tumors and in serum have been significantly correlated (Wang L, et al. Cancer Biol Ther. 2015; 16(10):1445-1452), paving the way for its establishment as a companion test. Salivary miRNA profiling has been
developed for oral cancer (Yoshizawa J and Wong D. Methods Mol Biol. 2013; 936:313- 324).
In the present study the inventors of the present invention identified a novel target of miR-422a, namely CD73. NT5E/CD73 is an oncogene, which is involved in enzymatic and non-enzymatic activities. As an enzyme, its ecto-5'-nucleotidase activity is responsible for hydrolyzing ADP into phosphate and adenosine, which in turn initiates adenosine receptor-dependent signals, or is imported into the cell by nucleoside transporters (Gao ZW et al. Biomed Res Int. 2014; 2014:460654). The adenosine receptor-dependent signaling is used by tumoral cells that overexpress CD73, to facilitate their immune escape (Jin D,et al. Cancer Res. 2010; 70(6):2245-2255, Stagg J,et al. Proc Natl Acad Sci U S A. 2010; 107(4):1547-1552). However, CD73 is also a signaling and an adhesion protein (Bowser JL et al. J Clin Invest. 2016; 126(1 ):220-238) involved in metastasis (Beavis PA,et al. Proc Natl Acad Sci U S A. 2013; 1 10(36):1471 1 -14716, Terp MG, et al. J Immunol. 2013; 191 (8):4165-4173), neovascularization (Koszatka P, et al. Int J Biochem Cell Biol. 2015; 69:1 -10) and tumor promotion (Loi S, et al. Proc Natl Acad Sci U S A. 2013; 1 10(27):1 1091 -1 1096), independently of its immune functions. Its overexpression has already been implicated in the resistance to treatment in vitro (Nevedomskaya E, et al. J Proteome Res. 2016; 15(1 ):280-290) and in vivo (Loi S, et al. Proc Natl Acad Sci U S A. 2013; 1 10(27):1 1091 -1 1096).
Regarding the clinical aspects, CD73 overexpression is predictive of a poor prognosis in colorectal, gastric, gallbladder and triple negative breast cancers, as well as in chronic lymphocytic leukemia (for review see (Gao ZW et al. Biomed Res Int. 2014; 2014:460654)). Overall, the results corroborate the pro-adhesive and pro-proliferative functions of CD73, along with its involvement in treatment resistance. However, in the present study of the inventors a high level of CD73 appeared to be unrelated to the metastatic capacity in our cohort and in the TCGA dataset. Consistently, the results published in the literature are conflictual about the pro-migratory and the pro-metastatic function of CD73. In meduloblastoma cell lines, the metastatic potential is inversely correlated with CD73 expression and activity. Pharmacological inhibition of CD73 reduces adhesion but increases the invasion/migration capacities in vitro (Bowser JL et al. J Clin Invest. 2016; 126(1 ):220-238), and treatment with adenosine (produced by CD73) inhibits cell migration and invasion. More recently, loss of CD73 has been involved in epithelial barrier misstructuration and endometrial tumor progression (Bowser JL et al. J Clin Invest. 2016; 126(1 ):220-238).
One plausible explanation of these controversial observations is that numerous factors can influence the consequence of CD73 upregulation, (i) the interaction with the
host immune function in vivo, (ii) its participation in enzymatic activities versus its function in adhesion/signaling, (iii) the destination of adenosine: receptor fixation (while A1 , A2A and A2B are pro-proliferative, A3 plays pro-apoptotic functions), or intracellular uptake (which inhibits cell growth and favors apoptosis), (iv) the intra-tumoral cellular subtype expressing CD73, (v) and the isoform that is upregulated. Considering the latter, it was recently shown that the short isoform, CD73S, is responsible for the pro-proliferative activity of CD73 (Snider NT et al. Mol Biol Cell. 2014; 25(25) :4024-4033) and for the tumor aggressiveness. This is in agreement with the higher significance of the predictive value on RFS of CD73S versus total CD73CD73S, devoid of its catalytic domain, heterodimerizes with CD73L and inhibits its nucleotidase activity (partly by targeting it to the proteasome). This may explain the increase in the CD73L/CD73S proportion in the miR-mimic condition in SCC61 cells (Figure 14A). Knocking down the short isoform alleviates the proteasomal degradation of CD73L, which results in the paradoxical increase in CD73L and in an inverse proportion of the two isoforms. With regards to the influence of the cellular sub-population (stromal or cancerous cells) overexpressing CD73 inside the tumor, an increase in the stroma associated with a decrease in the tumoral cells, is associated with a good prognosis in rectal adenocarcinoma (Zhang B, et al. Tumour Biol. 2015; 36(7):5459-5466). Considering our IHC observations, a differential labelling of the stroma and the tumor for CD73 is reported (Figure 10), which is in agreement with this publication. Taken together, CD73 is a bi-functional protein, which shares both pro- and anti-oncogenic properties depending on multiple factors.
Targeting the adenosine receptor by anti-A2A drug has reversed the resistance to doxorubicin in mice model of triple negative breast cancer model (Loi S, et al. Proc Natl Acad Sci U S A. 2013; 1 10(27):1 1091 -1 1096). However, blocking adenosine receptor only prevents a small part of the oncogenic effect of CD73, and therapeutic antibodies or pharmacological approaches targeting CD73 seem more appropriate to reach a higher therapeutic efficiency. These strategies have demonstrated anti-tumor activity in various xenograft mice models of breast, ovarian, colon and prostate cancers (Beavis PA,et al. Proc Natl Acad Sci U S A. 2013; 1 10(36):1471 1 -14716 ; Terp MG, et al. J Immunol. 2013; 191 (8):4165-4173, 42-44) and are now being developed for humans (Stagg J. Oncoimmunology. 2012; 1 (2):217-218, Zhang B. Immunotherapy. 2012; 4(9):861 -865). Indeed, the anti-CD73 monoclonal antibody MEDI9447 targets and binds to CD73, leading to its clustering and its internalization, abolishing its activity. This immunotherapy combined with anti-PD-L1 is currently under evaluation in phase I clinical trials, for adult solid tumor (NCT02503774). It is thus reasonable to think that HNSCC patients in advanced disease stages with a high intra-tumoral level of CD73 may benefit from
MEDI9447 in a near future. However, these drugs should be carefully prescribed taking into account the above mentioned considerations and the immune function of CD73. Furthermore, such an administration should be combined with a treatment preventing metastasis. The targeting of miR-422a is also plausible, with innovative therapies targeting microRNA currently being evaluated in clinical trials for different diseases. The drugs available so far can either mimic the microRNA (proMir) or inhibit it (antiMir). For example, the MiRagen Corporation developed a miR-29b mimic strategy to treat fibrosis, and following the successful preclinical assays, the company is now entering phase I of clinical trials. Regarding the antiMir strategy, Miravirsen a drug dedicated to the treatment of hepatitis C, developed by Santaris Pharma, has completed a phase 2 trials. In the near future, targeting miR-422a with this kind of molecules could represent a good therapeutic strategy for treating patients with an unfavorable-predicted response to standard radio(chemo)therapy, on the basis of their miR-422a value.
Figures:
Figure 1 : Graph demonstrating that the level of expression of miR-422a is downregulated in oropharynx tumors from patients who have experienced early loco-regional recurrence. The normalized expression level of miR-422a was determined on a TaqMan low density array (TLDA technology). MiR-422a is downregulated in tumor samples (R and NR) compared to healthy adjacent tissues (N), and in the NR versus the R subgroups (A). It is especially downregulated in NR patients exclusively with local recurrence (Local Rec.) (B). Wilcoxon tests were conducted, *p<0.05, **p<0.01 , ***p<0.001 .
Figure 2: Kaplan Meier representations of Relapse Free Survival in oropharynx tumors from patients who have experienced early loco-regional recurrence. Loco- regional recurrence (A) or only local recurrence (B) are considered.
Figure 3: Images of miR-422a localization by in situ hybridization in oropharynx tumors from patients who have experienced early loco-regional recurrence. Representative images (x200 magnification) of miR-422a localization by in situ hybridizationon 4 samples with low (D), high (A) or intermediate levels (B and C) of miR- 422a expression, as determined by RT-qPCR. An enhanced image of the outlined area (Bottom) shows an intense cytosolic and nuclear labelling in the high condition, and a faint cytosolic labelling in the "Low" condition, with intermediate levels in the "Medium" condition.
Figure 4: MiR-422a does not modulate cell response to irradiation. Clonogenic assays were conducted on three cell lines SCC61 (A), SQ20B (B) and HaCaT (C),
transfected with either miRCo (control), miRmim (mimic) or miRinhi (inhibitor). The survival fraction is plotted as a function of the dose of X-rays irradiation.
Figure 5: MiR-422a does not modulate cell response to irradiation. Cells (SCC61 (A), SQ20B (B) and HaCaT (C)) were irradiated (10Gy) 24hr post-transfection, and cell viability was determined using the CCK8 assay 5 days after irradiation (percentage of the non-irradiated condition are shown). No significant statistical differences were observed in both experiments.
Figure 6: MiR-422a modulates adhesion of SCC61 and SQ20B cells. Representation of the plating efficiency. Cells (SCC61 (A), SQ20B (B) and HaCaT (C)) were transfected with the different constructs and plated at a low density. All of the clones were fixed and counted, once the 64-cell stage had been reached in the miRCo condition. For each condition the ratio between the number of clones and the number of plated cells is shown. Figure 7: MiR-422a modulates adhesion of SCC61 and SQ20B cells. The strength of adhesion (maximal impedance signal) was determined using the xCELLigence assay. Cells (SCC61 (A), SQ20B (B) and HaCaT (C)) were transfected with the different constructs and plated, the signal was determined at full cellular confluence after 48 hr to 72 hr.
Figure 8: MiR-422a modulates adhesion of SCC61 and SQ20B cells. Fluorescence imaging of actin cytoskeleton and nucleus was conducted 48hr after transfection of the three cell lines (X40 magnification) (SCC61 (A), SQ20B (B) and HaCaT (C)).
Figure 9: Graph demonstrating the correlation between CD73 expression level and miR-422a expression levels. The CD73 expression level was determined by RT-qPCR from the same samples as those used for measuring miR-422a expression levels, and was significantly inverse correlated with miR-422a.
Figure 10: Representative images of immunohistochemically labelled CD73. The images (x200 magnification) show in grey the immunohistochemically labelled CD73 (original brown labelling), on the same samples used for ISH of Figure Figure 3, with low (A), high (D) or intermediate levels of expression of NT5E (B and C) (and High (A), medium (B and C), and low levels of miR-422a (D), respectively, as determined by RT- qPCR). An enhancement of the outlined area is shown below, and reveals an intense membranous labelling in the "High CD73" (but "Low miR-422a") condition, and a faint labelling in the "Low CD73" (but "High miR-422a") condition, with intermediate levels in the "Medium" condition.
Figure 11 : Graphs demonstrating the impact of 422a expression levels on CD73 expression. Two days after transfection with the different miRNA constructs, cells were lysed and analyzed for CD73 and GAPDH content by Western blot analysis. The two
isoforms (CD73 Long and short) are shown. The signal intensity was determined and normalized (GAPDH) for each isoform of CD73, the total intensity was set at 1 for the miPtCo condition.
Figure 12: Graphs demonstrating the impact of 422a expression levels on CD73 enzymatic activity. Measurement of the enzymatic activity of CD73. Two days after transfection, cells were incubated with 2mM of AMP for 1 hr and the final concentration of the produced inorganic phosphate (Pi) was measured in the medium. The threshold for detecting Pi was determined and is represented by a dashed line. Wilcoxon tests were conducted, *p<0.05, **p<0.01 , ***p<0.001 .
Figure 13: The silencing of CD73 phenocopies miR-422a mimic effect. The three cell lines (SCC61 (A), SQ20B (B) and HaCaT (C)) were transfected with an irrelevant siRNA (Si Co) or with two siRNA targeting CD73 (Si#1 and Si#2), and plated in different conditions. The plating efficiency was determined for A, B and C.
Figure 14: The silencing of CD73 phenocopies miR-422a mimic effect. The three cell lines (SCC61 (A), SQ20B (B) and HaCaT (C)) were transfected with an irrelevant siRNA (Si Co) or with two siRNA targeting CD73 (Si#1 and Si#2), and plated in different conditions. Cell proliferation was quantified using the CCK8 assays at days 4 and 6 post- transfection. The luminescent signal is normalized for 1 000 seeded cells. Wilcoxon tests were conducted, *p<0.05, **p<0.01 , ***p<0.001 .
Figure 15: MiR-422a and CD73 expression levels are predictive of loco(regional) recurrence. Kaplan Meier representation of Relapse Free Survival (RFS) for all of the patients (All Recur) of the oropharynx cohort, or for patients without metastasis at the time of loco-regional recurrence (Locoregional) from the same cohort.
Figure 16: Kaplan Meier representation of Relapse Free Survival (RFS) in the TCGA HNSCC Cohort. RFS was extracted from the TCGA database, for patients suffering from head and neck tumors (not restricted to oropharynx), at stages III and IV (N=255). Kaplan Meier representation of RFS as a function of total CD73 (B) for all types of recurrences (A, D) or restricted to loco-regional (B) or metastatic (C) recurrences (as first event). LogRank tests were conducted to calculate the p-values.
Figure 17: Kaplan Meier representation of Relapse Free Survival (RFS) in the TCGA HNSCC Cohort. RFS was extracted from the TCGA database, for patients suffering from head and neck tumors (not restricted to oropharynx), at stages III and IV (N=255). Kaplan Meier representation of RFS as a function of CD73S (C) for all types of recurrences (A, D) or restricted to loco-regional (B) or metastatic (C) recurrences (as first event). LogRank tests were conducted to calculate the p-values.
Figure 18: Confirmation of miR-422a downregulation in tumors from non-responder patients using custom-made RT-qPCR. The level of expression of miR-422a and of the three selected reference genes: Let.7a, miR-26a and Let.7b was determined using independent custom-made RT-qPCRs. Normalized miR-422a expression level is significantly downregulated in tumors from non-responder patients (A), particularly when they recur locally (Bt).
Figure 19: Basal characteristic of SCC61 , SQ20B and HaCaT cell lines. Basal expression levels of miR-422a (reference genes: Let.7a, miR-26a and Let.7b) (A) and CD73 (reference genes: GAPDH, RPL 19 and TBP) (B), as well as the basal plating efficiency (C), were analyzed in the three cell lines.
Figure 20: MiR-422a modulates cell proliferation but does not influence cell viability. Flow cytometry determination of Annexin-V and propidium iodide (PI) negative (ANN-/IP-) population was conducted two days after transfection of the cells (SCC61 (A), SQ20B (B) and HaCaT (C)) with the different constructs (miRCo, miRinhi, miRmim).
Figure 21 : MiR-422a modulates cell proliferation but does not influence cell viability.
Cells (SCC61 (A), SQ20B (B) and HaCaT (C)) were counted using CCK8 assay at days 4 and 6 post-transfection. Luminescence Arbitrary Unit was normalized for 1 000 seeded cells. Wilcoxon tests were conducted, *p<0.05, **p<0.01 , ***p<0.001 .
Figure 22: Inverse correlation of MiR-422a and NTE5E/CD73. MiR-422a and NTE5E/CD73 expression levels are inversely correlated MiR-422a and NTE5E/CD73 expression levels are inversely correlated in an independent HNSCC cohort from the GEO dataset. Expression data of miR-422a and CD73 were extracted from the GSE33232 SuperSeries of HNSCC. The CD73 expression level is represented as a function of miR- 422a expression (N=69 samples).
Figure 23: Two specific siRNA efficiently inhibit CD73 expression and activity. Cells were transfected either with an irrelevant siRNA (Si Co) or with two different siRNAs (Si#1 and Si#2) targeting CD73. Two days after transfection the enzymatic activity of CD73 was determined after 3h of incubation with 2mM ATP (A), and the cellular content of CD73 was determined by Western blot analysis (20μg of lysate was used for the SCC61 , 35μg for SQ20B and 70μg for HaCaT) (B).
Figure 24: Inhibition of miR-422a intensifies the recruitment of F-actin and E- cadherin at the cellular cortex. Two days after transfection of SCC61 cell lines, by miRmim, miRinh or miRCo, cells were fixed and labelled for nuclei (blue, first column), actin (green, second column) and E-cadherin (red, third column). An overlay is shown on the last column.
Figure 25: Inhibition of miR-422a intensifies the recruitment of F-actin and E- cadherin at the cellular cortex. Two days after transfection of SQ20B cell lines, by miRmim, miRinh or miRCo, cells were fixed and labelled for nuclei (blue, first column), actin (green, second column) and E-cadherin (red, third column). An overlay is shown on the last column.
Figure 26: CD73 knocking down only slightly impairs miR422a expression in SCC61 , SQ20B and HaCaT cell lines. The level of expression of miR-422a (reference genes: Let.7a, miR-26a and Let.7b) (A) and of CD73 (reference genes: ACTIN and TBP) (B) was assessed two days after transfection by a control siRNA (Si Co) or two siRNA targeting CD73 (Si#1 and Si#2).
Figure 27: The expression of the short and long isoforms of CD73 are correlated in a linear manner. The level of expression of CD73S and CD73L extracted from the TGCA cohort, are depicted. Spearman-calculated p-value is given.
Figure 28: Representation of Disease Free survival (DFS) as a function of miR- 21/miR422a subgrouping. The DFS was determined as a function of miR-21/miR422a subgrouping in the oropharynx stage lll-IV with p=0.017 (Fig. 28A) and TCGA stage lll-IV with p=0.01 cohorts (Fig. 28B).
Figure 29: Representation of Disease Free survival (DFS) as a function of miR-21 or miR422a subgrouping. The DFS was determined as a function of miR-21 (A) or miR422a (B) subgrouping in the oropharynx stage l l l-IV with p=0.035 (Fig. 29A) and p=0.029 (Fig. 29B).
Claims
1 . An in vitro method for selecting a subject who suffers from head and neck squamous cell carcinoma (HNSCC) which comprises:
a) determining the expression level of the micro-RNA miR-422a in a biological sample of said subject,
b) comparing the expression level of micro-RNA miR-422a with a miR-422a reference value,
wherein said method is for selecting a subject with head and neck squamous cell carcinoma (HNSCC) who is likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification, and said subject is selected as likely to be in need of a miR-422a mimic reagent, a CD73 inhibitor and/or treatment intensification if said subject has an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value.
2. An in vitro method for determining the chance of relapse-free survival in a subject suffering from head and neck squamous cell carcinoma (HNSCC), comprising:
a) determining the expression level of the micro-RNA miR-422a in a biological sample of said subject,
b) comparing the expression level of micro-RNA miR-422a with a miR-422a reference value,
wherein an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value indicates that the subject has a reduced chance of relapse-free survival than a subject suffering from head and neck squamous cell carcinoma (HNSCC) who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level.
3. The method according to claim 2, wherein an expression level of the micro-RNA miR- 422a as determined in step a) lower than the miR-422a reference value indicates that the subject has a 100-month relapse free survival (RFS) chance of less than 40%.
4. An in vitro method for predicting a clinical outcome in response to a treatment of head and neck squamous cell carcinoma (HNSCC) in a subject suffering from HNSCC, comprising :
a) determining the expression level of the micro-RNA miR-422a in a biological sample of said subject,
b) comparing the expression level of micro-RNA miR-422a with a miR-422a reference value,
c) based on the comparison of step b), classifying the subject as being at an increased risk of relapse,
wherein the presence of an expression level of the micro-RNA miR-422a as determined in step a) lower than the miR-422a reference value indicates that the subject has an increased risk of relapse than a subject suffering from HNSCC who has an expression level of the micro-RNA miR-422a equal to or higher than the miR-422a reference level.
5. The method according to claim 4, wherein an expression level of the micro-RNA miR- 422a as determined in step a) lower than the miR-422a reference value indicates that the subject has a 100-month risk of relapse of more than 70%.
6. The method according to any one of claims 1 to 5, wherein the biological sample is selected from the group constituted of tissue sample, blood sample, plasma, serum, saliva and urine.
7. The method according to any one of claims 1 to 6, wherein the HNSCC is selected from the group constituted of tumor in the oral cavity, tumor in the nasal cavity, tumor in the paranasal sinuses, nasopharynx tumor, larynx tumor, hypopharynx tumor and oropharynx tumor.
8. The method according to any one of claims 1 to 7, wherein the HNSCC is an oropharynx tumor.
9. The in vitro methods according to any one of claims 1 to 5 and 7 to 8, further comprising determining in step a) the expression level of miR21 and/or CD73 in said biological sample of said subject, and
further comparing in step b) the expression level of CD73 with a CD73 reference value, and/or comparing in step b) the expression level of miR21 with a miR21 reference value.
10. The in vitro method according to claim 9, wherein the expression level of miR-422a and the expression level of miR21 is measured by RT-qPCR or in situ hybridization, and/or the expression level of CD73 is measured by RT-qPCR, in situ hybridization or by immunologic methods.
1 1 . A kit for the in vitro methods as defined in any one of claims 1 to 10 comprising:
- at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-422a, and
- at least one nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding miR-21 , and/or
- at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to nucleic acids encoding CD73, and/or
- at least one isolated nucleic acid which comprises a sequence that hybridizes specifically under high stringency conditions to at least one further gene selected from the group constituted of Let.7a, miR-26a, Let.7e, RPL 19, TBP, and GAPDH.
12. A pharmaceutical composition comprising a miR-422a mimic reagent for use as a medicament.
13. The composition according to claim 12 for use in the treatment of head and neck squamous cell carcinoma (HNSCC).
14. The composition according to claim 12 or 13, wherein the miR-422a mimic reagent comprises the miR-422a sequence selected from the group consisting of SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.
15. Use of:
- a nucleic acid specifically hybridizing to a miR-422a nucleic acid sequence consisting of SEQ ID NO: 6 and/or SEQ ID NO: 7, and
- a nucleic acid specifically hybridizing to a CD73 nucleic acid sequence consisting of SEQ ID NO: 1 (CD73L) and/or SEQ ID NO: 3 (CD73S), and/or
- a nucleic acid specifically hybridizing to a miR-21 nucleic acid sequence consisting of SEQ ID NO: 18 and/or SEQ ID NO: 19,
as a primer for selecting a subject who suffers from head and neck squamous cell carcinoma (HNSCC) as defined in any one of claims 1 and 6 to 10, for determining relapse-free survival in a subject suffering from head and neck squamous cell carcinoma (HNSCC) as defined in any one of claims 2, 3 and 6 to 10, and for predicting a clinical outcome in response to a treatment of head and neck squamous cell carcinoma (HNSCC) as defined in any one of claims 4 to 10.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP16305637.7 | 2016-06-01 | ||
| EP16305637 | 2016-06-01 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2017207690A1 true WO2017207690A1 (en) | 2017-12-07 |
| WO2017207690A9 WO2017207690A9 (en) | 2018-05-11 |
Family
ID=56117659
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2017/063303 Ceased WO2017207690A1 (en) | 2016-06-01 | 2017-06-01 | Prognostic relevance of mir-422a in head and neck squamous cell carcinoma |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2017207690A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019206872A1 (en) * | 2018-04-24 | 2019-10-31 | Astrazeneca Ab | Selecting patients for therapy with adenosine signaling inhibitors |
| CN115074444A (en) * | 2022-06-30 | 2022-09-20 | 河北医科大学第二医院 | Application of miR-5189-3p in diagnosis and treatment of head and neck squamous cell carcinoma |
-
2017
- 2017-06-01 WO PCT/EP2017/063303 patent/WO2017207690A1/en not_active Ceased
Non-Patent Citations (9)
| Title |
|---|
| AN HU ET AL: "MiR-21/miR-375 ratio is an independent prognostic factor in patients with laryngeal squamous cell carcinoma", AM J CANCER RES, vol. 5, no. 5, 1 January 2015 (2015-01-01), pages 1775 - 1785, XP055317038 * |
| ANGÉLIQUE GOUGELET ET AL: "Micro-RNA profiles in osteosarcoma as a predictive tool for ifosfamide response", INTERNATIONAL JOURNAL OF CANCER, vol. 129, no. 3, 1 August 2011 (2011-08-01), pages 680 - 690, XP055030496, ISSN: 0020-7136, DOI: 10.1002/ijc.25715 * |
| GEOFFREY CHILDS ET AL: "Low-Level Expression of MicroRNAs let-7d and miR-205 Are Prognostic Markers of Head and Neck Squamous Cell Carcinoma", AMERICAN JOURNAL OF PATHOLOGY., vol. 174, no. 3, 1 March 2009 (2009-03-01), US, pages 736 - 745, XP055317296, ISSN: 0002-9440, DOI: 10.2353/ajpath.2009.080731 * |
| GIULIA COURTHOD ET AL: "The Role of microRNA in Head and Neck Cancer: Current Knowledge and Perspectives", MOLECULES ONLINE, vol. 19, no. 5, 1 January 2014 (2014-01-01), DE, pages 5704 - 5716, XP055316312, ISSN: 1433-1373, DOI: 10.3390/molecules19055704 * |
| LIMING WANG ET AL: "Identification of recurrence-related serum microRNAs in hepatocellular carcinoma following hepatectomy", CANCER BIOLOGY & THERAPY, vol. 16, no. 10, 15 July 2015 (2015-07-15), US, pages 1445 - 1452, XP055317043, ISSN: 1538-4047, DOI: 10.1080/15384047.2015.1071730 * |
| M. TURCOTTE ET AL: "CD73 Is Associated with Poor Prognosis in High-Grade Serous Ovarian Cancer", CANCER RESEARCH, vol. 75, no. 21, 1 November 2015 (2015-11-01), US, pages 4494 - 4503, XP055317259, ISSN: 0008-5472, DOI: 10.1158/0008-5472.CAN-14-3569 * |
| XIN ZHOU ET AL: "Prognostic Value of miR-21 in Various Cancers: An Updating Meta-Analysis", PLOS ONE, vol. 9, no. 7, 14 July 2014 (2014-07-14), pages e102413, XP055317246, DOI: 10.1371/journal.pone.0102413 * |
| YONG ZHOU ET AL: "miR-33a is up-regulated in chemoresistant osteosarcoma and promotes osteosarcoma cell resistance to cisplatin by down-regulating TWIST", JOURNAL OF EXPERIMENTAL & CLINICAL CANCER RESEARCH, BIOMED CENTRAL LTD, LONDON UK, vol. 33, no. 1, 27 January 2014 (2014-01-27), pages 12, XP021179182, ISSN: 1756-9966, DOI: 10.1186/1756-9966-33-12 * |
| YU-ZHOU QIN ET AL: "Screening and preliminary validation of miRNAs with the regulation of hTERT in colorectal cancer", ONCOLOGY REPORTS, 1 April 2015 (2015-04-01), GR, XP055317044, ISSN: 1021-335X, DOI: 10.3892/or.2015.3892 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019206872A1 (en) * | 2018-04-24 | 2019-10-31 | Astrazeneca Ab | Selecting patients for therapy with adenosine signaling inhibitors |
| CN115074444A (en) * | 2022-06-30 | 2022-09-20 | 河北医科大学第二医院 | Application of miR-5189-3p in diagnosis and treatment of head and neck squamous cell carcinoma |
| CN115074444B (en) * | 2022-06-30 | 2023-07-07 | 河北医科大学第二医院 | Application of miR-5189-3p in the diagnosis and treatment of head and neck squamous cell carcinoma |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2017207690A9 (en) | 2018-05-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5401460B2 (en) | MicroRNA signature in human ovarian cancer | |
| US8828656B2 (en) | Microrna-based methods and compositions for the diagnosis, prognosis and treatment of tumor involving chromosomal rearrangements | |
| EP3272880B1 (en) | Method for the diagnosis, prognosis and treatment of metastatic cancer | |
| JP2012500389A (en) | MicroRNA-based compositions and methods for diagnosis, prognosis and treatment of multiple myeloma | |
| JP2010525826A (en) | Composition comprising a MIR34 therapeutic for treating cancer | |
| US20110166200A1 (en) | Methods of using mir210 as a biomarker for hypoxia and as a therapeutic agent for treating cancer | |
| JP2009505639A (en) | MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer | |
| CN101861401A (en) | Methods and compositions for diagnosis and treatment of esophageal adenocarcinoma | |
| EP2414549A2 (en) | Differentially expressed micrornas as biomarkers for the diagnosis and treatment of sjögren's syndrome | |
| US20190276831A1 (en) | Lung cancer diagnostics and therapeutics with mir-660 | |
| JP5931897B2 (en) | Materials and methods associated with microRNA-21, mismatch repair and colorectal cancer | |
| JP2017006137A (en) | miRNA USEFUL TO REDUCE LUNG CANCER TUMORIGENESIS AND CHEMOTHERAPY RESISTANCE AND RELATED COMPOSITION AND METHOD | |
| Zhang et al. | RETRACTED ARTICLE: microRNA-877 inhibits malignant progression of colorectal cancer by directly targeting MTDH and regulating the PTEN/Akt pathway | |
| US20140045924A1 (en) | Melanoma treatments | |
| Tang et al. | Circ_0085616 contributes to the radio-resistance and progression of cervical cancer by targeting miR-541-3p/ARL2 signaling | |
| CN108220446B (en) | Application of LINC01356 as molecular marker in gastric cancer | |
| CN108165632B (en) | Application of LINC01426 in diagnosis and treatment of hepatocellular carcinoma | |
| CN118512468A (en) | Pharmaceutical composition for preventing or treating cancer comprising terminal uridyl transferase 4/7 expression regulatory factor | |
| WO2017207690A1 (en) | Prognostic relevance of mir-422a in head and neck squamous cell carcinoma | |
| US20220145395A1 (en) | Transpochimeric Gene Transcripts (TCGTS) As Cancer Biomarkers | |
| US20120190729A1 (en) | Mirna inhibition of six1 expression | |
| CN117721204A (en) | ceRNA regulatory mechanism of circ0104727 and its application in glioma | |
| CN111424092B (en) | Detection gene and application thereof | |
| JP7226763B2 (en) | Agent for reducing drug resistance in cancer stem cells, inhibitor for metastatic potential in cancer stem cells, and method for predicting risk of metastatic recurrence of cancer | |
| CN109811059B (en) | Application of biomarker UGGT1 in cervical diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17728511 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17728511 Country of ref document: EP Kind code of ref document: A1 |




