WO2017197322A1 - Drought tolerant plants - Google Patents
Drought tolerant plants Download PDFInfo
- Publication number
- WO2017197322A1 WO2017197322A1 PCT/US2017/032502 US2017032502W WO2017197322A1 WO 2017197322 A1 WO2017197322 A1 WO 2017197322A1 US 2017032502 W US2017032502 W US 2017032502W WO 2017197322 A1 WO2017197322 A1 WO 2017197322A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- plant
- expressed
- protein
- putative
- drought
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
Definitions
- the present invention relates generally to the field of molecular biology. More specifically, the invention relates to plant genes involved in drought tolerance and methods of use thereof.
- Drought is a major constraint to crop production worldwide.
- the greenhouse effect is predicted to raise temperatures and to prolong droughts.
- Human-induced climate change is predicted to put pressure on the supply of water for agriculture.
- the world population is estimated to exceed 9.5 billion by the year 2050. Therefore, central to long-term agricultural security is implementing a sustainable system that is more resilient and productive, while at the same time requires less of the increasingly costly inputs such as water.
- the present invention provides a method of increasing drought tolerance in a plant, comprising expressing in the plant a heterologous receptor kinase XA21 coding region, wherein the drought tolerance of the plant is increased when compared to a control plant that lacks the expressing of the heterologous XA21 coding region.
- the expressing comprises introducing into the plant a DNA construct comprising the heterologous receptor kinase XA21 coding region operably linked to a native receptor kinase XA21 promoter.
- the expressing comprises introducing into the plant a DNA construct comprising the heterologous receptor kinase XA21 coding region operably linked to a heterologous promoter functional in the plant.
- the promoter is a constitutive or inducible promoter.
- the heterologous receptor kinase XA21 coding region comprises a polynucleotide sequence at least 85%, 90%, 95%, 97%, 98% 99%, or 100% identical to the rice receptor kinase XA21 coding region (SEQ ID NO: l), or a homolog thereof.
- the heterologous receptor kinase XA21 coding region comprises a polynucleotide sequence encoding an XA21 protein at least 90%, 95%, 97%, 98%, 99% or 100% identical to the rice receptor kinase XA21 protein (SEQ ID NO:2), or a homolog thereof.
- the plant is a monocotyledonous plant, such as a monocotyledonous plant selected from the group consisting of maize, wheat, rice, sorghum (Sorghum bicolor), oats, barley, sugar cane, African oil palm (Elaeis guineensis), or switchgrass.
- a monocotyledonous plant selected from the group consisting of maize, wheat, rice, sorghum (Sorghum bicolor), oats, barley, sugar cane, African oil palm (Elaeis guineensis), or switchgrass.
- the plant is a dicotyledonous plant, such as a dicotyledonous plant selected from the group consisting of Arabidopsis, peanut (Arachis hypogaea), barrel medic (Medicago truncatula), carrot, soybean ⁇ Glycine max), cotton, Brassica, canola, tomato, potato, alfalfa, grape, clover, poplar, willow, eucalyptus, hemp, a Lotus sp., a Vinca sp., a Nicotiana sp., a Vitis sp., or a Ricinus sp.
- a dicotyledonous plant selected from the group consisting of Arabidopsis, peanut (Arachis hypogaea), barrel medic (Medicago truncatula), carrot, soybean ⁇ Glycine max), cotton, Brassica, canola, tomato, potato, alfalfa, grape, clover, poplar, willow, eucalypt
- the present invention further provides a plant, or part thereof, expressing a heterologous receptor kinase XA21 coding region, wherein drought tolerance of the plant or part thereof is increased when compared to a control plant or part thereof that lacks the expressing of the heterologous XA21 coding region.
- the expressing comprises introducing into the plant or part thereof a DNA construct comprising the heterologous receptor kinase XA21 coding region operably linked to a native receptor kinase XA21 promoter.
- the overexpressing comprises introducing into the plant or part thereof a DNA construct comprising the heterologous receptor kinase XA21 coding region operably linked to a heterologous promoter functional in the plant or part thereof.
- the part thereof is a cell, meristem, root, leaf, node, pistil, anther, flower, seed, embryo, stalk or petiole.
- the present invention additionally provides a method of producing food for human or animal consumption, comprising obtaining a plant, or part thereof, expressing a heterologous receptor kinase XA21 coding region, wherein drought tolerance of the plant or part thereof is increased when compared to a control plant or part thereof that lacks the expressing, and preparing food for human or animal consumption from the plant or part thereof.
- the food is starch, protein, meal, flour or grain.
- the present invention also provides a method of increasing drought tolerance in a rice plant, comprising introducing into the rice plant a DNA construct comprising the rice receptor kinase XA21 coding region or a heterologous receptor kinase XA21 coding region operably linked to a heterologous promoter functional in the rice plant, wherein the drought tolerance of the rice plant is increased when compared to a control rice plant that lacks the XA21 coding region or heterologous XA21 coding region.
- the present invention further provides a method of producing a drought tolerant plant, comprising crossing a plant expressing a heterologous receptor kinase XA21 coding region, wherein drought tolerance of the plant is increased when compared to a control plant that lacks the expressing of the XA21 coding region, with a second plant to produce at least a first progeny plant comprising drought tolerance.
- the drought tolerant plant is a drought tolerant rice plant.
- the present invention additionally provides a method of increasing drought tolerance in a plant, comprising introducing into the plant a DNA construct comprising a heterologous receptor kinase XA21 coding region operably linked to a promoter, and selecting a progeny plant that has increased drought tolerance when compared to a control plant that lacks the DNA construct.
- the promoter is a drought-inducible promoter.
- FIG. 1 A double-tagged XA21 confers resistance to Xoo PX099A.
- FIG. 1A Schematic representation of a double-tagged XA21. An 8,739 bp genomic fragment containing the Xa21 coding region, its own intron (not indicated in FIG. 1A) and the native 5' and 3' regulatory sequences was used to express the gene. Domains of XA21 were as described previously (Song, et al., Science 270: 1804-1806, 1995): LRRs, leucine-rich repeats; TM, transmembrane domain; JM, juxtamembrane domain.
- FIG. 3. XA21 confers tolerance to drought in rice.
- FIG. 3A RWC of A36 and B7-12 plants during the course of drought treatment. # indicates the day at which A36 leaves were rolled.
- FIG. 3B Survival rates of the drought-treated seedlings.
- FIG. 4B The XA21 line 4021-3 is tolerant to drought. Survival rates of the stress-treated seedlings.
- transgenic lines containing Xa21 are often more resistant to Xoo PX099A than the introgression line IRBB21, likely due to higher levels of transgene expression (Song, et al., Science 270: 1804-1806, 1995).
- FIG. 6. XA21 potentiates expression of drought-related genes in response to water stress.
- Four DEGs identified by RNA-seq, OsLEAl (FIG. 6A), OsLEA3 (FIG. 6B), OsLEA33 (FIG. 6C), and OsNACIO (FIG. 6D) were validated in A36 (blue) and B7-12 (pink) seedlings using q-PCR.
- FIG. 7 Severe drought-stress induces XA21 -dependent defense against the compatible Xoo strain DY87031.
- Two-week-old A36 and B7-12 seedlings were inoculated with Xoo strain DY87031 and incubated with or without 13% PEG to initiate disease development.
- the asterisk signs indicate statistically significant difference from the control A36 (treated with 13% PEG) as calculated using Student's t test (*: p ⁇ 0.05; **: p ⁇ 0.01).
- FIG. 8 Suppression of XA21 -mediated resistance to the incompatible Xoo strain PX099A by PEG or ABA.
- Two-week-old A36 and B7-12 seedlings were inoculated with Xoo PX099A and incubated with or without 13% PEG (FIG. 8A and FIG. 8B) or ABA (FIG. 8C and FIG. 8D).
- the asterisk signs indicate statistically significant difference from the control B7-12 (water, FIG. 8A and FIG. 8B) or B7-12 (0 ⁇ ABA, FIG. 8C and FIG. 8D) as calculated using Student's t test (*: p ⁇ 0.05; **: p ⁇ 0.01).
- FIG. 9 The rice Xb3 gene acts as a drought regulator.
- FIG. 9A Survival rates of the drought-treated lines.
- FIG. 9B Survival rates of the indicated lines after drought stress.
- FIG. 10 XA21 regulates XB3 nuclear accumulation. Structure and domain organization of XB3.
- the predicted XB3 domains include an N-terminal putative myristoylation motif in which the myristoylation residue G (Gly-2) is indicated, an ankyrin domain, a RING finger (RF) motif and the C-terminal region possessing a newly identified NLS (the basic residues underlined, the number indicates position of the Lys residue in the full-length XB3).
- the insertion sites for eGFP and mCherry are shown.
- FIG. 11 Working model for XA21 -mediated immunity.
- XA21-mediated defense signaling green dashed lines
- drought stress With the Xoo levels reaching a plateau in the xylem vessels, drought stress becomes evident, which in turn activates XA21-mediated drought signaling (red lines) that involves a release of XB3 from the XA21 complex into the nucleus, where the E3 ubiquitin ligase might degrade a substrate(s) for tolerance to drought.
- transgenic plants expressing an Xa21 gene displayed strong drought tolerance, as compared to control plants that lack the Xa21 gene.
- the invention thus represents a significant advance in the art by providing methods and compositions that permit engineering of plants for drought tolerance. In this manner, agronomic performance of crop plants may be increased, particularly when plants are subject to osmotic stress at any given stage of growth. This is particularly important in avoiding crop loss and also in increasing water use efficiency.
- the invention thus provides methods and compositions for obtaining improvements in osmotic stress tolerance.
- expression cassettes comprising an Xa21 nucleotide sequence are described operably linked to a promoter that directs expression or overexpression of the Xa21 nucleotide sequence in the plant cell.
- a plurality of XA21 transgenic plants are generated, and plants having improved drought tolerance compared to a control plant are selected.
- Innate immunity plays an important role in protecting evolutionarily diverse species from pathogen infection.
- PRRs pattern- recognition receptors
- PAMPs or MAMPs pathogen- or microbe-associated molecular patterns
- receptors for recognizing virulence effectors produced by pathogens for manipulating PAMP-triggered immunity and/or host cell physiology
- Plant PRRs are cell-surface proteins belonging to receptor kinase and receptor-like protein superfamilies, whereas the majority of effector-recognizing receptors are intracellular proteins possessing nucleotide-binding (NB) and leucine-rich repeat (LRR) domains (Couto and Zipfel, Nat. Rev. Immunol. 16:537-552, 2016; Dangl and Jones, Nature 411:826-833, 2001).
- NB nucleotide-binding
- LRR leucine-rich repeat
- PRRs include Arabidopsis flagellin sensitive 2 (FLS2), elongation factor receptor (EFR) and chitin elicitor receptor kinase 1 (CREK1) that recognize bacterial flagellin, elongation factor Tu (EF-Tu) and the fungal cell wall component chitin, respectively (Gomez-Gomez and Boiler, Mol. Cell 5: 1003-1011, 2000; Zipfel, et al., Cell 125:749-760, 2006; Miya, et al., Proc. Natl. Acad. Sci. USA 104: 19613-19618, 2007).
- FLS2 Arabidopsis flagellin sensitive 2
- EFR elongation factor receptor
- CREK1 chitin elicitor receptor kinase 1
- NB-LRR proteins are encoded by classic disease resistance genes and NB-LRR-encoding sequences represent one of the largest gene families in plants (Meyers, et al., Plant Cell 15:809-834, 2003; Sanseverino, et al., Nucleic Acids Res. 38(Database issue):D814-821, 2010).
- immune receptors mobilize a defense response leading to restriction of pathogen proliferation.
- Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight disease of rice (Oryza sativa L.). After entering leaves, Xoo exclusively accumulates and spreads in xylem vessels, causing phenotypes (i.e., leaf rolling and wilting) similar to those seen in plants stressed by drought (Nino-Liu, et al., Mol. Plant Pathol. 7:303-324, 2006).
- the product of the rice gene Xa21 confers resistance to Xoo and is among the first cell- surface receptors identified in the innate immune system of plants and animals (Song, et al, Science 270: 1804-1806, 1995; Chen, et al, Mol. Plant. 3:917-926, 2010; Park, et al, PLoS One 5:e9262, 2010).
- XA21 is a LRR-receptor kinase whose intracellular domain belongs to the non-RD subclass of the receptor-like kinase/Pelle family (Song, et al, Science 270: 1804-1806, 1995; Dardick and Ronald, PLoS Pathog. 2:e2, 2006).
- incompatible Xoo strains ⁇ e.g., PX099A
- PX099A incompatible Xoo strains
- XA21 is constitutively expressed and likely forms stable protein complexes with XA21 binding proteins (XBs) in multiple subcellular compartments.
- XBs XA21 binding proteins
- XA21 is also localized to the endoplasmic reticulum (ER) (Park, et ah, PLoS One 5:e9262, 2010).
- the first reported XA21 binding partner XB3 possesses an N-terminal myristoylation site, eight imperfect copies of ankyrin repeats, a RING finger (RF) domain, and a C-terminal region (XB3-C) (Wang, et al, 2006, supra).
- XB3 binds to the intracellular domain of XA21 through its ankyrin repeats, while the RF motif of XB3 is responsible for ubiquitin ligase activity.
- the Xb3 gene is required for full XA21 accumulation and resistance. When over- expressed in Nicotiana benthamiana ⁇ N.
- XB3 and its orthologs from diverse plant species are capable of triggering rapid cell death (Huang, et al, PLoS One 8: e63868, 2013). Despite these informative findings, the function and subcellular localization of XB3 are not fully understood.
- XA21 ncp can also be detected in microsomal fractions and XA21 immunoprecipitates (Park, et ah, 2010, supra; Wang, et ah, 2006, supra; Chen, et ah, 2010, supra; Jiang, et al., 2013, supra; Xu, et al., 2006, supra; Park and Ronald, Nat. Commun. 3:920, 2012).
- the C-terminal portion of cleaved XA21 (XA21 ccp , -37 kDa) is detectable in the nucleus (Park and Ronald, 2012, supra).
- XA21 signaling has a significant role in counteracting drought, which is surprising and unexpected because an immune sensor has never before been assigned a similar function under physiological conditions.
- Certain embodiments of the current invention concern the use of recombinant nucleic acid sequences comprising an Xa21 coding sequence.
- Complements to any nucleic acid sequences described herein can also be used in certain embodiments.
- Xa21 homologs Long, et al., Plant Cell 9: 1279-1287, 1997) can also be used in some aspects of the present invention.
- nucleic acids and polypeptides are used that have at least about 80% (percent) sequence identity, about 85% sequence identity, about 90% sequence identity, about 91% sequence identity, about 92% sequence identity, about 93% sequence identity, about 94% sequence identity, about 95% sequence identity, about 96% sequence identity, about 97% sequence identity, about 98% sequence identity, and about 99% sequence identity to any of the nucleic acid or protein sequences described herein.
- percent sequence identity refers to the percentage of identical nucleotides or amino acids in a linear polynucleotide or polypeptide sequence of a reference (“query”) sequence (or its complementary strand) as compared to a test ("subject") sequence (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide or amino acid insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the window of comparison).
- Methods to determine “percent sequence identity” are codified in numerous publicly available programs including, but are not limited to, GCG (also known as The Wisconsin PackageTM), and the BLAST programs that are publicly available from NCBI.
- Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools including, but not limited to, the local homology algorithm of Smith and Waterman (Adv. Appl. Math. 2:482-489, 1981), the homology alignment algorithm of Needleman and Wunsch (J. Mol. Biol. 48:443-453, 1970), and the search for similarity method of Lipman and Pearson (Science 227: 1435-1441, 1985).
- nucleic acids for use in the present invention may be from any source, e.g., identified as naturally occurring in a plant, or synthesized, e.g., by mutagenesis.
- the naturally occurring sequence may be from any plant.
- the plant may be a dicotyledonous plant, for example, Arabidopsis, peanut (Arachis hypogaea), barrel medic (Medicago truncatula), carrot, soybean (Glycine max), cotton, Brassica, canola, tomato, potato, alfalfa, grape, clover, poplar, willow, eucalyptus, hemp, a Lotus sp., a Vinca sp., a Nicotiana sp., a Vitis sp., or a Ricinus sp..
- a plant useful for the present invention may be a monocotyledonous plant, for example maize, wheat, rice, sorghum (Sorghum bicolor), oats, barley, sugar cane, African oil palm (Elaeis guineensis), or switchgrass.
- sorghum Sorghum bicolor
- oats barley
- sugar cane African oil palm
- African oil palm Elaeis guineensis
- Coding sequences used in the present invention may be provided in a recombinant vector operably linked to a homologous or heterologous promoter functional in plants. Expression constructs may also be used comprising these sequences. In other embodiments, plants and plant cells transformed with the sequences may be provided.
- the construction of vectors which may be employed in conjunction with plant transformation techniques using these or other sequences according to the invention will be known to those of skill of the art in light of the present disclosure (see, for example, Sambrook, et al, Molecular Cloning: a Laboratory Manual, Volume 3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). The techniques of the current invention are thus not limited to the use of any particular nucleic acid sequences.
- Vectors used for plant transformation may include, for example, plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes) or any other suitable cloning system, as well as fragments of DNA therefrom.
- vector or "expression vector” is used, all of the foregoing types of vectors, as well as nucleic acid sequences obtained therefrom and otherwise, are included.
- DNA segments used for transforming plant cells will generally comprise the cDNA, gene or genes which one desires to introduce into and have expressed in the host cells. These DNA segments can further include structures such as promoters, enhancers, polylinkers, or even regulatory genes as desired.
- the DNA segment or gene chosen for cellular introduction will often encode a protein which will be expressed in the resultant recombinant cells resulting in a screenable or selectable trait and/or which will impart an improved phenotype to the resulting transgenic plant.
- Preferred components likely to be included with vectors used in the current invention are as follows.
- exemplary promoters for expression of a nucleic acid sequence include plant promoters such as the CaMV 35S (Odell, et al, Nature 313:810-812, 1985), CaMV 19S (Lawton, et al, Plant Mol. Biol. 9:315-324, 1987), nos (Ebert, et al, Proc. Natl. Acad. Sci. USA 84:5745-5749, 1987), actin (Wang, et al, Mol. Cell. Biol. 12:3399-3406, 1992), UDP glucose flavonoid glycosyl-transferase gene promoter (Ralston, et al, Genet.
- plant promoters such as the CaMV 35S (Odell, et al, Nature 313:810-812, 1985), CaMV 19S (Lawton, et al, Plant Mol. Biol. 9:315-324, 1987), nos (Ebert, et al, Proc. Natl. Aca
- Tissue-specific promoters such as Adh (Walker, et ah, Proc. Natl. Acad. Sci. USA 84:6624-6628, 1987), sucrose synthase (Yang and Russell, Proc. Natl. Acad. Sci. USA 87:4144-4148, 1990), a-tubulin (Kim and An, Transgenic Research 1: 188-194, 1992), cab (Sullivan, et al., Mol. Gen. Genet. 215:431-440, 1989), PEPCase (Hudspeth and Grula, Plant Mol. Biol.
- tissue selective promoters and tissue- specific enhancers are also contemplated to be useful in certain embodiments, as are inducible promoters such as ABA- and turgor-inducible promoters, as well as drought- inducible promoters.
- inducible promoters such as ABA- and turgor-inducible promoters, as well as drought- inducible promoters.
- Any suitable promoters known in the art may be used to express XA21 coding sequences in a plant.
- a drought-inducible or osmotic stress-inducible promoter may be used to express XA21 coding sequences in a plant.
- leader sequences are contemplated to include those which comprise sequences predicted to direct optimum expression of the attached gene, i.e., to include a consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure.
- sequences that are derived from genes that are highly expressed in plants may be used for expression of XA21 coding sequences.
- Transformation constructs prepared in accordance with the invention may include a 3' end DNA sequence that acts as a signal to terminate transcription and allow for the polyadenylation of the mRNA produced by coding sequences operably linked to a promoter.
- the native terminator of a XA21 coding sequence may be used.
- a heterologous 3' end may enhance the expression of XA21 coding sequences.
- terminators that may be used in this context include those from the nopaline synthase gene of Agrobacterium tumefaciens (nos 3' end) (Bevan, et al., Nucl. Acids Res.
- T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens
- the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens
- the 3' end of the protease inhibitor I or II gene from potato or tomato.
- Regulatory elements such as an Adh intron (Callis, et al., Genes Dev. 1: 1183-1200, 1987), sucrose synthase intron (Vasil, et al, Plant Physiol. 91: 1575-1579, 1989) or TMV omega element (Gallie, et al., The Plant Cell 1:301-311,1989), may further be included in certain embodiments where desired.
- Sequences that are joined to the coding sequence of an expressed gene, which are removed post-translationally from the initial translation product and which facilitate the transport of the protein into or through intracellular or extracellular membranes, are termed transit (usually into vacuoles, vesicles, plastids and other intracellular organelles) and signal sequences (usually to the endoplasmic reticulum, Golgi apparatus and outside of the cellular membrane).
- transit usually into vacuoles, vesicles, plastids and other intracellular organelles
- signal sequences usually to the endoplasmic reticulum, Golgi apparatus and outside of the cellular membrane.
- translatable mRNA in front of the gene may increase the overall stability of the mRNA transcript from the gene and thereby increase synthesis of the gene product. Since transit and signal sequences are usually post- translationally removed from the initial translation product, the use of these sequences allows for the addition of extra translated sequences that may not appear on the final polypeptide. It further is contemplated that targeting of certain proteins may be desirable in order to enhance the stability of the protein (U.S. Patent No. 5,545,818, incorporated herein by reference in its entirety).
- vectors may be constructed and employed in the intracellular targeting of a specific gene product within the cells of a transgenic plant or in directing a protein to the extracellular environment. This generally will be achieved by joining a DNA sequence encoding a transit or signal peptide sequence to the coding sequence of a particular gene. The resultant transit or signal peptide will transport the protein to a particular intracellular or extracellular destination, respectively, and will then be post-translationally removed.
- Marker genes are genes that impart a distinct phenotype to cells expressing the marker protein and thus allow such transformed cells to be distinguished from cells that do not have the marker. Such genes may encode either a selectable or screenable marker, depending on whether the marker confers a trait which one can "select” for by chemical means, i.e., through the use of a selective agent (e.g., a herbicide, antibiotic, or the like), or whether it is simply a trait that one can identify through observation or testing, i.e., by "screening” (e.g., the green fluorescent protein).
- a selective agent e.g., a herbicide, antibiotic, or the like
- screening e.g., the green fluorescent protein
- neo Paneo
- Mol. Gen. Genet. 199: 183-188, 1985 which provides kanamycin resistance and can be selected for using kanamycin, G418, paromomycin, etc.
- bar which confers bialaphos or phosphinothricin resistance (Rathore, et al, Plant Mol. Biol. 21:871-884, 1993); a mutant EPSP synthase protein (Hinchee, et ah, Bio/Technol.
- glyphosate resistance conferring glyphosate resistance
- a nitrilase such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker, et ah, Science 242:419-423, 1988); a mutant acetolactate synthase (ALS) which confers resistance to imidazolinone, sulfonylurea or other ALS inhibiting chemicals (European Patent Application 154204, 1985); a methotrexate resistant DHFR (Thillet, et al, J. Biol. Chem.
- selectable marker capable of being used in systems to select transformants are those that encode the enzyme phosphinothricin acetyltransferase, such as the bar gene from Streptomyces hygroscopicus or the pat gene from Streptomyces viridochromogenes.
- the enzyme phosphinothricin acetyl transferase (PAT) inactivates the active ingredient in the herbicide bialaphos, phosphinothricin (PPT). PPT inhibits glutamine synthetase (Murakami, et al., Mol. Gen. Genet. 205:42-50, 1986; Twell, et ah, Plant Physiol. 91: 1270-1274, 1989), causing rapid accumulation of ammonia and cell death.
- transgenic plants transformed with the above-identified recombinant vectors encoding XA21, or a sequence modulating up-regulation thereof, and exhibiting tolerance to drought.
- Suitable methods for transformation of plant or other cells for use with the current invention are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts (Omirulleh, et al, Plant Mol. Biol. 21:415-428, 1993), by desiccation/inhibition-mediated DNA uptake (Potrykus, et al., Mol. Gen. Genet. 199: 183-188, 1985), by electroporation (U.S. Patent No.
- Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast.
- the use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described by Horsch, et al. (Science 227: 1229-1231, 1985), Rogers and Klee ⁇ Plant DNA Infectious Agents, Chapter 7, Springer- Verlag/Wein, 1987) and U.S. Patent No. 5,563,055, specifically incorporated herein by reference in its entirety.
- Agrobacterium-mediated transformation is most efficient in dicotyledonous plants and is the preferable method for transformation of dicots, including Arabidopsis, tobacco, tomato, alfalfa and potato. Indeed, while Agrobacterium-mediated transformation has been routinely used with dicotyledonous plants for a number of years, including alfalfa (Thomas, et al., Plant Sci. 69: 189-198, 1990), it has only more recently become applicable to monocotyledonous plants. Advances in Agrobacterium-mediated transformation techniques have now made the technique applicable to nearly all monocotyledonous plants. For example, Agrobacterium-mediated transformation techniques have now been applied to rice (Hiei, et al., Plant Mol. Biol.
- One also may employ protoplasts for electroporation transformation of plants (Bates, Mol. Biotechnol. 2: 135-145, 1994; Lazzeri, Methods Mol. Biol. 49:95-106, 1995).
- Another method for delivering transforming DNA segments to plant cells in accordance with the invention is microprojectile bombardment (U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,880; U.S. Patent No. 5,610,042; and PCT Application WO 94/09699; each of which is specifically incorporated herein by reference in its entirety).
- particles may be coated with nucleic acids and delivered into cells by a propelling force.
- the transgenic plants of the present invention expressing heterologous XA21 and exhibiting drought tolerance can be of any species.
- the plants can be an RO transgenic plant (i.e., a plant derived from the original transformed tissue).
- the plants can also be a progeny plant of any generation of an RO transgenic plant, wherein the transgenic plant comprises the nucleic acid sequence from the RO transgenic plant.
- Seeds of the above-described transgenic plants may also be provided, particularly where the seed comprises the nucleic acid sequence.
- the host cells transformed with the above-identified recombinant vector are contemplated.
- the host cell is a plant cell.
- the plants of these embodiments having increased or enhanced expression of XA21 and drought tolerance may be of any species.
- the species may be any monocotyledonous or dicotyledonous plant, such as those described herein.
- One of skill in the art will recognize that the present invention may be applied to plants of other species by employing methods described herein and others known in the art.
- Tissue cultures may be used in certain transformation techniques for the preparation of cells for transformation and for the regeneration of plants therefrom. Maintenance of tissue cultures requires use of media and controlled environments. "Media” refers to the numerous nutrient mixtures that are used to grow cells in vitro, that is, outside of the intact living organism. A medium usually is a suspension of various categories of ingredients (salts, amino acids, growth regulators, sugars, buffers) that are required for growth of most cell types. However, each specific cell type requires a specific range of ingredient proportions for growth, and an even more specific range of formulas for optimum growth. The rate of cell growth also will vary among cultures initiated with the array of media that permit growth of that cell type.
- the next steps generally concern identifying the transformed cells for further culturing and plant regeneration.
- a selectable or screenable marker gene with a transformation vector prepared in accordance with the invention.
- Potentially transformed cells then are exposed to the selective agent.
- the population of surviving cells will be those cells where, generally, the resistance- conferring gene has been integrated and expressed at sufficient levels to permit cell survival. Cells may be tested further to confirm stable integration of the exogenous DNA.
- One herbicide which constitutes a desirable selection agent is the broad-spectrum herbicide bialaphos.
- Another example of a herbicide which is useful for selection of transformed cell lines in the practice of the invention is the broad-spectrum herbicide glyphosate.
- Glyphosate inhibits the action of the enzyme EPSPS which is active in the aromatic amino acid biosynthetic pathway. Inhibition of this enzyme leads to starvation for the amino acids phenylalanine, tyrosine, and tryptophan and secondary metabolites derived therefrom.
- U.S. Patent No. 4,535,060 describes the isolation of EPSPS mutations which confer glyphosate resistance on the EPSPS of Salmonella typhimurium, encoded by the gene aroA.
- the EPSPS gene from Zea mays was cloned and mutations similar to those found in a glyphosate resistant aroA gene were introduced in vitro. Mutant genes encoding glyphosate resistant EPSPS enzymes are described in, for example, International Patent Application Publication Number WO 97/4103.
- the transformed cells identified by selection or screening and cultured in an appropriate medium that supports regeneration, will then be allowed to mature into plants.
- Developing plantlets can be transferred to soilless plant growth mix, and hardened, e.g., in an environmentally controlled chamber, for example, at about 85% relative humidity, 600 ppm C0 2 , and 25-250 microeinsteins m-2 s-1 of light.
- Plants may be matured in a growth chamber or greenhouse. Plants can be regenerated after a transformant is identified, depending on the initial tissue.
- cells are grown on solid media in tissue culture vessels. Illustrative embodiments of such vessels are petri dishes and Plant Cons.
- Regenerating plants can be grown at about 19 to 28°C, for example. After the regenerating plants have reached the stage of shoot and root development, they may be transferred to a greenhouse for further growth and testing.
- assays include, for example, “molecular biological” assays, such as Southern and Northern blotting and PCRTM; “biochemical” assays, such as detecting the presence of a protein product, e.g. , by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant.
- the expression of a gene product is often determined by evaluating the phenotypic results of its expression.
- bioassays also may take many forms including but not limited to analyzing changes in the chemical composition, morphology, or physiological properties of the plant.
- Chemical composition may be altered by expression of genes encoding enzymes or storage proteins which change amino acid composition and may be detected by amino acid analysis, or by enzymes that change starch quantity which may be analyzed by near infrared reflectance spectrometry. Morphological changes may include greater stature or thicker stalks. Most often changes in response of plants or plant parts to imposed treatments are evaluated under carefully controlled conditions termed bioassays.
- bioassays Such assays for determining drought tolerance are well-described herein BREEDING PLANTS OF THE INVENTION
- transgenic plants may be made by crossing a plant having a selected DNA of the invention to a second plant lacking the construct.
- a selected XA21 coding sequence can be introduced into a particular plant variety by crossing, without the need for ever directly transforming a plant of that given variety. Therefore, the current invention not only encompasses a plant directly transformed or regenerated from cells which have been transformed in accordance with the current invention, but also the progeny of such plants.
- progeny denotes the offspring of any generation of a parent plant prepared in accordance with the instant invention, wherein the progeny comprises a selected DNA construct prepared in accordance with the invention.
- Crossing a plant to provide a plant line having one or more added transgenes relative to a starting plant line, as disclosed herein, is defined as the techniques that result in a transgene of the invention being introduced into a plant line by crossing a plant of a starting line with a plant of a donor plant line that comprises a transgene of the invention.
- Backcrossing is herein defined as the process including the steps of: (a) crossing a plant of a first genotype containing a desired gene, DNA sequence or element to a plant of a second genotype lacking the desired gene, DNA sequence or element; (b) selecting one or more progeny plant containing the desired gene, DNA sequence or element; (c) crossing the progeny plant to a plant of the second genotype; and (d) repeating steps (b) and (c) for the purpose of transferring a desired DNA sequence from a plant of a first genotype to a plant of a second genotype. In any one or more generations of crossing, selection may be made for drought tolerance, yielding drought tolerant progeny.
- Intro gression of a DNA element into a plant genotype is defined as the result of the process of backcross conversion.
- a plant genotype into which a DNA sequence has been introgressed may be referred to as a backcross converted genotype, line, inbred, or hybrid.
- a plant genotype lacking the desired DNA sequence may be referred to as an unconverted genotype, line, inbred, or hybrid.
- Expression The combination of intracellular processes, including transcription and translation, undergone by a coding DNA molecule such as a structural gene to produce a polypeptide.
- Genetic Transformation A process of introducing a DNA sequence or construct (e.g. , a vector or expression cassette) into a cell or protoplast in which that exogenous DNA is incorporated into a chromosome or is capable of autonomous replication.
- a DNA sequence or construct e.g. , a vector or expression cassette
- Heterologous A sequence which is not normally present in a given host genome in the genetic context in which the sequence is currently found. In this respect, the sequence may be native to the host genome, but be rearranged with respect to other genetic sequences within the host sequence. For example, a regulatory sequence may be heterologous in that it is linked to a different coding sequence relative to the native regulatory sequence.
- Obtaining When used in conjunction with a transgenic plant cell or transgenic plant, obtaining means either transforming a non-transgenic plant cell or plant to create the transgenic plant cell or plant, or planting transgenic plant seed to produce the transgenic plant cell or plant. Such a transgenic plant seed may be from an R0 transgenic plant or may be from a progeny of any generation thereof that inherits a given transgenic sequence from a starting transgenic parent plant.
- Overexpression The increase in the expression of a DNA or RNA transcript and/or the function or activity of a protein relative to a control or naturally- occurring counterpart.
- Promoter A recognition site on a DNA sequence or group of DNA sequences that provides an expression control element for a structural gene and to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that gene.
- R0 transgenic plant A plant that has been genetically transformed or has been regenerated from a plant cell or cells that have been genetically transformed.
- Regeneration The process of growing a plant from a plant cell (e.g. , plant protoplast, callus or explant).
- a plant cell e.g. , plant protoplast, callus or explant.
- Selected DNA A DNA segment which one desires to introduce or has introduced into a plant genome by genetic transformation.
- Transformation construct A chimeric DNA molecule which is designed for introduction into a host genome by genetic transformation.
- Preferred transformation constructs will comprise all of the genetic elements necessary to direct the expression of one or more exogenous genes.
- Transformed cell A cell in which the DNA complement has been altered by the introduction of an exogenous DNA molecule into that cell.
- Transgene A segment of DNA which has been incorporated into a host genome or is capable of autonomous replication in a host cell and is capable of causing the expression of one or more coding sequences. Exemplary transgenes will provide the host cell, or plants regenerated therefrom, with a novel phenotype relative to the corresponding non-transformed cell or plant. Transgenes may be directly introduced into a plant by genetic transformation, or may be inherited from a plant of any previous generation which was transformed with the DNA segment.
- Transgenic plant A plant or progeny plant of any subsequent generation derived therefrom, wherein the DNA of the plant or progeny thereof contains an introduced exogenous DNA segment not naturally present in a non-transgenic plant of the same strain.
- the transgenic plant may additionally contain sequences which are native to the plant being transformed, but wherein the "exogenous" gene has been altered in order to alter the level or pattern of expression of the gene, for example, by use of one or more heterologous regulatory or other elements.
- Up-regulation The increase in the expression of a DNA or RNA transcript and/or the function or activity of a protein relative to a control or naturally-occurring counterpart.
- Vector A DNA molecule designed for transformation into a host cell. Some vectors may be capable of replication in a host cell.
- a plasmid is an exemplary vector, as are expression cassettes obtained therefrom.
- Example 1 Plasmid construction and plant transformation.
- the 3xFLAG-XA21-Myc construct was made using an 8.7 kb genomic fragment containing the c-Myc-tagged Xa21 coding region, intron and the native 5' and 3' regulatory sequences (FIG. 1A).
- a KpnI-Spel fragment with Myc-Xa21 was mobilized from the plasmid pBEK822-Bm into the vector pKBluescript to generate pKBXA21KS-M.
- enhanced green fluorescent protein (eGFP) with its own start codon removed was in-frame fused with XB3 between residues Thr-10 and Gly-11 to make pCR8GW-eGFP-XB3New-3xFLAG using primers SEQ ID NO:22 (GTGTGGA TCCATGGGTCACGGTGTCAGCTGCGCCCGCACCCCTAGGGTGAGCAAGGGCGAGGA
- the XB3-mCherry fusion plasmid was constructed by replacing the C-terminal tag of XB3-3xFLAG in pCR8GW-XB3New-3xFLAG (Huang, et al, PLoS One 8: e63868, 2013) with mCherry fluorescent protein.
- the mCherry open reading frame was PCR amplified from pmCherry-Cl (Clontech) using primers mCherry-F (GTGCGGCCGCACTAGTGGCGGAATGGTGAGC AAGGGCGAGGAGGA; SEQ ID NO:30)/mCherry-R (GTAGATCTTTACTTGTACAGCT CGTCCATGCCGC; SEQ ID NO:31).
- PCR was carried out using primers XB3New-2 (GTTCTAGAAGATCTTCATAGATCGTGCTCAG GCTTGTCCA; SEQ ID NO:25)/ XB3New-3 (GTTCTAGAGGATCCATGGCTCACGGTGT CAGCTGCGCCCG; SEQ ID NO:24) (carrying a mutation leading to substitution of Gly-2 in XB3 to Ala) and the mutated Xb3 gene was cloned into the vector pCR8GW (ThermoFisher Scientific).
- eGFP-XB3 n s mutant site-directed mutagenesis was performed using primers XB3NLS-3 (TGACAAGCCGTCATCCCTGCAACTCACCCGGGAGGAGT CGGAACGATCTCACAACCTCAGTGAGG; SEQ ID NO:26)/XB3NLS-4 (CCTCA CTGAGGTTGTGAGATCGTTCCGACTCCTCCCGGGTGAGTTGCAGGGATGACGGCTTG TCA; SEQ ID NO:27) and the template plasmid pCR8GW-XB3New-3xFLAG.
- eGFP-Xb3 and its mutants were then cloned into the binary vector pCAMBIA1300S containing a rice gene expression cassette with a double cauliflower mosaic virus (CaMV) 35S promoter.
- CaMV cauliflower mosaic virus
- PKKKRKVG SEQ ID NO: 17 from SV40 T antigen
- DsRed red fluorescent protein
- PCR was carried out using primers DsRed-F (GTGTTCTAGAACTAGTATGGCCTCCTCCGAGGACGTCA; SEQ ID NO:28)/DsRed-R (GTGTTCTAGACTATCCCACCTTACGCTTTTTCTTAGGTCCCAGGAACAGGTGGTGGC GGCC; SEQ ID NO:29) to amplify DsRed-NLS.
- the resultant product was cloned into pCAMBIA1300S.
- the XA21-eGFP fusion was made by using NEBuilder® HiFi DNA Assembly Kit (New England Biolabs).
- the coding sequences for the XA21 kinase domain and eGFP were PCR amplified using primer pairs XA21eGFP-l (CTGGATCATTTGGC TCAGTATACA; SEQ ID NO: 18)/XA21eGFP-2 (AAATTCAAGGCTCCCACCTTCA; SEQ ID NO: 19) and XA21eGFP-3 (GGTGGGAGCCTTGAATTTGTCGACATGGTGAGCAAG GGCGAGGA; SEQ ID NO:20)/ XA21eGFP-4 (TGATCGTGTGGTAGATACCACTGCAGT CAGTCGACCTTGTACAGCTCG TCCATGCCGA; SEQ ID NO:21), respectively.
- Full-length Xa21-eGFP was assembled using the PCR products and a restriction fragment coding for the N- terminal half of XA21. The resultant gene was inserted into pCAMBIA1300S for protein expression in rice protoplasts.
- Myc-XA21 was generated by cloning a c-Myc-tagged Xa21 cDNA into pCAMBIA1300S.
- the plasmid pCAMBIA1303 was used to express the GUS-GFP-6xHis fusion.
- pCAMBIA1300S-XB3-3xFLAG for expressing XB3-3xFLAG was described previously (Huang, et al., 2013, supra). All constructs were introduced into Agrobacterium tumefaciens strain EHA105. Infiltration of N. benthamiana was performed as described previously (Huang, et al., 2013, supra), except for tissue collection at 42 hours post infiltration. All constructs were verified by DNA sequencing.
- Example 2 Transient expression of fluorescent proteins in rice protoplasts.
- N-(3 triethylammoniumpropyl)-4-(6-(4(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64) staining was performed by incubating the dye [final concentration 1% (v/v)] with transfected protoplasts for 10 min at room temperature.
- eGFP, DsRed, mCherry and FM4-64 were excited with 488, 561, 561 and 488 nm laser lines, respectively.
- Fluorescence emissions were captured at 410-535 nm for eGFP, at 410-585 nm for DsRed, at 600-617 nm for mCherry and at 650-700 nm for FM4-64. Images were analyzed using ZEN 2.0 software packages.
- Rice seeds were surface sterilized and germinated on half-strength Murashige-Skoog (MS) medium supplemented with 30 g/L sucrose (for wild-type) or the same medium with 30 g/L sucrose and 50 ⁇ g/ml hygromycin (for transgenic lines) for nine days at 25°C under fluorescent light with a 16-hour photoperiod. Germinated seedlings of both XA21 -expressing lines and the vector control A36 were transferred into soil and grown in shared soil-holding trays prepared with evenly distributed holes on the bottom for absorbing water. The trays were maintained in large tanks filled with water in a greenhouse under nature light conditions in Gainesville, Florida.
- MS Murashige-Skoog
- RWC (FW - DW)/(TW - DW), where FW is the fresh weight of the leaf discs collected.
- Turgid weight (TW) was measured after floating the leaf discs on water for 24 hours at room temperature in dark.
- Dry weight (DW) was determined by weighing the leaves after drying at 65°C for three days, which was adequate to assure complete drying of the biomass.
- Example 4 Total RNA extraction, RNA-seq, q-PCR and RNA blot analyses.
- Transgenic A36 and B7-12 plants were subjected to drought stress treatments for 15 days at which point most of the treated A36 leaves, but not the B7-12 leaves, were rolled.
- Leaf tissues from five plants were harvested and pooled for each sample in order to minimize individual variations.
- Total RNA was extracted using the TRIzol Reagent (Ambion) according to the manufacturer's instruction. After treatment with RNase-free DNase (Qiagen) to eliminate genomic DNA contamination followed by further purification using RNeasy MinElute Cleanup Kit (Qiagen), the purified RNA was used for RNA-seq library construction and sequencing using the HiSeq 2000 platform (Illumina).
- DEGs Differential gene expression was analyzed using generalized linear model approaches (GLM) implemented in the BioConductor edgeR package.
- Significant differential expression genes (DEGs) were selected based on the following criteria: fold change over 2, p-value less than 0.05 and RPKM greater than 1 for B7-12 in up-regulation or RPKM greater 1 for A36 in down-regulation.
- Primer sequences SEQ ID NO:7 (GTACATCTAGATTTGGGGTAGA; forward) and SEQ ID NO:8 (GTACGAACACAAGCTAACACGA; reverse) were used for OsLEAl, SEQ ID NO:9 (CCAAGCAGAAGACCGCCGA; forward) and SEQ ID NO: 10 (GTCATCCCCAGCGTGCTCA; reverse) were used for OsLEA3, SEQ ID NO: 11 (CGATG AC G AC GCTG AGTG A A ; forward) and SEQ ID NO: 12 (CAGGTGACATCACACGCTTGA; reverse) were used for OsLEA33, SEQ ID NO: 13 (TAACAGCACCACCACCACAA; forward) and SEQ ID NO: 14 (GTCTTCAAGCTGTTCGACGG; reverse) were used for OsNACIO, and SEQ ID NO:5 (GGAATGTGGACGGTGAC ACT ; forward) and SEQ ID NO:6 (TCAAAATAG AGTCCAGTAGATTTGTCA; reverse)
- RNA blot analysis was performed using a radiolabeled XM-specific probe as described previously (Wang, et ah, 2006, supra).
- Example 5 Immunodetection.
- the homogenate was sequentially filtered through one-layer of 75 ⁇ nylon mesh, two-layers of miracloth (Millipore) and four-layers of miracloth. After addition of Triton X-100 to a final concentration of 0.5%, the homogenate was incubated on ice for 15 min and centrifuged at 1,500 g for 5 min. The supernatant was saved as a nuclei-depleted fraction and the pellet was washed with washing buffer (lx nuclei isolation buffer containing 0.1% Triton X-100) and centrifuged at 100 x g for 1 min to remove starch and cell debris. The pellet was further washed three times using washing buffer, and then resuspended in 1 ml of washing buffer.
- washing buffer lx nuclei isolation buffer containing 0.1% Triton X-100
- Microsomal fraction was isolated by homogenization of leaf tissue harvested from two-month-old plants in lx extraction buffer (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 1 mM EDTA; 10% glycerol; 1 mM PMSF, and lx complete protease inhibitor cocktail), filtrated through Miracloth, and centrifuged at 1,000 x g for 10 min at 4°C. The supernatant was re-centrifuged at 15,000 x g for 5 min at 4°C.
- lx extraction buffer 50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 1 mM EDTA; 10% glycerol; 1 mM PMSF, and lx complete protease inhibitor cocktail
- solubilization buffer extraction buffer containing 0.1% Triton X-100, but lacking glycerol
- incompatible Xoo strains e.g., PX099A
- PX099A incompatible Xoo strains
- FIG. 2 The inventors reasoned that XA21 might play a role in counteracting drought, although an immune sensor has never before been assigned a similar function under physiological conditions.
- the ability of XA21 to confer drought tolerance was tested in the absence of Xoo.
- Newly generated XA21 lines (B7-12 and B7-11) and the empty-vector control A36 [both using cultivar O. sativa ssp. japonica cv. TaiPei309 (TP309) as recipient] were stressed by withholding water.
- the XA21 lines expressing 3xFLAG-XA21-Myc under the control of its native promoter, conferred resistance to PX099A (FIG. IB).
- XA21 plants displayed delayed drought-related symptoms and were recovered from the water stress with significantly higher survival rates than A36. The tolerance appeared to be influenced by the seasons and developmental stages with greater degree in winter and at the older stages. The leaf water status of stressed plants was measured and it was confirmed that the B7-12 line was able to maintain higher levels of relative water content (RWC) than did A36 during drought conditions (FIG. 3A).
- RWC relative water content
- IRBB21 the original source for isolating the Xa21 gene, Khush, et al., Rice Genetics Newsletter 7: 121-122, 1990
- IRBB 14 seedlings which carry the genetically-characterized BLB resistance gene Xal4 (Taura, et al., Rice Genetics Newsletter 4: 101-102, 1987)
- IRBB 13 seedlings containing the recessive resistance gene xal3 coding for a sugar transporter Cho, et al., Genes Dev. 20: 1250-1255, 2006; Yang, et al., Proc. Natl. Acad. Sci. USA 103: 10503-10508, 2006; Chen, et al, Annu. Rev. Biochem. 84:865-894, 2015
- FIG. 5 the Xa21 introgression line IRBB21 (the original source for isolating the Xa21 gene, Khush, et al., Rice Genetics Newsletter 7: 121-122, 1990)
- Example 8 Water deficit induces heightened expression of drought stress-related genes in an XA21 dependent manner.
- RNA-seq analysis was performed. Adult plants were drought-stressed under greenhouse conditions for 15 days at which point most of the treated A36 leaves, but not the B7-12 leaves, were rolled, a phenotypic sign of early stage water deficit. Total RNA was isolated and subjected to library construction and sequencing. More than 61 million reads were generated from each sample and the obtained reads were aligned to the O. sativa Nipponbare reference genome using TopHat version 2.013 (Kawahara, et al., 2013, supra; Trapnell, et al., 2009, supra).
- DEGs differentially expressed genes
- Table 1 A total of 430 differentially expressed genes (DEGs) were identified between B7-12 and A36 after drought treatment, with 17 of them previously known to be water stress regulated (Table 1).
- known drought/dehydration-responsive genes are indicated in bold
- genes whose differential expression was validated by q-PCR are indicated in bold and underlining
- known drought/dehydration-responsive genes whose differential expression was validated by q-PCR are underlined (no bold).
- Fold change and p-value were generated by edgeR, and RPKM value is average value for each line.
- q-PCR Real-time quantitative reverse transcription-PCR validated the drought induction and differential expression of four DEGs ⁇ OsLEAl, OsLEA3, OsLEA33 and OsNACIO) (FIG. 6A, FIG, 6B, FIG. 6C and FIG. 6D, respectively). These data indicate that in response to water stress XA21 triggers heightened expression of a battery of drought-responsive genes.
- Os07g40460.2 prefoldin, putative, expressed 57.40 0.025212223 1.39779 0.0133264
- triosephosphate isomerase 12.90 0.01944993 1.73492 0.0852586 cytosolic, putative, expressed
- Os07g23640.1 retrotransposon protein 11.10 0.004396684 2.18513 0.124103 putative, Ty3-gypsy subclass,
- triosephosphate isomerase 10.50 0.020205805 1.26389 0.0724757 cytosolic, putative, expressed
- Os01gl9150.5 CGMC_GSK.3 - CGMC includes 3.55 0.032144494 2.3096 0.410895
- CDA CDA, MAPK, GSK3, and CLKC
- Os02gl2650.1 puromycin-sensitive 3.33 0.005200384 7.0731 1.33811 aminopeptidase, putative,
- Os09g34280.1 ankyrin repeat-containing 3.25 0.010233398 5.23619 1.01564 protein, putative, expressed
- Os09g28050.1 asparate aminotransferase, 3.01 0.00959124 13.2161 2.7631 putative, expressed
- Os03g05310.1 pheophorbide a oxygenase, 2.48 0.021235417 27.755 7.05028 chloroplast precursor
- Os02g42310.2 OsSCP8 - Putative Serine -2.98 0.007515762 8.86358 16.6299
- Os08g02070.1 OsMADS26 - MADS-box family -3.09 0.008546826 6.93434 13.5106 gene with MIKCc type-box,
- Osllg41034.1 expressed protein -3.17 0.026471925 1.06521 2.13003
- Osllg46810.1 retrotransposon protein -3.42 0.002118456 13.8543 29.8772 putative, unclassified
- Osl2g24320.1 ATPase 3 putative, expressed -3.55 0.018458942 0.924916 2.06871
- Osllg40090.1 A49-like RNA polymerase 1 -3.73 0.017651288 0.842065 1.98187 associated factor family
- Osl0g01080.1 SOR/SNZ family protein -3.89 0.005069858 2.20006 5.39425 putative, expressed Os06g40640.1 fructose-bisphospate aldolase -3.91 0.001400842 4.08166 10.0541 isozyme, putative, expressed
- Osl2g24050.1 retrotransposon protein -5.56 0.000491875 0.388465 1.36269 putative, unclassified
- Os04g31804.1 OsMADS64 - MADS-box family -7.26 0.00051423 0.810366 3.70925 gene with M-alpha type-box,
- Os03gl4334.1 expressed protein -7.94 0.015788103 0.239218 1.21521 Os02g47744.3 MYB family transcription -8.32 0.002155136 0.206919 1.09648 factor, putative, expressed
- Osllg26010.1 retrotransposon protein -9.89 0.000658558 0.218587 1.36391 putative, unclassified
- ABA levels increase when plants sense drought, and ABA-dependent signaling plays a predominant role in the plant response to water deficit (Nambara and Marion-Poll, Annu, Rev. Plant Biol. 56: 165-185, 2005; Zhu, Annu, Rev. Plant Biol. 53:247-273, 2002).
- ABA 5 contents were compared between A36 and B7-12 seedlings after drought treatment. Two-week- old seedlings were air-dried for 0, 1, 3 or 4 hours in a growth chamber (23 °C). Fully-expanded leaves (-100 mg FW) were harvested from the treated seedlings and immediately frozen in liquid nitrogen. After lyophilization, the dried materials were weighed and then ground in liquid nitrogen.
- ABA extraction was performed in darkness for 16 hours at 4°C with extraction buffer0 (80% methanol, 100 mg/L butylated hydroxytoluene and 500 mg/L citric acid monohydrate).
- the suppression effect can be attributed to the positive role of ABA in enhancing Xoo virulence (Xu, et al., BMC Plant Biol. 15: 10, 2015; Xu, et al., PLoS One 8:e67413, 2013) and the potentially negative impacts of the hormone on XA21 signaling. Support for the later possibility comes from the well-established suppression effects of ABA on plant defense events (Mang, et al, Plant Cell 24: 1271-1284, 2012).
- Example 9 - XB3 functions as a drought regulator.
- Xb3 transcripts were markedly induced by drought stress in wild-type cultivar TP309 (carrying no Xa21).
- Stress treatment of previously characterized RNA interference (RNAi) lines, A13 and 37-2 revealed that down-regulation of Xb3 increased drought sensitivity (FIG. 7A).
- RNAi RNA interference
- FIG. 7A The inventors predicted that over-expression of Xb3 might enhance rice tolerance to drought.
- a 3xFLAG tagged Xb3 was placed in an expression cassette under the control of the maize ubiquitin promoter.
- transgenic rice lines More than 50 independent transgenic rice lines were generated, and found to represent a range of transgene expression based on RNA blot analysis.
- Six transgenic lines with moderate and high levels of Xb3 transcripts were randomly chosen for further characterization. Importantly, all plants were similar in size when grown under normal conditions. By contrast, drastically enhanced abilities to survive severe drought stress and to maintain water status were observed in Xb3 over-expression transgenic plants compared with the control lines A36 and TP309 (FIG. 7B, FIG. 7C). Notably, the extent of damage caused by the stress was inversely correlated with levels of Xb3 expression. These results indicate that accumulation of Xb3 transcript levels improves drought tolerance in rice.
- Example 10 - XB3 is localized to both the plasma membrane and the nucleus.
- a monopartite nuclear localization signal was identified in XB3-C that is in addition to other previously reported domains (FIG. 8; Wang, et al., 2006, supra). Based on this and the presence of the putative N-myristoylation site (a membrane targeting signal, FIG. 8), the inventors predicted that XB3 is localized in both the plasma membrane and the nucleus. This hypothesis was tested by performing confocal microscopic analysis using rice protoplasts expressing fluorescently tagged XB3 fusion proteins under the control of a double cauliflower mosaic virus (CaMV) 35S promoter.
- CaMV cauliflower mosaic virus
- enhanced green fluorescent protein was placed in-frame with XB3 between ThrlO and Glyl l (downstream of the N-myristoylation site).
- DsRed Discosoma sp. red fluorescent protein
- DsRed-NLS Discosoma sp. red fluorescent protein
- a 7 -(3-Triethyiammoniimipropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide (FM4-64) dye has been widely used to stain plasma membrane (red color) and visualize endocytosis (Vida and Emr, J. Cell Biol. 128:779-792, 1995).
- FM4-64 staining of rice protoplasts expressing eGFP-XB3 confirmed the plasma membrane localization of the fusion protein.
- the fluorescent tags mCherry and eGFP were fused to the C-termini of these two proteins, respectively.
- Example 11 - XA21 mediates a higher steady-state level of XB3.
- Xb3 is required for full accumulation of XA21 in rice (Wang, et al., 2006, supra), it was examined whether the opposite scenario also holds true. It was found that abundance is increased in the Myc-XA21 line 4021-3 relative to the empty-vector control line A36. Furthermore, epitope-tagged XB3-3xFLAG was co-expressed with Myc-XA21 in N. benthamiana using a well-established transient system mediated by Agrobacterium transformation (Huang, et al., 2013, supra). Consistently, XB3 accumulated to a markedly higher level when co-expressed with XA21 in the infiltrated leaves than when expressed with the empty vector.
- Example 12 - XA21 increases the nuclear accumulation of XB3 in rice.
- a monoclonal antibody was developed, anti-XA21K, against the C-terminal intracellular domain of XA21. This antibody specifically recognized the 140 kDa Myc-XA21 in 4021-3 plants. It was determined that XB3 is readily detectable in the nuclear fraction prepared from two-week-old untreated seedlings of 4021-3 but not in that of A36 control.
- XA21 is cleaved constitutively to some extent in vivo at the seedling stage, coinciding with the accumulation of XB3 in the same subcellular compartment.
- Example 13 Drought tolerance mediated by XA21 is associated with nuclear accumulation of XB3.
- Plants unlike mammals, lack the advanced adaptive immunity required to eliminate most infectious pathogens. This results in significant burden of invaders remaining inside the host for an extended period of time or even a lifetime. An ability to cope with pathogen-induced stresses would therefore be beneficial for infected plants.
- cumulative growth of xylem-limited Xoo can induce water deficit in diseased leaves.
- injury is largely reduced in plants expressing the immune receptor XA21.
- the simplest interpretation of this phenomenon is the lower level of Xoo in the resistant plants than that in susceptible individuals.
- the present disclosure reveals a novel function of XA21, namely drought tolerance.
- XA21 carries an integrated ability to suppress bacterial over- accumulation during early stage infection and then contributes to the control of drought effects. Both of these functions serve to limit water loss injury (FIG. 11).
- XB3 an E3 ubiquitin ligase associating with XA21, also acts as a drought regulator.
- Xa21 which is natural only in the wild species O. longistaminata (Khush, et al., 1990, supra)
- Xb3 is a member of an evolutionarily conserved plant gene family (Huang, et al., 2013, supra).
- AdZFPl from the drought-tolerant species Artemisia desertorum Spreng, has been shown to be water- stress-responsive and capable of enhancing drought tolerance when over-expressing in tobacco (Yang, et al., J. Biosci. 33: 103-112, 2008).
- XB3 likely represents a regulator of a conserved plant drought signaling network and the immune receptor XA21 is linked to this network through binding to XB3.
- the present results show that these two proteins are co-localized in the membrane system and that the expression of XA21 leads to a higher abundance of XB3. Therefore, XA21 appears to promote storage of XB3 under normal growth conditions, potentially enhancing the ability of rice plants to survive drought stress.
- XB3 and XA21 ccp accumulation might reflect a difference in their stabilities in drought environments.
- XB3 might be released by a second, drought- induced cleavage of XA21 that results in short-lived intermediates. It has been well-documented in the animal system that cell- surface receptors can be activated via complex proteolysis (Kopan and Ilagan, Cell 137:216-33, 2009; Rawson, Biochim. Biophys. Acta 1828:2801-2807, 2013).
- drought-triggered, XA21 -dependent accumulation of XB3 might allow the E3 ubiquitin ligase to exceed a threshold in the nucleus leading to the degradation of its substrate(s) (FIG. 11).
- XA21 -mediated drought tolerance and defense likely utilize different signaling mechanisms.
- the present studies identified 17 DEGs between XA21 and control plants known to be drought-responsive. Of these, four were subjected to q-PCR analysis to validate drought induction and differential expression. They include three later embryogenesis abundant (LEAs) genes (OsLEAl, OsLEA3 and OsLEA33) and OsNAClO.
- LEAs encode hydrophilic proteins that potentially function in cellular protection during water deficit, whereas OsNAClO codes for a transcription factor of the NAM ATAF CUC2 (NAC) family (Xiao, et al, Theor. Appl. Genet.
- the immune sensor XA21 was surprisingly demonstrated to confer tolerance to drought. This novel function may act directly or indirectly through sensing water stress and subsequently activating of drought regulators (e.g., OsNAClO). Based on these results, an integrated ability for XA21 to suppress Xoo over- accumulation during early stage infection and then to control the water deficit caused by remaining bacteria may be achieved (FIG. 9). These findings therefore unify biotic and abiotic signaling under the control of a single stress sensor, XA21.
- Rice is the staple food of more than half of the population in the world.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Physiology (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
Abstract
The invention provides methods and compositions for enhancing drought tolerance in plants. Nucleic acid constructs therefore are also described. Transgenic plants are also provided that exhibit enhanced agronomic properties. The inventors have demonstrated increased drought tolerance in connection with increased expression of the Xa21 gene.
Description
DROUGHT TOLERANT PLANTS
CROSS REFERENCE TO RELATED APPLICATIONS
[001] This application claims the priority of U.S. Provisional Application No. 62/335,241, filed on May 12, 2016, the entire disclosure of which is incorporated herein by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[002] The U.S. government has certain rights in this invention, pursuant to USDA-NIFA Grant No. 2015-67013-22910, awarded by the U.S. Department of Agriculture.
INCORPORATION OF SEQUENCE LISTINGS
[003] The sequence listing that is contained in the file named "UFFL080WO_ST25.txt", which is 18.5 kilobytes (as measured in Microsoft Windows®) and was created on May 11, 2017, is filed herewith by electronic submission and is incorporated by reference herein.
FIELD OF THE INVENTION
[004] The present invention relates generally to the field of molecular biology. More specifically, the invention relates to plant genes involved in drought tolerance and methods of use thereof.
BACKGROUND OF THE INVENTION
[005] Drought is a major constraint to crop production worldwide. The greenhouse effect is predicted to raise temperatures and to prolong droughts. Human-induced climate change is predicted to put pressure on the supply of water for agriculture. At the same time the world population is estimated to exceed 9.5 billion by the year 2050. Therefore, central to long-term agricultural security is implementing a sustainable system that is more resilient and productive, while at the same time requires less of the increasingly costly inputs such as water.
SUMMARY OF THE INVENTION
[006] The present invention provides a method of increasing drought tolerance in a plant, comprising expressing in the plant a heterologous receptor kinase XA21 coding region, wherein the drought tolerance of the plant is increased when compared to a control plant that
lacks the expressing of the heterologous XA21 coding region. In certain embodiments the expressing comprises introducing into the plant a DNA construct comprising the heterologous receptor kinase XA21 coding region operably linked to a native receptor kinase XA21 promoter. In other embodiments the expressing comprises introducing into the plant a DNA construct comprising the heterologous receptor kinase XA21 coding region operably linked to a heterologous promoter functional in the plant. In some aspects the promoter is a constitutive or inducible promoter.
[007] In certain aspects of the present invention, the heterologous receptor kinase XA21 coding region comprises a polynucleotide sequence at least 85%, 90%, 95%, 97%, 98% 99%, or 100% identical to the rice receptor kinase XA21 coding region (SEQ ID NO: l), or a homolog thereof. In particular aspects the heterologous receptor kinase XA21 coding region comprises a polynucleotide sequence encoding an XA21 protein at least 90%, 95%, 97%, 98%, 99% or 100% identical to the rice receptor kinase XA21 protein (SEQ ID NO:2), or a homolog thereof.
[008] In some embodiments of the present invention the plant is a monocotyledonous plant, such as a monocotyledonous plant selected from the group consisting of maize, wheat, rice, sorghum (Sorghum bicolor), oats, barley, sugar cane, African oil palm (Elaeis guineensis), or switchgrass. In other embodiments of the present invention the plant is a dicotyledonous plant, such as a dicotyledonous plant selected from the group consisting of Arabidopsis, peanut (Arachis hypogaea), barrel medic (Medicago truncatula), carrot, soybean {Glycine max), cotton, Brassica, canola, tomato, potato, alfalfa, grape, clover, poplar, willow, eucalyptus, hemp, a Lotus sp., a Vinca sp., a Nicotiana sp., a Vitis sp., or a Ricinus sp.
[009] The present invention further provides a plant, or part thereof, expressing a heterologous receptor kinase XA21 coding region, wherein drought tolerance of the plant or part thereof is increased when compared to a control plant or part thereof that lacks the expressing of the heterologous XA21 coding region. In certain aspects the expressing comprises introducing into the plant or part thereof a DNA construct comprising the heterologous receptor kinase XA21 coding region operably linked to a native receptor kinase XA21 promoter. In other aspects the overexpressing comprises introducing into the plant or part thereof a DNA construct comprising the heterologous receptor kinase XA21 coding region operably linked to a heterologous promoter
functional in the plant or part thereof. In particular embodiments the part thereof is a cell, meristem, root, leaf, node, pistil, anther, flower, seed, embryo, stalk or petiole.
[0010] The present invention additionally provides a method of producing food for human or animal consumption, comprising obtaining a plant, or part thereof, expressing a heterologous receptor kinase XA21 coding region, wherein drought tolerance of the plant or part thereof is increased when compared to a control plant or part thereof that lacks the expressing, and preparing food for human or animal consumption from the plant or part thereof. In some aspects, the food is starch, protein, meal, flour or grain.
[0011] The present invention also provides a method of increasing drought tolerance in a rice plant, comprising introducing into the rice plant a DNA construct comprising the rice receptor kinase XA21 coding region or a heterologous receptor kinase XA21 coding region operably linked to a heterologous promoter functional in the rice plant, wherein the drought tolerance of the rice plant is increased when compared to a control rice plant that lacks the XA21 coding region or heterologous XA21 coding region. [0012] The present invention further provides a method of producing a drought tolerant plant, comprising crossing a plant expressing a heterologous receptor kinase XA21 coding region, wherein drought tolerance of the plant is increased when compared to a control plant that lacks the expressing of the XA21 coding region, with a second plant to produce at least a first progeny plant comprising drought tolerance. In certain aspects the drought tolerant plant is a drought tolerant rice plant.
[0013] The present invention additionally provides a method of increasing drought tolerance in a plant, comprising introducing into the plant a DNA construct comprising a heterologous receptor kinase XA21 coding region operably linked to a promoter, and selecting a progeny plant that has increased drought tolerance when compared to a control plant that lacks the DNA construct. In some embodiments the promoter is a drought-inducible promoter.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better
understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0015] FIG. 1. A double-tagged XA21 confers resistance to Xoo PX099A. FIG. 1A. Schematic representation of a double-tagged XA21. An 8,739 bp genomic fragment containing the Xa21 coding region, its own intron (not indicated in FIG. 1A) and the native 5' and 3' regulatory sequences was used to express the gene. Domains of XA21 were as described previously (Song, et al., Science 270: 1804-1806, 1995): LRRs, leucine-rich repeats; TM, transmembrane domain; JM, juxtamembrane domain. A triple FLAG tag was inserted into the Dra III site, whereas a c-Myc tag was fused in frame to the C-terminus of XA21. FIG. IB. Lesion length data of inoculated plants (n = 11 each line). The asterisk signs indicate statistically significant difference from the control A36 as calculated by Student's t test (**: p<0.01).
[0016] FIG. 2. XA21 -expressing plants display milder drought-related injuries than the control after Xoo infection. Growth of PX099A in 4021-3 and A36 plants. Each data point represents mean + SD (n = 3 each). CFU, colony-forming unit. Blue, A36; pink, 4021-3. The asterisk signs indicate statistically significant difference from the control A36 as calculated by Student's t test (**: p<0.01).
[0017] FIG. 3. XA21 confers tolerance to drought in rice. FIG. 3A. RWC of A36 and B7-12 plants during the course of drought treatment. # indicates the day at which A36 leaves were rolled. FIG. 3B. Survival rates of the drought-treated seedlings. FIG. 3C. Survival rates of the drought-treated seedlings. Results in FIG. 3A, FIG. 3B and FIG. 3C are means + s.e.m. (n = 3). Data sets with asterisks indicate statistically significant difference from A36 (*: p<0.05; **: p<0.01).
[0018] FIG. 4. FIG. 4A. The XA21 line B7- 11 displays tolerance to drought. Survival rates of the drought-treated seedlings. Results are means + s.e.m. (n = 3). The asterisk signs indicate statistically significant difference from A36 as calculated using Student's t test (**: p<0.01). FIG. 4B. The XA21 line 4021-3 is tolerant to drought. Survival rates of the stress-treated seedlings. FIG. 4C. The XA21 line IRBB21 is tolerant to drought. Survival rates of the drought-treated seedlings. Results in FIG. 4B and FIG. 4C are means + s.e.m. (n = 3). The asterisk signs indicate statistically significant difference from A36 or IR24 as calculated by Student's t test (*: p<0.05; **: p<0.01). Of note, transgenic lines containing Xa21 are often more
resistant to Xoo PX099A than the introgression line IRBB21, likely due to higher levels of transgene expression (Song, et al., Science 270: 1804-1806, 1995).
[0019] FIG. 5. IRBB 13 seedlings display no tolerance to drought. Survival rates of the drought-treated seedlings (n = 20). Results are means + s.e.m. (n = 3). [0020] FIG. 6. XA21 potentiates expression of drought-related genes in response to water stress. Four DEGs identified by RNA-seq, OsLEAl (FIG. 6A), OsLEA3 (FIG. 6B), OsLEA33 (FIG. 6C), and OsNACIO (FIG. 6D) were validated in A36 (blue) and B7-12 (pink) seedlings using q-PCR. FIG. 6E. Comparisons of ABA levels in A36 and the XA21 -expressing line B7-12 after drought treatment. ABA contents of leaves were determined from two-week-old seedlings. Each data point represents mean of three independent biological replicates. White, A36; gray, B7-12.
[0021] FIG. 7. Severe drought-stress induces XA21 -dependent defense against the compatible Xoo strain DY87031. Two-week-old A36 and B7-12 seedlings were inoculated with Xoo strain DY87031 and incubated with or without 13% PEG to initiate disease development. FIG. 7 A. Lesion length measurements of inoculated plants (n = 15 each line) at 7 dpi. FIG. 7B. Growth of Xoo in inoculated plants. Data points represent mean + SD (n = 3 each). CFU, colony-forming unit. The asterisk signs indicate statistically significant difference from the control A36 (treated with 13% PEG) as calculated using Student's t test (*: p<0.05; **: p<0.01).
[0022] FIG. 8. Suppression of XA21 -mediated resistance to the incompatible Xoo strain PX099A by PEG or ABA. Two-week-old A36 and B7-12 seedlings were inoculated with Xoo PX099A and incubated with or without 13% PEG (FIG. 8A and FIG. 8B) or ABA (FIG. 8C and FIG. 8D). Lesion lengths of diseased leaves (n=15 each line) at 10 dpi (FIG. 8A and FIG. 8C). Growth of PX099A in PEG- (FIG. 8B) or ABA- (FIG. 8D) treated plants. The asterisk signs indicate statistically significant difference from the control B7-12 (water, FIG. 8A and FIG. 8B) or B7-12 (0 μΜ ABA, FIG. 8C and FIG. 8D) as calculated using Student's t test (*: p<0.05; **: p<0.01).
[0023] FIG. 9. The rice Xb3 gene acts as a drought regulator. FIG. 9A. Survival rates of the drought-treated lines. FIG. 9B. Survival rates of the indicated lines after drought stress. FIG. 9C. RWC of A36 and OXB3-70 plants during the course of drought treatment. Results in
are means + s.e.m. (n = 3). Data sets with asterisks indicate statistically significant difference from A36 (*: p<0.05; **: p<0.01).
[0024] FIG. 10. XA21 regulates XB3 nuclear accumulation. Structure and domain organization of XB3. The predicted XB3 domains include an N-terminal putative myristoylation motif in which the myristoylation residue G (Gly-2) is indicated, an ankyrin domain, a RING finger (RF) motif and the C-terminal region possessing a newly identified NLS (the basic residues underlined, the number indicates position of the Lys residue in the full-length XB3). The insertion sites for eGFP and mCherry are shown.
[0025] FIG. 11. Working model for XA21 -mediated immunity. At the early stage of incompatible Xoo infection, progressive bacterial growth in rice leaves triggers XA21-mediated defense signaling (green dashed lines), which leads to the restriction of bacterial over- proliferation and disease development. With the Xoo levels reaching a plateau in the xylem vessels, drought stress becomes evident, which in turn activates XA21-mediated drought signaling (red lines) that involves a release of XB3 from the XA21 complex into the nucleus, where the E3 ubiquitin ligase might degrade a substrate(s) for tolerance to drought.
DETAILED DESCRIPTION OF THE INVENTION
[0026] The following detailed description is provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.
[0027] It has surprisingly been shown that transgenic plants expressing an Xa21 gene displayed strong drought tolerance, as compared to control plants that lack the Xa21 gene. The invention thus represents a significant advance in the art by providing methods and compositions that permit engineering of plants for drought tolerance. In this manner, agronomic performance of crop plants may be increased, particularly when plants are subject to osmotic stress at any given stage of growth. This is particularly important in avoiding crop loss and also in increasing water use efficiency. The invention thus provides methods and compositions for obtaining improvements in osmotic stress tolerance. In specific embodiments, expression cassettes comprising an Xa21 nucleotide sequence are described operably linked to a promoter that directs expression or overexpression of the Xa21 nucleotide sequence in the plant cell. In additional
embodiments, a plurality of XA21 transgenic plants are generated, and plants having improved drought tolerance compared to a control plant are selected.
[0028] Innate immunity plays an important role in protecting evolutionarily diverse species from pathogen infection. To perceive pathogenic invaders, hosts have evolved pattern- recognition receptors (PRRs) for detecting pathogen- or microbe-associated molecular patterns (PAMPs or MAMPs) and receptors for recognizing virulence effectors produced by pathogens for manipulating PAMP-triggered immunity and/or host cell physiology (Chisholm, et al, Cell 124:803-814, 2006; Jones and Dangl, Nature 444:323-329, 2006). Plant PRRs are cell-surface proteins belonging to receptor kinase and receptor-like protein superfamilies, whereas the majority of effector-recognizing receptors are intracellular proteins possessing nucleotide-binding (NB) and leucine-rich repeat (LRR) domains (Couto and Zipfel, Nat. Rev. Immunol. 16:537-552, 2016; Dangl and Jones, Nature 411:826-833, 2001). Well-studied PRRs include Arabidopsis flagellin sensitive 2 (FLS2), elongation factor receptor (EFR) and chitin elicitor receptor kinase 1 (CREK1) that recognize bacterial flagellin, elongation factor Tu (EF-Tu) and the fungal cell wall component chitin, respectively (Gomez-Gomez and Boiler, Mol. Cell 5: 1003-1011, 2000; Zipfel, et al., Cell 125:749-760, 2006; Miya, et al., Proc. Natl. Acad. Sci. USA 104: 19613-19618, 2007). Many NB-LRR proteins are encoded by classic disease resistance genes and NB-LRR-encoding sequences represent one of the largest gene families in plants (Meyers, et al., Plant Cell 15:809-834, 2003; Sanseverino, et al., Nucleic Acids Res. 38(Database issue):D814-821, 2010). Upon activation, immune receptors mobilize a defense response leading to restriction of pathogen proliferation.
[0029] The Gram-negative bacteria Xanthomonas oryzae pv. oryzae (Xoo) is the causal agent of bacterial leaf blight disease of rice (Oryza sativa L.). After entering leaves, Xoo exclusively accumulates and spreads in xylem vessels, causing phenotypes (i.e., leaf rolling and wilting) similar to those seen in plants stressed by drought (Nino-Liu, et al., Mol. Plant Pathol. 7:303-324, 2006). The product of the rice gene Xa21 confers resistance to Xoo and is among the first cell- surface receptors identified in the innate immune system of plants and animals (Song, et al, Science 270: 1804-1806, 1995; Chen, et al, Mol. Plant. 3:917-926, 2010; Park, et al, PLoS One 5:e9262, 2010). Like FLS2 and EFR, XA21 is a LRR-receptor kinase whose intracellular domain belongs to the non-RD subclass of the receptor-like kinase/Pelle family (Song, et al, Science 270: 1804-1806, 1995; Dardick and Ronald, PLoS Pathog. 2:e2,
2006). Evidence has been shown to support XA21 as a PRR recognizing the Xoo protein 'required for activation of ΧΑ2Γ (RaxX) (Pruitt et al, Sci. Adv. I:el500245, 2015). Xa21 -mediated resistance is only fully expressed in adult plants (Century, et al, Plant J. 20:231-236, 1999), however the inventors have shown that the developmentally-regulated resistance can be restored at the seedling stage by a low temperature (23-27°C) treatment. In highly resistant plants expressing XA21, incompatible Xoo strains {e.g., PX099A) still grow and propagate to a significant level (~ 10 7 to 108 bacterial cells/infected leaf), but they induce only shorter disease lesions and weaker water stress phenotypes than observed in susceptible individuals (FIG. 2). [0030] Under normal growth conditions devoid of Xoo, XA21 is constitutively expressed and likely forms stable protein complexes with XA21 binding proteins (XBs) in multiple subcellular compartments. Aside from the plasma membrane, XA21 is also localized to the endoplasmic reticulum (ER) (Park, et ah, PLoS One 5:e9262, 2010). Co-immunoprecipitation experiments have detected five XBs in XA21 precipitates prepared from fully mature leaves. They are XB3, the ATPase XB24, the ER chaperone luminal-binding protein 3 (OsBiP3), XB25, and rice somatic embryogenesis receptor kinase 2 (OsSERK2) (Park, et ah, 2010, supra; Wang, et al, Plant Cell 18:3635-3646, 2006; Chen, et al, Proc. Natl. Acad. Sci. USA 107:8029-8034, 2010; Jiang, et al, Plant J. 73:814-823, 2013; Chen, et al, Mol. Plant 7:874-892, 2014). [0031] The first reported XA21 binding partner XB3 possesses an N-terminal myristoylation site, eight imperfect copies of ankyrin repeats, a RING finger (RF) domain, and a C-terminal region (XB3-C) (Wang, et al, 2006, supra). XB3 binds to the intracellular domain of XA21 through its ankyrin repeats, while the RF motif of XB3 is responsible for ubiquitin ligase activity. The Xb3 gene is required for full XA21 accumulation and resistance. When over- expressed in Nicotiana benthamiana {N. benthamiana), XB3 and its orthologs from diverse plant species are capable of triggering rapid cell death (Huang, et al, PLoS One 8: e63868, 2013). Despite these informative findings, the function and subcellular localization of XB3 are not fully understood.
[0032] The inventors have previously shown in rice that an N-terminal c-Myc epitope- tagged XA21 (Myc-XA21, -140 kDa) is sensitive to proteolytic cleavage by an unidentified
protease(s) resulting in an N-terminal cleavage product (XA21ncp) of -100 kDa (Xu, et al, Plant J. 45:740-751, 2006). XA21ncp can also be detected in microsomal fractions and XA21 immunoprecipitates (Park, et ah, 2010, supra; Wang, et ah, 2006, supra; Chen, et ah, 2010, supra; Jiang, et al., 2013, supra; Xu, et al., 2006, supra; Park and Ronald, Nat. Commun. 3:920, 2012). The C-terminal portion of cleaved XA21 (XA21ccp, -37 kDa) is detectable in the nucleus (Park and Ronald, 2012, supra). Kinase inactive (Myc-XA21K736E) and autophosphorylation (Myc-XA21S686A/T688A/S689A) mutants both appear to be more sensitive to cleavage, suggesting that autophosphorylation protects XA21 from degradation (Xu, et al., 2006, supra). In addition to XA21, proteolysis has been observed from other PRRs/receptor-like kinases including the Arabidopsis CERK1 and brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1); and the symbiotic receptor kinase (SYMRK) from Lotus japonicas (Petutschnig, et al., New Phytol. 204:955-967, 2014; Dominguez-Ferreras, et al., Plant Physiol. 168: 1106-1121, 2015; Antolin-Llovera, et al, Curr. Biol. 24:422-427, 2014).
[0033] The inventors have shown that XA21 signaling has a significant role in counteracting drought, which is surprising and unexpected because an immune sensor has never before been assigned a similar function under physiological conditions.
NUCLEIC ACIDS, POLYPEPTIDES AND PLANT TRANSFORMATION CONSTRUCTS
[0034] Certain embodiments of the current invention concern the use of recombinant nucleic acid sequences comprising an Xa21 coding sequence. Complements to any nucleic acid sequences described herein can also be used in certain embodiments. In addition, Xa21 homologs (Song, et al., Plant Cell 9: 1279-1287, 1997) can also be used in some aspects of the present invention.
[0035] In further embodiments, nucleic acids and polypeptides are used that have at least about 80% (percent) sequence identity, about 85% sequence identity, about 90% sequence identity, about 91% sequence identity, about 92% sequence identity, about 93% sequence identity, about 94% sequence identity, about 95% sequence identity, about 96% sequence identity, about 97% sequence identity, about 98% sequence identity, and about 99% sequence identity to any of the nucleic acid or protein sequences described herein. As used herein, the term "percent sequence identity" or "% sequence identity" refers to the percentage of identical nucleotides or amino acids in a linear polynucleotide or polypeptide sequence of a reference
("query") sequence (or its complementary strand) as compared to a test ("subject") sequence (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide or amino acid insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the window of comparison). Methods to determine "percent sequence identity" are codified in numerous publicly available programs including, but are not limited to, GCG (also known as The Wisconsin Package™), and the BLAST programs that are publicly available from NCBI. Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools including, but not limited to, the local homology algorithm of Smith and Waterman (Adv. Appl. Math. 2:482-489, 1981), the homology alignment algorithm of Needleman and Wunsch (J. Mol. Biol. 48:443-453, 1970), and the search for similarity method of Lipman and Pearson (Science 227: 1435-1441, 1985).
[0036] The nucleic acids for use in the present invention may be from any source, e.g., identified as naturally occurring in a plant, or synthesized, e.g., by mutagenesis. In certain embodiments, the naturally occurring sequence may be from any plant. In some embodiments, the plant may be a dicotyledonous plant, for example, Arabidopsis, peanut (Arachis hypogaea), barrel medic (Medicago truncatula), carrot, soybean (Glycine max), cotton, Brassica, canola, tomato, potato, alfalfa, grape, clover, poplar, willow, eucalyptus, hemp, a Lotus sp., a Vinca sp., a Nicotiana sp., a Vitis sp., or a Ricinus sp.. In other embodiments, a plant useful for the present invention may be a monocotyledonous plant, for example maize, wheat, rice, sorghum (Sorghum bicolor), oats, barley, sugar cane, African oil palm (Elaeis guineensis), or switchgrass.
[0037] Coding sequences used in the present invention may be provided in a recombinant vector operably linked to a homologous or heterologous promoter functional in plants. Expression constructs may also be used comprising these sequences. In other embodiments, plants and plant cells transformed with the sequences may be provided. The construction of vectors which may be employed in conjunction with plant transformation techniques using these or other sequences according to the invention will be known to those of skill of the art in light of the present disclosure (see, for example, Sambrook, et al, Molecular Cloning: a Laboratory Manual, Volume 3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). The techniques of the current invention are thus not limited to the use of any particular nucleic acid sequences.
[0038] The choice of any additional elements used in conjunction with the Xa21 coding sequences may depend on the purpose of the transformation. One of the major purposes of transformation of crop plants is to add commercially desirable, agronomically important traits to the plant, as described herein. [0039] Vectors used for plant transformation may include, for example, plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes) or any other suitable cloning system, as well as fragments of DNA therefrom. Thus when the term "vector" or "expression vector" is used, all of the foregoing types of vectors, as well as nucleic acid sequences obtained therefrom and otherwise, are included. It is contemplated that utilization of cloning systems with large insert capacities will allow introduction of large DNA sequences comprising more than one selected gene. In accordance with the invention, this could be used to introduce genes corresponding to, e.g., an entire biosynthetic pathway, into a plant.
[0040] Particularly useful for transformation are expression cassettes which have been derived from such vectors. DNA segments used for transforming plant cells will generally comprise the cDNA, gene or genes which one desires to introduce into and have expressed in the host cells. These DNA segments can further include structures such as promoters, enhancers, polylinkers, or even regulatory genes as desired. The DNA segment or gene chosen for cellular introduction will often encode a protein which will be expressed in the resultant recombinant cells resulting in a screenable or selectable trait and/or which will impart an improved phenotype to the resulting transgenic plant. Preferred components likely to be included with vectors used in the current invention are as follows.
A. REGULATORY ELEMENTS
[0041] In certain embodiments, exemplary promoters for expression of a nucleic acid sequence include plant promoters such as the CaMV 35S (Odell, et al, Nature 313:810-812, 1985), CaMV 19S (Lawton, et al, Plant Mol. Biol. 9:315-324, 1987), nos (Ebert, et al, Proc. Natl. Acad. Sci. USA 84:5745-5749, 1987), actin (Wang, et al, Mol. Cell. Biol. 12:3399-3406, 1992), UDP glucose flavonoid glycosyl-transferase gene promoter (Ralston, et al, Genet. 119: 185-197, 1988), MPI proteinase inhibitor (Cordero, et al, Plant J. 6141-150, 1994), and the glyceraldehyde-3-phosphate dehydrogenase (Kohler, et al, Plant Mol. Biol. 29: 1293-1298, 1995; Quigley, et al, J. Mol. Evol. 29:412-421, 1989; Martinez, et al, J. Mol. Biol. 208:551-565,
1989) promoter, and the ubiquitin promoters from maize or rice, or ubiquitin promoters for use in various monocotyledonous plants (Christensen and Quail, Transgenic Res. 5:213-218, 1996).
[0042] Tissue- specific promoters, such as Adh (Walker, et ah, Proc. Natl. Acad. Sci. USA 84:6624-6628, 1987), sucrose synthase (Yang and Russell, Proc. Natl. Acad. Sci. USA 87:4144-4148, 1990), a-tubulin (Kim and An, Transgenic Research 1: 188-194, 1992), cab (Sullivan, et al., Mol. Gen. Genet. 215:431-440, 1989), PEPCase (Hudspeth and Grula, Plant Mol. Biol. 12:579-589, 1989), lectin (Vodkin, et al., Cell 34: 1023, 1983; Lindstrom, et al., Dev. Genet. 11: 160, 1990), corn alcohol dehydrogenase 1 (Vogel, et al., J. Cell. Biochem. 13:Part D, 1989; Dennis, et al., Nucl. Acids Res. 12:3983-4000, 1984); corn light harvesting complex (Simpson, Science 233:34, 1986; Bansal, et al., Proc. Natl. Acad. Sci. USA 89:3654-3658, 1992), corn heat shock protein (Rochester, et al., EMBO J. 5:451-458, 1986), pea small subunit RuBP carboxylase (Poulsen, et al., Mol. Gen. Genet. 205: 193-200, 1986; Cashmore, et al., Gen. Eng. of Plants, Plenum Press, New York, 29-38, 1983), Ti plasmid mannopine synthase or nopaline synthase (Langridge, et al., Proc. Natl. Acad. Sci. USA 86:3219-3223, 1989), petunia chalcone isomerase (Van Tunen, et al., EMBO J. 7: 1257, 1988), bean glycine rich protein 1 (Keller, et al., EMBO J. 8: 1309-1314, 1989), potato patatin promoters (Wenzler, et al, Plant Mol. Biol. 12:41-50, 1989), root cell promoters (Conkling, et al, Plant Physiol. 93: 1203-1211, 1990), maize zein (Reina, et al, Nucl. Acids Res. 18:6426, 1990; Kriz, et al, Mol. Gen. Genet. 207:90-98, 1987; Wandelt and Feix, Nucl. Acids Res. 17:2354, 1989; Langridge and Feix, Cell 34: 1015-1022, 1983; Reina, et al, Nucl. Acids Res. 18:6426, 1990), globulin-1 (Belanger and Kriz, Genet. 129:863-872, 1991), R gene complex-associated promoters (Chandler, et al, The Plant Cell 1: 1175-1183, 1989), and chalcone synthase (Franken, et al, EMBO J. 10:2605-2612, 1991), or tissue selective promoters and tissue- specific enhancers (Fromm, et al, Nature 312:791-793, 1986, Fromm, et al, The Plant Cell 1:977-984, 1989) are also contemplated to be useful in certain embodiments, as are inducible promoters such as ABA- and turgor-inducible promoters, as well as drought- inducible promoters. Any suitable promoters known in the art may be used to express XA21 coding sequences in a plant. In certain embodiments of the invention a drought-inducible or osmotic stress-inducible promoter may be used to express XA21 coding sequences in a plant. [0043] The DNA sequence between the transcription initiation site and the start of the coding sequence, i.e., the untranslated leader sequence, can also influence gene expression. One
may thus wish to employ a particular leader sequence with a transformation construct of the invention. In certain embodiments, leader sequences are contemplated to include those which comprise sequences predicted to direct optimum expression of the attached gene, i.e., to include a consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation. The choice of such sequences will be known to those of skill in the art in light of the present disclosure. In some embodiments, sequences that are derived from genes that are highly expressed in plants may be used for expression of XA21 coding sequences.
B. TERMINATORS
[0044] Transformation constructs prepared in accordance with the invention may include a 3' end DNA sequence that acts as a signal to terminate transcription and allow for the polyadenylation of the mRNA produced by coding sequences operably linked to a promoter. In one embodiment of the invention, the native terminator of a XA21 coding sequence may be used. Alternatively, a heterologous 3' end may enhance the expression of XA21 coding sequences. Non-limiting examples of terminators that may be used in this context include those from the nopaline synthase gene of Agrobacterium tumefaciens (nos 3' end) (Bevan, et al., Nucl. Acids Res. 11:369-385, 1983), the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3' end of the protease inhibitor I or II gene from potato or tomato. Regulatory elements such as an Adh intron (Callis, et al., Genes Dev. 1: 1183-1200, 1987), sucrose synthase intron (Vasil, et al, Plant Physiol. 91: 1575-1579, 1989) or TMV omega element (Gallie, et al., The Plant Cell 1:301-311,1989), may further be included in certain embodiments where desired.
C. TRANSIT OR SIGNAL PEPTIDES
[0045] Sequences that are joined to the coding sequence of an expressed gene, which are removed post-translationally from the initial translation product and which facilitate the transport of the protein into or through intracellular or extracellular membranes, are termed transit (usually into vacuoles, vesicles, plastids and other intracellular organelles) and signal sequences (usually to the endoplasmic reticulum, Golgi apparatus and outside of the cellular membrane). By facilitating the transport of the protein into compartments inside and outside the cell, these sequences may increase the accumulation of gene products by protecting them from proteolytic
degradation. These sequences also allow for additional mRNA sequences from highly expressed genes to be attached to the coding sequence of the genes. Since mRNA being translated by ribosomes is more stable than naked mRNA, the presence of translatable mRNA in front of the gene may increase the overall stability of the mRNA transcript from the gene and thereby increase synthesis of the gene product. Since transit and signal sequences are usually post- translationally removed from the initial translation product, the use of these sequences allows for the addition of extra translated sequences that may not appear on the final polypeptide. It further is contemplated that targeting of certain proteins may be desirable in order to enhance the stability of the protein (U.S. Patent No. 5,545,818, incorporated herein by reference in its entirety).
[0046] Additionally, vectors may be constructed and employed in the intracellular targeting of a specific gene product within the cells of a transgenic plant or in directing a protein to the extracellular environment. This generally will be achieved by joining a DNA sequence encoding a transit or signal peptide sequence to the coding sequence of a particular gene. The resultant transit or signal peptide will transport the protein to a particular intracellular or extracellular destination, respectively, and will then be post-translationally removed.
D. MARKER GENES
[0047] By employing a selectable or screenable marker, one can provide or enhance the ability to identify transformants. "Marker genes" are genes that impart a distinct phenotype to cells expressing the marker protein and thus allow such transformed cells to be distinguished from cells that do not have the marker. Such genes may encode either a selectable or screenable marker, depending on whether the marker confers a trait which one can "select" for by chemical means, i.e., through the use of a selective agent (e.g., a herbicide, antibiotic, or the like), or whether it is simply a trait that one can identify through observation or testing, i.e., by "screening" (e.g., the green fluorescent protein). Of course, many examples of suitable marker proteins are known to the art and can be employed in the practice of the invention.
[0048] Many selectable marker coding regions are known and could be used with the present invention including, but not limited to, neo (Potrykus, et ah, Mol. Gen. Genet. 199: 183-188, 1985), which provides kanamycin resistance and can be selected for using kanamycin, G418, paromomycin, etc.; bar, which confers bialaphos or phosphinothricin
resistance (Rathore, et al, Plant Mol. Biol. 21:871-884, 1993); a mutant EPSP synthase protein (Hinchee, et ah, Bio/Technol. 6:915-922, 1988) conferring glyphosate resistance; a nitrilase such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker, et ah, Science 242:419-423, 1988); a mutant acetolactate synthase (ALS) which confers resistance to imidazolinone, sulfonylurea or other ALS inhibiting chemicals (European Patent Application 154204, 1985); a methotrexate resistant DHFR (Thillet, et al, J. Biol. Chem. 263: 12500-12508, 1988), a dalapon dehalogenase that confers resistance to the herbicide dalapon (Buchanan-Wollaston, et ah, Plant Cell Reports 11:627-631, 1992); or a mutated anthranilate synthase that confers resistance to 5-methyl tryptophan (Li and Last, Plant Physiol. 110:51-59, 1996).
[0049] An illustrative embodiment of selectable marker capable of being used in systems to select transformants are those that encode the enzyme phosphinothricin acetyltransferase, such as the bar gene from Streptomyces hygroscopicus or the pat gene from Streptomyces viridochromogenes. The enzyme phosphinothricin acetyl transferase (PAT) inactivates the active ingredient in the herbicide bialaphos, phosphinothricin (PPT). PPT inhibits glutamine synthetase (Murakami, et al., Mol. Gen. Genet. 205:42-50, 1986; Twell, et ah, Plant Physiol. 91: 1270-1274, 1989), causing rapid accumulation of ammonia and cell death.
GENETIC TRANSFORMATION
[0050] Additionally provided herein are transgenic plants transformed with the above-identified recombinant vectors encoding XA21, or a sequence modulating up-regulation thereof, and exhibiting tolerance to drought.
[0051] Suitable methods for transformation of plant or other cells for use with the current invention are believed to include virtually any method by which DNA can be introduced into a cell, such as by direct delivery of DNA such as by PEG-mediated transformation of protoplasts (Omirulleh, et al, Plant Mol. Biol. 21:415-428, 1993), by desiccation/inhibition-mediated DNA uptake (Potrykus, et al., Mol. Gen. Genet. 199: 183-188, 1985), by electroporation (U.S. Patent No. 5,384,253, specifically incorporated herein by reference in its entirety), by agitation with silicon carbide fibers (Kaeppler, et al, Plant Cell Reports 9:415-418, 1990; U.S. Patent No. 5,302,523 and U.S. Patent No. 5,464,765, both specifically incorporated herein by reference in its entirety), by Agrobacterium-mediated transformation (U.S. Patent No. 5,591,616 and U.S.
Patent No. 5,563,055; both specifically incorporated herein by reference) and by acceleration of DNA coated particles (U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,877; and U.S. Patent No. 5,538,880; each specifically incorporated herein by reference in its entirety). Through the application of techniques such as these, the cells of virtually any plant species may be stably transformed, and these cells developed into transgenic plants.
[0052] Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art. See, for example, the methods described by Horsch, et al. (Science 227: 1229-1231, 1985), Rogers and Klee {Plant DNA Infectious Agents, Chapter 7, Springer- Verlag/Wein, 1987) and U.S. Patent No. 5,563,055, specifically incorporated herein by reference in its entirety.
[0053] Agrobacterium-mediated transformation is most efficient in dicotyledonous plants and is the preferable method for transformation of dicots, including Arabidopsis, tobacco, tomato, alfalfa and potato. Indeed, while Agrobacterium-mediated transformation has been routinely used with dicotyledonous plants for a number of years, including alfalfa (Thomas, et al., Plant Sci. 69: 189-198, 1990), it has only more recently become applicable to monocotyledonous plants. Advances in Agrobacterium-mediated transformation techniques have now made the technique applicable to nearly all monocotyledonous plants. For example, Agrobacterium-mediated transformation techniques have now been applied to rice (Hiei, et al., Plant Mol. Biol. 35:205-218, 1997; U.S. Patent No. 5,591,616, specifically incorporated herein by reference in its entirety), wheat (McCormac, et al., Euphytica 99: 17-25, 1998), barley (Tingay, et al., The Plant Journal 11: 1369-1376, 1997) and maize (Ishidia, et al., Nature Biotechnology 14:745-750, 1996).
[0054] One also may employ protoplasts for electroporation transformation of plants (Bates, Mol. Biotechnol. 2: 135-145, 1994; Lazzeri, Methods Mol. Biol. 49:95-106, 1995). Another method for delivering transforming DNA segments to plant cells in accordance with the invention is microprojectile bombardment (U.S. Patent No. 5,550,318; U.S. Patent No. 5,538,880; U.S. Patent No. 5,610,042; and PCT Application WO 94/09699; each of which is
specifically incorporated herein by reference in its entirety). In this method, particles may be coated with nucleic acids and delivered into cells by a propelling force.
[0055] The transgenic plants of the present invention expressing heterologous XA21 and exhibiting drought tolerance can be of any species. The plants can be an RO transgenic plant (i.e., a plant derived from the original transformed tissue). The plants can also be a progeny plant of any generation of an RO transgenic plant, wherein the transgenic plant comprises the nucleic acid sequence from the RO transgenic plant.
[0056] Seeds of the above-described transgenic plants may also be provided, particularly where the seed comprises the nucleic acid sequence. Additionally contemplated are host cells transformed with the above-identified recombinant vector. In some embodiments, the host cell is a plant cell.
[0057] The plants of these embodiments having increased or enhanced expression of XA21 and drought tolerance may be of any species. The species may be any monocotyledonous or dicotyledonous plant, such as those described herein. One of skill in the art will recognize that the present invention may be applied to plants of other species by employing methods described herein and others known in the art.
[0058] Tissue cultures may be used in certain transformation techniques for the preparation of cells for transformation and for the regeneration of plants therefrom. Maintenance of tissue cultures requires use of media and controlled environments. "Media" refers to the numerous nutrient mixtures that are used to grow cells in vitro, that is, outside of the intact living organism. A medium usually is a suspension of various categories of ingredients (salts, amino acids, growth regulators, sugars, buffers) that are required for growth of most cell types. However, each specific cell type requires a specific range of ingredient proportions for growth, and an even more specific range of formulas for optimum growth. The rate of cell growth also will vary among cultures initiated with the array of media that permit growth of that cell type.
PRODUCTION AND CHARACTERIZATION OF STABLY TRANSFORMED PLANTS
[0059] After effecting delivery of exogenous DNA to recipient cells, the next steps generally concern identifying the transformed cells for further culturing and plant regeneration. In order to improve the ability to identify transformants, one may desire to employ a selectable
or screenable marker gene with a transformation vector prepared in accordance with the invention. In this case, one would then generally assay the potentially transformed cell population by exposing the cells to a selective agent or agents, or one would screen the cells for the desired marker gene trait. Potentially transformed cells then are exposed to the selective agent. In the population of surviving cells will be those cells where, generally, the resistance- conferring gene has been integrated and expressed at sufficient levels to permit cell survival. Cells may be tested further to confirm stable integration of the exogenous DNA.
[0060] One herbicide which constitutes a desirable selection agent is the broad-spectrum herbicide bialaphos. Another example of a herbicide which is useful for selection of transformed cell lines in the practice of the invention is the broad-spectrum herbicide glyphosate. Glyphosate inhibits the action of the enzyme EPSPS which is active in the aromatic amino acid biosynthetic pathway. Inhibition of this enzyme leads to starvation for the amino acids phenylalanine, tyrosine, and tryptophan and secondary metabolites derived therefrom. U.S. Patent No. 4,535,060 describes the isolation of EPSPS mutations which confer glyphosate resistance on the EPSPS of Salmonella typhimurium, encoded by the gene aroA. The EPSPS gene from Zea mays was cloned and mutations similar to those found in a glyphosate resistant aroA gene were introduced in vitro. Mutant genes encoding glyphosate resistant EPSPS enzymes are described in, for example, International Patent Application Publication Number WO 97/4103.
[0061] The transformed cells, identified by selection or screening and cultured in an appropriate medium that supports regeneration, will then be allowed to mature into plants. Developing plantlets can be transferred to soilless plant growth mix, and hardened, e.g., in an environmentally controlled chamber, for example, at about 85% relative humidity, 600 ppm C02, and 25-250 microeinsteins m-2 s-1 of light. Plants may be matured in a growth chamber or greenhouse. Plants can be regenerated after a transformant is identified, depending on the initial tissue. During regeneration, cells are grown on solid media in tissue culture vessels. Illustrative embodiments of such vessels are petri dishes and Plant Cons. Regenerating plants can be grown at about 19 to 28°C, for example. After the regenerating plants have reached the stage of shoot and root development, they may be transferred to a greenhouse for further growth and testing.
[0062] To confirm the presence of the exogenous DNA or "transgene(s)" in the regenerating plants, a variety of assays may be performed. Such assays include, for example,
"molecular biological" assays, such as Southern and Northern blotting and PCR™; "biochemical" assays, such as detecting the presence of a protein product, e.g. , by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant. [0063] The expression of a gene product is often determined by evaluating the phenotypic results of its expression. These assays also may take many forms including but not limited to analyzing changes in the chemical composition, morphology, or physiological properties of the plant. Chemical composition may be altered by expression of genes encoding enzymes or storage proteins which change amino acid composition and may be detected by amino acid analysis, or by enzymes that change starch quantity which may be analyzed by near infrared reflectance spectrometry. Morphological changes may include greater stature or thicker stalks. Most often changes in response of plants or plant parts to imposed treatments are evaluated under carefully controlled conditions termed bioassays. Such assays for determining drought tolerance are well-described herein BREEDING PLANTS OF THE INVENTION
[0064] In addition to direct transformation of a particular plant genotype with a construct prepared according to the current invention, transgenic plants may be made by crossing a plant having a selected DNA of the invention to a second plant lacking the construct. For example, a selected XA21 coding sequence can be introduced into a particular plant variety by crossing, without the need for ever directly transforming a plant of that given variety. Therefore, the current invention not only encompasses a plant directly transformed or regenerated from cells which have been transformed in accordance with the current invention, but also the progeny of such plants. As used herein, the term "progeny" denotes the offspring of any generation of a parent plant prepared in accordance with the instant invention, wherein the progeny comprises a selected DNA construct prepared in accordance with the invention. "Crossing" a plant to provide a plant line having one or more added transgenes relative to a starting plant line, as disclosed herein, is defined as the techniques that result in a transgene of the invention being introduced into a plant line by crossing a plant of a starting line with a plant of a donor plant line that comprises a transgene of the invention. To achieve this one could, for example, perform the following steps: (a) plant seeds of the first (starting line) and second (donor plant line that
comprises a transgene of the invention) parent plants; (b) grow the seeds of the first and second parent plants into plants that bear flowers; (c) pollinate a flower from the first parent plant with pollen from the second parent plant; and (d) harvest seeds produced on the parent plant bearing the fertilized flower. Backcrossing is herein defined as the process including the steps of: (a) crossing a plant of a first genotype containing a desired gene, DNA sequence or element to a plant of a second genotype lacking the desired gene, DNA sequence or element; (b) selecting one or more progeny plant containing the desired gene, DNA sequence or element; (c) crossing the progeny plant to a plant of the second genotype; and (d) repeating steps (b) and (c) for the purpose of transferring a desired DNA sequence from a plant of a first genotype to a plant of a second genotype. In any one or more generations of crossing, selection may be made for drought tolerance, yielding drought tolerant progeny.
[0065] Intro gression of a DNA element into a plant genotype is defined as the result of the process of backcross conversion. A plant genotype into which a DNA sequence has been introgressed may be referred to as a backcross converted genotype, line, inbred, or hybrid. Similarly a plant genotype lacking the desired DNA sequence may be referred to as an unconverted genotype, line, inbred, or hybrid.
DEFINITIONS
[0066] Expression: The combination of intracellular processes, including transcription and translation, undergone by a coding DNA molecule such as a structural gene to produce a polypeptide.
[0067] Genetic Transformation: A process of introducing a DNA sequence or construct (e.g. , a vector or expression cassette) into a cell or protoplast in which that exogenous DNA is incorporated into a chromosome or is capable of autonomous replication.
[0068] Heterologous: A sequence which is not normally present in a given host genome in the genetic context in which the sequence is currently found. In this respect, the sequence may be native to the host genome, but be rearranged with respect to other genetic sequences within the host sequence. For example, a regulatory sequence may be heterologous in that it is linked to a different coding sequence relative to the native regulatory sequence.
[0069] Obtaining: When used in conjunction with a transgenic plant cell or transgenic plant, obtaining means either transforming a non-transgenic plant cell or plant to create the transgenic plant cell or plant, or planting transgenic plant seed to produce the transgenic plant cell or plant. Such a transgenic plant seed may be from an R0 transgenic plant or may be from a progeny of any generation thereof that inherits a given transgenic sequence from a starting transgenic parent plant.
[0070] Overexpression: The increase in the expression of a DNA or RNA transcript and/or the function or activity of a protein relative to a control or naturally- occurring counterpart.
[0071] Promoter: A recognition site on a DNA sequence or group of DNA sequences that provides an expression control element for a structural gene and to which RNA polymerase specifically binds and initiates RNA synthesis (transcription) of that gene.
[0072] R0 transgenic plant: A plant that has been genetically transformed or has been regenerated from a plant cell or cells that have been genetically transformed.
[0073] Regeneration: The process of growing a plant from a plant cell (e.g. , plant protoplast, callus or explant).
[0074] Selected DNA: A DNA segment which one desires to introduce or has introduced into a plant genome by genetic transformation.
[0075] Transformation construct: A chimeric DNA molecule which is designed for introduction into a host genome by genetic transformation. Preferred transformation constructs will comprise all of the genetic elements necessary to direct the expression of one or more exogenous genes. In particular embodiments of the instant invention, it may be desirable to introduce a transformation construct into a host cell in the form of an expression cassette.
[0076] Transformed cell: A cell in which the DNA complement has been altered by the introduction of an exogenous DNA molecule into that cell. [0077] Transgene: A segment of DNA which has been incorporated into a host genome or is capable of autonomous replication in a host cell and is capable of causing the expression of one or more coding sequences. Exemplary transgenes will provide the host cell, or plants regenerated therefrom, with a novel phenotype relative to the corresponding non-transformed cell or plant. Transgenes may be directly introduced into a plant by genetic transformation, or
may be inherited from a plant of any previous generation which was transformed with the DNA segment.
[0078] Transgenic plant: A plant or progeny plant of any subsequent generation derived therefrom, wherein the DNA of the plant or progeny thereof contains an introduced exogenous DNA segment not naturally present in a non-transgenic plant of the same strain. The transgenic plant may additionally contain sequences which are native to the plant being transformed, but wherein the "exogenous" gene has been altered in order to alter the level or pattern of expression of the gene, for example, by use of one or more heterologous regulatory or other elements.
[0079] Up-regulation: The increase in the expression of a DNA or RNA transcript and/or the function or activity of a protein relative to a control or naturally-occurring counterpart.
[0080] Vector: A DNA molecule designed for transformation into a host cell. Some vectors may be capable of replication in a host cell. A plasmid is an exemplary vector, as are expression cassettes obtained therefrom.
EXAMPLES
[0081] The following examples are included to demonstrate illustrative embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
Example 1 - Plasmid construction and plant transformation.
[0082] The 3xFLAG-XA21-Myc construct was made using an 8.7 kb genomic fragment containing the c-Myc-tagged Xa21 coding region, intron and the native 5' and 3' regulatory
sequences (FIG. 1A). To delete the extra 3' from the 9.9 kb Xa21 -containing fragment previously used for rice transformation (Wang, et al., Plant Cell 18:3635-3646, 2006), a KpnI-Spel fragment with Myc-Xa21 was mobilized from the plasmid pBEK822-Bm into the vector pKBluescript to generate pKBXA21KS-M. An additional 1.8 kb 3' sequence, PCR amplified from the 9.9 kb Xa21 fragment with primers XA21-Tail-F (CTTTCCGAAGACGAGT ATATCTAACG; SEQ ID NO:3)/XA21-Tail-R (ACTAGTGGTACCCGTCTTATATC GCCTCA; SEQ ID NO:4), was added to the 3' end of the KpnI-Spel fragment of pBXA21KS-M using the Spel site. The resultant construct, namely pKB-Myc-XA21-S, contains a c-Myc tag (EQKLISEEDLLEK; SEQ ID NO: 15) in the N-terminal region (domain B) of XA21. To introduce a c-Myc tag to the C-terminus of XA21, the EcoRl fragment of pKB-Myc-XA21-S was replaced by one with the tag fused to the C-terminus of XA21. The N-terminal c-Myc tag in the construct was replaced with 3xFLAG (DYKDDDDKGGDYKDDDDKGGDYKDDDDK; SEQ ID NO: 16) using the Dralll site. The 8.7 kb Kpnl fragment containing Myc-Xa21-3xFLAG was then subcloned into the binary vector pCAMBIA1300. Agrobacterium-mediated rice transformation was performed using cultivar TP309 as recipient as described previously (Wang, et al, 2006, supra).
[0083] For protoplast transformation, enhanced green fluorescent protein (eGFP) with its own start codon removed was in-frame fused with XB3 between residues Thr-10 and Gly-11 to make pCR8GW-eGFP-XB3New-3xFLAG using primers SEQ ID NO:22 (GTGTGGA TCCATGGGTCACGGTGTCAGCTGCGCCCGCACCCCTAGGGTGAGCAAGGGCGAGGA
G; GFP-F) and SEQ ID NO:23 (GAATAGGGAATTCTCCCAGCCGAA; XB3seq-2). The XB3-mCherry fusion plasmid was constructed by replacing the C-terminal tag of XB3-3xFLAG in pCR8GW-XB3New-3xFLAG (Huang, et al, PLoS One 8: e63868, 2013) with mCherry fluorescent protein. The mCherry open reading frame was PCR amplified from pmCherry-Cl (Clontech) using primers mCherry-F (GTGCGGCCGCACTAGTGGCGGAATGGTGAGC AAGGGCGAGGAGGA; SEQ ID NO:30)/mCherry-R (GTAGATCTTTACTTGTACAGCT CGTCCATGCCGC; SEQ ID NO:31). To generate the eGFP-XB3G2A mutant, PCR was carried out using primers XB3New-2 (GTTCTAGAAGATCTTCATAGATCGTGCTCAG GCTTGTCCA; SEQ ID NO:25)/ XB3New-3 (GTTCTAGAGGATCCATGGCTCACGGTGT CAGCTGCGCCCG; SEQ ID NO:24) (carrying a mutation leading to substitution of Gly-2 in XB3 to Ala) and the mutated Xb3 gene was cloned into the vector pCR8GW (ThermoFisher
Scientific). To construct the eGFP-XB3n s mutant, site-directed mutagenesis was performed using primers XB3NLS-3 (TGACAAGCCGTCATCCCTGCAACTCACCCGGGAGGAGT CGGAACGATCTCACAACCTCAGTGAGG; SEQ ID NO:26)/XB3NLS-4 (CCTCA CTGAGGTTGTGAGATCGTTCCGACTCCTCCCGGGTGAGTTGCAGGGATGACGGCTTG TCA; SEQ ID NO:27) and the template plasmid pCR8GW-XB3New-3xFLAG. eGFP-Xb3 and its mutants were then cloned into the binary vector pCAMBIA1300S containing a rice gene expression cassette with a double cauliflower mosaic virus (CaMV) 35S promoter. To fuse a functional NLS (PKKKRKVG; SEQ ID NO: 17 from SV40 T antigen) to the C-terminus of Discosoma sp. red fluorescent protein (DsRed), PCR was carried out using primers DsRed-F (GTGTTCTAGAACTAGTATGGCCTCCTCCGAGGACGTCA; SEQ ID NO:28)/DsRed-R (GTGTTCTAGACTATCCCACCTTACGCTTTTTCTTAGGTCCCAGGAACAGGTGGTGGC GGCC; SEQ ID NO:29) to amplify DsRed-NLS. The resultant product was cloned into pCAMBIA1300S. The XA21-eGFP fusion was made by using NEBuilder® HiFi DNA Assembly Kit (New England Biolabs). The coding sequences for the XA21 kinase domain and eGFP were PCR amplified using primer pairs XA21eGFP-l (CTGGATCATTTGGC TCAGTATACA; SEQ ID NO: 18)/XA21eGFP-2 (AAATTCAAGGCTCCCACCTTCA; SEQ ID NO: 19) and XA21eGFP-3 (GGTGGGAGCCTTGAATTTGTCGACATGGTGAGCAAG GGCGAGGA; SEQ ID NO:20)/ XA21eGFP-4 (TGATCGTGTGGTAGATACCACTGCAGT CAGTCGACCTTGTACAGCTCG TCCATGCCGA; SEQ ID NO:21), respectively. Full-length Xa21-eGFP was assembled using the PCR products and a restriction fragment coding for the N- terminal half of XA21. The resultant gene was inserted into pCAMBIA1300S for protein expression in rice protoplasts.
[0084] For agrobacterium-mediated transient gene expression, Myc-XA21 was generated by cloning a c-Myc-tagged Xa21 cDNA into pCAMBIA1300S. The plasmid pCAMBIA1303 was used to express the GUS-GFP-6xHis fusion. pCAMBIA1300S-XB3-3xFLAG for expressing XB3-3xFLAG was described previously (Huang, et al., 2013, supra). All constructs were introduced into Agrobacterium tumefaciens strain EHA105. Infiltration of N. benthamiana was performed as described previously (Huang, et al., 2013, supra), except for tissue collection at 42 hours post infiltration. All constructs were verified by DNA sequencing.
Example 2 - Transient expression of fluorescent proteins in rice protoplasts.
[0085] Rice protoplasts were isolated from cultivar TP309 as described (Zhang, et ah, Plant Methods 7:30, 2011) except for the use of eight-day-old, dark-grown seedlings. Sixteen hours after transfection with the constructs described above, the protoplasts were visualized using a 40 x objective with a Zeiss LSM800 confocal laser scanning microscope. N-(3 triethylammoniumpropyl)-4-(6-(4(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM4-64) staining was performed by incubating the dye [final concentration 1% (v/v)] with transfected protoplasts for 10 min at room temperature. eGFP, DsRed, mCherry and FM4-64 were excited with 488, 561, 561 and 488 nm laser lines, respectively. Fluorescence emissions were captured at 410-535 nm for eGFP, at 410-585 nm for DsRed, at 600-617 nm for mCherry and at 650-700 nm for FM4-64. Images were analyzed using ZEN 2.0 software packages.
Example 3 - Plant growth and treatments.
[0086] Rice seeds were surface sterilized and germinated on half-strength Murashige-Skoog (MS) medium supplemented with 30 g/L sucrose (for wild-type) or the same medium with 30 g/L sucrose and 50 μg/ml hygromycin (for transgenic lines) for nine days at 25°C under fluorescent light with a 16-hour photoperiod. Germinated seedlings of both XA21 -expressing lines and the vector control A36 were transferred into soil and grown in shared soil-holding trays prepared with evenly distributed holes on the bottom for absorbing water. The trays were maintained in large tanks filled with water in a greenhouse under nature light conditions in Gainesville, Florida. For drought treatments, the plant trays were transferred to a bench and kept under natural light conditions without watering for approximately 20-40 days depending on the season. To recover drought-stressed plants, the trays were returned to water tanks for 12 days before survivors were scored. RWC of drought-stressed leaves was determined using the equation: RWC = (FW - DW)/(TW - DW), where FW is the fresh weight of the leaf discs collected. Turgid weight (TW) was measured after floating the leaf discs on water for 24 hours at room temperature in dark. Dry weight (DW) was determined by weighing the leaves after drying at 65°C for three days, which was adequate to assure complete drying of the biomass.
[0087] For seedling air-drying assays, germinated individuals were cultured in water for an additional two (for indica lines) and five (for transgenic japonica lines) days, respectively. Two- week-old japonica seedlings were air-dried in a growth chamber (23 °C) for three and half hours followed by a recovery in half-strength MS medium for three days. Survivors were defined as individuals possessing at least one true leaf flattened after recovery. A similar method, except that a five-hour-drought treatment and 11-day-old seedlings, was used to dehydrate the indica lines.
Example 4 - Total RNA extraction, RNA-seq, q-PCR and RNA blot analyses.
[0088] Transgenic A36 and B7-12 plants were subjected to drought stress treatments for 15 days at which point most of the treated A36 leaves, but not the B7-12 leaves, were rolled. Leaf tissues from five plants were harvested and pooled for each sample in order to minimize individual variations. Total RNA was extracted using the TRIzol Reagent (Ambion) according to the manufacturer's instruction. After treatment with RNase-free DNase (Qiagen) to eliminate genomic DNA contamination followed by further purification using RNeasy MinElute Cleanup Kit (Qiagen), the purified RNA was used for RNA-seq library construction and sequencing using the HiSeq 2000 platform (Illumina).
[0089] The obtained reads were aligned to the O. sativa Nipponbare reference genome using TopHat version 2.013 (Kawahara, et ah, Rice 6:4, 2013; Trapnell, et ah, Bioinformatics 25: 1105-1111, 2009). Ambiguous reads that mapped to more than one region in the genome or those with a MAPQ score of less than 10 were removed. Transcript quantification was carried out by the Partek Genomics Suite (version 6.4, Partek, Inc.) to obtain raw read counts and normalized read counts (RPKM: Reads per kilobase per million mapped reads) (Mortazavi, et al., Nat. Methods 5:621-628, 2008). Differential gene expression was analyzed using generalized linear model approaches (GLM) implemented in the BioConductor edgeR package. Significant differential expression genes (DEGs) were selected based on the following criteria: fold change over 2, p-value less than 0.05 and RPKM greater than 1 for B7-12 in up-regulation or RPKM greater 1 for A36 in down-regulation.
[0090] For q-PCR analysis, two-week-old seedlings were subjected to dehydration followed by RNA isolation as described above. cDNA was synthesized with ^g of total RNA using RT First Strand Kit (Qiagen). Q-PCR was performed under the following conditions:
95°C, 2 min; (95°C, 5 s; 60°C, 5 s) x 40 cycles, 72°C, 5 min using the CFX 96 Real-Time PCR Detection System (Bio-Rad) according to the manufacturer's instruction. Results were normalized to the expression of the rice reference gene Os06gl 1170.1 (Narsai, et ah, BMC Plant Biol. 10:56, 2010). Primer sequences SEQ ID NO:7 (GTACATCTAGATTTGGGGTAGA; forward) and SEQ ID NO:8 (GTACGAACACAAGCTAACACGA; reverse) were used for OsLEAl, SEQ ID NO:9 (CCAAGCAGAAGACCGCCGA; forward) and SEQ ID NO: 10 (GTCATCCCCAGCGTGCTCA; reverse) were used for OsLEA3, SEQ ID NO: 11 (CGATG AC G AC GCTG AGTG A A ; forward) and SEQ ID NO: 12 (CAGGTGACATCACACGCTTGA; reverse) were used for OsLEA33, SEQ ID NO: 13 (TAACAGCACCACCACCACAA; forward) and SEQ ID NO: 14 (GTCTTCAAGCTGTTCGACGG; reverse) were used for OsNACIO, and SEQ ID NO:5 (GGAATGTGGACGGTGAC ACT ; forward) and SEQ ID NO:6 (TCAAAATAG AGTCCAGTAGATTTGTCA; reverse) were used for Os06gl 1170.1.
[0091] RNA blot analysis was performed using a radiolabeled XM-specific probe as described previously (Wang, et ah, 2006, supra). Example 5 - Immunodetection.
[0092] To generate monoclonal anti-XA21K antibody, the intracellular kinase domain of XA21 was expressed in E. coli and the purified fusion protein was used as immunogen in mice. Antibody production was performed as described (Rong, et al, J. Integrative Agricultural 15:726-734, 2016). [0093] Nuclear fraction was isolated by homogenization of leaf tissues in lx nuclei isolation buffer (2.5% Ficoll 400, 0.4 M sucrose, 25% glycerol, 25 mM Tris-HCl, pH 7.5, 10 mM MgCl2, 1 mM DTT, 1 mM PMSF, and lx complete protease inhibitor cocktail) using a mortar and pestle. The homogenate was sequentially filtered through one-layer of 75 μιη nylon mesh, two-layers of miracloth (Millipore) and four-layers of miracloth. After addition of Triton X-100 to a final concentration of 0.5%, the homogenate was incubated on ice for 15 min and centrifuged at 1,500 g for 5 min. The supernatant was saved as a nuclei-depleted fraction and the pellet was washed with washing buffer (lx nuclei isolation buffer containing 0.1% Triton X-100) and centrifuged at 100 x g for 1 min to remove starch and cell debris. The pellet was further washed three times using washing buffer, and then resuspended in 1 ml of washing buffer. After centrifuging at 1,800 x g for 5 min, the nuclei-enriched pellet was collected.
[0094] Microsomal fraction was isolated by homogenization of leaf tissue harvested from two-month-old plants in lx extraction buffer (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 1 mM EDTA; 10% glycerol; 1 mM PMSF, and lx complete protease inhibitor cocktail), filtrated through Miracloth, and centrifuged at 1,000 x g for 10 min at 4°C. The supernatant was re-centrifuged at 15,000 x g for 5 min at 4°C. The resultant supernatant was centrifuged at 150,000 x g for 60 min at 4°C. The pellet was re-suspended in solubilization buffer (extraction buffer containing 0.1% Triton X-100, but lacking glycerol) and stored at -70°C until used.
[0095] Protein extraction and protein blot analysis was performed as previously described (Xu, et al, Plant J. 45:740-751, 2006). Example 6 - Inoculation of plants with Xoo.
[0096] Six-week-old plants were inoculated with Xoo strains using the leaf-clipping method (Kauffman, et ah, Plant Disease Rep. 57:537-541, 1993). After inoculation, disease lesion development and bacterial population were determined as described previously (Song, et al., Science 270: 1804-1806, 1995). Example 7 - XA21 confers drought tolerance in rice.
[0097] After infection, incompatible Xoo strains (e.g., PX099A) can propagate to a significant level in rice; but they cause short disease lesions and weak water stress injuries (FIG. 2). The inventors reasoned that XA21 might play a role in counteracting drought, although an immune sensor has never before been assigned a similar function under physiological conditions. The ability of XA21 to confer drought tolerance was tested in the absence of Xoo. Newly generated XA21 lines (B7-12 and B7-11) and the empty-vector control A36 [both using cultivar O. sativa ssp. japonica cv. TaiPei309 (TP309) as recipient] were stressed by withholding water. The XA21 lines, expressing 3xFLAG-XA21-Myc under the control of its native promoter, conferred resistance to PX099A (FIG. IB). Remarkably, XA21 plants displayed delayed drought-related symptoms and were recovered from the water stress with significantly higher survival rates than A36. The tolerance appeared to be influenced by the seasons and developmental stages with greater degree in winter and at the older stages. The leaf water status of stressed plants was measured and it was confirmed that the B7-12 line was able to maintain higher levels of relative water content (RWC) than did A36 during drought conditions (FIG. 3A).
[0098] The novel function of XA21 was confirmed in temperature-controlled laboratory settings. Air-drying of two-week-old seedlings for three and half hours at 23°C induced more than 54% mortality in A36, but caused less than 25% death in B7-12, B7-11 and the previously characterized line 4021-3 with a higher level of Myc-XA21 (FIG. 3B; FIG. 4A; FIG. 4B; Wang, et al., 2006, supra). Relative to the near-isogenic recurrent parent IR24 (O. sativa ssp. indica), the Xa21 introgression line IRBB21 (the original source for isolating the Xa21 gene, Khush, et al., Rice Genetics Newsletter 7: 121-122, 1990) as well as IRBB 14 seedlings, which carry the genetically-characterized BLB resistance gene Xal4 (Taura, et al., Rice Genetics Newsletter 4: 101-102, 1987), exhibit better performance after five hour of drought treatment (FIG. 4C; FIG. 3C). By contrast, IRBB 13 seedlings containing the recessive resistance gene xal3 coding for a sugar transporter (Chu, et al., Genes Dev. 20: 1250-1255, 2006; Yang, et al., Proc. Natl. Acad. Sci. USA 103: 10503-10508, 2006; Chen, et al, Annu. Rev. Biochem. 84:865-894, 2015) are sensitive to water stress (FIG. 5).
Example 8 - Water deficit induces heightened expression of drought stress-related genes in an XA21 dependent manner.
[0099] To determine the molecular mechanisms underlying XA21 -mediated drought response, RNA-seq analysis was performed. Adult plants were drought-stressed under greenhouse conditions for 15 days at which point most of the treated A36 leaves, but not the B7-12 leaves, were rolled, a phenotypic sign of early stage water deficit. Total RNA was isolated and subjected to library construction and sequencing. More than 61 million reads were generated from each sample and the obtained reads were aligned to the O. sativa Nipponbare reference genome using TopHat version 2.013 (Kawahara, et al., 2013, supra; Trapnell, et al., 2009, supra). A total of 430 differentially expressed genes (DEGs) were identified between B7-12 and A36 after drought treatment, with 17 of them previously known to be water stress regulated (Table 1). In Table 1, known drought/dehydration-responsive genes are indicated in bold, genes whose differential expression was validated by q-PCR are indicated in bold and underlining, and known drought/dehydration-responsive genes whose differential expression was validated by q-PCR are underlined (no bold). Fold change and p-value were generated by edgeR, and RPKM value is average value for each line. Real-time quantitative reverse transcription-PCR (q-PCR) validated the drought induction and differential expression of four DEGs {OsLEAl, OsLEA3, OsLEA33 and OsNACIO) (FIG. 6A, FIG, 6B, FIG. 6C and FIG. 6D,
respectively). These data indicate that in response to water stress XA21 triggers heightened expression of a battery of drought-responsive genes.
Table 1
Gene model Annotation Fold change p-value B7-12 A36
drought (RPKM) (RPKM)
(B7-12/A36)
Os08g36740.1 bHelix-loop-helix transcription 65.60 0.014347791 1.05888 0.0101797 factor, putative, expressed
Os02g20940.2 CHCH domain containing 64.92 0.015035143 1.31103 0.0123909 protein, expressed
Os07g48450.2 NAC domain transcription 57.63 2.91E-07 3.48369 0.0360582 factor
Os07g40460.2 prefoldin, putative, expressed 57.40 0.025212223 1.39779 0.0133264
Os05g47860.1 expressed protein 56.03 0.027707752 1.30644 0.014704
Os06g42430.2 expressed protein 46.81 0.004351535 1.62423 0.0252887
Os08gl8974.2 expressed protein 36.56 0.015416347 1.47982 0.0254192
Os01g65090.1 aminotransferase, classes 1 32.25 4.74E-06 2.51309 0.0474212 and II, domain containing
protein, expressed
Os02g58730.2 ras-related protein, putative, 27.11 0.014580597 1.13705 0.0277986 expressed
Os03gl7870.1 metallothionein, putative, 25.45 0.006840116 5.56079 0.137775 expressed (related to OsMTla)
Os05g47730.1 LTPL153 - Protease inhibitor/ 19.93 7.64E-07 15.8955 0.502877 seed storage/LTP family
protein precursor, expressed
Osllg25040.1 plant-specific domain 17.47 0.006340921 1.35904 0.0490498
TIGR01615 family protein,
expressed
Os08g31860.1 expressed protein 15.54 3.00E-09 23.074 0.936311
Os03g08360.1 3-ketoacyl-CoA synthase 10, 15.35 4.78E-05 2.42981 0.100974 putative, expressed
Os04g33920.1 LTPL102 - Protease 14.33 1.17E-08 35.8224 1.57634 inhibitor/seed storage/LTP
family protein precursor,
expressed
Os01g62420.3 triosephosphate isomerase, 12.90 0.01944993 1.73492 0.0852586 cytosolic, putative, expressed
Os05g31140.2 glycosyl hydrolases family 17, 12.43 2.42E-07 12.3571 0.626934 putative, expressed
Os05gll320.1 metallothionein-like protein 12.30 1.57E-09 691.652 35.4509
3B, putative, expressed
Osl0g38470.1 glutathione S-transf erase, 11.44 2.51E-07 21.5953 1.19037 putative, expressed
Os08g44270.1 vignain precursor, putative, 11.28 0.018962743 1.03103 0.0576694 expressed
Os07g23640.1 retrotransposon protein, 11.10 0.004396684 2.18513 0.124103 putative, Ty3-gypsy subclass,
expressed
Os01g45640.1 tat pathway signal sequence 10.95 4.59E-08 73.6573 4.24383 family protein, expressed
Osllgl8570.1 cytochrome P450, putative, 10.78 4.03E-06 6.69536 0.391673 expressed
Osl2g09300.1 amino acid transporter, 10.78 0.000118804 3.17876 0.185964 putative, expressed
Os04g33510.1 expressed protein 10.75 0.01806747 1.66628 0.101577
Os01g46120.1 GDSL-like 10.61 0.004705021 1.64294 0.0968729 lipase/acylhydrolase, putative,
expressed
Os01g62420.1 triosephosphate isomerase, 10.50 0.020205805 1.26389 0.0724757 cytosolic, putative, expressed
Os01g43740.1 cytochrome P450 72A1, 9.72 0.006632195 1.15791 0.0751394 putative, expressed
Os09g29660.1 white-brown complex 9.69 0.000123738 2.50208 0.162849 homolog protein 11, putative,
expressed
Osl0g35070.4 alpha-galactosidase precursor, 9.40 0.004817214 2.52422 0.167932 putative, expressed
Osl2g41680.1 NAC domain transcription 8.82 8.61E-06 10.5794 0.756102 factor
Os01g03730.1 nuclease PA3, putative, 8.72 5.59E-06 14.1191 1.02108 expressed
Os01g43372.1 expressed protein 8.64 0.000127875 3.45949 0.251629
Os05g48510.1 phenylalanyl-tRNA synthetase 8.60 0.005416772 1.08485 0.0800341 beta chain, putative,
expressed
Os05g46480.2 late embrvogenesis abundant 8.42 1.08E-05 18.4447 1.38329 protein, group 3, putative,
expressed (OsLEA3)
Os07g37690.1 UDP-glucoronosyl and UDP- 8.42 0.012705122 1.21277 0.0908814 glucosyl transferase domain
containing protein, expressed
Os02gl6000.1 E1-BTB1 - Bric-a-Brac, 8.41 0.001700045 1.86881 0.138122
Tramtrack, and Broad Complex
domain with El subfamily
conserved sequence,
expressed
Os01g73830.1 expressed protein 8.11 0.028925119 1.32138 0.102768
Os01g68290.1 expressed protein 8.07 2.86E-07 408.154 31.9028
Os01g06310.1 glycine-rich cell wall structural 8.06 1.41E-06 66.2272 5.18048 protein precursor, putative,
expressed
Osl2g33130.1 expressed protein 7.81 1.44E-06 119.968 9.68975
Os03gl8850.1 pathogenesis-related Bet v 1 7.80 0.001346482 6.01608 0.486655 family protein, putative,
expressed
Os08gl9420.1 O-methyltransferase, putative, 7.62 1.94E-05 11.9352 0.987687 expressed
Os06g49660.1 transferase family protein, 7.43 0.004939444 1.95157 0.165563 putative, expressed
Os06g46270.1 NAC domain transcription 7.40 0.0320483 1.26111 0.107533 factor
Os01g55940.1 OsGH3.2 - Probable indole-3- 7.14 9.95E-05 4.82056 0.425924 acetic acid-amido synthetase,
expressed
Os06g36390.2 expressed protein 7.04 0.000893281 4.66685 0.418074
Osl2g07970.2 transporter, major facilitator 6.86 0.019455049 1.20617 0.110105 family, putative, expressed
Os04g49980.1 late embrvogenesis abundant 6.66 0.000841869 10.3023 0.975863 group 1, putative, expressed
(OsLEAl)
Os02g28170.1 transferase family protein, 6.49 0.01744985 1.28606 0.124938 putative, expressed
Os01g42860.1 inhibitor 1 family protein, 6.45 0.049838642 3.9417 0.385182 putative, expressed
Osllg40530.1 LTPL162 - Protease 6.30 7.07E-06 179.129 17.9183 inhibitor/seed storage/LTP
family protein precursor,
expressed
Os01g09220.1 transposon protein, putative, 5.88 0.019435644 1.45257 0.155772
CACTA, En/Spm sub-class,
expressed
Os04g54330.1 acetyltransferase, GNAT 5.82 0.045569669 1.40486 0.153768 family, putative, expressed
Os03g08550.1 STRUBBELIG-RECEPTOR 5.80 0.002096038 2.17117 0.234815
FAMILY 6 precursor, putative,
expressed
Os03g20870.1 zinc finger, C3HC4 type 5.79 0.000419056 7.89185 0.859687 domain containing protein,
expressed
Os05g43300.1 expressed protein 5.78 0.00324686 2.50565 0.27477
Os08g31340.1 heavy metal-associated 5.76 0.010627881 2.69415 0.29489 domain containing protein,
expressed
Os04g54330.3 acetyltransferase, GNAT 5.74 0.04074359 1.50025 0.1642 family, putative, expressed
Os07gl0420.1 expressed protein 5.66 4.95E-05 39.7652 4.43137
Os03g43720.1 transporter family protein, 5.61 0.006395436 2.00027 0.226837 putative, expressed
Osl2g38270.1 metallothionein, putative, 5.53 0.000403064 22.7044 2.58901 expressed (related to OsMTla)
Osl0g34614.1 csAtPR5, putative, expressed 5.49 0.039014666 1.34781 0.152235
Os05g07940.1 glyoxalase family protein, 5.46 0.000258157 13.8468 1.60099 putative, expressed
Os02g08440.1 WRKY71, expressed 5.38 0.03227178 1.41166 0.164446
Os03g04500.1 tetratricopeptide repeat 5.33 0.021962974 1.04358 0.124314 domain containing protein,
expressed
Os03g55590.1 MYB family transcription 5.28 9.62E-05 18.0639 2.15755 factor, putative, expressed
Osl2g42910.1 sodium/calcium exchanger 5.26 0.013891386 1.61749 0.194023 protein, putative, expressed
Os08g35620.1 HD domain containing protein, 5.23 0.01181755 1.29624 0.156381 putative, expressed
Os04g38680.1 transmembrane amino acid 5.23 0.000612057 7.00345 0.844909 transporter protein, putative,
expressed
Os04g58750.3 protein kinase family protein, 5.23 0.010002973 2.09933 0.251298 putative, expressed
Os05g01280.2 expressed protein 5.08 0.041787996 4.1354 0.508973
Os02g36974.2 14-3-3 protein, putative, 5.07 0.002758265 5.64025 0.70212 expressed
Os01g53240.1 BURP domain containing 5.07 0.000123555 22.1057 2.7515 protein, expressed
Os01g66100.1 gibberellin 20 oxidase 2 (semi- 4.91 0.0045523 4.05657 0.521365 dwarfing gene SD1)
Os06g23350.1 late embryogenesis abundant 4.90 0.013580481 3.53686 0.45529 protein D-34, putative,
expressed (OsLEA33)
Os02gl6630.1 tryptophan biosynthesis 4.87 0.034101964 1.78049 0.228005
protein trpCF, putative,
expressed
Os04g42250.3 transferase family protein, 4.86 0.0027841 4.33123 0.561044 putative, expressed
Os01g27020.3 transposon protein, putative, 4.76 0.046556802 1.02605 0.134374 unclassified, expressed
Os05g23440.2 solute carrier family 35 4.74 0.027841494 2.05889 0.273971 member Fl, putative,
expressed
Os04g02900.1 dehydrogenase El component 4.70 0.000341814 14.179 1.90125 domain containing protein,
expressed
Os02g42290.3 OsClp3 - Putative Clp protease 4.66 0.000410464 19.8523 2.68277 homologue, expressed
Os03g07130.1 RING finger protein 13, 4.65 0.015820352 1.75596 0.23755 putative, expressed
Os07g47450.1 flowering promoting factor4.41 0.006286889 15.6035 2.23356 like 1, putative, expressed
Os05g45090.1 anthocyanidin 5,3-0- 4.38 0.044069989 1.4007 0.201701 glucosyltransferase, putative,
expressed
Os05gl5770.1 glycosyl hydrolase, putative, 4.35 0.000540829 25.293 3.66743 expressed
Osl0g25130.1 aminotransferase, classes 1 4.32 0.001426589 7.73144 1.12752 and II, domain containing
protein, expressed
Os05g09600.3 GA11916-PA, putative, 4.32 0.030862698 3.39147 0.498372 expressed
Os05g49940.1 expressed protein 4.14 0.001070071 35.3562 5.37991
Os05g07940.5 glyoxalase family protein, 4.13 0.00368885 10.1542 1.548 putative, expressed
Os08g08960.1 Cupin domain containing 4.12 0.027926452 3.87949 0.593737 protein, expressed
Os02g55590.1 expressed protein 4.07 0.011803933 2.68421 0.414516
Os01g46600.1 seed maturation protein 4.06 0.003422302 41.6122 6.46556
PM41, putative, expressed
Os02g07230.2 porphobilinogen deaminase, 4.05 0.028910079 2.56107 0.401008 chloroplast precursor,
putative, expressed
Os01g72890.2 transposon protein, putative, 4.03 0.019251511 2.75861 0.42939
CACTA, En/Spm sub-class,
expressed
Osl0gl8150.1 crooked neck, putative, 4.02 0.018603025 1.86837 0.292938
expressed
Os09g29710.1 beta-expansin precursor, 4.02 0.041299195 4.5672 0.717197 putative, expressed
Os05g08980.3 expressed protein 4.00 0.007464156 5.90306 0.929681
Os09g21120.1 armadillo/beta-catenin repeat 4.00 0.017785079 1.85889 0.293372 family protein, putative,
expressed
Os07g04220.1 wound and phytochrome 3.93 0.043253877 1.08147 0.17371 signaling involved receptor like
kinase, putative, expressed
Os09g33810.2 ankyrin repeat domain 3.92 0.009507488 4.72312 0.76076 containing protein, putative,
expressed
Os04g33500.1 protein kinase, putative, 3.92 0.035154191 2.07574 0.334254 expressed
Os01g59600.2 peptidase, Tl family, putative, 3.92 0.026888423 3.62538 0.583029 expressed
Os04g55850.1 nuclease PA3, putative, 3.89 0.003666708 11.3396 1.84064 expressed
Os09gl9940.2 cwfJ-like family protein, 3.87 0.048843213 1.31393 0.214269 putative, expressed
Osl0g39920.1 expressed protein 3.85 0.006408314 12.0164 1.9664
Os02g32520.1 early-responsive dehydration 3.85 0.004053087 3.76972 0.618829
1 (ERD1) protein
Osl0g38610.1 glutathione S-transf erase, 3.83 0.007759607 8.05908 1.32678 putative, expressed
Os03g08580.1 expressed protein 3.80 0.008598883 7.34964 1.21944
Os01g08440.1 UDP-glucoronosyl and UDP- 3.79 0.009586004 4.33448 0.721899 glucosyl transferase domain
containing protein, expressed
Os04gl0680.3 zinc finger, C3HC4 type 3.70 0.041016557 1.24967 0.212153 domain containing protein,
expressed
Os01g51010.1 DUF292 domain containing 3.70 0.032642746 1.00933 0.172579 protein, expressed
Os05gl0940.1 metal cation transporter, 3.68 0.013041639 4.15535 0.712355 putative, expressed
Os03g03810.1 DEF8 - Defensin and Defensin- 3.67 0.002356129 56.5489 9.72839 like DEFL family, expressed
Os07g36465.1 vacuolar ATP synthase subunit 3.65 0.045822573 6.42183 1.10929
H, putative, expressed
Osllg47809.1 metallothionein, putative, 3.63 0.001210069 156.213 27.1128 expressed (OsMTla)
Os01g70920.2 cullin-1, putative, expressed 3.62 0.040235358 2.53091 0.442728
Os05g34830.3 NAC domain transcription 3.59 0.010772328 6.60158 1.16018 factor
Os01g65480.1 dnaJ domain containing 3.57 0.016264368 4.51583 0.797834 protein, expressed
Os09g26620.4 auxin-repressed protein, 3.57 0.039860726 5.27219 0.926879 putative, expressed
Os01gl9150.5 CGMC_GSK.3 - CGMC includes 3.55 0.032144494 2.3096 0.410895
CDA, MAPK, GSK3, and CLKC
kinases, expressed
Os06g37010.2 metal cation transporter, 3.53 0.035643776 2.62741 0.46961 putative, expressed
Osl0g33960.2 START domain containing 3.52 0.024508117 1.76838 0.317967 protein, expressed
Os04g52450.1 aminotransferase, putative, 3.46 0.005097202 8.77895 1.59814 expressed
Os06g03660.1 peroxisomal biogenesis factor 3.44 0.010123999 6.15175 1.12762
11, putative, expressed
Osllg03300.2 NAC domain transcription 3.42 0.043369255 3.19666 0.590187 factor (OsNACIO)
Os07g48830.2 glycosyl transferase 8 domain 3.36 0.003255207 29.1802 5.47601 containing protein, putative,
expressed
Os02gl2650.1 puromycin-sensitive 3.33 0.005200384 7.0731 1.33811 aminopeptidase, putative,
expressed
Os01g09300.3 oxidoreductase, putative, 3.31 0.040225522 3.25537 0.622002 expressed
Os03g61920.1 electron transfer flavoprotein 3.30 0.007785135 10.1092 1.93468 subunit alpha, mitochondrial
precursor, putative, expressed
Os04g56110.1 protein kinase, putative, 3.29 0.009049751 8.07154 1.54822 expressed
Os04g53690.1 expressed protein 3.29 0.036186551 4.03281 0.77431
Os09g34280.1 ankyrin repeat-containing 3.25 0.010233398 5.23619 1.01564 protein, putative, expressed
Os07g48160.1 alpha-galactosidase precursor, 3.23 0.020628362 4.7077 0.918123 putative, expressed
Os04g54830.1 expressed protein 3.19 0.033398369 2.32475 0.459516
Os01g37750.1 glutathione S-transf erase, 3.18 0.0105181 14.6467 2.90378 putative, expressed
Osl0gll810.1 dehydrogenase, putative, 3.11 0.022703831 5.79326 1.17309 expressed
Os08g05570.3 monodehydroascorbate 3.11 0.019060015 4.55583 0.926648 reductase, putative, expressed
Os03g50290.1 14-3-3 protein, putative, 3.09 0.005406408 31.7782 6.47917 expressed
Os04g58360.1 expressed protein 3.09 0.025484871 18.1069 3.69421
Os03gl7930.2 alpha-taxilin, putative, 3.06 0.047655945 3.01106 0.621429 expressed
Os02g57840.2 remorin C-terminal domain 3.05 0.021179187 11.2032 2.31616 containing protein, putative,
expressed
Os08g38880.4 WD-40 repeat family protein, 3.04 0.012817107 9.44055 1.95841 putative, expressed
Os01g53880.5 OslAA6 - Auxin-responsive 3.02 0.017470191 6.78062 1.41427
Aux/IAA gene family member,
expressed
Os05g34830.1 NAC domain transcription 3.02 0.012973598 11.6291 2.426 factor
Os05g03920.1 TKL_IRAK_DUF26-lf.3 - DUF26 3.02 0.014560547 5.98364 1.25081 kinases have homology to
DUF26 containing loci,
expressed
Osl2g03470.4 alpha-N-arabinofuranosidase 3.02 0.028865128 2.99124 0.626884
A, putative, expressed
Os09g28050.1 asparate aminotransferase, 3.01 0.00959124 13.2161 2.7631 putative, expressed
Osllg03780.2 alpha-N-arabinofuranosidase, 3.00 0.011278122 8.13877 1.71027 putative, expressed
Os04g33590.1 hydrolase, alpha/beta fold 2.99 0.044269298 3.8648 0.816558 family protein, putative,
expressed
Osllg40090.2 A49-like RNA polymerase 1 2.98 0.024667002 5.07588 1.07563 associated factor family
protein, expressed
Os06gl0750.1 integral membrane protein 2.96 0.01881857 7.51249 1.59882
DUF6 containing protein,
expressed
Os08g35740.1 12-oxophytodienoate 2.95 0.016204039 9.46148 2.02497 reductase, putative, expressed
Os09g31130.1 citrate transporter, putative, 2.94 0.041760309 2.64974 0.568961 expressed
Os03g44900.1 CCR4-NOT transcription factor, 2.93 0.043888981 2.01017 0.432212 putative, expressed
Os09g21230.2 AMP-binding enzyme, 2.87 0.011871401 11.3363 2.49409 putative, expressed
Os05g46480.1 late embryogenesis abundant 2.84 0.008633078 70.9919 15.7612 protein, group 3, putative,
expressed (OsLEA3)
Os01g63990.2 hydrolase, alpha/beta fold 2.84 0.011984955 20.3489 4.51509 family protein, putative,
expressed
Os01g59000.1 cytochrome P450, putative, 2.84 0.026288698 6.02527 1.33845 expressed
Os02g52560.1 xyloglucan fucosyltransferase, 2.83 0.019421299 7.09289 1.57996 putative, expressed
Osl0g41060.1 expressed protein 2.81 0.034573323 4.15975 0.932969
Osl2g03040.1 NAC domain transcription 2.80 0.022774518 7.96675 1.79473 factor
Os04g35060.1 nicotinate 2.80 0.026759488 5.27013 1.18742 phosphoribosyltransferase
family domain containing
protein, expressed
Os08g03290.1 glyceraldehyde-3-phosphate 2.79 0.007669592 174.12 39.3703 dehydrogenase, putative,
expressed
Os07gl2150.1 acyl carrier protein, putative, 2.76 0.040950598 11.6442 2.65945 expressed
Os05g42210.1 serine/threonine-protein 2.75 0.018907713 6.76181 1.54937 kinase receptor precursor,
putative, expressed
Os09gll460.2 AP2 domain containing 2.75 0.024284631 9.94016 2.27893 protein, expressed
Os06g24730.1 hydrolase, alpha/beta fold 2.75 0.009674252 47.9783 11.0139 family domain containing
protein, expressed
Os06g41930.3 zinc-binding protein, putative, 2.73 0.036007727 6.44591 1.48721 expressed
Os06g47200.1 LTPL85 - Protease 2.70 0.027390758 20.0421 4.6762 inhibitor/seed storage/LTP
family protein precursor,
expressed
Os02g56850.1 glutathione reductase, 2.70 0.019441752 11.4648 2.68255 putative, expressed
Os01g50450.1 expressed protein 2.68 0.023521504 14.7349 3.46828
Os07gl3270.1 SNF7 domain containing 2.64 0.025151051 18.5537 4.43033 protein, putative, expressed
Os04g49757.1 purine permease, putative, 2.63 0.037495399 7.75265 1.86432 expressed
Os02gl5860.1 expressed protein 2.62 0.015275712 187.296 45.0737
Os01g62060.1 plant-specific domain 2.58 0.040598341 17.8803 4.36682
TIGR01589 family protein,
expressed
Os03g56460.1 glucose-6-phosphate 2.57 0.039210869 5.37327 1.32074 isomerase, putative, expressed
Os04g55720.2 D-3-phosphoglycerate 2.55 0.021651388 16.1942 4.00543 dehydrogenase, chloroplast
precursor, putative, expressed
Os01gl7190.1 OsCam3 - Calmodulin, 2.54 0.02590334 33.2291 8.24689 expressed
Os05g46560.2 RAN GTPase-activating protein 2.53 0.033625822 8.10648 2.0235
1, putative, expressed
Os01g07950.1 OsGrx_S15.2 - glutaredoxin 2.53 0.03846351 15.8821 3.96206 subgroup II, expressed
Os04g56160.1 plasma membrane ATPase, 2.53 0.031998692 5.10151 1.27298 putative, expressed
Os01g58380.1 3-hydroxybutyryl-CoA 2.51 0.028660723 18.6086 4.66751 dehydrogenase, putative,
expressed
Os06g48500.1 expressed protein 2.51 0.031334088 13.4713 3.38703
Os05g24550.4 Papain family cysteine 2.50 0.017546457 117.503 29.6923 protease domain containing
protein, expressed
Os03g05310.1 pheophorbide a oxygenase, 2.48 0.021235417 27.755 7.05028 chloroplast precursor,
putative, expressed
Osl0g35070.1 alpha-galactosidase precursor, 2.46 0.019744005 103.457 26.5642 putative, expressed
Os01g73170.1 peroxidase precursor, 2.45 0.041846292 10.9312 2.81781 putative, expressed
Os04g55720.1 D-3-phosphoglycerate 2.44 0.024351298 25.7436 6.64834 dehydrogenase, chloroplast
precursor, putative, expressed
Osl0g31330.1 retrotransposon protein, 2.39 0.025256249 86.8535 22.9056 putative, unclassified,
expressed
Os02g07260.1 phosphoglycerate kinase 2.37 0.026635993 53.5015 14.2099 protein, putative, expressed
Os04g38870.4 14-3-3 protein, putative, 2.34 0.040467828 23.7275 6.38233 expressed
Os08g33710.1 ribonuclease T2 family domain 2.34 0.035044134 33.4444 9.00889 containing protein, expressed
Os02g32520.2 ERD1 protein, chloroplast 2.33 0.03683252 14.9923 4.05293 precursor, putative, expressed
Os06g07760.1 sulfiredoxin-1, putative, 2.33 0.046904416 29.9865 8.1148 expressed
Os06g03800.1 pollen ankyrin, putative, 2.32 0.045719504 12.2605 3.33104 expressed
Os01gl0890.1 CAMK_KIN1/SNF1/Niml_like.8 2.31 0.039219237 18.5848 5.07691
- CAMK includes
calcium/calmodulin dep.
protein kinases, expressed
Os05g47700.1 LTPL152 - Protease 2.30 0.042697449 52.4999 14.3715 inhibitor/seed storage/LTP
family protein precursor,
expressed
Os08g25720.1 pyrophosphate-fructose 6- 2.30 0.048255047 8.9484 2.45378 phosphate 1- phosphotransferase subunit
alpha, putative, expressed
Os06g29180.1 erythronate-4-phosphate 2.30 0.033926849 44.5829 12.2327 dehydrogenase domain
containing protein, expressed
Os01g68300.1 expressed protein 2.22 0.035781973 1111.02 315.67
Os02g52390.1 M16 domain containing zinc 2.20 0.039703736 44.7604 12.8433 peptidase, putative, expressed
Os07g05360.1 photosystem II 10 kDa 2.18 0.045788927 59.2679 17.1484 polypeptide, chloroplast
precursor, putative, expressed
Osl2g33120.1 expressed protein 2.17 0.045013224 237.343 68.9371
Os01g37910.1 vacuolar-processing enzyme 2.15 0.04915593 48.0585 14.1222 precursor, putative, expressed
Os03g57220.2 hydroxyacid oxidase 1, -2.11 0.04973388 120.76 160.463 putative, expressed
Os08g44680.1 photosystem 1 reaction center -2.11 0.048774331 646.373 859.146 subunit II, chloroplast
precursor, putative, expressed
Os09g00999.1 expressed protein -2.16 0.042040381 624.184 849.324
Os07g09800.1 expressed protein -2.19 0.043369594 41.2813 57.066
Os04g21350.1 flowering promoting factor-2.22 0.039080205 81.6275 114.133 like 1, putative, expressed
Os08g01380.1 2Fe-2S iron-sulfur cluster -2.23 0.036387607 104.838 147.563 binding domain containing
protein, expressed
Os04gl6872.1 photosystem II D2 protein, -2.29 0.039753954 14.3788 20.7646 putative, expressed
Os03gl8770.1 wound-induced protein WI12, -2.32 0.037385003 17.4302 25.5421 putative, expressed
Os08g01170.1 acetyltransferase, GNAT -2.34 0.047340648 9.44318 13.9644 family, putative, expressed
Os01g58049.1 photosystem 1 assembly -2.36 0.038341618 15.4432 23.0173 protein ycf4, putative,
expressed
Os01g43980.1 retrotransposon protein, -2.36 0.042151575 1.88686 2.81276 putative, unclassified,
expressed
Osl2g35465.1 expressed protein -2.36 0.040741528 6.94725 10.3569
Os06gl5360.3 RAD23 DNA repair protein, -2.38 0.044872431 5.14721 7.72242 putative, expressed
Osl2g02340.2 LTPL14 - Protease -2.38 0.049365188 12.9394 19.4327 inhibitor/seed storage/LTP
family protein precursor,
expressed
Osllg35710.1 cycloartenol synthase, -2.39 0.033210561 4.83313 7.29655 putative, expressed
Os02g32250.1 retrotransposon protein, -2.40 0.029254255 5.09024 7.69633 putative, unclassified,
expressed
Os06gl6330.1 BRASSINOSTEROID -2.41 0.037727183 3.61924 5.49781
INSENSITIVE 1-associated
receptor kinase 1 precursor,
putative, expressed
Os01g01120.1 enolase-phosphatase El, -2.42 0.028980149 13.3159 20.327 putative, expressed
Os08gll470.1 transposon protein, putative, -2.42 0.040771816 2.54775 3.89277
CACTA, En/Spm sub-class,
expressed
Os02g01590.2 glycosyl hydrolases, putative, -2.42 0.038144132 3.89457 5.9538 expressed
Os07g01480.2 oxygen evolving enhancer -2.43 0.021063133 65.8037 100.78 protein 3 domain containing
protein, expressed
Osl2g43380.1 thaumatin, putative, -2.45 0.025703885 23.6051 36.423 expressed
Os04gl6722.1 uncharacterized protein ycf68, -2.45 0.018254508 9550.19 14744.2 putative, expressed
Os09g08910.1 ATP synthase, putative, -2.46 0.024377738 5.18384 8.03774 expressed
Os06g01210.1 plastocyanin, chloroplast -2.47 0.017359677 505.916 788.873 precursor, putative, expressed
Os04g40630.3 BTBZ4 - Bric-a-Brac, -2.48 0.040222601 3.98385 6.23537
Tramtrack, Broad Complex
BTB domain with TAZ zinc
finger and Calmodulin-binding
domains, expressed
Os08g23410.1 rubredoxin family protein, -2.49 0.021188627 22.0919 34.7154 putative, expressed
Os02g56940.2 expressed protein -2.50 0.048028799 4.29532 6.76306
Osllg02424.2 LTPL9 - Protease -2.50 0.025681419 17.3126 27.3406 inhibitor/seed storage/LTP
family protein precursor,
expressed
Os01g09620.1 zinc finger/CCCH transcription -2.51 0.026677194 6.04229 9.57034 factor, putative, expressed
Os09g26420.4 AP2 domain containing -2.51 0.020683786 13.4701 21.3636 protein, expressed
Os04g40100.1 BTBN11 - Bric-a-Brac, -2.52 0.028632449 3.80953 6.06242
Tramtrack, Broad Complex
BTB domain with non- phototropic hypocotyl 3 NPH3
domain, expressed
Os02g45750.1 protein kinase domain -2.53 0.045403651 2.33871 3.73764 containing protein, expressed
Osl0g24004.1 expressed protein -2.54 0.02111726 27.7315 44.3977
Osllgl3890.5 chlorophyll A-B binding -2.56 0.018394166 25.1011 40.4963 protein, putative, expressed
Os03g28960.1 DNA-directed RNA polymerase -2.56 0.03528912 2.1012 3.39128 subunit, putative, expressed
Os03g54150.1 expressed protein -2.57 0.032852054 1.98813 3.21744
Os06g39708.1 photosystem II P680 -2.58 0.023484887 5.94125 9.65741 chlorophyll A apoprotein,
putative, expressed
Os03gl7174.1 PsbP, putative, expressed -2.58 0.034992189 5.56692 9.05769
Os04g33660.1 bifunctional -2.62 0.037315729 3.86508 6.38636 monodehydroascorbate
reductase and carbonic
anhydrasenectarin-3
precursor, putative, expressed
Os08gl7390.1 expressed protein -2.63 0.024950826 3.38554 5.6187
Os02g40240.1 receptor kinase, putative, -2.63 0.03901775 1.04241 1.73003 expressed
Os07g22650.1 expressed protein -2.63 0.031528124 4.61748 7.66277
Os02g45520.1 uncharacterized membrane -2.64 0.020549594 3.45497 5.74754 protein, putative, expressed
Os01g01280.1 expressed protein -2.67 0.015628319 13.0445 21.9808
Os04g33830.1 membrane protein, putative, -2.68 0.010216745 211.314 356.58 expressed
Osl2g27370.1 expressed protein -2.71 0.041699717 1.6132 2.75822
Os07gl3969.1 expressed protein -2.71 0.0181913 10.7634 18.4216
Osl2g34054.1 mitochondrial ribosomal -2.73 0.049477102 1.26015 2.1663 protein S3, putative,
expressed
Os07g35260.1 TKL_IRAK_DUF26-lc.9 - DUF26 -2.76 0.019314796 3.40647 5.92903 kinases have homology to
DUF26 containing loci,
expressed
Os08gl5296.1 photosystem II reaction center -2.77 0.009029597 65.7876 114.745 protein H, putative, expressed
Os01g57968.1 expressed protein -2.77 0.007427768 1261.8 2207.7
Os02g42810.1 oxidoreductase, short chain -2.78 0.013632634 8.61573 15.1268 dehydrogenase/reductase
family domain containing
protein, expressed
Os05g48630.1 expressed protein -2.79 0.007437456 246.127 432.689
Osl2g41560.1 expressed protein -2.80 0.02902244 3.1284 5.52978
Osl0g21310.1 photosystem II P680 -2.80 0.015449955 4.52616 8.0044 chlorophyll A apoprotein,
putative, expressed
Os01g41710.1 chlorophyll A-B binding -2.81 0.006905218 323.987 573.608 protein, putative, expressed
Os08g06090.1 zinc finger, C3HC4 type -2.82 0.036649395 2.8734 5.11857 domain containing protein,
expressed
Os03g52239.2 homeobox domain containing -2.85 0.020717277 3.22534 5.788 protein, expressed
Os02g24598.1 chloroplast envelope -2.85 0.007994176 36.1604 64.9277 membrane protein, putative,
expressed
Os04gl2080.1 TKL_IRAK_DUF26-lc.7 - DUF26 -2.85 0.041070403 1.31646 2.36718 kinases have homology to
DUF26 containing loci,
expressed
Os04g44924.1 short-chain -2.86 0.017612658 4.64346 8.3898 dehydrogenase/reductase,
putative, expressed
Os02g01140.1 GDSL-like -2.87 0.01280911 6.24649 11.3211 lipase/acylhydrolase, putative,
expressed
Osl2g33946.1 cytochrome c oxidase subunit -2.89 0.014298673 3.79342 6.92534
1, putative, expressed
Osl0g21230.1 ATP synthase C chain, -2.91 0.044044755 4.26926 7.82835 putative, expressed
Os09g37710.1 NIN, putative, expressed -2.93 0.046112809 0.58783 1.08828
Os05gll064.1 expressed protein -2.94 0.028587135 2.32589 4.31324
Os09gl7850.1 acetyltransferase type B -2.95 0.040313841 1.18819 2.21185 catalytic subunit, putative,
expressed
Os06g40640.2 fructose-bisphospate aldolase -2.97 0.005871929 18.5791 34.7809 isozyme, putative, expressed
Os03gll250.1 expressed protein -2.97 0.037124169 1.90148 3.56756
Os02g42310.2 OsSCP8 - Putative Serine -2.98 0.007515762 8.86358 16.6299
Carboxypeptidase homologue,
expressed
Os07gl2800.2 expressed protein -3.00 0.040948201 0.964209 1.82098
Osl2gl9470.1 ribulose bisphosphate -3.00 0.006825462 9.71274 18.4053 carboxylase small chain,
chloroplast precursor,
putative, expressed
Osl2g34108.1 ATP synthase protein 9, -3.01 0.01931871 3.70372 7.04199 mitochondrial, putative,
expressed
Osl2gl6350.12 enoyl-CoA -3.03 0.015357674 2.53417 4.84772 hydratase/isomerase family
protein, putative, expressed
Os01g57960.1 retrotransposon protein, -3.05 0.003686299 113.058 217.275 putative, unclassified,
expressed
Os04g02920.1 leucine-rich repeat family -3.05 0.040133619 0.894626 1.71945 protein, putative, expressed
Os06gl5730.1 expressed protein -3.06 0.01207292 2.04551 3.94106
Os01g51410.2 glycine dehydrogenase, -3.06 0.004114518 12.9951 25.0591 putative, expressed
Os02g39570.6 ACT domain containing -3.09 0.041130025 1.10089 2.13905 protein, expressed
Os08g02070.1 OsMADS26 - MADS-box family -3.09 0.008546826 6.93434 13.5106 gene with MIKCc type-box,
expressed
Osl2g42250.1 ZOS12-10 - C2H2 zinc finger -3.11 0.043405939 1.68039 3.29125 protein, expressed
Os09g01000.1 expressed protein -3.13 0.002835193 28626.9 56678.2
Os01g48950.1 expressed protein -3.14 0.009488916 9.21536 18.2327
Os01g53330.1 anthocyanidin 5,3-0- -3.15 0.03594689 0.977994 1.94335 glucosyltransferase, putative,
expressed
Os02g36210.1 ent-kaurene synthase, -3.16 0.013488185 1.26204 2.51531 chloroplast precursor,
putative, expressed
Osllg41034.1 expressed protein -3.17 0.026471925 1.06521 2.13003
Os02g24614.1 DNA-directed RNA polymerase -3.18 0.020292773 1.16077 2.32663 subunit beta, putative,
expressed
Os06g43350.1 cytochrome P450, putative, -3.19 0.021363349 1.41985 2.86078 expressed
Os02g42330.2 nitrilase, putative, expressed -3.20 0.031210755 1.40234 2.82859
Os03g04060.1 CHIT16 - Chitinase family -3.20 0.004653141 11.2584 22.7463 protein precursor, expressed
Os04g52479.3 peptidase, trypsin-like serine -3.22 0.01634472 1.2232 2.48759 and cysteine proteases,
putative, expressed
Os05g26070.1 cyclin, putative, expressed -3.22 0.024496667 1.48547 3.01958
Osllgl3890.4 chlorophyll A-B binding -3.23 0.002404666 108.795 221.402 protein, putative, expressed
Os06g03580.1 zinc RING finger protein, -3.24 0.044828258 1.12059 2.29091 putative, expressed
Os01g45274.1 carbonic anhydrase, -3.26 0.002517656 38.5148 79.1304 chloroplast precursor,
putative, expressed
Os03gl2660.1 cytochrome P450, putative, -3.32 0.013360285 1.53999 3.22067 expressed
Os02g24100.1 expressed protein -3.32 0.044769085 1.86548 3.90163
Os04g24300.1 OsWAK35a - OsWAK short -3.32 0.027020786 0.623301 1.30685 gene, expressed
Osl0g21190.1 expressed protein -3.33 0.001711351 2445.89 5139.54
Osllg06800.1 retrotransposon protein, -3.39 0.049559639 1.39094 2.97058 putative, unclassified,
expressed
Osllg46810.1 retrotransposon protein, -3.42 0.002118456 13.8543 29.8772 putative, unclassified,
expressed
Os01g57020.1 expressed protein -3.44 0.003842246 4.58919 9.94446
Os01g48990.2 uncharacterized kinase -3.44 0.003696533 5.13813 11.1609 mug58, putative, expressed
Osl2g34018.1 ATP synthase protein YMF19, -3.45 0.044235735 1.23426 2.68572 putative, expressed
Os01g44020.1 expressed protein -3.45 0.041502973 2.27925 4.96304
Osl0g37180.1 glycine cleavage system H -3.46 0.001738309 32.6701 71.3354 protein, putative, expressed
Os01gl2710.2 oxidoreductase, short chain -3.47 0.008159118 1.98177 4.34252 dehydrogenase/reductase
family domain containing
protein, expressed
Os03g22200.2 nodulin MtN3 family protein, -3.48 0.049214892 1.06068 2.32982 putative, expressed
Osl2g44030.1 purple acid phosphatase -3.49 0.011989244 1.94701 4.28544 precursor, putative, expressed
Os03gl4040.2 expressed protein -3.50 0.028420934 1.76265 3.89431
Os02g22100.3 OsRhmbd6 - Putative -3.54 0.042450158 0.656258 1.47098
Rhomboid homologue,
expressed
Osl2g24320.1 ATPase 3, putative, expressed -3.55 0.018458942 0.924916 2.06871
Os05g45890.2 tRNAHis guanylyltransferase -3.60 0.039618106 0.528332 1.20289 family protein, expressed
Osl0g21396.1 NADPH-dependent -3.60 0.008362727 2.31162 5.25042 oxidoreductase, putative,
expressed
Os07g01480.1 oxygen evolving enhancer -3.60 0.03269576 0.946308 2.14243 protein 3 domain containing
protein, expressed
Osl0g42020.1 RALFL29 - Rapid ALkalinization -3.64 0.002649312 11.3037 25.9462
Factor RALF family protein
precursor, expressed
Os07g05480.2 photosystem 1 reaction center -3.66 0.003326406 8.08208 18.6791 subunit, chloroplast precursor,
putative, expressed
Os06g38450.1 vignain precursor, putative, -3.66 0.002890345 4.15974 9.60965 expressed
Os08gl5322.1 cytochrome b559 subunit -3.66 0.008488865 2.77526 6.41236 alpha, putative, expressed
Os03g34310.2 expressed protein -3.67 0.038910641 0.830196 1.91576
Os03gl5460.1 expressed protein -3.68 0.019181151 1.94767 4.51519
Osllgl3890.6 chlorophyll A-B binding -3.70 0.005435782 2.43461 5.68905 protein, putative, expressed
Os01g69840.1 expressed protein -3.71 0.002170427 14.9403 34.9671
Os07g48040.1 peroxidase precursor, -3.71 0.002173163 5.36435 12.5589 putative, expressed
Osllg40090.1 A49-like RNA polymerase 1 -3.73 0.017651288 0.842065 1.98187 associated factor family
protein, expressed
Osl2g34094.1 NADH-ubiquinone -3.75 0.028523155 0.860706 2.03713 oxidoreductase chain 4,
putative, expressed
Os04gl6820.1 DNA-directed RNA polymerase -3.77 0.009887744 0.555736 1.32178 subunit beta, putative,
expressed
Os06g46434.1 cytochrome c biogenesis -3.78 0.046199711 0.769943 1.83503 protein ccsA, putative,
expressed
Os04gl0750.4 inorganic phosphate -3.80 0.007369382 1.16562 2.7978 transporter, putative,
expressed
Os08g35740.2 12-oxophytodienoate -3.80 0.006247429 1.87677 4.50112 reductase, putative, expressed
Os01g63990.5 hydrolase, alpha/beta fold -3.81 0.029529997 0.763068 1.82868 family protein, putative,
expressed
Os03g45779.1 expressed protein -3.83 0.012357599 1.6604 4.01537
Os06g41010.3 zinc finger A20 and AN1 -3.86 0.019926181 1.28767 3.1428 domain-containing stress- associated protein, putative,
expressed
Osl0g42040.1 expressed protein -3.88 0.030731625 2.21964 5.4372
Osl0g01080.1 SOR/SNZ family protein, -3.89 0.005069858 2.20006 5.39425 putative, expressed
Os06g40640.1 fructose-bisphospate aldolase -3.91 0.001400842 4.08166 10.0541 isozyme, putative, expressed
Os07gllll0.1 NAD dependent -3.93 0.000675528 11.7843 29.1984 epimerase/dehydratase family
protein, putative, expressed
Os02g45520.2 uncharacterized membrane -3.94 0.00421714 1.15253 2.87185 protein, putative, expressed
Os01gl6920.1 embryonic protein DC-8, -3.98 0.006093606 2.35729 5.91148 putative, expressed
Os06g23870.2 acyl-CoA dehydrogenase -3.98 0.001086021 12.4808 31.332 domain protein, putative,
expressed
Os08g31410.5 sulfate transporter, putative, -3.98 0.018120375 0.481531 1.21264 expressed
Osl0g38940.1 fatty acid hydroxylase, -3.98 0.012011389 1.32302 3.32473 putative, expressed
Os01g45274.4 carbonic anhydrase, -4.00 0.000390136 71.9813 181.803 chloroplast precursor,
putative, expressed
Os09g24200.1 RAD23 DNA repair protein, -4.06 0.011957671 0.943316 2.41856 putative, expressed
Os01g61880.2 respiratory burst oxidase, -4.11 0.001153124 2.15394 5.57829 putative, expressed
Osllg01240.1 IBR domain containing -4.11 0.021607225 0.542908 1.40751 protein, expressed
Os03g39610.2 chlorophyll A-B binding -4.11 0.000332278 30.8309 79.9466 protein, putative, expressed
Os01gl3120.1 aquaporin protein, putative, -4.12 0.026464665 0.811939 2.1104 expressed
Os04g29550.1 RIPER2 - Ripening-related -4.12 0.007320102 2.32311 6.04122 family protein precursor,
expressed
Os04g01780.1 uncharacterized ACR, -4.13 0.003012322 2.22556 5.79825
COG1399 family protein,
expressed
Os05g37170.8 transcription factor, putative, -4.14 0.0137674 0.798359 2.07846 expressed
Os09g26210.1 ZOS9-12 - C2H2 zinc finger -4.16 0.017146048 1.47155 3.85929 protein, expressed
Os04g38600.1 glyceraldehyde-3-phosphate -4.23 0.002482698 1.73177 4.6172 dehydrogenase, putative,
expressed
Os01g28500.1 SCP-like extracellular protein, -4.25 0.006643665 2.32969 6.24835 expressed
Os02g46380.2 purine permease, putative, -4.33 0.033108641 0.449198 1.21927 expressed
Os03g31026.2 retrotransposon protein, -4.33 0.004295454 0.867985 2.37493 putative, unclassified,
expressed
Osl2g33962.1 uncharacterized tatC-like -4.34 0.048989573 0.531805 1.45633 protein ymfl6, putative,
expressed
Os01g32460.1 expressed protein -4.39 0.03102075 0.964544 2.67056
Osl2g39620.5 disease resistance protein, -4.41 0.012012142 0.436545 1.21301 putative, expressed
Os01g25484.3 ferredoxin-nitrite reductase, -4.43 0.000827728 2.18109 6.1005 putative, expressed
Os04gl6770.1 photosynthetic reaction center -4.46 0.000193741 17.4533 49.0407 protein, putative, expressed
Os06g40640.3 fructose-bisphospate aldolase -4.46 0.000239742 9.6605 27.1746 isozyme, putative, expressed
Osl2gl2580.2 NADP-dependent -4.46 0.008349851 1.02209 2.88737 oxidoreductase, putative,
expressed
Os01g51570.1 glycosyl hydrolases family 17, -4.51 0.040226868 0.445291 1.26603 putative, expressed
Os08g01690.1 retrotransposon protein, -4.52 0.007619224 0.811031 2.30538 putative, unclassified,
expressed
Osl0g21418.1 NADPH-dependent -4.54 0.000351456 3.03207 8.68233 oxidoreductase, putative,
expressed
Os01g62060.3 plant-specific domain -4.57 0.042980678 0.944953 2.72623
TIGR01589 family protein,
expressed
Os04g40530.1 methyltransferase domain -4.60 0.001394639 2.6646 7.7336 containing protein, expressed
Os08g01240.1 expressed protein -4.65 0.007485999 1.61447 4.73775
Os01g64660.4 fructose-l,6-bisphosphatase, -4.79 0.007454393 0.760764 2.29732 putative, expressed
Os08g35420.1 photosynthetic reaction center -4.81 7.82E-05 27.3698 83.0373 protein, putative, expressed
Os02g01380.1 expressed protein -4.85 0.005170394 0.670185 2.05088
Osl0g42030.1 expressed protein -4.87 0.01204109 0.834753 2.56518
Osl2g38170.1 osmotin, putative, expressed -4.88 5.60E-05 80.4968 247.673
Osl0g04730.1 TKL_IRAK_DUF26-la.6 - DUF26 -4.96 0.000585907 1.3146 4.1092 kinases have homology to
DUF26 containing loci,
expressed
Os04g52260.1 LTPL124 - Protease -4.96 0.001867307 2.12163 6.63514 inhibitor/seed storage/LTP
family protein precursor,
expressed
Os02g57180.2 NADH dehydrogenase 1 alpha -5.12 0.006046562 0.649766 2.10466 subcomplex subunit
9,mitochondrial precursor,
putative, expressed
Os04g58050.1 expressed protein -5.13 0.002431313 1.06758 3.45488
Os01g03310.1 BBTI1 - Bowman-Birk type -5.14 5.53E-05 19.5107 63.2453 bran trypsin inhibitor
precursor, expressed
Os07g40690.1 NAD dependent -5.18 0.009711085 0.587754 1.92089 epimerase/dehydratase family
protein, putative, expressed
Os01g55570.4 expressed protein -5.20 0.002342732 1.82155 5.97436
Os06g21980.2 pantothenate kinase 4, -5.23 0.044238551 0.307777 1.00544 putative, expressed
Os01g55974.3 deoxycytidylate deaminase, -5.29 0.014567188 0.470402 1.57056 putative, expressed
Os05gl0310.1 acid phosphatase, putative, -5.37 0.016168211 0.382125 1.29311 expressed
Os01g74160.1 carboxyl-terminal peptidase, -5.37 0.000165502 3.05855 10.3628 putative, expressed
Os02gl4170.2 peroxidase precursor, -5.38 0.006864916 0.652723 2.21656 putative, expressed
Osllg05190.1 phytosulfokines precursor, -5.48 0.01678246 0.678707 2.34629 putative, expressed
Osl0g41999.1 RALFL27 - Rapid ALkalinization -5.52 0.040682104 0.495348 1.72315
Factor RALF family protein
precursor, expressed
Os06g39120.1 expressed protein -5.53 0.000226805 3.33059 11.6259
Osl2g39620.4 disease resistance protein, -5.55 0.003196162 0.39917 1.40199 putative, expressed
Osl2g24050.1 retrotransposon protein, -5.56 0.000491875 0.388465 1.36269 putative, unclassified,
expressed
Os07gl3770.1 UDP-glucoronosyl and UDP- -5.73 0.002184869 0.618458 2.23392 glucosyl transferase domain
containing protein, expressed
Os02g24642.1 photosystem II reaction center -5.76 0.020955552 0.944201 3.43118 protein K precursor, putative,
expressed
Os03gl4669.2 core histone H2A/H2B/H3/H4, -5.81 2.24E-05 5.57868 20.4331 putative, expressed
Osllgl3890.2 chlorophyll A-B binding -6.10 0.016302812 0.309686 1.19768 protein, putative, expressed
Os01g42210.1 LTPL47 - Protease -6.14 0.016649766 0.564518 2.18593 inhibitor/seed storage/LTP
family protein precursor,
putative, expressed
Os02g42310.4 OsSCP8 - Putative Serine -6.16 0.007460782 0.402748 1.56816
Carboxypeptidase homologue,
expressed
Os07g03750.1 SCP-like extracellular protein, -6.26 0.021306065 0.629922 2.48532 expressed
Os09gl6950.1 cysteine-rich receptor-like -6.47 0.001787905 0.393259 1.60501 protein kinase 25 precursor,
putative, expressed
Os06g06980.3 caffeoyl-CoA 0- -6.62 0.000382154 1.29041 5.38687 methyltransferase, putative,
expressed
Os01g65090.2 aminotransferase, classes 1 -7.08 0.006093234 0.291077 1.31301 and II, domain containing
protein, expressed
Os01g03320.1 BBTI2 - Bowman-Birk type -7.11 2.37E-05 3.12949 14.0342 bran trypsin inhibitor
precursor, expressed
Os02g51770.2 TLD family protein, putative, -7.13 0.002653059 0.434182 1.96715 expressed
Os04g31804.1 OsMADS64 - MADS-box family -7.26 0.00051423 0.810366 3.70925 gene with M-alpha type-box,
expressed
Os04g32240.1 retrotransposon, putative, -7.68 0.018735285 0.231279 1.12061 centromere-specific,
expressed
Osl0g40210.1 retrotransposon protein, -7.80 0.035737399 0.342591 1.68629 putative, Ty3-gypsy subclass
Os03gl4334.1 expressed protein -7.94 0.015788103 0.239218 1.21521
Os02g47744.3 MYB family transcription -8.32 0.002155136 0.206919 1.09648 factor, putative, expressed
Os02g21530.1 expressed protein -9.07 0.020448368 0.268415 1.53588
Osl0g42020.2 RALFL29 - Rapid ALkalinization -9.24 0.021519728 0.381216 2.18003
Factor RALF family protein
precursor, expressed
Osllg26010.1 retrotransposon protein, -9.89 0.000658558 0.218587 1.36391 putative, unclassified,
expressed
Os07g36080.3 oxygen evolving enhancer -10.04 1.73E-07 5.56036 35.2314 protein 3 domain containing
protein, expressed
Os03gl3976.1 expressed protein -10.81 0.029242121 0.197642 1.38591
Os01g47200.1 retrotransposon protein, -12.25 5.76E-05 0.290781 2.2469 putative, unclassified,
expressed
Os08g09240.2 autophagy-related protein, -12.93 0.016103366 0.1591 1.3233 putative, expressed
Os06g25010.1 glycosyl hydrolase, putative, -13.59 0.007430365 0.122906 1.05329 expressed
Os01g01307.2 translocon-associated protein -14.63 0.000460409 0.294688 2.771 beta domain containing
protein, expressed
Os01g02790.1 protein kinase domain -18.02 0.000612146 0.089325 1.01503 containing protein, expressed
Os01g45914.1 expressed protein -23.65 1.07E-12 8.78029 130.938
Os03g51530.1 expressed protein -27.22 0.000248169 0.162814 2.79487
Os07g04930.1 retrotransposon protein, -27.51 0.000226137 0.103328 1.79281 putative, unclassified,
expressed
Os03g26210.3 helix-loop-helix DNA-binding -28.64 0.001162253 0.0557487 1.03806 domain containing protein,
expressed
Os02g06215.1 RNA-directed DNA -33.24 3.25E-06 0.0862936 1.80899 polymerase, putative,
expressed
Os03g02670.3 transporter family protein, -42.44 0.000115651 0.0417516 1.17481 putative, expressed
Osl2g04870.1 expressed protein -43.17 9.89E-05 0.0913211 2.48629
Os01g52240.1 chlorophyll A-B binding -50.81 9.01E-12 0.255551 8.18971 protein, putative, expressed
Os07g06834.1 expressed protein -72.95 1.14E-17 0.722018 33.2201
Osl2g02210.1 RING finger protein, putative, -110.89 3.36E-12 0.130078 9.09714 expressed
Os08gl4195.1 expressed protein -154.67 5.22E-17 0.0767163 7.48325
Os07gl5460.2 metal transporter Nramp6, -185.36 8.47E-10 0.0156898 1.63297 putative, expressed
Os08g28010.1 expressed protein -224.48 1.76E-14 0.0183586 2.5991
Os03gl8779.1 expressed protein -334.14 1.98E-14 0.0244952 5.1619
Os07g26100.1 expressed protein -427.31 4.85E-09 0.00865809 2.33326
Os08g29980.1 retrotransposon protein, -818.52 1.24E-22 0.0052153 2.69221 putative, unclassified,
expressed
Osllg35300.1 expressed protein -1027.30 6.27E-16 0.0092041 5.96317
[00100] ABA levels increase when plants sense drought, and ABA-dependent signaling plays a predominant role in the plant response to water deficit (Nambara and Marion-Poll, Annu, Rev. Plant Biol. 56: 165-185, 2005; Zhu, Annu, Rev. Plant Biol. 53:247-273, 2002). ABA 5 contents were compared between A36 and B7-12 seedlings after drought treatment. Two-week- old seedlings were air-dried for 0, 1, 3 or 4 hours in a growth chamber (23 °C). Fully-expanded leaves (-100 mg FW) were harvested from the treated seedlings and immediately frozen in liquid nitrogen. After lyophilization, the dried materials were weighed and then ground in liquid nitrogen. ABA extraction was performed in darkness for 16 hours at 4°C with extraction buffer0 (80% methanol, 100 mg/L butylated hydroxytoluene and 500 mg/L citric acid monohydrate).
Quantification of ABA was carried out using a Phytodetek ABA ELISA kit (Agdia Inc., Elkhart, IN) following the manufacturer's instructions. No significant difference was observed despite dramatically elevated levels of ABA observed in the treated seedlings of both genotypes (FIG. 6E). The results suggest that the heightened expression of drought/ ABA-responsive genes5 described above is likely due to an increased ABA sensitivity in XA21 plants.
[00101] Since the infection of rice by any Xoo strains causes water stress, activation of XA21 by drought raised the possibility of some degree of non-race- specific defense against this bacterial pathogen. Plants were inoculated with Xoo strains at the seedling or adult stages using the leaf-clipping method (Kauffman, et ah, Plant Disease Rep. 57:537-541, 1973). For the adult0 inoculation, plants were grown in the greenhouse for 6 weeks, transferred to a controlled facility and clipped with scissors dipped in the Xoo inoculum. Seedling inoculation was performed at the 2-week-old stage. After inoculation, seedlings were cultured in water in growth chambers
(27°C, under florescent light with light/dark photoperiod of 16/8) for the indicated time period. For hormone and water stress treatment assays, inoculated seedlings were grown in water supplemented with ABA and PEG, respectively. Disease lesion development and bacterial population were determined as described previously (Xu, et ah, Plant J. 45:740-751, 2006). [00102] Strain DY87031 possesses mutations in the sulfenylation system required by Xoo to trigger Xa21 -mediated resistance (Burdman, et al., Mol. Plant Microbe Interact. 17:602-612, 2004) and induced similar lesion developments between A36 and B7-12 plants. Water stress was further enhanced by incubating challenged seedlings with polyethylene glycol (PEG), a nonionic water-soluble polymer widely used to simulate drought in plants (Lagerwerff, et ah, Science 133: 1486-1487, 1961). Beginning at 5 days post-inoculation (dpi), B7-12 seedlings repeatedly showed a reduction in disease progression relative to A36 (FIG. 7 A for the data at 7 dpi). Growth of Xoo in B7-12 was also at lower levels than that seen in A36 (FIG. 7B). However, at 10 dpi, lesion had spread to the entire length of infected B7-12 leaves. Therefore, cumulative drought stress does elicit an XA21 -dependent defense response capable of providing partial protection against Xoo. Notably, this defense mechanism might help explain the puzzling phenomenon that, under high temperatures in greenhouses (presumably elevating the water stress of infected leaves), adult IRBB21 plants (containing Xa21) exhibited shorter lesions than IR24 controls after challenge with compatible Xoo strains of different origins (Gu, et ah, Theor. Appl. Genet. 108:800-807, 2003). [00103] The interplay between drought and XA21 resistance in the context of incompatible interactions was also examined. Treatment of B7-12 seedlings with PEG suppressed XA21 resistance to incompatible PX099A as evidenced by the reduction in lesion lengths and bacterial growth (FIG. 8A and FIG. 8B). Likewise, high temperatures appear to have a negative impact on XA21 resistance at the adult stage (Gu, et ah, Theor. Appl. Genet. 108:800-807, 2003). The apparent paradoxical effects of PEG/drought on XA21 defense and resistance responses would suggest that distinct defense signaling pathways are initiated by XA21 after Xoo infection (FIG. 9).
[00104] Treatment of rice seedlings with PEG rapidly and significantly increases endogenous ABA accumulation (Ye, et ah, Plant Cell Physiol. 52:689-698, 2011). The ability of ABA to suppress XA21 resistance was tested by introduction of this hormone into the root zone.
ABA can be taken up by roots from soil or cultural medium and transported via xylem to leaf blades (Schraut, et al., J. Exp. Bot. 55: 1635-1641, 2004; Sauter, et al., J. Exp. Bot. 52: 1991-1997, 2001). Application of ABA significantly compromised XA21 resistance in a dosage dependent manner (FIG. 8C and FIG. 8D). The suppression effect can be attributed to the positive role of ABA in enhancing Xoo virulence (Xu, et al., BMC Plant Biol. 15: 10, 2015; Xu, et al., PLoS One 8:e67413, 2013) and the potentially negative impacts of the hormone on XA21 signaling. Support for the later possibility comes from the well-established suppression effects of ABA on plant defense events (Mang, et al, Plant Cell 24: 1271-1284, 2012).
Example 9 - XB3 functions as a drought regulator.
[00105] The inventors previously showed that XB3 interacts with XA21 in planta
(Wang, et al., 2006, supra). Interestingly, Xb3 transcripts were markedly induced by drought stress in wild-type cultivar TP309 (carrying no Xa21). Stress treatment of previously characterized RNA interference (RNAi) lines, A13 and 37-2 (Wang, et al., 2006, supra), revealed that down-regulation of Xb3 increased drought sensitivity (FIG. 7A). The inventors predicted that over-expression of Xb3 might enhance rice tolerance to drought. To test this, a 3xFLAG tagged Xb3 was placed in an expression cassette under the control of the maize ubiquitin promoter. More than 50 independent transgenic rice lines were generated, and found to represent a range of transgene expression based on RNA blot analysis. Six transgenic lines with moderate and high levels of Xb3 transcripts were randomly chosen for further characterization. Importantly, all plants were similar in size when grown under normal conditions. By contrast, drastically enhanced abilities to survive severe drought stress and to maintain water status were observed in Xb3 over-expression transgenic plants compared with the control lines A36 and TP309 (FIG. 7B, FIG. 7C). Notably, the extent of damage caused by the stress was inversely correlated with levels of Xb3 expression. These results indicate that accumulation of Xb3 transcript levels improves drought tolerance in rice.
Example 10 - XB3 is localized to both the plasma membrane and the nucleus.
[00106] In this Example, a monopartite nuclear localization signal (NLS) was identified in XB3-C that is in addition to other previously reported domains (FIG. 8; Wang, et al., 2006, supra). Based on this and the presence of the putative N-myristoylation site (a membrane targeting signal, FIG. 8), the inventors predicted that XB3 is localized in both the plasma
membrane and the nucleus. This hypothesis was tested by performing confocal microscopic analysis using rice protoplasts expressing fluorescently tagged XB3 fusion proteins under the control of a double cauliflower mosaic virus (CaMV) 35S promoter. To avoid disturbance of the putative membrane localization, enhanced green fluorescent protein (eGFP) was placed in-frame with XB3 between ThrlO and Glyl l (downstream of the N-myristoylation site). Transient co-expression of eGFP-XB3 with Discosoma sp. red fluorescent protein (DsRed)-nuclear localization signal fusion (DsRed-NLS) resulted in rice protoplasts with yellow nuclei. A7-(3-Triethyiammoniimipropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide (FM4-64) dye has been widely used to stain plasma membrane (red color) and visualize endocytosis (Vida and Emr, J. Cell Biol. 128:779-792, 1995). FM4-64 staining of rice protoplasts expressing eGFP-XB3 confirmed the plasma membrane localization of the fusion protein. To demonstrate co-localization of XB3 and XA21, the fluorescent tags mCherry and eGFP were fused to the C-termini of these two proteins, respectively. Consistent with the observations made for eGFP-XB3, red XB3-mCherry signals were clearly seen in the plasma membrane and the nucleus. Green fluorescence was detected in the plasma membrane and an ER-like compartment as previously reported (Park, et al., PLoS One 5:e9262, 2010). Co-localization of XB3-mCherry and XA21-eGFP in the plasma membrane was evidenced by the yellow color that resulted from superimposed single color images of the two fluorescent proteins. By contrast, mutations of the predicted NLS and the putative N-myristoylation residue Gly-2 eliminated the fluorescent signals from the nucleus and the plasma membrane, respectively. As a control, GFP was present in both the cytoplasm and the nucleus.
[00107] To confirm the subcellular localizations of functional XB3 expressed by its native promoter in planta, the nuclear and membrane fractions were purified from leaf tissues of TP309 and the Myc-XA21 line 4021-3, respectively. 4021-3, rather than double-tagged B7-12, plants were selected for protein-related experiments because of the relatively easy detection of XA21 by anti-c-Myc in this line coupled with the successful development of a monoclonal antibody that recognizes the C-terminal kinase domain of XA21 in the later stage of this study. As expected, XB3 was detected in both the nuclei-enriched and nuclei-depleted fractions. Fractionations were validated by the nuclear marker histone H3 and the chloroplast protein ribulose-1, 5-bisphosphate carboxylase/oxygenase (Rubisco, nuclei-depleted). XB3 was also found in the microsomal pool of 4021-3 plants, in which membrane-localized XA21, but not the
cytoplasmic marker UGPase, was present. Purification of the microsomal fraction led to XA21 degradation as evidenced by the accumulation of XA21ncp observed previously (Xu, et al., 2006, supra). The presence of XB3 in the cytosolic fraction (S) might be due to a leak from the nuclei and a release from the XA21 complex through cleavage during purification. Taken together, these results indicate that XB3 is co-localized with XA21 to the plasma membrane and also accumulates in the nucleus.
Example 11 - XA21 mediates a higher steady-state level of XB3.
[00108] Because Xb3 is required for full accumulation of XA21 in rice (Wang, et al., 2006, supra), it was examined whether the opposite scenario also holds true. It was found that abundance is increased in the Myc-XA21 line 4021-3 relative to the empty-vector control line A36. Furthermore, epitope-tagged XB3-3xFLAG was co-expressed with Myc-XA21 in N. benthamiana using a well-established transient system mediated by Agrobacterium transformation (Huang, et al., 2013, supra). Consistently, XB3 accumulated to a markedly higher level when co-expressed with XA21 in the infiltrated leaves than when expressed with the empty vector.
Example 12 - XA21 increases the nuclear accumulation of XB3 in rice.
[00109] It was next determined whether XA21 regulates subcellular distributions of XB3. It was decided to focus on the nuclear abundance of XB3 because it is unlikely that nuclear trafficking of proteins is influenced by the process of protein purification. By contrast, XB3 in the membrane pool could be released by cleavage of XA21 during sample preparation (see above). In addition, a monoclonal antibody was developed, anti-XA21K, against the C-terminal intracellular domain of XA21. This antibody specifically recognized the 140 kDa Myc-XA21 in 4021-3 plants. It was determined that XB3 is readily detectable in the nuclear fraction prepared from two-week-old untreated seedlings of 4021-3 but not in that of A36 control. In the XA21 nuclear pool, the cleaved XA21ccp product of 37 kDa was also detected using anti-XA21K. XA21ccp did not react with anti-c-Myc. Thus, XA21 is cleaved constitutively to some extent in vivo at the seedling stage, coinciding with the accumulation of XB3 in the same subcellular compartment.
[00110] In response to water stress, a marked increase in XB3 protein levels followed by a decline was observed in the A36 control. By contrast, XB3 accumulation in the nucleus of
XA21 seedlings reached higher levels and was sustained at five hours post drought stress (hpd). These changes in protein abundance likely result from a redistribution of pre-existing XB3 since no apparent difference in Xb3 mRNA was observed between the two lines during the time period of stress treatment, and the induction of Xb3 transcripts by drought in seedlings occurred at seven hpd. XA21ccp was detectable after drought, but appeared to be decreased at five hpd.
Example 13 - Drought tolerance mediated by XA21 is associated with nuclear accumulation of XB3.
[00111] Plants, unlike mammals, lack the advanced adaptive immunity required to eliminate most infectious pathogens. This results in significant burden of invaders remaining inside the host for an extended period of time or even a lifetime. An ability to cope with pathogen-induced stresses would therefore be beneficial for infected plants. In the case of rice BLB, cumulative growth of xylem-limited Xoo can induce water deficit in diseased leaves. However, injury is largely reduced in plants expressing the immune receptor XA21. The simplest interpretation of this phenomenon is the lower level of Xoo in the resistant plants than that in susceptible individuals. The present disclosure, however, reveals a novel function of XA21, namely drought tolerance. Without being bound by any one theory, the inventors believe that XA21 carries an integrated ability to suppress bacterial over- accumulation during early stage infection and then contributes to the control of drought effects. Both of these functions serve to limit water loss injury (FIG. 11). [00112] The present disclosure demonstrates that XB3, an E3 ubiquitin ligase associating with XA21, also acts as a drought regulator. Unlike Xa21, which is natural only in the wild species O. longistaminata (Khush, et al., 1990, supra), Xb3 is a member of an evolutionarily conserved plant gene family (Huang, et al., 2013, supra). In addition to Xb3 another member, AdZFPl from the drought-tolerant species Artemisia desertorum Spreng, has been shown to be water- stress-responsive and capable of enhancing drought tolerance when over-expressing in tobacco (Yang, et al., J. Biosci. 33: 103-112, 2008). Thus, XB3 likely represents a regulator of a conserved plant drought signaling network and the immune receptor XA21 is linked to this network through binding to XB3. Furthermore, the present results show that these two proteins are co-localized in the membrane system and that the expression of XA21 leads to a higher abundance of XB3. Therefore, XA21 appears to promote storage of XB3 under normal growth
conditions, potentially enhancing the ability of rice plants to survive drought stress. Of note, increased XB3 was not only observed in the total protein extracts, but also in the nuclei-enriched fraction from 23°C treated two-week-old seedlings that accumulate the cleaved XA21ccp. Independent studies have confirmed the proteolytic cleavage of XA21 by an unidentified protease at a site (designated XA21CS-1) near the transmembrane domain (Park, et al, 2010, supra; Wang, et ah, 2006, supra; Jiang, et ah, Plant J. 73:814-823, 2013; Chen, et ah, Mol. Plant 7:874-892, 2014; Xu, et al, 2006, supra; Park and Ronald, Nat. Commun. 3:920, 2012). In contrast to the observations made using adult plants (Park and Ronald, Nat. Commun. 3:920, 2012, supra), the present data indicate that XA21 is constitutively cleaved to some extent at the seedling stage, which provides an explanation for the XA21 -dependent nuclear accumulation of XB3.
[00113] Without being bound to any one theory, there are a number of ways that drought conditions can be perceived by the receptor kinase XA21 in a pathogen ligand-independent manner. One possibility is that water stress induces the production of a rice protein/peptide that can be recognized by the LRR domain of XA21. Since there is no homologs of RaxX identified in the rice genome, this would imply that XA21 is capable of recognizing two distinct ligands for pathogen defense and drought response, respectively. It has been shown that the Arabidopsis damage-associated molecule AiPepl binds to the LRR-receptor kinase AtPEPRl and activates immune responses (Huffaker, et al, Proc. Natl. Acad. Sci. USA 103: 10098-10103, 2006; Yamaguchi, et al, Proc. Natl. Acad. Sci. USA 103: 10104-10109, 2006). An alternative scenario is that drought might induce proteolysis of XA21, which in turn leads to a release and translocation of XA21- associated drought regulators {e.g., XB3) into the nucleus. However, no significant increase in XA21ccp levels was observed in the nuclei-enriched pool after drought stress treatment. By contrast, the nuclear abundance of XB3 was markedly increased after drought in an XA21 -dependent manner. The distinct kinetics of XB3 and XA21ccp accumulation might reflect a difference in their stabilities in drought environments. Alternatively, XB3 might be released by a second, drought- induced cleavage of XA21 that results in short-lived intermediates. It has been well-documented in the animal system that cell- surface receptors can be activated via complex proteolysis (Kopan and Ilagan, Cell 137:216-33, 2009; Rawson, Biochim. Biophys. Acta 1828:2801-2807, 2013). Regardless of the explanation,
drought-triggered, XA21 -dependent accumulation of XB3 might allow the E3 ubiquitin ligase to exceed a threshold in the nucleus leading to the degradation of its substrate(s) (FIG. 11).
[00114] XA21 -mediated drought tolerance and defense likely utilize different signaling mechanisms. In response to water stress, the present studies identified 17 DEGs between XA21 and control plants known to be drought-responsive. Of these, four were subjected to q-PCR analysis to validate drought induction and differential expression. They include three later embryogenesis abundant (LEAs) genes (OsLEAl, OsLEA3 and OsLEA33) and OsNAClO. LEAs, encode hydrophilic proteins that potentially function in cellular protection during water deficit, whereas OsNAClO codes for a transcription factor of the NAM ATAF CUC2 (NAC) family (Xiao, et al, Theor. Appl. Genet. 115:35-46, 2007; Jeong, et al, Plant Physiol. 153: 185-197, 2010; Battaglia, et al, Plant Physiol. 148:6-24, 2008). Over-expression of either OsLEA3 or OsNAClO in transgenic rice plants enhances drought tolerance. In contrast, no defense marker genes, including PRlOb (Osl2g36850), Os04gl0010 and Osl2g36830, previously shown to be induced by RaxX treatments in an XA21 -dependent manner (Pruitt, et al, Sci. Adv. I:el500245, 2015), were detected as DEGs following drought. These results strongly suggest that in XA21 plants water stress triggers a heightened drought response signaling, but does not activate pathogen defense.
[00115] In conclusion, the immune sensor XA21 was surprisingly demonstrated to confer tolerance to drought. This novel function may act directly or indirectly through sensing water stress and subsequently activating of drought regulators (e.g., OsNAClO). Based on these results, an integrated ability for XA21 to suppress Xoo over- accumulation during early stage infection and then to control the water deficit caused by remaining bacteria may be achieved (FIG. 9). These findings therefore unify biotic and abiotic signaling under the control of a single stress sensor, XA21. [00116] Rice is the staple food of more than half of the population in the world.
Demonstration of the drought tolerance function of XA21 allows development of rice varieties with a broad- spectrum resistance/tolerance to environmental stresses using a single gene/pathway.
[00117] All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
Claims
Claim 1. A method of increasing drought tolerance in a plant, comprising expressing in the plant a heterologous receptor kinase XA21 coding region, wherein the drought tolerance of the plant is increased when compared to a control plant that lacks said expressing.
Claim 2. The method of claim 1, wherein said expressing comprises introducing into the plant a DNA construct comprising said heterologous receptor kinase XA21 coding region operably linked to a native receptor kinase XA21 promoter.
Claim 3. The method of claim 1, wherein said expressing comprises introducing into the plant a DNA construct comprising said heterologous receptor kinase XA21 coding region operably linked to a heterologous promoter functional in the plant.
Claim 4. The method of claim 3, wherein the promoter is a constitutive or inducible promoter.
Claim 5. The method of claim 1, wherein said heterologous receptor kinase XA21 coding region comprises a polynucleotide sequence at least 85% identical to SEQ ID NO: l .
Claim 6. The method of claim 5, wherein said heterologous receptor kinase XA21 coding region comprises a polynucleotide sequence at least 90% identical to SEQ ID NO: l .
Claim 7. The method of claim 5, wherein said heterologous receptor kinase XA21 coding region comprises a polynucleotide sequence at least 95% identical to SEQ ID NO: l .
Claim 8. The method of claim 1, wherein the plant is a monocotyledonous plant.
Claim 9. The method of claim 8, wherein the monocotyledonous plant is selected from the group consisting of maize, wheat, rice, sorghum (Sorghum bicolor), oats, barley, sugar cane, African oil palm (Elaeis guineensis), or switchgrass.
Claim 10. The method of claim 1, wherein the plant is a dicotyledonous plant.
Claim 11. The method of claim 10, wherein the dicotyledonous plant is selected from the group consisting of Arabidopsis, peanut (Arachis hypogaea), barrel medic (Medicago truncatula), carrot, soybean (Glycine max), cotton, Brassica, canola, tomato, potato, alfalfa, grape, clover, poplar, willow, eucalyptus, hemp, a Lotus sp., a Vinca sp., a Nicotiana sp., a Vitis sp., or a Ricinus sp.
Claim 12. A plant, or part thereof, expressing a heterologous receptor kinase XA21 coding region, wherein drought tolerance of the plant or part thereof is increased when compared to a control plant or part thereof that lacks said expressing.
Claim 13. The plant, or part thereof, of claim 12, wherein said expressing comprises introducing into the plant or part thereof a DNA construct comprising said heterologous receptor kinase XA21 coding region operably linked to a native receptor kinase XA21 promoter.
Claim 14. The plant, or part thereof, of claim 12, wherein said expressing comprises introducing into the plant or part thereof a DNA construct comprising said heterologous receptor kinase XA21 coding region operably linked to a heterologous promoter functional in the plant or part thereof.
Claim 15. The plant, or part thereof, of claim 12, wherein the part thereof is a cell, meristem, root, leaf, node, pistil, anther, flower, seed, embryo, stalk or petiole.
Claim 16. A method of producing food for human or animal consumption, comprising: a) obtaining the plant, or part thereof, of claim 12; and b) preparing food for human or animal consumption from the plant or part thereof.
Claim 17. The method of claim 16, wherein the food is starch, protein, meal, flour or grain.
Claim 18. A method of increasing drought tolerance in a rice plant, comprising introducing into the rice plant a DNA construct comprising a rice receptor kinase XA21 coding region operably linked to a heterologous promoter functional in the rice plant, wherein the drought tolerance of the rice plant is increased when compared to a control rice plant that lacks said DNA construct.
Claim 19. A method of producing a drought tolerant plant, comprising crossing the plant of claim 12 with a second plant to produce at least a first progeny plant comprising drought tolerance.
Claim 20. The method of claim 19, wherein said drought tolerant plant is a drought tolerant rice plant.
Claim 21. A method of increasing drought tolerance in a plant, comprising introducing into the plant a DNA construct comprising a heterologous receptor kinase XA21 coding region operably linked to a promoter, and selecting a progeny plant that has increased drought tolerance when compared to a control plant that lacks said DNA construct.
Claim 22. The method of claim 21, wherein said promoter is a drought- inducible promoter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/186,954 US11203765B2 (en) | 2016-05-12 | 2018-11-12 | Drought tolerant plants |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662335241P | 2016-05-12 | 2016-05-12 | |
| US62/335,241 | 2016-05-12 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/186,954 Continuation-In-Part US11203765B2 (en) | 2016-05-12 | 2018-11-12 | Drought tolerant plants |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017197322A1 true WO2017197322A1 (en) | 2017-11-16 |
Family
ID=60266878
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/032502 Ceased WO2017197322A1 (en) | 2016-05-12 | 2017-05-12 | Drought tolerant plants |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US11203765B2 (en) |
| WO (1) | WO2017197322A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109971769A (en) * | 2019-04-18 | 2019-07-05 | 贵州大学 | A sorghum drought-responsive gene SbJAZ1 and its recombinant vector and expression method |
| CN119162198A (en) * | 2024-02-26 | 2024-12-20 | 四川农业大学 | Rice SDR1 gene, its encoded protein and its application |
| CN120989149A (en) * | 2025-10-23 | 2025-11-21 | 海南大学三亚南繁研究院 | Soybean drought adaptation gene GmTIFY8b and its application |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154774B (en) * | 2020-03-17 | 2022-07-12 | 河南科技大学 | Application of Grape VyLhcb4 Gene and Its Encoded Protein and Gene in Stress Resistant Variety Breeding |
| CN115976095B (en) * | 2022-10-17 | 2025-11-07 | 中山大学 | Application of OsLAC gene in improving rice yield |
| CN115851816A (en) * | 2022-10-28 | 2023-03-28 | 上海交通大学 | Method for constructing drought-resistant hyacinth bean strain by using gene for improving drought resistance of hyacinth bean |
| CN116286878B (en) * | 2023-05-17 | 2023-07-21 | 三亚中国农业科学院国家南繁研究院 | Application of Rice OsJAZ5 Gene |
| CN117586982B (en) * | 2024-01-18 | 2024-04-30 | 浙江大学海南研究院 | Cotton glutathione-S-transferase gene GhGSTU and application thereof |
| CN118773202B (en) * | 2024-06-03 | 2026-04-24 | 南京林业大学 | Pinus massoniana series zinc finger structure PmTZF gene and expression protein and application thereof |
| CN120441671B (en) * | 2025-05-26 | 2025-10-24 | 中国林业科学研究院华北林业实验中心 | Salix psammophila SpsRLCK upstream regulatory factor SpsZFP coding protein and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999045129A1 (en) * | 1998-03-06 | 1999-09-10 | Mogen International N.V. | Method for the induction of pathogen resistance in plants |
| WO2015081061A2 (en) * | 2013-11-26 | 2015-06-04 | University Of Florida Research Foundation, Inc. | Drought tolerant plants |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5952485A (en) * | 1995-01-17 | 1999-09-14 | The Regents Of The University Of California | Procedures and materials for conferring disease resistance in plants |
| WO2009127441A2 (en) * | 2008-04-16 | 2009-10-22 | Universität Potsdam | Transcription factors involved in drought stress in plants |
| WO2014113605A1 (en) * | 2013-01-16 | 2014-07-24 | The Regents Of The University Of California | Proteins involved in plant stress response |
-
2017
- 2017-05-12 WO PCT/US2017/032502 patent/WO2017197322A1/en not_active Ceased
-
2018
- 2018-11-12 US US16/186,954 patent/US11203765B2/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999045129A1 (en) * | 1998-03-06 | 1999-09-10 | Mogen International N.V. | Method for the induction of pathogen resistance in plants |
| WO2015081061A2 (en) * | 2013-11-26 | 2015-06-04 | University Of Florida Research Foundation, Inc. | Drought tolerant plants |
Non-Patent Citations (1)
| Title |
|---|
| WANG ET AL.: "Rice XA21 Binding Protein 3 Is a Ubiquitin Ligase Required for Full Xa21- Mediated Disease Resistance", PLANT CELL, vol. 18, no. 12, December 2006 (2006-12-01), pages 3635 - 3646, XP055435974 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109971769A (en) * | 2019-04-18 | 2019-07-05 | 贵州大学 | A sorghum drought-responsive gene SbJAZ1 and its recombinant vector and expression method |
| CN119162198A (en) * | 2024-02-26 | 2024-12-20 | 四川农业大学 | Rice SDR1 gene, its encoded protein and its application |
| CN120989149A (en) * | 2025-10-23 | 2025-11-21 | 海南大学三亚南繁研究院 | Soybean drought adaptation gene GmTIFY8b and its application |
| CN120989149B (en) * | 2025-10-23 | 2025-12-23 | 海南大学三亚南繁研究院 | Soybean drought environment adaptability gene GmTIFY b and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US11203765B2 (en) | 2021-12-21 |
| US20190062776A1 (en) | 2019-02-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11203765B2 (en) | Drought tolerant plants | |
| US7847156B2 (en) | Plants having improved growth characteristics and methods for making the same | |
| ES2375361T3 (en) | GENES INVOLVED IN THE STRESS TOLERANCE BY THE ENVIRONMENT. | |
| US10597667B2 (en) | Stress tolerance in plants | |
| US20120137382A1 (en) | Stress tolerance in plants | |
| US20090265813A1 (en) | Stress tolerance in plants | |
| US20110207608A1 (en) | Transcriptional and post-transcription regulation of transcription factor for drought resistance | |
| CN1555414B (en) | Plant-derived resistance gene | |
| US11015207B2 (en) | RNAs from pathogens inhibit plant immunity | |
| Yokotani et al. | Overexpression of a rice gene encoding a small C2 domain protein OsSMCP1 increases tolerance to abiotic and biotic stresses in transgenic Arabidopsis | |
| EP2422615A2 (en) | Dominant negative mutant krp protein protection of active cyclin-cdk complex inhibition by wild-type krp | |
| CN106232818A (en) | Improvement plant | |
| Jung et al. | Functional characterization of OsRacB GTPase–a potentially negative regulator of basal disease resistance in rice | |
| US9512440B2 (en) | Modulation of receptor-like kinases for promotion of plant growth | |
| US20130247248A1 (en) | Transcription factors in plants related to levels of nitrate and methods of using the same | |
| WO2009158591A1 (en) | Strong activation domain | |
| US20170306346A1 (en) | Improved agronomic characteristics under water limiting conditions for plants expressing pub10 polypeptides | |
| WO2015024119A1 (en) | Plants producing seeds which remove chlorophyl during maturation under stress conditions | |
| CA2913329A1 (en) | Stress tolerant plants | |
| US20190359996A1 (en) | Transcription factor genes and proteins from helianthus annuus, and transgenic plants including the same | |
| US20150135360A1 (en) | Stress tolerance in plants | |
| CN107446946B (en) | Esterase genes regulated by disease resistance in Poaceae | |
| WO2014037735A1 (en) | Atsp1, an e3 ubiquitin ligase, and its use | |
| WO2015193653A1 (en) | Oxidative resistance chimeric genes and proteins, and transgenic plants including the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17796974 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17796974 Country of ref document: EP Kind code of ref document: A1 |