WO2017184674A1 - Methods for increasing efficiency of nuclease-mediated gene editing in stem cells - Google Patents
Methods for increasing efficiency of nuclease-mediated gene editing in stem cells Download PDFInfo
- Publication number
- WO2017184674A1 WO2017184674A1 PCT/US2017/028266 US2017028266W WO2017184674A1 WO 2017184674 A1 WO2017184674 A1 WO 2017184674A1 US 2017028266 W US2017028266 W US 2017028266W WO 2017184674 A1 WO2017184674 A1 WO 2017184674A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- stem cell
- nuclease
- bcl
- expression construct
- genetically modified
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0618—Cells of the nervous system
- C12N5/0619—Neurons
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
- C12N5/0662—Stem cells
- C12N5/0663—Bone marrow mesenchymal stem cells (BM-MSC)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16041—Use of virus, viral particle or viral elements as a vector
- C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0696—Artificially induced pluripotent stem cells, e.g. iPS
Definitions
- This disclosure relates generally to gene editing.
- the CRISPR type II system has been used to edit the genomes of a broad spectrum of species (see, e.g. , Friedland et al , 2013; Mali et al, 2013; Hwang et al, 2013; Jiang et al, 2013; Jinek et al, 2013; Cong et al , 2013; Yin et al , 2014).
- CRISPR is particularly customizable because the active form consists of an invariant Cas9 protein and an easily programmable single guide RNA (sgRNA). Jinek et al, 2012.
- the Streptococcus pyogenes (Sp) CRISPR is the most well-characterized and widely used.
- the Cas9-gRNA complex first probes DNA for the protospacer-adjacent motif (PAM) sequence (-NGG for Sp Cas9), after which Watson-Crick base-pairing between the sgRNA and target DNA proceeds in a ratchet mechanism to form an R-loop.
- PAM protospacer-adjacent motif
- the Cas9 protein Following formation of a ternary complex of Cas9, sgRNA, and target DNA, the Cas9 protein generates two nicks in the target DNA, creating a blunt double-strand break (DSB) that is repaired by the non-homologous end joining (NHEJ) pathway or template-directed homologous recombination (HR).
- CRISPR methods are disclosed, for example, in US 9,023,649 and US 8,697,359.
- iPSC and embryonic stem cells are especially poised to undergo programmed cell death in response to DNA damage compared to their differentiated progeny or other adult stem cell types, and they undergo high rates of spontaneous apoptosis even during routine culture (Garcia et al, 2014; Grandela et al, 2007; Liu et al , 2014; Qin et al , 2007).
- This sensitivity also limits the generation of iPSC lines, as blocking the principal DNA damage mediator p53 greatly enhances reprogramming efficiency (Zhao et al , 2008).
- hESC Unlike differentiated cells, which activate the pro- apoptotic Bcl-2 family member Bax in the cytosol to form pores in the outer mitochondrial membrane, hESC normally maintain Bax in the active conformation where it is sequestered at the Golgi (Dumitru et al, 2012).
- DNA damage-induced apoptosis in hESC was Bax-dependent (but Bak-independent), and the active Bax in hES cells translocated to the mitochondria through a p53 -dependent mechanism (Dumitru et al , 2012).
- Human ESC also possess higher mitochondrial priming for apoptosis (the balance of pro-apoptotic and anti-apoptotic Bcl-2 family members), compared to their differentiated progeny (Liu et al, 2013).
- FIGS. 1A-C Cas9 nuclease toxicity in human iPSC only occurs with sgRNAs that target the human genome.
- FIG. 1A A human iPSC line containing a doxycycline-inducible Cas9 nuclease was infected with lentivirus that constitutively expresses CFP together with an sgRNA. Three days after infection, each culture was divided into several wells and treated with the indicated concentrations of doxycycline for up to 14 days.
- FIG. IB At the indicated time points, the percent of CFP + of live single cells was determined by flow cytometry.
- FIG. 1C 14 days after doxycycline induction, iPSC infected with the Thyl sgRNA were stained for expression of the Thyl surface marker and analyzed by flow cytometry. The percent of Thyl -negative edited cells gated on the CFP + infected cells is shown for varying concentrations of doxycycline. Results are representative of three independent experiments.
- FIGS. 2A-B Nuclease-mediated toxicity in human iPSC can be rescued by
- FIG. 2A Human iPSC containing a doxycycline-inducible Cas9 nuclease were infected with two lentiviruses: one that constitutively expresses CFP together with an sgRNA and another that constitutively expresses EGFP together with an anti-apoptotic gene separated by an IRES sequence. Two sgRNAs targeted the coding region of human genes, ⁇ 1 and BSG (CD 147), together with a negative control sgRNA.
- the anti-apoptotic genes tested were a dominant negative form of p53, Bcl-2, Bcl2Al, BC1-XL, and Mcl-1, together with an EGFP only negative control.
- p53 p53
- Bcl-2 p53
- Bcl2Al p53
- BC1-XL p53
- Mcl-1 EGFP only negative control.
- FIG. 2B The percent of decline of CFP + EGFP + cells after 6 days of doxycycline induction relative to uninduced cultures is shown. Results are representative of three independent experiments.
- FIGS. 3A-D Overexpression of anti-apoptotic factors increases gene targeting rates in human iPSC, both for HR-mediated gene replacement and NHEJ-mediated gene excision.
- FIG. 3A Mouse Thyl gene targeting scheme. Two Crispr sgRNAs target human ⁇ 1 either within intron 1 (Left) or after the polyadenylation site (Right). The mouse Thyl targeting vector plasmid contains mThyl coding exons 2 and 3, flanked by hThyl homology arms outside the sgRNA sites - coding exon 1 (which encodes the signal peptide) is retained but the sgRNA sites are disrupted.
- FIG. 3B Mouse Thyl gene targeting scheme. Two Crispr sgRNAs target human ⁇ 1 either within intron 1 (Left) or after the polyadenylation site (Right). The mouse Thyl targeting vector plasmid contains mThyl coding exons 2 and 3, flanked by hThyl
- FIG. 3C Representative FACS plots gated on live single cells: iPSC from each transfected culture were gated based on EGFP expression and the percentage of cells within those subsets that have gained mThyl expression and/or lost hThyl expression are indicated.
- iPSC that are mThyl + and hThyl " have undergone targeted gene replacement at both alleles (*).
- iPSC that are hThyl " and mThyl " have undergone a gene excision or inversion at both alleles ( ⁇ ). The amount of increase between the EGFP negative and positive subset is indicated.
- FIG. 3D The amount of increase between the EGFP negative and positive subset is indicated.
- FIGS. 4A-D Bcl-2 overexpression increases HR-mediated gene targeting in human iPSC when transiently transfected with the Cas9 nuclease.
- FIG. 4A Mouse Thyl gene targeting scheme.
- FIG. 4B Plasmids were constructed to constitutively express Cas9 together with an anti-apoptotic gene (separated by an IRES) under the constitutively active EFlot promoter. Plain human iPSC were nucleofected with 0.5 ⁇ g of one of these Cas9 plasmids together with 2 ⁇ g of the mThyl targeting vector and 1.5 ⁇ g of plasmids expressing the Thyl Left, Right, both, or no sgRNAs (pUC19).
- FIG. 4C Flow cytometry staining for mThyl and hThyl for the Cas9 only sample gated on live single cells; the percent of cells in each quadrant is indicated. No gene targeting was seen in cells transfected with the pUC19 empty vector.
- FIG. 4D Compiled gene editing frequencies. The percent of mThy 1 + hThyl " (bottom portion of each bar in the left, center, and right grafts), mThyl + hThy 1 + (top portion of bars in the left and center graphs), and mThyl " hThyl " (top portion of bars in the right graph) cells is graphed for each indicated sample. Lines mark the percentages for the Cas9 only sample. Results are representative of two independent experiments.
- FIGS. 5A-B Bcl-2 overexpression enables double homozygous targeted gene replacement in human iPSC.
- FIG. 5A Mouse Thyl gene targeting scheme (left).
- the mouse CD 147 targeting vector plasmid contains mCD147 coding exons 2-7, flanked by hCD147 homology arms outside the sgRNA sites - coding exon 1 (which encodes the signal peptide) is retained but the sgRNA sites are disrupted.
- FIG. 5B Mouse Thyl gene targeting scheme
- Two sgRNAs target human BSG (CD 147) within intron 1 (Left) or after the polyadenylation site (Right).
- the mouse CD 147 targeting vector plasmid contains mCD147 coding exons 2-7, flanked by hCD147 homo
- Plain human iPSC were transfected with 1 ⁇ g each of the mThyl and mCD 147 targeting vectors together with a total of 2 ⁇ g "Cas9 only sgRNA” or "Cas9 Bel -2 sgRNA” expression plasmid.
- Cells were transfected with the following sgRNA combinations: Thyl Left and CD147 Left, Thyl Right and CD 147 Right, all four Thyl and CD147 sgRNAs, or Negative sgRNA #1.
- sgRNA combinations Thyl Left and CD147 Left, Thyl Right and CD 147 Right, all four Thyl and CD147 sgRNAs, or Negative sgRNA #1.
- cells were analyzed by flow cytometry for mThyl, hThyl, mCD147, and hCD147 expression.
- FIGS. 6A-C Bcl-2 overexpression increases the efficiency of engineering single base pair changes using ssODN donors in human iPSC.
- FIG. 6A A sgRNA was designed to target exon 14 of human JAK2. The V617F mutation was encoded within 110 bp ssODN donors (in either the plus or minus orientation) or a plasmid containing 1.9 kb and 1.3 kb flanking homology arms. Small triangles indicate the primer sites for the genotyping PCR reaction outside the ssODN sequence.
- Plain human iPSC were transfected with 2 ⁇ g "Cas9 only sgRNA” or "Cas9 Bcl-2 sgRNA” expression plasmid and / or 10 ⁇ ssODN or 2 ⁇ g V617F plasmid donor. 17 days later, cells were harvested for genomic DNA purification. The genomic region around exon 14 was PCR amplified and analyzed by MiSeq. FIG. 6B. Representative sequencing results for the "Cas9 Bcl-2 sgRNA" expression plasmid with the V617F plasmid donor.
- FIG. 6C Compiled HR and NHEJ frequencies for all the samples and an untransfected control. Results are representative of two independent experiments. Jak2 sgRNA, nucleotides 2-24 of SEQ ID NO: 12; ssODNs: SEQ ID NO:21 (+) and SEQ ID NO:22 (-). The sequence ttttaaattatggagtatgtttctgtggagacgagagtaa is nucleotides 41 to 78 of SEQ ID NO:21.
- FIG. 7 Flow cytometry plots for the data in FIG. 2 after 6 days with or without doxycycline induction. The percent of CFP + and / or EGFP + cells gated on live single cells is shown.
- FIGS. 8A-F Wild type Bcl-2 improves gene targeting at various genomic loci across multiple hiPSC lines.
- FIG. 8A Plasmids were constructed to constitutively express the Cas9 nuclease with a form of Bcl-2 (separated by an IRES), and a sgRNA. Three human iPSC lines were nucleofected with 2 ⁇ g of mThyl or mCD147 targeting vector and 2 ⁇ g of "Cas9 sgRNA" or "Cas9 Bcl-2 sgRNA” expression plasmid. 5-9 days later, cells were analyzed by flow cytometry.
- FIG. 8B Mouse Thyl gene targeting scheme.
- FIG. 8C Mouse Thyl gene targeting scheme.
- FIG. 8D Mouse CD 147 gene targeting scheme.
- FIG. 8E Mouse CD 147 gene targeting scheme.
- FIG. 8F Compiled gene editing frequencies for cells transfected with the Left, Right, or both CD 147 sgRNAs.
- the percent of mCD 147 + hCD147 " (bottom portion of each set of bars in each graph), mCD147 + hCD147 + (top portion of left and center sets of bars in each graph and center portion of right set of bars in each graph), and mCD147 " hCD147 " (top portion of right set of bars in each graph) cells among the three hiPSC lines is indicated.
- FIGS. 9A-G Effects of chemical and genetic inhibitors on mThyl gene targeting in hiPSC.
- FIG. 9A Mouse Thyl gene targeting scheme. Human iPSC were nucleofected with the mThy 1 targeting vector system plasmids and analyzed by flow cytometry five days later. The percentages of mThy 1 + hThyl " , mThy 1 + hThyl + , and mThyl " hThyl " cells for each sample (gated on live single cells) are graphed. Lines mark the percentage values for the control sample.
- FIGS. 9B-9D The percentages of mThy 1 + hThyl " , mThy 1 + hThyl + , and mThyl " hThyl " cells for each sample (gated on live single cells) are graphed. Lines mark the percentage values for the control sample.
- FIGS. 9B-9D The percentages of mThy 1 +
- Human iPSC were nucleofected with: 2 ⁇ g mThyl targeting vector; 0.5 ⁇ g Cas9 plasmid; and 1.5 ⁇ g of sgRNA plasmids.
- the sample was divided into multiple wells and cultured in plain media (mTeSRl + 10 ⁇ Y-27632 ROCK inhibitor) supplemented with the indicated chemical inhibitor for three days.
- 20 ⁇ pifithrin a, 200 ⁇ peptide V5 (VPMLK, SEQ ID NO:31), 200 ⁇ peptide control (IPMIK, SEQ ID NO:32), 50 ⁇ TEMPOL, or the indicated concentrations of SCR7 or L755507 were used.
- FIG. 9B mThyl + hThyl " (bottom portion of each bar in each graph), mThyl + hThyl + (top portion of each bar in each graph).
- FIG. 9C mThyl + hThyl " (bottom portion of each bar in each graph), mThyl + hThyl + (top portion of each bar in left and center graphs, middle portion of each bar in right graph), and mThy ⁇ hThyl " (top portion of each bar in right graph).
- FIG. 9C mThyl + hThyl " (bottom portion of each bar in each graph), mThyl + hThyl + (top portion of each bar in left and center graphs, middle portion of each bar in right graph), and mThy ⁇ hThyl " (top portion of each bar in right graph).
- FIGS. 9E-9F Human iPSC were nucleofected with: 2 ⁇ g mThyl targeting vector plasmid; 0.5 ⁇ g Cas9 plasmid; 1 ⁇ g of sgRNA plasmids; and 0.5 ⁇ g of plasmid expressing the indicated DNA repair gene or pUC19 control ("Cas9 only").
- FIG. 9G Human iPSC were nucleofected with: 2 ⁇ g mThyl targeting vector plasmid; 0.5 ⁇ g Cas9 plasmid; 1 ⁇ g of sgRNA plasmids; and 0.5 ⁇ g of plasmid expressing the indicated DNA repair gene or pUC19 control ("Cas9 only").
- FIG. 9E cultures were treated with 50 ⁇ zVAD and 10 ⁇ SB203580 post transfection.
- mThyl + hThyl " bottom portion of each bar in each graph
- mThyl + hThyl + top portion of each bar in left and center graphs, middle portion of each bar in right graph
- mThyl " hThyl top portion of each bar in right graph
- FIG. 9F mThy 1 + hThyl " (bottom portion of each bar in each graph), mThy 1 + hThy 1 + (top portion of each bar in left and center graphs, middle portion of each bar in right graph), and mThyl " hThyl " (top portion of each bar in right graph).
- FIG. 9G shows
- Human iPSC were nucleofected with: 2 ⁇ g mThyl targeting vector plasmid; 0.5 ⁇ g Cas9 plasmid; and 1.5 ⁇ g of sgRNA plasmids.
- the indicated viral inhibitor genes were cloned into the Cas9 expression vector following an IRES sequence. Cultures were supplemented with 50 ⁇ zVAD post transfection. mThy 1 + hThyl " (bottom portion of each bar in each graph), mThyl + hThy 1 + (top portion of each bar in left and center graphs, middle portion of each bar in right graph), and mThyl " hThyl " (top portion of each bar in right graph).
- FIGS. 10A-F Effect of Caspase and p38 MAPK inhibitors on survival and gene targeting of human iPSC.
- FIG. 10A and FIG. 10B Mouse Thyl gene targeting scheme. Human iPSC were nucleofected with the mThyl targeting vector, Cas9 nuclease, and Thyl sgRNA expressing plasmid or pUC19 empty vector. Nucleofected cells were evenly divided and plated onto plain media (mTeSRl + 10 ⁇ Y-27632 ROCK inhibitor), or media supplemented with the indicated chemical inhibitor. For specific caspase inhibitors, the principal caspase they target is noted in parentheses.
- FIG. IOC Two days after nucleofection, viable cells were counted. Error bars indicate s.e.m. of technical duplicates. Lines mark the count levels for nucleofected cells in plain media with or without sgRNA.
- FIG. 10D Five days after transfection, cells were analyzed by flow cytometry for mThyl and hThyl expression. The percent of mThyl + hThyl " (bottom of each bar) and mThyl + hThyl + (top of each bar) cells of live single cells is indicated.
- FIG. 10E FACS plots of human iPSC transfected with the mThyl targeting vector, Cas9 nuclease, and Thyl Left and Right sgRNAs. Cells were subsequently cultured for 5 days in plain media ⁇ 50 ⁇ zVAD and ⁇ 10 ⁇ SB203580.
- FIG. 10F Human iPSC cultures were single cell FACS sorted into 96-well tissue culture plates containing a MEF feeder layer and hES media supplemented with SMC4 inhibitors ⁇ 50 ⁇ zVAD for eight days. Ten days after sorting, the number of surviving iPSC colonies was counted (from 190 cells sorted). PGP1 hiPSC lines created using retroviral vectors or non-integrating methods were both tested.
- FIGS. 11A-C Genotype and pluripotency of targeted mThyl mCD147 hiPSC clones.
- FIG. 11A Mouse Thyl and mouse CD147 gene targeting schemes from FIG. 5. Small triangles indicate the primer sites for the ten genotyping PCR reactions. Single hiPSC were FACS sorted into individual wells and cultured.
- FIG. 11B After clonal expansion, hiPSC lines were analyzed by flow cytometry for mThyl, hThyl, mCD147, and hCD 147 expression (top panels). Genomic DNA was extracted and genotyped using the ten PCR reactions (bottom panels).
- Targeted, sorted, and expanded hiPSC clones were analyzed by flow cytometry for expression of the pluripotency markers Tra-1/60 and Oct3/4. Shaded peaks indicate the background staining from an isotype control antibody.
- FIG. 12 Gene disruption activity of truncated sgRNAs with and without the Trex2 endonuclease.
- Full length (20 bp of target complementarity) and Truncated (18-19 bp) sgRNAs were designed to target the coding region of four genes expressed on the surface of hiPSC (top) and cloned into expression plasmids under the constitutive U6 promoter.
- the Cas9 nuclease and Trex2 endonuclease were also cloned into separate expression plasmids under the constitutive EFlot promoter.
- Human iPSC were nucleofected with 0.5 ⁇ g Cas9 plasmid, 1 ⁇ g sgRNA plasmid, and 1 ⁇ g of either pUC19 control or Trex2 plasmid. Five days later, cells were stained for expression of the surface markers (Thyl, CD147, HLA-A2, or HLA-BC) and analyzed by flow cytometry gated on live single cells (open histograms). Shaded histograms indicate staining of an untargeted hiPSC control. The percent of cells that have lost expression of the surface markers is shown.
- the surface markers Thil, CD147, HLA-A2, or HLA-BC
- FIG. 13 Nuclease-mediated toxicity in human iPSC can be rescued by a short hairpin RNA (shRNA) construct to knockdown p53 expression.
- FIG. 13A Human iPSC containing a doxy cycline -inducible Cas9 nuclease were infected with two lentiviruses: one that constitutively expresses CFP along with an sgRNA and another that constitutively expresses EGFP along with an shRNA.
- One sgRNA targeted the coding region of human THY1; the other was a negative control sgRNA.
- One shRNA targeted human p53; the other was a negative control shRNA.
- each culture was divided into several wells and treated with 0 or 200 ng / ml doxycycline for up to 6 days.
- the percent of CFP + EGFP + iPSC was determined by flow cytometry.
- FIG. 13B The percent of decline of CFP + EGFP + cells after 6 days of doxycycline induction relative to uninduced cultures is shown.
- CRISPR/Cas9 nuclease toxicity severely limits gene editing in human pluripotent stem cells (hiPSC).
- This disclosure provides methods of reducing this toxicity and improving gene targeting frequencies in such hiPSC and in other types of stem cells by inhibiting p53 or Bax. This inhibition can be achieved, for example, by expressing an anti-apoptosis protein or by using genetic or chemical agents to reduce expression of p53 or Bax or to inhibit the function of p53 or Bax.
- This disclosure also provides methods of increasing gene targeting frequencies several- fold by overexpressing Bcl-2 with Cas9 during a transient transfection to increase gene targeting frequencies several -fold. For example, base pair changes with 39% homologous recombination efficiency or multiplex gene replacements can be achieved using a simple plasmid transfection without antibiotic selection. Increasing the absolute gene targeting frequency reduces the need for an antibiotic selection marker that must subsequently be removed through a second round of culture and cloning, which adds extra passages andcost and risks contamination or loss of pluripotency. These advances can be used in conjunction with other rapidly developing CRISPR technologies, including improvements in specificity, other types of nucleases, and further enrichment, screening, and selection schemes. Thus, the methods described herein improve the use of genetically modified stem cells, particularly hiPSC, for both experimental studies and therapeutic purposes (e.g. , tissue engineering). Genetically Modified Stem Cells
- This disclosure provides genetically modified stem cells and methods of editing the genome of stem cells such that populations of these cells can be used as in vitro model system or for in vivo therapeutic purposes.
- the stem cell to be genetically modified can be an embryonic stem cell (ESC) or a somatic stem cell such as hiPSC, a hematopoietic stem cell, a neural stem cell, or a mesenchymal stem cell.
- ESC embryonic stem cell
- somatic stem cell such as hiPSC, a hematopoietic stem cell, a neural stem cell, or a mesenchymal stem cell.
- the genetically modified stem cell is human.
- the stem cell is that of a non-human mammal, such as a non-human primate, a mouse, or a rat.
- the genetically modified stem cells comprise (a) an expression construct encoding a programmable DNA nuclease or a meganuclease; and (b) an anti-apoptosis component.
- a "programmable DNA nuclease” as used herein means a DNA nuclease that can be engineered to recognize and cleave a desired sequence in the genome of the stem cell. Examples of a programmable DNA nuclease include a class 2 clustered regularly-interspaced short palindromic repeat (CRISPR) nucleases, a zinc finger nuclease (ZFN), and a Transcription Activator-Like Effector nuclease (TALEN). Each of these types of programmable DNA nucleases is well known in the art.
- CRISPR regularly-interspaced short palindromic repeat
- ZFN zinc finger nuclease
- TALEN Transcription Activator-Like Effector nuclease
- CRISPR nuclease examples include a CRISPR associated protein 9 (Cas9) nuclease, a CRISPR from Prevotella and Francisella 1 nuclease (Cpfl), a Class 2 candidate 1 nuclease (C2cl), a Class 2 candidate 2 nuclease (C2c2), and a Class 2 candidate 3 nuclease (C2c3).
- Cas9 CRISPR associated protein 9
- Cpfl CRISPR from Prevotella and Francisella 1 nuclease
- C2cl Class 2 candidate 1 nuclease
- C2c2c2 Class 2 candidate 2 nuclease
- C2c3 Class 2 candidate 3 nuclease
- Cas9 nucleases exist in many bacteria, including S. pyogenes, S. thermophilus, and Neisseria meningitidis.
- a "Cas9 nuclease” includes a Cas9 nuclease with native (or wild-type) nuclease activity, as well as modified versions of a Cas9 nuclease, such as SpCas9-HFl ("high fidelity variant number 1;” Kleinstiver et al, 2016), eSpCas9 ("enhanced specificity Cas9;” Slaymaker et al, 2016), Cas9 nickases (e.g., Cong et al, 2013; Mali et al, 2013) and nuclease- deficient or nuclease-null Cas9 (e.g.
- meganucleases include I-Scel meganuclease and I-Crel meganuclease, as well as engineered derivatives thereof (e.g. , Thermes et al. , 2002; Arnould et al. , 2011).
- an "anti-apoptosis component” as used herein is a component that inhibits the apoptotic function of p53 or Bax.
- the anti-apoptosis component is an anti-apoptosis protein, such as a dominant negative mutant of p53, or a genetic mediator which binds to p53 or promotes its degradation including, but not limited to, mouse double minute 2 homolog (MDM2), p53- induced protein with a RING (Really Interesting New Gene)-H2 domain
- MDM2 mouse double minute 2 homolog
- the anti-apoptosis component is an anti-apoptosis protein, such as a member of the Bcl-2 family, such as B cell lymphoma 2 protein (Bcl-2), Bcl-2 -related protein A (Bcl2Al), B-cell lymphoma-extra large protein (BC1-XL), myeloid cell leukemia 1 protein (Mcl- 1), B cell lymphoma 2-like protein 2 (Bcl-w), or Bcl-2-like protein 10 (Bcl-B).
- Bcl-2 B cell lymphoma 2 protein
- Bcl2Al Bcl-2 -related protein A
- Bcl2Al B-cell lymphoma-extra large protein
- Mcl- 1 protein myeloid cell leukemia 1 protein
- Bcl-w B cell lymphoma 2-like protein 2
- Bcl-2-like protein 10 Bcl-B
- the anti-apoptosis component is an oligonucleotide inhibitor of p53, such as an shRNA.
- the anti-apoptosis component is a small molecule Bax channel blocker, such as Bax channel inhibitor- 1 (Bcil) and Bax channel inhibitor-2 (Bci2) (Hetz et al, 2005):
- the genetically modified stem cell also comprises an sgRNA (single guide RNA) complementary to a target nucleic acid sequence of the stem cell genome.
- the genetically modified stem cell may comprise multiple such sgRNAs, each complementary to a different target nucleic acid sequence of the stem cell genome.
- the expression construct encoding the CRISPR nuclease also includes a nucleic acid encoding one or more sgRNAs.
- one or more sgRNAs can be provided using one or more separate expression constructs. Types of sgRNAs are well known in the art (e.g., US 2014/0356959; US
- This disclosure also provides methods of making a genetically modified stem cell.
- an expression construct encoding a Cas9 nuclease and Bcl-2 is provided to a stem cell.
- the expression construct also encodes one or more sgRNA.
- an expression construct encoding a programmable DNA nuclease and (b) an expression construct encoding an anti-apoptosis protein (e.g., a DN p53, Bcl-2, Bcl2Al, Bcl-xL, Mcl-1), an oligonucleotide inhibitor of p53 (e.g. , shRNA), or a Bax channel blocker is provided to a stem cell.
- an anti-apoptosis protein e.g., a DN p53, Bcl-2, Bcl2Al, Bcl-xL, Mcl-1
- an oligonucleotide inhibitor of p53 e.g. , shRNA
- a Bax channel blocker e.g., a Bax channel blocker
- a stem cell comprises an expression construct encoding a
- the method comprises provided to the stem cell an expression construct encoding an anti-apoptosis protein (e.g., a DN p53, Bcl-2, Bcl2Al, Bcl-xL, Mcl-1), an oligonucleotide inhibitor of p53 (e.g., shRNA), or a Bax channel blocker.
- an anti-apoptosis protein e.g., a DN p53, Bcl-2, Bcl2Al, Bcl-xL, Mcl-1
- an oligonucleotide inhibitor of p53 e.g., shRNA
- Bax channel blocker e.g., a Bax channel blocker
- nucleic acids can also be delivered by electroporation, injection, or lipofection.
- the nucleic acid encoding the programmable DNA nuclease or meganuclease and the nucleic acid encoding an anti-apoptosis protein can be provided in separate expression constructs or the same expression construct.
- This disclosure also provides methods of altering a target nucleic acid sequence of a stem cell, comprising providing a genetically modified stem cell as described above with a single guide RNA (sgRNA) complementary to a target nucleic acid sequence of the stem cell genome or with a plurality of sgRNA complementary to a plurality of target nucleic acid sequences of the stem cell genome, i.e. , to carry out multiplex editing of the stem cell genome.
- sgRNA can be delivered to the stem cell by methods well known in the art. Plasmid donors with >1 kb homology arms for small changes (1-100 bp) are particularly useful.
- the genetically modified stem cell is also contacted with a caspase inhibitor (e.g., zVAD-fmk) to reduce dissociation-mediated cell death, particularly following transfection or cell sorting, and/or a p38 MAP kinase inhibitor (e.g., SB203580) to enhance gene targeting efficiency; see Example 5, below.
- a caspase inhibitor e.g., zVAD-fmk
- a p38 MAP kinase inhibitor e.g., SB203580
- This disclosure also provides an expression construct encoding a Cas9 nuclease and Bcl- 2.
- Expression constructs useful for the expression of a Cas9 nuclease and Bcl-2 are described in the Examples, below, but any suitable expression construct can be used.
- the expression construct also encodes a single guide R A (sgRNA) or a plurality of sgR As.
- Negative sgRNA #2 G GAGAC GATTA ATGCG TCTCG 5
- CD 147 (coding exon) GTCGT CAGAA CACAT CAACG AGG 6
- mice Thy 1 and CD 147 gene targeting systems and the original plasmids to constitutive ly express the EFla promoter-Cas9 nuclease or the U6 promoter-sgRNA have been previously described and verified (Byrne et al, 2015).
- Anti-apoptotic genes were obtained from previously published plasmids: Bcl-2 (Addgene plasmid #8793) and BC1-XL (#8790) (Cheng et al, 2001); Bcl2Al (#36973) (Pratt et al, 2012); and Mcl-l (#21605) (Maurer et al, 2006).
- Bcl-2 Additional plasmid #8793
- BC1-XL #8790
- Bcl2Al #36973
- Mcl-l #21605
- the dominant negative p53 sequence from Addgene plasmid #9058 was synthesized as a gBlock. These genes were cloned into the EFla promoter-Cas9 nuclease plasmid after an IRES.
- CtIP RBBP8 was cloned from human ORFeome v8.1 (horfdb.dfci.harvard.edu clone #1563) (ORFeome Collaboration, 2016) and altered from UniprotKB isoform Q99708-2 to Q99708-1.
- GBLOCKS® GBLOCKS®
- E1B55K, and E4orf6 Chou et al , 2015 were synthesized as GBLOCKS® (IDT), and inserted into the constitutive expression plasmid, after the EFlot promoter, Cas9 nuclease, and an IRES.
- the U6 promoter-sgRNA (for each sgRNA sequence) was cloned into the EF la promoter-Cas9 nuclease or EF la promoter-Cas9 nuclease-IRES-Bcl-2 expression plasmids to form the "Cas9 only sgRNA" or "Cas9 Bcl-2 sgRNA” plasmids used in Examples 6 and 7.
- Jak2 V617F targeting vectors Desalted 1 10 bp ssODN (IDT) encoding the Jak2 V617F mutation were ordered in the plus (SEQ ID NO:21) or minus (SEQ ID NO:22) orientation.
- IDT ssODN
- homology arms were PCR amplified from purified PGPl human genomic DNA (upstream, SEQ ID NO: 23 and SEQ ID NO: 24; downstream, SEQ ID NO:25 and SEQ ID NO:26) and cloned using isothermal assembly into the pUC19 plasmid backbone (amplified with SEQ ID NO:27 and SEQ ID NO:28).
- the non-integrated PGP1 hiPSC line was generated from PGP1 fibroblasts using the Sendai virus-based CYTOTU E® iPS Reprogramming kit (Invitrogen) and received at passage 4. All three lines were adapted to feeder-free culture conditions, karyotyped, and FACS stained for expression of pluripotency markers. All experiments were done at passage number 29-42 for the retroviral hiPSC lines and passage 9- 15 for the non-integrated hiPSC line.
- 3G transactivator-T2A cleavage sequence-Hygromycin resistance insert was combined with a transposase expression plasmid, nucleofected into PGP 1 (retroviral) hiPSC, and selected with hygromycin, similar to (Chavez et al , 2015).
- MTESR1TM Stem Cell Technologies
- ROCK inhibitor Y-27632 R&D Systems, Abeam
- Human g-band karyotype analysis was done by Cell Line Genetics. Viable cell counts were measured with the MUSE® Count & Viability Assay kit (EMD Millipore). Anti-human HLA- A2 APC (BB7.2) and anti-human HLA-BC PE (B 1.23.2) were purchased from eBioscience. Human iPSC cultures were treated with 50 ng / ml recombinant interferon gamma (eBioscience) for 2 days prior to HLA staining. [57] Lentiviral Infection.
- a U6 promoter-sgRNA and CAGGS promoter-Cerulean fluorescent protein construct was cloned into the pLVX lentiviral vector backbone (Clontech) (pSB700, Addgene #64046).
- a similar construct containing a U6 promoter-shRNA and CAGGS promoter-EGFP was cloned into the pLVX lentiviral vector backbone.
- Individual sgRNA or shRNA sequences were cloned into these vectors.
- the shRNA sequences for human TP53 (#TRCN0000003755) and control (#TRCN0000057023) are from the Sigma MISSION® shRNA library.
- An EFla promoter-EGFP-IRES-anti-apoptotic gene construct was also cloned into the pLVX lentiviral backbone.
- Lentiviral plasmids were combined with psPax2 (Addgene plasmid #12260) and pMD2.G (#12259) and transfected into HEK 293T cells using TransIT-293 transfection reagent (Mirus Bio). 25 ⁇ chloroquine (Sigma) was included in the media for the first 24 hr after transfection. Cell culture supernatants were harvested at 48 and 72 hours, and concentrated using the PEG virus precipitation kit (BioVision).
- Lentivirus was added to human iPSC for one day in mTeSRl media with 4 ⁇ g/ml polybrene (EMD Millipore) and 10 ⁇ Y- 27632. At least three days after infection, cells were treated with doxycycline (Sigma) for the indicated concentrations and times.
- Plasmids were purified using the Qiagen ENDOFREE® Plasmid Maxi kit and nucleofected into iPSC cells using the Lonza 4D-Nucleofector X unit (Buffer P3, Program CB-150). For each 20 ⁇ nucleofection reaction, 0.2-0.5 x 106 iPSC were transfected with up to 4 ⁇ g of plasmid DNA. Post-nucleofection, iPSC were plated onto MATRIGELD-coated wells containing MTESR1TM media with 10 ⁇ Y-27632 plus other chemical inhibitors when noted.
- p53 or Bax inhibitors cyclic pifithrin a (StemCell Technologies); pifithrin ⁇
- peptide V5 peptide control
- iMACl peptide control
- iMAC2 EMD Millipore
- N- acetyl cysteine and 4-hydroxy TEMPO TEMPOL
- Caspase inhibitors zVAD-fmk, zVAD(OMe)-fmk, and
- zD(Ome)E(Ome)VD(Ome)-fmk (Bachem); zVD(Ome)VAD(0: zVE(Ome)ID(Ome)-fmk, zIE(Ome)TD(Ome)-fmk, zLE(Ome)HD(Ome)-fmk, and zAE(Ome)VD(Ome)-fmk (R&D Systems).
- Cas9 nuclease activity is toxic to human pluripotent stem cells, but can be rescued by inhibiting p53 or the mitochondrial pathway of apoptosis
- a hiPSC line that contains a doxycycline-inducible Cas9 nuclease expression construct was used to study the extent of Cas9 nuclease-mediated death. These cells were infected with lentivirus to constitutively express an sgRNA and a CFP marker, divided into several wells, treated with varying concentrations of doxycycline, and the proportion of CFP + cells was monitored over two weeks (FIG. 1A). Induction of the Cas9 nuclease produced a dramatic decline in the amount of CFP + sgRNA + cells, but only with sgRNAs targeting human genes. No decline was seen with negative control sgRNAs designed to not cut anywhere in the human genome (FIG. IB). Lowering titrations of Cas9 induction over two weeks only yielded lower frequencies of gene disruption (FIG. 1C).
- Bcl-2 anti-apoptotic family members: Bcl-2, Bcl2Al, BC1-XL, and Mcl-1 (Moldoveanu et al , 2014).
- the doxycycline-inducible Cas9 hiPSC line was infected with both lentiviruses (6 anti- apoptotic EGFP x 3 sgRNA CFP), split into multiple wells, treated with or without doxycycline, and the frequencies of CFP + and / or EGFP + cells were assayed at various time points by flow cytometry (FIG. 2 and FIG. 7).
- sgRNAs Two sgRNAs were designed that target hThyl on either side of the replaced coding region— in intron 1 (Left) or after the polyadenylation sequence (Right).
- the mThy l targeting vector plasmid contains the corresponding coding region of mThyl flanked by hThyl homology arms outside of the cut sites.
- Thy l sgRNAs When both Thy l sgRNAs are transfected, a fourth population of double negative mThyl " hThyl " cells also emerges; this largely comprises cells which have excised or inverted the hThyl alleles, which can also be found in the mThy 1 + hThyl " population of these samples (Byrne et al. , 2015).
- Overexpressing DN p53 or Bcl-2 produced a dramatic increase in the frequency of homologous recombination (HR)-mediated mThyl homozygous gene replacements (FIG. 3C, top row).
- HR homologous recombination
- mThyl homozygous gene replacements FIG. 3C, top row.
- overexpressing DN p53 or Bcl-2 also increased the frequency of non-homologous end joining (NHEJ)-mediated hThyl homozygous gene deletions (FIG. 3C, bottom row). While DN p53 produced the greatest increase in HR-mediated gene targeting (7-8-fold), each of the four Bcl-2 family members also increased gene targeting (3-fold) (FIG. 3D, left).
- DN p53 again produced the greatest increase (1.7-fold) versus each of the four Bcl-2 family members (1.3-1.5-fold) (FIG. 3D, right).
- Gene deletion showed more modest fold increases because the initial frequency was higher. Therefore, rescuing nuclease-mediated death in hiPSC strongly increases the efficiency of both HR-mediated gene replacement and NHEJ- mediated gene deletion.
- Bcl-2 improves gene targeting when transiently transfected with the Cas9 nuclease
- the sgR A segment was cloned onto the Cas9 nuclease expression plasmid ("Cas9 only sgRNA” or "Cas9 Bcl-2 sgRNA”).
- This set of plasmids, together with the mThy 1 targeting vector, was transfected into plain hiPSC, and gene targeting frequencies were assessed using flow cytometry (FIG. 8).
- both mutations showed intermediate levels of gene targeting compared to wild type Bcl-2, which showed the greatest enhancement.
- Bcl-2 's protective effects were more pronounced on a different hiPSC line, reprogrammed through non-integrating methods, although the absolute mThy 1 targeting frequencies were lower (FIG. 8C).
- Pifithrin ⁇ does not affect p53 transcriptional activation, but does prevent p53 from binding to Bcl-2 and BC1-XL at the mitochondria and has been shown to improve hESC survival after genotoxic stressors (Garcia et al, 2014; Grandela et al, 2007; Qin et al, 2007). However, it exhibited considerable toxicity to hiPSC when applied for 2 days after nucleofection (10-20 ⁇ , data not shown) instead of a few hours as used in previous studies.
- the Bax inhibiting pentapeptide V5 VPMLK, SEQ ID NO:31
- Caspase inhibitors rescue hiPSC death from dissociation but not nuclease activity
- Caspase inhibitors have been shown to prevent detachment-mediated cell death (anoikis) of human ES cells (Wang et al, 2009), which would explain why inhibiting caspases improves the survival of all hiPSC following nucleofection.
- Caspase inhibitors also increased hiPSC recovery following single cell FACS sorting (in conjunction with SMC4 inhibitors) (FIG. 10F).
- rescuing hiPSC with pan-caspase inhibitors actually decreased the gene targeting frequencies compared to plain media, which could be due to inhibition of the cell cycle (FIGS. 10D, 10E). Adding zVAD did not affect the doxy cycline -induced Cas9 nuclease toxicity shown in FIG. 1.
- zDEVD-fmk and zAEVD-fmk also prevented anoikis (FIG. IOC).
- zDEVD preferentially inhibits the executioner caspases 3 and 7.
- zAEVD is often sold as a specific inhibitor of caspase 10, which cleaves and activates caspases 3 and 7 downstream of surface death receptor signals, but zAEVD can inhibit other caspases as well (Garcia-Calvo et al, 1998).
- the caspase 9 inhibitor zLEHD-fmk was very toxic to hiPSC; however, it can also inhibit caspases 3, 6, and 8, and may be more potent than zVAD (Berger et al , 2006; McStay and Green, 2014). Lower concentrations (25 ⁇ ) did not show as much anoikis rescue (zVAD or zDEVD) or toxicity (zLEHD).
- the p38 MAP kinase inhibitor SB203580 was reported to enhance HR in response to a dsDNA break (Golding et al. , 2007) and is also included in some protocols for deriving naive human pluripotent stem cells (Gafni et al, 2013). Adding 10 ⁇ SB203580 to the hiPSC media after nucleofection did not affect cell survival, but did enhance gene targeting efficiency (FIGS. 10C-E). Future experiments included 50 ⁇ zVAD and 10 ⁇ SB203580 after hiPSC transfection as it produced the best balance regarding anoikis rescue, gene targeting efficiency, and price. EXAMPLE 6
- Human iPSC were transfected with the aforementioned Cas9-Bcl-2 plasmid constructs containing an sgRNA targeting Jak2 (Smith et al, 2014) together with 110 bp ssODN donors (in either orientation) or a plasmid donor (FIG. 6A).
- Gene editing rates were measured using PCR and next-generation sequencing around the cut site to examine both incorporation of the mutation (HR) and indels (NHEJ) (FIG. 6B) (Guell et al, 2014).
- Circular plasmids have higher nucleofection efficiencies than linear plasmids (Byrne et al , 2015). Circular plasmids may persist longer inside the cells than an ssODN - indeed, culturing the cells for 17 days after transfection was necessary to completely eliminate unincorporated plasmid. Finally, oligo- mediated gene targeting may involve a single-strand annealing mechanism rather than traditional HR. While other groups have demonstrated equal or higher gene targeting with ssODN compared to plasmid or dsODN donors (Chen et al. , 2011 ; Richardson et al. , 2016; Soldner et al, 2011), we achieved optimal results using a plasmid donor containing longer homology arms for Cas9 nucleases in hiPSC.
- Truncated sgRNAs which possess 17-19 bp of target complementarity instead of 20 bp, have been reported to reduce off-target Cas9 nuclease activity while preserving on-target activity (Fu et al, 2014). However, these studies were done in human tumor cell lines with near-complete gene disruption efficiencies. We developed truncated sgRNAs against hiPSC surface proteins and assayed gene disruption efficiencies by flow cytometry.
- DNA ligase IV inhibitor SCR7 (Maruyama et al, 2015) nor the p3-adrenergic receptor agonist
- BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAK-mediated mitochondrial apoptosis.
- ORFeome Collaboration (2016).
- the ORFeome Collaboration a genome-scale human ORF- clone resource. Nature Methods 13, 191-192.
- LMP1 latent membrane protein 1
- Jinek et al "RNA-programmed genome editing in human cells,” elife, 2013. 2: p. e00471.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Cell Biology (AREA)
- Developmental Biology & Embryology (AREA)
- Neurology (AREA)
- Reproductive Health (AREA)
- Gynecology & Obstetrics (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Neurosurgery (AREA)
- Biophysics (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Rheumatology (AREA)
- Physics & Mathematics (AREA)
- Mycology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Transplantation (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Inhibiting p53 or Bax can be used to improve nuclease-mediated gene targeting frequencies in stem cells. This inhibition can be achieved, e.g., by overexpression of anti-apoptosis proteins or by silencing or reducing p53 or Bax expression. This technique can be used in conjunction with other rapidly developing CRISPR technologies, including improvements in specificity, other types of nucleases, and further enrichment, screening, and selection schemes, to expand the use of stem cells in experimental studies and tissue engineering for therapeutic purposes.
Description
METHODS FOR INCREASING EFFICIENCY OF NUCLEASE-MEDIATED
GENE EDITING IN STEM CELLS
[01] Each reference cited in this disclosure is incorporated herein by reference in its entirety.
[02] This application incorporates by reference the contents of a 5.98 kb text file created on April 11, 2016 and named "PCT_Sequence_Listing.txt," which is the sequence listing for this application.
[03] This invention was made with government support under P50 HG005550 and RM1 HG008525 awarded by the National Institutes of Health (National Human Genome Research Institute) and SA5283-11210 awarded by the National Science Foundation Synthetic Biology Engineering Research Center. The government has certain rights in the invention.
RELATED APPLICATION DATA
[04] This application claims priority to U.S. Provisional Application No. 62/324,485 filed on April 19, 2016, which is hereby incorporated by reference in its entirety for all purposes.
TECHNICAL FIELD
[05] This disclosure relates generally to gene editing.
BACKGROUND
[06] The CRISPR type II system has been used to edit the genomes of a broad spectrum of species (see, e.g. , Friedland et al , 2013; Mali et al, 2013; Hwang et al, 2013; Jiang et al, 2013; Jinek et al, 2013; Cong et al , 2013; Yin et al , 2014). CRISPR is particularly customizable because the active form consists of an invariant Cas9 protein and an easily programmable single guide RNA (sgRNA). Jinek et al, 2012. Of the various CRISPR orthologs, the Streptococcus pyogenes (Sp) CRISPR is the most well-characterized and widely used. The Cas9-gRNA complex first probes DNA for the protospacer-adjacent motif (PAM) sequence (-NGG for Sp Cas9), after which Watson-Crick base-pairing between the sgRNA and target DNA proceeds in a ratchet mechanism to form an R-loop. Following formation of a ternary complex of Cas9, sgRNA, and target DNA, the Cas9 protein generates two nicks in the target DNA, creating a blunt double-strand break (DSB) that is repaired by the non-homologous end joining (NHEJ) pathway or template-directed homologous recombination (HR). CRISPR methods are disclosed, for example, in US 9,023,649 and US 8,697,359.
[07] The development of CRISPR/Cas9 nucleases has enormously expanded our ability to engineer genetic changes in human cells (Mali et al, 2013). But while immortalized human tumor cell lines have been edited with almost complete efficiency (Fu et al, 2014), gene editing in human stem cells has proved more challenging. Tumor cell lines are favored for their robustness, but they also possess unchecked proliferation, gross mutations, and abnormal responses to DNA damage. Genome engineering in human induced pluripotent stem cells (hiPSC) is therefore desired for developing scientific disease models or potential gene therapies. Their self-renewing capability allows hiPSC to be gene targeted, cloned, genotyped, and expanded, unlike primary tissues with limited growth potential. Edited pluripotent clones can then be differentiated into a variety of other cell types to analyze the phenotypic effect of the engineered mutations or employ reporter constructs.
[08] Unfortunately, much lower gene editing rates have been achieved in human iPSC compared to tumor cell lines (Mali et al, 2013). For example, when human iPSC were transfected with plasmids expressing the Cas9 nuclease and a single guide RNA (sgRNA), significantly more cells died compared to hiPSC controls that received no sgRNA (Byrne et al , 2015). Both human iPSC and embryonic stem cells (hESC) are especially poised to undergo programmed cell death in response to DNA damage compared to their differentiated progeny or other adult stem cell types, and they undergo high rates of spontaneous apoptosis even during routine culture (Garcia et al, 2014; Grandela et al, 2007; Liu et al , 2014; Qin et al , 2007). This sensitivity also limits the generation of iPSC lines, as blocking the principal DNA damage mediator p53 greatly enhances reprogramming efficiency (Zhao et al , 2008). Accumulation of p53 following DNA damage caused hESC apoptosis through the mitochondrial pathway (rather than p53 transcriptional activation) and knocking down p53 prevented cell death (Grandela et al, 2007; Liu et al , 2013; Qin et al , 2007). Unlike differentiated cells, which activate the pro- apoptotic Bcl-2 family member Bax in the cytosol to form pores in the outer mitochondrial membrane, hESC normally maintain Bax in the active conformation where it is sequestered at the Golgi (Dumitru et al, 2012). DNA damage-induced apoptosis in hESC was Bax-dependent (but Bak-independent), and the active Bax in hES cells translocated to the mitochondria through a p53 -dependent mechanism (Dumitru et al , 2012). Human ESC also possess higher mitochondrial priming for apoptosis (the balance of pro-apoptotic and anti-apoptotic Bcl-2 family members), compared to their differentiated progeny (Liu et al, 2013).
[09] There is, therefore, a need for improved methods of engineering genetic changes in hiPSC using CRISPR/Cas9.
BRIEF DESCRIPTION OF THE DRAWINGS
[10] FIGS. 1A-C. Cas9 nuclease toxicity in human iPSC only occurs with sgRNAs that target the human genome. FIG. 1A. A human iPSC line containing a doxycycline-inducible Cas9 nuclease was infected with lentivirus that constitutively expresses CFP together with an sgRNA. Three days after infection, each culture was divided into several wells and treated with the indicated concentrations of doxycycline for up to 14 days. FIG. IB. At the indicated time points, the percent of CFP+ of live single cells was determined by flow cytometry. Two sgRNAs targeted the coding region of human genes (THY1 and POU5F1) and two control sgRNAs did not target anywhere in the human genome (Negative sgRNA #1 and 2). FIG. 1C. 14 days after doxycycline induction, iPSC infected with the Thyl sgRNA were stained for expression of the Thyl surface marker and analyzed by flow cytometry. The percent of Thyl -negative edited cells gated on the CFP+ infected cells is shown for varying concentrations of doxycycline. Results are representative of three independent experiments.
[11] FIGS. 2A-B. Nuclease-mediated toxicity in human iPSC can be rescued by
overexpression of dominant negative p53 or anti-apoptotic Bcl-2 family members. FIG. 2A. Human iPSC containing a doxycycline-inducible Cas9 nuclease were infected with two lentiviruses: one that constitutively expresses CFP together with an sgRNA and another that constitutively expresses EGFP together with an anti-apoptotic gene separated by an IRES sequence. Two sgRNAs targeted the coding region of human genes, ΊΉΥ1 and BSG (CD 147), together with a negative control sgRNA. The anti-apoptotic genes tested were a dominant negative form of p53, Bcl-2, Bcl2Al, BC1-XL, and Mcl-1, together with an EGFP only negative control. Three days after infection, each culture was divided into several wells and treated with 0 or 200 ng/ml doxycycline for up to 6 days. At the indicated time points, the percent of CFP+ EGFP+ iPSC was determined by flow cytometry. FIG. 2B. The percent of decline of CFP+ EGFP+ cells after 6 days of doxycycline induction relative to uninduced cultures is shown. Results are representative of three independent experiments.
[12] FIGS. 3A-D. Overexpression of anti-apoptotic factors increases gene targeting rates in human iPSC, both for HR-mediated gene replacement and NHEJ-mediated gene excision. FIG. 3A. Mouse Thyl gene targeting scheme. Two Crispr sgRNAs target human ΊΉΥ1 either within intron 1 (Left) or after the polyadenylation site (Right). The mouse Thyl targeting vector plasmid contains mThyl coding exons 2 and 3, flanked by hThyl homology arms outside the sgRNA sites - coding exon 1 (which encodes the signal peptide) is retained but the sgRNA sites
are disrupted. FIG. 3B. Plain human iPSC were infected with lentivirus that constitutively expresses EGFP together with an anti-apoptotic gene separated by an IRES. Three days after infection, each culture was nucleofected with plasmids encoding the mThyl targeting vector, Cas9 nuclease, and Thy 1 Left, Right, both, or no sgRNAs (pUC19). Five days later, cells were analyzed by flow cytometry. FIG. 3C. Representative FACS plots gated on live single cells: iPSC from each transfected culture were gated based on EGFP expression and the percentage of cells within those subsets that have gained mThyl expression and/or lost hThyl expression are indicated. Using one sgRNA (top row), iPSC that are mThyl+ and hThyl" have undergone targeted gene replacement at both alleles (*). Using both sgRNAs (bottom row), iPSC that are hThyl" and mThyl" have undergone a gene excision or inversion at both alleles (·). The amount of increase between the EGFP negative and positive subset is indicated. FIG. 3D. Left, compiled results showing the fold increase of HR-mediated gene targeting with one or both sgRNAs for all of the anti-apoptotic genes tested: DN p53, Bcl-2, Bcl2Al, BC1-XL, and Mcl-1; Right, compiled results showing the fold increase of NHEJ-mediated gene deletion with both sgRNAs for all of the anti-apoptotic genes tested. Results are representative of two independent experiments.
[13] FIGS. 4A-D. Bcl-2 overexpression increases HR-mediated gene targeting in human iPSC when transiently transfected with the Cas9 nuclease. FIG. 4A. Mouse Thyl gene targeting scheme. FIG. 4B. Plasmids were constructed to constitutively express Cas9 together with an anti-apoptotic gene (separated by an IRES) under the constitutively active EFlot promoter. Plain human iPSC were nucleofected with 0.5 μg of one of these Cas9 plasmids together with 2 μg of the mThyl targeting vector and 1.5 μg of plasmids expressing the Thyl Left, Right, both, or no sgRNAs (pUC19). Five days later, cells were analyzed by flow cytometry. FIG. 4C. Flow cytometry staining for mThyl and hThyl for the Cas9 only sample gated on live single cells; the percent of cells in each quadrant is indicated. No gene targeting was seen in cells transfected with the pUC19 empty vector. FIG. 4D. Compiled gene editing frequencies. The percent of mThy 1+ hThyl" (bottom portion of each bar in the left, center, and right grafts), mThyl+ hThy 1+ (top portion of bars in the left and center graphs), and mThyl" hThyl" (top portion of bars in the right graph) cells is graphed for each indicated sample. Lines mark the percentages for the Cas9 only sample. Results are representative of two independent experiments.
[14] FIGS. 5A-B. Bcl-2 overexpression enables double homozygous targeted gene replacement in human iPSC. FIG. 5A. Mouse Thyl gene targeting scheme (left). Mouse CD147 gene targeting scheme (right): Two sgRNAs target human BSG (CD 147) within intron 1 (Left) or
after the polyadenylation site (Right). The mouse CD 147 targeting vector plasmid contains mCD147 coding exons 2-7, flanked by hCD147 homology arms outside the sgRNA sites - coding exon 1 (which encodes the signal peptide) is retained but the sgRNA sites are disrupted. FIG. 5B. Plain human iPSC were transfected with 1 μg each of the mThyl and mCD 147 targeting vectors together with a total of 2 μg "Cas9 only sgRNA" or "Cas9 Bel -2 sgRNA" expression plasmid. Cells were transfected with the following sgRNA combinations: Thyl Left and CD147 Left, Thyl Right and CD 147 Right, all four Thyl and CD147 sgRNAs, or Negative sgRNA #1. Nine days later, cells were analyzed by flow cytometry for mThyl, hThyl, mCD147, and hCD147 expression. Upper two plots show the percent of Thyl or CD 147 gene replacement as gated on all live single iPSC. Lower four plots show the percent of CD 147 gene replacement as gated on the Thyl gene targeting quadrants. Results are representative of four independent experiments.
[15] FIGS. 6A-C. Bcl-2 overexpression increases the efficiency of engineering single base pair changes using ssODN donors in human iPSC. FIG. 6A. A sgRNA was designed to target exon 14 of human JAK2. The V617F mutation was encoded within 110 bp ssODN donors (in either the plus or minus orientation) or a plasmid containing 1.9 kb and 1.3 kb flanking homology arms. Small triangles indicate the primer sites for the genotyping PCR reaction outside the ssODN sequence. Plain human iPSC were transfected with 2 μg "Cas9 only sgRNA" or "Cas9 Bcl-2 sgRNA" expression plasmid and / or 10 μΜ ssODN or 2 μg V617F plasmid donor. 17 days later, cells were harvested for genomic DNA purification. The genomic region around exon 14 was PCR amplified and analyzed by MiSeq. FIG. 6B. Representative sequencing results for the "Cas9 Bcl-2 sgRNA" expression plasmid with the V617F plasmid donor. The percent of MiSeq reads containing the Jak2 V617F mutation (HR) or indel mutations (NHEJ) is indicated together with a plot of bp position along the PCR product versus the number of sequencing reads. FIG. 6C. Compiled HR and NHEJ frequencies for all the samples and an untransfected control. Results are representative of two independent experiments. Jak2 sgRNA, nucleotides 2-24 of SEQ ID NO: 12; ssODNs: SEQ ID NO:21 (+) and SEQ ID NO:22 (-). The sequence ttttaaattatggagtatgtttctgtggagacgagagtaa is nucleotides 41 to 78 of SEQ ID NO:21. The sequence aaaatttaatacctcatacaaagacacctctgctctcatt is the reverse complement of nucleotides 41-78 of SEQ ID NO:21.
[16] FIG. 7. Flow cytometry plots for the data in FIG. 2 after 6 days with or without doxycycline induction. The percent of CFP+ and / or EGFP+ cells gated on live single cells is shown.
[17] FIGS. 8A-F. Wild type Bcl-2 improves gene targeting at various genomic loci across multiple hiPSC lines. FIG. 8A. Plasmids were constructed to constitutively express the Cas9 nuclease with a form of Bcl-2 (separated by an IRES), and a sgRNA. Three human iPSC lines were nucleofected with 2 μg of mThyl or mCD147 targeting vector and 2 μg of "Cas9 sgRNA" or "Cas9 Bcl-2 sgRNA" expression plasmid. 5-9 days later, cells were analyzed by flow cytometry. FIG. 8B. Mouse Thyl gene targeting scheme. FIG. 8C. Single amino acid mutations were generated for the Bcl-2 BH1 (G145A) or BH4 (Y28A) domains. Compiled gene editing frequencies for cells transfected with the Left, Right, or Both Thyl sgRNAs. The percent of mThy 1+ hThy 1" (bottom portion of each set of bars in each graph), mThyl+ hThy 1+ (top portion of left and center sets of bars in each graph and center portion of right set of bars in each graph), and mThyl" hThyl" (top portion of right set of bars in each graph) cells among the various samples is indicated. FIG. 8D. Mouse CD 147 gene targeting scheme. FIG. 8E. Flow cytometry staining for mCD 147 and hCD147 for retrovirally-derived PGP1 hiPSC transfected with "Cas9 sgRNA" or "Cas9 Bcl-2 sgRNA". Samples are gated on live single cells; the percent of cells in each quadrant is indicated. FIG. 8F. Compiled gene editing frequencies for cells transfected with the Left, Right, or both CD 147 sgRNAs. The percent of mCD 147+ hCD147" (bottom portion of each set of bars in each graph), mCD147+ hCD147+ (top portion of left and center sets of bars in each graph and center portion of right set of bars in each graph), and mCD147" hCD147" (top portion of right set of bars in each graph) cells among the three hiPSC lines is indicated.
[18] FIGS. 9A-G. Effects of chemical and genetic inhibitors on mThyl gene targeting in hiPSC. FIG. 9A. Mouse Thyl gene targeting scheme. Human iPSC were nucleofected with the mThy 1 targeting vector system plasmids and analyzed by flow cytometry five days later. The percentages of mThy 1+ hThyl", mThy 1+ hThyl+, and mThyl" hThyl" cells for each sample (gated on live single cells) are graphed. Lines mark the percentage values for the control sample. FIGS. 9B-9D. Human iPSC were nucleofected with: 2 μg mThyl targeting vector; 0.5 μg Cas9 plasmid; and 1.5 μg of sgRNA plasmids. The sample was divided into multiple wells and cultured in plain media (mTeSRl + 10 μΜ Y-27632 ROCK inhibitor) supplemented with the indicated chemical inhibitor for three days. 20 μΜ pifithrin a, 200 μΜ peptide V5 (VPMLK, SEQ ID NO:31), 200 μΜ peptide control (IPMIK, SEQ ID NO:32), 50 μΜ TEMPOL, or the
indicated concentrations of SCR7 or L755507 were used. FIG. 9B, mThyl+ hThyl" (bottom portion of each bar in each graph), mThyl+ hThyl+ (top portion of each bar in each graph). FIG. 9C, mThyl+ hThyl" (bottom portion of each bar in each graph), mThyl+ hThyl+ (top portion of each bar in left and center graphs, middle portion of each bar in right graph), and mThy Γ hThyl" (top portion of each bar in right graph). FIG. 9D, mThyl+ hThyl" (bottom portion of each bar in each graph), mThyl+ hThyl+ (center portion of each bar in each graph), and mThyl" hThyl" (top portion of each bar in each graph). FIGS. 9E-9F. Human iPSC were nucleofected with: 2 μg mThyl targeting vector plasmid; 0.5 μg Cas9 plasmid; 1 μg of sgRNA plasmids; and 0.5 μg of plasmid expressing the indicated DNA repair gene or pUC19 control ("Cas9 only"). For FIG. 9E, cultures were treated with 50 μΜ zVAD and 10 μΜ SB203580 post transfection. mThyl+ hThyl" (bottom portion of each bar in each graph), mThyl+ hThyl+ (top portion of each bar in left and center graphs, middle portion of each bar in right graph), and mThyl" hThyl" (top portion of each bar in right graph). FIG. 9F, mThy 1+ hThyl" (bottom portion of each bar in each graph), mThy 1+ hThy 1+ (top portion of each bar in left and center graphs, middle portion of each bar in right graph), and mThyl" hThyl" (top portion of each bar in right graph). FIG. 9G.
Human iPSC were nucleofected with: 2 μg mThyl targeting vector plasmid; 0.5 μg Cas9 plasmid; and 1.5 μg of sgRNA plasmids. The indicated viral inhibitor genes were cloned into the Cas9 expression vector following an IRES sequence. Cultures were supplemented with 50 μΜ zVAD post transfection. mThy 1+ hThyl" (bottom portion of each bar in each graph), mThyl+ hThy 1+ (top portion of each bar in left and center graphs, middle portion of each bar in right graph), and mThyl" hThyl" (top portion of each bar in right graph).
[19] FIGS. 10A-F. Effect of Caspase and p38 MAPK inhibitors on survival and gene targeting of human iPSC. FIG. 10A and FIG. 10B. Mouse Thyl gene targeting scheme. Human iPSC were nucleofected with the mThyl targeting vector, Cas9 nuclease, and Thyl sgRNA expressing plasmid or pUC19 empty vector. Nucleofected cells were evenly divided and plated onto plain media (mTeSRl + 10 μΜ Y-27632 ROCK inhibitor), or media supplemented with the indicated chemical inhibitor. For specific caspase inhibitors, the principal caspase they target is noted in parentheses. As observed in previous reports, most of the nuclease-mediated cell death occurred between days 1-2 post transfection, and the proportions of mThy 1+ cells remained stable beyond day 5. FIG. IOC. Two days after nucleofection, viable cells were counted. Error bars indicate s.e.m. of technical duplicates. Lines mark the count levels for nucleofected cells in plain media with or without sgRNA. FIG. 10D. Five days after transfection, cells were analyzed by flow cytometry for mThyl and hThyl expression. The percent of mThyl+ hThyl" (bottom of
each bar) and mThyl+ hThyl+ (top of each bar) cells of live single cells is indicated. Lines mark the levels for cells in plain media. No gene targeting was seen in cells transfected with the pUC19 empty vector. FIG. 10E. FACS plots of human iPSC transfected with the mThyl targeting vector, Cas9 nuclease, and Thyl Left and Right sgRNAs. Cells were subsequently cultured for 5 days in plain media ± 50 μΜ zVAD and ± 10 μΜ SB203580. FIG. 10F. Human iPSC cultures were single cell FACS sorted into 96-well tissue culture plates containing a MEF feeder layer and hES media supplemented with SMC4 inhibitors ± 50 μΜ zVAD for eight days. Ten days after sorting, the number of surviving iPSC colonies was counted (from 190 cells sorted). PGP1 hiPSC lines created using retroviral vectors or non-integrating methods were both tested.
[20] FIGS. 11A-C. Genotype and pluripotency of targeted mThyl mCD147 hiPSC clones. FIG. 11A. Mouse Thyl and mouse CD147 gene targeting schemes from FIG. 5. Small triangles indicate the primer sites for the ten genotyping PCR reactions. Single hiPSC were FACS sorted into individual wells and cultured. FIG. 11B. After clonal expansion, hiPSC lines were analyzed by flow cytometry for mThyl, hThyl, mCD147, and hCD 147 expression (top panels). Genomic DNA was extracted and genotyped using the ten PCR reactions (bottom panels). Alleles were identified based on the size of the PCR products: native human (h); recombined mouse (m); or excised between the two sgRNA sites (Δ). Data from representative clones is shown from samples transfected with Thyl and CD147 Left sgRNAs or all four sgRNAs. FIG. 11C.
Targeted, sorted, and expanded hiPSC clones were analyzed by flow cytometry for expression of the pluripotency markers Tra-1/60 and Oct3/4. Shaded peaks indicate the background staining from an isotype control antibody.
[21] FIG. 12. Gene disruption activity of truncated sgRNAs with and without the Trex2 endonuclease. Full length (20 bp of target complementarity) and Truncated (18-19 bp) sgRNAs were designed to target the coding region of four genes expressed on the surface of hiPSC (top) and cloned into expression plasmids under the constitutive U6 promoter. The Cas9 nuclease and Trex2 endonuclease were also cloned into separate expression plasmids under the constitutive EFlot promoter. Human iPSC were nucleofected with 0.5 μg Cas9 plasmid, 1 μg sgRNA plasmid, and 1 μg of either pUC19 control or Trex2 plasmid. Five days later, cells were stained for expression of the surface markers (Thyl, CD147, HLA-A2, or HLA-BC) and analyzed by flow cytometry gated on live single cells (open histograms). Shaded histograms indicate staining
of an untargeted hiPSC control. The percent of cells that have lost expression of the surface markers is shown.
[22] FIG. 13. Nuclease-mediated toxicity in human iPSC can be rescued by a short hairpin RNA (shRNA) construct to knockdown p53 expression. FIG. 13A. Human iPSC containing a doxy cycline -inducible Cas9 nuclease were infected with two lentiviruses: one that constitutively expresses CFP along with an sgRNA and another that constitutively expresses EGFP along with an shRNA. One sgRNA targeted the coding region of human THY1; the other was a negative control sgRNA. One shRNA targeted human p53; the other was a negative control shRNA. Three days after infection, each culture was divided into several wells and treated with 0 or 200 ng / ml doxycycline for up to 6 days. At the indicated time points, the percent of CFP+ EGFP+ iPSC was determined by flow cytometry. FIG. 13B. The percent of decline of CFP+ EGFP+ cells after 6 days of doxycycline induction relative to uninduced cultures is shown.
DETAILED DESCRIPTION
[23] CRISPR/Cas9 nuclease toxicity severely limits gene editing in human pluripotent stem cells (hiPSC). This disclosure provides methods of reducing this toxicity and improving gene targeting frequencies in such hiPSC and in other types of stem cells by inhibiting p53 or Bax. This inhibition can be achieved, for example, by expressing an anti-apoptosis protein or by using genetic or chemical agents to reduce expression of p53 or Bax or to inhibit the function of p53 or Bax.
[24] This disclosure also provides methods of increasing gene targeting frequencies several- fold by overexpressing Bcl-2 with Cas9 during a transient transfection to increase gene targeting frequencies several -fold. For example, base pair changes with 39% homologous recombination efficiency or multiplex gene replacements can be achieved using a simple plasmid transfection without antibiotic selection. Increasing the absolute gene targeting frequency reduces the need for an antibiotic selection marker that must subsequently be removed through a second round of culture and cloning, which adds extra passages andcost and risks contamination or loss of pluripotency. These advances can be used in conjunction with other rapidly developing CRISPR technologies, including improvements in specificity, other types of nucleases, and further enrichment, screening, and selection schemes. Thus, the methods described herein improve the use of genetically modified stem cells, particularly hiPSC, for both experimental studies and therapeutic purposes (e.g. , tissue engineering).
Genetically Modified Stem Cells
[25] This disclosure provides genetically modified stem cells and methods of editing the genome of stem cells such that populations of these cells can be used as in vitro model system or for in vivo therapeutic purposes.
[26] The stem cell to be genetically modified can be an embryonic stem cell (ESC) or a somatic stem cell such as hiPSC, a hematopoietic stem cell, a neural stem cell, or a mesenchymal stem cell. In some variations, the genetically modified stem cell is human. In other variations, the stem cell is that of a non-human mammal, such as a non-human primate, a mouse, or a rat.
Methods of obtaining and growing various types of stem cells are well known the in the art (e.g., Takahashi et al , 2007; Yu et al, 2007; Robinton & Daley, 2012; Drawnel et al, 2014; Li et al, 2015; US 2012/0087933; US 2014/0377865; US 2015/0299712; US 2015/0307841; US
2016/0032250; US 2016/0060594).
[27] The genetically modified stem cells comprise (a) an expression construct encoding a programmable DNA nuclease or a meganuclease; and (b) an anti-apoptosis component. A "programmable DNA nuclease" as used herein means a DNA nuclease that can be engineered to recognize and cleave a desired sequence in the genome of the stem cell. Examples of a programmable DNA nuclease include a class 2 clustered regularly-interspaced short palindromic repeat (CRISPR) nucleases, a zinc finger nuclease (ZFN), and a Transcription Activator-Like Effector nuclease (TALEN). Each of these types of programmable DNA nucleases is well known in the art.
[28] Particular examples of a CRISPR nuclease include a CRISPR associated protein 9 (Cas9) nuclease, a CRISPR from Prevotella and Francisella 1 nuclease (Cpfl), a Class 2 candidate 1 nuclease (C2cl), a Class 2 candidate 2 nuclease (C2c2), and a Class 2 candidate 3 nuclease (C2c3).
[29] "Cas9 nucleases" exist in many bacteria, including S. pyogenes, S. thermophilus, and Neisseria meningitidis. A "Cas9 nuclease" includes a Cas9 nuclease with native (or wild-type) nuclease activity, as well as modified versions of a Cas9 nuclease, such as SpCas9-HFl ("high fidelity variant number 1;" Kleinstiver et al, 2016), eSpCas9 ("enhanced specificity Cas9;" Slaymaker et al, 2016), Cas9 nickases (e.g., Cong et al, 2013; Mali et al, 2013) and nuclease- deficient or nuclease-null Cas9 (e.g. , Jinek et al. , 2012) fused to a nuclease domain (e.g. , Fokl).
[30] Examples of meganucleases include I-Scel meganuclease and I-Crel meganuclease, as well as engineered derivatives thereof (e.g. , Thermes et al. , 2002; Arnould et al. , 2011).
[31] An "anti-apoptosis component" as used herein is a component that inhibits the apoptotic function of p53 or Bax.
[32] In some variations, the anti-apoptosis component is an anti-apoptosis protein, such as a dominant negative mutant of p53, or a genetic mediator which binds to p53 or promotes its degradation including, but not limited to, mouse double minute 2 homolog (MDM2), p53- induced protein with a RING (Really Interesting New Gene)-H2 domain
(Pirh2, RCHY1), constitutive ly photo-morphogenic 1 (COP1), and ARF (Alternative Reading Frame) Binding Protein 1 (ARF-BP1, HUWE1). See, e.g., Tsvetkov et al, "2010; Pant & Lozano, 2014.
[33] In some variations, the anti-apoptosis component is an anti-apoptosis protein, such as a member of the Bcl-2 family, such as B cell lymphoma 2 protein (Bcl-2), Bcl-2 -related protein A (Bcl2Al), B-cell lymphoma-extra large protein (BC1-XL), myeloid cell leukemia 1 protein (Mcl- 1), B cell lymphoma 2-like protein 2 (Bcl-w), or Bcl-2-like protein 10 (Bcl-B).
[34] In some variations, the anti-apoptosis component is an oligonucleotide inhibitor of p53, such as an shRNA.
[35] In some variations, the anti-apoptosis component is a small molecule Bax channel blocker, such as Bax channel inhibitor- 1 (Bcil) and Bax channel inhibitor-2 (Bci2) (Hetz et al, 2005):
[36] In some variations, the genetically modified stem cell also comprises an sgRNA (single guide RNA) complementary to a target nucleic acid sequence of the stem cell genome. The genetically modified stem cell may comprise multiple such sgRNAs, each complementary to a different target nucleic acid sequence of the stem cell genome. In some variations in which the
programmable DNA nuclease is a CRISPR nuclease, the expression construct encoding the CRISPR nuclease also includes a nucleic acid encoding one or more sgRNAs. In other variations, one or more sgRNAs can be provided using one or more separate expression constructs. Types of sgRNAs are well known in the art (e.g., US 2014/0356959; US
2015/0259704).
[37] This disclosure also provides methods of making a genetically modified stem cell. In some variations, an expression construct encoding a Cas9 nuclease and Bcl-2 is provided to a stem cell. In some of these variations, the expression construct also encodes one or more sgRNA.
[38] In some variations, (a) an expression construct encoding a programmable DNA nuclease and (b) an expression construct encoding an anti-apoptosis protein (e.g., a DN p53, Bcl-2, Bcl2Al, Bcl-xL, Mcl-1), an oligonucleotide inhibitor of p53 (e.g. , shRNA), or a Bax channel blocker is provided to a stem cell.
[39] In other variations, a stem cell comprises an expression construct encoding a
programmable DNA nuclease, and the method comprises provided to the stem cell an expression construct encoding an anti-apoptosis protein (e.g., a DN p53, Bcl-2, Bcl2Al, Bcl-xL, Mcl-1), an oligonucleotide inhibitor of p53 (e.g., shRNA), or a Bax channel blocker.
[40] Expression constructs useful for the expression of Cas9, anti-apoptosis proteins, and sgRNA are described in the Examples, below, but any suitable expression construct can be used.
[41] Methods of delivering exogenous nucleic acids to stem cells are well known in the art and include plasmid vectors, viral vectors (e.g., lenti-, adeno-, and adeno-associated viral vectors), and ribonucleoproteins. See Shui et al, 2016. Nucleic acids can also be delivered by electroporation, injection, or lipofection. The nucleic acid encoding the programmable DNA nuclease or meganuclease and the nucleic acid encoding an anti-apoptosis protein can be provided in separate expression constructs or the same expression construct.
[42] This disclosure also provides methods of altering a target nucleic acid sequence of a stem cell, comprising providing a genetically modified stem cell as described above with a single guide RNA (sgRNA) complementary to a target nucleic acid sequence of the stem cell genome or with a plurality of sgRNA complementary to a plurality of target nucleic acid sequences of the stem cell genome, i.e. , to carry out multiplex editing of the stem cell genome. sgRNA can be
delivered to the stem cell by methods well known in the art. Plasmid donors with >1 kb homology arms for small changes (1-100 bp) are particularly useful.
[43] In some variations, the genetically modified stem cell is also contacted with a caspase inhibitor (e.g., zVAD-fmk) to reduce dissociation-mediated cell death, particularly following transfection or cell sorting, and/or a p38 MAP kinase inhibitor (e.g., SB203580) to enhance gene targeting efficiency; see Example 5, below.
Expression constructs encoding a Cas9 nuclease and Bcl-2
[44] This disclosure also provides an expression construct encoding a Cas9 nuclease and Bcl- 2. Expression constructs useful for the expression of a Cas9 nuclease and Bcl-2 are described in the Examples, below, but any suitable expression construct can be used. In some variations, the expression construct also encodes a single guide R A (sgRNA) or a plurality of sgR As.
[45] The following examples are intended to illustrate but not limit this disclosure.
EXAMPLE 1
Experimental Procedures
[46] DNA constructs. Sequences of sgRNAs are provided in the table below. Bold indicates a base that was changed to a G to enable transcription from the U6 promoter. PAM sequences for the sgRNA targeting site are underlined where applicable.
SEQ ID NO:
THY 1 (coding exon) GGGTC AGGCT GAACT CGTAC TGG 1
THY1 truncated GTC AGGCT GAACT CGTAC TGG 2
POU5F 1 (coding exon) GCTGG AGCAA AACCC GGAGG AGG 3
Negative sgRNA # 1 G CTTCA AAGAA CGGCG CTAAC 4
Negative sgRNA #2 G GAGAC GATTA ATGCG TCTCG 5
CD 147 (coding exon) GTCGT CAGAA CACAT CAACG AGG 6
CD 147 truncated GCGT CAGAA CACAT CAACG AGG 7
THY 1 Left GCACA GTCTC AGAAA AGCGC AGG 8
THY 1 Right GTTAG TAGCA ACGCT ACCCC AGG 9
CD 147 Left G ATTTC CTGCG CTGAA TCGGG TGG 10
CD 147 Right G TGGCT CCTGT CTGTG CCTGA CGG 1 1
Jak2 G AATTA TGGAG TATGT GTCTG TGG 12
HLA-A GGACC TGCGC TCTTG GACCG CGG 13
HLA-A truncated GACC TGCGC TCTTG GACCG CGG 14
HLA-B or C GGGCC GCCTC CCACT TGCGC TGG 15
HLA-B or C truncated GCC GCCTC CCACT TGCGC TGG 16
[47] The mouse Thy 1 and CD 147 gene targeting systems and the original plasmids to constitutive ly express the EFla promoter-Cas9 nuclease or the U6 promoter-sgRNA have been previously described and verified (Byrne et al, 2015).
[48] The Jak2 V617F 110 bp ssODN, construction of the plasmid donor, and sequencing primers. PCR reactions were done using KAPA HIFI™ HotStart polymerase; primers and GBLOCKS® are from IDT. Plasmids were constructed using isothermal assembly, transformed into Stbl3 competent E. coli (Invitrogen), grown at 30°C, and verified by Sanger sequencing (Genewiz). Anti-apoptotic genes were obtained from previously published plasmids: Bcl-2 (Addgene plasmid #8793) and BC1-XL (#8790) (Cheng et al, 2001); Bcl2Al (#36973) (Pratt et al, 2012); and Mcl-l (#21605) (Maurer et al, 2006). The dominant negative p53 sequence from Addgene plasmid #9058 (Hahn et al , 2002) was synthesized as a gBlock. These genes were cloned into the EFla promoter-Cas9 nuclease plasmid after an IRES.
[49] Mutations to the Bcl-2 gene were made using the QUIKCHANGE® Lightning Site- Directed Mutagenesis kit (Stratagene) using the following primers:
Y28A:
5' GTCGCAGAGGGGCGCCGAGTGGGATGCG 3' (SEQ ID NO: 17)
5' CGCATCCCACTCGGCGCCCCTCTGCGAC 3' (SEQ ID NO: 18)
G145A:
5' AGGCCACAATCCTCGCCCAGTTCACCCCG 3' (SEQ ID NO: 19)
5' CGGGGTGAACTGGGCGAGGATTGTGGCCT 3' (SEQ ID NO:20)
[50] Other modifier genes were obtained from previously published plasmids: BRCA1 (Addgene plasmid #14999) (Cortez et al , 1999); BRCA2 (#16246) (Wang et al , 2002); and Trex2 (#40210) (Certo et al, 2012; Chari et al, 2015). CtIP (RBBP8) was cloned from human ORFeome v8.1 (horfdb.dfci.harvard.edu clone #1563) (ORFeome Collaboration, 2016) and altered from UniprotKB isoform Q99708-2 to Q99708-1. Rad51 (CCDS 10062.1) and MREl 1A (CCDS8299.1) were synthesized as GBLOCKS® (IDT). These genes were cloned in the constitutive expression plasmid (Byrne et al, 2015), after the EFla promoter, replacing the Cas9
nuclease. E1B55K, and E4orf6 (Chu et al , 2015) were synthesized as GBLOCKS® (IDT), and inserted into the constitutive expression plasmid, after the EFlot promoter, Cas9 nuclease, and an IRES.
[51] The U6 promoter-sgRNA (for each sgRNA sequence) was cloned into the EF la promoter-Cas9 nuclease or EF la promoter-Cas9 nuclease-IRES-Bcl-2 expression plasmids to form the "Cas9 only sgRNA" or "Cas9 Bcl-2 sgRNA" plasmids used in Examples 6 and 7.
[52] Jak2 V617F targeting vectors. Desalted 1 10 bp ssODN (IDT) encoding the Jak2 V617F mutation were ordered in the plus (SEQ ID NO:21) or minus (SEQ ID NO:22) orientation. For the Jak2 V617F plasmid targeting vector, homology arms were PCR amplified from purified PGPl human genomic DNA (upstream, SEQ ID NO: 23 and SEQ ID NO: 24; downstream, SEQ ID NO:25 and SEQ ID NO:26) and cloned using isothermal assembly into the pUC19 plasmid backbone (amplified with SEQ ID NO:27 and SEQ ID NO:28).
SEQ ID NO:21
5 ' AAGTATGATGAGCAAGCTTTCTCACAAGCATTTGGTTTTAAATTATGGAGTATGTT TCTGTGGAGACGAGAGTAAGTAAAACTACAGGCTTTCTAATGCCTTTCTCAGAG 3 '
SEQ ID NO:22
5 ' CTCTGAGAAAGGCATTAGAAAGCCTGTAGTTTTACTTACTCTCGTCTCCACAGAA ACATACTCCATAATTTAAAACCAAATGCTTGTGAGAAAGCTTGCTCATCATACTT 3 '
SEQ ID NO:23
5' GTGCAGGCTTTCAACAATTACTTTG 3'
SEQ ID NO:24
5' TCTCGTCTCCACAGAAACATACTCCATAATTTAAAACC 3'
SEQ ID NO:25
5' ATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAACTACAG 3'
SEQ ID NO:26
5' ATCTTGCTCTAGATTGGGCTTTGG 3'
SEQ ID NO:27
5' CTTGAGCCAAAGCCCAATCTAGAGCAAGATTAGACGTCAGGTGGCACTTTTC 3' SEQ ID NO:28
5' CTTTACAAAGTAATTGTTGAAAGCCTGCACGTTTGCGTATTGGGCGCTCTTC 3'
[53] Stem Cell Culture. Verified human iPSC (retrovirally-reprogrammed) from Personal Genome Project donors PGP1 and PGP4 were obtained through the Coriell Institute
Biorepository at passage 20 (#GM23338, GM23340) (Ball et al , 2012; Byrne et al , 2015; Lee et al , 2009). The non-integrated PGP1 hiPSC line was generated from PGP1 fibroblasts using the Sendai virus-based CYTOTU E® iPS Reprogramming kit (Invitrogen) and received at passage 4. All three lines were adapted to feeder-free culture conditions, karyotyped, and FACS stained for expression of pluripotency markers. All experiments were done at passage number 29-42 for the retroviral hiPSC lines and passage 9- 15 for the non-integrated hiPSC line.
[54] A PIGGYBAC™ vector containing a TRE 3G tetracycline/doxycycline-inducible promoter-Cas9 nuclease and a hEFl HTLV constitutive promoter-Tet On 3G transactivator-T2A cleavage sequence-Hygromycin resistance insert was combined with a transposase expression plasmid, nucleofected into PGP 1 (retroviral) hiPSC, and selected with hygromycin, similar to (Chavez et al , 2015).
[55] Cell lines were maintained on MATRIGEL®-coated plates (BD) and grown in
MTESR1™ (Stem Cell Technologies) according to standard protocols. 10 μΜ of the ROCK inhibitor Y-27632 (R&D Systems, Abeam) was added to the culture before, during, and after passaging with ACCUTASE® (EMD Millipore) or after passaging with RELESR™ (Stem Cell Technologies).
[56] Stem Cell Verification. Pluripotency of iPSC cultures was verified by flow cytometry staining using anti -human Tra-1/60 PE (TRA-1-60, BD) and anti -human Oct3/4 eFluor 660 (EM92, eBioscience) with the BD CYTOFIX™ and PHOSFLOW™ Perm/Wash buffers.
Human g-band karyotype analysis was done by Cell Line Genetics. Viable cell counts were measured with the MUSE® Count & Viability Assay kit (EMD Millipore). Anti-human HLA- A2 APC (BB7.2) and anti-human HLA-BC PE (B 1.23.2) were purchased from eBioscience. Human iPSC cultures were treated with 50 ng / ml recombinant interferon gamma (eBioscience) for 2 days prior to HLA staining.
[57] Lentiviral Infection. A U6 promoter-sgRNA and CAGGS promoter-Cerulean fluorescent protein construct was cloned into the pLVX lentiviral vector backbone (Clontech) (pSB700, Addgene #64046). A similar construct containing a U6 promoter-shRNA and CAGGS promoter-EGFP was cloned into the pLVX lentiviral vector backbone. Individual sgRNA or shRNA sequences were cloned into these vectors. The shRNA sequences for human TP53 (#TRCN0000003755) and control (#TRCN0000057023) are from the Sigma MISSION® shRNA library. An EFla promoter-EGFP-IRES-anti-apoptotic gene construct was also cloned into the pLVX lentiviral backbone. Lentiviral plasmids were combined with psPax2 (Addgene plasmid #12260) and pMD2.G (#12259) and transfected into HEK 293T cells using TransIT-293 transfection reagent (Mirus Bio). 25 μΜ chloroquine (Sigma) was included in the media for the first 24 hr after transfection. Cell culture supernatants were harvested at 48 and 72 hours, and concentrated using the PEG virus precipitation kit (BioVision). Lentivirus was added to human iPSC for one day in mTeSRl media with 4 μg/ml polybrene (EMD Millipore) and 10 μΜ Y- 27632. At least three days after infection, cells were treated with doxycycline (Sigma) for the indicated concentrations and times.
[58] Stem Cell Transfection. Plasmids were purified using the Qiagen ENDOFREE® Plasmid Maxi kit and nucleofected into iPSC cells using the Lonza 4D-Nucleofector X unit (Buffer P3, Program CB-150). For each 20 μΐ nucleofection reaction, 0.2-0.5 x 106 iPSC were transfected with up to 4 μg of plasmid DNA. Post-nucleofection, iPSC were plated onto MATRIGELD-coated wells containing MTESR1™ media with 10 μΜ Y-27632 plus other chemical inhibitors when noted. Later experiments included 50 uM zVAD-fmk (Bachem) for 1 day and 10 μΜ SB203580 (Biovision) for 4-5 days post transfection (see FIGS. 5, 6, 11, and 12). For FIG. 6 (ssODN transfection), 200 ng/ml recombinant B 18R (eBioscience), was also added to the culture for 5 days post transfection.
[59] Chemical inhibitors in Stem Cell Culture. The following inhibitors were added to the hiPSC culture at the concentrations and time periods indicated in the Examples below.
1. p53 or Bax inhibitors: cyclic pifithrin a (StemCell Technologies); pifithrin μ
(Tocris); peptide V5, peptide control, iMACl and iMAC2 (EMD Millipore); N- acetyl cysteine and 4-hydroxy TEMPO (TEMPOL) (Sigma).
Caspase inhibitors: zVAD-fmk, zVAD(OMe)-fmk, and
zD(Ome)E(Ome)VD(Ome)-fmk (Bachem); zVD(Ome)VAD(0:
zVE(Ome)ID(Ome)-fmk, zIE(Ome)TD(Ome)-fmk, zLE(Ome)HD(Ome)-fmk, and zAE(Ome)VD(Ome)-fmk (R&D Systems).
3. HR / NHEJ: SCR7 (Xcess Biosciences); L755507 (Tocris); Brefeldin A (EMD Millipore).
[60] Flow Cytometry. Cells were dissociated using TRYPLE™ Express and washed in FACS buffer: PBS + 10% fetal calf serum (Invitrogen). The following antibodies were purchased from eBioscience: Anti-human Thyl APC or PECy7 (eBio5E10), anti-mouse Thy 1.2 PE or FITC (30- H12), anti-human CD 147 APC (8D12), anti-mouse CD 147 PE (RL73). For antibody staining, cells were stained in FACS buffer for 30 min at 4°C and washed twice in FACS buffer. Cells were finally resuspended in FACS buffer with 20 ng/ml DAPI (Sigma) or 0.5 μΜ ToPro-3 (Invitrogen) as viability dye and analyzed on a BD LSRFORTESSA™ flow cytometer. Single- cell hiPSC FACS sorting was done as previously described (Byrne et al., 2015); 50 μΜ zVAD- fmk was added with the SMC4 inhibitors for eight days after sorting for FIG. 11 and where otherwise indicated.
[61] Next-Generation Sequencing. The percent of indel or gene targeted mutations at the Jak2 V617F site was assayed using next-generation sequencing (Byrne et al., 2015; Guell et al, 2014). To sequence the Jak2 locus, the first round of PCR was done on purified genomic DNA (GENELUTE™ Mammalian Genomic DNA Miniprep Kit, Sigma) using the following primers, in which Illumina adapter sequences are underlined:
SEQ ID NO:29
5' CTTTCCCTACACGACGCTCTTCCGATCTTTATGGACAACAGTCAAACAACAATT 3' SEQ ID NO:30
5' GGAGTTCAGACGTGTGCTCTTCCGATCT ACACCTAGCTGTGATCCTGAAACTG 3'
[62] A second round of nested PCR with NEXTERA™ index primers (Illumina) was used to add barcodes and remaining adaptor sequences. Both PCR reactions were supplemented with SYBR® Green (Invitrogen) and monitored on a quantitative PCR machine to prevent over- amplification. PCR products were gel-purified using the QIAQUICK® Gel Extraction kit (Qiagen).
[63] Paired-end 150 Illumina MiSeq reactions were analyzed by the CRISPR Genome Analyzer (crispr.med.harvard.edu).
EXAMPLE 2
Cas9 nuclease activity is toxic to human pluripotent stem cells, but can be rescued by inhibiting p53 or the mitochondrial pathway of apoptosis
[64] A hiPSC line that contains a doxycycline-inducible Cas9 nuclease expression construct was used to study the extent of Cas9 nuclease-mediated death. These cells were infected with lentivirus to constitutively express an sgRNA and a CFP marker, divided into several wells, treated with varying concentrations of doxycycline, and the proportion of CFP+ cells was monitored over two weeks (FIG. 1A). Induction of the Cas9 nuclease produced a dramatic decline in the amount of CFP+ sgRNA+ cells, but only with sgRNAs targeting human genes. No decline was seen with negative control sgRNAs designed to not cut anywhere in the human genome (FIG. IB). Lowering titrations of Cas9 induction over two weeks only yielded lower frequencies of gene disruption (FIG. 1C).
[65] Next, we sought to rescue the nuclease-mediated death of hiPSC by inhibiting principal apoptotic pathways of the DNA damage response. A second set of lentiviruses was generated to constitutively overexpress EGFP together with an anti-apoptotic gene. To inhibit p53, we overexpressed a dominant negative form of p53 (DN p53) harboring a 288 amino acid deletion known to disrupt p53 tetramerization and enhance hiPSC reprogramming (Hahn et al, 2002; Kawamura et al, 2009). To inhibit the mitochondrial pathway of apoptosis, we overexpressed anti-apoptotic Bcl-2 family members: Bcl-2, Bcl2Al, BC1-XL, and Mcl-1 (Moldoveanu et al , 2014). The doxycycline-inducible Cas9 hiPSC line was infected with both lentiviruses (6 anti- apoptotic EGFP x 3 sgRNA CFP), split into multiple wells, treated with or without doxycycline, and the frequencies of CFP+ and / or EGFP+ cells were assayed at various time points by flow cytometry (FIG. 2 and FIG. 7). With no doxycycline induction of Cas9, the percent of EGFP+ CFP+ cells remained fairly stable over time, although some anti-apoptotic constructs conferred a growth advantage to the EGFP+ subset. When Cas9 was induced, in the EGFP only negative control construct, the percent of EGFP+ CFP+ cells declined by 65-68% (FIG. 2B). The percent of CFP+ EGFP" cells also declined, similar to FIG. 1 (FIG. 7). Each of the anti-apoptotic EGFP lentiviruses was able to abrogate (although not completely eliminate) the EGFP+ CFP+ decline compared to the EGFP only control (FIG. 2B). Again, no Cas9 toxicity was seen with the negative control sgRNA. A similar rescue was observed with an shRNA construct to knockdown
p53 expression (FIG. 13). Thus, inhibiting p53 or the mitochondrial pathway can partly reduce the nuclease-mediated death in hiPSC.
EXAMPLE 3
Inhibiting nuclease-mediated death improves gene targeting
[66] Subsequently, we determined whether rescue by these anti-apoptotic genes would result in higher gene editing frequencies in hiPSC. We used our previously developed and verified model system for assessing targeted gene replacements, where a 2.7 kb segment of the human ΊΉΥ1 gene (hThyl) is replaced with 2.5 kb of its mouse homologue (mThyl) (Byrne et al , 2015) (FIG. 3A). Human Thy l was chosen because it is expressed on the surface of hiPSC, not essential for cell survival in vitro, and species-specific staining antibodies are available. Two sgRNAs were designed that target hThyl on either side of the replaced coding region— in intron 1 (Left) or after the polyadenylation sequence (Right). The mThy l targeting vector plasmid contains the corresponding coding region of mThyl flanked by hThyl homology arms outside of the cut sites.
[67] After hiPSC are transfected with the mThy 1 targeting vector and plasmids to express the Cas9 nuclease and sgRNAs, the absolute frequencies of gene replacement can be observed using flow cytometry analysis. We have previously shown that, when one sgRNA is used, almost all mThy 1+ hThy 1+ cells have successfully undergone a targeted gene replacement at one allele (heterozygous), and most mThy 1+ hThy l" cells have replaced both alleles (homozygous). When both Thy l sgRNAs are transfected, a fourth population of double negative mThyl" hThyl" cells also emerges; this largely comprises cells which have excised or inverted the hThyl alleles, which can also be found in the mThy 1+ hThyl" population of these samples (Byrne et al. , 2015).
[68] Because our set of anti-apoptotic lentiviral constructs includes an EGFP marker, we could compare gene targeting frequencies between the EGFP+ and EGFP" subsets within the same transfected cell population. Plain hiPSC were infected with each of the six EGFP anti- apoptotic lentiviruses described in FIG. 2, and then transfected with the mThyl targeting vector together with plasmids expressing the Cas9 nuclease and either, both, or no Thy 1 sgRNAs (FIG. 3B). For the EGFP only control lentivirus, roughly similar gene targeting rates were observed between the EGFP" and EGFP+ gated subpopulations. Overexpressing DN p53 or Bcl-2 produced a dramatic increase in the frequency of homologous recombination (HR)-mediated mThyl homozygous gene replacements (FIG. 3C, top row). When both Thyl sgRNAs were used,
overexpressing DN p53 or Bcl-2 also increased the frequency of non-homologous end joining (NHEJ)-mediated hThyl homozygous gene deletions (FIG. 3C, bottom row). While DN p53 produced the greatest increase in HR-mediated gene targeting (7-8-fold), each of the four Bcl-2 family members also increased gene targeting (3-fold) (FIG. 3D, left). For NHEJ-mediated gene deletions, DN p53 again produced the greatest increase (1.7-fold) versus each of the four Bcl-2 family members (1.3-1.5-fold) (FIG. 3D, right). Gene deletion showed more modest fold increases because the initial frequency was higher. Therefore, rescuing nuclease-mediated death in hiPSC strongly increases the efficiency of both HR-mediated gene replacement and NHEJ- mediated gene deletion.
EXAMPLE 4
Bcl-2 improves gene targeting when transiently transfected with the Cas9 nuclease
[69] Because of their ability to block apoptosis in response to DNA damage, dominant negative forms of p53 and the anti-apoptotic Bcl-2 family members are potent oncogenes, and their permanent overexpression would alter the characteristics of hiPSC and any subsequently differentiated cell types. An ideal anti-apoptotic factor would be capable of rescuing hiPSC and enhancing gene editing when transiently transfected on a plasmid together with the Cas9 nuclease. As the hiPSC culture divides, the cells will lose expression of both the oncogene and the Cas9 nuclease. To test this, we generated a set of plasmids to express the Cas9 nuclease with an anti-apoptotic factor (FIG. 4). Plain hiPSC were transfected with these Cas9 plasmids together with the mThy 1 targeting vector and sgRNAs, and gene targeting frequencies were assessed by flow cytometry. Surprisingly, Bcl-2 was the only anti-apoptotic factor that increased gene targeting frequencies compared to Cas9 only controls (FIG. 4C and FIG. 4D). In some cases, the frequency of gene targeting actually declined. While all of the factors increased gene targeting when expressed continuously (FIG. 3), they did not when expression kinetics occurred later. It is unclear why Bcl-2 was uniquely able to improve gene targeting upon transient transfection— each anti-apoptotic gene was artificially overexpressed under the same conditions. However, the different Bcl-2 family members may have qualitative and quantitative differences in their synthesis and affinities of interaction.
[70] To further investigate the mechanism by which Bcl-2 was able to improve gene targeting, we tested previously characterized mutant forms of Bcl-2. The G145A mutation in the BH1 domain prevents Bcl-2 from interacting with Bax and inhibiting apoptosis. Alternatively, the
Y28A mutation in the BH4 domain does not block Bax interaction, but may be required for Bcl- 2 inhibition of the cell cycle (Huang et al , 1997; Youn et al , 2004), although there are conflicting reports (Janumyan et al, 2003). For enhanced transfection efficiency, the sgR A segment was cloned onto the Cas9 nuclease expression plasmid ("Cas9 only sgRNA" or "Cas9 Bcl-2 sgRNA"). This set of plasmids, together with the mThy 1 targeting vector, was transfected into plain hiPSC, and gene targeting frequencies were assessed using flow cytometry (FIG. 8). Surprisingly, both mutations showed intermediate levels of gene targeting compared to wild type Bcl-2, which showed the greatest enhancement. Bcl-2 's protective effects were more pronounced on a different hiPSC line, reprogrammed through non-integrating methods, although the absolute mThy 1 targeting frequencies were lower (FIG. 8C). Even if the Y28 mutation does not affect the anti-apoptotic function of Bcl-2, its N-terminal BH4 domain may still be involved, as truncation mutants or caspase cleavage of this domain can prevent anti-apoptotic activity (Cheng et al. , 1997).
[71] Next, we tested several chemical inhibitors of p53 and Bax. None of these inhibitors promoted mThy 1 gene targeting in hiPSC when applied after transfection. Pifithrin a, which blocks p53-dependent transcriptional activation, has been shown to rescue mouse, but not human, ES cells from UV-induced apoptosis (Grandela et al , 2007; Qin et al , 2007), but did not enhance hiPSC gene targeting (FIG. 9A, FIG. 9B). Pifithrin μ does not affect p53 transcriptional activation, but does prevent p53 from binding to Bcl-2 and BC1-XL at the mitochondria and has been shown to improve hESC survival after genotoxic stressors (Garcia et al, 2014; Grandela et al, 2007; Qin et al, 2007). However, it exhibited considerable toxicity to hiPSC when applied for 2 days after nucleofection (10-20 μΜ, data not shown) instead of a few hours as used in previous studies. The Bax inhibiting pentapeptide V5 (VPMLK, SEQ ID NO:31), derived from the human Ku70 Bax-binding domain (Y oshida et al. , 2004), produced only a very slight improvement in gene targeting (FIG. 9C). These Ku-derived peptides may not be effective on the active conformation of Bax maintained in hiPSC. The mitochondrial apoptosis-induced channel blockers iMACl and iMAC2 (Peixoto et al , 2009) were toxic to hiPSC at 2.5-10 μΜ. The antioxidants N-acetyl cysteine (1-5 mM) or TEMPOL showed toxicity or no effect, respectively (FIG. 9C).
EXAMPLE 5
Caspase inhibitors rescue hiPSC death from dissociation but not nuclease activity
[72] We then tested chemical caspase inhibitors after hiPSC transfection. As seen in previous studies, more cell death was observed when a sgRNA-expressing plasmid was transfected compared to an equivalent amount of pUC19 empty vector (Byrne et al, 2015) (FIG. 10). The pan-caspase inhibitors zVAD-fmk and zVAD(OMe)-fmk rescued cells transfected with an sgPvNA, and also those transfected with the pUC19 control. Despite this overall rescue, the difference between the sgRNA and pUC19 cell counts remained about the same (FIG. IOC). Caspase inhibitors have been shown to prevent detachment-mediated cell death (anoikis) of human ES cells (Wang et al, 2009), which would explain why inhibiting caspases improves the survival of all hiPSC following nucleofection. Caspase inhibitors also increased hiPSC recovery following single cell FACS sorting (in conjunction with SMC4 inhibitors) (FIG. 10F). However, rescuing hiPSC with pan-caspase inhibitors actually decreased the gene targeting frequencies compared to plain media, which could be due to inhibition of the cell cycle (FIGS. 10D, 10E). Adding zVAD did not affect the doxy cycline -induced Cas9 nuclease toxicity shown in FIG. 1.
[73] More specific caspase inhibitors (zDEVD-fmk and zAEVD-fmk) also prevented anoikis (FIG. IOC). zDEVD preferentially inhibits the executioner caspases 3 and 7. zAEVD is often sold as a specific inhibitor of caspase 10, which cleaves and activates caspases 3 and 7 downstream of surface death receptor signals, but zAEVD can inhibit other caspases as well (Garcia-Calvo et al, 1998). Surprisingly, the caspase 9 inhibitor zLEHD-fmk was very toxic to hiPSC; however, it can also inhibit caspases 3, 6, and 8, and may be more potent than zVAD (Berger et al , 2006; McStay and Green, 2014). Lower concentrations (25 μΜ) did not show as much anoikis rescue (zVAD or zDEVD) or toxicity (zLEHD).
[74] The p38 MAP kinase inhibitor SB203580 was reported to enhance HR in response to a dsDNA break (Golding et al. , 2007) and is also included in some protocols for deriving naive human pluripotent stem cells (Gafni et al, 2013). Adding 10 μΜ SB203580 to the hiPSC media after nucleofection did not affect cell survival, but did enhance gene targeting efficiency (FIGS. 10C-E). Future experiments included 50 μΜ zVAD and 10 μΜ SB203580 after hiPSC transfection as it produced the best balance regarding anoikis rescue, gene targeting efficiency, and price.
EXAMPLE 6
Simultaneous multiplex large gene replacements
[75] We confirmed Bcl-2's ability to improve gene targeting at a second gene locus using our previously published similar scheme for human Basigin (BSG, CD147) (Byrne et al, 2015). Like hThyl, CD147 is expressed on the surface of hiPSC, not essential for hiPSC survival in vitro, and good staining antibodies are available. Similar to the mThyl targeting scheme, two sgRNAs, 9.8 kb apart, target human BSG either in intron 1 or after the polyadenylation sequence. The mouse CD 147 targeting vector plasmid encodes 5.8 kb of the corresponding mouse CD 147 coding region flanked by homology arms outside of the cut sites (FIG. 5A and FIG. 8D). We have previously demonstrated that, after transfection, a similar pattern of multi-kilobase homozygous and heterozygous gene replacement for mCD147 can be observed using flow cytometry, including excision and inversion alleles when both CD 147 sgRNAs are used
(although the larger CD147 gene replacements occurred less frequently) (Byrne et al, 2015). Including Bcl-2 on the Cas9 plasmid substantially and reproducibly increased gene targeting frequencies, in both retroviral and non-integrating PGP1 hiPSC lines (FIGS. 8E-F). A third hiPSC line, which was retrovirally-reprogrammed from a different donor (PGP4), also showed markedly improved gene targeting with Bcl-2 at the CD147 and Thyl loci (FIGS. 8C, 8F).
[76] Previously, low gene targeting frequencies in hiPSC could be overcome by clever enrichment or selection schemes. However, for simultaneous multiplex gene targeting, a higher absolute frequency is needed. To demonstrate the ability of transient Bcl-2 overexpression to achieve multiplex large gene replacements, we combined our mThyl and mCD147 gene targeting systems (FIG. 5). Plain hiPSC were transfected with both mThyl and mCD147 targeting vectors together with the "Cas9 only sgRNA" or "Cas9 Bcl-2 sgRNA" plasmids.
Combinations of both Left sgRNAs, both Right sgRNAs, all four sgRNAs, or a negative control sgRNA were used. Cultures were then analyzed by flow cytometry for hThyl, mThyl, hCD147, and mCD 147 expression. In each case, samples transfected with only the Left or only the Right sgRNAs showed the expected patterns of homozygous and heterozygous gene replacement for each locus, whereas only the samples transfected with all four sgRNAs showed substantial double-negative (or quadruple-negative) populations (FIG. 5B). In every instance, inclusion of Bcl-2 improved gene editing frequencies. When cell populations were gated on homozygous mThyl gene replacement (red) and then analyzed for mCD147 gene replacement, we found an enrichment of mCD 147 events, rather than an independent assortment of gene editing outcomes.
Likewise, when all four sgRNAs were transfected, the mThyl" hThyl" double negative population (blue) contained an enriched proportion of mCD 147" hCD147" cells. Even considering an overall transfection rate of 60-70%, these enrichments indicate that hiPSC may be poised for either HR or NHEJ at various periods. With Bcl-2, the frequency of HR-mediated double homozygous gene replacements (mThyl+ hThyl" mCD 147+ hCD147") increased by an order of magnitude (Left sgRNAs: from 0.02% to 0.16%; Right sgRNAs: from 0.01% to 0.37%). NHEJ-mediated quadruple -negative deletions (mThyl" hThyl" mCD147" hCD 147") increased from 0.7% to 1.1% (FIG. 5B). Quadruple-targeted hiPSC were cloned using single cell FACS sorting and expanded. Their genotypes were confirmed using ten PCR reactions; they retained expression of pluripotent markers; and they possessed normal karyotypes (FIG. 12).
EXAMPLE 7
Engineering single base pair changes with high HR frequency
[77] While multi-kilobase mouse gene replacement is a valuable model system for readily assessing gene editing outcomes, many hiPSC experiments aim to study small disease variants. For engineering particular point mutations, single-stranded oligodeoxynucleotide (ssODN) donors are often preferred instead of plasmids. To demonstrate the use of Bcl-2 overexpression to engineer a disease mutation in hiPSC, we chose the Jak2 V617F mutation, which is the most commonly affected gene in myeloproliferative neoplasms (MPN). This mutation generates disease outcomes of varying severity, but studies have been complicated by differences in patient's genetic backgrounds, so an isogenic model system is desired (Chen et al, 2010).
Human iPSC were transfected with the aforementioned Cas9-Bcl-2 plasmid constructs containing an sgRNA targeting Jak2 (Smith et al, 2014) together with 110 bp ssODN donors (in either orientation) or a plasmid donor (FIG. 6A). Gene editing rates were measured using PCR and next-generation sequencing around the cut site to examine both incorporation of the mutation (HR) and indels (NHEJ) (FIG. 6B) (Guell et al, 2014). Including Bcl-2 on the Cas9 plasmid substantially increased the absolute recombination frequencies - with oligo donors it increased by 2-4-fold, whereas with plasmid donors it increased from 25% to 39% (FIG. 6C). Donor ssODN containing two phosphorothioated bonds at each end were considerably more toxic to hiPSC and produced lower targeting efficiencies (data not shown).
[78] Even in the absence of Bcl-2, the plasmid V617F donor vector was far superior to ssODN donors for introducing specific point mutations, which may be due to several factors:
Transfecting ssODN appeared to be more toxic to hiPSC, even with the interferon-neutralizing B 18R protein, which also explains the lower NHEJ rates in these samples. We have previously demonstrated ~2 kb as the optimal homology arm length for hiPSC gene targeting (Byrne et al. , 2015); the V617F plasmid donor contained 1.9 kb and 1.3 kb flanking homology arms - far longer than the 110 bp ssODN. We have also reported that circular plasmids have higher nucleofection efficiencies than linear plasmids (Byrne et al , 2015). Circular plasmids may persist longer inside the cells than an ssODN - indeed, culturing the cells for 17 days after transfection was necessary to completely eliminate unincorporated plasmid. Finally, oligo- mediated gene targeting may involve a single-strand annealing mechanism rather than traditional HR. While other groups have demonstrated equal or higher gene targeting with ssODN compared to plasmid or dsODN donors (Chen et al. , 2011 ; Richardson et al. , 2016; Soldner et al, 2011), we achieved optimal results using a plasmid donor containing longer homology arms for Cas9 nucleases in hiPSC.
[79] Many methods have been developed to improve all aspects of Cas9-mediated gene targeting, some of which we have tested in hiPSC. Truncated sgRNAs, which possess 17-19 bp of target complementarity instead of 20 bp, have been reported to reduce off-target Cas9 nuclease activity while preserving on-target activity (Fu et al, 2014). However, these studies were done in human tumor cell lines with near-complete gene disruption efficiencies. We developed truncated sgRNAs against hiPSC surface proteins and assayed gene disruption efficiencies by flow cytometry. This more stringent assay revealed that truncated sgRNAs showed reduced on-target activity, yet no consistent decrease in nuclease toxicity, when compared to full length sgRNA controls (FIG. 12). However, the endonuclease Trex2 (Certo et al, 2012) increased gene disruption frequencies by making NHEJ more error-prone in hiPSC (FIG. 12). The blunt-ended dsDNA breaks made by Cas9 are often re-ligated perfectly by canonical NHEJ, so indel frequency is an imperfect measure of the total cutting frequency (Betermier et al, 2014).
[80] Other methods sought to improve gene targeting by inhibiting NHEJ or enhancing HR, which we also tested with our mThyl gene targeting system in hiPSC. Unfortunately, neither the
DNA ligase IV inhibitor SCR7 (Maruyama et al, 2015) nor the p3-adrenergic receptor agonist
L755507 (Yu et al , 2015) improved mThyl gene targeting efficiencies in PGP1 hiPSC when administered after plasmid nucleofection (FIG. 9D). Brefeldin A, which blocks protein transport to the Golgi, was toxic to PGP1 hiPSC at 0.1 μΜ (data not shown). Adding plasmids to overexpress principal HR mediators BRCA1, BRCA2, CtIP, and MREl la into the hiPSC
transfection did not improve mThyl gene targeting efficiency; paradoxically, overexpressing Rad51 reduced gene targeting efficiency (FIG. 9E). Adding Trex2 also reduced mThyl gene targeting efficiency, likely due to an increased frequency of indel mutations competing with the gene replacement (FIG. 9F). Overexpressing the adenoviral DNA ligase IV inhibitor genes E1B55K or E4orf6 (Chu et al , 2015) reduced mThyl gene targeting efficiency (FIG. 9G). Human iPSC possessing mutations in DNA ligase IV show impaired NHEJ, but also accumulate dsDNA breaks with increased apoptosis (Tilgner et al, 2013). Many differences between the experimental systems used, including cell line and kinetics, may explain why our results differ from those previously published; however, robust techniques to improve gene targeting remain a topic of intense interest. Therefore, by simply adding Bcl-2 onto the Cas9 nuclease plasmid, we are able to ameliorate nuclease-mediated death and increase the absolute frequency of successful gene editing in hiPSC using a single transfection without enrichment or selection.
REFERENCES
Adams et al. (2010). ATM-independent, high-fidelity nonhomologous end joining predominates in human embryonic stem cells. Aging (Albany NY) 2, 582-596.
Ardehali et al. (2011). Overexpression of BCL2 enhances survival of human embryonic stem cells during stress and obviates the requirement for serum factors. Proc. Natl. Acad. Sci. U.S.A. 108, 3282-3287.
Bai et al. (2012). Bcl-xL enhances single-cell survival and expansion of human embryonic stem cells without affecting self-renewal. Stem Cell Research 8, 26-37.
Ball et al. (2012). A public resource facilitating clinical use of genomes. Proc. Natl. Acad. Sci.
U.S.A. 109, 11920-11927.
Berger et al. (2006). Identification of Early Intermediates of Caspase Activation Using Selective
Inhibitors and Activity-Based Probes. Molecular Cell 23, 509-521.
Betermier et al. (2014). Is non-homologous end-joining really an inherently error-prone process?
PLoS Genet. 10, el004086.
Byrne et al. (2015). Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Research 43, e21.
Certo et al. (2012). Coupling endonucleases with DNA end-processing enzymes to drive gene disruption. Nature Methods 9, 973-975.
Cervantes et al. (2002). Embryonic stem cells and somatic cells differ in mutation frequency and type. Proc. Natl. Acad. Sci. U.S.A. 99, 3586-3590.
Chari et al. (2015). Unraveling CRISPR-Cas9 genome engineering parameters via a library-on- library approach. Nature Methods 12, 823-826.
Chavez et al. (2015). Highly efficient Cas9-mediated transcriptional programming. Nature
Methods 12, 326-328.
Chen et al. (2010). Distinct Clinical Phenotypes Associated with JAK2V617F Reflect
Differential STAT1 Signaling. Cancer Cell 18, 524-535.
Chen et al. (201 1). High-frequency genome editing using ssDNA oligonucleotides with zinc- finger nucleases. Nature Methods 8, 753-755.
Cheng et al. (1997). Conversion of Bcl-2 to a Bax-like death effector by caspases. Science 278, 1966-1968.
Cheng et al. (2001). BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAK-mediated mitochondrial apoptosis. Molecular Cell 8, 705-71 1.
Chu et al. (2015). Increasing the efficiency of homology -directed repair for CRISPR-Cas9- induced precise gene editing in mammalian cells. Nature Biotechnology 33, 543-548. Cortez et al. (1999). Requirement of ATM-dependent phosphorylation of brcal in the DNA damage response to double-strand breaks. Science 286, 1 162-1 166.
Dumitru et al. (2012). Human Embryonic Stem Cells Have Constitutively Active Bax at the
Golgi and Are Primed to Undergo Rapid Apoptosis. Molecular Cell 46, 573-583.
Fu et al. (2014). Improving CRISPR-Cas nuclease specificity using truncated guide RNAs.
Nature Biotechnology 32, 279-284.
Gafni et al. (2013). Derivation of novel human ground state naive pluripotent stem cells. Nature
504, 282-286.
Garcia-Calvo et al. ( 1998). Inhibition of human caspases by peptide-based and macromolecular inhibitors. J. Biol. Chem. 273, 32608-32613.
Garcia et al. (2014). Topoisomerase I inhibitor, camptothecin, induces apoptogenic signaling in human embryonic stem cells. Stem Cell Research 12, 400-414.
Garitaonandia et al. (2015). Increased Risk of Genetic and Epigenetic Instability in Human Embryonic Stem Cells Associated with Specific Culture Conditions. PLoS ONE 10, e01 18307.
Golding et al. (2007). Extracellular Signal-Related Kinase Positively Regulates Ataxia
Telangiectasia Mutated, Homologous Recombination Repair, and the DNA Damage Response. Cancer Research 67, 1046-1053.
Grande la et al. (2007). p53 is required for etoposide-induced apoptosis of human embryonic stem cells. Stem Cell Research 1, 116-128.
Guell et al. (2014). Genome editing assessment using CRISPR Genome Analyzer (CRISPR-
GA). Bioinformatics 30, 2968-2970.
Hahn et al. (2002). Enumeration of the Simian Virus 40 Early Region Elements Necessary for
Human Cell Transformation. Mol. Cell. Biol. 22, 2111-2123.
Huang et al. (1997). The anti-apoptosis function of Bcl-2 can be genetically separated from its inhibitory effect on cell cycle entry. Embo J. 16, 4628-4638.
International Stem Cell Initiative et al. (2011). Screening ethnically diverse human embryonic stem cells identifies a chromosome 20 minimal amplicon conferring growth advantage.
Nature Biotechnology 29, 1 132-1144.
Janumyan et al. (2003). Bcl-xL/Bcl-2 coordinately regulates apoptosis, cell cycle arrest and cell cycle entry. Embo J. 22, 5459-5470.
Kawamura et al. (2009). Linking the p53 tumour suppressor pathway to somatic cell
reprogramming. Nature 460, 1140-1144.
aulier et al. (2012). The secret life ofBcl-2: apoptosis-independent inhibition of DNA repair by
Bcl-2 family members. Mutat. Res. 751, 247-257.
Lee et al. (2013). Tumorigenicity as a clinical hurdle for pluripotent stem cell therapies. Nature
Medicine 19, 998-1004.
Lee et al. (2009). A Robust Approach to Identifying Tissue-Specific Gene Expression
Regulatory Variants Using Personalized Human Induced Pluripotent Stem Cells. PLoS
Genet. 5, el 000718.
Liu et al. (2013). High Mitochondrial Priming Sensitizes hESCs to DNA-Damage-Induced
Apoptosis. Cell Stem Cell 13, 483-491.
Liu et al. (2014). Stem cells: balancing resistance and sensitivity to DNA damage. Trends in Cell Biology 24, 268-274.
Mali et al. (2013). RNA-guided human genome engineering via Cas9. Science 339, 823-826. Maruyama et al. (2015). Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nature Biotechnology 33, 538-542.
Maurer et al. (2006). Glycogen synthase kinase-3 regulates mitochondrial outer membrane permeabilization and apoptosis by destabilization of MCL-1. Molecular Cell 21, 749- 760.
Mayshar et al. (2010). Identification and classification of chromosomal aberrations in human induced pluripotent stem cells. Cell Stem Cell 7, 521-531.
McStay & Green (2014). Measuring apoptosis: caspase inhibitors and activity assays. Cold Spring Harb Protoc 2014, 799-806.
Moldoveanu et al. (2014). Many players in BCL-2 family affairs. Trends in Biochemical
Sciences 39, 101-1 1 1.
Momcilovic et al. (2010). DNA Damage Responses in Human Induced Pluripotent Stem Cells and Embryonic Stem Cells. PLoS ONE 5, e l3410.
Monaco et al. (2013). The selective BH4-domain biology of Bcl-2-family members: IP3Rs and beyond. Cell. Mol. Life Sci. 70, 1 171-1 183.
Nagaria et al. (2013). DNA double-strand break response in stem cells: mechanisms to maintain genomic integrity. Biochim. Biophys. Acta 1830, 2345-2353.
ORFeome Collaboration (2016). The ORFeome Collaboration: a genome-scale human ORF- clone resource. Nature Methods 13, 191-192.
Peixoto et al. (2009). MAC inhibitors suppress mitochondrial apoptosis. Biochem. J. 423, 381—
387.
Pratt et al. (2012). The latent membrane protein 1 (LMP1) oncogene of Epstein-Barr virus can simultaneously induce and inhibit apoptosis in B cells. J. Virol. 86, 4380-4393.
Qin et al. (2007). Regulation of Apoptosis and Differentiation by p53 in Human Embryonic
Stem Cells. Journal of Biological Chemistry 282, 5842-5852.
Richardson et al. (2016). Enhancing homology -directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nature Biotechnology. Slaymaker et al , Rationally engineered Cas9 nucleases with improved specificity, 2016 Jan l ;351(6268): 84-88.
Shalem et al. (2014). Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells.
Science 343, 84-87.
Smith et al. (2014). Efficient and Allele-Specific Genome Editing of Disease Loci in Human iPSCs. Molecular Therapy 23, 570-577.
Soldner et al. (2011). Generation of Isogenic Pluripotent Stem Cells Differing Exclusively at Two Early Onset Parkinson Point Mutations. Cell 146, 318-331.
Tilgner et al. (2013). A human iPSC model of Ligase IV deficiency reveals an important role for NHEJ-mediated-DSB repair in the survival and genomic stability of induced pluripotent stem cells and emerging haematopoietic progenitors. Cell Death Differ 20, 1089-1100.
Wang et al. (2001). Transient Expression of Wild-type or Mitochondrially Targeted Bel -2
Induces Apoptosis, whereas Transient Expression of Endoplasmic Reticulum-targeted Bcl-2 Is Protective against Bax-induced Cell Death. Journal of Biological Chemistry 276, 44117-44128.
Wang et al. (2009). Inhibition of Caspase-mediated Anoikis Is Critical for Basic Fibroblast
Growth Factor-sustained Culture of Human Pluripotent Stem Cells. Journal of Biological Chemistry 284, 34054-34064.
Wang et al. (2002). Inhibition of cancer cell growth by BRCA2. Cancer Research 62, 1311- 1314.
Yoshida et al. (2004). Bax-inhibiting peptide derived from mouse and rat Ku70. Biochemical and Biophysical Research Communications 321, 961-966.
Youle et al. (2008). The BCL-2 protein family: opposing activities that mediate cell death.
Nature Reviews Molecular Cell Biology 9, 47-59.
Youn et al. (2004). Bcl-2 expression suppresses mismatch repair activity through inhibition of
E2F transcriptional activity. Nature Cell Biology 7, 137-147.
Yu et al. (2015). Small molecules enhance CRISPR genome editing in pluripotent stem cells.
Cell Stem Cell 16, 142-147.
Zhao et al. (2008). Two supporting factors greatly improve the efficiency of human iPSC
generation. Cell Stem Cell 3, 475-479.
Arnould et al, "The I-Crel meganuclease and its engineered derivatives: applications from cell modification to gene therapy," Prot. Eng. Des. Sel. 2011, 24:27-31.
Cong et al , "Multiplex genome engineering using CRISPR/Cas systems," Science, 2013,
339(6121): p. 819-23.
Drawnel et al. , "Disease modeling and phenotypic drug screening for diabetic cardiomyopathy using human induced pluripotent stem cells," Cell Rep. 2014; 9, 810-21.
Friedland et al. , "Heritable genome editing in C. elegans via a CRISPR-Cas9 system," Nat
Methods, 2013. 10(8): pp. 741-43.
Hwang et al , "Efficient genome editing in zebrafish using a CRISPR-Cas system," Nat
Biotechnol, 2013, 31 :227-29.
Jiang et al , "RNA-guided editing of bacterial genomes using CRISPR-Cas systems," Nat
Biotechnol, 2013, 31 :233-39.
Jinek et al. , "A programmable dual -RNA-guided DNA endonuclease in adaptive bacterial
immunity," Science, 2012. 337(6096): p. 816-21.
Jinek et al , "RNA-programmed genome editing in human cells," elife, 2013. 2: p. e00471.
Kleinstiver et al. , "High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off- target effects," Nature 2016 529:490-95.
Li et al. , "Precise correction of the dystrophin gene in duchenne muscular dystrophy patient induced pluripotent stem cells by TALEN and CrISPR-Cas9," Stem Cell Reports 4, 143- 54, 2015.
Mali et al , "CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering," Nature Biotechnology 31, 833-838 (2013).
Makarova et al , Nature Reviews, Microbiology, Vol. 9, June 201 1, pp. 467-477.
Pant & Lozano, "Limiting the power of p53 through the ubiquitin proteasome pathway," Genes Dev. 28, 1739-51, 2014.
Robinton & Daley, "The promise of induced pluripotent stem cells in research and therapy," Nature 481, 295-305, 2012.
Shui et al. , "The Rise of CRISPR/Cas for Genome Editing in Stem Cells," Stem Cells
International Volume 2016, Article ID 8140168, 17 pages.
Takahashi et al. , "Induction of pluripotent stem cells from adult human fibroblasts by defined factors," Cell 131, 861-72, 2007.
Thermes et al , "I-Scel meganuclease mediates highly efficient transgenesis in fish," Mech. Dev.
2002 Oct; 1 18(l-2):91-98.
Tsvetkov et al., "Ubiquitin-independent p53 proteasomal degradation," Cell Death Differ. 17,
103-08, 2010.
Yin et al , "Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype.," Nat Biotechnol, 2014. 32(6): p. 551-53.
Yu et al, "Induced pluripotent stem cell lines derived from human somatic cells," Science 318, 1917-20, 2007.
Claims
1. An expression construct encoding a Cas9 nuclease and Bcl-2.
2. The expression construct of claim 1, which further encodes a single guide R A (sgR A) complementary to a target nucleic acid sequence.
3. The expression construct of claim 1, which further encloses a plurality of sgRNAs complementary to a plurality of target nucleic acid sequences.
4. A genetically modified stem cell comprising the expression construct of any of claims
1-3.
5. A genetically modified stem cell, comprising:
(a) an expression construct encoding a programmable DNA nuclease or a meganuclease; and
(b) an anti-apoptosis component selected from the group consisting of:
(i) an expression construct encoding an anti-apoptosis protein selected from the group consisting of a dominant negative mutant of p53 (DNp53), a mouse double minute 2 homolog (MDM2), a p53 -induced protein with a RING (Really Interesting New Gene)-H2 domain (Pirh2, RCHY1), a constitutively photo-morphogenic 1 (COP 1), an ARF (Alternative Reading Frame) Binding Protein 1 (ARF-BP 1, HUWE1), a B cell lymphoma 2 protein (Bcl-2), Bcl-2- related protein A (Bcl2Al), a B-cell lymphoma-extra large protein (BC1-XL), a myeloid cell leukemia 1 protein (Mcl-1), a B cell lymphoma 2-like protein 2 (Bcl- w), and a Bcl-2-like protein 10 (Bcl-B);
(ii) an oligonucleotide inhibitor of p53; and
(iii) a Bax channel blocker.
6. The genetically modified stem cell of claim 4 or claim 5, wherein the programmable DNA nuclease is selected from the group consisting of (1) a class 2 clustered regularly-
interspaced short palindromic repeat (CRISPR) nuclease, (2) a zinc finger nuclease (ZFN), (3) a Transcription Activator-Like Effector nuclease (TALEN), and (4) a meganuclease.
7. The genetically modified stem cell of claim 6, wherein the programmable DNA nuclease is a CRISPR nuclease, wherein the CRISPR nuclease is selected from the group consisting of a CRISPR associated protein 9 (Cas9) nuclease, a CRISPR from Prevotella and Francisella 1 nuclease (Cpfl), a Class 2 candidate 1 nuclease (C2cl), a Class 2 candidate 2 nuclease (C2c2), and a Class 2 candidate 3 nuclease (C2c3).
8. The genetically modified stem cell of claim 7, wherein the CRISPR nuclease is the Cas9 nuclease, wherein the Cas9 nuclease has wild-type enzymatic activity, is a nickase, or is a nuclease-null Cas9 fused to a nuclease domain.
9. The genetically modified stem cell of claim 8, wherein the programmable DNA nuclease is a CRISPR enzyme and wherein the expression construct encoding the CRISPR enzyme and a nucleic acid encoding the first sgRNA are present in a single expression construct.
10. The genetically modified stem cell of claim 8, wherein the programmable DNA nuclease is a CRISPR enzyme and wherein the expression construct encoding the CRISPR enzyme and a nucleic acid encoding the first sgRNA are present in separate expression constructs.
11. The genetically modified stem cell of any of claims 4-10, further comprising a first single guide RNA (sgRNA) complementary to a first target nucleic acid sequence of the stem cell genome.
12. The genetically modified stem cell of any of claims 4-10, further comprising a plurality of sgRNAs, wherein each of the plurality of sgRNAs is complementary to a target nucleic acid sequence of the stem cell genome.
13. The genetically modified stem cell of any of claims 1-12, which is in vitro.
14. The genetically modified stem cell of any of claims 1-12, which is in vivo.
15. The genetically modified stem cell of any of claims 4-14, which is an embryonic stem cell (ESC).
16. The genetically modified stem cell of any of claims 4-14, which is a somatic stem cell.
17. The genetically modified stem cell of claim 16, selected from the group consisting of an inducible pluripotent stem cell (iPSC), a hematopoietic stem cell, a neural stem cell, and a mesenchymal stem cell.
18. The genetically modified stem cell of any of claims 4-17, which is a human stem cell.
19. A population of genetically modified stem cells according to any of claims 4- 18.
20. A method of making a genetically modified stem cell, comprising providing to a stem cell:
(a) the expression construct of any of claims 1-3;
(b) an expression construct encoding an anti-apoptosis protein selected from the group consisting of a dominant negative mutant of p53 (DN p53), a mouse double minute 2 homolog (MDM2), a p53-induced protein with a RING (Really Interesting New Gene)- H2 domain (Pirh2, RCHY1), a constitutive ly photo-morphogenic 1 (COP1), an ARF (Alternative Reading Frame) Binding Protein 1 (ARF-BP 1, HUWE1), Bcl-2, Bcl2A l, Bel -XL, Mcl-1, Bcl-w, and Bcl-B, wherein the stem cell comprises an expression construct encoding a programmable DNA nuclease;
(c) an RNA inhibitor of p53, wherein the stem cell comprises an expression construct encoding a programmable DNA nuclease;
(d) an expression construct encoding a programmable DNA nuclease and an expression construct encoding an anti-apoptosis protein selected from the group consisting of a dominant negative mutant of p53 (DN p53), a mouse double minute 2
homolog (MDM2), a p53 -induced protein with a RING (Really Interesting New Gene)- H2 domain (Pirh2, RCHY1), a constitutive ly photo-morphogenic 1 (COP1), an ARF (Alternative Reading Frame) Binding Protein 1 (ARF-BP 1, HUWE1), Bcl-2, Bcl2Al, Bcl-XL, Mcl- 1, Bcl-w, and Bcl-B;
(e) an expression construct encoding a programmable DNA nuclease and an RNA inhibitor of p53;
(f) an oligonucleotide inhibitor of p53, wherein the stem cell comprises an expression construct encoding a programmable DNA nuclease;
(g) an oligonucleotide inhibitor of p53 and an expression construct encoding a programmable DNA nuclease;
(h) a Bax channel inhibitor, wherein the stem cell comprises an expression construct encoding a programmable DNA nuclease; or
(i) a Bax channel inhibitor and an expression construct encoding a programmable DNA nuclease.
21. A method of altering a target nucleic acid sequence of a stem cell, comprising providing the stem cell of any of claims 4-8 with a first single guide RNA (sgRNA) complementary to a first target nucleic acid sequence of the stem cell genome.
22. The method of claim 20 or 21, further comprising contacting the stem cell with a caspase inhibitor.
23. The method of any of claims 20-22, further comprising contacting the stem cell with a p38 MAP kinase inhibitor.
24. The method of any of claims 20-23, wherein the stem cell is an embryonic stem cell
(ESC).
25. The method of any of claims 20-23, wherein the stem cell is a somatic stem cell.
26. The method of claim 25, wherein the somatic stem cell is selected from the group consisting of an inducible pluripotent stem cell, a hematopoietic stem cell, a neural stem cell, and a mesenchymal stem cell.
27. The method of any of claims 20-26, wherein the stem cell is a human stem cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16/094,011 US11459586B2 (en) | 2016-04-19 | 2017-04-19 | Methods for increasing efficiency of nuclease-mediated gene editing in stem cells |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662324485P | 2016-04-19 | 2016-04-19 | |
| US62/324,485 | 2016-04-19 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017184674A1 true WO2017184674A1 (en) | 2017-10-26 |
Family
ID=60116332
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/028266 Ceased WO2017184674A1 (en) | 2016-04-19 | 2017-04-19 | Methods for increasing efficiency of nuclease-mediated gene editing in stem cells |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US11459586B2 (en) |
| WO (1) | WO2017184674A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018083606A1 (en) * | 2016-11-01 | 2018-05-11 | Novartis Ag | Methods and compositions for enhancing gene editing |
| CN110678553A (en) * | 2018-08-21 | 2020-01-10 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | Methods for genome editing in mammalian stem cells |
| CN110904032A (en) * | 2019-11-18 | 2020-03-24 | 中国人民解放军军事科学院军事医学研究院 | Methods for improving lentiviral transfection of human pluripotent stem cells |
| WO2020158972A1 (en) * | 2019-01-29 | 2020-08-06 | (주)넥셀 | Method for producing in vitro wilson's disease model using human pluripotent stem cells, and in vitro wilson's disease model produced through same |
| GB202101107D0 (en) | 2021-01-27 | 2021-03-10 | Oxford Genetics Ltd | Method of genome editing |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB201608944D0 (en) * | 2016-05-20 | 2016-07-06 | Ospedale San Raffaele And Fond Telethon | Gene Tharapy |
| CN112979823B (en) * | 2019-12-18 | 2022-04-08 | 华东师范大学 | Product and fusion protein for treating and/or preventing beta-hemoglobinopathy |
| CN114958767B (en) * | 2022-06-02 | 2022-12-27 | 健颐生物科技发展(山东)有限公司 | Preparation method of neural stem cell preparation constructed based on hiPSC cells |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3294343A4 (en) * | 2015-05-13 | 2018-09-26 | Seattle Children's Hospital, dba Seattle Children's Research Institute | Enhancing endonuclease based gene editing in primary cells |
-
2017
- 2017-04-19 WO PCT/US2017/028266 patent/WO2017184674A1/en not_active Ceased
- 2017-04-19 US US16/094,011 patent/US11459586B2/en active Active
Non-Patent Citations (2)
| Title |
|---|
| KAWAMURA ET AL.: "Linking the p53 tumor suppressor pathway to somatic cell reprogramming", NATURE, vol. 460, no. 7259, 2009, pages 1140 - 1144, XP002639994 * |
| ZHANG ET AL.: "CRISPR/Cas9-Mediated Genome Editing in Human Pluripotent Stem Cells", SPRINGER BRIEFS IN STEM CELLS, VOLUME 6 : HEMATOPOIETIC DIFFERENTIATION OF HUMAN PLURIPOTEN T . STEM CELLS, 2015, pages 103 - 116 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018083606A1 (en) * | 2016-11-01 | 2018-05-11 | Novartis Ag | Methods and compositions for enhancing gene editing |
| CN110678553A (en) * | 2018-08-21 | 2020-01-10 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | Methods for genome editing in mammalian stem cells |
| CN110678553B (en) * | 2018-08-21 | 2023-08-11 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | Methods for Genome Editing in Mammalian Stem Cells |
| WO2020158972A1 (en) * | 2019-01-29 | 2020-08-06 | (주)넥셀 | Method for producing in vitro wilson's disease model using human pluripotent stem cells, and in vitro wilson's disease model produced through same |
| CN110904032A (en) * | 2019-11-18 | 2020-03-24 | 中国人民解放军军事科学院军事医学研究院 | Methods for improving lentiviral transfection of human pluripotent stem cells |
| GB202101107D0 (en) | 2021-01-27 | 2021-03-10 | Oxford Genetics Ltd | Method of genome editing |
| WO2022162353A1 (en) | 2021-01-27 | 2022-08-04 | Oxford Genetics Limited | Method of reducing the tumorigenic potential of a population of mammalian stem cells after genome editing |
Also Published As
| Publication number | Publication date |
|---|---|
| US20190127762A1 (en) | 2019-05-02 |
| US11459586B2 (en) | 2022-10-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11459586B2 (en) | Methods for increasing efficiency of nuclease-mediated gene editing in stem cells | |
| US12227758B2 (en) | Somatic haploid human cell line | |
| CN110300803B (en) | Methods for improving efficiency of Homology Directed Repair (HDR) in cellular genomes | |
| AU2014293015B2 (en) | Genome engineering | |
| JP2021048882A (en) | Rna-guided human genome engineering | |
| Betermier et al. | Programmed rearrangement in ciliates: Paramecium | |
| CN106893739A (en) | New methods and systems for targeted genetic manipulation | |
| WO2015040075A1 (en) | Genomic screening methods using rna-guided endonucleases | |
| JP2017536811A (en) | Methods and compositions for establishing or maintaining pluripotent cells | |
| Byrne et al. | Crispr‐mediated gene targeting of human induced pluripotent stem cells | |
| JP2015500637A (en) | Haploid cells | |
| Georges et al. | Acute deletion of TET enzymes results in aneuploidy in mouse embryonic stem cells through decreased expression of Khdc3 | |
| WO2020037490A1 (en) | Method of genome editing in mammalian stem cell | |
| EP3408376B1 (en) | Autosomal-identical pluripotent stem cell populations having non-identical sex chromosomal composition and uses thereof | |
| Forsén et al. | Creating isogenic iPSC-based in vitro models for ASH1L-linked intellectual disability | |
| Chammas | Role of PRC2-associated factor EPOP in mouse embryonic stem cells differentiation and early development | |
| Ono et al. | Akihiro Kagita, Mandy SY Lung, Huaigeng Xu, Yuto Kita, Noriko Sasakawa, Takahiro Iguchi | |
| Nakhuda et al. | STEM CELLS AND REGENERATION RESEARCH ARTICLE NANOGP1, a tandem duplicate of NANOG, exhibits partial functional conservation in human naïve pluripotent stem cells Katsiaryna Maskalenka1,*, Gökberk Alagöz2,*, Felix Krueger3, Joshua Wright1, Maria Rostovskaya1 | |
| NZ754904A (en) | Genome engineering | |
| NZ754904B2 (en) | Genome engineering | |
| NZ754903B2 (en) | Genome engineering |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17786514 Country of ref document: EP Kind code of ref document: A1 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 17786514 Country of ref document: EP Kind code of ref document: A1 |
