CN110678553B - Method for genome editing in mammalian stem cells - Google Patents

Abstract

The present invention provides a method of editing genomic DNA of interest in mammalian stem cells. The method comprises the following steps: introducing an apoptosis-regulating factor and a genome editing composition into a mammalian stem cell, generating a modified mammalian stem cell that overexpresses the apoptosis-regulating factor, wherein the apoptosis-regulating factor is BCL-XL, wherein the genome editing composition is a genome editing endonuclease that cleaves within a desired target sequence of genomic DNA of the mammalian stem cell, and edits the target genomic DNA.

Description

Method for genome editing in mammalian stem cells

Technical Field

The present invention relates to a method for genome editing in mammalian stem cells.

Background

Human Embryonic Stem Cells (ESCs) can provide an adequate source of cells for regenerative medicine due to their unlimited self-renewal capacity, but are derived from blastocysts, which presents ethical problems. The discovery of patient-specific induced pluripotent stem cells (ipscs) solves the immunogenicity and ethics problems associated with allogeneic cell transplantation. Recently, there has been great progress in generating ipscs from readily available cell sources such as peripheral blood using non-integrative vectors expressing reprogramming factors. However, to achieve the potential of ipscs in regenerative medicine and disease modeling, correction or modification of pathogenic genes is often required prior to treatment. Although these methods are versatile, they often result in the integration of the entire donor plasmid and may induce mutant ligation by erroneous NHEJ, thereby limiting the application prospects, and thus, research into new methods for efficient and accurate gene knock-in is currently an important topic.

Gene targeting in mouse ESC has been achieved for decades, despite the extremely low efficiency. Further research has led to the recognition that early achievements have inadvertently employed the inherent repair mechanisms of cells following DNA fragmentation. However, naturally occurring double-stranded DNA breaks (DSBs) around the targeted loci are extremely rare, and therefore, targeting efficiency is often limited to the level of parts per million even with homology arms of 10 kilobase pairs in length. In order to enhance gene targeting, efforts have been made over the last two decades to create DSBs at specific loci by targetable endoproteases. While the development of engineered endonucleases such as Zinc Finger Nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) has attracted interest, their limitations in design or cloning have made them impossible for use in routine laboratories. The latest generation of RNA-guided endonucleases or CRISPR-Cas9 are widely used due to the simple carrier design and stable performance. CRISPR-Cas9 is an adaptive immune system evolved in bacteria and archaea to recognize and destroy phage or plasmid invading agents. Commonly used Cas9 is from streptococcus pyogenes (Sp).

After creation of double-stranded DNA breaks (DSBs), cellular mechanisms repair the damage mainly through two pathways: non-homologous end joining (NHEJ) and Homology Directed Repair (HDR). In the absence of a template, the NHEJ pathway is utilized to enter variable insertions or deletions (indels) at the DSB site, which may disrupt the open reading frame of the gene and create a knock-out (KO) phenotype. The editing method is high in efficiency and is widely used in animal modeling, disease modeling and functional genome research. In the presence of donor templates flanking Homology Arms (HA), the HDR pathway can be used to integrate sequences between HAs to form precise DNA deletions, substitutions or insertions, to correct diseased genes or targeted integrated genes of interest. Unfortunately, HDR-mediated gene knock-in is generally less efficient.

The inefficiency of human PSC editing is mainly due to the low survival rate following experimental procedures. In contrast to mouse PSCs, the isolation of human PSCs into single cell suspensions typically causes massive cell death. The use of ROCK inhibitors can significantly increase cloning efficiency by preventing anoikis, i.e., apoptosis by segregation. However, this can only solve one problem. To accurately edit PSCs, CRISPR components, i.e., cas9 and sgrnas, are delivered into cells along with a DNA donor template. The most effective carrier delivery means is electroporation or its modified nuclear transfection, but this causes cell death.

Since massive cell death remains a major obstacle to genome editing in iPSC during or after nuclear transfection of plasmid vectors, it is currently the main topic to study new methods for genome editing in pluripotent stem cells.

Disclosure of Invention

The present invention provides a method for performing efficient, accurate gene editing.

In one embodiment, disclosed herein is a method of editing genomic DNA of interest in mammalian stem cells. The method comprises introducing an apoptosis-regulating factor and a genomic editing composition into a mammalian stem cell, generating a modified mammalian stem cell that overexpresses the apoptosis-regulating factor, wherein the apoptosis-regulating factor is BCL-XL, wherein the genomic editing composition is a genomic endonuclease that cleaves within a desired target sequence of genomic DNA of the mammalian stem cell, and editing the target genomic DNA.

In some embodiments, the BCL-XL comprises an amino acid sequence which has at least 70% amino acid sequence identity to the amino acid sequence of SEQ ID NO. 1.

In some embodiments, introducing the apoptosis-regulating factor and the genome editing composition into the mammalian stem cell comprises: introducing the apoptosis-regulating factor into the mammalian stem cell, generating the modified mammalian stem cell over-expressing the apoptosis-regulating factor; and introducing the genome editing composition into the modified mammalian stem cell.

In some embodiments, the genome editing composition can include an RNA-guided endonuclease and a guide RNA.

In some embodiments, the RNA-guided endonuclease can be Cas9.

In some embodiments, the guide RNAs may include clustered regularly interspaced short palindromic repeat RNAs and tracrRNA.

In some embodiments, the genome editing composition can comprise a donor plasmid comprising a donor sequence, wherein the donor sequence is inserted into the genome at an insertion site by homology directed repair.

In some embodiments, the mammalian stem cells may include embryonic stem cells or pluripotent stem cells.

In some embodiments, the mammalian stem cells may be induced pluripotent stem cells.

In some embodiments, the method may further comprise introducing a BCL-inhibiting factor into the cell.

In some embodiments, the BCL inhibitory factor may be ABT-263.

In some embodiments, the BCL XL is stably expressed.

In certain embodiments, the BCL XL is transiently over-expressed.

In some embodiments, the BCL XL is overexpressed for about 1 hour to about 72 hours.

In some embodiments, the BCL XL is over-expressed at least 5-fold over background.

Drawings

FIG. 1 shows a protocol design for stable overexpression of BCL-CL in human iPSC.

Fig. 2 is a schematic diagram of HDR editing at PRDM 14.

FIG. 3 shows flow cytometry analysis of the iPSC-Lenti-BCL-XL and iPSC-Lenti-control lines after CRISPR plasmid co-transfection.

FIG. 4 shows a protocol design for transient BCL-CL overexpression in human iPSC.

FIG. 5 shows flow cytometry analysis of transient BCL-XL over-expression and control groups.

Fig. 6 is a schematic diagram of HDR editing at CTNNB 1.

Fig. 7 is a schematic diagram of HDR editing at OCT 4.

Fig. 8 shows flow cytometry analysis indicating KI efficiency at CTNNB1 and OCT4 in iPSC.

FIG. 9 is a schematic representation of NHEJ mediated gene knockout at CD 326.

FIG. 10 is a schematic representation of NHEJ mediated gene knockout at CD 9.

Fig. 11 shows flow cytometry analysis indicating KO efficiencies at CD326 and CD9 in ipscs.

FIG. 12 shows the dynamic change in relative cell numbers after electroporation with genome editing plasmids with or without BCL-XL.

FIG. 13 shows flow cytometry analysis of iPSCs that bind BCL-XL, BCL2, or MCL 1.

Fig. 14 shows the expression levels of Cas9 and sgrnas.

Fig. 15 shows the effect of BAX gene knockout on iPSC cell survival and editing efficiency.

Figure 16 shows the effect of BBC3 gene knockout on iPSC cell survival and editing efficiency.

Figure 17 shows the effect of different basal doses and courses of ABT-263 on cell viability of ipscs after electroporation.

Figure 18 shows the effect of different basal doses and courses of ABT-263 on HDR efficiency of iPSC after electroporation.

FIG. 19 shows the effect of ABT-263 on iPSC cell viability and editing efficiency.

Fig. 20 is a schematic of HDR mediated dual KI at PRDM14 and CTNNB1 in iPSC.

FIG. 21 shows a flow cytometry analysis indicating KI efficiency at CTNNB1 in an iPSC.

Fig. 22 is a schematic diagram of dual editing at PRDM14 by HDR and at CD326 by NHEJ.

Fig. 23 shows a flow cytometry analysis indicating KO efficiency at CD326 in iPSC.

Figure 24 is a schematic of gene knockout by allelic HDR insertion of the cassette.

Fig. 25 shows a flow cytometry analysis indicating KO efficiency at CD326 in iPSC.

FIG. 26 shows the effect of transient BCL-XL, BCL2 or MCL1 overexpression on HDR efficiency in mouse ES cells.

FIG. 27 shows the effect of transient BCL-XL, BCL2 or MCL1 overexpression in K562 cells on HDR efficiency.

FIG. 28 shows the effect of transient BCL-XL, BCL2 or MCL1 overexpression on HDR efficiency in mouse 193T cells.

FIG. 29 shows the effect of transient BCL-XL, BCL2 or MCL1 overexpression on HDR efficiency in mouse Jurkat cells.

Detailed Description

The present application provides a novel genome editing method that is significantly more efficient than conventional genome editing methods employing RNA-guided endonucleases such as CRISPR/Cas 9. The method of the application adopts apoptosis regulator BCL-XL. By over-expressing BCL-XL during iPSC transfection, the survival of iPSC can be improved after electroporation, and also the HDR KI and KO efficiencies can be improved. The improved genome editing system provides a useful tool for applications ranging from manipulating the human iPSC genome to creating genetically modified animal models.

The terms "nucleic acid", "polynucleic acid" and "oligonucleotide" are used interchangeably and refer to polymers of deoxyribonucleic acid or ribonucleotides in linear or circular conformation and in single-or double-stranded form. For the purposes of the present application, these terms should not be construed as limiting the length of the polymer. The term may include known natural nucleotide analogs as well as nucleotides that are modified at the base, sugar, and/or hydrochloride moiety (e.g., phosphorothioate backbone). In general, specific nucleotide analogs have the same base pairing specificity; that is, an analog of A will base pair with T.

The terms "polypeptide", "peptide" and "protein" are used interchangeably to refer to a polymer having amino acid residues. The term may also apply to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of the corresponding naturally occurring amino acids.

The term "sequence" refers to a nucleotide sequence of any length, which may be DNA or RNA; may be linear, circular or branched, and may be single-stranded or double-stranded.

The term "homologous nucleic acid" as used herein encompasses nucleic acid sequences that are identical or similar to a known reference sequence. In one embodiment, the term "homologous nucleic acid" is used to characterize a sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or even 100% identical to a known reference sequence.

The term "Homology Directed Repair (HDR)" refers to a particular form of DNA repair, for example, that occurs during repair of an intracellular double strand break. This process requires homology of the nucleotide sequence, template repair of the "target" molecule (i.e., the molecule that undergoes a double strand break) using the "donor" molecule, and transfer of genetic information from the donor to the target. If the donor nucleotide is different from the target molecule and part or all of the sequence of the donor nucleotide is contained in the target DNA, homology directed repair may result in a change (e.g., an insertion, a deletion, a mutation) in the sequence of the target molecule.

The term "non-homologous end joining (NHEJ)" refers to repair of a double-stranded break in DNA by directly joining the break end to another break end, without the need for a homology template (unlike homology-directed repair, which requires a homology sequence to direct repair). NHEJ typically results in the loss (deletion) of nucleotide sequence near the double strand break site.

In this context, the term "stem cell" is used to refer to a cell (e.g., plant stem cell, vertebrate stem cell) that has the ability to self-renew and produce a differentiated cell type. In the context of the occurrence of cellular individuals, the adjective "differentiated" or "differentiated" is a relative term. A "differentiated cell" is a cell that progresses farther during development than a cell to which it is compared.

In this context, the term "pluripotent stem cell" or "PSC" is used to mean a stem cell capable of producing all organism cell types. Thus, PSCs can produce cells of all the germ layers of organisms (e.g., endoderm, mesoderm, and ectoderm of vertebrates). Pluripotent cells are capable of forming teratomas and are beneficial to endodermal, mesodermal and ectodermal tissues in living organisms. The pluripotent stem cells of a plant are capable of producing all cell types of the plant (e.g., cells of roots, stems, leaves, etc.). Since the term PSC refers to pluripotent stem cells, regardless of their origin, the term PSC includes the terms ESC and iPSC, as well as the term Embryonic Germ Stem Cells (EGSCs), which are another example of PSCs. PSCs can be in the form of established cell lines, which can be obtained directly from the original embryonic tissue or from somatic cells. PSCs can be target cells for the methods described herein.

The term "induced pluripotent stem cell" or "iPSC" refers to a PSC derived from a cell that is not a PSC (i.e., derived from a cell that is differentiated relative to a PSC). ipscs can be derived from a variety of different cell types, including terminally differentiated cells. iPSC has ES cell-like morphology, grows as flat colonies, has large nuclear-to-cytoplasmic ratio, and has clear boundaries and remarkable nuclei.

The term "donor sequence" as used herein refers to a nucleic acid to be inserted into the chromosome of a host donor sequence. The donor sequence may be any length, for example, from 2 to 10,000 nucleotides in length (or any integer value therebetween or above).

Reference herein to "about" a value or parameter includes (and describes) a variation for that value or parameter itself. For example, a description of "about X" includes a description of "X".

As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

The compositions and methods of the present invention can comprise, consist of, or consist essentially of the essential elements and limitations of the invention described herein, as well as any of the additional or optional ingredients, components, or limitations described herein or for nutritional or pharmaceutical use.

The present invention provides a method for genome editing in mammalian stem cells. The method comprises modifying a mammalian stem cell by overexpressing an apoptosis-modulating factor and introducing a genome editing composition into the mammalian stem cell. Genome editing includes NHEJ and HDR. The genome editing endonuclease may create a single or double strand break in the genomic DNA of interest, which is repaired. Repair by NHEJ is sometimes referred to as "indel" (insertion or deletion); DNA repair by HDR is sometimes referred to as "genetic modification" or "genetic modification". In some cases, editing the genomic DNA of interest includes replacing one or more nucleotides in the genomic DNA of interest, thereby generating the edited genomic DNA of interest. In some cases, editing the genomic DNA of interest includes deleting one or more nucleotides from the genomic DNA of interest, thereby generating edited genomic DNA of interest. In some cases, editing the genomic DNA of interest includes inserting one or more nucleotides from the genomic DNA of interest, thereby generating the edited genomic DNA of interest.

In some embodiments, the method comprises introducing an apoptosis-regulating factor and a genomic editing composition into a mammalian stem cell, generating a modified mammalian stem cell that overexpresses the apoptosis-regulating factor, wherein the apoptosis-regulating factor is BCL-XL, wherein the genomic editing composition is a genomic editing endonuclease that cleaves within a desired target sequence of genomic DNA of the mammalian stem cell, and edits the target genomic DNA. BCL-XL encoded by BCL 2-like 1 (BCL 1L 1) gene maintains the integrity of the mitochondrial outer membrane, thereby preventing release of mitochondrial contents such as cytochrome c, apoptosis activating factor, etc.

In some embodiments, BCL-XL comprises an amino acid sequence which is at least 70%, at least 90%, at least 95%, at least 98%, at least 99% or at least 100% amino acid sequence identical to the amino acid sequence of SEQ ID NO. 1.

In some embodiments, the mammalian stem cells described herein may be embryonic stem cells or pluripotent stem cells. In some embodiments, the mammalian stem cells may be induced pluripotent stem cells. In some embodiments, the mammalian stem cells may be human-induced pluripotent stem cells.

Overexpression of BCL-XL in mammalian stem cells can be achieved using known methods. In some cases, BCL-XL is introduced into mammalian stem cells in the form of a protein. In some cases, BCL-XL is introduced into mammalian stem cells in the form of a nucleic acid, such as messenger RNA (mRNA) or cDNA. The nucleic acid may be delivered as part of a larger construct, such as a plasmid or viral vector, or directly by electroporation, lipid vesicles, viral transporters, and microinjection, for example. In some embodiments, BCL-XL can be introduced into cells by a variety of means known in the art including transfection, calcium phosphate-DNA co-precipitation, DEAE-dextran mediated transfection, polybrene-mediated transfection, electroporation, microinjection, transduction, cell fusion, liposome fusion, lipofection, protoplast fusion, retroviral infection, use of a gene gun, use of DNA carrier transporter, and biolistic (e.g., particle bombardment). In some embodiments, the nucleotide sequence encoding BCL-XL is operably linked to a transcriptional control element such as a promoter, wherein the promoter is active in mammalian stem cells. In some cases, the promoter is a constitutive promoter. In this case, BCL XL expression is stable. In some cases, the promoter is an inducible promoter. In some embodiments, the nucleotide sequence encoding BCL-XL is introduced into a mammalian stem cell and then reinserted into the genome of the mammalian stem cell.

In some embodiments, the genome editing composition and BCL-XL are introduced into the cell simultaneously. In some embodiments, BCL-XL can be introduced into the cell first and then the genome editing composition. In some embodiments, introducing the apoptosis-regulating factor (e.g., BCL-XL) and the genome editing composition into mammalian stem cells comprises the following steps. First, an apoptosis-regulating factor (e.g., BCL-XL) is introduced into mammalian stem cells, resulting in modified mammalian stem cells that overexpress the apoptosis-regulating factor. The genome editing composition is then introduced into the modified mammalian stem cells.

In some embodiments, BCL-XL is constitutively overexpressed in the cell. In some embodiments, BCL-XL is transiently over-expressed. For example, in certain instances, BCL-XL is over-expressed for about 1 hour to about 72 hours, about 4 hours to about 8 hours, about 8 hours to about 12 hours, about 12 hours to about 16 hours, about 16 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, or about 42 hours to about 48 hours. In some cases, BCL-XL is overexpressed for about 12 hours to about 48 hours. In some cases, BCL-XL is overexpressed for about 12 hours to about 24 hours.

In some embodiments, BCL-XL is introduced into the cells such that the level of BCL-XL in the cells is at least 2-fold, or greater than 2-fold, the background level of BCL-XL in the control (unmodified) cells. For example, in some cases, BCL-XL is introduced into the cells such that the content of BCL-XL in the cells is 2-to 10-fold or 5-to 10-fold higher than the background content of BCL-XL in control (unmodified) cells.

Overexpression of BCL-XL in mammalian stem cells can result in modified mammalian stem cells. Thus, the genome editing composition can be introduced into mammalian stem cells during the time that BCL-XL is over-expressed.

In some embodiments, the overexpression of BCL-XL in the mammalian stem cells when the mammalian stem cells are contacted with the genome editing composition increases the viability of the mammalian stem cells by at least 5-fold, at least 10-fold, at least 20-fold, or more than 20-fold over the viability of control stem cells that do not overexpress BCL-XL and are contacted with the genome editing composition. For example, in certain instances, overexpression of BCL-XL in mammalian stem cells when contacted with the genome editing composition increases survival of mammalian stem cells by a factor of 10-20 over survival of control stem cells that do not overexpress BCL-XL and are contacted with the genome editing composition.

In some embodiments, overexpression of BCL-XL in a mammalian stem cell increases HDR-mediated KI (gene knock-in) efficiency by at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, or more than 100-fold over survival of a control stem cell that does not overexpress BCL-XL and is contacted with the genome editing composition when the mammalian stem cell is contacted with the genome editing composition. For example, in certain instances, when mammalian stem cells are contacted with the genome editing composition, overexpression of BCL-XL in mammalian stem cells increases HDR-mediated KI (gene knock-in) efficiency by a factor of 20-100 over survival of control stem cells that do not overexpress BCL-XL and are contacted with the genome editing composition.

In some embodiments, overexpression of BCL-XL in mammalian stem cells increases NHEJ-mediated KO (gene knockout) efficiency by at least 1-fold, at least 2-fold, at least 5-fold, or more than 5-fold over survival of control stem cells that do not overexpress BCL-XL and are contacted with the genome editing composition when the mammalian stem cells are contacted with the genome editing composition. For example, in certain instances, when mammalian stem cells are contacted with a genome editing composition, overexpression of BCL-XL in mammalian stem cells increases NHEJ-mediated KO (gene knockout) efficiency by 1-to 5-fold over survival of control stem cells that do not overexpress BCL-XL and are contacted with the genome editing composition. Thus, when the mammalian stem cells overexpress BCL-XL, the genome editing efficiency of the mammalian stem cells increases.

In some embodiments, the genome editing composition comprises an RNA-guided endonuclease and a guide RNA.

In some embodiments, the RNA-guided endonuclease is introduced into the eukaryotic cell in the form of a protein or in the form of a nucleic acid that edits the RNA-guided endonuclease, such as messenger RNA (mRNA) or cDNA. Nucleic acids may be delivered as part of a larger construct, such as a plasmid or viral vector, or directly by electroporation, lipid vesicles, viral transporters, and microinjection, for example. RNA-mediated endonucleases can be introduced into cells by a variety of means known in the art including transfection, calcium phosphate-DNA co-precipitation, DEAE-dextran mediated transfection, polybrene-mediated transfection, electroporation, microinjection, transduction, cell fusion, liposome fusion, lipofection, protoplast fusion, retroviral infection, use of gene guns, use of DNA carrier transporters and biolistics (e.g., particle bombardment).

In some embodiments, nucleic acids encoding RNA-guided endonucleases can be introduced into cells by transfection (including, for example, transfection by electroporation). In some embodiments, the nucleic acid encoding the RNA-guided endonuclease can be introduced into the cell by injection.

In some embodiments, for example, guide RNAs (grnas) may be introduced as RNAs or as plasmids or other nucleic acid vectors that edit the guide RNAs. The RNA-guided endonuclease binds to the gRNA and the target DNA linked thereto and cleaves the chromosome at a designed specific site. For example, guide RNAs (grnas) can be introduced into cells by various means known in the art including transfection, calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, transduction, cell fusion, liposome fusion, lipofection, protoplast fusion, retroviral infection, use of a gene gun, use of DNA carrier transporters and biolistics (e.g., particle bombardment).

In some embodiments, the RNA-guided endonuclease is a sequence-specific nuclease. The term "sequence-specific nuclease" as used herein refers to a protein that recognizes and binds to a polynucleotide at a particular nucleic acid sequence and catalyzes a double strand break within the polynucleotide. In certain embodiments, the RNA-guided endonuclease cleaves the chromosome only once, i.e., in the methods described herein, a single double strand break is introduced at a particular site of design.

Examples of RNA guided endonuclease systems that can be used with the methods and compositions described herein include Cas/CRISPR systems. Cas/CRISPR (clustered regularly interspaced short palindromic repeats) systems employ RNA-guided DNA binding and sequence-specific cleavage of target DNA. Guide RNAs (grnas) contain approximately 20-25 (e.g., 20) nucleotides complementary to the target genomic DNA sequence and constant RNA scaffold region upstream of the genomic PAM (protospacer) site. In certain embodiments, the target sequence is associated with PAM, which is a short sequence recognized by the CRISPR complex. The exact sequence and length requirements of PAM will vary depending on the CRISPR enzyme used, but PAM is typically a 2-5bp sequence adjacent to the pre-spacer sequence (i.e., the target sequence). Examples of PAM sequences are well known in the art and one skilled in the art will be able to further identify PAM sequences for a given CRISPR enzyme. For example, the target site of Cas9 of streptococcus pyogenes (s.pyogens) with PAM sequence NGG can be identified by searching for 5'-nx-NGG-3' on the input sequence and the reverse complement of the input. In certain embodiments, the genomic PAM site used herein is NGG, NNG, NAG, NGGNG or nniagaaw. In a specific embodiment, s.pyogenes Cas9 (SpCas 9) is used, the corresponding PAM is NGG. In certain aspects, different Cas9 enzymes from different strains employ different PAM sequences. Cas (CRISPR-associated) proteins are linked to gRNA and target DNA linked thereto and introduce double strand breaks at defined positions upstream of the PAM site. In one aspect, the CRISPR/Cas, cas/CRISPR, or CRISPR-Cas systems (these terms are used interchangeably throughout the application) do not require the generation of customized proteins to target specific sequences, but rather the programming of a single Cas enzyme by a short RNA molecule to recognize a specific DNA target, i.e., the recruitment of Cas enzymes into a specific DNA target using a short RNA molecule.

In some embodiments, the RNA-guided endonuclease is a type II Cas protein. In some embodiments, the RNA-guided endonuclease is Cas9, a homolog thereof, or a modified version thereof. In some embodiments, a combination of two or more Cas proteins may be used. In some embodiments, the CRISPR enzyme is Cas9, but can also be Cas9 from s.pyogenes or streptococcus pneumoniae s.pneumoniae. In some embodiments, cas9 is used in the methods described herein. Cas9 contains two independent nuclease domains homologous to HNH and RuvC endonucleases and is capable of cleaving the double strand of DNA under the guidance of gRNA, creating a blunt-ended Double Strand Break (DSB).

In some embodiments, the guide RNA is an RNA comprising a 5 'region comprising at least one repeat sequence from a CRISPR locus and a 3' region complementary to a predetermined insertion site on a chromosome. In certain embodiments, the 5 'region comprises a sequence complementary to a predetermined insertion site on a chromosome and the 3' region comprises at least one repeat sequence from a CRISPR locus. In certain aspects, the 3' region of the guide RNA further comprises a crRNA and/or one or more structural sequences of a tracrRNA. In some embodiments, the guide RNA includes crRNA and tracrRNA, which form a complex by hybridization.

In some embodiments, the genome editing composition further comprises a donor plasmid comprising a donor sequence. Donor plasmids can be introduced into cells by a variety of means known in the art including transfection, calcium phosphate-DNA co-precipitation, DEAE-dextran mediated transfection, polybrene-mediated transfection, electroporation, microinjection, transduction, cell fusion, liposome fusion, lipofection, protoplast fusion, retroviral infection, use of gene guns, use of DNA carrier transporters and biolistics (e.g., particle bombardment).

In some embodiments, the donor sequence is flanked by a 5 'homology arm and a 3' homology arm, wherein the 5 'homology arm is homologous to a 5' target sequence located upstream of an insertion site on the genome and the 3 'homology arm is homologous to a 3' target sequence located downstream of the insertion site on the genome, wherein the donor sequence can be inserted into the genome at the insertion site by homology directed repair.

In some embodiments, insertion of the donor sequence is assessed using any method known in the art. For example, 5 'primers corresponding to sequences located upstream of the 5' homology arm and 3 'primers corresponding to a region in the donor sequence may be designed to assess the 5' ligation of the insert. Similarly, 3 'primers corresponding to sequences located downstream of the 3' homology arm and 5 'primers corresponding to a region in the donor sequence can be designed to assess the 3' ligation of the insert.

In some embodiments, the insertion site may be located at any desired site, so long as the RNA-guided endonuclease is designed to effect cleavage at that site. In some embodiments, the insertion site is located at the target locus. In some embodiments, the insertion site is not a locus.

In some embodiments, the donor nucleic acid is a sequence that is not present in the host cell. In some embodiments, the donor sequence is an endonuclease sequence present at a site other than the predetermined target site. In some embodiments, the donor sequence is a coding sequence. In some embodiments, the donor sequence is a non-coding sequence. In some embodiments, the donor sequence is a mutated locus.

In some embodiments, the donor sequence is about 1bp to about 100kp in size. In certain embodiments, the donor sequence is between about 1bp and about 10bp, between about 10bp and about 50bp, between about 50bp and about 100bp, between about 100bp and about 500bp, between about 500bp and about 1kb, between about 1kb and about 10kb, between about 10kb and about 50kb, between about 50kb and about 100kb, or above about 100 kb.

In some embodiments, the donor sequence is an exogenous gene to be inserted into a chromosome. In some embodiments, the donor sequence is a modified sequence that can replace an exogenous sequence at the site of interest. For example, the donor sequence may be a gene having a desired mutation, and may be used for an exogenous gene present on a replacement chromosome. In some embodiments, the donor sequence is a regulatory element. In some embodiments, the donor sequence is a tag or coding sequence encoding a reporter protein and/or RNA. In some embodiments, the donor sequence is inserted in frame into the coding sequence of a gene of interest that will allow expression of a fusion protein comprising an exogenous sequence fused to the N or C terminus of the protein of interest.

In some embodiments, the donor plasmids described herein are cleaved in a cell to produce linear nucleic acids. The linear nucleic acids described herein comprise a 5 'homology arm, a donor sequence, and a 3' homology arm. In other words, the donor sequence is flanked by a 5 'homology arm and a 3' homology arm.

In some embodiments, the homology arm is at least about 50bp in length, e.g., at least about any one of 50bp, 100bp, 200bp, 300bp, 600bp, 900bp, 1kb, 1.5kb, 2kb, 4kb, 6kb, 10kb, 15kb, and 20kp in length. In some embodiments, the homology arms are at least 300bp in length. In certain embodiments, the homology arms may be about 50bp to about 2000bp, about 100bp to about 2000bp, about 150bp to about 2000bp, about 300bp to about 1500bp, about 300bp to about 1000bp in length. In some embodiments, the length of the 5 'homology arm is the same as the length of the 3' homology arm. In some embodiments, the length of the 5 'homology arm is different from the length of the 3' homology arm.

In some embodiments, the 5 'homology arm is homologous to a 5' target sequence located upstream of an insertion site on the genome, and the 3 'homology arm is homologous to a 3' target sequence located downstream of an insertion site (e.g., DSB) on the genome, allowing for homology directed repair. In some embodiments, the 5 'and/or 3' homology arms may be homologous to a corresponding target sequence that is less than 200bp from the insertion site (e.g., DNA cleavage site). In some embodiments, the 5 'and/or 3' homology arms may be homologous to a target sequence less than 0bp from the DNA cleavage site. In some embodiments, the separation between the 5 'target sequence and the 3' target sequence is less than 200bp.

In some embodiments, cleavage of a donor plasmid (e.g., by an RNA-guided endonuclease that recognizes a cleavage site on the plasmid) within a cell produces a linear nucleic acid as described herein. For example, the donor plasmid may comprise flanking sequences upstream of the 5 'homology arm and downstream of the 3' homology arm. These flanking sequences in some embodiments are not present in the genomic sequence of the host cell, allowing cleavage only on the donor plasmid. The guide RNA recognizes the 5 'flanking sequence and the 3' flanking sequence. RNA-guided endonucleases can then be designed accordingly to effect cleavage at the 5 'flanking sequence and the 3' flanking sequence under the direction of guide RNAs that release linear nucleic acids but do not affect host sequences. The flanking sequences may, for example, be about 20 to about 23bp.

In some embodiments, the method further comprises introducing a BCL-inhibiting factor into the cell. In some embodiments, the BCL-inhibiting factor is introduced into the eukaryotic cell in the form of a protein or in the form of a nucleic acid such as messenger RNA (mRNA) or cDNA encoding the BCL-inhibiting factor. Nucleic acids may be delivered as part of a larger construct, such as a plasmid or viral vector, or directly by electroporation, lipid vesicles, viral transporters, and microinjection, for example. In some embodiments, BCL-inhibiting factors can be introduced into cells by a variety of means known in the art including transfection, calcium phosphate-DNA co-precipitation, DEAE-dextran mediated transfection, polybrene-mediated transfection, electroporation, microinjection, transduction, cell fusion, liposome fusion, lipofection, protoplast fusion, retroviral infection, use of a gene gun, use of DNA carrier transporter, and biolistic (e.g., particle bombardment). In some embodiments, the BCL-inhibiting factor is added directly to the culture medium and then introduced into the cells by contact with cells having the BCL-inhibiting factor. In some embodiments, at least two BCL inhibitory factors are introduced into the cell.

In some embodiments, the apoptosis-regulating factor (e.g., BCL-XL), the genome editing composition, and the BCL inhibitor are introduced into the cell simultaneously. In some embodiments, at least one of the three components is introduced into the cell at a different time than the other components. For example, the BCL-XL is introduced into the cell first, followed by the genomic editing composition and BCL inhibitor. In some embodiments, the BCL-XL is introduced into the cell prior to the BCL inhibitor and the genome editing composition. In some embodiments, all three components are introduced at different points in time from one another. For example, the three components may be applied sequentially in a particular order. In some embodiments, the BCL-XL and genome editing composition are introduced into the cell prior to the BCL inhibitor.

In some embodiments, the BCL-inhibiting factor is introduced into the cell such that the BCL-inhibiting factor content in the cell is at least 20%, at least 50%, at least 75%, at least 1-fold, at least 2-fold, or more than 2-fold greater than the background content of BCL-inhibiting factor in the control cell. For example, in some cases, the BCL-inhibiting factor is introduced into the cell such that the level of BCL-inhibiting factor in the cell is 25% to 50%, 50% to 75%, 75% to 1-fold, or 1-fold to 2-fold higher than the background level of BCL-inhibiting factor in the control cell.

In some embodiments, the BCL-inhibiting factor is added directly to the culture medium and then introduced into the cells by contact with the cells containing the BCL-inhibiting factor. The concentration of BCL inhibitory factor in the medium ranged from 0.5 μm to 1 μm. In some embodiments, the BCL inhibitory factor comprises ABT-263.

The above embodiments will be described in more detail below with reference to examples. However, these examples should not be construed as limiting the scope of the invention in any way.

Example 1: stable BCL-XL overexpression

FIG. 1 shows the design of a scheme for stabilizing BCL-CL overexpression in human iPSC. In this experiment, ipscs were used to examine the effect of stable BCL-XL overexpression on editing efficiency. To achieve this, iPSC-Lenti-BCL-XL cells were established (FIG. 1).

A chronic viral vector containing the BCL-XL sequence between the Puro and Wpre elements (Lenti-EF 1-BCL-XL-E2A-Puro-Wpre) was constructed as follows. Complementary DNA (cDNA) of the puromycin gene (Puro) and BCL-XL was amplified by PCR and purified with KAPA Hifi polymerase (KAPA biosystems) and GeneJET gel extraction kit (Thermo Fisher Scientific), respectively. Fragments of BCL-XL, E2A linker and Puro were inserted using NEBuilder-HiFi-DNA Assembly kit (New England Biolabs) Into a lentiviral vector carrying the EF1 promoter. All constructs were verified by Sanger sequencing (MCLAB). The correct clones were cultured in the CircleGrow medium (MP biomedical) and the DNA plasmid was purified using the endonuclease-free plasmid Maxi kit (Qiagen). Standard calcium phosphate precipitation protocols are used for lentivirus production. Centrifuging at 6000g for 24 hr at 4deg.C, concentrating lentiviral vector 100 times to 2-10X10 ⁷ Biological potency per ml.

iPSC was transduced with lentiviral vector (Lenti-EF 1-BCL-XL-E2A-Puro-Wpre) at low MOI of 0.1-0.2 and stably transduced cells were selected by culturing the cells in mTESR1 medium supplemented with 1 μg/mL puromycin for 1 week. One week after antibiotic selection, an iPSC-BCL-XL cell line expressing BCL-XL was established. As a control, an iPSC-BCL-XL control cell line can also be established by transduction with the anti-puro gene alone.

The effect of stabilizing BCL-XL overexpression was tested by creating a green fluorescent protein reporter line for PDRM 14. Fig. 2 is a schematic diagram of HDR editing at PDRM 14. The following plasmids were constructed: pEF1-Cas9, pU6-sgPRDM14, pD-PRDM 14-E2A-mNaneonGreen-sg and pU6-sgDocut.

All Cas9 plasmas (pEF 1-Cas 9) and sgRNA plasmas (pU 6-sgPRDM14 and pU 6-sgDocut) were constructed with the nebulider HiFi assembly kit (new england biology laboratory). First, PCR products were produced with KAPAHiFi polymerase (KAPA biosystems) and purified with GeneJET gel extraction kit (Thermo Fisher Scientific). Then, the linear PCR products were assembled into plasmids in a DNA assembly reaction (20. Mu.l) on ice according to the manufacturer's instructions. The reaction contained NEBuilder HiFi DNA assembly master mix (10 μl), equal proportions of PCR product and water. The ligation reaction was briefly vortexed and centrifuged prior to incubation at 50℃for 5-30 min. The assembled DNA product was then used to transform NeB-alpha-competent E.coli cells and plated on LB agar plates with ampicillin. Multiple colonies were selected for Sanger sequencing (MCLAB) and correct clones were determined. The sgDocut sequence is GGGTGCGAGATGAACTCA (SEQ ID NO: 2). The sgPRM14 sequence was GAGACTACTAGCTCCTGCC (SEQ ID NO: 3). The sgPRMD14 was designed to cleave PRDM14, and the sgDocut was designed to cleave the double cut donor plasmid (pD-sg, i.e., pD-PRD14-E2A mNanGreen-sg).

The double cut donor plasmid (pD-sg, i.e., pD-PRD14-E2A mNaeonGreen-sg) was generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) as detailed above. Briefly, all fragments contained in pDonor-sg (left homology arm, fragment required for gene knock-in, right homology arm) were amplified by PCR using KAPA HiFi polymerase (KAPA biosystems) and purified using GeneJET gel extraction kit (Thermo Fisher Scientific). HA sequences of-600 bp in length were amplified from human gDNA, and sgDocut recognition sequences were added upstream of the left HA and downstream of the right HA. All vectors were verified by Sanger sequencing.

CRISPR plasmids including pEF1-Cas9, pU6-sgPRDM14, pD-PRDM14-E2A-mneon green-sg and pU6-sgDocut were co-electroporated into iPSC-penti-BCL-XL line and iPSC-penti-control line, thereby integrating E2A-mneon green exactly at PRDM14 stop codon by HDR pathway. For electroporation of human iPSC, the following protocol was used according to the manufacturer's instructions Kit 2 and procedure B-016 cells were transfected by electroporation. Since PRDM14 was actively expressed in ipscs, its endogenous transcription mechanism driven expression of mneon green, which can be quantified by FACS analysis on day 3 post electroporation (fig. 2). Cell viability was determined by the number of cells surviving day 1 relative to the number of cells used for electroporation. FIG. 3 shows flow cytometry analysis of iPSC-Lenti-BCL-XL and iPSC-Lenti-control lines after CRISPR plasmid co-transfection. Cell viability was determined by the relative ratio of the cell count surviving the first day to the cell count at electroporation. The first day the iPSC-Lenti-control cells survived 3% and the iPSC-Lenti-BCL-XL cells survived 90%, indicating that stable overexpression resulted in a 30-fold increase in cell viability following electroporation with plasmid (FIG. 3). 3 days after electroporation, the KI (knock-in) efficiency reflected by the percentage of mNanGreen-positive cells was determined by FACS. HDR efficiency at PRDM14 was from 0.1 for the control group The 7% increase to about 15% for the Lenti-BCL-XL iPSC line was 90-fold higher (FIG. 3). These results indicate that increased survival of ipscs by BCL-XL can enhance HDR editing in surviving cells.

Example 2: transient BCL-XL overexpression

FIG. 4 shows the protocol design for transient BCL-CL overexpression in human iPSC. In this experiment, a plasmid encoding BCL-XL (pEF 1-BCL-XL) under the control of the EF1 promoter was constructed. The pEF1-BCL-XL plasmid was generated using the NEBuilder HiFi DNA assembly kit (New England Biolabs) detailed above.

CRISPR plasmids (pEF 1-Cas9, pU6-sgPRDM14, pD-PRDM14-E2A-mneon green-sg and pU 6-sgDocut) were co-transfected with pEF1-BCL-XL plasmids into ipscs by electroporation (fig. 4). Because of vector deletion following cell division and progressive silencing in mammalian cells, the vector only provides transient BCL-XL overexpression. As a control, a control group can also be established by transduction with CRISPR plasmid alone (without BCL-XL).

FIG. 5 shows flow cytometry analysis of transient BCL-XL over-expression and control groups. Cell viability on day one and HDR gene knock-in (KI) efficiency on day 3 were tested as detailed above. There was a 9-fold increase in 27% cell survival in the transient BCL-XL over-expressed group compared to 3% cell survival in the control group without BCL-XL (fig. 5). Increased survival resulted in an approximately 150-fold increase in KI efficiency (0.17% vs.25%) at the PRDM14 locus (fig. 5). It should be noted that transient BCL-XL exhibited higher editing efficiency compared to stable BCL-XL overexpression (25% vs. 15%) (fig. 5, fig. 3). This is probably due to the increased selection pressure after transient transfection of BCL-XL, since cells transfected with more BCL-XL copy number and editing plasmid survive more easily under pressure and have higher editing efficiency.

Example 3 influence of BCL-XL on iPSC survival and HDR efficiency at the CTNNB1 or OCT4 loci in iPSC

To summarize the effect of BCL-XL on iPSC survival and HDR-mediated KI, we performed similar experiments at the other two loci CTNNB1 and OCT 4. Fig. 6 is a schematic diagram of HDR editing at CTNNB 1. Fig. 7 is a schematic diagram of HDR editing at OCT 4. The following plasmids were constructed: pU6-sg CTNNB1, pD-CTNNB 1-E2A-mNanGreen-sg, pU6-sgOCT4 and pD-OCT4-E2A-Puro-E2A-Crimson-sg.

CTNNB1 is a key gene in the classical WNT pathway that is constitutively expressed in ipscs and other cells. The pU6-sgCTNNB1 and pD-CTNNB 1-E2A-mNanGreen-sg were used for targeting at 39bp before the stop codon, and the E2A-mNanGreen cassette was inserted into CTNNB1 locus A. The sgCTNNB1 sequence was GCTGATTGCTGTCACTGGG (SEQ ID NO: 4).

The E2A-puro-E2A-Crimson cassette was inserted in front of the OCT4 stop codon of the double cut HDR donor pD-OCT-E2A puro-E2A Crimson-sg, the left HA (600 bp) extended from intron 2 to exon 4 and the right HA (1000 bp) started from the stop codon, resulting in the substitution of exon 5-E2A-puro-E2A-Crimson on the genome with intron 4 and exon 5 on the pDOor. Target OCT4 intron 4 the sgOCT4 sequence was GTGAGTGCCATGTCTCTCTG (SEQ ID NO: 5).

In this experiment, all sgRNA plasmids and donor plasmids used in this experiment were generated using the NEBuilder HiFi DNA assembly kit detailed above (new england biology laboratory). To further increase reproducibility, 6 different iPSC lines were used in this experiment.

CRISPR plasmids (pEF 1-Cas9, pU6-sgCTNNB1, pD-CTNNB1-E2A-mneon green-sg and pU 6-sgDocut) and CRISPR plasmids (pEF 1-Cas9, pU6-sgOCT4, pD-OCT4-E2A-puro-E2A-Crimson-sg and pU 6-sgDocut) were co-transfected into ipscs by electroporation, respectively. After HDR gene knock-in without promoter pDonor vector, the expression of the fluorescent reporter factors mneon green or Crimson will be driven by endogenous CTNNB1 or OCT4 transcription mechanisms.

Fig. 8 shows flow cytometry analysis indicating KI efficiency at CTNNB1 and OCT4 in iPSC. HDR gene knock-in (KI) efficiency was measured on day 3 as detailed above. Likewise, BCL-XL co-transfection resulted in a 20-fold increase in KI efficiency for both CTNNB1 (1.6% vs. 32%) and OCT4 (0.4% vs. 7.6%) (fig. 8). Based on the above, BCL-XL can improve the survival rate of stress iPSC after electroporation.

Example 4: effect of BCL-XL on efficiency of Gene knockout at CTNNB1 and OCT4 in iPSC

FIG. 9 is a schematic representation of NHEJ mediated gene knockout at C326. FIG. 10 is a schematic representation of NHEJ mediated gene knockout at CD9. The following plasmids were constructed: pU6-sgCD326 and pU6-sgCD9. sgCD9 was designed to target exon 1 of CD 326. The sgCD326 sequence is GGTTCTCACTCGCTCAGAC (SEQ ID NO: 6). sgCD9 was designed to target exon 2 of CD9. The sgCD9 sequence is GCTTCTACAGGTAGGGGA (SEQ ID NO: 7).

CRISPR plasmids (pEF 1-Cas9 and pU6-sgCD 326) and CRISPR plasmids (pEF 1-Cas9 and pU6-sgCD 9) were co-transfected with pEF1-BCL-XL plasmids into ipscs, respectively, by electroporation.

The knockdown of these two genes is because they are highly expressed in human ipscs and can be detected by staining with surface-labeled antibodies (anti-human CD9 FUTC (eBioscience) and anti-human CD326 PE (eBioscience)) and flow cytometry. CD326 gene knockout efficiency was determined 1 week after electroporation with anti-CD 326 PE staining and gating PE negative cells. CD9 knockout efficiency in 6 iPSC cell lines was determined 1 week after electroporation using anti-CD 9 FITC staining and gating FITC negative cells.

Fig. 11 shows flow cytometry analysis indicating KO efficiencies at CD326 and CD9 in ipscs. KO efficiency was significantly increased by BCL-XL, 5.5-fold (10% vs. 55%) at CD326 and 2.5-fold (9% vs. 22%) at CD9. Transient BCL-XL overexpression can significantly improve HDR gene knockout efficiency and NHEJ-mediated gene knockout efficiency.

Example 5: dynamic analysis of cell death following electroporation in the presence or absence of BCL-XL

In this experiment, live cells from 2-48 hours post-transfection were counted to investigate the kinetics of cell death following iPSC electroporation using plasmids in the absence or presence of BCL-XL.

FIG. 12 shows the dynamic change in relative cell numbers after electroporation with or without the binding of the genome editing plasmid. About 0.5h after electroporation, about 50% of ipscs in both groups survived electroporation. From 0.5 hours to 2 hours, cell attachment from both groups was more stable, and no additional cell death was observed (fig. 12). However, from 2 hours to 9 hours, most of the cells in the control group began to die. In contrast, the continued expression of BCL-XL began to protect cells from death, which resulted in a 60% increase in survival at 4 hours. After 6 hours, there was no significant increase in cell death following accumulation of BCL-XL. 24 hours after electroporation with BCL-XL, cells began to divide, resulting in a doubling of relative survival from about 10 to about 20 times compared to the BCL-XL-free control (fig. 12). These results demonstrate that cells die rapidly 2 to 8 hours after electroporation, while over-expressed BCL-XL prevents cells from beginning to die 4 hours after electroporation.

Example 6: effects of BCL2 family on cell viability and editing

In this experiment, pEF1-BCL2 and pEF1-MCL1 plasmids were constructed for comparison with the pEF1-BCL-XL plasmid. As detailed above, the pEF1-BCL2 and pEF1-MCL1 plasmids were produced using the NEBuilder HIFI DNA assembly kit (New England Biolabs).

pEF1-Bcl-XL, pEF1-BCL2, pEF1-MCL1 plasmids were tested in the HDR gene knockout system and the NHEJ gene knockout system in a manner similar to that described in example 2 and example 4 above. As a control, a control group can also be established by transduction with CRISPR plasmid alone. Cell viability was determined by cell count 1 day after electroporation. KI or KO efficiencies were determined by FACS at 3 or 7 days.

FIG. 13 shows flow cytometry analysis of iPSCs that bind BCL-XL, BCL2, or MCL 1. In both systems (HDR gene knockout and NHEJ gene knockout), the cell viability of the individual vectors was not different and thus could be combined for analysis. BCL2 also increased survival (about 5-fold), but at lower levels compared to BCL-XL (about 8-fold), while MCL1 did not significantly increase iPSC survival after plasmid transfection. Accordingly, BCL2 moderately increased both HDR-mediated KI efficiency (0.2% vs.7.5%, about 35-fold improvement) and NHEJ-mediated KO efficiency (9.2% vs.37%, about 4-fold improvement), whereas MCL1 did not significantly increase KI and KO efficiency (fig. 13). These data indicate that the significant effects of BCL-XL cannot be replaced by BCL2 or MCL 1. In other words, BCL2 or MCL1 is lower than BCL-XL in iPSC survival and editing.

Furthermore, expression of Cas9mRNA and sgRNA in ipscs 8 hours after transfection was determined by RT-PCR.

Fig. 14 shows the expression levels of Cas9 and sgrnas. It was observed that Cas9 expression levels increased 5-10 fold and sgRNA expression levels increased 3-6 fold. These data indicate that BCL-XL or BCL2 preferentially protects cells transfected with greater plasmid copy numbers from death, resulting in higher levels of CRISPR components in surviving ipscs, and thus improved editing efficiency.

Example 7: effect of BCL-XL on BAX Gene knockout cell lines

BCL-XL binds to pro-apoptotic counterparts BAX and BAK1, preventing the formation of a dead pore in the mitochondrial outer membrane, thus interrupting apoptosis. Human ipscs express mainly BAX instead of BAK1 (about 300vs. about 50TPM or parts per million transcripts) (not shown). In this experiment, 4 BAX KO cell lines were established in two different iPSC cell lines by targeting BAX exon 1 or exon 2 with Cas 9-sgRNA. Wild-type iPSC was used as a control.

The BAX-targeted sgRNAs (sgBAX-E1, sgBAX-E2) were designed. And pD-EF1-Puro-PolyA-sg was designed and constructed. Two human iPSC cell lines were electroporated with plasmids for Cas9, sgRNA (targeting BAX), pD-EF1-Puro-PolyA-sg and BCL-XL. A stable BAX knockout cell line was selected by adding 1. Mu.g/ml puromycin to the medium for 1 week. The sgBAX-E1 sequence was GCGGCGGTGATGACGGGTC (SEQ ID NO: 8). The sgBAX-E2 sequence was GACAGGGCCCTTTTGCTTC (SEQ ID NO: 9).

Fig. 15 shows the effect of BAX gene knockout on iPSC cell survival and editing efficiency. BAX KO in these four lines greatly improved cell viability and HDR-mediated KI at PDRM14 and CTNNB1 loci (fig. 15). However, the addition of BCL-XL significantly increases HDR efficiency, indicating that BAX KO alone cannot replace BCL-XL.

Example 8: effect of BCL-XL on BBC3 Gene knockout cell line

BBC3, also known as PUMA, interacts with BCL2 family members, releasing BAX or BAK1 and inducing apoptosis. In this experiment, 4 BBC3 KO cell lines were established in two different iPSC cell lines by targeting BBC3 exons 1 or 2 with Cas 9-sgrnas.

The BBC-targeted sgRNAs (sgBBC 3-E1, sgBBC 3-E2) were designed. And pD-EF1-Puro-PolyA-sg was designed and constructed. Two human iPSC cell lines were electroporated with Cas9, sgRNA (targeting BBC 3), pD-EF1-Puro-PolyA-sg and BCL-XL plasmids. A stable BAX knockout cell line was selected by adding 1. Mu.g/ml puromycin to the medium for 1 week. The sgBBC3-E1 sequence was GACTCACAAATCTGGCA (SEQ ID NO: 10). The sgBBC3-E2 sequence was GTAGGGGCCTGGCCCGA (SEQ ID NO: 11).

Figure 16 shows the effect of BBC3 gene knockout on iPSC cell survival and editing efficiency. Similar to BAX KO, BBC3 KO significantly improved cell viability and editing, but addition of BCL-XL further increased HDR efficiency at both loci (fig. 16), suggesting that BBC3 deletion also failed to replace BCL-XL.

Example 9: effect of BCL inhibitor ABT-263 on iPSC editing

Ipscs containing high copy number CRISPR plasmids can increase editing efficiency, so that enrichment of these cells can increase editing efficiency for larger populations. To preferentially remove cells transfected with low copy plasmids, the cells were treated with potent inhibitors of ABT-263 (Navitocrax), BCL-XL, BCL-2 and BCL-W.

To test the effect of ABT-263, iPSCs were split into wells after electroporation with CRISPR plasmids (pEF 1-Cas9, pU6-sgPRDM14, pD-PRDM 14-E2A-mNannGreen-sg and pU 6-sgDocut) and peF-BCL-XL. First, BCL inhibitory factor ABT-263 (Navitocrax; selleck Chemicals) was diluted in 50. Mu.l of medium to prepare a master mix, and then 50. Mu.l of diluted small molecules were added uniformly to each well at the desired working concentration and treatment time. Thereafter, the medium was replaced with fresh medium. As a control, DMSO alone (0.1%) was added to the parallel wells. 3 days after electroporation, cells were collected for FACS analysis to determine cell viability and editing efficiency under each condition.

Figure 17 shows the effect of different doses of ABT-263 and treatment cycles on iPSC cell viability after electroporation. Figure 18 shows the effect of ABT-263 on HDR efficiency of ipscs at different doses and treatment cycles after electroporation.

From FIGS. 17 and 18, it can be seen that the addition of ABT-263 (0.2 μm,0.5 μm) immediately after electroporation resulted in a dramatic decrease in cell viability without a significant increase in editing efficiency when there was no exogenous BCL-XL expression. In contrast, when ABT-263 was administered starting from 8 hours, a gradual decrease in cell viability dose-dependent and an increase in editing efficiency was not observed when robust BCL-XL was expressed until 24 hours.

In addition, the effect of ABT-263 on KO efficiency was also tested. KO efficiency was determined in a similar manner as in example 4. FIG. 19 shows the effect of ABT-263 on iPSC cell viability and editing efficiency. As can be seen from FIGS. 17, 18 and 19, the cell viability was reduced by 50-70% under the ABT-263 condition of 1. Mu.m, and the KI and KO editing efficiencies were improved by 70% and 40%, respectively. These results indicate that the use of BCL-XL in iPSC genome editing can allow cell screening and enrichment of successfully edited cells by administration of BCL inhibitor.

Example 10: rapid high-level gene knock-in or gene knock-out via bi-or allelic editing

Fig. 20 is a schematic of HDR mediated dual KI at PRDM14 and CTNNB1 in iPSC. In this experiment, a double-cut donor (pD-E2A-Puro-E2A-Crimson-sg) with an puromycin-resistant gene was designed to target the PDRM14 locus. CRISPR plasmids (pD-E2A-Puro-E2A-Crimson-sg, pD-CTNNB 1-E2A-mNannB-sg, pU6-sgCTNNB1, pU6-sgPRDM14, pEF1-Cas9, pU 6-sgDocut) were co-electroporated with the BCL-XL plasmid as iPSCs. Gene knock-in of the E2A-Puro-E2A-Crimson cassette by HDR gene knock-in at PRDM14 allows selection of puromycin to enrich ipscs with HDR editing at CTNNB 1. Specifically, screening was performed by adding 1. Mu.g/ml puromycin 2 days after electroporation. KI efficiency at CTNNB1 (mNanGreen positive) was determined by FACS.

FIG. 21 shows a flow cytometry analysis indicating KI efficiency at CTNNB1 in an iPSC. As can be seen from fig. 21, the HDR KI efficiency at CTNNB1 increased from 17% to 95% after puromycin screening.

Fig. 22 is a schematic diagram of dual editing by HDR at PRDM14 and by NHEJ at CD 326. CRISPR plasmids (pD-E2A-Puro-E2A-Crimson-sg, pU6-sgCD326, pU6-sgPRDM14, pEF1-Cas9, pU 6-sgDocut) were co-electroporated with BCL-XL plasmids as ipscs. Puromycin was selected at PRDM14 by HDR gene knock-in E2A-Puro-E2A-Crimson cassette to enrich ipscs with NHEJ editing at CD 326. KO efficiency at CD326 (CD 326 PE negative) was determined by FACS.

Fig. 23 shows flow cytometry analysis indicating KO efficiency at CD326 in iPSC. As can be seen from FIG. 23, cells containing CD326 KO were enriched from 21% to 98%. These data indicate that in bulk ipscs, a dual editing strategy is employed to easily increase the HDR or KO editing efficiency to above 95%.

Figure 24 is a schematic of gene knockout by bi-allelic HDR insertion of the cassette. In this experiment, two double cut HDR donors (pD-EF 1-Puro-sg and pD-EF 1-zeocin-sg) were designed with 600bp homology arms to insert the puromycin or bleomycin resistant gene at CD326, resulting in a double allelic break in the open reading frame.

All CRISPR plasmids (pD-EF 1-puro-sg, pD-EF1-zeocin-sg, pU6-sgCD326, pEF1-Cas9, pU 6-sgDocut) were co-electroporated with the BCL-XL plasmid as iPSCs. Antibody staining and FACS analysis were performed 1 week after electroporation. Fig. 25 shows a flow cytometry analysis indicating KO efficiency at CD326 in iPSC. As can be seen from fig. 25, the KO efficiency was observed to be 38%. KO efficiency was increased to 95-96% by selection with puromycin or zoxillin, whereas 100% by double selection with puromycin and zoxillin (FIG. 25). These data indicate that gene knockout in nearly 100% of cells is achieved by double allele knockout of the selective cassette.

Example 11: differential effect of BCL2 family on editing of multiple cell lines

In this experimental test, the effects of BCL-XL, BCL2 and MCL1 in mouse ESCs, 293T (human embryonic kidney cells), K562 (human erythroleukemia cells) and Jurkat (T cell leukemia) cells were tested. In all of these cell lines, electroporation with BCL did not increase cell viability (data not shown).

To facilitate detection of HDR editing, the promoterless pDOOR-mNEonGreen was designed to target introns before the stop codon located exons of the commonly expressed genes EEF1A1 and GAPDH. In mouse ESCs, two sgRNAs (sgEef 1a1-1, sgEef1a 1-2) were designed to target the Eef1a1 intron. The sgEef1a1-1 sequence is GAGTTAGCAGACTCAGATC (SEQ ID NO: 12). The sgEef1a1-2 sequence is GTAGCAAAGATACTGATAAA (SEQ ID NO: 13). In addition, in 293T, K562 and Jurkat cells, sgEEF1A1-1 and sgGAPDH were designed to target the EEF1A1 and GAPDH introns. The sgEEF1A1-1 sequence was GTAGTCCTCTATCCCAA (SEQ ID NO: 14). The sgGAPDH sequence is GACAACTTTTCATTCT (SEQ ID NO: 15).

Mouse ES cells were purchased from ATCC and maintained in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% serum replacement (Gibco), 2mM glutamine (Gibco), 10ng/ml mouse Leukemia Inhibitory Factor (LIF), 0.1mM 2-mercaptoethanol (Gibco), 3 μm GSK inhibitory factor (CHIR 99021, selleck), 1 μm MEK inhibitory factorAnd 1% penicillin/streptomycin (Invitrogen) on 6 well plates treated with 0.1% gelatin (Sigma) coated tissue. The cells are fed with fresh medium every day, dividing 6-8 times every 2-3 days. The electroporation procedure was similar to that used for human iPSC, except that the a-013 procedure was used.

K562 (ATCC, CCL-243) cells were grown in RPMI-1640 (VWR life sciences) containing 10% FBS (Gibco) and 1% penicillin/streptomycin (Invitrogen). For electroporation of K562 cells, the methotrexate cell line Nucleofector kit v (Lonza) and procedure T-016 were used according to the manufacturer's instructions.

Jurkat (ATCC, clone E6-1) cells were grown in RPMI-1640 (VWR life sciences) containing 10% FBS (Gibco) and 1% penicillin/streptomycin (Invitrogen). For electroporation of Jurkat cells, the AmaxaTM cell line Nucleofector kit V (Lonza) and procedure X-001 were used according to the manufacturer's instructions.

HEK 293T cells were cultured in DMEM (dulbeck's modified Eagle medium, sigma) supplemented with 10% fetal bovine serum (FBS; gibco) and 1% penicillin/streptomycin (Invitrogen). To transfect 293T cells, lipofectamine 3000 (life technology) was used according to the manufacturer's instructions.

Mouse ESCs, K562, 293T cells were electroporated with the editing plasmid in the presence or absence of the BCL plasmid. 293T cells were transfected by lipofection. The HDR gene knockin efficiency reflected by partial mneon green positive cells was determined 3 days after transfection by FACS.

FIG. 26 shows the effect of transient BCL-XL, BCL2 or MCL1 overexpression on HDR efficiency in mouse ES cells. BCL-XL significantly increased HDR editing in 2 mouse ESC experiments, while BCL2 and MCL1 were less effective.

FIG. 27 shows the effect of transient BCL-XL, BCL2 or MCL1 overexpression on HDR efficiency in K562 cells. In K562 cells, BCL-XL and MCL1 were not significantly beneficial, while BCL2 significantly reduced the HDR efficiency at EEF1A1 and GAPDH.

FIG. 28 shows the effect of transient BCL-XL, BCL2 or MCL1 overexpression on HDR efficiency in 293T cells. In 293T cells, both BCL-XL and BCL2 significantly reduced HDR efficiency at EEF1A1 and GAPDH, whereas MCL1 had no significant effect.

FIG. 29 shows the effect of transient BCL-XL, BCL2 or MCL1 overexpression on HDR efficiency in Jurkat cells. In Jurkat cells, BCL-XL and MCL1 have a tendency to increase editing efficiency, but the difference is not significant.

Taken together, these data indicate that BCL-XL increases HDR efficiency in ESC, with BCL2 members having different effects on gene editing in different cell lines by affecting mechanisms other than cell viability.

It will be apparent to those skilled in the art that various modifications and variations can be made to the disclosed embodiments without departing from the scope or spirit of the invention. In view of the foregoing, it is intended that the present invention cover modifications and variations of this invention provided they come within the scope of the following claims and their equivalents.

Sequence listing

<110> Chinese medical science center blood disease Hospital (Chinese medical science center blood study center)

<120> method for genome editing in mammalian stem cells

<130> XYS19005-1

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 233

<212> PRT

<213> human (human)

<400> 1

Met Ser Gln Ser Asn Arg Glu Leu Val Val Asp Phe Leu Ser Tyr Lys

1 5 10 15

Leu Ser Gln Lys Gly Tyr Ser Trp Ser Gln Phe Ser Asp Val Glu Glu

20 25 30

Asn Arg Thr Glu Ala Pro Glu Gly Thr Glu Ser Glu Met Glu Thr Pro

35 40 45

Ser Ala Ile Asn Gly Asn Pro Ser Trp His Leu Ala Asp Ser Pro Ala

50 55 60

Val Asn Gly Ala Thr Gly His Ser Ser Ser Leu Asp Ala Arg Glu Val

65 70 75 80

Ile Pro Met Ala Ala Val Lys Gln Ala Leu Arg Glu Ala Gly Asp Glu

85 90 95

Phe Glu Leu Arg Tyr Arg Arg Ala Phe Ser Asp Leu Thr Ser Gln Leu

100 105 110

His Ile Thr Pro Gly Thr Ala Tyr Gln Ser Phe Glu Gln Val Val Asn

115 120 125

Glu Leu Phe Arg Asp Gly Val Asn Trp Gly Arg Ile Val Ala Phe Phe

130 135 140

Ser Phe Gly Gly Ala Leu Cys Val Glu Ser Val Asp Lys Glu Met Gln

145 150 155 160

Val Leu Val Ser Arg Ile Ala Ala Trp Met Ala Thr Tyr Leu Asn Asp

165 170 175

His Leu Glu Pro Trp Ile Gln Glu Asn Gly Gly Trp Asp Thr Phe Val

180 185 190

Glu Leu Tyr Gly Asn Asn Ala Ala Ala Glu Ser Arg Lys Gly Gln Glu

195 200 205

Arg Phe Asn Arg Trp Phe Leu Thr Gly Met Thr Val Ala Gly Val Val

210 215 220

Leu Leu Gly Ser Leu Phe Ser Arg Lys

225 230

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(18)

<223> synthetic oligonucleotides

<400> 2

gggtgcagat gaacttca 18

<210> 3

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(19)

<223> synthetic oligonucleotides

<400> 3

gaagactact agccctgcc 19

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(19)

<223> synthetic oligonucleotides

<400> 4

gctgattgct gtcacctgg 19

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 5

gtgagtgcca tgtctctctg 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 6

ggttctcact cgctcagagc 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 7

gcttctacac aggtgaggga 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 8

gcggcggtga tggacgggtc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 9

gacaggggcc cttttgcttc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 10

gactcaccac aaatctggca 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 11

gtagagggcc tggcccgcga 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 12

gagtgtagca gactcagatc 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 13

gtagcaaaga tactgataaa 20

<210> 14

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(18)

<223> synthetic oligonucleotides

<400> 14

gtagtcatcc ttacccaa 18

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> synthetic oligonucleotides

<400> 15

gacaactctt ttcatcttct 20

Claims (7)

1. A method of increasing efficiency of editing a genomic DNA of interest in a mammalian stem cell, the method comprising: introducing an apoptosis controlling factor, a genome editing composition and a BCL inhibitor into mammalian stem cells, generating modified mammalian stem cells that overexpress said apoptosis controlling factor; wherein,

The apoptosis regulating factor is BCL-XL, and the amino acid sequence of the BCL-XL is shown as SEQ ID NO. 1;

the genome editing composition includes an endonuclease that cleaves within a desired target sequence of genomic DNA of mammalian stem cells and edits the target genomic DNA; the endonuclease is an RNA-guided endonuclease; the RNA-guided endonuclease is Cas9; the genome editing composition comprises a guide RNA;

the BCL inhibition factor is ABT-263;

the mammalian stem cells are ipscs;

the methods are non-disease diagnostic and therapeutic methods.

2. The method of claim 1, wherein introducing the apoptosis-regulating factor and genome editing composition into the mammalian stem cell comprises: introducing said apoptosis-modulating factor into said mammalian stem cell, generating said modified mammalian stem cell over-expressing said apoptosis-modulating factor; and introducing the genome editing composition into the modified mammalian stem cell.

3. The method of claim 1, wherein the guide RNAs comprise clustered regularly interspaced short palindromic repeat RNAs and tracrRNA.

4. The method of claim 1, wherein the genome editing composition further comprises a donor plasmid comprising a donor sequence, wherein the donor sequence is inserted into the genome at an insertion site by homology directed repair.

5. The method of claim 1, wherein BCL XL is stably expressed or transiently overexpressed.

6. The method of claim 5, wherein BCL XL is overexpressed for 1 hour to 72 hours.

7. The method of claim 1, wherein the BCL XL is over-expressed at least 5-fold over background.