WO2017160849A1 - Tc24-c4, a chagas disease vaccine antigen with improved stability and decreased aggregation - Google Patents

Tc24-c4, a chagas disease vaccine antigen with improved stability and decreased aggregation Download PDF

Info

Publication number
WO2017160849A1
WO2017160849A1 PCT/US2017/022317 US2017022317W WO2017160849A1 WO 2017160849 A1 WO2017160849 A1 WO 2017160849A1 US 2017022317 W US2017022317 W US 2017022317W WO 2017160849 A1 WO2017160849 A1 WO 2017160849A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
protein
polypeptide
trypanosoma cruzi
cruzi
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/022317
Other languages
French (fr)
Inventor
Oluwatoyin Ajibola ASOJO
Maria Elena Bottazzi
Eric Olivier DUMONTEIL
Peter Jay HOTEZ
Elissa M. HUDSPETH
Jeroen POLLET
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Baylor College of Medicine
Tulane University
Original Assignee
Baylor College of Medicine
Tulane University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Baylor College of Medicine, Tulane University filed Critical Baylor College of Medicine
Priority to BR112018068544A priority Critical patent/BR112018068544A2/en
Priority to MX2018011226A priority patent/MX2018011226A/en
Publication of WO2017160849A1 publication Critical patent/WO2017160849A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56905Protozoa
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/002Protozoa antigens
    • A61K39/005Trypanosoma antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/44Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Embodiments of the present disclosure concern at least the fields of cell biology, molecular biology, biochemistry, immunology, and medicine.
  • Chagas disease caused by infection with an intracellular protozoan T. cruzi, is a major public health issue, particularly in the Americas, with approximately 9-10 million infected, 10,600 deaths each year and an estimated $7.2 billion in annual economic losses. Due to the limited efficacy of current available drugs, nifurtimox and benznidazole, on the chronic phase of T. cruzi infection that causes major pathology and deadly cardiomyopathy and their serious side effects, developing a vaccine to reduce the disease and prevent the infection is urgent.
  • TSA-1 and Tc24 are 24 kDa calcium-binding protein localized to the flagellar pocket of the parasite and functions as a J! cruzi immune modulator.
  • Mice immunized with DNA vaccines of Tc24 and TSA1 showed significantly reduced parasitemia and inflammation in the heart, and the protective efficacy was concomitant with strong induction of parasite-specific IFNy producing CD4(+) and CD8(+) T cells.
  • Embodiments of the present disclosure provide a solution to a longfelt need in the art to provide an effective immunogenic composition, such as a vaccine, for Chagas disease that is able to be produced in large quantities.
  • Embodiments of the disclosure encompass methods and/or compositions for treating and/or preventing a medical condition.
  • the disclosure concerns methods and compositions related to a medical condition caused by a species of the protozoan Trypanosoma, including at least Trypanosoma cruzi.
  • the medical condition is Chagas disease, in specific aspects.
  • compositions of the disclosure relate to a protein of the protozoan Trypanosoma, such as Trypanosoma cruzi.
  • Trypanosoma cruzi such as Tc24.
  • Certain embodiments concern non-natural derivatives of the wild-type Tc24 protein that have reduced aggregation activity upon production, purification, and/or formulation compared to a wild-type version.
  • the non-natural version of the Tc24 comprises 1, 2, 3, or 4 fewer cysteine residues compared to the wildtype Tc24.
  • Specific embodiments encompass Tc24 derivatives that comprise no cysteine residues.
  • all four cysteine residues of the wildtype Tc24 protein are substituted, including with conservative substitutions, for example.
  • the substitutions may be to serine, methionine, or threonine, for example, and each of the four substituted cysteines may or may not be substituted with the same substitute amino acid.
  • compositions of the disclosure are encompassed herein, including methods of providing an effective amount of the compositions to an individual in need thereof.
  • the individual may be an individual who already has a disease caused by a
  • Trypanosoma species or that is seropositive or has been exposed to the parasite The individual may have been previously infected with a Trypanosoma species, exposed to a Trypanosoma species, suspected of having been exposed to a Trypanosoma species, be seropositive for a Trypanosoma species, or there is evidence that the individual has been infected.
  • the Trypanosoma species is T. cruzi.
  • compositions comprising a non-natural Trypanosoma cruzi Tc24 polypeptide, wherein the polypeptide lacks 1, 2, 3, or all cysteine residues of the wild-type Tc24 protein.
  • the composition may be further defined as comprising one or more amino acid substitutions at 1, 2, 3, or all cysteine residues of the wild-type Tc24 polypeptide. The substitution may be to a serine, methionine, or threonine.
  • the composition is further defined as comprising the sequence of SEQ ID NO:2.
  • the polypeptide may comprise one or more modifications other than the modification(s) to one or more of the cysteine residues, in at least some cases.
  • the polypeptide comprise an N-terrninal truncation, a C-terminal truncation, or both.
  • a composition may comprise an adjuvant, such as one or more TLR-4 receptor agonists.
  • the adjuvant may comprise synthetic TLR4 agonist E6020, squalene oil-in-water emulsions, liposomes, TLR9 agonists, TLR9 ligands, or a combination thereof, in some cases.
  • the composition comprises microparticles or nanoparticles.
  • the composition comprises aluminum salts, emulsions, poly(lactic-co-glycolic acid) (PLGA) microspheres; lipidoids; lipoplex; liposome; polymers; carbohydrates; oligonucleotides, cationic lipids; fibrin gel; fibrin hydrogel; fibrin glue; fibrin sealant; fibrinogen; thrombin; rapidly eliminated lipid nanoparticles; or combinations thereof.
  • PLGA poly(lactic-co-glycolic acid)
  • Any composition may be formulated in a pharmaceutically acceptable carrier.
  • a method of treating or preventing a medical condition caused by Trypanosoma cruzi in an individual comprising the step of providing to the individual an effective amount of a composition that comprise a non-natural Tc24 protein comprising amino acid substitution at least at 1, 2, 3, or all cysteine residues of the wild-type Tc24 protein.
  • the individual may be a human, horse, cow, dog, cat, goat, sheep, or Pig-
  • a method of treating or preventing a medical condition caused by Trypanosoma cruzi in an individual comprising the step of providing to the individual an effective amount of a composition encompassed by the disclosure.
  • the individual is a human, horse, cow, dog, cat, goat, sheep, or pig.
  • the method may further comprise the step of diagnosing the medical condition.
  • the individual has a medical condition caused by Trypanosoma cruzi, is seropositive for
  • Trypanosoma cruzi has been exposed to Trypanosoma cruzi, was previously infected with Trypanosoma cruzi, resides in a region known to have Trypanosoma cruzi, or has been or will be traveling to a region known to have Trypanosoma cruzi.
  • a method of producing an immunogenic composition for the treatment or prevention of a medical condition caused by Trypanosoma cruzi comprising the step of modifying Tc24 polypeptide, or a functionally active fragment thereof, to lack one or more cysteine residues compared to wildtype Tc24 polypeptide.
  • a method of producing an immunogenic composition for the treatment or prevention of a medical condition caused by Trypanosoma cruzi comprising the step of modifying Tc24 polypeptide, or a functionally active fragment thereof, to produce a mutant Tc24 that aggregates less and/or has longer storage capacity compared to wildtype Tc24 polypeptide.
  • the method further comprises the step of providing an effective amount of the polypeptide to an individual in need thereof.
  • FIGS. 1 A and IB provide SDS-PAGE and Western Blot Analysis of Tc24- WT+His in-process samples. Samples were separated on 4-12% Bis-Tris gels under Non- Reduced (FIG. 1A) and Reduced (FIG. IB) conditions. Lane 1 : SeeBlue Plus Molecular Weight marker (10 ⁇ ). Lane 2: Starting Material (7.5 ⁇ ). Lane 3 : IMAC eluate (7.5 ⁇ ). Lanes 4-5 QXL eluate (2.5 ⁇ and 1.3 ⁇ load). Lanes 6-7: Final Tc24-WT+His (4 ⁇ and 2 ⁇ load). Western Blots (Primary Ab: in house mouse anti-Tc24 1 :2500; Secondary Ab: goat anti -mouse IgG alkaline phosphatase conjugate 1 :7500).
  • FIG. 2 provides a Tc24 Amino Acid Sequence Alignment. Amino acid sequence alignment of wild-type and the cysteine-mutated Tc24 constructs. The cysteine and serine residues of interest are underlined. (SEQ ID NOS. 4, 6, and 2)
  • FIGS. 3 A, 3B, and 3C demonstrate a western Blot comparison of Tc24-WT (FIG. 3A), Tc24-C2 (FIG. 3B), and Tc24-C4 (FIG. 3C) purified proteins.
  • Lanes 1-3 Non- Reduced.
  • Lane 4 SeeBlue Plus Molecular Weight Marker.
  • Lanes 5-7 Reduced.
  • Lanes 1,5 Sample before size-exclusion chromatography (SEC) 8 ⁇ g load.
  • Lanes 2,6 Post SEC low load (3 ⁇ g).
  • Lanes 3,7 Post SEC high load (8 ⁇ g).
  • Detection was performed using mouse polyclonal antibody against Tc24 expressed in Pichia pastoris as primary antibody diluted 1 :2500 in PBST and an alkaline phosphatase conjugated goat anti-mouse secondary antibody diluted 1 :7500 in PBST.
  • FIG. 4 shows stability assessment of Tc24.
  • Western blot of different Tc24 constructs taken after storing the proteins for 10 days at 4 °C in PBS.
  • Lane 1 Tc24-WT+His
  • Lane 2 Tc24-WT+His
  • Lane 3 Tc24-WT
  • Lane 4 Tc24-C2
  • Lane 5 Tc24-C4.
  • a ponceau-stained Mark 12 protein ladder was used as a MW reference.
  • Detection was performed using mouse polyclonal antibody against Tc24 expressed in Pichia pastoris as primary antibody diluted 1 :2500 in PBST and an alkaline phosphatase conjugated goat anti-mouse secondary antibody diluted 1 :7500 in PBST.
  • FIG. 5 shows hydrodynamic radius and polydispersity of Tc24 antigens after 3 days at 4°C. Tc24-C4 was noticeably the most monodispersed product.
  • FIGS. 6A and 6B show structural comparison of Tc24 constructs.
  • FIG. 6A Circular Dichroism (CD). Far UV CD spectrum of different constructs of Tc24 were taken on a Jasco J- 1500. All tested Tc24 protein have a virtual identical CD profile with overlapping spectra. Negative peaks at 222 nm and 208 nm and a positive peak at 193 nm indicate that Tc24 is an a-helical protein.
  • FIG. 6B Thermal melting profile of Tc24-WT and Tc24-C4 measured using Protein Thermal ShiftTM kit (Life Technologies).
  • FIGS. 7A and 7B provide purification of Tc24-C4.
  • In-process and final Tc24- C4 protein samples separated on a 4-12% Bis-Tris SDS PAGE gel under reducing (FIG. 7A) and non-reducing (FIG. 7B) conditions.
  • Lanes 1 SeeBlue Plus 2 molecular weight marker.
  • Lanes 2 Cell Lysate (3 ⁇ g).
  • Lane 3 QXL1 elution (3 ⁇ g).
  • Lane 4 QXL2 elution (3 ⁇ g).
  • Lane 5
  • FIGS. 8A and 8B demonstrate IFNy Measurements after Homologous or Heterologous Stimulation of Vaccinated Mice by ELISA. IFNy concentrations in supernatants from splenocytes harvested from mice vaccinated with the indicated protein combined with E6020 emulsified in squalene-oil-in-water (AddaVaxTM, Invivogen) and restimulated in vitro with homologous recombinant protein (FIG.
  • mice vaccinated with Tc24 wt No His combined with E6020 emulsified with squalene-oil-in-water (AddaVaxTM, Invivogen) and re stimulated in vitro with heterologous protein as indicated (FIG. 8B). No statistically significant differences in antigen specific IFNy secretion.
  • FIG. 9 shows Measurement of IgG2a in Vaccinated Mice by ELISA.
  • FIGS. 1 OA- IOC demonstrates specificity of Antibodies from Infected Mice against wild-type and mutant Tc24 constructs. Antibodies from mice infected with T.
  • cruzi parasites were evaluated for specificity against either Tc24-WT (non-tagged) or Tc24- C4 by ELISA (FIGS 10A 10B, IOC). Plates were coated with either antigen and bound antibodies were detected using labeled goat anti-mouse IgG2a secondary antibodies. Geometric mean titers were calculated.
  • FIG. 11 shows freeze-thaw stability of Tc24-C4 purified in three independent runs, as indicated by select stability indicators, including pH, A280/A275 + A280/A258 value, molecular weight on Coomassie-stained non-reduced SDS-PAGE gels, and purity on reversed- phase HPLC. Data are mean ⁇ SD.
  • FIG. 12 demonstrates accelerated stability of Tc24-C4 purified in three independent runs, as measured by select stability indicators, including pH, A280/A275 + A280/A258 value, molecular weight on non-reduced Coomassie-stained SDS-PAGE gels, and purity on reversed-phase HPLC. Data represent mean ⁇ SD.
  • FIG. 13 shows purification of Tc24-C4 from E. coli. Samples from each purification step were analyzed by staining with Coomassie blue, and by Western blot for E. coli host-cell proteins.
  • FIGS. 14A-14C show SDS-PAGE as an indicator of Tc24-C4 identity and stability.
  • FIG. 14A Tc24-C4 incubated with 1/500 (w/w) protease and 0.2 % formaldehyde in the absence or presence of Ca2+, which appears to protect a small subdomain (red *) against proteolysis.
  • FIG. 14B Lc24-C4 after 30 ⁇ 1 days at 4 °C, room temperature, and 37 °C, with accelerated degradation apparent at 37 °C (red *). Samples are from three independent production runs.
  • FIG. 14C Western blot analysis. Numbers indicate the amount ⁇ g) of Tc24- C4 loaded in the lane, while B and E are 2 ⁇ g BSA and 35 ⁇ g E. coli host-cell proteins.
  • FIGS. 15A - 15C demonstrate reversed-phase ECPLC on a C4 column as an indicator of stability.
  • FIG. 15 A Tc24-C4 incubated with 1/500 w/w protease and 0.2 % formaldehyde, and analyzed separately or as a pool.
  • FIG. 15B Time course of Tc24-C4 degradation when incubated with 1/500 w/w protease at 4 °C, with % purity indicated.
  • FIG. 15C Accelerated degradation (D) of Tc24-C4 Run 3 after 30 days at 37 °C.
  • FIGS. 16A-16B show UV absorbance spectra as stability indicator.
  • FIGS. 16A-16B show UV absorbance spectra as stability indicator.
  • FIG. 16A Tc24-C4 incubated overnight at room temperature with 1/500 w/w protease in the absence or presence of Ca2+.
  • FIG. 16B Time course of A280/A275 + A280/A258 value of Tc24-C4 incubated with 1/500 w/w protease and with 0.1 % acetic acid in the presence or absence of Ca2+.
  • FIG. 17 provides a representative mass spectrum indicating the presence of a gluconylated form (red arrowhead) in a preparation of recombinant Tc24-C4 (blue arrowhead).
  • a or “an” may mean one or more.
  • the words “a” or “an” when used in conjunction with the word “comprising”, the words “a” or “an” may mean one or more than one.
  • another may mean at least a second or more.
  • aspects of the invention may "consist essentially of or “consist of one or more elements or steps of the invention, for example.
  • Some embodiments of the invention may consist of or consist essentially of one or more elements, method steps, and/or methods of the invention. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein.
  • Embodiments of the disclosure concern methods and compositions for treating or preventing a medical condition caused by a Trypanosoma species, such as Trypanosoma cruzi, which is a species of parasitic euglenoid protozoan that bores tissue in its host and feeds on blood and lymph, resulting in disease.
  • a Trypanosoma species such as Trypanosoma cruzi
  • Mammals are susceptible to trypanosomes, and the disease or the likelihood of disease varies with the organism. Trypanosomes require a host body and the haematophagous insect triatomine (descriptions "assassin bug", “cone-nose bug”, and “kissing bug”) is a common vector for a mechanism of infection.
  • compositions including vaccines, for the protection of an individual from a Trypanosoma species, such as T. cruzi.
  • the disclosure also concerns improved methods of producing immunogenic compositions.
  • the methods and compositions concern a mutated version of a particular T. cruzi protein, Tc-24.
  • cysteine mutagenesis of the Tc-24 protein improves production of a recombinant protein immunogenic composition for human Chagas disease without abrogating antigenicity.
  • a need for such an improvement in the art was realized upon generation of a wildtype (but codon optimized for E. coli expression) recombinant protein vaccine that upon production at a large scale through fermentation became increasingly aggregated especially during purification and storage at temperatures above the freezing point.
  • Tc24 is an immunogenic composition for preventing or treating a disease caused by T. cruzi infection, such as Chagas disease in humans.
  • the compositions comprise one or more modifications compared to the Tc24 protein found in nature.
  • the modification(s) concern at least one of four cysteine residues that likely cause intermolecular disulfide bridges and protein aggregation during purification or storage (such as prolonged storage at 2°C or higher temperatures).
  • prolonged storage refers to two or more days.
  • the compositions of the disclosure have storage capability for at least three weeks (for example) compared to storage of a Tc24 protein that lacks any modifications directed toward at least one cysteine.
  • the dynamics of the aggregation process are mainly driven by concentration and temperature, which may be determined and utilized according to standard practices in the art.
  • Embodiments of the disclosure concern certain Tc24 polypeptides and also polynucleotides that express the polypeptides.
  • Specific embodiments provide constructs that encode Tc24 with one or multiple cysteine residues mutated.
  • a particular construct referred to as Tc24-C4 with 4 cysteine residues mutated to serine residues, was genetically engineered and is encompassed herein.
  • Recombinant Tc24-C4 as an example composition, was expressed in E. coli (BL21) as soluble protein with similar yields as Tc24, but without any aggregation during purification process.
  • Tc24-C4 did not form any aggregation after being stored at 4°C for 9 days, as determined by Western blot, light-scattering and HPLC-RP, for example.
  • Vaccine efficacy assays using mouse challenge models showed mice immunized with Tc24-C4 formulated with the immunostimulant E6020-SE (squalene oil- in-water emulstion) were similarly protected as mice immunized with Tc24 + E6020-SE, as judged by mouse survival rate and parasitemia levels in blood.
  • the disclosure concerns non-natural Tc24 polypeptides and their use for a medical purpose.
  • the non-natural Tc24 polypeptides may have any kind of modification compared to wildtype Tc24, but in particular embodiments the modification occurs at least at 1, 2, 3, or all cysteine sites in the naturally occurring polypeptide. In at least some cases, there may be further modifications in addition to the modification(s) at 1, 2, 3, or all cysteine residues. For example, other amino acid(s) than cysteine may be modified. Other modifications may be made for any purpose, such as to increase immunogenicity, to improve folding, to enhance purification, to increase storage length, to reduce aggregation, and a combination thereof.
  • modifications include amino acid substitution, deletion, inversion, addition, truncation (C-terminal and/or N-terminal), and so forth.
  • amino acid(s) are substituted
  • the substitution may or may not be conservative.
  • cysteine residue(s) are substituted
  • the substitutions at cysteine may be to serine, methionine, or threonine.
  • when multiple cysteines are mutated they may or may not be substituted with the same amino acid.
  • a nucleotide sequence for Tc24 using an isolate of T. cruzi from the Yucatan, Mexico is as follows:
  • Tc24-WT E. coli codon optimized DNA sequence for wild type Tc24 (Tc24-WT) is as follows: ATGGGTGCTTGTGGCTCCAAAGGTTCAACGAGTGATAAAGGTCTGGCTTCGGATAAAGAT
  • Codons mutated from cysteines to serines are underlined above.
  • Tc24-C4 amino acid sequence comprising mutations of all four cysteines:
  • the immunogenic composition comprises SEQ ID NO:2.
  • the immunogenic composition comprises the amino acid sequence of SEQ ID NO:4 except that 1, 2, 3, or all cysteine residues are mutated to another amino acid.
  • the immunogenic composition comprises modifications compared to SEQ ID NO:4 and is at least 70, 75, 80, 85, 90, 95, 97, 98, or 99% identical to SEQ ID NO:4.
  • the immunogenic composition in particular aspects, is a fragment of SEQ ID NO:4 yet still comprises mutation at one or more cysteine residues within the fragment. In specific aspects, the fragment is at least 100, 125, 150, 175, 180, 185, 190, 195, 200, 205, or 210 amino acids in length.
  • the fragment is no more than 100, 125, 150, 175, 180, 185, 190, 195, 200, 205, or 210 amino acids in length.
  • the composition may be a fragment of SEQ ID NO:4 and may also have 1, 2, 3, or 4 cysteines that have been mutated to another amino acid, such as to serine, methionine, or cysteine.
  • the composition has a modification that is a posttranslational modification.
  • the composition may be produced in cells that are not bacterial, such as yeast, mammalian, or insect cells.
  • the Tc24 antigen (such as the Tc24-C4 antigen) is formulated, such as with an immune potentiator or adjuvant.
  • This adjuvant can be, but is not limited to, a TLR4 agonist (such as the synthetic TLR4 agonist E6020 (Eisai Co., Ltd)), for example.
  • the vaccine formulation can be comprised out of one or more delivery vehicles, such as aluminum salts, emulsions, poly(lactic-co-glycolic acid) (PLGA) microspheres, lipidoids, lipoplex, liposome, polymers, carbohydrates (including simple sugars), oligonucleotides, cationic lipids, fibrin gel, fibrin hydrogel, fibrin glue, fibrin sealant, fibrinogen, thrombin, rapidly eliminated lipid nanoparticles and combinations thereof.
  • delivery vehicles such as aluminum salts, emulsions, poly(lactic-co-glycolic acid) (PLGA) microspheres, lipidoids, lipoplex, liposome, polymers, carbohydrates (including simple sugars), oligonucleotides, cationic lipids, fibrin gel, fibrin hydrogel, fibrin glue, fibrin sealant, fibrinogen, thrombin, rapidly eliminated lipid nanoparticles and combinations thereof.
  • Methods of the disclosure include those for treatment or prevention of a medical condition caused by T. cruzi, such as Chagas disease.
  • a medical condition caused by T. cruzi such as Chagas disease.
  • the symptoms change over the duration of the infection.
  • the individual is asymptomatic or the symptoms are mild, including, for example, fever, swollen lymph nodes, headaches, and/or localized swelling at the location of the initial bite.
  • the symptoms are mild, including, for example, fever, swollen lymph nodes, headaches, and/or localized swelling at the location of the initial bite.
  • Such symptoms include damage to and fibrosis of the heart myocardial tissue, arrhythmias and disturbance of the heart electrical conduction system that can result in sudden cardiac death, enlargement of the ventricles of the heart (which may lead to heart failure); an enlarged esophagus; an enlarged colon, neuronal cell loss, microvascular dysfunction, and/or myocardial damage.
  • the transmission of the pathogen may be spread through blood transfusion, organ transplantation, ingesting contaminated food, or by vertical transmission from mother to child.
  • Diagnosis of early disease may occur by microscopic analysis for the pathogen, while chronic disease may be diagnosed using assays of blood samples for antibodies for T. cruzi, for example. Another way to diagnose is by polymerase chain reaction looking for T. cruzi DNA.
  • methods of the disclosure encompass methods of determining that an individual has Chagas disease or has been exposed to or is infected with T. cruzi.
  • Embodiments of the disclosure include methods of using compositions encompassed by the disclosure.
  • the methods may be for any purpose, in specific embodiments the methods are for a therapeutic purpose, including treatment or prevention of a certain medical condition associated with trypanosomes, including at least Trypanosoma cruzi.
  • methods for treating any medical condition for which one or more compositions of the disclosure is therapeutic are encompassed herein.
  • the medical condition that is treated or prevented is Chagas disease in humans. The humans may reside in any region of the world or travel to any region of the world, but in specific
  • humans reside in and/or travel to North America, Central America, or South America.
  • Methods of the disclosure include methods that concern treatment of a disease caused by T. cruzi.
  • the treatment may result in amelioration of at least one symptom of the disease and/or result in reduction in severity of at least one symptom of the disease, and in some embodiments the treatment results in complete alleviation of at least one symptom of the disease.
  • the outcome of the treatment may occur at any time following the treatment, including within days, weeks, months, or years of the treatment.
  • the treatment methods may be provided to the individual in need thereof only once or multiple administrations. Separate administrations may be separated in time by minutes, days, hours, weeks, months, or years.
  • Methods of the disclosure include methods that concern prevention of a disease caused by T. cruzi.
  • the prevention may include delay of onset of at least one symptom of the disease and/or reduction in severity of at least one symptom of the disease, and in some embodiments the prevention concerns complete prevention of at least one symptom of the disease or all symptoms of the disease.
  • administration of the composition(s) of the disclosure occurs prior to exposure to T. cruzi or after infection but prior to onset of one or more symptoms of a disease caused by T. cruzi, for example.
  • the vaccine may also prevent additional symptoms or further heart damage even after myocardial damage ensues, in at least some cases.
  • compositions of the disclosure may be known to have Chagas disease, may be suspected of having Chagas disease, may be traveling to or may have traveled to a region of the world that puts the individual at risk for Chagas disease, may have been exposed to T. cruzi, may have been suspected of having been exposed to T. cruzi, may be in need of routine prevention of Chagas disease, may be seropositive for 71 cruzi, may be in the military or in a vocation that requires travel, and so forth.
  • methods of treatment or prevention include administration of an agent that is in addition to the administration of a composition(s) of the disclosure.
  • a composition(s) of the disclosure For example, early infections may be treated with benznidazole or nifurtimox. These two drugs work best for treating the early acute stages of the infection, but do not work as well for later chronic stages. For individuals with chronic disease, these medications may delay or prevent the development of end-stage symptoms.
  • the administration of the two or more agents may be given to the individual at the same time or at separate times. When given at the same time, they may or may not be administered to the individual by the same administration route. When given at separate times, they may or may not be administered to the individual by the same administration route.
  • the duration of time between delivery of the separate agents may be of any duration, including of minutes, hours, days, months, or years.
  • a method of treating a medical condition caused by or in any event related to T. cruzi wherein an effective amount of a derivative of an antigen from a protein from T. cruzi is provided to an individual in need thereof to invoke an immune response.
  • the immune response may be of any kind, including cellular or humoral immune responses.
  • Embodiments of the disclosure concern immunogenic compositions for treatment or prevention of a medical condition caused directly or indirectly from T. cruzi.
  • an effective amount of an immunogenic composition is provided to an individual in need thereof.
  • the immunogenic composition may be referred to as an antigenic composition.
  • An immunogenic composition of the disclosure is a composition that invokes any kind of immune response in a mammal, including a cell-mediated or humoral response. In some cases, the immunogenic composition may be considered a vaccine.
  • an antigenic composition may comprise an antigen ⁇ e.g., a peptide or polypeptide), a nucleic acid encoding an antigen (e.g. , an antigen expression vector), or a cell expressing or presenting an antigen.
  • the antigenic composition comprises or encodes all or part of the sequence shown in SEQ ID NO:4, or an immunologically functional equivalent thereof (such as a protein that comprises the sequence of SEQ ID NO:2 but that comprises 1, 2, 3, 4, 5, 6 or more modifications thereto, such as amino acid substitutions, for example).
  • the antigenic composition is in a mixture that comprises an additional immunostimulatory agent or nucleic acids encoding such an agent.
  • Immunostimulatory agents include but are not limited to an additional antigen, an
  • immunomodulator an antigen presenting cell or an adjuvant, for example.
  • one or more of the additional agent(s) is covalently bonded to the antigen or an immunostimulatory agent, in any combination.
  • the antigenic composition is conjugated to or comprises an HLA anchor motif amino acids.
  • an antigenic composition or immunologically functional equivalent may be used as an effective vaccine in inducing an anti-Tc24 humoral and/or cell-mediated immune response in an animal.
  • the present invention contemplates one or more antigenic compositions or vaccines for use in both active and passive immunization embodiments.
  • An immunogenic composition such as a vaccine, of the present disclosure may vary in its composition of proteinaceous, nucleic acid and/or cellular components.
  • a nucleic encoding an antigen might also be formulated with a proteinaceous adjuvant.
  • various compositions described herein may further comprise additional components.
  • one or more components may be comprised in a lipid or liposome.
  • an immunogenic composition may comprise one or more adjuvants
  • An immunogenic composition of the present disclosure, and its various components may be prepared and/or administered by any method disclosed herein or as would be known to one of ordinary skill in the art, in light of the present disclosure.
  • an antigenic Tc24 composition of the present disclosure may be made by a method that is well known in the art, including but not limited to chemical synthesis by solid phase synthesis and purification away from the other products of the chemical reactions by HPLC, or production by the expression of a nucleic acid sequence (e.g. , a DNA sequence) encoding a peptide or polypeptide comprising an antigen of the present invention in an in vitro translation system or in a living cell, for example.
  • the antigenic composition isolated and extensively dialyzed to remove one or more undesired small molecular weight molecules and/or lyophilized for more ready formulation into a desired vehicle.
  • additional amino acids, mutations, chemical modification and such like, if any, that are made in a vaccine component will preferably not substantially interfere with the antibody recognition of the epitopic sequence.
  • Polypeptides may be prepared, e.g. , by recombinant means.
  • a nucleic acid encoding an antigenic composition and/or a component described herein may be used, for example, to produce an antigenic composition in vitro or in vivo for the various compositions and methods of the present invention
  • a nucleic acid encoding an antigenic composition and/or a component described herein may be used, for example, to produce an antigenic composition in vitro or in vivo for the various compositions and methods of the present invention
  • a nucleic acid encoding an antigenic composition and/or a component described herein may be used, for example, to produce an antigenic composition in vitro or in vivo for the various compositions and methods of the present invention.
  • a nucleic acid encoding an antigen is comprised in, for example, a vector in a recombinant cell.
  • the nucleic acid may be expressed to produce a peptide or polypeptide comprising an antigenic sequence.
  • the peptide or polypeptide may be secreted from the cell, or comprised as part of or within the cell.
  • an immune response may be promoted by transfecting or inoculating an animal with a nucleic acid encoding an antigen, such as one encoding a non- natural Tc24 antigen of the disclosure.
  • a nucleic acid encoding an antigen
  • One or more cells comprised within a target animal then expresses the sequences encoded by the nucleic acid after administration of the nucleic acid to the animal.
  • the vaccine may comprise "genetic vaccine" useful for immunization protocols.
  • a vaccine may also be in the form, for example, of a nucleic acid (e.g., a cDNA or an R A) encoding all or part of the peptide or polypeptide sequence of an antigen.
  • Expression in vivo by the nucleic acid may be, for example, by a plasmid type vector, a viral vector, or a viral/plasmid construct vector.
  • the nucleic acid comprises a coding region that encodes all or part of the sequences disclosed as SEQ ID NO: 2 or SEQ ID NO: 4 but with one or more modifications, or an immunologically functional equivalent thereof.
  • the nucleic acid may comprise and/or encode additional sequences, including but not limited to those comprising one or more immunomodulators or adjuvants.
  • the nucleotide and protein, polypeptide and peptide encoding sequences for various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's Genbank and GenPept databases
  • nucleic acid may be expressed in an in vitro expression system, in preferred embodiments the nucleic acid comprises a vector for in vivo replication and/or expression.
  • a cell expressing the Tc24 antigen of the disclosure may comprise the immunogenic composition (such as a vaccine).
  • the cell may be isolated from a culture, tissue, organ or organism and administered to an animal as a cellular immunogenic composition (such as a cellular vaccine).
  • a cellular immunogenic composition such as a cellular vaccine.
  • the present disclosure contemplates a "cellular vaccine .”
  • the cell may be transfected with a nucleic acid encoding an antigen to enhance its expression of the antigen.
  • the cell may also express one or more additional vaccine components, such as immunomodulators or adjuvants.
  • a vaccine may comprise all or part of the cell.
  • nucleic acids encoding antigens of the present invention may be transfected into plants, particularly edible plants, and all or part of the plant material used to prepare a vaccine, such as for example, an oral vaccine.
  • a vaccine such as for example, an oral vaccine.
  • an antigenic composition e.g., a Tc24 mutant
  • modifications and changes may be made in the structure of an antigenic composition (e.g., a Tc24 mutant) of the present disclosure, and still obtain molecules having like or otherwise desirable characteristics, such immunologically functional equivalents are also encompassed within the present invention.
  • certain amino acids may also be substituted for other amino acids in a peptide, polypeptide or protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies, binding sites on substrate molecules or receptors, DNA binding sites, or such like. Since it is the interactive capacity and nature of a peptide, polypeptide or protein that defines its biological (e.g., immunological) functional activity, certain amino acid sequence substitutions can be made in an amino acid sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a peptide or polypeptide with like (agonistic) properties. It is thus contemplated by the inventors that various changes may be made in the sequence of an antigenic composition such as, for example a Tc24 peptide or polypeptide, or underlying DNA, without appreciable loss of biological utility or activity.
  • an "amino molecule” refers to any amino acid, amino acid derivative or amino acid mimic as would be known to one of ordinary skill in the art.
  • the residues of the antigenic composition comprises amino molecules that are sequential, without any non-amino molecule interrupting the sequence of amino molecule residues.
  • the sequence may comprise one or more non-amino molecule moieties.
  • the sequence of residues of the antigenic composition may be interrupted by one or more non-amino molecule moieties.
  • antigenic composition particularly an immunologically functional equivalent of the sequences disclosed herein, may encompass an amino molecule sequence comprising at least one of the 20 common amino acids in naturally synthesized proteins, or at least one modified or unusual amino acid.
  • immunologically functional equivalent it is well understood by the skilled artisan that, inherent in the definition is the concept that there is a limit to the number of changes that may be made within a defined portion of the molecule and still result in a molecule with an acceptable level of equivalent immunological activity.
  • An immunologically functional equivalent peptide or polypeptide are thus defined herein as those peptide(s) or polypeptide(s) in which certain, not most or all, of the amino acid(s) may be substituted.
  • residues are shown to be particularly important to the immunological or structural properties of a protein or peptide, e.g., residues in binding regions or active sites, such residues may not generally be exchanged.
  • changes in an antigenic site other than the one or more cysteines that may or may not be in the antigenic site
  • maintenance of immunological function e.g., antigenicity
  • functional equivalents are defined herein as those peptides or polypeptides that maintain a substantial amount of their native immunological activity.
  • Amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.
  • An analysis of the size, shape and type of the amino acid side-chain substituents reveals that arginine, lysine and histidine are all positively charged residues; that alanine, glycine and serine are all a similar size; and that phenylalanine, tryptophan and tyrosine all have a generally similar shape.
  • arginine, lysine and histidine; alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine; are defined herein as immunologically functional equivalents.
  • hydropathic index of amino acids may be considered.
  • Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
  • Examples include those programs based upon the Jameson-Wolf analysis (Jameson & Wolf, 1988; Wolf et al, 1988), the program PepPlot® (Brutlag et al, 1990; Weinberger et al, 1985), and other new programs for protein tertiary structure prediction (Fetrow & Bryant, 1993).
  • Another commercially available software program capable of carrying out such analyses is Mac Vector (TBI, New Haven, CT).
  • major antigenic determinants of a Tc24 polypeptide may be identified by an empirical approach in which portions of a nucleic acid encoding the polypeptide are expressed in a recombinant host, and the resulting polypeptide(s) tested for their ability to elicit an immune response. In such a case, any resulting polypeptide would lack one or more, including all, cysteines.
  • PCRTM can be used to prepare a range of Tc24 peptides or Tc24 polypeptides lacking successively longer fragments of the C-terminus or N- terminus of the amino acid sequence. The immunoactivity of each of these Tc24 peptides or Tc24 polypeptides is determined to identify those fragments or domains that are
  • Another method for determining a major antigenic determinant of a Tc24 peptide or Tc24 polypeptide is a system in which overlapping peptides are synthesized on a cellulose membrane, which following synthesis and de-protection, is screened using a polyclonal or monoclonal antibody.
  • An antigenic determinant of the peptides or polypeptides that are initially identified can be further localized by performing subsequent syntheses of smaller peptides with larger overlaps, and by eventually replacing individual amino acids at each position along the immunoreactive Tc24 sequence.
  • an antigenic composition such as for example a Tc24 peptide or a Tc24 polypeptide is prepared that contain at least the essential features of one or more antigenic determinants.
  • a Tc24 antigenic composition is then employed in the generation of antisera against the composition, and preferably the antigenic determinant(s).
  • peptidyl compounds described herein may be formulated to mimic the key portions of the peptide or polypeptide structure or to interact specifically with, for example, an antibody.
  • Such compounds which may be termed peptidomimetics, may be used in the same manner as a peptide or polypeptide of the invention and hence are also immunologically functional equivalents.
  • peptide mimetics that mimic elements of protein secondary structure are described in Johnson et al. (1993).
  • the underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orientate amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and antigen.
  • a peptide mimetic is thus designed to permit molecular interactions similar to the natural molecule.
  • a Tc24 antigenic composition is mutated for purposes such as, for example, reducing aggregation, enhancing its immunogenicity and/or producing or identifying a immunologically functional equivalent sequence.
  • Methods of mutagenesis are well known to those of skill in the art (Sambrook et al, 1987).
  • oligonucleotide directed mutagenesis procedure refers to template-dependent processes and vector-mediated propagation which result in an increase in the concentration of a specific nucleic acid molecule relative to its initial
  • oligonucleotide directed mutagenesis procedure is intended to refer to a process that involves the template-dependent extension of a primer molecule.
  • template dependent process refers to nucleic acid synthesis of an RNA or a DNA molecule wherein the sequence of the newly synthesized strand of nucleic acid is dictated by the well-known rules of complementary base pairing (see, for example, Watson, 1987).
  • vector mediated methodologies involve the introduction of the nucleic acid fragment into a DNA or RNA vector, the clonal amplification of the vector, and the recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided by U. S. Patent 4,237,224, specifically incorporated herein by reference in its entirety.
  • site directed mutagenesis is used.
  • Site-specific mutagenesis is a technique useful in the preparation of an antigenic composition ⁇ e.g., a Tc24- comprising peptide or polypeptide, or immunologically functional equivalent protein, polypeptide or peptide), through specific mutagenesis of the underlying DNA.
  • the technique of site-specific mutagenesis is well known in the art.
  • the technique further provides a ready ability to prepare and test sequence variants, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA.
  • Site-specific mutagenesis allows the production of a mutant through the use of specific oligonucleotide sequence(s) which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the position being mutated.
  • a primer of about 17 to about 75 nucleotides in length is preferred, with about 10 to about 25 or more residues on both sides of the position being altered, while primers of about 17 to about 25 nucleotides in length being more preferred, with about 5 to 10 residues on both sides of the position being altered.
  • site-directed mutagenesis is performed by first obtaining a single-stranded vector, or melting of two strands of a double stranded vector which includes within its sequence a DNA sequence encoding the desired protein.
  • the technique typically employs a bacteriophage vector that exists in both a single stranded and double stranded form.
  • Typical vectors useful in site-directed mutagenesis include vectors such as the Ml 3 phage. These phage vectors are commercially available and their use is generally well known to those skilled in the art.
  • Double stranded plasmids are also routinely employed in site directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid.
  • This mutagenic primer is then annealed with the single-stranded DNA preparation, and subjected to DNA polymerizing enzymes such as, for example, E. coli polymerase I Klenow fragment, in order to complete the synthesis of the mutation-bearing strand.
  • DNA polymerizing enzymes such as, for example, E. coli polymerase I Klenow fragment.
  • E. coli polymerase I Klenow fragment a DNA polymerizing enzymes
  • This heteroduplex vector is then used to transform appropriate cells, such as E. coli cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement.
  • a pair of primers may be annealed to two separate strands of a double stranded vector to simultaneously synthesize both corresponding complementary strands with the desired mutation(s) in a PCRTM reaction.
  • a genetic selection scheme to enrich for clones incorporating the mutagenic oligonucleotide has been devised (Kunkel et al., 1987).
  • the use of PCRTM with commercially available thermostable enzymes such as Taq polymerase may be used to incorporate a mutagenic oligonucleotide primer into an amplified DNA fragment that can then be cloned into an appropriate cloning or expression vector
  • thermostable ligase in addition to a thermostable polymerase also may be used to incorporate a phosphorylated mutagenic oligonucleotide into an amplified DNA fragment that may then be cloned into an appropriate cloning or expression vector (Michael 1994).
  • sequence variants of the selected gene using site-directed mutagenesis is provided as a means of producing potentially useful species and is not meant to be limiting, as there are other ways in which sequence variants of genes may be obtained.
  • recombinant vectors encoding the desired gene may be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants.
  • one particularly useful mutagenesis technique is alanine scanning mutagenesis in which a number of residues are substituted individually with the amino acid alanine so that the effects of losing side-chain interactions can be determined, while minimizing the risk of large-scale perturbations in protein conformation (Cunningham et al, 1989).
  • Other methods of site-directed mutagenesis are disclosed in U.S. Patents 5,220,007; 5,284,760;
  • compositions of the present disclosure comprise an effective amount of one or more Tc24 compositions, such as Tc24 polypeptides comprising one or more fewer cysteines compared to the corresponding wildtype polypeptide dissolved or dispersed in a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate.
  • the preparation of a pharmaceutical composition that contains at least one Tc24 polypeptide active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington: The Science and Practice of Pharmacy, 21 st Ed.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.
  • the Tc24 polypeptide may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection.
  • the present invention can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, topically, intramuscularly, subcutaneously, mucosally, orally, topically, locally, inhalation (e.g., aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference).
  • the Tc24 polypeptide may be formulated into a composition in a free base, neutral or salt form.
  • Pharmaceutically acceptable salts include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.
  • solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations are easily administered in a variety of dosage forms such as formulated for parenteral
  • composition of the present invention suitable for administration is provided in a pharmaceutically acceptable carrier with or without an inert diluent.
  • the carrier should be assimilable and includes liquid, semi-solid, i.e., pastes, or solid carriers. Except insofar as any conventional media, agent, diluent or carrier is detrimental to the recipient or to the therapeutic effectiveness of the composition contained therein, its use in administrable composition for use in practicing the methods of the present invention is appropriate.
  • carriers or diluents include fats, oils, water, saline solutions, lipids, liposomes, resins, binders, fillers and the like, or combinations thereof.
  • the composition may also comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
  • parabens e.g., methylparabens, propylparabens
  • chlorobutanol phenol
  • sorbic acid thimerosal or combinations thereof.
  • the composition is combined with the carrier in any convenient and practical manner, i.e., by solution, suspension, emulsifi cation, admixture, encapsulation, absorption and the like. Such procedures are routine for those skilled in the art.
  • the composition is combined or mixed thoroughly with a semi-solid or solid carrier.
  • the mixing can be carried out in any convenient manner such as grinding.
  • Stabilizing agents can be also added in the mixing process in order to protect the composition from loss of therapeutic activity, i.e., denaturation in the stomach.
  • stabilizers for use in an the composition include buffers, amino acids such as glycine and lysine, carbohydrates such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.
  • the present invention may concern the use of a pharmaceutical lipid vehicle compositions that include a Tc24 polypeptide, one or more lipids, and an aqueous solvent.
  • lipid will be defined to include any of a broad range of substances that is characteristically insoluble in water and extractable with an organic solvent. This broad class of compounds are well known to those of skill in the art, and as the term "lipid” is used herein, it is not limited to any particular structure. Examples include compounds which contain long-chain aliphatic hydrocarbons and their derivatives. A lipid may be naturally occurring or synthetic (i.e., designed or produced by man). However, a lipid is usually a biological substance.
  • Biological lipids are well known in the art, and include for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulphatides, lipids with ether and ester-linked fatty acids and polymerizable lipids, and combinations thereof.
  • neutral fats phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulphatides, lipids with ether and ester-linked fatty acids and polymerizable lipids, and combinations thereof.
  • lipids are also encompassed by the compositions and methods of the present invention.
  • the Tc24 polypeptide may be dispersed in a solution containing a lipid, dissolved with a lipid, emulsified with a lipid, mixed with a lipid, combined with a lipid, covalently bonded to a lipid, contained as a suspension in a lipid, contained or complexed with a micelle or liposome, or otherwise associated with a lipid or lipid structure by any means known to those of ordinary skill in the art.
  • the dispersion may or may not result in the formation of liposomes.
  • administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration.
  • the number of administrations of a preferred dosage and/or an effective amount may vary according to the response of the subject.
  • the practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
  • compositions may comprise, for example, at least about 0.1% of an active compound.
  • the an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein.
  • the amount of active compound(s) in each therapeutically useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
  • a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500
  • microgram/kg/body weight about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein.
  • a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc. can be administered, based on the numbers described above.
  • the Tc24 polypeptides are formulated to be administered via an alimentary route.
  • Alimentary routes include all possible routes of administration in which the composition is in direct contact with the alimentary tract.
  • the pharmaceutical compositions disclosed herein may be administered orally, buccally, rectally, or sublingually.
  • these compositions may be formulated with an inert diluent or with an assimilable edible carrier, or they may be enclosed in hard- or soft- shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet.
  • the active compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and the like (Mathiowitz et al., 1997; Hwang et al., 1998; U.S. Pat. Nos. 5,641,515; 5,580,579 and 5,792, 451, each specifically incorporated herein by reference in its entirety).
  • the tablets, troches, pills, capsules and the like may also contain the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof; a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or
  • the dosage unit form may contain, in addition to materials of the above type, a liquid carrier.
  • a liquid carrier such as, for example, sucrose, lactose, saccharin or combinations thereof.
  • a flavoring agent such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.
  • Gelatin capsules, tablets, or pills may be enterically coated. Enteric coatings prevent denaturation of the composition in the stomach or upper bowel where the pH is acidic. See, e.g., U. S. Pat. No. 5,629,001. Upon reaching the small intestines, the basic pH therein dissolves the coating and permits the composition to be released and absorbed by specialized cells, e.g., epithelial enterocytes and Peyer's patch M cells.
  • a syrup of elixir may contain the active compound sucrose as a sweetening agent methyl and
  • propylparabens as preservatives, a dye and flavoring, such as cherry or orange flavor.
  • any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed.
  • the active compounds may be incorporated into sustained-release preparation and formulations.
  • compositions of the present invention may alternatively be incorporated with one or more excipients in the form of a mouthwash, dentifrice, buccal tablet, oral spray, or sublingual orally- administered formulation.
  • a mouthwash may be prepared incorporating the active ingredient in the required amount in an appropriate solvent, such as a sodium borate solution (Dobell's Solution).
  • the active ingredient may be incorporated into an oral solution such as one containing sodium borate, glycerin and potassium bicarbonate, or dispersed in a dentifrice, or added in a therapeutically- effective amount to a composition that may include water, binders, abrasives, flavoring agents, foaming agents, and humectants.
  • the compositions may be fashioned into a tablet or solution form that may be placed under the tongue or otherwise dissolved in the mouth.
  • suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum. After insertion, suppositories soften, melt or dissolve in the cavity fluids.
  • traditional carriers may include, for example, polyalkylene glycols, triglycerides or combinations thereof.
  • suppositories may be formed from mixtures containing, for example, the active ingredient in the range of about 0.5% to about 10%, and preferably about 1% to about 2%.
  • the Tc24 polypeptide may be administered via a parenteral route.
  • parenteral includes routes that bypass the alimentary tract.
  • the pharmaceutical compositions disclosed herein may be administered for example, but not limited to intravenously, intradermally, intramuscularly, intraarterially, intrathecally, subcutaneous, or intraperitoneally U.S. Pat. Nos. 6,7537,514, 6,613,308, 5,466,468, 5,543,158; 5,641,515; and 5,399,363 (each specifically incorporated herein by reference in its entirety).
  • Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety).
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • a coating such as lecithin
  • surfactants for example
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like.
  • isotonic agents for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration.
  • sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage may be dissolved in isotonic NaCl solution and either added hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of
  • Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof.
  • a powdered composition is combined with a liquid carrier such as, e.g., water or a saline solution, with or without a stabilizing agent.
  • the active compound Tc24 polypeptide may be formulated for administration via various miscellaneous routes, for example, topical (i.e., transdermal) administration, mucosal administration (intranasal, vaginal, etc.) and/or inhalation.
  • topical i.e., transdermal
  • mucosal administration intranasal, vaginal, etc.
  • inhalation inhalation
  • compositions for topical administration may include the active compound formulated for a medicated application such as an ointment, paste, cream or powder.
  • Ointments include all oleaginous, adsorption, emulsion and water-soluble based compositions for topical application, while creams and lotions are those compositions that include an emulsion base only.
  • Topically administered medications may contain a penetration enhancer to facilitate adsorption of the active ingredients through the skin. Suitable penetration enhancers include glycerin, alcohols, alkyl methyl sulfoxides, pyrrolidones and luarocapram.
  • compositions for topical application include polyethylene glycol, lanolin, cold cream and petrolatum as well as any other suitable absorption, emulsion or water-soluble ointment base.
  • Topical preparations may also include emulsifiers, gelling agents, and antimicrobial
  • Transdermal administration of the present invention may also comprise the use of a "patch".
  • the patch may supply one or more active substances at a predetermined rate and in a continuous manner over a fixed period of time.
  • the pharmaceutical compositions may be delivered by eye drops, intranasal sprays, inhalation, and/or other aerosol delivery vehicles.
  • Methods for delivering compositions directly to the lungs via nasal aerosol sprays has been described e.g., in U.S. Pat. Nos. 5,756,353 and 5,804,212 (each specifically incorporated herein by reference in its entirety).
  • the delivery of drugs using intranasal microparticle resins Takenaga et al., 1998) and lysophosphatidyl-glycerol compounds (U. S. Pat. No. 5,725, 871, specifically incorporated herein by reference in its entirety) are also well-known in the pharmaceutical arts.
  • transmucosal drug delivery in the form of a polytetrafluoroetheylene support matrix is described in U.S. Pat. No. 5,780,045 (specifically incorporated herein by reference in its entirety).
  • aerosol refers to a colloidal system of finely divided solid of liquid particles dispersed in a liquefied or pressurized gas propellant.
  • the typical aerosol of the present invention for inhalation will consist of a suspension of active ingredients in liquid propellant or a mixture of liquid propellant and a suitable solvent.
  • Suitable propellants include hydrocarbons and hydrocarbon ethers.
  • Suitable containers will vary according to the pressure requirements of the propellant.
  • Administration of the aerosol will vary according to subject's age, weight and the severity and response of the symptoms.
  • compositions described herein may be comprised in a kit.
  • a Tc24 polypeptide such as one comprising one or more fewer cysteine residues compared to wild type is comprised in a kit, and in specific embodiments, a carrier and/or an additional agent, may be comprised in a kit.
  • kits may be packaged either in aqueous media or in lyophilized form.
  • the container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there are more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial.
  • the kits of the present invention also will typically include a means for containing the Tc24 polypeptide, lipid, additional agent, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.
  • the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred.
  • the Tc24 polypeptide compositions may also be formulated into a syringeable composition.
  • the container means may itself be a syringe, pipette, and/or other such like apparatus, from which the formulation may be applied to an infected area of the body, injected into an animal, and/or even applied to and/or mixed with the other components of the kit.
  • the components of the kit may be provided as dried powder(s).
  • the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
  • kits of the invention may also comprise, and/or be packaged with, an instrument for assisting with the
  • Such an instrument may be a syringe, pipette, forceps, and/or any such medically approved delivery vehicle.
  • Chagas disease is a serious disease caused by the infection with the protozoan Trypanosoma cruzi, transmitted by a triatomine insect vector (kissing bug). Due to the limited efficacy and side effects of the currently available drugs, developing a vaccine to reduce the effects of the disease and prevent the infection is urgent.
  • Tc24 a 24 kDa calcium-binding protein localized to the flagellar pocket of the parasite, functions as a T. cruzi immune modulator and a leading vaccine antigen with preventive and therapeutic efficacy against T. cruzi infection when used as a DNA vaccine in mouse model.
  • Tc24 In an effort to develop a recombinant protein vaccine of Tc24 that can be applied in humans, the coding DNA of Tc24 was cloned and transformed into E. coli.
  • the recombinant Tc24 protein can be highly expressed in the bacterial lysate, however, the expressed Tc24 protein aggregates during purification and formulation, likely due to the four cysteine residues in the molecule that form intermolecular disulfide bridges.
  • the four cysteine residues of Tc24 were genetically mutated to serine residues.
  • Recombinant Tc24-C4 was expressed in E. coli BL21 as a soluble protein at a similar yield as Tc24, but no aggregation was observed during the purification process.
  • the purified Tc24-C4 did not form any aggregates after being stored at 4°C for 9 days, as determined by Western blot, light-scattering and HPLC-RP.
  • Vaccine efficacy testing using mouse challenge models showed that mice immunized with Tc24-C4 formulated with an immunostimulant (E6020-SE) elicited a similar protection effect as Tc24 against a T. cruzi challenge, as judged based on mouse survival rate and parasitemia levels. Therefore, the mutant Tc24-C4 constitutes an improved vaccine antigen candidate, without the aggregation problem of the original protein, Tc24.
  • Tc24-C4 In order to eliminate the intramolecular aggregation caused by the disulfide bridges in the original Tc24, a new construct, Tc24-C4, with the four cysteine residues (C4, C66, C74 and CI 24) mutated to serine residues was genetically engineered. The reason for using serine residues to replace the cysteine residues is their similar size.
  • the coding DNA for mutant Tc24-C4 was codon optimized based on E. coli codon preference, synthesized by GenScript, and was cloned into pET41a, without any tag. The recombinant plasmid DNAs were transformed into E.
  • Tc24-C4 After being induced with 0.5 mM IPTG, Tc24-C4 had a similar expression yield as Tc24. Like Tc24, Tc24-C4 was expressed as a soluble protein in the induced bacterial lysate. More importantly, and unlike Tc24, there was no aggregation observed with Tc24-C4 during the purification process or when stored at 4°C for 9 days, as determined by SDS-PAGE, Western blot, light scattering and HPLC-RP.
  • mice immunized with Tc24-C4 formulated with the immunostimulant E6020-SE were similarly protected as mice immunized with Tc24 + E6020-SE, as judged by mouse survival rate and parasitemia levels in blood.
  • Chagas Disease also known as American trypanosomiasis, is a blood-borne disease caused by the protozoan parasite Trypanosoma cruzi which is endemic in parts of the Western Hemisphere extending from the southern United States to southern Argentina.
  • the parasites which cause Chagas Disease are transmitted to humans and other mammals by bloodsucking "kissing bugs" of the subfamily Triatominae, but can also be spread via blood transfusion, organ transplantation, and congenital transmission (Haberland et al., 2013). In 2013, the number of people estimated to be infected with T. cruzi was approximately 9-10 million, mostly in Latin America (Bonney, 2014).
  • benznidazole and nifurtimox work effectively against parasite replication when given during the acute stage of infection but can cause adverse side effects ranging from anorexia, weight loss, excitability, and nausea in the case of nifurtimox (Castro et al., 2006), to dermatitis, muscular pain, neuralgias, and potentially bone marrow disorders such as thrombocytopenia purpura or agranulocytosis in the case of benznidazole (Pinazo et al., 2010).
  • Both drugs require long treatment schedules (60 days for benznidazole and 90 days for nifurtimox), making treatment logistically difficult, and tend to increase the risk for drug resistance (Sanchez-Burgos et al., 2007; Castro et al., 2006; Fabbro et al., 2007; Campos et al., 2014; Pinazoo et al., 2013; Le Loup et al., 201 1). These drugs also have the potential to cause anemia in pregnant mothers and insufficient weight gain in their children [16].
  • Chagas vaccine offers a more effective solution (Dumonteil et al., 2012).
  • vaccines for the treatment of Chagas Disease are currently under development, including vaccines composed of peptides, plasmid DNA, or recombinant proteins [17-22].
  • vaccination of mice with a synthetic peptide containing predicted overlapping antigenic epitopes from T. cruzi mucin-like associated surface protein increased survival in mice with a reduction in parasite load in the heart (Serna et al., 2014).
  • T. cruzi parasites As a fusion protein and shown to induce significant protection in Balb/c mice against a lethal dose of T. cruzi parasites (Taibi et al., 1995). Data suggests that amino acids 109- 124 contain a putative T cell epitope which may be responsible for the protection (Taibi et al., 199). More recently, a DNA vaccine containing the Tc24 coding sequence has likewise shown efficacy when introduced into T. cruzi infected mice and dogs (Dumonteil et al., 2004; Llimon- Flores et al., 2010, Ouij ano-Hernandez et al., 2008; Ouijano-Hernandez et al., 2013).
  • Tc24-WT wild-type Tc24
  • Thl -biased immune response which provided partial protection after T. cruzi challenge
  • This initial version of wild-type Tc24 was expressed in Escherichia coli and purified using a two-step chromatography method.
  • cysteine-to-serine mutations were introduced into two new Tc24 constructs at residues C4S and C66S yielding Tc24-C2, and C4S, C66S, C74S, C124S yielding Tc24-C4.
  • the C4S and C66S mutations were selected for the Tc24-C2 construct over cysteine residues C74 and CI 24 due to their location on the surface of the molecule as determined by X- ray crystallography (Wingard et al., 2008).
  • Tc24-C2 Western blot analysis of Tc24-C2 revealed fewer protein aggregates as a result of these mutations, while the four cysteine-to-serine mutations in Tc24-C4 eliminated -100% of aggregated molecules. Based on these results, the inventors formulated wild-type and both mutant Tc24 proteins with a synthetic TLR-4 receptor agonist in squalene emulsions for immunologic testing in mice. Tc24-C2 and Tc24-C4 were shown to be immunologically equivalent to the parent molecule, indicating that cysteine mutagenesis did not adversely impact the antigenicity of the molecule. Due to the reduced aggregation of Tc24-C4 compared to Tc24-C2, Tc24-C4 is a useful vaccine antigen and is produced for the treatment and prevention of Chagas Disease.
  • Tc24 DNA coding for the full-length Yucatan strain T. cruzi 24 kDa excretory- secretory protein (Tc24) (Dumonteil et al., 2004) was codon optimized for expression in E. coli and chemically synthesized as wild-type Tc24 (Tc24-WT).
  • Constructs for Tc24-C2 and Tc24-C4 were based from the wild-type Tc24 DNA sequence with the first two cysteines mutated to serine residues (C4S, C66S) and all four cysteines mutated to serine residues (C4S, C66S, C74S and C124S), respectively (Figure 2).
  • Tc24-WT, Tc24-C2 and Tc24- C4 were sub-cloned in frame into the E. coli expression vector pET41a (EMD Millipore) using the restriction sites Nde I and Xho I with the GST fusion deleted.
  • the Tc24-WT construct was initially cloned in frame with the hexahistidine tag (Tc24-WT + His) at the C-terminus which was removed prior to process scale up in order to optimize the manufacturing process for a tag- free product.
  • the correct insert sequence and reading frame in the constructed recombinant plasmids were confirmed by double-stranded DNA sequencing.
  • the sequence-confirmed recombinant plasmid DNAs were transformed into BL21 (DE3) (EMD Millipore) and recombinant protein was induced with 1 mM Isopropyl-P-D-l-thiogalactopyranoside (IPTG) to confirm expression.
  • IPTG Isopropyl-P-D-l-thiogalactopyranoside
  • Frozen biomass of Tc24-WT + HIS was thawed and re-suspended in extraction Buffer Al (30 mM Tris-HCl, 500 mM NaCl, 20 mM Imidazole, pH 8.0) at a ratio of 20 mL buffer per gram of wet cell paste.
  • homogenization was performed using an EmulsiFlex-C3 high pressure homogenizer (Avestin, Inc.). The suspension was passed through the homogenizer three times at 15,000 psi and incubated on ice during and between passes. After extraction, the homogenate was centrifuged twice (31,000 x g, 4 °C, 30 min.) to remove insoluble debris.
  • the supernatant was then filtered consecutively through 0.45 ⁇ and 0.22 ⁇ filters before being loaded, at 3 mL/min, onto three tandem 5 mL HiTrap IMAC Sepharose 6 FF columns (GE Healthcare), equilibrated with buffer Al .
  • the columns were washed with 10 column volumes (CVs) buffer Al and protein was subsequently eluted using a linear gradient over 20 CVs of buffer B 1 (30 mM Tris-HCl, 500 mM NaCl, 500 mM Imidazole, pH 8.0).
  • Peak fractions containing the his-tagged Tc24 wild-type protein were pooled and buffer exchanged using a Sephadex G-25 (Fine) XK50 desalting column (GE Healthcare) into Q Sepharose XL (QXL) Buffer A (50 mM Tris-HCl, 30 mM NaCl, pH 7.5). The protein was loaded at 5 mL/min onto three tandem 5 mL HiTrap QXL columns (GE Healthcare), washed with 10 CVs of QXL buffer A, and eluted over a linear gradient of 0-100% B with QXL buffer B (50 mM Tris-HCl, 1 M NaCl, pH 7.5).
  • the amount of seed used for inoculation of the fermenter was adjusted in order to have a starting cell density (OD 60 o) of 0.05. At the time the cell density reached approximately 0.5, the temperature was reduced to 30 °C. When the cell density reached OD 6 oo of 0.6-1.0, IPTG was added to a final concentration of 1 mM to ensure full induction due to the high cell density achieved during fermentation. Approximately 5 hours after the start of induction, fed-batch medium (50% glycerol (v/v), 20 mM MgCl 2 ) was added to the fermenter at a rate of 3 mL/L/hr.
  • Agitation was set at 500 rpm, 1 vvm air flow, pH of 7.2, and DO of 30% was maintained through fermentation. After approximately 18 hours of induction, the culture was removed from the fermenter and biomass was collected by centrifugation (12,227 x g, 4 °C, 45 min.). The cell paste was collected and stored at -80 °C prior to downstream processing.
  • Tc24-WT and Tc24-C2 were homogenized using an EmulsiFlex C3 (Avestin, Inc.) with 3-5 passes at an average pressure of 15,000 psi.
  • the protein solution was kept cold using a heat exchanger. After extraction, the solution was centrifuged twice (31,000 x g, 4 °C, 30 min.).
  • Tc24-C4 was homogenized on a larger scale using an
  • EmulsiFlex C-55 (Avestin, Inc.) with 3-5 passes at an average pressure of 15,000 psi.
  • the protein solution was kept cold using a heat exchanger. After extraction, the solution was centrifuged three times (17,700 x g, 4 °C, 45 min.).
  • clarified supernatant was filtered using a 0.45 ⁇ filter unit followed by a 0.2 ⁇ filter unit and then loaded onto a Tricorn 10/200 column (GE Healthcare) packed with Q Sepharose XL resin (QXL, bed height 19.5 cm; column volume 15.3 mL) that was pre-equilibrated with
  • the concentrated Tc24 protein was loaded onto a size exclusion chromatography (SEC) column (Sephacryl S-200 HR HiPrep 26/60 (GE Healthcare) previously equilibrated with 2-3 CVs IX PBS pH 7.4. The protein was eluted using 2 CVs of IX PBS pH 7.4. The final concentration of Tc24 protein was determined spectrophotometrically (A280) using 22.46 mM ' Om '1 as the molar extinction coefficient and 23.58, 23.61, or 23.64 kDa as the molecular weight for Tc24-WT, Tc24-C2, and Tc24-C4, respectively. Aliquots were stored at -80 °C.
  • Endotoxin assays were conducted using the Charles River Endosafe PTS System. Each sample was tested after dilution from 1 : 10 to 1 :5000 with endotoxin-free water using an Inhibition/Enhancement cartridge which contains a known amount of endotoxin spike in each sample channel. This spike test checks for matrix interferences that can result in either inhibition or enhancement of endotoxin detection. The lowest sample dilution from the
  • Inhibition/Enhancement test which resulted in a spike recovery within the range 50%-200% was then used for final testing using an Endosafe®-PTSTM test cartridge with the Endosafe®PTSTM system to determine the endotoxin level present within the sample.
  • Tc24 was diluted to 1 mg/mL in a buffer containing 100 mM Tris-HCl, pH 8.3.
  • Dithiothreitol (DTT) was added to a final concentration of 5 mM and the sample was incubated for 30 min at 45 °C to reduce the disulfide bonds.
  • the protein mixture was then cooled to room temperature followed by the addition of lodoacetamide to 15 mM.
  • the alkylation of the cysteine residues was continued in the dark for 30 min at room temperature.
  • the unreacted lodoacetamide was then quenched by the addition of DTT (10 mM final concentration) during a 15 min incubation period.
  • the protein was then dialyzed into 1 x PBS.
  • DTT Dynamic light scattering
  • Tc24-WT, Tc24-C2, and Tc24-C4 were prepared in PBS, pH 7.4 and filtered through a 0.02 ⁇ inorganic membrane filter (Anotop 10, Whatman).
  • Tc24- WT purified Tc24
  • Tc24-C2 Tc24-C4
  • Tc24-C4 total concentration of 0.185 mg/mL.
  • CD spectra were recorded with a Jasco J- 1500s spectrophotometer, scanning from 280 nm to 185 nm at 100 nm/min with a bandwidth of 1 nm and response time of 1 sec.
  • Experiments were performed using one quartz cuvette with a path length of 0.1 cm, keeping a constant temperature of 25 °C. The average value was determined after five scans and the spectrum of the matching 'buffer alone' sample served as the control.
  • the secondary structure of the Tc24 was predicted using the software CDPro (Sreerama et al., 2004) by comparing with two reference sets (SP43and SMP56) and using three data fitting programs (CONTIN, SELCON3, and CDSSTR).
  • Samples for Protein Thermal Shift Studies were prepared by diluting purified Tc24-WT + His and Tc24-C4 to a final concentration of 0.5 mg/mL. The assay was executed using Protein Thermal ShiftTM reagents, ViiATM 7 qPCR Instrument and Protein Thermal ShiftTM Software v2.0 (Life technologies) according to manufacturers' protocol.
  • mice Female BALB/c mice, 5-6 weeks old (Taconic Farms, Inc.) were used in all experiments. After one week of acclimation, pre-immune blood samples were taken from all mice. Mice were then vaccinated subcutaneously (SC) with 25 ⁇ g of the selected Tc24 protein construct combined with 5 ⁇ g E6020 (Eisai Co. Ltd, a synthetic Toll-like receptor 4 (TLR-4) agonist (Singh et al., 2012) emulsified in AddaVaxTM, a squalene-oil-in-water emulsion
  • T. cruzi HI strain parasites previously isolated from a human case in Yucatan, Mexico (Dumonteil et al., 2004) were maintained by serial passage in mice.
  • To obtain immune serum from infected mice naive mice were infected with 500 trypomastigotes by intraperitoneal injection. Parasitemia was confirmed by microscopic examination of blood collected by tail vein microsampling approximately 21 days post infection. At 53 days of infection, mice were humanely euthanized by C02 inhalation and terminal serum samples were collected to evaluate antibody responses to proteins. Animal experiments were performed in compliance with the National Institutes for Health Guide for the Care and Use of Laboratory Animals and were approved by the BCM Institutional Animal Care and Use Committee (IACUC).
  • IACUC BCM Institutional Animal Care and Use Committee
  • a total of lxlO 6 cells were added to each well and stimuli were added at a final concentration of either 5 ⁇ g/mL Concanavalin A (positive control), 10 ⁇ g/mL antigen, or cDMEM media only (negative control). Plates were incubated for approximately 72 hours at 37 °C in 5% CO2 Plates were then centrifuged at 300 x g for 5 min at 4 °C and the supernatants were harvested and subsequently frozen at -20 °C until quantification by ELISA.
  • IFNy levels in duplicate from supernatants, plates pre-coated with IFNy capture antibody were washed twice with 1 x PBS, 0.05% Tween 20 (PBST), then standards, samples and the biotin conjugate were added to the plates. After incubation at room temperature for 2 hours with shaking, plates were washed and bound IFNy was quantified using Streptavidin- HRP and TMB substrate. The reaction was stopped using 1M Phosphoric acid and absorbance was measured at 450 nm using a Spectra Max Plate Reader and SoftMax Pro software.
  • PBST 0.05% Tween 20
  • Serum antibodies specific to the Tc24-WT + His protein were measured by ELISA using the following protocol. 96-well NUNC High/binding ELISA plates were coated with 1.25 ⁇ g/mL recombinant Tc24 WT + His protein diluted in 1 x KPL coating buffer (KPL, Inc.). After overnight incubation at 4 °C, the coating solution was removed and plates were sealed and frozen at -80 °C until further use. At the time of use, plates were thawed at room temperature, washed twice with PBST, and then blocked with 0.1% BSA in PBST for at least 2 hours.
  • Serum samples serially diluted in 1 x PBS, 0.05% Tween 20 were added in duplicate and plates were incubated for 2 hours at RT.
  • IgG2a antibody was detected with an HRP -conjugated anti-IgG2a antibody using TMB Substrate and 1 M HCl for color development.
  • Absorbance was measured at 450 nm using a Spectra Max Plate Reader and SoftMax Pro software.
  • IFNy concentration for each splenocyte sample was calculated from the standard curve. Background IFNy release was determined from non-stimulated (media only) control cells and this value was subtracted from IFNy measured from protein re-stimulated cells to determine the antigen specific IFNy released from splenocytes. Responses to antigen specific stimulation were compared between treatment groups using a Mann-Whitney test and Prism Graph Pad software. P values ⁇ 0.05 were considered statistically significant
  • Tc24-WT + His specific IgG2a titers were calculated by first subtracting the background OD 450 (wells with no serum added) from each individual well followed by calculating the average OD 450 from replicate wells for each sample. The positive cutoff was calculated as the average OD 450 plus 3 standard deviations of the naive serum sample at a dilution of 1 : 1,600. For each sample, the titer was determined as the lowest dilution with an average OD45 0 above the positive cutoff. Geometric mean titers for each group were plotted using Graph Pad Prism software. Kruskal-Wallis ANOVA and Dunn' s multiple comparisons tests were applied using Graph Pad Prism software. P values ⁇ 0.05 were considered statistically significant.
  • the present example demonstrates the process development and initial preclinical investigations for the Chagas vaccine candidate, Tc24.
  • this antigen had been tested as a DNA vaccine and more recently as a recombinant protein subunit vaccine (Martinez- Campos et al., 2015; Dumonteil et al., 2004).
  • significant aggregation of the antigen was observed with both the His-tagged and tag-less Tc24- WT proteins. Because the reduction of either version of Tc24-WT resulted in significantly decreased aggregation, embodiments of the disclosure concern the mutation of the protein' s cysteine residues.
  • the yield from this process was approximately 56 mg of protein per liter of culture which represents a recovery of approximately 40% compared to the starting material (142 mg Tc24-WT + His per liter of fermentation biomass).
  • the low yield per liter was due to the low biomass generated from the shake flask cultures (4-5 grams per liter).
  • Analysis of both the in- process as well as the final purified protein by non-reducing SDS-PAGE and Western blot revealed significant aggregation of the protein (FIG. 1A). Aggregation of this nature poses a significant hurdle for scale up production of any candidate vaccine and thus needed to be addressed.
  • Tc24-WT + His prior to SDS-PAGE and Western analysis there was a significant decrease in protein aggregation (FIG.
  • Tc24-C2 contained two mutations (C4S, C66S) and Tc24-C4 was derived by mutating all four cysteine residues (C4S, C66S, C74S, and C124S) (FIG. 2).
  • Tc24-C4 Based on the reduced aggregation observed with Tc24-C4, it was selected for further scale-up and pre-clinical testing. SDS-PAGE analysis of reduced and non-reduced in process samples of Tc24-C4 from crude E. coli lysate to final purified protein is shown in FIG. 7A and FIG. 7B. After ion exchange (QXL) chromatography, where the protein eluted at 80 mM NaCl, Tc24-C4 had a purity of >94% (reduced) and >96% (non-reduced). After a subsequent size exclusion chromatography step, Tc24-C4 had a purity of >99% (reduced) and >98% (non- reduced) (FIG.
  • QXL ion exchange
  • Tc24-C4 The final recovery of Tc24-C4 was 52% of the starting amount with a yield of 2,664 mg per liter of fermentation harvest (Table 1). The high yield and purity for Tc24-C4 allowed for initial pre-clinical immunogenicity testing of the candidate antigen.
  • Tc24-WT, Tc24-C2 and Tc24-C4 plus an alkylated version of Tc24-WT + His were compared in a short-term stability study. After 10 days at 4°C, protein samples were separated by SDS-PAGE and a Western blot was performed. As anticipated, there was strong aggregation with Tc24-WT + His, which could be eliminated by alkylation of the cysteines. Tc24-C2 and Tc24-C4 preparations exhibited enhanced stability, reduced aggregation, correlating with the number of cysteines removed from their sequence (FIG. 4).
  • FIG. 5 shows the average hydrodynamic radius and the polydispersity of the different Tc24 proteins after 2 days at 4°C. Whereas the radius of the Tc24-WT + His protein was approximately 3.2 nm, elimination of most disulfide bond formation through alkylation (Tc24-WT + His, alkylated) reduced the average size of the protein to less than 2.6 nm, indicative of a reduction in the amount of aggregated protein.
  • Tc24-C2 and Tc24-C4 exhibited a reduced average hydrodynamic radius and moreover, a significant reduction in polydispersity (12%) when compared to Tc24-WT + His (21%), which supports the conclusion that elimination of disulfide bond formation results in a more consistent, monodispersed recombinant protein, stable for at least 10 days at 4°C.
  • Circular dichroism was performed to investigate the impact of the cysteine mutagenesis on the secondary structure of Tc24.
  • the CD analysis demonstrated identical secondary structures, characteristic of alpha-helical proteins, for all Tc24 variants (FIG. 6A). Specifically, based on comparison with two reference sets using CONTENT, SELCON, and CDSSTR data fitting programs (Sreerama et al., 2004) the protein was predicted to fold into 70% alpha helix, 7% Beta sheet and 23% turns and loops. In addition, the tertiary folding of the proteins was compared by thermal melt analysis (FIG. 6B), where Tc24 WT and Tc24-C4 display similar melting behavior, indicating that the removal of the cysteine residues had no detrimental impact on folding.
  • IFNy secretion was measured from splenocytes harvested from vaccinated mice and re-stimulated in vitro with homologous or heterologous proteins (FIG. 8A, FIG. 8B). The results showed that IFNy secretion was similar between groups, regardless of the protein used for re-stimulation. Although the mean IFNy production observed for Tc24-C4 was lower than that for the other groups, the differences were not significant. IFNy secretion from mice vaccinated with Tc24 C4 combined with E6020 in a stable squalene emulsion was significantly increased compared to mice vaccinated with Tc24 C4 (protein only) or E6020 SE alone (adjuvant only control).
  • Tc24-specific IgG2a antibody titers were also measured from the serum of vaccinated mice (FIG. 9). Although terminal Tc24 specific antibody titers in mice vaccinated with Tc24-C4 were significantly lower (1 :25,600 dilution) compared to mice vaccinated with Tc24-WT + His protein (> 100K dilution), similar antibody titers were observed for mice which had been vaccinated with non-tagged Tc24-WT.
  • Tc24-C4 no His antigen is both immunogenic in na €ive mice, and protective in acutely infected mice.
  • Tc24 a T. cruzi 24 kDa parasite excretory-secretory protein has been selected as a lead antigen for the Chagas vaccine under development by the Sabin Vaccine Institute Product Development Partnership (Sabin PDP).
  • the protein expresses at both a high yield and solubility in the E. coli T7 expression system.
  • aggregation of the wild-type protein became apparent which had to be resolved in order to move a Chagas vaccine development program forward. There was evidence that the aggregation observed was mostly due to the formation of disulfide bridges between Tc24 monomers.
  • the approach selected to minimize or eliminate the aggregation observed was to mutate the cysteine residues present in the molecule to serine residues, which would eliminate aberrant disulfide bond formation without introducing local structural changes within the molecule. Changing the protein in such a fashion did have the desired impact on the aggregation; whereas elimination of two cysteine residues partially eliminated the aggregation, elimination of all four cysteine residues almost completely abolished protein aggregation. This change made it possible to develop a scalable and efficient production process that resulted in a doubling of the overall yield of protein after fermentation. Most importantly, due to the elimination of aggregation, less protein was lost during purification.
  • Tc24-C4 met the requirements for large scale production.
  • Tc24-C4 had retained the immunogenic and antigenic properties of the parent molecule.
  • Studies in Chagasic humans had shown an inverse correlation between disease severity and the magnitude of a TiJ skewed antigen specific immune response (Laucella et al., 2004).
  • mice vaccinated with either wild-type or mutant Tc24 proteins develop antigen specific T l immune responses upon homologous re- stimulation as evidenced by IFN " production from splenocytes re-stimulated in vitro and serum IgG2a production.
  • IFN IFN-induced immunogenicity
  • IgG2a titers to the Tc24-WT in mice vaccinated with the Tc24-C4 construct were significantly lower than titers in mice vaccinated with Tc24-WT. This suggests that the cysteine to serine mutations did impact native B cell epitopes responsible for inducing the humoral response. Induction of antigen specific antibody production from B cells depends on the engagement of surface B cell receptors by antigen presented on MHC Class II receptors
  • mice vaccinated with the Tc24-C4 construct were a mean of 1 :25,600 which indicates that there is appreciable recognition of native B cell epitopes by Tc24-C4 specific antibodies, but at a lower level than what is induced by vaccination with the Tc24-WT construct. This suggests that vaccination with the Tc24-C4 protein induced a robust immune response that can recognize native proteins, but without excessive induction of antibodies that might result in immune mediated adverse effects in the host. Taken together, these data indicate that mice vaccinated with mutant proteins develop both cellular and humoral immune responses that will recognize native Tc24 protein upon challenge with T. cruzi parasites.
  • the present examples demonstrates that the production process for Tc24-C4 is reproducible, robust, and yields a recombinant protein with ideal analytical characteristics and stability profiles.
  • Tc24-C4 was expressed at the 10 L scale using a Celligen 310 Benchtop fermentation system (Eppendorf). Briefly, 10 L of E. coli Basal Salt medium was inoculated with a seed culture to a starting OD 60 o of 0.05, and grown at 37 °C. At an OD 60 o of 0.5, the temperature was reduced to 30 °C. At an OD 60 o between 0.6 and 1.0, isopropyl ⁇ -D-l- thiogalactopyranoside was added to a final concentration of 1 mM. Approximately 5 h after induction, fed-batch medium (50 % v/v glycerol, 20 mM MgCl 2 ) was added at 3 mL/L/hr.
  • fed-batch medium 50 % v/v glycerol, 20 mM MgCl 2
  • Tc24-C4 was purified in three separate purification runs from frozen biomass obtained from three separate 10 L fermentations. In each purification run, 200 g of E. coli biomass was thawed and lysed in 50 mM Tris-HCl pH 8.0 using an Avestin Emulsiflex C55 high-pressure homogenizer and heat exchanger. The concentration of Tc24-C4 in the homogenate was determined on pre-cast 12 % Bis-Tris SDS-PAGE gels (Invitrogen) stained with Coomassie blue, using purified Tc24-C4 as the calibration standard.
  • a volume of lysate equal to 3,200 mg of Tc24-C4 was clarified using a GE Healthcare Ultrafiltration Hollow Fiber cartridge (nominal molecular weight cutoff 750 kDa, 2800 cm 2 ).
  • the hollow fiber-clarified permeate was loaded onto a 373 mL GE Healthcare Q Sepharose XL column, which was then washed with lysis buffer and then with 75 mM NaCl.
  • Tc24-C4 was eluted with 125 mM NaCl, and fractions from the peak were pooled starting at approximately 67 % of the maximum peak height until the end of the peak.
  • the eluate was concentrated 24-34-fold with two flat-sheet tangential flow filtration cassettes (Sartorius Sartocon Slice 200 Hydrosart, nominal molecular weight cutoff 10 kDa, 0.02 m 2 ) to a concentration of 16-17 mg/mL, as measured by absorbance at 280 nm on a Nanodrop 2000 spectrophotometer (Thermo Fisher), using a molecular weight of 23,660 Da and molar extinction coefficient of 20,970 M '1 cm '1 .
  • the concentrated pool was loaded in two cycles onto a 4 L GE Healthcare Sephacryl S-200 High Resolution column, and eluted with 1 * phosphate-buffered saline pH 7.4.
  • Tc24-C4 Purified recombinant Tc24-C4 was characterized according to guideline Q6B of the International Committee on Harmonization. Color and appearance were visually assessed on an illuminated visual inspection hood (Bosch, Model MIH DX). pH was measured using a PerpHect microelectrode (Orion, Model 8220BNWP) and a Versa Star pH meter (Orion, Model VSTAR90). Protein concentration was determined by absorbance at 280 nm on an Ultrospec 6300 pro spectrophotometer (Amersham Biosciences), using a molecular weight of 23,660 Da, a molar extinction coefficient of 20,970 M "1 cm "1 , and a path length of 1 cm.
  • Tc24-C4 On SDS-PAGE gels stained with Coomassie blue, Tc24-C4 migrated as a single band with molecular weight 27.2 ⁇ 0.3 kDa and purity above 97 %. On silver-stained SDS- PAGE gels, Tc24-C4 from the third purification run was less pure (86.3 ⁇ 8.6 %) than lots from the second (90.0 ⁇ 3.9 %) and first run (94.5 ⁇ 2.0 %). Although silver staining is less
  • Tc24-C4 also reacted as a single 28 kDa band with in-house antibodies raised against wild-type Tc24 that was produced in yeast (FIG. 14C).
  • An E. coli host-cell protein with a molecular weight of approximately 18 kDa was also detected by western blot in all three lots.
  • Tc24 eluted from a C4 reversed-phase column as a single peak at 19.36 ⁇ 0.01 min, with purity 98 % or better. Small differences in purity were observed between the three lots, following similar trends noted on silver-stained SDS-PAGE gels.
  • the data indicate that three independent runs yielded comparable lots with a coefficient of variation of less than 6 % for all parameters tested, despite slight differences in the fractions pooled during size-exclusion chromatography.
  • Tryptophan and cysteine content was not experimentally determined, and is excluded from analysis. Experimental values are mean ⁇ SD of three lots, each measured in duplicate.
  • Tc24-C4 After 17-18 months at -80 °C, Tc24-C4 remained clear, nonviscous, and colorless, with pH 7.32 ⁇ 0.04, concentration between 1.5 and 1.8 mg/mL, and purity 98 % or better by C4 reversed-phase chromatography. On SDS-PAGE gels stained with Coomassie blue, Tc24-C4 migrated as a single band with molecular weight 27.9 ⁇ 0.5 kDa and purity above 95 %. Taken together, the data indicate that the antigen is stable over long-term storage at -80 °C.
  • Tc24-C4 The data indicate that the production process for E. co/i-expressed Tc24-C4 protein is robust, and reproducibly yields protein lots with consistent analytical characteristics, freeze-thaw, accelerated, and long-term stability profiles. Like most proteins, Tc24-C4 should be stored at -80 °C, but is also stable at 4 °C and room temperature for at least 30 days, and up to 7- 15 days at 37 °C. The data also indicate that the main pathway of degradation is proteolysis. Thus, Tc24-C4 is suitable for technology transfer, cGMP production, and clinical testing based on process robustness, analytical characteristics, and stability.
  • Gupta S Garg J. TcVac3 induced control of Trypanosoma cruzi infection and chronic myocarditis in mice. PloS one. 2013;8:e59434.
  • Gupta S Garg NJ. Prophylactic efficacy of TcVac2 against Trypanosoma cruzi in mice. PLoS neglected tropical diseases. 2010;4:e797.
  • Gupta S Garg NJ. Delivery of antigenic candidates by a DNA/MVA heterologous approach elicits effector CD8(+)T cell mediated immunity against Trypanosoma cruzi. Vaccine. 2012;30:7179-86.
  • Hotez PJ Bottazzi ME
  • Franco-Paredes C Ault SK
  • Periago MR The neglected tropical diseases of Latin America and the Caribbean: a review of disease burden and distribution and a roadmap for control and elimination.
  • PLoS neglected tropical diseases.
  • Pinazo MJ Munoz J Fau - Posada E, Posada E Fau - Lopez-Chejade P, Lopez-Chejade P Fau - Gallego M, Gallego M Fau - Ayala E, Ayala E Fau - del Cacho E, et al. Tolerance of benznidazole in treatment of Chagas' disease in adults. 2010; 54(l l):4896-9. Pinazo MJ, Guerrero L, Posada E, Rodriguez E, Soy D, Gascon J. Benznidazole-related adverse drug reactions and their relationship to serum drug concentrations in patients with chronic chagas disease.
  • MF59 oil-in- water emulsion in combination with a synthetic TLR4 agonist is a potent adjuvant for a combination Meningococcus vaccine. 2012; 8(4):486-90.
  • Sreerama Woody RW. Computation and analysis of protein circular dichroism spectra. Methods in enzymology. 2004;383 :318-51.
  • Taibi A Espinoza AG, Ouaissi A. Trypanosoma cruzi: analysis of cellular and humoral response against a protective recombinant antigen during experimental Chagas' disease. Immunology letters. 1995;48: 193-200.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicinal Preparation (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Embodiments of the disclosure concern methods and compositions related to a particular immunogenic composition that comprises the Trypanosoma cruzi Tc24 protein having substitutions at four cysteine residues to improve stability and/or decrease aggregation. The compositions are useful for immunoprotection related to medical conditions caused by T. cruzi, particularly in mammals susceptible thereto.

Description

Tc24-C4, A CHAGAS DISEASE VACCINE ANTIGEN WITH IMPROVED STABILITY
AND DECREASED AGGREGATION
[0001] This application claims priority to U. S. Provisional Patent Application Serial No. 62/308,054, filed March 14, 2016, which is incorporated by reference herein in its entirety.
TECHNICAL FIELD
[0002] Embodiments of the present disclosure concern at least the fields of cell biology, molecular biology, biochemistry, immunology, and medicine.
BACKGROUND
[0003] Chagas disease, caused by infection with an intracellular protozoan T. cruzi, is a major public health issue, particularly in the Americas, with approximately 9-10 million infected, 10,600 deaths each year and an estimated $7.2 billion in annual economic losses. Due to the limited efficacy of current available drugs, nifurtimox and benznidazole, on the chronic phase of T. cruzi infection that causes major pathology and deadly cardiomyopathy and their serious side effects, developing a vaccine to reduce the disease and prevent the infection is urgent.
[0004] In an effort to identify antigens with potential vaccine efficacy using mouse models, several parasite antigens, TSA-1 and Tc24 in particular, have emerged as promising candidates. These antigens, alone or in combination, have been found to be able to control a T. cruzi infection in mice. Tc24 is a 24 kDa calcium-binding protein localized to the flagellar pocket of the parasite and functions as a J! cruzi immune modulator. Mice immunized with DNA vaccines of Tc24 and TSA1 showed significantly reduced parasitemia and inflammation in the heart, and the protective efficacy was concomitant with strong induction of parasite-specific IFNy producing CD4(+) and CD8(+) T cells.
[0005] However, because of efficacy, safety and regulatory concerns with DNA vaccines, a protein vaccine is preferred. Embodiments of the present disclosure provide a solution to a longfelt need in the art to provide an effective immunogenic composition, such as a vaccine, for Chagas disease that is able to be produced in large quantities. BRIEF SUMMARY
[0006] Embodiments of the disclosure encompass methods and/or compositions for treating and/or preventing a medical condition. In specific embodiments, the disclosure concerns methods and compositions related to a medical condition caused by a species of the protozoan Trypanosoma, including at least Trypanosoma cruzi. The medical condition is Chagas disease, in specific aspects.
[0007] In particular embodiments, the methods and/or compositions of the disclosure relate to a protein of the protozoan Trypanosoma, such as Trypanosoma cruzi. Particular aspects of the disclosure concern compositions related to a protein of the flagellar pocket of
Trypanosoma cruzi, such as Tc24. Certain embodiments concern non-natural derivatives of the wild-type Tc24 protein that have reduced aggregation activity upon production, purification, and/or formulation compared to a wild-type version. In specific embodiments, the non-natural version of the Tc24 comprises 1, 2, 3, or 4 fewer cysteine residues compared to the wildtype Tc24. Specific embodiments encompass Tc24 derivatives that comprise no cysteine residues. In specific embodiments, all four cysteine residues of the wildtype Tc24 protein are substituted, including with conservative substitutions, for example. In specific embodiments, the substitutions may be to serine, methionine, or threonine, for example, and each of the four substituted cysteines may or may not be substituted with the same substitute amino acid.
[0008] Methods of using compositions of the disclosure are encompassed herein, including methods of providing an effective amount of the compositions to an individual in need thereof. The individual may be an individual who already has a disease caused by a
Trypanosoma species or that is seropositive or has been exposed to the parasite. The individual may have been previously infected with a Trypanosoma species, exposed to a Trypanosoma species, suspected of having been exposed to a Trypanosoma species, be seropositive for a Trypanosoma species, or there is evidence that the individual has been infected. In specific embodiments, the Trypanosoma species is T. cruzi.
[0009] In one embodiment there is at least one composition comprising a non-natural Trypanosoma cruzi Tc24 polypeptide, wherein the polypeptide lacks 1, 2, 3, or all cysteine residues of the wild-type Tc24 protein. The composition may be further defined as comprising one or more amino acid substitutions at 1, 2, 3, or all cysteine residues of the wild-type Tc24 polypeptide. The substitution may be to a serine, methionine, or threonine. In specific embodiments, the composition is further defined as comprising the sequence of SEQ ID NO:2. The polypeptide may comprise one or more modifications other than the modification(s) to one or more of the cysteine residues, in at least some cases. For example, the polypeptide comprise an N-terrninal truncation, a C-terminal truncation, or both.
[0010] In certain embodiments, a composition may comprise an adjuvant, such as one or more TLR-4 receptor agonists. The adjuvant may comprise synthetic TLR4 agonist E6020, squalene oil-in-water emulsions, liposomes, TLR9 agonists, TLR9 ligands, or a combination thereof, in some cases. In specific embodiments, the composition comprises microparticles or nanoparticles. In specific cases, the composition comprises aluminum salts, emulsions, poly(lactic-co-glycolic acid) (PLGA) microspheres; lipidoids; lipoplex; liposome; polymers; carbohydrates; oligonucleotides, cationic lipids; fibrin gel; fibrin hydrogel; fibrin glue; fibrin sealant; fibrinogen; thrombin; rapidly eliminated lipid nanoparticles; or combinations thereof. Any composition may be formulated in a pharmaceutically acceptable carrier.
[0011] In one embodiment, there is provided a method of treating or preventing a medical condition caused by Trypanosoma cruzi in an individual, comprising the step of providing to the individual an effective amount of a composition that comprise a non-natural Tc24 protein comprising amino acid substitution at least at 1, 2, 3, or all cysteine residues of the wild-type Tc24 protein. The individual may be a human, horse, cow, dog, cat, goat, sheep, or Pig-
[0012] In a certain embodiment, there is a method of treating or preventing a medical condition caused by Trypanosoma cruzi in an individual, comprising the step of providing to the individual an effective amount of a composition encompassed by the disclosure. In specific aspects, the individual is a human, horse, cow, dog, cat, goat, sheep, or pig. The method may further comprise the step of diagnosing the medical condition. In a specific embodiment, the individual has a medical condition caused by Trypanosoma cruzi, is seropositive for
Trypanosoma cruzi, has been exposed to Trypanosoma cruzi, was previously infected with Trypanosoma cruzi, resides in a region known to have Trypanosoma cruzi, or has been or will be traveling to a region known to have Trypanosoma cruzi.
[0013] In one embodiment, there is provided a method of producing an immunogenic composition for the treatment or prevention of a medical condition caused by Trypanosoma cruzi, comprising the step of modifying Tc24 polypeptide, or a functionally active fragment thereof, to lack one or more cysteine residues compared to wildtype Tc24 polypeptide.
[0014] In one embodiment, there is provided a method of producing an immunogenic composition for the treatment or prevention of a medical condition caused by Trypanosoma cruzi, comprising the step of modifying Tc24 polypeptide, or a functionally active fragment thereof, to produce a mutant Tc24 that aggregates less and/or has longer storage capacity compared to wildtype Tc24 polypeptide. In specific embodiments, the method further comprises the step of providing an effective amount of the polypeptide to an individual in need thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] FIGS. 1 A and IB provide SDS-PAGE and Western Blot Analysis of Tc24- WT+His in-process samples. Samples were separated on 4-12% Bis-Tris gels under Non- Reduced (FIG. 1A) and Reduced (FIG. IB) conditions. Lane 1 : SeeBlue Plus Molecular Weight marker (10 μΐ). Lane 2: Starting Material (7.5 μΐ). Lane 3 : IMAC eluate (7.5 μΐ). Lanes 4-5 QXL eluate (2.5 μΐ and 1.3 μΐ load). Lanes 6-7: Final Tc24-WT+His (4 μΐ and 2 μΐ load). Western Blots (Primary Ab: in house mouse anti-Tc24 1 :2500; Secondary Ab: goat anti -mouse IgG alkaline phosphatase conjugate 1 :7500).
[0016] FIG. 2 provides a Tc24 Amino Acid Sequence Alignment. Amino acid sequence alignment of wild-type and the cysteine-mutated Tc24 constructs. The cysteine and serine residues of interest are underlined. (SEQ ID NOS. 4, 6, and 2)
[0017] FIGS. 3 A, 3B, and 3C demonstrate a western Blot comparison of Tc24-WT (FIG. 3A), Tc24-C2 (FIG. 3B), and Tc24-C4 (FIG. 3C) purified proteins. Lanes 1-3 : Non- Reduced. Lane 4: SeeBlue Plus Molecular Weight Marker. Lanes 5-7 Reduced. Lanes 1,5 : Sample before size-exclusion chromatography (SEC) 8 μg load. Lanes 2,6: Post SEC low load (3 μg). Lanes 3,7: Post SEC high load (8 μg). Detection was performed using mouse polyclonal antibody against Tc24 expressed in Pichia pastoris as primary antibody diluted 1 :2500 in PBST and an alkaline phosphatase conjugated goat anti-mouse secondary antibody diluted 1 :7500 in PBST.
[0018] FIG. 4 shows stability assessment of Tc24. Western blot of different Tc24 constructs, taken after storing the proteins for 10 days at 4 °C in PBS. Lane 1 : Tc24-WT+His, Lane 2:Tc24-WT+His, alkylated, Lane 3 : Tc24-WT, Lane 4: Tc24-C2, Lane 5 : Tc24-C4. A ponceau-stained Mark 12 protein ladder was used as a MW reference. Detection was performed using mouse polyclonal antibody against Tc24 expressed in Pichia pastoris as primary antibody diluted 1 :2500 in PBST and an alkaline phosphatase conjugated goat anti-mouse secondary antibody diluted 1 :7500 in PBST.
[0019] FIG. 5 shows hydrodynamic radius and polydispersity of Tc24 antigens after 3 days at 4°C. Tc24-C4 was noticeably the most monodispersed product.
[0020] FIGS. 6A and 6B show structural comparison of Tc24 constructs. (FIG. 6A) Circular Dichroism (CD). Far UV CD spectrum of different constructs of Tc24 were taken on a Jasco J- 1500. All tested Tc24 protein have a virtual identical CD profile with overlapping spectra. Negative peaks at 222 nm and 208 nm and a positive peak at 193 nm indicate that Tc24 is an a-helical protein. (FIG. 6B) Thermal melting profile of Tc24-WT and Tc24-C4 measured using Protein Thermal Shift™ kit (Life Technologies).
[0021] FIGS. 7A and 7B provide purification of Tc24-C4. In-process and final Tc24- C4 protein samples separated on a 4-12% Bis-Tris SDS PAGE gel under reducing (FIG. 7A) and non-reducing (FIG. 7B) conditions. Lanes 1 : SeeBlue Plus 2 molecular weight marker. Lanes 2: Cell Lysate (3 μg). Lane 3 : QXL1 elution (3 μg). Lane 4: QXL2 elution (3 μg). Lane 5 :
Concentrated QXL (8 μg). Lane 6: SEC elution (3 μg). Lane 7: SEC elution (8 μg). Lanes 2-7: Non-reduced. Lanes 9-14: Reduced.
[0022] FIGS. 8A and 8B demonstrate IFNy Measurements after Homologous or Heterologous Stimulation of Vaccinated Mice by ELISA. IFNy concentrations in supernatants from splenocytes harvested from mice vaccinated with the indicated protein combined with E6020 emulsified in squalene-oil-in-water (AddaVax™, Invivogen) and restimulated in vitro with homologous recombinant protein (FIG. 8A) or mice vaccinated with Tc24 wt No His combined with E6020 emulsified with squalene-oil-in-water (AddaVax™, Invivogen) and re stimulated in vitro with heterologous protein as indicated (FIG. 8B). No statistically significant differences in antigen specific IFNy secretion.
[0023] FIG. 9 shows Measurement of IgG2a in Vaccinated Mice by ELISA. Anti-Tc24 IgG2a antibody titers in terminal serum were measured by ELISA for wild-type and mutant Tc24 constructs. Mice vaccinated with Tc24-C4 had significantly lower titers of Tc24 specific antibodies compared to mice vaccinated with Tc24-WT +His. (p=0.0021). [0024] FIGS. 1 OA- IOC demonstrates specificity of Antibodies from Infected Mice against wild-type and mutant Tc24 constructs. Antibodies from mice infected with T. cruzi parasites were evaluated for specificity against either Tc24-WT (non-tagged) or Tc24- C4 by ELISA (FIGS 10A 10B, IOC). Plates were coated with either antigen and bound antibodies were detected using labeled goat anti-mouse IgG2a secondary antibodies. Geometric mean titers were calculated.
[0025] FIG. 11 shows freeze-thaw stability of Tc24-C4 purified in three independent runs, as indicated by select stability indicators, including pH, A280/A275 + A280/A258 value, molecular weight on Coomassie-stained non-reduced SDS-PAGE gels, and purity on reversed- phase HPLC. Data are mean ± SD.
[0026] FIG. 12 demonstrates accelerated stability of Tc24-C4 purified in three independent runs, as measured by select stability indicators, including pH, A280/A275 + A280/A258 value, molecular weight on non-reduced Coomassie-stained SDS-PAGE gels, and purity on reversed-phase HPLC. Data represent mean ± SD.
[0027] FIG. 13 shows purification of Tc24-C4 from E. coli. Samples from each purification step were analyzed by staining with Coomassie blue, and by Western blot for E. coli host-cell proteins.
[0028] FIGS. 14A-14C show SDS-PAGE as an indicator of Tc24-C4 identity and stability. (FIG. 14A) Tc24-C4 incubated with 1/500 (w/w) protease and 0.2 % formaldehyde in the absence or presence of Ca2+, which appears to protect a small subdomain (red *) against proteolysis. (FIG. 14B) Lc24-C4 after 30 ± 1 days at 4 °C, room temperature, and 37 °C, with accelerated degradation apparent at 37 °C (red *). Samples are from three independent production runs. (FIG. 14C) Western blot analysis. Numbers indicate the amount ^g) of Tc24- C4 loaded in the lane, while B and E are 2 μg BSA and 35 μg E. coli host-cell proteins.
[0029] FIGS. 15A - 15C demonstrate reversed-phase ECPLC on a C4 column as an indicator of stability. (FIG. 15 A) Tc24-C4 incubated with 1/500 w/w protease and 0.2 % formaldehyde, and analyzed separately or as a pool. (FIG. 15B) Time course of Tc24-C4 degradation when incubated with 1/500 w/w protease at 4 °C, with % purity indicated. (FIG. 15C) Accelerated degradation (D) of Tc24-C4 Run 3 after 30 days at 37 °C. [0030] FIGS. 16A-16B show UV absorbance spectra as stability indicator. (FIG. 16A) Tc24-C4 incubated overnight at room temperature with 1/500 w/w protease in the absence or presence of Ca2+. (FIG. 16B) Time course of A280/A275 + A280/A258 value of Tc24-C4 incubated with 1/500 w/w protease and with 0.1 % acetic acid in the presence or absence of Ca2+.
[0031] FIG. 17 provides a representative mass spectrum indicating the presence of a gluconylated form (red arrowhead) in a preparation of recombinant Tc24-C4 (blue arrowhead).
DETAILED DESCRIPTION
[0032] As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one. As used herein "another" may mean at least a second or more. In specific embodiments, aspects of the invention may "consist essentially of or "consist of one or more elements or steps of the invention, for example. Some embodiments of the invention may consist of or consist essentially of one or more elements, method steps, and/or methods of the invention. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein.
[0033] The scope of the present application is not intended to be limited to the particular embodiments of the process, machine, manufacture, composition of matter, means, methods and steps described in the specification.
[0034] Embodiments of the disclosure concern methods and compositions for treating or preventing a medical condition caused by a Trypanosoma species, such as Trypanosoma cruzi, which is a species of parasitic euglenoid protozoan that bores tissue in its host and feeds on blood and lymph, resulting in disease. Mammals are susceptible to trypanosomes, and the disease or the likelihood of disease varies with the organism. Trypanosomes require a host body and the haematophagous insect triatomine (descriptions "assassin bug", "cone-nose bug", and "kissing bug") is a common vector for a mechanism of infection.
[0035] Particular embodiments of the disclosure concern immunogenic compositions, including vaccines, for the protection of an individual from a Trypanosoma species, such as T. cruzi. The disclosure also concerns improved methods of producing immunogenic compositions. The methods and compositions concern a mutated version of a particular T. cruzi protein, Tc-24. In specific aspects, cysteine mutagenesis of the Tc-24 protein improves production of a recombinant protein immunogenic composition for human Chagas disease without abrogating antigenicity. A need for such an improvement in the art was realized upon generation of a wildtype (but codon optimized for E. coli expression) recombinant protein vaccine that upon production at a large scale through fermentation became increasingly aggregated especially during purification and storage at temperatures above the freezing point.
I. Embodiments of Compositions
[0036] The present disclosure provides Tc24 is an immunogenic composition for preventing or treating a disease caused by T. cruzi infection, such as Chagas disease in humans. In particular embodiments the compositions comprise one or more modifications compared to the Tc24 protein found in nature. The modification(s), in specific embodiments, concern at least one of four cysteine residues that likely cause intermolecular disulfide bridges and protein aggregation during purification or storage (such as prolonged storage at 2°C or higher temperatures). In specific aspects, prolonged storage refers to two or more days. The compositions of the disclosure have storage capability for at least three weeks (for example) compared to storage of a Tc24 protein that lacks any modifications directed toward at least one cysteine.
[0037] In some embodiments of the disclosure, a polypeptide is analyzed for aggregation by quantifying the % monomer by SDS-PAGE analysis, HPLC size exclusion or dynamic light scattering, for example. Aggregated protein %=100%-monomer%. The dynamics of the aggregation process are mainly driven by concentration and temperature, which may be determined and utilized according to standard practices in the art.
[0038] Embodiments of the disclosure concern certain Tc24 polypeptides and also polynucleotides that express the polypeptides. Specific embodiments provide constructs that encode Tc24 with one or multiple cysteine residues mutated. In specific embodiments, a particular construct referred to as Tc24-C4, with 4 cysteine residues mutated to serine residues, was genetically engineered and is encompassed herein. Recombinant Tc24-C4, as an example composition, was expressed in E. coli (BL21) as soluble protein with similar yields as Tc24, but without any aggregation during purification process. The purified Tc24-C4 did not form any aggregation after being stored at 4°C for 9 days, as determined by Western blot, light-scattering and HPLC-RP, for example. Vaccine efficacy assays using mouse challenge models showed mice immunized with Tc24-C4 formulated with the immunostimulant E6020-SE (squalene oil- in-water emulstion) were similarly protected as mice immunized with Tc24 + E6020-SE, as judged by mouse survival rate and parasitemia levels in blood.
[0039] The disclosure concerns non-natural Tc24 polypeptides and their use for a medical purpose. The non-natural Tc24 polypeptides may have any kind of modification compared to wildtype Tc24, but in particular embodiments the modification occurs at least at 1, 2, 3, or all cysteine sites in the naturally occurring polypeptide. In at least some cases, there may be further modifications in addition to the modification(s) at 1, 2, 3, or all cysteine residues. For example, other amino acid(s) than cysteine may be modified. Other modifications may be made for any purpose, such as to increase immunogenicity, to improve folding, to enhance purification, to increase storage length, to reduce aggregation, and a combination thereof.
Examples of modifications include amino acid substitution, deletion, inversion, addition, truncation (C-terminal and/or N-terminal), and so forth. In embodiments wherein amino acid(s) are substituted, the substitution may or may not be conservative. In cases wherein the cysteine residue(s) are substituted, the substitution may or may not be conservative. However, to encourage proper folding, the substitutions at cysteine may be to serine, methionine, or threonine. In a given Tc24 polypeptide, when multiple cysteines are mutated they may or may not be substituted with the same amino acid.
[0040] A nucleotide sequence for Tc24 using an isolate of T. cruzi from the Yucatan, Mexico is as follows:
[0041]
ATGGGTGCTTGTGGGTCGAAGGGCTCGACGAGCGACAAGGGGTTGGCGAGCGATAAGGACGGCAAGAACGCCAA GGACCGCAAGGAAGCGTGGGAGCGCATTCGCCAGGCGATTCCTCGTGAGAAGACCGCCGAGGCAAAACAGCGCC GCATCGAGCTATTCAAGAAGTTCGACAAGAACGAGACTGGGAAGCTGTGCTACGATGAGGTGCACAGCGGCTGC CTCGAGGTGCTGAAGTTGGACGAGTTCACGCCGCGAGTGCGCGACATCACGAAGCGTGCGTTCGACAAGGCGAG GGCCCTGGGCAGCAAGCTGGAGAACAAGGGCTCCGAGGACTTTGTTGAATTTCTGGAGTTCCGTCTGATGCTGT GCTACATCTACGACTTCTTCGAGCTGACGGTGATGTTCGACGAGATTGACGCCTCCGGCAACATGCTGGTCGAC GAGGAGGAGCTCAAGCGCGCCGTGCCCAAGCTTGAGGCGTGGGGCGCCAAGGTCGAGGATCCCGCGGCGCTGTT CAAGGAGCTCGATAAGAATGGCACTGGGTCCGTGACGTTCGACGAGTTTGCAGCGTGGGCTTCTGCAGTCAAAC TGGACGCCGACGGCGACCCGGACAACGTGCCGGAGAGCGCG ( SEQ ID NO : 3 )
[0042] E. coli codon optimized DNA sequence for wild type Tc24 (Tc24-WT) is as follows: ATGGGTGCTTGTGGCTCCAAAGGTTCAACGAGTGATAAAGGTCTGGCTTCGGATAAAGAT
GGTAAAAATGCTAAAGATCGCAAAGAAGCGTGGGAACGTATTCGCCAGGCCATCCCGCGT
GAAAAAACCGCGGAAGCCAAACAACGTCGCATCGAACTGTTCAAAAAATTCGATAAAAAC
GAAACGGGCAAACTGTGCTATGACGAAGTGCATAGCGGTTGTCTGGAAGTTCTGAAACTG
GATGAATTCACCCCGCGTGTCCGCGATATCACGAAACGTGCCTTTGACAAAGCACGCGCT
CTGGGCAGCAAACTGGAAAACAAAGGTTCTGAAGATTTCGTGGAATTCCTGGAAT TCGT
CTGATGCTGTGCTATATTTACGACTTTTTCGAACTGACCGTTATGTTCGATGAAATCGAC
GCAAGCGGCAACATGCTGGTCGATGAAGAAGAACTGAAACGCGCGGTGCCGAAACTGGAA
GCATGGGGTGCTAAAGTTGAAGATCCGGCGGCCCTGTTTAAAGAACTGGACAAAAATGGC
ACCGGTAGTGTTACGTTCGATGAATTTGCAGCTTGGGCGTCCGCCGTCAAACTGGATGCA
GACGGCGACCCGGATAATGTCCCGGAATCAGCC (SEQ ID NO:5)
[0043] 7c24-C4 DNA sequence (E. coli codon optimized) is as follows:
ATGGGTGCTAGCGGCTCCAAAGGTTCAACGAGTGATAAAGGTCTGGCTTCGGATAAAGAT GGTAAAAATGCTAAAGATCGCAAAGAAGCGTGGGAACGTATTCGCCAGGCCATCCCGCGT GAAAAAACCGCGGAAGCCAAACAACGTCGCATCGAACTGTTCAAAAAATTCGATAAAAAC GAAACGGGCAAACTGAGCTATGACGAAGTGCATAGCGGTAGCCTGGAAGTTCTGAAACTG GATGAATTCACCCCGCGTGTCCGCGATATCACGAAACGTGCCTTTGACAAAGCACGCGCT CTGGGCAGCAAACTGGAAAACAAAGGTTCTGAAGATTTCGTGGAATTCCTGGAATTTCGT CTGATGCTGAGCTATATTTACGACTTTTTCGAACTGACCGTTATGTTCGATGAAATCGAC GCAAGCGGCAACATGCTGGTCGATGAAGAAGAACTGAAACGCGCGGTGCCGAAACTGGAA GCATGGGGTGCTAAAGTTGAAGATCCGGCGGCCCTGTTTAAAGAACTGGACAAAAATGGC ACCGGTAGTGTTACGTTCGATGAATTTGCAGCTTGGGCGTCCGCCGTCAAACTGGATGCA GACGGCGACCCGGATAATGTCCCGGAATCAGCC ( SEQ ID NO : l )
[0044] Codons mutated from cysteines to serines are underlined above.
[0045] The 7c24-WT amino acid sequence with the naturally occurring cysteine residues underlined is as follows:
MGACGSKGST SDKGLASDKD GK AKDRKEA WERIRQAIPR EKTAEAKQRR IELF KFDK ETGKLCYDEV HSGCLEVLKL DEFTPRVRDI T KRAFD KARA LGSKLENKGS EDFVEFLEFR L LCYIYDFF ELTVMFDE ID ASGN LVDEE ELKRAVPKLE AWGAKVEDPA ALFKELDKNG TGSVTFDEFA A ASAVKLDA DGDPDNVPES A* ( SEQ ID NO : 4 )
[0046] Tc24-C4 amino acid sequence comprising mutations of all four cysteines:
MGASGSKGST SDKGLASDKD GKNAKDRKEA WERIRQAIPR EKTAEAKQRR IELFKKFDKN ETGKLSYDEV HSGSLEVLKL DEFTPRVRDI TKRAFDKARA LGSKLENKGS EDFVEFLEFR LMLSYIYDFF ELTVMFDEID ASGNMLVDEE ELKRAVPKLE AWGAKVEDPA ALFKELDKNG TGSVTFDEFA AWASAVKLDA DGDPDNVPES A* (SEQ ID NO:2)
[0047] Amino acids mutated from cysteines to serines are underlined.
[0048] In particular embodiments, the immunogenic composition comprises SEQ ID NO:2. In certain aspects, the immunogenic composition comprises the amino acid sequence of SEQ ID NO:4 except that 1, 2, 3, or all cysteine residues are mutated to another amino acid. In specific aspects, the immunogenic composition comprises modifications compared to SEQ ID NO:4 and is at least 70, 75, 80, 85, 90, 95, 97, 98, or 99% identical to SEQ ID NO:4. The immunogenic composition, in particular aspects, is a fragment of SEQ ID NO:4 yet still comprises mutation at one or more cysteine residues within the fragment. In specific aspects, the fragment is at least 100, 125, 150, 175, 180, 185, 190, 195, 200, 205, or 210 amino acids in length. In some cases, the fragment is no more than 100, 125, 150, 175, 180, 185, 190, 195, 200, 205, or 210 amino acids in length. The composition may be a fragment of SEQ ID NO:4 and may also have 1, 2, 3, or 4 cysteines that have been mutated to another amino acid, such as to serine, methionine, or cysteine.
[0049] In certain embodiments, the composition has a modification that is a posttranslational modification. In such cases, the composition may be produced in cells that are not bacterial, such as yeast, mammalian, or insect cells. In specific embodiments, there are more than one posttranslational modifications. Any posttranslational modification may be present on the polypeptide, but in specific embodiments the modification is glycosylation, myristilation, ubiquitination, phosphorylation, acylation, acetylation, alkylation, oxidation, amidation, propionylation, hydroxylation, malonylation, and so forth.
[0050] In certain cases, the Tc24 antigen (such as the Tc24-C4 antigen) is formulated, such as with an immune potentiator or adjuvant. This adjuvant can be, but is not limited to, a TLR4 agonist (such as the synthetic TLR4 agonist E6020 (Eisai Co., Ltd)), for example. In addition, the vaccine formulation can be comprised out of one or more delivery vehicles, such as aluminum salts, emulsions, poly(lactic-co-glycolic acid) (PLGA) microspheres, lipidoids, lipoplex, liposome, polymers, carbohydrates (including simple sugars), oligonucleotides, cationic lipids, fibrin gel, fibrin hydrogel, fibrin glue, fibrin sealant, fibrinogen, thrombin, rapidly eliminated lipid nanoparticles and combinations thereof.
II. Exemplary Methods of Use
[0051] Methods of the disclosure include those for treatment or prevention of a medical condition caused by T. cruzi, such as Chagas disease. In a typical case of Chagas disease, the symptoms change over the duration of the infection. For example, in the beginning stages, the individual is asymptomatic or the symptoms are mild, including, for example, fever, swollen lymph nodes, headaches, and/or localized swelling at the location of the initial bite. After approximately 8-12 weeks, there is onset of the chronic phase of the disease, which may or may not produce further symptoms. However, for some— approximately 25-33% of patients— there are additional symptoms even 10 to 30 years after the initial infection. Such symptoms include damage to and fibrosis of the heart myocardial tissue, arrhythmias and disturbance of the heart electrical conduction system that can result in sudden cardiac death, enlargement of the ventricles of the heart (which may lead to heart failure); an enlarged esophagus; an enlarged colon, neuronal cell loss, microvascular dysfunction, and/or myocardial damage. In addition to insects, the transmission of the pathogen may be spread through blood transfusion, organ transplantation, ingesting contaminated food, or by vertical transmission from mother to child. Diagnosis of early disease may occur by microscopic analysis for the pathogen, while chronic disease may be diagnosed using assays of blood samples for antibodies for T. cruzi, for example. Another way to diagnose is by polymerase chain reaction looking for T. cruzi DNA. In certain embodiments, methods of the disclosure encompass methods of determining that an individual has Chagas disease or has been exposed to or is infected with T. cruzi.
[0052] Embodiments of the disclosure include methods of using compositions encompassed by the disclosure. Although the methods may be for any purpose, in specific embodiments the methods are for a therapeutic purpose, including treatment or prevention of a certain medical condition associated with trypanosomes, including at least Trypanosoma cruzi. In specific embodiments, methods for treating any medical condition for which one or more compositions of the disclosure is therapeutic are encompassed herein. In certain embodiments, the medical condition that is treated or prevented is Chagas disease in humans. The humans may reside in any region of the world or travel to any region of the world, but in specific
embodiments the humans reside in and/or travel to North America, Central America, or South America.
[0053] Methods of the disclosure include methods that concern treatment of a disease caused by T. cruzi. The treatment may result in amelioration of at least one symptom of the disease and/or result in reduction in severity of at least one symptom of the disease, and in some embodiments the treatment results in complete alleviation of at least one symptom of the disease. The outcome of the treatment may occur at any time following the treatment, including within days, weeks, months, or years of the treatment. The treatment methods may be provided to the individual in need thereof only once or multiple administrations. Separate administrations may be separated in time by minutes, days, hours, weeks, months, or years.
[0054] Methods of the disclosure include methods that concern prevention of a disease caused by T. cruzi. The prevention may include delay of onset of at least one symptom of the disease and/or reduction in severity of at least one symptom of the disease, and in some embodiments the prevention concerns complete prevention of at least one symptom of the disease or all symptoms of the disease. In prevention methods, administration of the composition(s) of the disclosure occurs prior to exposure to T. cruzi or after infection but prior to onset of one or more symptoms of a disease caused by T. cruzi, for example. The vaccine may also prevent additional symptoms or further heart damage even after myocardial damage ensues, in at least some cases.
[0055] The individual being provided one or more compositions of the disclosure may be known to have Chagas disease, may be suspected of having Chagas disease, may be traveling to or may have traveled to a region of the world that puts the individual at risk for Chagas disease, may have been exposed to T. cruzi, may have been suspected of having been exposed to T. cruzi, may be in need of routine prevention of Chagas disease, may be seropositive for 71 cruzi, may be in the military or in a vocation that requires travel, and so forth.
[0056] In some aspects of the disclosure, methods of treatment or prevention include administration of an agent that is in addition to the administration of a composition(s) of the disclosure. For example, early infections may be treated with benznidazole or nifurtimox. These two drugs work best for treating the early acute stages of the infection, but do not work as well for later chronic stages. For individuals with chronic disease, these medications may delay or prevent the development of end-stage symptoms. When one or more compositions other than the compositions of the disclosure are provided to an individual for treatment or prevention of a disease caused by T. cruzi, the administration of the two or more agents may be given to the individual at the same time or at separate times. When given at the same time, they may or may not be administered to the individual by the same administration route. When given at separate times, they may or may not be administered to the individual by the same administration route. When given at separate times, the duration of time between delivery of the separate agents may be of any duration, including of minutes, hours, days, months, or years.
[0057] In one embodiment, there is a method of treating a medical condition caused by or in any event related to T. cruzi, wherein an effective amount of a derivative of an antigen from a protein from T. cruzi is provided to an individual in need thereof to invoke an immune response. The immune response may be of any kind, including cellular or humoral immune responses. III. Immunogenic Compositions, Generally
[0058] Embodiments of the disclosure concern immunogenic compositions for treatment or prevention of a medical condition caused directly or indirectly from T. cruzi. As defined herein, an effective amount of an immunogenic composition is provided to an individual in need thereof. The immunogenic composition may be referred to as an antigenic composition. An immunogenic composition of the disclosure is a composition that invokes any kind of immune response in a mammal, including a cell-mediated or humoral response. In some cases, the immunogenic composition may be considered a vaccine.
[0059] For an antigenic composition to be useful, the antigenic composition must induce an immune response to the antigen in a cell, tissue or animal (e.g., a human). As used herein, an "antigenic composition" may comprise an antigen {e.g., a peptide or polypeptide), a nucleic acid encoding an antigen (e.g. , an antigen expression vector), or a cell expressing or presenting an antigen. In particular embodiments, the antigenic composition comprises or encodes all or part of the sequence shown in SEQ ID NO:4, or an immunologically functional equivalent thereof (such as a protein that comprises the sequence of SEQ ID NO:2 but that comprises 1, 2, 3, 4, 5, 6 or more modifications thereto, such as amino acid substitutions, for example). In other embodiments, the antigenic composition is in a mixture that comprises an additional immunostimulatory agent or nucleic acids encoding such an agent.
Immunostimulatory agents include but are not limited to an additional antigen, an
immunomodulator, an antigen presenting cell or an adjuvant, for example. In other
embodiments, one or more of the additional agent(s) is covalently bonded to the antigen or an immunostimulatory agent, in any combination. In certain embodiments, the antigenic composition is conjugated to or comprises an HLA anchor motif amino acids.
[0060] In certain embodiments, an antigenic composition or immunologically functional equivalent, may be used as an effective vaccine in inducing an anti-Tc24 humoral and/or cell-mediated immune response in an animal. The present invention contemplates one or more antigenic compositions or vaccines for use in both active and passive immunization embodiments.
[0061] An immunogenic composition, such as a vaccine, of the present disclosure may vary in its composition of proteinaceous, nucleic acid and/or cellular components. In a non- limiting example, a nucleic encoding an antigen might also be formulated with a proteinaceous adjuvant. Of course, it will be understood that various compositions described herein may further comprise additional components. For example, one or more components may be comprised in a lipid or liposome. In another non-limiting example, an immunogenic composition may comprise one or more adjuvants An immunogenic composition of the present disclosure, and its various components, may be prepared and/or administered by any method disclosed herein or as would be known to one of ordinary skill in the art, in light of the present disclosure.
A. Proteinaceous Antigens
[0062] It is understood that an antigenic Tc24 composition of the present disclosure may be made by a method that is well known in the art, including but not limited to chemical synthesis by solid phase synthesis and purification away from the other products of the chemical reactions by HPLC, or production by the expression of a nucleic acid sequence (e.g. , a DNA sequence) encoding a peptide or polypeptide comprising an antigen of the present invention in an in vitro translation system or in a living cell, for example. Preferably the antigenic composition isolated and extensively dialyzed to remove one or more undesired small molecular weight molecules and/or lyophilized for more ready formulation into a desired vehicle. It is further understood that additional amino acids, mutations, chemical modification and such like, if any, that are made in a vaccine component will preferably not substantially interfere with the antibody recognition of the epitopic sequence.
[0063] Polypeptides may be prepared, e.g. , by recombinant means. In certain embodiments, a nucleic acid encoding an antigenic composition and/or a component described herein may be used, for example, to produce an antigenic composition in vitro or in vivo for the various compositions and methods of the present invention For example, in certain
embodiments, a nucleic acid encoding an antigen is comprised in, for example, a vector in a recombinant cell. The nucleic acid may be expressed to produce a peptide or polypeptide comprising an antigenic sequence. The peptide or polypeptide may be secreted from the cell, or comprised as part of or within the cell.
B. Genetic Vaccine Antigens
[0064] In certain embodiments, an immune response may be promoted by transfecting or inoculating an animal with a nucleic acid encoding an antigen, such as one encoding a non- natural Tc24 antigen of the disclosure. One or more cells comprised within a target animal then expresses the sequences encoded by the nucleic acid after administration of the nucleic acid to the animal. Thus, the vaccine may comprise "genetic vaccine" useful for immunization protocols. A vaccine may also be in the form, for example, of a nucleic acid (e.g., a cDNA or an R A) encoding all or part of the peptide or polypeptide sequence of an antigen. Expression in vivo by the nucleic acid may be, for example, by a plasmid type vector, a viral vector, or a viral/plasmid construct vector.
[0065] In some aspects, the nucleic acid comprises a coding region that encodes all or part of the sequences disclosed as SEQ ID NO: 2 or SEQ ID NO: 4 but with one or more modifications, or an immunologically functional equivalent thereof. Of course, the nucleic acid may comprise and/or encode additional sequences, including but not limited to those comprising one or more immunomodulators or adjuvants. The nucleotide and protein, polypeptide and peptide encoding sequences for various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's Genbank and GenPept databases
(http://www.ncbi.nlm.nih.gov/). The coding regions for these known genes may be amplified, combined with the exemplary sequences disclosed herein {e.g., ligated) and/or expressed using the techniques disclosed herein or by any technique that would be known to those of ordinary skill in the art {e.g., Sambrook et al, 1 87). Though a nucleic acid may be expressed in an in vitro expression system, in preferred embodiments the nucleic acid comprises a vector for in vivo replication and/or expression.
C. Cellular Vaccine Antigens
[0066] In another embodiment, a cell expressing the Tc24 antigen of the disclosure may comprise the immunogenic composition (such as a vaccine). The cell may be isolated from a culture, tissue, organ or organism and administered to an animal as a cellular immunogenic composition (such as a cellular vaccine). Thus, the present disclosure contemplates a "cellular vaccine ." The cell may be transfected with a nucleic acid encoding an antigen to enhance its expression of the antigen. Of course, the cell may also express one or more additional vaccine components, such as immunomodulators or adjuvants. A vaccine may comprise all or part of the cell.
[0067] In particular embodiments, it is contemplated that nucleic acids encoding antigens of the present invention may be transfected into plants, particularly edible plants, and all or part of the plant material used to prepare a vaccine, such as for example, an oral vaccine. Such methods are described in U. S. Patent Nos. 5,484,719, 5,612,487, 5,914, 123, 5,977,438 and 6,034,298, each incorporated herein by reference.
D. Immunologically Functional Equivalents
[0068] As modifications and changes may be made in the structure of an antigenic composition (e.g., a Tc24 mutant) of the present disclosure, and still obtain molecules having like or otherwise desirable characteristics, such immunologically functional equivalents are also encompassed within the present invention.
[0069] For example, in addition to the one or more cysteine residues that are mutated in Tc24, certain amino acids may also be substituted for other amino acids in a peptide, polypeptide or protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies, binding sites on substrate molecules or receptors, DNA binding sites, or such like. Since it is the interactive capacity and nature of a peptide, polypeptide or protein that defines its biological (e.g., immunological) functional activity, certain amino acid sequence substitutions can be made in an amino acid sequence (or, of course, its underlying DNA coding sequence) and nevertheless obtain a peptide or polypeptide with like (agonistic) properties. It is thus contemplated by the inventors that various changes may be made in the sequence of an antigenic composition such as, for example a Tc24 peptide or polypeptide, or underlying DNA, without appreciable loss of biological utility or activity.
[0070] As used herein, an "amino molecule" refers to any amino acid, amino acid derivative or amino acid mimic as would be known to one of ordinary skill in the art. In certain embodiments, the residues of the antigenic composition comprises amino molecules that are sequential, without any non-amino molecule interrupting the sequence of amino molecule residues. In other embodiments, the sequence may comprise one or more non-amino molecule moieties. In particular embodiments, the sequence of residues of the antigenic composition may be interrupted by one or more non-amino molecule moieties.
[0071] Accordingly, antigenic composition, particularly an immunologically functional equivalent of the sequences disclosed herein, may encompass an amino molecule sequence comprising at least one of the 20 common amino acids in naturally synthesized proteins, or at least one modified or unusual amino acid. [0072] In terms of immunologically functional equivalent, it is well understood by the skilled artisan that, inherent in the definition is the concept that there is a limit to the number of changes that may be made within a defined portion of the molecule and still result in a molecule with an acceptable level of equivalent immunological activity. An immunologically functional equivalent peptide or polypeptide are thus defined herein as those peptide(s) or polypeptide(s) in which certain, not most or all, of the amino acid(s) may be substituted.
[0073] In particular, where a shorter length peptide is concerned, it is contemplated that fewer amino acid substitutions should be made within the given peptide. A longer polypeptide may have an intermediate number of changes. The full length protein will have the most tolerance for a larger number of changes. Of course, a plurality of distinct polypeptides/peptides with different substitutions may easily be made and used in accordance with the invention.
[0074] It also is well understood that where certain residues are shown to be particularly important to the immunological or structural properties of a protein or peptide, e.g., residues in binding regions or active sites, such residues may not generally be exchanged. This is a consideration in the present disclosure, where changes in an antigenic site (other than the one or more cysteines that may or may not be in the antigenic site) should be carefully considered and subsequently tested to ensure maintenance of immunological function (e.g., antigenicity), where maintenance of immunological function is desired. In this manner, functional equivalents are defined herein as those peptides or polypeptides that maintain a substantial amount of their native immunological activity.
[0075] Amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. An analysis of the size, shape and type of the amino acid side-chain substituents reveals that arginine, lysine and histidine are all positively charged residues; that alanine, glycine and serine are all a similar size; and that phenylalanine, tryptophan and tyrosine all have a generally similar shape. Therefore, based upon these considerations, arginine, lysine and histidine; alanine, glycine and serine; and phenylalanine, tryptophan and tyrosine; are defined herein as immunologically functional equivalents.
[0076] To effect more quantitative changes, the hydropathic index of amino acids may be considered. Each amino acid has been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics, these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
[0077] The importance of the hydropathic amino acid index in conferring interactive biological function on a protein, polypeptide or peptide is generally understood in the art (Kyte & Doolittle, 1982, incorporated herein by reference). It is known that certain amino acids may be substituted for other amino acids having a similar hydropathic index or score and still retain a similar biological activity. In making changes based upon the hydropathic index, the substitution of amino acids whose hydropathic indices are within ±2 is preferred, those which are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.
[0078] It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity, particularly where the immunological functional equivalent polypeptide or peptide thereby created is intended for use in immunological embodiments, as in certain embodiments of the present invention. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with its immunogenicity and antigenicity, i.e. with a immunological property of the protein. In making changes based upon similar hydrophilicity values, the substitution of amino acids whose hydrophilicity values are within ±2 is preferred, those which are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred. Numerous scientific publications have also been devoted to the prediction of secondary structure, and to the identification of an epitope, from analyses of an amino acid sequence (Chou & Fasman, 1974a,b; 1978a,b, 1979). Moreover, computer programs are currently available to assist with predicting an antigenic portion and an epitopic core region of one or more proteins, polypeptides or peptides. Examples include those programs based upon the Jameson-Wolf analysis (Jameson & Wolf, 1988; Wolf et al, 1988), the program PepPlot® (Brutlag et al, 1990; Weinberger et al, 1985), and other new programs for protein tertiary structure prediction (Fetrow & Bryant, 1993). Another commercially available software program capable of carrying out such analyses is Mac Vector (TBI, New Haven, CT).
[0079] In further embodiments, major antigenic determinants of a Tc24 polypeptide may be identified by an empirical approach in which portions of a nucleic acid encoding the polypeptide are expressed in a recombinant host, and the resulting polypeptide(s) tested for their ability to elicit an immune response. In such a case, any resulting polypeptide would lack one or more, including all, cysteines. For example, PCR™ can be used to prepare a range of Tc24 peptides or Tc24 polypeptides lacking successively longer fragments of the C-terminus or N- terminus of the amino acid sequence. The immunoactivity of each of these Tc24 peptides or Tc24 polypeptides is determined to identify those fragments or domains that are
immunodominant. Further studies in which only a small number of amino acids are removed at each iteration then allows the location of the antigenic determinant(s) of the peptide or polypeptide to be more precisely determined.
[0080] Another method for determining a major antigenic determinant of a Tc24 peptide or Tc24 polypeptide is a system in which overlapping peptides are synthesized on a cellulose membrane, which following synthesis and de-protection, is screened using a polyclonal or monoclonal antibody. An antigenic determinant of the peptides or polypeptides that are initially identified can be further localized by performing subsequent syntheses of smaller peptides with larger overlaps, and by eventually replacing individual amino acids at each position along the immunoreactive Tc24 sequence.
[0081] Once one or more such analyses are completed, an antigenic composition, such as for example a Tc24 peptide or a Tc24 polypeptide is prepared that contain at least the essential features of one or more antigenic determinants. A Tc24 antigenic composition is then employed in the generation of antisera against the composition, and preferably the antigenic determinant(s).
[0082] While discussion has focused on functionally equivalent polypeptides arising from amino acid changes, it will be appreciated that these changes may be effected by alteration of the encoding DNA; taking into consideration also that the genetic code is degenerate and that two or more codons may code for the same amino acid. Nucleic acids encoding these antigenic compositions also can be constructed and inserted into one or more expression vectors by standard methods (Sambrook et al , 1987), for example, using PCR™ cloning methodology.
[0083] In addition to the peptidyl compounds described herein, the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions of the peptide or polypeptide structure or to interact specifically with, for example, an antibody. Such compounds, which may be termed peptidomimetics, may be used in the same manner as a peptide or polypeptide of the invention and hence are also immunologically functional equivalents.
[0084] Certain mimetics that mimic elements of protein secondary structure are described in Johnson et al. (1993). The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orientate amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and antigen. A peptide mimetic is thus designed to permit molecular interactions similar to the natural molecule.
E. Antigen Mutagenesis
[0085] In particular embodiments, a Tc24 antigenic composition is mutated for purposes such as, for example, reducing aggregation, enhancing its immunogenicity and/or producing or identifying a immunologically functional equivalent sequence. Methods of mutagenesis are well known to those of skill in the art (Sambrook et al, 1987).
[0086] As used herein, the term "oligonucleotide directed mutagenesis procedure" refers to template-dependent processes and vector-mediated propagation which result in an increase in the concentration of a specific nucleic acid molecule relative to its initial
concentration, or in an increase in the concentration of a detectable signal, such as amplification. As used herein, the term "oligonucleotide directed mutagenesis procedure" is intended to refer to a process that involves the template-dependent extension of a primer molecule. The term template dependent process refers to nucleic acid synthesis of an RNA or a DNA molecule wherein the sequence of the newly synthesized strand of nucleic acid is dictated by the well-known rules of complementary base pairing (see, for example, Watson, 1987). Typically, vector mediated methodologies involve the introduction of the nucleic acid fragment into a DNA or RNA vector, the clonal amplification of the vector, and the recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided by U. S. Patent 4,237,224, specifically incorporated herein by reference in its entirety.
[0087] In a particular embodiment, site directed mutagenesis is used. Site-specific mutagenesis is a technique useful in the preparation of an antigenic composition {e.g., a Tc24- comprising peptide or polypeptide, or immunologically functional equivalent protein, polypeptide or peptide), through specific mutagenesis of the underlying DNA. In general, the technique of site-specific mutagenesis is well known in the art. The technique further provides a ready ability to prepare and test sequence variants, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA.
Site-specific mutagenesis allows the production of a mutant through the use of specific oligonucleotide sequence(s) which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the position being mutated.
Typically, a primer of about 17 to about 75 nucleotides in length is preferred, with about 10 to about 25 or more residues on both sides of the position being altered, while primers of about 17 to about 25 nucleotides in length being more preferred, with about 5 to 10 residues on both sides of the position being altered.
[0088] In general, site-directed mutagenesis is performed by first obtaining a single-stranded vector, or melting of two strands of a double stranded vector which includes within its sequence a DNA sequence encoding the desired protein. As will be appreciated by one of ordinary skill in the art, the technique typically employs a bacteriophage vector that exists in both a single stranded and double stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the Ml 3 phage. These phage vectors are commercially available and their use is generally well known to those skilled in the art. Double stranded plasmids are also routinely employed in site directed mutagenesis, which eliminates the step of transferring the gene of interest from a phage to a plasmid.
[0089] This mutagenic primer is then annealed with the single-stranded DNA preparation, and subjected to DNA polymerizing enzymes such as, for example, E. coli polymerase I Klenow fragment, in order to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated sequence and the second strand bears the desired mutation. This heteroduplex vector is then used to transform appropriate cells, such as E. coli cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement.
[0090] Alternatively, a pair of primers may be annealed to two separate strands of a double stranded vector to simultaneously synthesize both corresponding complementary strands with the desired mutation(s) in a PCR™ reaction. A genetic selection scheme to enrich for clones incorporating the mutagenic oligonucleotide has been devised (Kunkel et al., 1987). Alternatively, the use of PCR™ with commercially available thermostable enzymes such as Taq polymerase may be used to incorporate a mutagenic oligonucleotide primer into an amplified DNA fragment that can then be cloned into an appropriate cloning or expression vector
(Tomic ei /., 1990; Upender et al, 1995). A PCR™ employing a thermostable ligase in addition to a thermostable polymerase also may be used to incorporate a phosphorylated mutagenic oligonucleotide into an amplified DNA fragment that may then be cloned into an appropriate cloning or expression vector (Michael 1994).
[0091] The preparation of sequence variants of the selected gene using site-directed mutagenesis is provided as a means of producing potentially useful species and is not meant to be limiting, as there are other ways in which sequence variants of genes may be obtained. For example, recombinant vectors encoding the desired gene may be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants.
[0092] Additionally, one particularly useful mutagenesis technique is alanine scanning mutagenesis in which a number of residues are substituted individually with the amino acid alanine so that the effects of losing side-chain interactions can be determined, while minimizing the risk of large-scale perturbations in protein conformation (Cunningham et al, 1989). Other methods of site-directed mutagenesis are disclosed in U.S. Patents 5,220,007; 5,284,760;
5,354,670; 5,366,878; 5,389,514; 5,635,377; and 5,789, 166.
IV. Pharmaceutical Preparations
[0093] Pharmaceutical compositions of the present disclosure comprise an effective amount of one or more Tc24 compositions, such as Tc24 polypeptides comprising one or more fewer cysteines compared to the corresponding wildtype polypeptide dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases "pharmaceutical or pharmacologically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of a pharmaceutical composition that contains at least one Tc24 polypeptide active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington: The Science and Practice of Pharmacy, 21st Ed.
Lippincott Williams and Wilkins, 2005, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards. [0094] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.
[0095] The Tc24 polypeptide may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection. The present invention can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, topically, intramuscularly, subcutaneously, mucosally, orally, topically, locally, inhalation (e.g., aerosol inhalation), injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference).
[0096] The Tc24 polypeptide may be formulated into a composition in a free base, neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as formulated for parenteral
administrations such as injectable solutions, or aerosols for delivery to the lungs, or formulated for alimentary administrations such as drug release capsules and the like. [0097] Further in accordance with the present invention, the composition of the present invention suitable for administration is provided in a pharmaceutically acceptable carrier with or without an inert diluent. The carrier should be assimilable and includes liquid, semi-solid, i.e., pastes, or solid carriers. Except insofar as any conventional media, agent, diluent or carrier is detrimental to the recipient or to the therapeutic effectiveness of the composition contained therein, its use in administrable composition for use in practicing the methods of the present invention is appropriate. Examples of carriers or diluents include fats, oils, water, saline solutions, lipids, liposomes, resins, binders, fillers and the like, or combinations thereof. The composition may also comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.
[0098] In accordance with the present invention, the composition is combined with the carrier in any convenient and practical manner, i.e., by solution, suspension, emulsifi cation, admixture, encapsulation, absorption and the like. Such procedures are routine for those skilled in the art.
[0099] In a specific embodiment of the present invention, the composition is combined or mixed thoroughly with a semi-solid or solid carrier. The mixing can be carried out in any convenient manner such as grinding. Stabilizing agents can be also added in the mixing process in order to protect the composition from loss of therapeutic activity, i.e., denaturation in the stomach. Examples of stabilizers for use in an the composition include buffers, amino acids such as glycine and lysine, carbohydrates such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.
[0100] In further embodiments, the present invention may concern the use of a pharmaceutical lipid vehicle compositions that include a Tc24 polypeptide, one or more lipids, and an aqueous solvent. As used herein, the term "lipid" will be defined to include any of a broad range of substances that is characteristically insoluble in water and extractable with an organic solvent. This broad class of compounds are well known to those of skill in the art, and as the term "lipid" is used herein, it is not limited to any particular structure. Examples include compounds which contain long-chain aliphatic hydrocarbons and their derivatives. A lipid may be naturally occurring or synthetic (i.e., designed or produced by man). However, a lipid is usually a biological substance. Biological lipids are well known in the art, and include for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulphatides, lipids with ether and ester-linked fatty acids and polymerizable lipids, and combinations thereof. Of course, compounds other than those specifically described herein that are understood by one of skill in the art as lipids are also encompassed by the compositions and methods of the present invention.
[0101] One of ordinary skill in the art would be familiar with the range of techniques that can be employed for dispersing a composition in a lipid vehicle. For example, the Tc24 polypeptide may be dispersed in a solution containing a lipid, dissolved with a lipid, emulsified with a lipid, mixed with a lipid, combined with a lipid, covalently bonded to a lipid, contained as a suspension in a lipid, contained or complexed with a micelle or liposome, or otherwise associated with a lipid or lipid structure by any means known to those of ordinary skill in the art. The dispersion may or may not result in the formation of liposomes.
[0102] The actual dosage amount of a composition of the present invention
administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and/or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.
[0103] In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, the an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Naturally, the amount of active compound(s) in each therapeutically useful composition may be prepared is such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
[0104] In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500
microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.
A. Alimentary Compositions and Formulations
[0105] In preferred embodiments of the present invention, the Tc24 polypeptides are formulated to be administered via an alimentary route. Alimentary routes include all possible routes of administration in which the composition is in direct contact with the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered orally, buccally, rectally, or sublingually. As such, these compositions may be formulated with an inert diluent or with an assimilable edible carrier, or they may be enclosed in hard- or soft- shell gelatin capsule, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet.
[0106] In certain embodiments, the active compounds may be incorporated with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and the like (Mathiowitz et al., 1997; Hwang et al., 1998; U.S. Pat. Nos. 5,641,515; 5,580,579 and 5,792, 451, each specifically incorporated herein by reference in its entirety). The tablets, troches, pills, capsules and the like may also contain the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof; a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or
combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar, or both. When the dosage form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Gelatin capsules, tablets, or pills may be enterically coated. Enteric coatings prevent denaturation of the composition in the stomach or upper bowel where the pH is acidic. See, e.g., U. S. Pat. No. 5,629,001. Upon reaching the small intestines, the basic pH therein dissolves the coating and permits the composition to be released and absorbed by specialized cells, e.g., epithelial enterocytes and Peyer's patch M cells. A syrup of elixir may contain the active compound sucrose as a sweetening agent methyl and
propylparabens as preservatives, a dye and flavoring, such as cherry or orange flavor. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compounds may be incorporated into sustained-release preparation and formulations.
[0107] For oral administration the compositions of the present invention may alternatively be incorporated with one or more excipients in the form of a mouthwash, dentifrice, buccal tablet, oral spray, or sublingual orally- administered formulation. For example, a mouthwash may be prepared incorporating the active ingredient in the required amount in an appropriate solvent, such as a sodium borate solution (Dobell's Solution). Alternatively, the active ingredient may be incorporated into an oral solution such as one containing sodium borate, glycerin and potassium bicarbonate, or dispersed in a dentifrice, or added in a therapeutically- effective amount to a composition that may include water, binders, abrasives, flavoring agents, foaming agents, and humectants. Alternatively the compositions may be fashioned into a tablet or solution form that may be placed under the tongue or otherwise dissolved in the mouth.
[0108] Additional formulations which are suitable for other modes of alimentary administration include suppositories. Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum. After insertion, suppositories soften, melt or dissolve in the cavity fluids. In general, for suppositories, traditional carriers may include, for example, polyalkylene glycols, triglycerides or combinations thereof. In certain embodiments, suppositories may be formed from mixtures containing, for example, the active ingredient in the range of about 0.5% to about 10%, and preferably about 1% to about 2%.
B. Parenteral Compositions and Formulations
[0109] In further embodiments, the Tc24 polypeptide may be administered via a parenteral route. As used herein, the term "parenteral" includes routes that bypass the alimentary tract. Specifically, the pharmaceutical compositions disclosed herein may be administered for example, but not limited to intravenously, intradermally, intramuscularly, intraarterially, intrathecally, subcutaneous, or intraperitoneally U.S. Pat. Nos. 6,7537,514, 6,613,308, 5,466,468, 5,543,158; 5,641,515; and 5,399,363 (each specifically incorporated herein by reference in its entirety)..
[0110] Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy inj ectability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. [0111] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in isotonic NaCl solution and either added hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of
Biologies standards.
[0112] Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof. A powdered composition is combined with a liquid carrier such as, e.g., water or a saline solution, with or without a stabilizing agent.
C. Miscellaneous Pharmaceutical Compositions and Formulations
[0113] In other preferred embodiments of the invention, the active compound Tc24 polypeptide may be formulated for administration via various miscellaneous routes, for example, topical (i.e., transdermal) administration, mucosal administration (intranasal, vaginal, etc.) and/or inhalation.
[0114] Pharmaceutical compositions for topical administration may include the active compound formulated for a medicated application such as an ointment, paste, cream or powder. Ointments include all oleaginous, adsorption, emulsion and water-soluble based compositions for topical application, while creams and lotions are those compositions that include an emulsion base only. Topically administered medications may contain a penetration enhancer to facilitate adsorption of the active ingredients through the skin. Suitable penetration enhancers include glycerin, alcohols, alkyl methyl sulfoxides, pyrrolidones and luarocapram. Possible bases for compositions for topical application include polyethylene glycol, lanolin, cold cream and petrolatum as well as any other suitable absorption, emulsion or water-soluble ointment base. Topical preparations may also include emulsifiers, gelling agents, and antimicrobial
preservatives as necessary to preserve the active ingredient and provide for a homogenous mixture. Transdermal administration of the present invention may also comprise the use of a "patch". For example, the patch may supply one or more active substances at a predetermined rate and in a continuous manner over a fixed period of time.
[0115] In certain embodiments, the pharmaceutical compositions may be delivered by eye drops, intranasal sprays, inhalation, and/or other aerosol delivery vehicles. Methods for delivering compositions directly to the lungs via nasal aerosol sprays has been described e.g., in U.S. Pat. Nos. 5,756,353 and 5,804,212 (each specifically incorporated herein by reference in its entirety). Likewise, the delivery of drugs using intranasal microparticle resins (Takenaga et al., 1998) and lysophosphatidyl-glycerol compounds (U. S. Pat. No. 5,725, 871, specifically incorporated herein by reference in its entirety) are also well-known in the pharmaceutical arts. Likewise, transmucosal drug delivery in the form of a polytetrafluoroetheylene support matrix is described in U.S. Pat. No. 5,780,045 (specifically incorporated herein by reference in its entirety).
[0116] The term aerosol refers to a colloidal system of finely divided solid of liquid particles dispersed in a liquefied or pressurized gas propellant. The typical aerosol of the present invention for inhalation will consist of a suspension of active ingredients in liquid propellant or a mixture of liquid propellant and a suitable solvent. Suitable propellants include hydrocarbons and hydrocarbon ethers. Suitable containers will vary according to the pressure requirements of the propellant. Administration of the aerosol will vary according to subject's age, weight and the severity and response of the symptoms.
V. Kits of the Disclosure
[0117] Any of the compositions described herein may be comprised in a kit. In a non- limiting example, a Tc24 polypeptide, such as one comprising one or more fewer cysteine residues compared to wild type is comprised in a kit, and in specific embodiments, a carrier and/or an additional agent, may be comprised in a kit.
[0118] The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there are more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the Tc24 polypeptide, lipid, additional agent, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained.
[0119] When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred. The Tc24 polypeptide compositions may also be formulated into a syringeable composition. In which case, the container means may itself be a syringe, pipette, and/or other such like apparatus, from which the formulation may be applied to an infected area of the body, injected into an animal, and/or even applied to and/or mixed with the other components of the kit. However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
[0120] Irrespective of the number and/or type of containers, the kits of the invention may also comprise, and/or be packaged with, an instrument for assisting with the
injection/administration and/or placement of the ultimate Tc24 polypeptide within the body of an animal. Such an instrument may be a syringe, pipette, forceps, and/or any such medically approved delivery vehicle.
EXAMPLES
[0121] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1
OVERVIEW OF EMBODIMENTS OF THE DISCLOSURE
[0122] Chagas disease is a serious disease caused by the infection with the protozoan Trypanosoma cruzi, transmitted by a triatomine insect vector (kissing bug). Due to the limited efficacy and side effects of the currently available drugs, developing a vaccine to reduce the effects of the disease and prevent the infection is urgent. Tc24, a 24 kDa calcium-binding protein localized to the flagellar pocket of the parasite, functions as a T. cruzi immune modulator and a leading vaccine antigen with preventive and therapeutic efficacy against T. cruzi infection when used as a DNA vaccine in mouse model. In an effort to develop a recombinant protein vaccine of Tc24 that can be applied in humans, the coding DNA of Tc24 was cloned and transformed into E. coli. The recombinant Tc24 protein can be highly expressed in the bacterial lysate, however, the expressed Tc24 protein aggregates during purification and formulation, likely due to the four cysteine residues in the molecule that form intermolecular disulfide bridges. In order to prevent the aggregation, in Tc24-C4, the four cysteine residues of Tc24 were genetically mutated to serine residues. Recombinant Tc24-C4 was expressed in E. coli BL21 as a soluble protein at a similar yield as Tc24, but no aggregation was observed during the purification process.
Moreover, the purified Tc24-C4 did not form any aggregates after being stored at 4°C for 9 days, as determined by Western blot, light-scattering and HPLC-RP. Vaccine efficacy testing using mouse challenge models showed that mice immunized with Tc24-C4 formulated with an immunostimulant (E6020-SE) elicited a similar protection effect as Tc24 against a T. cruzi challenge, as judged based on mouse survival rate and parasitemia levels. Therefore, the mutant Tc24-C4 constitutes an improved vaccine antigen candidate, without the aggregation problem of the original protein, Tc24.
[0123] In order to eliminate the intramolecular aggregation caused by the disulfide bridges in the original Tc24, a new construct, Tc24-C4, with the four cysteine residues (C4, C66, C74 and CI 24) mutated to serine residues was genetically engineered. The reason for using serine residues to replace the cysteine residues is their similar size. The coding DNA for mutant Tc24-C4 was codon optimized based on E. coli codon preference, synthesized by GenScript, and was cloned into pET41a, without any tag. The recombinant plasmid DNAs were transformed into E. coli BL21(DE3) and selected on LB agar plates containing 30 μg/mL of kanamycin The correct sequences and reading frames were confirmed by double-strand DNA sequencing with vector flanking primers. After being induced with 0.5 mM IPTG, Tc24-C4 had a similar expression yield as Tc24. Like Tc24, Tc24-C4 was expressed as a soluble protein in the induced bacterial lysate. More importantly, and unlike Tc24, there was no aggregation observed with Tc24-C4 during the purification process or when stored at 4°C for 9 days, as determined by SDS-PAGE, Western blot, light scattering and HPLC-RP. Vaccine efficacy assays using mouse challenge models showed mice immunized with Tc24-C4 formulated with the immunostimulant E6020-SE were similarly protected as mice immunized with Tc24 + E6020-SE, as judged by mouse survival rate and parasitemia levels in blood.
EXAMPLE 2
CYSTEINE MUTAGENESIS IMPROVES THE PRODUCTION WITHOUT ABROGATING ANTIGENICITY OF A RECOMBrNANT PROTEIN VACCINE CANDIDATE FOR HUMAN
CHAGAS DISEASE
Abstract
[0124] A therapeutic human vaccine for Chagas Disease is currently under
development by the Sabin Vaccine Institute Product Development Partnership (Sabin PDP). The aim of the vaccine is to significantly reduce the parasite burden of Trypanosoma cruzi in humans, either as a standalone product or in combination with conventional chemotherapy. Recently our collaborators have shown that vaccination of mice with Tc24, a T. cruzi excretory secretory protein, resulted in partial protection from T. cruzi challenge (Martinez-Campos et al., 2015). Consistent production of the recombinant Tc24 antigen for the preclinical assessment however was problematic. Significant protein aggregation was observed during the purification process which we believed was due to intermolecular disulfide bridges. To eliminate this aggregation, mutations were introduced into the molecule at cysteine residues which resulted in a corresponding reduction in protein aggregation without changing the secondary structure of Tc24. In addition, elimination of the cysteine residues resulted in a significant increase in E. coli biomass and therefore, target product. Immunization of mice with either wild-type or mutant Tc24 resulted in equivalent antigen specific IFNy production levels from splenocytes and IgG2a production, indicating that the elimination of putative intermolecular disulfide bond formation had no significant impact on the immunogenicity of the molecule. These immunological data shows that the cysteine mutations, which eliminated disulphide bond formation, improved both the production and quality with little to no impact on the antigenicity of Tc24.
Introduction
[0125] Chagas Disease, also known as American trypanosomiasis, is a blood-borne disease caused by the protozoan parasite Trypanosoma cruzi which is endemic in parts of the Western Hemisphere extending from the southern United States to southern Argentina. The parasites which cause Chagas Disease are transmitted to humans and other mammals by bloodsucking "kissing bugs" of the subfamily Triatominae, but can also be spread via blood transfusion, organ transplantation, and congenital transmission (Haberland et al., 2013). In 2013, the number of people estimated to be infected with T. cruzi was approximately 9-10 million, mostly in Latin America (Bonney, 2014). Recent projections, however, suggest that 60-100 million people are at risk of infection in the Western Hemisphere (Garcia et al., 2015; Reithinger et al., 2009; Sanchez-Burgos et al., 2007). Human Chagas disease occurs in two important phases: the acute and chronic phases of infection. During the acute phase, parasites are present in the blood at high levels and those infected are either asymptomatic or exhibit an acute self- limiting febrile illness which typically resolves within 4-8 weeks in 90% of cases (Rassi et al., 2000; Rassi et al., 2010). Individuals with chronic Chagas disease, however, have very low levels of circulating parasites and the majority of these people have no clinical symptoms of disease throughout life. Approximately 20-40% of those with chronic disease, however, develop clinical manifestations due to parasite persistence in tissues which is characterized by neuronal cell loss, microvascular dysfunction, and myocardial damage (Andrade, 1991; Bestetti et al., 1997; Hotez et al., 2008) - alterations that affect the nervous, digestive, and cardiovascular systems. To date, there are limited treatment options for chronic infection. Current drugs such as benznidazole and nifurtimox work effectively against parasite replication when given during the acute stage of infection but can cause adverse side effects ranging from anorexia, weight loss, excitability, and nausea in the case of nifurtimox (Castro et al., 2006), to dermatitis, muscular pain, neuralgias, and potentially bone marrow disorders such as thrombocytopenia purpura or agranulocytosis in the case of benznidazole (Pinazo et al., 2010). Both drugs require long treatment schedules (60 days for benznidazole and 90 days for nifurtimox), making treatment logistically difficult, and tend to increase the risk for drug resistance (Sanchez-Burgos et al., 2007; Castro et al., 2006; Fabbro et al., 2007; Campos et al., 2014; Pinazoo et al., 2013; Le Loup et al., 201 1). These drugs also have the potential to cause anemia in pregnant mothers and insufficient weight gain in their children [16]. A recent multicenter randomized study of benznidazole on patients with chronic Chagas cardiomyopathy showed a significant reduction in the number of circulating parasites, but there was no reduction in the progression of cardiac symptoms over a 5 year period, indicating that drug alone is ineffective against disease progression during the chronic stage of disease (Morillo et al., 2015).
[0126] To circumvent the problems with chemotherapeutic treatment of Chagas Disease and to achieve protection from cardiac complications, a Chagas vaccine offers a more effective solution (Dumonteil et al., 2012). Several vaccines for the treatment of Chagas Disease are currently under development, including vaccines composed of peptides, plasmid DNA, or recombinant proteins [17-22]. Specifically, vaccination of mice with a synthetic peptide containing predicted overlapping antigenic epitopes from T. cruzi mucin-like associated surface protein increased survival in mice with a reduction in parasite load in the heart (Serna et al., 2014). Immunization of adenovirus carrying amastigote surface protein-2 and trans-sialidase antigens (Pereira et al., 2015), and plasmids expressing TcGl, TcG2, or TcG4, membrane associated glycosylphosphatidylinositol (GPI) proteins expressed on the surface of T. cruzi (Bhatia et al., 2008) resulted in reduced parasite burden in tissue, reduced heart injury and increased survival. The present inventors have been developing a Chagas vaccine based on the Tc24 protein, a T. cruzi parasite excretory-secretory protein. This antigen was originally expressed in E. coli as a fusion protein and shown to induce significant protection in Balb/c mice against a lethal dose of T. cruzi parasites (Taibi et al., 1995). Data suggests that amino acids 109- 124 contain a putative T cell epitope which may be responsible for the protection (Taibi et al., 199). More recently, a DNA vaccine containing the Tc24 coding sequence has likewise shown efficacy when introduced into T. cruzi infected mice and dogs (Dumonteil et al., 2004; Llimon- Flores et al., 2010, Ouij ano-Hernandez et al., 2008; Ouijano-Hernandez et al., 2013). Based on the fact that no DNA vaccine has ever been licensed by the FDA to date, in some embodiments the present disclosure focuses on Chagas vaccine development following a recombinant protein- based approach. Recently, a study has been published where vaccination of mice with wild-type Tc24 (Tc24-WT), expressed and purified in the laboratory, induced a Thl -biased immune response which provided partial protection after T. cruzi challenge (Martinez-Campos et al., 2015). This initial version of wild-type Tc24 was expressed in Escherichia coli and purified using a two-step chromatography method. However, significant aggregation was observed during the purification and storage of the protein that would make reproducible scale-up of the protein more difficult and also could impact or skew the immune response. In an attempt to reduce or eliminate aggregation, cysteine-to-serine mutations were introduced into two new Tc24 constructs at residues C4S and C66S yielding Tc24-C2, and C4S, C66S, C74S, C124S yielding Tc24-C4. The C4S and C66S mutations were selected for the Tc24-C2 construct over cysteine residues C74 and CI 24 due to their location on the surface of the molecule as determined by X- ray crystallography (Wingard et al., 2008). Western blot analysis of Tc24-C2 revealed fewer protein aggregates as a result of these mutations, while the four cysteine-to-serine mutations in Tc24-C4 eliminated -100% of aggregated molecules. Based on these results, the inventors formulated wild-type and both mutant Tc24 proteins with a synthetic TLR-4 receptor agonist in squalene emulsions for immunologic testing in mice. Tc24-C2 and Tc24-C4 were shown to be immunologically equivalent to the parent molecule, indicating that cysteine mutagenesis did not adversely impact the antigenicity of the molecule. Due to the reduced aggregation of Tc24-C4 compared to Tc24-C2, Tc24-C4 is a useful vaccine antigen and is produced for the treatment and prevention of Chagas Disease.
Examples of Material and Methods
Construction of recombinant Tc24 expressing clones in E. coli
[0127] DNA coding for the full-length Yucatan strain T. cruzi 24 kDa excretory- secretory protein (Tc24) (Dumonteil et al., 2004) was codon optimized for expression in E. coli and chemically synthesized as wild-type Tc24 (Tc24-WT). Constructs for Tc24-C2 and Tc24-C4 were based from the wild-type Tc24 DNA sequence with the first two cysteines mutated to serine residues (C4S, C66S) and all four cysteines mutated to serine residues (C4S, C66S, C74S and C124S), respectively (Figure 2). The synthesized DNAs for Tc24-WT, Tc24-C2 and Tc24- C4 were sub-cloned in frame into the E. coli expression vector pET41a (EMD Millipore) using the restriction sites Nde I and Xho I with the GST fusion deleted. The Tc24-WT construct was initially cloned in frame with the hexahistidine tag (Tc24-WT + His) at the C-terminus which was removed prior to process scale up in order to optimize the manufacturing process for a tag- free product. The correct insert sequence and reading frame in the constructed recombinant plasmids were confirmed by double-stranded DNA sequencing. The sequence-confirmed recombinant plasmid DNAs were transformed into BL21 (DE3) (EMD Millipore) and recombinant protein was induced with 1 mM Isopropyl-P-D-l-thiogalactopyranoside (IPTG) to confirm expression. The clone with the highest expression for each construct was chosen to create research seed stocks.
Small scale expression of Tc24-WT + His
[0128] Six 2.5 L Tunair shake flasks containing 1 L sterile LB medium each with 30 μg/mL Kanamycin were inoculated with 20 mL of an overnight seed culture of Tc24-WT + HIS and incubated at 37 °C with agitation until the OD6oo reached 0.7-0.8. At this point, the temperature was reduced to 30 °C and IPTG was added to a final concentration of 0.5 mM. After 5 hours of induction, cells were collected by centrifugation (12,227 x g, 4 °C, 30 min.) and biomass was collected and stored at -80 °C.
Purification of Tc24-WT + His
[0129] Frozen biomass of Tc24-WT + HIS was thawed and re-suspended in extraction Buffer Al (30 mM Tris-HCl, 500 mM NaCl, 20 mM Imidazole, pH 8.0) at a ratio of 20 mL buffer per gram of wet cell paste. For small scale expression, homogenization was performed using an EmulsiFlex-C3 high pressure homogenizer (Avestin, Inc.). The suspension was passed through the homogenizer three times at 15,000 psi and incubated on ice during and between passes. After extraction, the homogenate was centrifuged twice (31,000 x g, 4 °C, 30 min.) to remove insoluble debris. The supernatant was then filtered consecutively through 0.45 μιη and 0.22 μιη filters before being loaded, at 3 mL/min, onto three tandem 5 mL HiTrap IMAC Sepharose 6 FF columns (GE Healthcare), equilibrated with buffer Al . The columns were washed with 10 column volumes (CVs) buffer Al and protein was subsequently eluted using a linear gradient over 20 CVs of buffer B 1 (30 mM Tris-HCl, 500 mM NaCl, 500 mM Imidazole, pH 8.0). Peak fractions containing the his-tagged Tc24 wild-type protein were pooled and buffer exchanged using a Sephadex G-25 (Fine) XK50 desalting column (GE Healthcare) into Q Sepharose XL (QXL) Buffer A (50 mM Tris-HCl, 30 mM NaCl, pH 7.5). The protein was loaded at 5 mL/min onto three tandem 5 mL HiTrap QXL columns (GE Healthcare), washed with 10 CVs of QXL buffer A, and eluted over a linear gradient of 0-100% B with QXL buffer B (50 mM Tris-HCl, 1 M NaCl, pH 7.5). Fractions containing Tc24 were pooled and a Sephadex G25 (Fine) XK50 desalting column was used to buffer exchange into IX PBS, pH 7.4. Protein aliquots were stored at -80 °C. Large scale expression of non-tagged wild-type and mutant Tc24 proteins in E. coli
[0130] 1 L LB medium (BD Difco) was added to a 2.5 L Tunair baffled shake flask and autoclaved. After media sterilization and cooling, Kanamycin was added to a final concentration of 50 μg/mL. An aliquot from a frozen glycerol seed stock of Tc24-WT, Tc24-C2, or Tc24-C4, was used to inoculate the shake flask for expansion of the seed culture. After overnight incubation at 37 °C and agitation at 210-240 rpm, an aliquot of the seed culture was used to inoculate a fermentation vessel containing 10 L E. coli BSM medium (5.0 g/L K2HPO4, 3.5 g/L KH2PO4, 3.5 g/L (NH4)2HP04, 40.0 g/L glycerol, 4.0 mL/L 25% MgS04 x 7 H20 (added after sterilization and cooling)) with 1 mL/L K-12 Bacterial Trace Salts (composed of 5.0 g/L NaCl, 1.0 g/L ZnS04 x 7H20, 4.0 g/L MnCl2 x 4 H20, 4.75 g/L FeCl3 6H20, 0.4 g/L CuS04 5H20, 0.575 g/L H3BO3, 0.5 g/L Na2Mo04 x 2 H20, 7.5 mL/L 10 N H2S04), 10 mL/L of 15 g/L CaCl2 x 2 H20, 1 mL/L Kanamycin (100 mg/mL). The amount of seed used for inoculation of the fermenter was adjusted in order to have a starting cell density (OD60o) of 0.05. At the time the cell density reached approximately 0.5, the temperature was reduced to 30 °C. When the cell density reached OD6oo of 0.6-1.0, IPTG was added to a final concentration of 1 mM to ensure full induction due to the high cell density achieved during fermentation. Approximately 5 hours after the start of induction, fed-batch medium (50% glycerol (v/v), 20 mM MgCl2) was added to the fermenter at a rate of 3 mL/L/hr. Agitation was set at 500 rpm, 1 vvm air flow, pH of 7.2, and DO of 30% was maintained through fermentation. After approximately 18 hours of induction, the culture was removed from the fermenter and biomass was collected by centrifugation (12,227 x g, 4 °C, 45 min.). The cell paste was collected and stored at -80 °C prior to downstream processing.
Purification of non-tagged wild-type and mutant Tc24
[0131] Purification of non-tagged wild-type Tc24 and mutant constructs was performed as follows: each gram of biomass was re-suspended in 20 mL of 50 mM Tris-HCl, pH 8.0 and mixed on a stir plate until homogeneous. Tc24-WT and Tc24-C2 were homogenized using an EmulsiFlex C3 (Avestin, Inc.) with 3-5 passes at an average pressure of 15,000 psi. The protein solution was kept cold using a heat exchanger. After extraction, the solution was centrifuged twice (31,000 x g, 4 °C, 30 min.). Tc24-C4 was homogenized on a larger scale using an
EmulsiFlex C-55 (Avestin, Inc.) with 3-5 passes at an average pressure of 15,000 psi. The protein solution was kept cold using a heat exchanger. After extraction, the solution was centrifuged three times (17,700 x g, 4 °C, 45 min.). For Tc24-WT, Tc24-C2, and Tc24-C4, clarified supernatant was filtered using a 0.45 μπι filter unit followed by a 0.2 μπι filter unit and then loaded onto a Tricorn 10/200 column (GE Healthcare) packed with Q Sepharose XL resin (QXL, bed height 19.5 cm; column volume 15.3 mL) that was pre-equilibrated with
approximately 5 CVs of extraction buffer. The column was washed with 2-3 CVs of 50 mM Tris-HCl pH 8.0 followed by an 8-9 CV wash with 50 mM Tris-HCl, pH 8.0, 75 mM NaCl. Tc24 was eluted from the column with 20 CVs of 50 mM Tris-HCl, pH 8.0, 125 mM NaCl. The remaining protein was removed from the column and discarded by stripping with 5 CVs of 50 mM Tris-HCl, pH 8.0, 1 M NaCl followed by 5 CVs 0.5 N NaOH. The QXL column was re- equilibrated with 50 mM Tris-HCl, 200 mM NaCl pH 8.0. To the QXL eluate, 5 M NaCl was added to bring the final concentration to approximately 200 mM. The NaCl adjusted QXL elution was passed through the re-equilibrated QXL column (negative capture) to remove residual endotoxin. The QXL flow-through was concentrated greater than 45-fold by using a Centricon Plus-70 (Millipore) with a 10 kDa molecular weight cut off, and the final volume was adjusted to approximately 4.5 mL using 50 mM Tris-HCl, 200 mM NaCl, pH 8.0. The concentrated Tc24 protein was loaded onto a size exclusion chromatography (SEC) column (Sephacryl S-200 HR HiPrep 26/60 (GE Healthcare) previously equilibrated with 2-3 CVs IX PBS pH 7.4. The protein was eluted using 2 CVs of IX PBS pH 7.4. The final concentration of Tc24 protein was determined spectrophotometrically (A280) using 22.46 mM'Om'1 as the molar extinction coefficient and 23.58, 23.61, or 23.64 kDa as the molecular weight for Tc24-WT, Tc24-C2, and Tc24-C4, respectively. Aliquots were stored at -80 °C.
SDS-PAGE and Western blot analysis
[0132] For in-process and purified protein samples, SDS-PAGE and Western Blot analysis were carried out using non-reduced and reduced 4-12% Bis-Tris gradient gels (Life Technologies) in 2-(N-morpholino) ethanesulfonic acid (MES) running buffer (Life
Technologies) and lithium dodecyl sulfate (LDS) sample loading buffer (Life Technologies). The reducing agent 2-mercaptoethanol (Sigma Aldrich) was added to the sample loading buffer at a concentration of 20% (v/v) prior to sample preparation Electrophoresis was performed at 200 Volts for 35 min at room temperature and gels were then stained with 0.1% Coomassie Blue R- 350 and de-stained with successive washes of 5% methanol in 10% acetic acid. Western blots were performed using in-house generated anti-Tc24 polyclonal mouse antisera at a dilution of 1 :2500 in 1X PBST (phosphate buffered saline + 0.05% Tween 20). Initial blocking of the nitrocellulose membrane was performed using 5% dry milk in IX PBST. A goat anti-mouse (IgG) secondary antibody conjugated to alkaline phosphatase was diluted 1 :7500 in IX PBST and used for detection. Incubations were carried out for one hour at room temperature followed by 3-5 washes using PBST Color development was accomplished using a 5-Bromo-4-chloro-3- indolyl phosphate/Nitro Blue Tetrazolium (BCIP NBT) membrane phosphatase substrate solution (KPL Laboratories).
[0133] For the alkylation experiments, proteins were separated on 4-20% Tris Glycine gels and transferred to nitrocellulose membranes. Membranes were blocked as described above and the primary Tc24 antibody was used at a dilution of 1 : 5000 followed by a goat anti-mouse (IgG) secondary antibody conjugated to alkaline phosphatase (KPL Laboratories) used at a dilution of 1 : 5000 in PBST. Incubations were carried out for one hour at RT followed by three washes in PBST. Color development was accomplished using a BCIP/NBT membrane phosphatase substrate solution (KPL Laboratories).
Endotoxin analysis
[0134] Endotoxin assays were conducted using the Charles River Endosafe PTS System. Each sample was tested after dilution from 1 : 10 to 1 :5000 with endotoxin-free water using an Inhibition/Enhancement cartridge which contains a known amount of endotoxin spike in each sample channel. This spike test checks for matrix interferences that can result in either inhibition or enhancement of endotoxin detection. The lowest sample dilution from the
Inhibition/Enhancement test which resulted in a spike recovery within the range 50%-200% was then used for final testing using an Endosafe®-PTS™ test cartridge with the Endosafe®PTS™ system to determine the endotoxin level present within the sample.
Alkylation of Tc24
[0135] Tc24 was diluted to 1 mg/mL in a buffer containing 100 mM Tris-HCl, pH 8.3. Dithiothreitol (DTT) was added to a final concentration of 5 mM and the sample was incubated for 30 min at 45 °C to reduce the disulfide bonds. The protein mixture was then cooled to room temperature followed by the addition of lodoacetamide to 15 mM. The alkylation of the cysteine residues was continued in the dark for 30 min at room temperature. The unreacted lodoacetamide was then quenched by the addition of DTT (10 mM final concentration) during a 15 min incubation period. The protein was then dialyzed into 1 x PBS. Dynamic light scattering (DLS)
[0136] DLS analysis was performed on a DynaPro Plate Reader (Wyatt Technology). Samples of Tc24 (Tc24-WT, Tc24-C2, and Tc24-C4, 0.5 mg/mL each) were prepared in PBS, pH 7.4 and filtered through a 0.02 μιη inorganic membrane filter (Anotop 10, Whatman).
Samples were measured ten times over 5 s in a UV-transparent 384 black plate (Aurora
Biotechnologies). All wells were overlaid with 5 silicon oil to prevent evaporation. Dynamics Software package version 7.1.7.16 (Wyatt Technology) was used for data analysis.
Circular dichroism (CD)
[0137] Samples for CD experiments were prepared by diluting purified Tc24 (Tc24- WT, Tc24-C2, and Tc24-C4) to a final concentration of 0.185 mg/mL. CD spectra were recorded with a Jasco J- 1500s spectrophotometer, scanning from 280 nm to 185 nm at 100 nm/min with a bandwidth of 1 nm and response time of 1 sec. Experiments were performed using one quartz cuvette with a path length of 0.1 cm, keeping a constant temperature of 25 °C. The average value was determined after five scans and the spectrum of the matching 'buffer alone' sample served as the control. The secondary structure of the Tc24 was predicted using the software CDPro (Sreerama et al., 2004) by comparing with two reference sets (SP43and SMP56) and using three data fitting programs (CONTIN, SELCON3, and CDSSTR).
Protein Thermal Shift Studies
[0138] Samples for Protein Thermal Shift Studies were prepared by diluting purified Tc24-WT + His and Tc24-C4 to a final concentration of 0.5 mg/mL. The assay was executed using Protein Thermal Shift™ reagents, ViiA™ 7 qPCR Instrument and Protein Thermal Shift™ Software v2.0 (Life technologies) according to manufacturers' protocol.
Mice, immunization and infection
[0139] Female BALB/c mice, 5-6 weeks old (Taconic Farms, Inc.) were used in all experiments. After one week of acclimation, pre-immune blood samples were taken from all mice. Mice were then vaccinated subcutaneously (SC) with 25 μg of the selected Tc24 protein construct combined with 5 μg E6020 (Eisai Co. Ltd, a synthetic Toll-like receptor 4 (TLR-4) agonist (Singh et al., 2012) emulsified in AddaVax™, a squalene-oil-in-water emulsion
(InvivoGen). The level of endotoxin, a potent agonist for TLR-4, was measured for each antigen and determined to be below 20 EU/mg of protein prior to use. Two weeks after prime vaccination, mice were boosted with the same vaccine formulation. Two weeks after boost, serum was collected and spleens were harvested for the evaluation of antigen specific immune responses.
[0140] T. cruzi HI strain parasites, previously isolated from a human case in Yucatan, Mexico (Dumonteil et al., 2004) were maintained by serial passage in mice. To obtain immune serum from infected mice, naive mice were infected with 500 trypomastigotes by intraperitoneal injection. Parasitemia was confirmed by microscopic examination of blood collected by tail vein microsampling approximately 21 days post infection. At 53 days of infection, mice were humanely euthanized by C02 inhalation and terminal serum samples were collected to evaluate antibody responses to proteins. Animal experiments were performed in compliance with the National Institutes for Health Guide for the Care and Use of Laboratory Animals and were approved by the BCM Institutional Animal Care and Use Committee (IACUC).
Interferon gamma (ΠΤΝγ) production
[0141] To prepare single cell suspensions of splenocytes, whole spleens from vaccinated mice were mechanically dissociated by pressing through a 70 μπι nylon screen. Cells were rinsed through the screen with DMEM medium supplemented with 5% FBS, 100 IU Penicillin/100 μg Streptomycin (complete DMEM (cDMEM)), and then pelleted by
centrifugation. Red cells were lysed by incubation of the cell pellet with lmL ammonium- chloride-potassium (ACK) Lysis solution for 5 minutes. Cells were washed once with cDMEM, then counted using a Cellometer Auto 2000 automated cell counter (Nexcelom). Antigen specific IFNy release into the supernatant from splenocytes was quantified using an eBioscience kit following the manufacturer's protocol. Briefly, splenocytes and stimuli were added to 96 well culture plates in a final volume of 0.2 mL. A total of lxlO6 cells were added to each well and stimuli were added at a final concentration of either 5 μg/mL Concanavalin A (positive control), 10 μg/mL antigen, or cDMEM media only (negative control). Plates were incubated for approximately 72 hours at 37 °C in 5% CO2 Plates were then centrifuged at 300 x g for 5 min at 4 °C and the supernatants were harvested and subsequently frozen at -20 °C until quantification by ELISA. To measure IFNy levels (in duplicate) from supernatants, plates pre-coated with IFNy capture antibody were washed twice with 1 x PBS, 0.05% Tween 20 (PBST), then standards, samples and the biotin conjugate were added to the plates. After incubation at room temperature for 2 hours with shaking, plates were washed and bound IFNy was quantified using Streptavidin- HRP and TMB substrate. The reaction was stopped using 1M Phosphoric acid and absorbance was measured at 450 nm using a Spectra Max Plate Reader and SoftMax Pro software.
Serum IgG2a antibody response
[0142] Serum antibodies specific to the Tc24-WT + His protein were measured by ELISA using the following protocol. 96-well NUNC High/binding ELISA plates were coated with 1.25 μg/mL recombinant Tc24 WT + His protein diluted in 1 x KPL coating buffer (KPL, Inc.). After overnight incubation at 4 °C, the coating solution was removed and plates were sealed and frozen at -80 °C until further use. At the time of use, plates were thawed at room temperature, washed twice with PBST, and then blocked with 0.1% BSA in PBST for at least 2 hours. Serum samples serially diluted in 1 x PBS, 0.05% Tween 20 were added in duplicate and plates were incubated for 2 hours at RT. IgG2a antibody was detected with an HRP -conjugated anti-IgG2a antibody using TMB Substrate and 1 M HCl for color development. Absorbance was measured at 450 nm using a Spectra Max Plate Reader and SoftMax Pro software.
Data analysis
[0143] Antigen specific lymphocyte IFNy production
[0144] IFNy concentration for each splenocyte sample was calculated from the standard curve. Background IFNy release was determined from non-stimulated (media only) control cells and this value was subtracted from IFNy measured from protein re-stimulated cells to determine the antigen specific IFNy released from splenocytes. Responses to antigen specific stimulation were compared between treatment groups using a Mann-Whitney test and Prism Graph Pad software. P values < 0.05 were considered statistically significant
[0145] Tc24 specific antibodies in serum
[0146] Tc24-WT + His specific IgG2a titers were calculated by first subtracting the background OD450 (wells with no serum added) from each individual well followed by calculating the average OD450 from replicate wells for each sample. The positive cutoff was calculated as the average OD450 plus 3 standard deviations of the naive serum sample at a dilution of 1 : 1,600. For each sample, the titer was determined as the lowest dilution with an average OD450 above the positive cutoff. Geometric mean titers for each group were plotted using Graph Pad Prism software. Kruskal-Wallis ANOVA and Dunn' s multiple comparisons tests were applied using Graph Pad Prism software. P values < 0.05 were considered statistically significant.
Examples of Results
[0147] The present example demonstrates the process development and initial preclinical investigations for the Chagas vaccine candidate, Tc24. Originally, this antigen had been tested as a DNA vaccine and more recently as a recombinant protein subunit vaccine (Martinez- Campos et al., 2015; Dumonteil et al., 2004). During early process development, however, significant aggregation of the antigen was observed with both the His-tagged and tag-less Tc24- WT proteins. Because the reduction of either version of Tc24-WT resulted in significantly decreased aggregation, embodiments of the disclosure concern the mutation of the protein' s cysteine residues.
[0148] Expression and purification of Tc24- WT
[0149] An initial Chagas vaccine antigen candidate was based on wild-type Tc24 from the Yucatan strain of T. cruzi (Dumonteil et al., 2004). Tc24-WT, with the addition of a hexahistidine tag at the C-terminus (Tc24-WT + His), was expressed in E. coli BL21 (DE3) as a soluble recombinant protein using the T7 expression system. Purification of Tc24-WT + His was performed using a two-step purification scheme encompassing Immobilized Metal Affinity Chromatography followed by Q Sepharose XL anion exchange chromatography to remove endotoxin. The yield from this process was approximately 56 mg of protein per liter of culture which represents a recovery of approximately 40% compared to the starting material (142 mg Tc24-WT + His per liter of fermentation biomass). The low yield per liter was due to the low biomass generated from the shake flask cultures (4-5 grams per liter). Analysis of both the in- process as well as the final purified protein by non-reducing SDS-PAGE and Western blot revealed significant aggregation of the protein (FIG. 1A). Aggregation of this nature poses a significant hurdle for scale up production of any candidate vaccine and thus needed to be addressed. Interestingly, upon reduction of Tc24-WT + His prior to SDS-PAGE and Western analysis, there was a significant decrease in protein aggregation (FIG. IB), indicating that intermolecular disulfide bonds between Tc24-WT + His monomers were at least partially responsible for the aggregation observed. There was very similar aggregation with a non-tagged version of wild-type TC24 protein. [0150] To reduce or eliminate these disulfide bonds, cysteine-to-serine mutations were introduced into at the four cysteine residues of Tc24-WT: Tc24-C2 contained two mutations (C4S, C66S) and Tc24-C4 was derived by mutating all four cysteine residues (C4S, C66S, C74S, and C124S) (FIG. 2). The C4 and C66 residues were selected for the Tc24-C2 mutant construct since these two residues likely are surface exposed based on high resolution crystallography (Wingard et al., 2008). Because the final vaccine candidate was to be free of any purification tags, all work performed from this point forward utilized a tag-free version of Tc24-WT, Tc24- C2, and Tc24-C4. They were cloned, expressed, and subsequently purified through ion exchange chromatography and size exclusion chromatography as described in Materials and Methods. Yield and purity of all three proteins are shown in Table 1. Although the yield of target protein per mg biomass was higher for Tc24-WT compared to Tc24-C2 and Tc24-C4, the fermentations for Tc24-C2 and Tc24-C4 yielded significantly more biomass which lead to a higher overall yield for both mutants over Tc24-WT. More importantly, Western blot analysis of all three protein preparations suggested an inverse correlation between the number of cysteine residues removed and the level of aggregation observed. Tc24-C2 protein still showed some evidence of aggregation whereas almost none was seen with Tc24-C4 (FIGS. 3A-3C). Thus, elimination of all four cysteine residues in Tc24 is useful for developing a scalable process for the production of Tc24.
[0151] Table 1 : Comparison of yield and purity for Tc24 constructs
Figure imgf000047_0001
Scalable purification process for Tc24-C4
[0152] Based on the reduced aggregation observed with Tc24-C4, it was selected for further scale-up and pre-clinical testing. SDS-PAGE analysis of reduced and non-reduced in process samples of Tc24-C4 from crude E. coli lysate to final purified protein is shown in FIG. 7A and FIG. 7B. After ion exchange (QXL) chromatography, where the protein eluted at 80 mM NaCl, Tc24-C4 had a purity of >94% (reduced) and >96% (non-reduced). After a subsequent size exclusion chromatography step, Tc24-C4 had a purity of >99% (reduced) and >98% (non- reduced) (FIG. 7B). The final recovery of Tc24-C4 was 52% of the starting amount with a yield of 2,664 mg per liter of fermentation harvest (Table 1). The high yield and purity for Tc24-C4 allowed for initial pre-clinical immunogenicity testing of the candidate antigen.
Protein stability
[0153] Tc24-WT, Tc24-C2 and Tc24-C4, plus an alkylated version of Tc24-WT + His were compared in a short-term stability study. After 10 days at 4°C, protein samples were separated by SDS-PAGE and a Western blot was performed. As anticipated, there was strong aggregation with Tc24-WT + His, which could be eliminated by alkylation of the cysteines. Tc24-C2 and Tc24-C4 preparations exhibited enhanced stability, reduced aggregation, correlating with the number of cysteines removed from their sequence (FIG. 4). The effect of the cysteine induced aggregation was even more noticeable when monitoring the average size and size distribution (polydispersity) of the proteins in solution by dynamic light scattering. FIG. 5 shows the average hydrodynamic radius and the polydispersity of the different Tc24 proteins after 2 days at 4°C. Whereas the radius of the Tc24-WT + His protein was approximately 3.2 nm, elimination of most disulfide bond formation through alkylation (Tc24-WT + His, alkylated) reduced the average size of the protein to less than 2.6 nm, indicative of a reduction in the amount of aggregated protein. Remarkably, Tc24-C2 and Tc24-C4 exhibited a reduced average hydrodynamic radius and moreover, a significant reduction in polydispersity (12%) when compared to Tc24-WT + His (21%), which supports the conclusion that elimination of disulfide bond formation results in a more consistent, monodispersed recombinant protein, stable for at least 10 days at 4°C.
Structural equivalence of the Tc24 constructs
[0154] Circular dichroism (CD) was performed to investigate the impact of the cysteine mutagenesis on the secondary structure of Tc24. The CD analysis demonstrated identical secondary structures, characteristic of alpha-helical proteins, for all Tc24 variants (FIG. 6A). Specifically, based on comparison with two reference sets using CONTENT, SELCON, and CDSSTR data fitting programs (Sreerama et al., 2004) the protein was predicted to fold into 70% alpha helix, 7% Beta sheet and 23% turns and loops. In addition, the tertiary folding of the proteins was compared by thermal melt analysis (FIG. 6B), where Tc24 WT and Tc24-C4 display similar melting behavior, indicating that the removal of the cysteine residues had no detrimental impact on folding.
Immunogenicity and antigenicity of Tc24
[0155] Multiple studies in mouse models have shown that vaccine constructs that induce antigen specific IFNy production from splenocytes and increased antigen specific IgG2a protect mice infected with T. cruzi, resulting in decreased parasite burdens and reduced cardiac pathology (Martinez-Campos et al., 2015; Pereira et al., 2015; Limon-Flores et al., 2010; Gupta and Garg, 2010; Gupta and Garg, 2012). To determine whether cysteine to serine mutagenesis had an impact on the immunogenicity of the Tc24-C4 protein compared to Tc24-WT (± His), we investigated the levels of IFNy and IgG2a production in mice vaccinated with formulated Tc24- WT + His, Tc24-WT, Tc24-C2 and Tc24-C4. Naive mice were vaccinated with the selected proteins combined with the immune potentiator E6020 (Eisai) in a squalene emulsion
(AddaVax™). IFNy secretion was measured from splenocytes harvested from vaccinated mice and re-stimulated in vitro with homologous or heterologous proteins (FIG. 8A, FIG. 8B). The results showed that IFNy secretion was similar between groups, regardless of the protein used for re-stimulation. Although the mean IFNy production observed for Tc24-C4 was lower than that for the other groups, the differences were not significant. IFNy secretion from mice vaccinated with Tc24 C4 combined with E6020 in a stable squalene emulsion was significantly increased compared to mice vaccinated with Tc24 C4 (protein only) or E6020 SE alone (adjuvant only control). These data indicate that cysteine mutagenesis did not significantly affect the antigen- specific cellular immunogenicity of Tc24-C4 in naive mice. As a correlate of Thl skewed immune responses, Tc24-specific IgG2a antibody titers were also measured from the serum of vaccinated mice (FIG. 9). Although terminal Tc24 specific antibody titers in mice vaccinated with Tc24-C4 were significantly lower (1 :25,600 dilution) compared to mice vaccinated with Tc24-WT + His protein (> 100K dilution), similar antibody titers were observed for mice which had been vaccinated with non-tagged Tc24-WT. These data suggest that although the His tagged version of Tc24 may be more antigenic, (possibly due to increased aggregation of the protein(Ratanji et al., 2014) mutation of all four cysteine residues did not appear to abrogate B- cell specific antigenic epitopes. Although reduced compared to Tc24-WT + His, antibody titers were still considered robust at the levels observed. This conclusion is supported by the results of the experiment shown in FIGS. lOA-lOC. In this experiment, mice were infected with T. cruzi parasites and after 53 days post-infection, serum level of IgG2a antibodies towards Tc24-WT and Tc24-C4 were measured. For both Tc24-WT and Tc24-C4, identical IgG2a titers were observed which further supports the conclusion that Tc24 epitopes responsible for the humoral immune response were not disrupted by the C4 mutation.
[0156] Further, protective efficacy of the Tc24-C4 no His pro- tein was confirmed in acutely infected mice vaccinated therapeutically. Vaccination with either Tc24-WT no His or Tc24-C4 combined with E6020 SE significantly increased survival (FIG. 10B). Interestingly, vaccination with E6020 SE alone significantly increased survival as well, likely due to a general boosting of the immune response to native T. cruzi antigens released from the parasites during infection. However, it is important to note that only mice vaccinated with Tc24-C4 no His combined with E6020 SE had significantly reduced cardiac tissue parasite burdens (FIG. IOC). This indicates that while there is some protective effect from adjuvant alone, the presence of additional exogenous Tc24-C4 no His antigen enhances the protective effect, further reducing cardiac parasite burdens and likely tissue damage. Taken together, these data indicate that the Tc24-C4 no His antigen is both immunogenic in na€ive mice, and protective in acutely infected mice.
Significance of Certain Embodiments
[0157] Tc24, a T. cruzi 24 kDa parasite excretory-secretory protein has been selected as a lead antigen for the Chagas vaccine under development by the Sabin Vaccine Institute Product Development Partnership (Sabin PDP). The protein expresses at both a high yield and solubility in the E. coli T7 expression system. However, aggregation of the wild-type protein became apparent which had to be resolved in order to move a Chagas vaccine development program forward. There was evidence that the aggregation observed was mostly due to the formation of disulfide bridges between Tc24 monomers. The approach selected to minimize or eliminate the aggregation observed was to mutate the cysteine residues present in the molecule to serine residues, which would eliminate aberrant disulfide bond formation without introducing local structural changes within the molecule. Changing the protein in such a fashion did have the desired impact on the aggregation; whereas elimination of two cysteine residues partially eliminated the aggregation, elimination of all four cysteine residues almost completely abolished protein aggregation. This change made it possible to develop a scalable and efficient production process that resulted in a doubling of the overall yield of protein after fermentation. Most importantly, due to the elimination of aggregation, less protein was lost during purification. Moreover, elimination of disulfide bond formation did not seem to impact the structure significantly since circular dichroism and thermal melt analysis between Tc24-WT and Tc24-C4 produced very similar results. Thus, the Tc24-C4 met the requirements for large scale production.
[0158] Subsequently, it was shown that Tc24-C4 had retained the immunogenic and antigenic properties of the parent molecule. Studies in Chagasic humans had shown an inverse correlation between disease severity and the magnitude of a TiJ skewed antigen specific immune response (Laucella et al., 2004). Further studies in pre-clinical models to determine the mechanisms of protection have shown that induction of antigen specific T l responses, characterized by increased IFNy production from T cells and increased serum IgG2a, results in reduced blood and tissue parasite burdens as well as decreased cardiac pathology in both acute and chronic infections (Martinez-Campos et al., 2015; Pereira et al., 2015; Bhatia and Garg et al., 2008; Limon-Flores et al, 2010; Gupta and Garg, 2010; Gupta and Garg, 2012; Gupta and Garg, 2013). In the studies described here, it is shown that mice vaccinated with either wild-type or mutant Tc24 proteins develop antigen specific T l immune responses upon homologous re- stimulation as evidenced by IFN " production from splenocytes re-stimulated in vitro and serum IgG2a production. The magnitude of the IFNy responses from mice primed in vivo with wild- type or mutant proteins were comparable, indicating that the cysteine to serine mutations did not negatively affect the overall immunogenicity of the mutant proteins (FIGS. 8 and 9).
Additionally, when splenocytes from mice vaccinated with the Tc24-C2 or Tc24-C4 mutant were re-stimulated in vitro with wild-type proteins (heterologous re-stimulation), IFNy production was not significantly reduced compared to homologous re-stimulation, indicating that the cysteine to serine mutation did not significantly alter the native T cell epitopes responsible for inducing the cellular response. This indicates that cellular responses induced by the mutant proteins would recognize native T cell epitopes in a T. cruzi challenge model and contribute to elimination of intracellular parasites. Studies are ongoing to determine whether splenocytes from T. cruzi infected mice produce antigen specific IFNy upon re-stimulation with Tc24-C2 or Tc24-C4 protein.
[0159] Concurrently, serum IgG2a antibody titers to the wild-type protein in mice vaccinated with Tc24-WT, the Tc24-C2 or Tc24-C4 constructs were robust (FIG. 9).
Interestingly, IgG2a titers to the Tc24-WT in mice vaccinated with the Tc24-C4 construct were significantly lower than titers in mice vaccinated with Tc24-WT. This suggests that the cysteine to serine mutations did impact native B cell epitopes responsible for inducing the humoral response. Induction of antigen specific antibody production from B cells depends on the engagement of surface B cell receptors by antigen presented on MHC Class II receptors
(Harwood et al , 2010). It is well know that aggregated protein antigens can induce more robust antibody production, even in the absence of T cell help (Rosenberg, 2006). Thus reduced aggregation of the Tc24-C4 protein could result in reduced B cell surface receptor engagement and subsequently less antibody production compared to aggregated antigen. However, since aggregated protein therapeutics has been associated with adverse effects in humans, (Wang et al., 2012; Ratanji et al., 2014) achieving a robust level of immunogenicity with the candidate vaccine to induce protection must be balanced with minimizing protein aggregates to minimize adverse effects. The IgG2a antibody titers specific for the wild-type protein in mice vaccinated with the Tc24-C4 construct were a mean of 1 :25,600 which indicates that there is appreciable recognition of native B cell epitopes by Tc24-C4 specific antibodies, but at a lower level than what is induced by vaccination with the Tc24-WT construct. This suggests that vaccination with the Tc24-C4 protein induced a robust immune response that can recognize native proteins, but without excessive induction of antibodies that might result in immune mediated adverse effects in the host. Taken together, these data indicate that mice vaccinated with mutant proteins develop both cellular and humoral immune responses that will recognize native Tc24 protein upon challenge with T. cruzi parasites. Recognition of the mutant proteins by serum from infected mice on ELISA (FIGS. 1 OA- IOC) provides further evidence that immune responses induced in vivo by mutant proteins will recognize native Tc24 protein in the face of T. cruzi challenge. These immune responses should provide protection to T. cruzi challenge through reduction of both intracellular and extracellular parasites, resulting in decreased parasite-induced pathology. Efforts to further evaluate the protective efficacy of the Tc24-C4 antigen, formulated with the E6020-SE adjuvant in a T. cruzi challenge model are underway. Now that the aggregation that would have made manufacture and quality control of the molecule difficult has been eliminated with little impact towards immunogenicity, one can scale-up expression of Tc24-C4 in order to provide sufficient quantities of antigen for clinical purposes. EXAMPLE 3
CHARACTERIZATION AND STABILITY OF TRYPANOSOMA CRUZI 24-C4 (TC24-C4), A CANDIDATE ANTIGEN FOR A THERAPEUTIC VACCINE AGAINST CHAGAS
DISEASE
[0160] The present examples demonstrates that the production process for Tc24-C4 is reproducible, robust, and yields a recombinant protein with ideal analytical characteristics and stability profiles.
MATERIALS AND METHODS
Fermentation
[0161] Tc24-C4 was expressed at the 10 L scale using a Celligen 310 Benchtop fermentation system (Eppendorf). Briefly, 10 L of E. coli Basal Salt medium was inoculated with a seed culture to a starting OD60o of 0.05, and grown at 37 °C. At an OD60o of 0.5, the temperature was reduced to 30 °C. At an OD60o between 0.6 and 1.0, isopropyl β-D-l- thiogalactopyranoside was added to a final concentration of 1 mM. Approximately 5 h after induction, fed-batch medium (50 % v/v glycerol, 20 mM MgCl2) was added at 3 mL/L/hr.
Agitation at 500 rpm, 1 vvm air flow, pH 7.2, and 30 % DO was maintained throughout fermentation. After approximately 18 h of induction, the culture was recovered from the fermenter, and biomass was collected by centrifugation for 25 min at 12,227 x g and 4 °C. The cell paste was collected and stored at -80 °C prior to downstream processing.
Purification
[0162] Tc24-C4 was purified in three separate purification runs from frozen biomass obtained from three separate 10 L fermentations. In each purification run, 200 g of E. coli biomass was thawed and lysed in 50 mM Tris-HCl pH 8.0 using an Avestin Emulsiflex C55 high-pressure homogenizer and heat exchanger. The concentration of Tc24-C4 in the homogenate was determined on pre-cast 12 % Bis-Tris SDS-PAGE gels (Invitrogen) stained with Coomassie blue, using purified Tc24-C4 as the calibration standard. A volume of lysate equal to 3,200 mg of Tc24-C4 was clarified using a GE Healthcare Ultrafiltration Hollow Fiber cartridge (nominal molecular weight cutoff 750 kDa, 2800 cm2). The hollow fiber-clarified permeate was loaded onto a 373 mL GE Healthcare Q Sepharose XL column, which was then washed with lysis buffer and then with 75 mM NaCl. Tc24-C4 was eluted with 125 mM NaCl, and fractions from the peak were pooled starting at approximately 67 % of the maximum peak height until the end of the peak. The eluate was concentrated 24-34-fold with two flat-sheet tangential flow filtration cassettes (Sartorius Sartocon Slice 200 Hydrosart, nominal molecular weight cutoff 10 kDa, 0.02 m2) to a concentration of 16-17 mg/mL, as measured by absorbance at 280 nm on a Nanodrop 2000 spectrophotometer (Thermo Fisher), using a molecular weight of 23,660 Da and molar extinction coefficient of 20,970 M'1 cm'1. The concentrated pool was loaded in two cycles onto a 4 L GE Healthcare Sephacryl S-200 High Resolution column, and eluted with 1 * phosphate-buffered saline pH 7.4. Fractions from the peak were pooled starting at 88 %, 73 %, and 64 % of the peak height for the first, second, and third run, respectively. The pool extended through the end of the peak, and the final pool was sterile-filtered at 0.22 μπι, aliquoted, and stored at -80 °C. Endotoxin levels were measured prior to aliquoting using Endosafe® PTS™ system (Charles River).25
Characterization of purified Tc24-C4
[0163] Purified recombinant Tc24-C4 was characterized according to guideline Q6B of the International Committee on Harmonization. Color and appearance were visually assessed on an illuminated visual inspection hood (Bosch, Model MIH DX). pH was measured using a PerpHect microelectrode (Orion, Model 8220BNWP) and a Versa Star pH meter (Orion, Model VSTAR90). Protein concentration was determined by absorbance at 280 nm on an Ultrospec 6300 pro spectrophotometer (Amersham Biosciences), using a molecular weight of 23,660 Da, a molar extinction coefficient of 20,970 M"1 cm"1, and a path length of 1 cm. Purity was assessed on pre-cast 4-20 % Tris-glycine SDS-PAGE gels (Invitrogen) stained with Coomassie blue and silver, and on Western blots developed with in-house primary mouse antibodies against wild- type Tc24, secondary anti-mouse IgG conjugated to alkaline phosphatase (KPL), and BCIP/NBT substrate kit (KPL). Presence of E. coli host-cell proteins was assessed using an E. coli host-cell protein Western blot kit (Cygnus). Purity was also assessed by reversed-phase HPLC on an Alliance 2695 system (Waters) fitted with a 5 μπι, 4.6 χ 150 mm Symmetry300 C4 column (Waters), using as mobile phase water with 0.05 % trifluoroactetic acid (Buffer A) and acetonitrile with 0.05 % trifluoroacetic acid (Buffer B). Tc24-C4 (50 μg) was eluted at 1.0 mL/min and 45 °C over 15 % Buffer B for 5 min, a linear gradient to 45 % Buffer B in 10 min, and a linear gradient to 55 % Buffer B in 10 min. Elution was monitored by absorbance at 280 nm on a photodiode array detector (Waters, Model 2996). The column was washed between samples in 100 % Buffer B for 5 min, and finally re-equilibrated for 10 min in 15 % Buffer B. Where appropriate, tests were performed according to in-house standard operating procedures.
Stability testing
[0164] For all lots, stability, as measured by color and appearance, pH, UV spectrophotometry, SDS-PAGE, and reversed-phase HPLC, was evaluated over three freeze- thaw cycles in an ethanol-dry ice bath, over 30 ± 1 days at 4 °C, room temperature (-25 °C), and 37 °C, and after 17-18 months at -80 °C
RESULTS AND DISCUSSION
Purification
[0165] From a fermentation run at 10 L scale, approximately 100 g of biomass was obtained per liter, with over 4 g of target protein expressed per liter. The established purification scheme achieved 98 % purity, as measured on SDS-PAGE gels stained with Coomassie blue, and reduced endotoxin levels to less than 0.5 EU/mL, with minimal E. coli host cell proteins remaining (FIG. 13 and Table 2). By maintaining recoveries greater than 60 % at each step, 1.5 g of Tc24-C4 per liter of fermentation culture was obtained as final product. Pooling after elution from a Sephacryl size exclusion column was optimized through three separate runs by starting the pool earlier in the peak while maintaining 98 % purity on Coomassie-stained SDS-PAGE gels. Collectively, the data demonstrate that the purification process is robust, and suitable for technology transfer and cGMP manufacturing.
[0166] Table 2. Purification of Tc24 C4. Data represent the mean ± standard deviation of three separate purification runs. mg/L of Step Overall SDS-PAGE Endotoxin
Step fermentation Recovery Recovery Purity (EU)
culture (%) (%) (%)
Homogenized lysate 4259 ± 660 n/a n/a 45 ± 1 1 5.42E9 ± 1.40E9
Hollow fiber clarified 3608 ± 869 85 ± 2 85 ± 2 67 ± 10 9.42E6 ± 1.05E7
QXL Pool 2430 ± 396 67 ± 1 57 ± 1 94 ± 3 1.51E3 ± 4.78E2
Post-TFF QXL Pool 2330 ± 322 96 ± 5 55 ± 3 95 ± 2 Not determined
Sephacryl Pool 1508 ± 312 65 ± 9 36 ± 7 98 ± 1 5.56E1 ± 5.09E0
Analytical Assay Development [0167] Prior to characterization and stability testing, assays were established to detect potential degradation events. Proteolysis and crosslinking due to trace amounts of protease
(1/500) and formaldehyde (0.2 %), respectively, were detectable by SDS-PAGE (FIG. 14A) and reversed-phase HPLC (FIG. 15A, FIG. 15B). Notably, we found that the absorbance spectrum between 200 and 750 nm markedly changed with proteolysis (FIG. 16A), presumably due to the gradual exposure of tryptophan, tyrosine, and phenylalanine as the globular structure of the protein was progressively lost. As these amino acids have maximum absorbance peaks at 280, 275, and 258 nm, respectively, an arbitrary value, A280/A275 + A280/A258, was used as an indicator of stability. A time course indicated that this value decreased with limited proteolysis and exposure to 0.1 % acetic acid (pH ~ 4) (FIG. 16B).
Analytical Characterization
[0168] As shown in Table 3, all lots of Tc24-C4 were visually clear, non-viscous, and colorless, with a pH of 7.43 ± 0.05 and a concentration between 1.5 and 1.7 mg/mL.
[0169] Table 3. Characterization of Tc24-C4 purified from E. coli in three independent
Test Run 1 Run 2 Run 3 Mean % CV
Color and appearance clear clear clear
pH 7.48 ± 0.01 7.43 ± 0.01 7.38 ± 0.02 7.43 'J.U 0.5 concentration, mg/mL 1.538 ± 0.003 1.741 ± 0.002 1.717 ± 0.002 1.67 ± 0.11 5.4
SDS-PAGE and Coomassie
MW, kDa 26.8 ± 0.2 27.4 ± 0.1 27.4 ± 0.3 27.2 ± 0.3 1.0
Purity, % 97.5 ± 0.7 97.1 ± 1.0 97.3 ± 1.0 97.3 ± 0.2 0.2
SDS-PAGE and Silver
MW, kDa 29.4 ± 0.6 30.5 ± 0.8 30.0 ± 0.8 30.0 ± 0.6 1.5
Purity, % 94.5 ± 2.0 90.0 ± 3.9 86.3 ± 8.6 90.3 ± 4.1 3.7
Western blot
MW, kDa 29.1 ± 1.0 28.1 ± 0.3 28.1 ± 0.4 28.4 ± 0.6 1.7
Reversed-phase HPLC
Elution time, min 19.35 ± 0.004 19.37 ± 0.01 19.38 ± 0.01 19.36 ± 0.01 0.04
Purity, % 99.1 ± 0.1 98.8 ± 0.1 98.0 ± 0.1 98.6 ± 0.6 0.5
[0170] On SDS-PAGE gels stained with Coomassie blue, Tc24-C4 migrated as a single band with molecular weight 27.2 ± 0.3 kDa and purity above 97 %. On silver-stained SDS- PAGE gels, Tc24-C4 from the third purification run was less pure (86.3 ± 8.6 %) than lots from the second (90.0 ± 3.9 %) and first run (94.5 ± 2.0 %). Although silver staining is less
quantitative, the purity values correlate with visual assessment of higher and lower molecular weight bands. Tc24-C4 also reacted as a single 28 kDa band with in-house antibodies raised against wild-type Tc24 that was produced in yeast (FIG. 14C). An E. coli host-cell protein with a molecular weight of approximately 18 kDa was also detected by western blot in all three lots. Finally, Tc24 eluted from a C4 reversed-phase column as a single peak at 19.36 ± 0.01 min, with purity 98 % or better. Small differences in purity were observed between the three lots, following similar trends noted on silver-stained SDS-PAGE gels. Collectively, the data indicate that three independent runs yielded comparable lots with a coefficient of variation of less than 6 % for all parameters tested, despite slight differences in the fractions pooled during size-exclusion chromatography.
[0171] Experimental values from amino acid analysis deviated very little from theoretical values, confirming the identity and high purity of Tc24-C4 lots (Table 4).
[0172] Table 4. Experimental and theoretical amino acid content of Tc24-C4.
Tryptophan and cysteine content was not experimentally determined, and is excluded from analysis. Experimental values are mean ± SD of three lots, each measured in duplicate.
Residue Theoretical (%) Experimental
(%)
ASX 13.0 12.4 ± 0.1
GLX 12.0 12.7 ± 0.2
LYS 11.1 11.3 ± 0.1
ALA 10.6 10.5 ± 0.0
LEU 8.7 8.6 ± 0.1
SER 7.2 7.1 ± 0.0
GLY 6.7 6.8 ± 0.2
PHE 6.3 6.2 ± 0.1
ARG 5.8 5.9 ± 0.0
VAL 5.3 5.1 ± 0.0
THR 3.8 4.0 ± 0.1
ILE 2.9 3.0 ± 0.0
PRO 2.9 3.0 ± 0.0
MET 1.9 1.2 ± 0.3
TYR 1.4 1.7 ± 0.1
HIS 0.5 0.5 ± 0.0
[0173] On the other hand, mass spectrometry indicated that the lots are gluconylated (FIG. 17), a posttranslational modification due to passive sugar-protein reactions ( akitzis et al., 1998), and which has been reported in recombinant proteins (Mironoya et al., 2003; Casey et al., 1995; Geoghegan et al., 1999). While the impact on antigenicity is presently unknown, this posttranslational modification can be suppressed if necessary by overexpression of
phosphogluconalactonase (Aon et al., 2008).
Freeze-thaw stability
[0174] All lots remained visually clear, non-viscous, and colorless over multiple freeze- thaw cycles in ethanol and dry ice. The pH was stable at approximately pH 7.4. Freeze-thaw stress did not affect the A280/A275 + A280/A258 value, the molecular weight and purity on Coomassie-stained SDS-PAGE gels, as well as the retention time and purity on reversed-phase FIPLC (FIG. 11). Taken together, the data indicate that Tc24-C4 is stable over multiple freeze- thaw cycles.
Accelerated stability
[0175] All lots remained visually clear, non-viscous, and colorless over 30 ± 1 days at 4 °C, room temperature, and 37 °C. The pH was stable at 7.40 ± 0.03 at all temperatures, as was the A280/A275 + A280/A258 value. However, degradation at 37 °C was observed in all lots at 30 ± 1 days on SDS-PAGE gels stained with Coomassie blue (FIG. 14B), although purity decreased only marginally from 96-98 % to 93-97 %. The molecular weight of the intact antigen remained constant at approximately 30 kDa. Similarly, accelerated degradation at 37 °C was detected in all lots by reversed-phase HPLC, with purity decreasing from 97-99 % to 89-92 % at 30 ± 1 days (FIG. 15C). Collectively, the data indicate that Tc24-C4 is stable for at least 30 days at room temperature and 4 °C, and will tolerate short-term exposure to 37 °C (FIG. 12).
Long-term stability
[0176] After 17-18 months at -80 °C, Tc24-C4 remained clear, nonviscous, and colorless, with pH 7.32 ± 0.04, concentration between 1.5 and 1.8 mg/mL, and purity 98 % or better by C4 reversed-phase chromatography. On SDS-PAGE gels stained with Coomassie blue, Tc24-C4 migrated as a single band with molecular weight 27.9 ± 0.5 kDa and purity above 95 %. Taken together, the data indicate that the antigen is stable over long-term storage at -80 °C.
CONCLUSIONS
[0177] The data indicate that the production process for E. co/i-expressed Tc24-C4 protein is robust, and reproducibly yields protein lots with consistent analytical characteristics, freeze-thaw, accelerated, and long-term stability profiles. Like most proteins, Tc24-C4 should be stored at -80 °C, but is also stable at 4 °C and room temperature for at least 30 days, and up to 7- 15 days at 37 °C. The data also indicate that the main pathway of degradation is proteolysis. Thus, Tc24-C4 is suitable for technology transfer, cGMP production, and clinical testing based on process robustness, analytical characteristics, and stability.
REFERENCES
All patents and publications mentioned in the specification are indicative of the level of those skilled in the art to which the invention pertains. All patents and publications are herein incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.
1. Andrade ZA. Pathogenesis of Chagas' Disease. Res Immunol. 1991 ; 142: 126-9.
2. Aon JC, Caimi RJ, Taylor AH, et al. Suppressing Posttranslational Gluconoylation of Heterologous Proteins by Metabolic Engineering of Escherichia coli. Appl Environ Microbiol. 2008;74(4):950-958. doi: 10.1128/AEM.01790-07.
3. Bestetti RB, Muccillo, G. Clinical course of Chagas' heart disease: a comparison with dilated cardiomyopathy. International journal of cardiology. 1997;60: 187-93.
4. Bhatia V, Garg NJ. Previously unrecognized vaccine candidates control Trypanosoma cruzi infection and immunopathology in mice. Clinical and vaccine immunology : CVI. 2008; 15 : 1 158-64.
5. Bonney KM. Chagas disease in the 21 st century: a public health success or an emerging threat? Parasite. 2014;21 : 11.
6. Campos MC, Leon LL, Taylor MC, Kelly TM. Benznidazole-resistance in Trypanosoma cruzi: evidence that distinct mechanisms can act in concert. Molecular and biochemical parasitology. 2014; 193 : 17-9.
7. Casey EB, Zhao HR, Abraham EC. Role of glycine 1 and lysine 2 in the glycation of bovine gamma B-crystallin. Site-directed mutagenesis of lysine to threonine. J Biol Chem. 1995;270(35):20781-20786. Castro JA, de Mecca MM, Bartel LC. Toxic side effects of drugs used to treat C agas' disease (American trypanosomiasis). Human & experimental toxicology. 2006;25:471-9. Dumonteil E, Escobedo-Ortegon J, Reyes-Rodriguez N, Arjona-Torres A, Ramirez-Sierra MJ. Immunotherapy of Trypanosoma cruzi infection with DNA vaccines in mice. Infect Immun. 2004;72:46-53. Dumonteil E, Bottazzi ME, Zhan B, Heffernan MJ, Jones K, Valenzuela JG, et al.
Accelerating the development of a therapeutic vaccine for human Chagas disease:
rationale and prospects. Expert review of vaccines. 2012; 11 : 1043-55. Fabbro DL, Streiger ML, Arias ED, Bizai ML, del Barco M, Amicone NA. Trypanocide treatment among adults with chronic Chagas disease living in Santa Fe city (Argentina), over a mean follow-up of 21 years: parasitological, serological and clinical evolution. Revista da Sociedade Brasileira de Medicina Tropical. 2007;40: 1-10. Garcia MN, Murray KO, Hotez PJ, Rossmann SN, Gorchakov R, Ontiveros A, et al. Development of chagas cardiac manifestations among Texas blood donors. The
American j ournal of cardiology. 2015; 115 : 1 13-7. Geoghegan KF, Dixon HB, Rosner PJ, et al. Spontaneous alpha-N-6- phosphogluconoylation of a "His tag" in Escherichia coli: the cause of extra mass of 258 or 178 Da in fusion proteins. Anal Biochem. 1999;267(1): 169-184.
doi: 10.1006/abio.1998.2990. Gupta S, Garg J. TcVac3 induced control of Trypanosoma cruzi infection and chronic myocarditis in mice. PloS one. 2013;8:e59434. Gupta S, Garg NJ. Prophylactic efficacy of TcVac2 against Trypanosoma cruzi in mice. PLoS neglected tropical diseases. 2010;4:e797. Gupta S, Garg NJ. Delivery of antigenic candidates by a DNA/MVA heterologous approach elicits effector CD8(+)T cell mediated immunity against Trypanosoma cruzi. Vaccine. 2012;30:7179-86. Haberland A, Saravia SG, Wallukat G, Ziebig R, Schimke I. Chronic Chagas disease: from basics to laboratory medicine. Clinical chemistry and laboratory medicine : CCLM / FESCC. 2013;51 :271-94. Harwood NE, Batista FD. Early events in B cell activation. Annual review of
immunology. 2010;28: 185-210. Hotez PJ, Bottazzi ME, Franco-Paredes C, Ault SK, Periago MR. The neglected tropical diseases of Latin America and the Caribbean: a review of disease burden and distribution and a roadmap for control and elimination. PLoS neglected tropical diseases.
2008;2:e300. Laucella SA, Postan M, Martin D, Hubby Fralish B, Albareda MC, Alvarez MG, et al. Frequency of interferon- gamma -producing T cells specific for Trypanosoma cruzi inversely correlates with disease severity in chronic human Chagas disease. The Journal of infectious diseases. 2004; 189:909-18. Le Loup G, Pialoux G, Lescure FX. Update in treatment of Chagas disease. Current opinion in infectious diseases. 2011;24:428-34. Martinez-Campos V, Martinez- Vega P, Ramirez-Sierra MJ, Rosado-Vallado M, Seid CA, Hudspeth EM, et al. Expression, purification, immunogenicity, and protective efficacy of a recombinant Tc24 antigen as a vaccine against Trypanosoma cruzi infection in mice. Vaccine. 2015;33 :4505-12. Mironova R, Niwa T, Dimitrova R, Boyanova M, Ivanov I. Gly cation and post- translational processing of human interferon-gamma expressed in Escherichia coli. J Biol Chem. 2003;278(51):51068-51074. doi: 10.1074/jbc.M307470200. Morillo CA, Marin-Neto Ja Fau - Avezum A, Avezum A Fau - Sosa-Estani S, Sosa- Estani S Fau - Rassi A, Jr., Rassi A Jr Fau - Rosas F, Rosas F Fau - Villena E, et al. Randomized Trial of Benznidazole for Chronic Chagas' Cardiomyopathy. 2015;
373(14): 1295-306.
Pereira IR, Vilar-Pereira G, Marques V, da Silva AA, Caetano B, Moreira OC, et al. A human type 5 adenovirus-based Trypanosoma cruzi therapeutic vaccine re-programs immune response and reverses chronic cardiomyopathy. PLoS Pathog.
2015; l l :el004594. Pinazo MJ, Munoz J Fau - Posada E, Posada E Fau - Lopez-Chejade P, Lopez-Chejade P Fau - Gallego M, Gallego M Fau - Ayala E, Ayala E Fau - del Cacho E, et al. Tolerance of benznidazole in treatment of Chagas' disease in adults. 2010; 54(l l):4896-9. Pinazo MJ, Guerrero L, Posada E, Rodriguez E, Soy D, Gascon J. Benznidazole-related adverse drug reactions and their relationship to serum drug concentrations in patients with chronic chagas disease. Antimicrobial agents and chemotherapy. 2013;57:390-5. Quij ano-Hernandez IA, Bolio-Gonzalez ME, Rodriguez -Buenfil JC, Ramirez-Sierra MJ, Dumonteil E. Therapeutic DNA vaccine against Trypanosoma cruzi infection in dogs. Annals of the New York Academy of Sciences. 2008; 1149:343-6. Quij ano-Hernandez IA, Castro-Barcena A, Vazquez-Chagoyan JC, Bolio-Gonzalez ME, Ortega-Lopez J, Dumonteil E. Preventive and therapeutic DNA vaccination partially protect dogs against an infectious challenge with Trypanosoma cruzi. Vaccine.
2013;31 :2246-52. Rakitzis ET, Papandreou P. Reactivity of 6-phosphogluconolactone with hydroxylamine: the possible involvement of glucose-6-phosphate dehydrogenase in endogenous glycation reactions. Chem Biol Interact. 1998; 113(3):205-216. Rassi Jr. A, Rassi, A., Little, W.C. Chagas' Heart Disease. Clin Cardiol. 2000;23 :883-9. Rassi Jr. A, Rassi, A., Marin-Neto, J.A. Chagas Disease. Lancet. 2010;375: 1388-402. Ratanji KD, Derrick Jp Fau - Dearman RJ, Dearman Rj Fau - Kimber I, Kimber I.
Immunogenicity of therapeutic proteins: influence of aggregation. 2014; 1 1(2):99-109. Reithinger R, Tarleton RL, Urbina JA, Kitron U, Gurtler RE. Eliminating Chagas disease: challenges and a roadmap. Bmj. 2009;338:bl283. Rosenberg AS. Effects of protein aggregates: an immunologic perspective. The AAPS journal. 2006;8:E501-7. Sanchez -Burgos G, Mezquita-Vega RG, Escobedo-Ortegon J, Ramirez-Sierra MJ, Arjona-Torres A, Ouaissi A, et al. Comparative evaluation of therapeutic DNA vaccines against Trypanosoma cruzi in mice. FEMS immunology and medical microbiology. 2007;50:333-41. Serna C, Lara JA, Rodrigues SP, Marques AF, Almeida IC, Maldonado RA. A synthetic peptide from Trypanosoma cruzi mucin-like associated surface protein as candidate for a vaccine against Chagas disease. Vaccine. 2014;32:3525-32. Singh M, Kazzaz J Fau - Ugozzoli M, Ugozzoli M Fau - Baudner B, Baudner B Fau - Pizza M, Pizza M Fau - Giuliani M, Giuliani M Fau - Hawkins LD, et al. MF59 oil-in- water emulsion in combination with a synthetic TLR4 agonist (E6020) is a potent adjuvant for a combination Meningococcus vaccine. 2012; 8(4):486-90. Sreerama , Woody RW. Computation and analysis of protein circular dichroism spectra. Methods in enzymology. 2004;383 :318-51. Taibi A, Espinoza AG, Ouaissi A. Trypanosoma cruzi: analysis of cellular and humoral response against a protective recombinant antigen during experimental Chagas' disease. Immunology letters. 1995;48: 193-200. Taibi A, Plumas-Marty B Fau - Guevara-Espinoza A, Guevara-Espinoza A Fau - Schoneck R, Schoneck R Fau - Pessoa H, Pessoa H Fau - Loyens M, Loyens M Fau - Piras R, et al. Trypanosoma cruzi: immunity -induced in mice and rats by trypomastigote excretory-secretory antigens and identification of a peptide sequence containing a T cell epitope with protective activity. 1993; 51(5):2676-89. Wang W, Singh SK, Li N, Toler MR, King KR, Nema S. Immunogenicity of protein aggregates—concerns and realities. International journal of pharmaceutics. 2012;431 : 1- 1 1. Wingard IN, Ladner, J., Vanarotti, M., Fisher, A.J., Robinson, H., Buchanan, K.T., Engman, D.M., Ames, J.B. . Structural Insights into Membrane Targeting by the Flagellar Calcium-binding Protein (FCaBP), a Myristoylated and Palmitoylated Calcium Sensor in Trypanosoma cruzi. THE JOURNAL OF BIOLOGICAL CHEMISTRY.
2008;283 :23388-96.

Claims

CLAIMS What is claimed is:
1. A composition comprising a non-natural Trypanosoma cruzi Tc24 polypeptide, wherein the polypeptide lacks 1, 2, 3, or all cysteine residues of the wild-type Tc24 protein.
2. The composition of claim 1, further defined as comprising one or more amino acid substitutions at 1, 2, 3, or all cysteine residues of the wild-type Tc24 polypeptide.
3. The composition of claim 2, wherein the substitution is to a serine, methionine, or threonine.
4. The composition of any of claims 1-3, further defined as comprising the sequence of SEQ ID NO:2.
5. The composition of any of claims 1-4, wherein the polypeptide comprises one or more modifications other than the modification(s) to one or more of the cysteine residues.
6. The composition of any one of claims 1-5, wherein the polypeptide comprises an N- terminal truncation, a C-terminal truncation, or both.
7. The composition of any one of claims 1-6, wherein the composition comprises an adjuvant.
8. The composition of claim 7, wherein the adjuvant comprises one or more TLR-4 receptor agonists.
9. The composition of claim 7, wherein the adjuvant comprises synthetic TLR4 agonist E6020, squalene oil-in-water emulsions, liposomes, TLR9 agonists, TLR ligands, or a combination thereof.
10. The composition of any of claims 1-9, wherein the composition comprises microparticles or nanoparticles.
1 1. The composition of any of claims 1-10, wherein the composition comprises aluminum salts, emulsions, poly(lactic-co-glycolic acid) (PLGA) microspheres; lipidoids; lipoplex; liposome; polymers; carbohydrates; oligonucleotides, cationic lipids; fibrin gel; fibrin hydrogel; fibrin glue; fibrin sealant; fibrinogen; thrombin; rapidly eliminated lipid nanoparticles; or combinations thereof.
12. The composition of any one of claims 1-1 1, wherein the composition is formulated in a pharmaceutically acceptable carrier.
13. A method of treating or preventing a medical condition caused by Trypanosoma cruzi in an individual, comprising the step of providing to the individual an effective amount of a composition that comprise a non-natural Tc24 protein comprising amino acid substitution at least at 1, 2, 3, or all cysteine residues of the wild-type Tc24 protein.
14. The method of claim 13, wherein the individual is a human, horse, cow, dog, cat, goat, sheep, or pig.
15. A method of treating or preventing a medical condition caused by Trypanosoma cruzi in an individual, comprising the step of providing to the individual an effective amount of a composition of any one of claims 1-12.
16. The method of claim 15, wherein the individual is a human, horse, cow, dog, cat, goat, sheep, or pig.
17. The method of any one of claims 13-16, further comprising the step of diagnosing the medical condition.
18. The method of any one of claims 13-17, wherein the individual has a medical condition caused by Trypanosoma cruzi, is seropositive for Trypanosoma cruzi, has been exposed to Trypanosoma cruzi, was previously infected with Trypanosoma cruzi, resides in a region known to have Trypanosoma cruzi, or has been or will be traveling to a region known to have Trypanosoma cruzi.
19. A method of producing an immunogenic composition for the treatment or prevention of a medical condition caused by Trypanosoma cruzi, comprising the step of modifying Tc24 polypeptide, or a functionally active fragment thereof, to lack one or more cysteine residues compared to wildtype Tc24 polypeptide.
20. A method of producing an immunogenic composition for the treatment or prevention of a medical condition caused by Trypanosoma cruzi, comprising the step of modifying Tc24 polypeptide, or a functionally active fragment thereof, to produce a mutant Tc24 that aggregates less and/or has longer storage capacity compared to wildtype Tc24 polypeptide.
21. The method of claim 19 or 20, further comprising the step of providing an effective amount of the polypeptide to an individual in need thereof.
PCT/US2017/022317 2016-03-14 2017-03-14 Tc24-c4, a chagas disease vaccine antigen with improved stability and decreased aggregation Ceased WO2017160849A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
BR112018068544A BR112018068544A2 (en) 2016-03-14 2017-03-14 tc24-c4, Chagas disease antigen with improved stability and decreased aggregation
MX2018011226A MX2018011226A (en) 2016-03-14 2017-03-14 Tc24-c4, a chagas disease vaccine antigen with improved stability and decreased aggregation.

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662308054P 2016-03-14 2016-03-14
US62/308,054 2016-03-14

Publications (1)

Publication Number Publication Date
WO2017160849A1 true WO2017160849A1 (en) 2017-09-21

Family

ID=59851379

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/022317 Ceased WO2017160849A1 (en) 2016-03-14 2017-03-14 Tc24-c4, a chagas disease vaccine antigen with improved stability and decreased aggregation

Country Status (3)

Country Link
BR (1) BR112018068544A2 (en)
MX (1) MX2018011226A (en)
WO (1) WO2017160849A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021076570A3 (en) * 2019-10-17 2021-05-27 Baylor College Of Medicine Chagas disease vaccine antigens with improved stability and decreased aggregation
CN118108790A (en) * 2024-03-25 2024-05-31 中国农业大学 Preparation and application of a whey protein-derived hypoglycemic peptide with GLP-1 receptor agonist activity

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030108960A1 (en) * 1998-07-30 2003-06-12 Innogenetics N.V. Antigens and immunoassays for diagnosing Chagas' disease
US20080096232A1 (en) * 2006-10-19 2008-04-24 Shah Dinesh O Methods for the detection and diagnosis of Trypanosoma cruzi infection
US20120122125A1 (en) * 2007-12-27 2012-05-17 Abbott Laboratories Anti-t. cruzi antibodies and methods of use
US20150250869A1 (en) * 2012-10-02 2015-09-10 Transgene Sa Virus-containing formulation and use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030108960A1 (en) * 1998-07-30 2003-06-12 Innogenetics N.V. Antigens and immunoassays for diagnosing Chagas' disease
US20080096232A1 (en) * 2006-10-19 2008-04-24 Shah Dinesh O Methods for the detection and diagnosis of Trypanosoma cruzi infection
US20120122125A1 (en) * 2007-12-27 2012-05-17 Abbott Laboratories Anti-t. cruzi antibodies and methods of use
US20150250869A1 (en) * 2012-10-02 2015-09-10 Transgene Sa Virus-containing formulation and use thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
SEID, CA ET AL.: "Cysteine mutagenesis improves the production without abrogating antigenicity of a recombinant protein vaccine candidate for human chagas disease", HUMAN VACCINES & IMMUNOTHERAPEUTICS., vol. 13, no. 3, 4 March 2017 (2017-03-04), pages 621 - 633, XP055422626 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021076570A3 (en) * 2019-10-17 2021-05-27 Baylor College Of Medicine Chagas disease vaccine antigens with improved stability and decreased aggregation
CN118108790A (en) * 2024-03-25 2024-05-31 中国农业大学 Preparation and application of a whey protein-derived hypoglycemic peptide with GLP-1 receptor agonist activity

Also Published As

Publication number Publication date
MX2018011226A (en) 2019-05-16
BR112018068544A2 (en) 2019-04-24

Similar Documents

Publication Publication Date Title
Wang et al. Phosphoglycerate kinase enhanced immunity of the whole cell of Streptococcus agalactiae in tilapia, Oreochromis niloticus
JP6461100B2 (en) New vaccine against apicomplexa pathogen
US9422343B2 (en) Vaccine
EP3299384B1 (en) Truncated rotavirus vp4 protein and application thereof
JP2023025066A (en) Vaccine constructs and their use against staphylococcal infections
WO2017160849A1 (en) Tc24-c4, a chagas disease vaccine antigen with improved stability and decreased aggregation
EP4466013A1 (en) Chimeric polypeptides
JP2025503080A (en) Chimeric Polypeptides
US10513543B2 (en) Antigen chimera, antigen composition, vaccine, method of preparing the same and cassette thereof
JP5980810B2 (en) Canine babesiosis vaccine antigen
EP3509630A1 (en) Thermostable variants of p. falciparum pfrh5 which can be produced in bacterial cells
US20220378892A1 (en) Recombinant expression of chlamydia momp antigen
KR102092041B1 (en) Vaccine composition for prevention or treatment of brucellosis comprising SodC, RibH, Ndk, L7/L12 and MDH protein derived from Brucella abortus as effective component
US20240108707A1 (en) Chagas disease vaccine antigens with improved stability and decreased aggregation
CA3033143A1 (en) Composition for preventing and treating mycoplasma hyorhinis infection, and method for producing said composition
JP2007527707A (en) Piroplasmid vaccine
US12048743B2 (en) Glyconjugate vaccines
US10174086B2 (en) Vaccine
WO2025172894A1 (en) Modified nanoparticle subunits and use thereof
EP4701655A1 (en) Tp0751 chimera-containing vaccine
US20190255167A1 (en) Fusion polypeptides
CA3153247A1 (en) Non-toxic listeriolysin o polypeptides and uses thereof
CN112543640A (en) Recombinant yeast lysates for inducing cellular immune responses
KR20200048054A (en) Vaccine composition for prevention or treatment of brucellosis comprising SodC and RibH protein derived from Brucella abortus as effective component

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: MX/A/2018/011226

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112018068544

Country of ref document: BR

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17767344

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17767344

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 112018068544

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20180913