WO2017155973A1 - Aav-mediated expression using a synthetic promoter and enhancer - Google Patents

Aav-mediated expression using a synthetic promoter and enhancer Download PDF

Info

Publication number
WO2017155973A1
WO2017155973A1 PCT/US2017/021124 US2017021124W WO2017155973A1 WO 2017155973 A1 WO2017155973 A1 WO 2017155973A1 US 2017021124 W US2017021124 W US 2017021124W WO 2017155973 A1 WO2017155973 A1 WO 2017155973A1
Authority
WO
WIPO (PCT)
Prior art keywords
vector
promoter
enhancer
synthetic
cftr
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2017/021124
Other languages
French (fr)
Inventor
John F. Engelhardt
Ziying Yan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Iowa Research Foundation UIRF
Original Assignee
University of Iowa Research Foundation UIRF
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to MX2018010842A priority Critical patent/MX2018010842A/en
Priority to CA3016985A priority patent/CA3016985C/en
Priority to IL261642A priority patent/IL261642B2/en
Priority to IL322737A priority patent/IL322737A/en
Priority to EA201892006A priority patent/EA201892006A1/en
Priority to AU2017229347A priority patent/AU2017229347A1/en
Priority to EP17712339.5A priority patent/EP3426787A1/en
Application filed by University of Iowa Research Foundation UIRF filed Critical University of Iowa Research Foundation UIRF
Priority to US16/082,767 priority patent/US11684679B2/en
Publication of WO2017155973A1 publication Critical patent/WO2017155973A1/en
Anticipated expiration legal-status Critical
Priority to AU2020289851A priority patent/AU2020289851B2/en
Priority to US18/139,661 priority patent/US20240066147A1/en
Priority to AU2023263461A priority patent/AU2023263461A1/en
Priority to US19/183,490 priority patent/US20250381308A1/en
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14041Use of virus, viral particle or viral elements as a vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14041Use of virus, viral particle or viral elements as a vector
    • C12N2750/14043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011Details
    • C12N2750/14011Parvoviridae
    • C12N2750/14111Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14141Use of virus, viral particle or viral elements as a vector
    • C12N2750/14143Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Definitions

  • Cystic fibrosis is a lethal, autosomal-recessive disorder that affects at least 30,000 people in the U.S. alone (O'Sullivan et al., 2009),
  • the genetic basis of CF is mutation of a single gene that encodes the cystic fibrosis transmembrane conductance regulator (CFTR) (Riordan et al., 1989; Rommens et al., 1989). This results in a defective CFTR protein and consequent abnormalities in ihe transport of electrolytes and fluids in multiple organs (Welsh, 1990; Rowe et al., 2005).
  • CF pulmonary disease which is characterized by viscous mucous secretions and chronic bacterial infections (Welsh, 1990).
  • CF pulmonary disease With improvement in patient care and advances in pharmacologic therapies for CF, ihe lifespan of CF patients has steadily been extended over the past decades; however, the qualify of life for CF patients remains poor, and medications that alleviate pulmonary complications are expensive and efficacious only in select patients.
  • lung disease is the major cause of mortality in CF patients and the genetic basis is a single-gene defect
  • gene therapy for CF lung disease has the potential to cure all CF patients, regardless of their CFTR mutation. Thus, clinical trials for CF lung gene therapy were initiated in the mid-1990s.
  • Adeno-associated virus (AAV), a member of the human parvovirus family, is a non-pathogenic virus that depends on helper viruses for its replication. For this reason, rAAV vectors are among the most frequently used in gene therapy pre-clinicai studies and clinical trials (Carter, 2005; Wu et al., 2006; Daya & Berns, 2008). Indeed, CF lung disease clinical trials with rAAV2 demonstrated both a good safety profile and long persistence of the viral genome in airway tissue (as assessed by biopsy) relative to other gene transfer agents (such as recombinant adenovirus).
  • the AAV capsid can accommodate content in excess of its native DNA genome, its maximum packaging capacity is approximately 5.0 kb (Dong et al., 1996), and transgene expression from vectors exceeding this limit result in significantly reduced function (Wu et al,, 1993).
  • the requirements for 300 bp of c/ ' s-elements from the AAV genome (two ITR sequences at the termini) and the 4,443 bp CFTR coding sequence there is little space left in the vector genome (257 bp) for a strong promoter and poiyadenyiation signal.
  • the first-generation rAAV-CFTT ?
  • AV2.tgCF AV2.tgCF
  • CFTR minigene ⁇ create space for incorporating a better promoter into the rAAV vectors; this seemed justified based on earlier studies of CFTR gene function and structure indicating that the deletion of short, nonessential sequences from the C-terminus and regulatory domain (R-domasn) had only minimal effects on the chloride channel function of CFTR (Zhang et a!., 1998).
  • One widely used CFTR minigene is CFTRAR, which lacks 156 bp encoding 52 amino acid residues (708-759) at the N-terminus of the R-domasn.
  • This 156 bp deletion made it possible to package a rAAV CFTR expression vector 4.94 kb in length, with expression driven by a minimal CMV promoter (173 bp), into an AAV5 capsid (Ostedgaard et al., 2005). Additional efforts were aimed at developing AAV variant vectors of higher apical tropism, through directed evolution of the AAV capsid in polarized HAE ALi cultures (Li et al., 2009). However, these rAAV vectors did not provide efficient CFTR expression because the minimal CMV promoter did not function well in fully differentiated airway epitheiia.
  • adeno- associated viral (rAAV) vector that can be used to express certain transgenes
  • rAAV adeno- associated viral
  • CF cystic fibrosis
  • a recombinant vector such as a parvovirus vector, e.g., a recombinant adeno-associated virus (rAAV) vector or a bocavirus (BoV), such as a human BoV, vector, comprising a synthetic enhancer having a plurality of synthetic enhancer sequences operably linked to a promoter, e.g., a synthetic promoter, in one embodiment, each of the plurality of enhancers has the same sequence. In one embodiment, at least 2 of the plurality of enhancers have a different sequence.
  • a parvovirus vector e.g., a recombinant adeno-associated virus (rAAV) vector or a bocavirus (BoV), such as a human BoV
  • a synthetic enhancer having a plurality of synthetic enhancer sequences operably linked to a promoter, e.g., a synthetic promoter
  • each of the plurality of enhancers has the same sequence.
  • the synthetic enhancer is formed of different enhancer sequences, where each unique sequence may be represented once or more than once, and if more than once, may be in tandem or interspersed with other (different) enhancer sequences.
  • the synthetic enhancer may have five different enhancer sequences, each represented twice in the synthetic enhancer, and the repeated sequences may be in tandem (or not).
  • at least one of the enhancer sequences has a TP53 binding site, in one embodiment, at least one of the enhancer sequences has a CREB binding site, in one embodiment, at least one of the enhancer sequences has a NRF-1 binding site (CATGCGCAG).
  • plurality has a combination of one or more TP53 binding sites, one or more NRF-1 binding sites, and/or one or more CREB, e.g., CREB7, binding sites.
  • the enhancer sequence has a binding site shown in one of Figures 8A-8C. in one embodiment, the plurality has 2 up to 20 distinct synthetic enhancer sequences In one embodiment, at least one of the enhancer sequences has no more than 15 bp. in one embodiment, the plurality is up to about 150 nucleotides in length, e.g., from about 20, 30, 40, 50, 60, 70, 80, 90, 100,
  • the synthetic enhancer comprises F1 , F5 or F10. in one embodiment, the enhancer has at least 80%, 85%, 90%, 92%, 95%, 98% or 99% nucleotide sequence identity to F1 , F5 or F10. in one embodiment, the linked promoter is a synthetic promoter. In one embodiment, the promoter is tg83. In one embodiment, the promoter is an AAV promoter.
  • the promoter is a heterologous promoter, e.g., from a different virus or from a mammalian genome, in one embodiment, the promoter is operably linked to an open reading frame, e.g., a heterologous open reading frame, in one embodiment, the open reading frame encodes a prophylactic or a therapeutic gene product, e.g., cystic fibrosis transmembrane conductance regulator, a-antitrypsin, ⁇ -globin, ⁇ -globin, tyrosine hydroxylase, glucocerebrosidase, aryl sulfatase A, factor VIII, dystrophin or
  • a prophylactic or a therapeutic gene product e.g., cystic fibrosis transmembrane conductance regulator, a-antitrypsin, ⁇ -globin, ⁇ -globin, tyrosine hydroxylase, glucocerebrosidase, aryl sulfatase A
  • the combination of the plurality of enhancer sequences and the promoter is no more than 300 nucleotides in length, e.g., no more than 125, 150, 175, 200, 250, or 275 nucleotides in length, in one embodiment, the combination of the plurality of enhancer sequences and the promoter is less than 500 nucleotides in length.
  • the vector is a parvovirus vector such as a rAAV vector, e.g., an AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 vector, or a human bocavirus vector, e.g., HBoV1 , HBoV2, HBoV3 or HBoV4, or an evolved AAV or HBoV vector that adapts a unique tropism, e.g., optionally one with slightly altered capsid sequences from known serotypes
  • This disclosure also relates to an approach to screen tissue-specific as well as ubiquitous synthetic promoter/enhancer combinations in a step-wise fashion, in plasmids, proviral vectors, and rAAV vectors, which can be used in the application of rAAV gene therapy for the delivery of large transgene cassette.
  • Examples of use include but are not limited to express 4.3 kb B-domain deleted Factor-VIII in muscle and/or liver for hemophilia A, or to deliver the 4.2 kb the gene-editing tool of
  • Streptococcus pyogenes (SpCasQ) and a chimeric sgRNA together in any desired tissue and organ in vivo.
  • recombinant parvovirus vector to infect ceils, e.g., mammalian cells such as ferret, canine, feline, bovine, equine, caprine, or porcine cells, or primate ceils, e.g., human cells, for example, administering a composition comprising the recombinant parvovirus vector to a mammal.
  • ceils e.g., mammalian cells such as ferret, canine, feline, bovine, equine, caprine, or porcine cells
  • primate ceils e.g., human cells
  • the recombinant parvovirus genome may include an expression cassette encoding a heterologous gene product, e.g., which is a therapeutic protein such as cystic fibrosis transmembrane conductance regulator, ⁇ -antitrypsin, p-globin, ⁇ -globin, tyrosine hydroxylase, glucocerebrosidase, aryl sulfatase A, factor Vili, dystrophin, erythropoietin, alpha 1 -antitrypsin, surfactant protein SP-D, SP-A or SP-C, erythropoietin,, or a cytokine, e.g., IFN-alpha, IFNv, TNF, IL-1 , IL-17, o lL-8, or a prophylactic protein that is an antigen such as viral, bacterial, tumor or fungal antigen, or a neutralizing antibody or a fragment thereof that targets an epitope of an
  • Figures 1A-1 D Effectiveness of synthetic oligonucleotide enhancers in augmenting activity of tg83-directed luciferase reporter plasmids in monolayer cultures.
  • A Schematic structure of the reporter vectors used to screen the enhancer library. The transcriptional motifs of the synthetic tg83 promoter are indicated.
  • FIGS 2A-2F Effectiveness of enhancers F1 , F5 and F10 in augmenting activity of the tg83 promoter in the context of proviral plasmids and rAAV.
  • A) Effect of the AAV2 ITR on transcription from the tg83 promoter, as evaluated following transfection of A549 and primary airway ferret cells with pGL3-tg83 or pAV2-ig83luc. Data represent the mean (+/- SEM, N 3) relative luciferase activity (RLU) 24 hours post-transfection.
  • FIGS 3A-3C Impact of (AAV-CFTR construct size on restoration of CFTR chloride currents in polarized CF airway epithelium.
  • the ORF of full-length ferret CFTR (fCFTR) is 4455 bp.
  • the 99 bp 3xHA tag was inserted between amino acid residues S90Q and 1901 , bringing iCFTR ⁇ HA) to 4554 bp.
  • the fCFTRAR has a shortened ORF (4,296 bp); 53 amino acid residues (1708-1760, 159 bp) are deleted from the R-domain.
  • iCFTRAR ⁇ HA is 4395 bp in length, having a 99 bp HA-tag insertion and a 159 bp deletion in the R-domain.
  • Amiioride and DIDS were used to block ENaC-mediated sodium currents and non-CFTR chloride channels prior to addition of cAMP agonist (forskolin and IBMX), and GiyH101 was used to block CFTR-specific currents. Also (IBMX & Forsk) reflects the activation of CFTR-mediated chloride currents following induction with cAMP agonist, and Alsc (GlyH101) reflects the inhibition of CF77?-mediated chloride currents following addition of GlyH101 . C) Effects of vector size on rescue of chloride Isc currents. rAAV- CFTR vectors were increased by about 100 bp increments.
  • FIGS 4A-4B Analyses of integrity of the viral genome by denaturing gel electrophoresis and slot blot analysis.
  • (-) and (+) represent the probes hybridizing to the minus and positive strand of the single stranded rAAV genome.
  • Hybridization was first conducted with the set of probes that hybridize to the minus strand, and then reprobed with the set of oligonucleotides that hybridize to the positive strand.
  • FIG. 5 Effects of the F5 enhancer on CFTR currents generated by CF HAE following infection with rAAV vectors.
  • CF HAE ALI were infected with AV2/2.tg83- fCFTRAR or AV2/2.F5tg83-f CFTRAR, at the indicated MOIs, from the apical or basolaterai surface.
  • Proteasome inhibitors were co-administrated during the 16 hours infection period, isc measurements of the infected ALI cultures were conducted at 2 weeks post-infection. The mean (+/- SEM) Aisc (IBMX & Forsk) and Also (GlyH101) are shown with the N for independent transwel!s assays indicated. Mock-infected CF and non-CF HAE cultures are shown for reference.
  • FIGS 8A-6B Effects of the F5 enhancer on CFTR currents and tg83-directed CFTR transcription following infection with rAAV vectors.
  • CF HAE ALI v/ere infected with AV2/2.tg83-fC/ 773 ⁇ 4 ⁇ R or AV2/2.F5tg83-fCF7RAf? at an MGi of 2 x 10 4 DRP/celi from the basolaterai surface, in the presence of proteasome inhibitors.
  • A) isc was measured in the infected ALI cultures at 3 and 10 days post-infection.
  • A!sc (IBMX & Forsk) and A!se (GlyH101) values are presented.
  • B) Values represent the (mean ⁇ SE , n 3) relative luciierase activity (RLU/pg protein).
  • FIGS 8A-8W A-E) Binding sites in F5 which may be employed to prepare synthetic enhancers as described herein.
  • F-P Binding sites in F10 which may be employed to prepare synthetic enhancers as described herein.
  • Q-W Binding sites in F5tg83, which may be employed to prepare synthetic enhancers or promoter as described herein. SEQ ID NOs: 31 -68.
  • FIGS 9A-D Gene transfer efficiency of AV.F5Tg83-hCFTRAR to the ferret trachea and lung.
  • Three day old ferrets were infected with a 100 ⁇ . volume of 8 x 10 11 DRP of AV.F5Tg83-hCFTRAR in 500 ⁇ doxorubicin.
  • Non-infected animals were given an equal volume of vehicle with doxorubicin.
  • the entire lung and trachea were harvested and snap frozen in liquid nitrogen. Tissue was pulverized and mRNA and cDNA generated for Q-PCR of human and ferret CFTR.
  • FIGS 10A-D AV.F5Tg83-hCFTRAR effectively transduces the mature ferret airways.
  • Vector was delivered to the lung with a PennCentury microsprayer through tracheal intubation.
  • Nasal delivery in the same animals was also performed using 100 ⁇ _ containing 1 .5 x 10 12 DRP with 25Q ⁇ doxorubicin by instillation of fluid.
  • Mock-infected nasal delivery received PBS with 250 ⁇ doxorubicin.
  • the lung lobes were harvested separately along with the trachea, carina, and nasal turbinates with surrounding adventitia. The tissues were snap frozen and pulverized samples were processed separately for mRNA and DNA.
  • rAAV Gene therapy has been widely used in clinical trials since 1990s with many successful cases reported using viral or non-viral vectors to deliver therapeutic genes.
  • rAAV is the most widely used one proven of high safety profile, broad tissue/organ tropism and persistence transgene expression.
  • AAV is a small single stranded DNA virus of an inherently small 4.679 kb genome, thus the application of rAAV for gene therapy is restricted to delivering relative small transgenes.
  • AAV capsid can house a rAAV genome slightly larger than its original size, 4.95 kb appears to be the maximal size for efficient transgene expression.
  • One typical example is to deliver the CFTR gene (cystic fibrosis
  • CFTR cystic fibrosis
  • polyadenylation signal to direct the transcription of full-length CFTR cDNA.
  • the first-generation rAA ⁇ f-CFTR vector (AV2.tgCF), relied on the cryptic promoter activity of the AAV2 ITR, inefficiently expressed CFTR in clinical trials.
  • AV2.tg83-CF7 which uses an 83-bp synthetic promoter (tg83) was used to improve expression.
  • this vector produced a 3-iold higher in cA P-mediated CI- currents in CF HAE AL! cultures than AV2.tgCF, this level of expression remains suboptimal for application in CF gene therapy. So, there is an immediate need for a strong short promoter to direct the CFTR expression in the AAV vector for CF gene therapy.
  • rAAV to express the 4.3kb B- domain deleted Factor-Vill in muscle and/or liver for hemophilia gene therapy using rAAV, short promoter effective in muscle and liver is also needed.
  • Another example is to deliver the CRiSPR/Cas9 system for gene editing.
  • the recent development of CRiSPR/Cas9 gene editing technique promotes a new human gene therapy strategy by correcting a defect gene at pre-chosen sites without altering the endogenous regulation of gene of interest.
  • This system consists of two key components: Cas9 protein and sgRNA, as well as a correction template when needed.
  • rAAV can be used to deliver these elements in vivo to various target organs, but the co- delivery of Cas9 protein and the a chimeriG sgRNA in the same cell is required while the duai-AAV vector delivery system is low efficient.
  • Staphylococcus aureus Cas9 (SaCas9), which is about 1 .0 kb smaller in size, fits together with its sgRNA and relevant expression cassettes within a single AAV vector, using short synthetic promoter allows for the additional incorporation of the gene correction template for an all-in-one rAAV vector in the application of gene editing-based gene therapy.
  • short (less than 0.2 kb) synthetic enhancer/promoters provide a solution to solve the current problem of rAAV vector in delivering a large transgene cassette.
  • This disclosure in one embodiment, relates to the use of a 183-bp F5tg83 synthetic enhancer/promoter to rAAV vectors to deliver effective CFTR expression in lung airway tissue for CF gene therapy.
  • This disclosure in one embodiment, also provides an effective approach to screen and identify tissue-specific or ubiquitous synthetic promoter/enhancer combinations.
  • enhancer activity differs by cell lines and state of cell differentiation, as well as is influenced by the AAV ITRs and by the sequence of gene of interest
  • the screening was conducted in a step-wise fashion, e.g., in piasmids, proviral vectors, and rAAV vectors.
  • the screening system includes a defined 83-mer synthetic core promoter (tg83p) and a set of random 100-mer synthetic sequence of potent enhancer activity.
  • the screening approach can be used to screen the 100-mer synthetic sequences for their enhancer activity to enhance promoter transcription, e.g., the 83 bp tg83p promoter transcription, in different organ/tissue for different gene of interests, in a similar in a step-wise fashion: such as to direct the Factor VIII expression in muscle or liver, as well as to direct the Cas9 protein expression in any specific tissues or stem cells.
  • tissue-specific expression the approach also can be used to identify an enhancer of ubiquitous effect to improve the tg83p promoter activity in a wide range of tissue/organ, through testing rAAV derived reporter gene
  • a set of vectors containing the synthetic tg83 promoter linked with different synthetic sequences (about 100 bp) of potent enhancer activity was constructed for initial screening in monolayer (non-polarized) cultures of human airway cell lines and primary ferret airway cells, which as discussed below revealed that three of these synthetic enhancers (F1 , F5, and F10) significantly promoted transcription of a luciferase transgene from tg83p in the context of piasmid transfection.
  • the F5tg83 promoter also produced the highest level of transgene expression in the ferret airway in vivo. Finally, the F5tg83 promoter was used the rfiAV-CFTR vector to direct the CFTR expression, the vector (AV.F5tg8ZCFTRAR) yielded an about 17-fold increase related to the enhancer-less vector (AV.tg83CF773 ⁇ 4 ) in vector derived CFTR mRNA transcription and significantly improved CI- currents in human CF ALI cultures.
  • F5tg83, F1tg83 and F10tg83 were capable to direct strong transgene expression in human as well as non-human mammalian (such as ferret) airway cells.
  • the robust F5tg83 promoter can be used in rAAV vector to deliver the 4.4 kb cystic fibrosis transmembrane conductance regulator (CFTR) for cystic fibrosis gene therapy.
  • rAAV Vectors All rAAV vector stocks were generated in HEK293 cells triple piasmid co-transfection using an adenovirus-free system, and purified with two rounds of CsC! ultracentrifugation as reported in Yan ei ai. (2004).
  • rAAV2 genomes were used and packaged into AAV2 or AAV1 capsid to generate rAAV2/2 and rAAV2/1 viruses, respectively.
  • TaqMan reai-time PGR was used to quantify the physical titer (DNase resistant particles, DRP) of the purified viral stocks as described in Yan et al. (2008) and Ding et al. (2006).
  • the PCR primer/probe set used to titer luciferase vectors was: 5'- TTTTTGAAGCGAAGGTTGTGG-3' (forward primer) (SEQ ID NO:1), 5'- CACACACAGTTCGCCTCTTTG-3' (reverse primer) (SEQ ID NO:2) and 5 -FAM- ATCTGGATACCGGGAAAACGCTGGGCGTTAAT-TA RA-3' probe) (SEQ ID NO:3); the primer/probe set used for ferret CFTR vectors was 5'-
  • Viral DNA was extracted from 1 Q 9 DRP of AA V-CFTR vectors and resolved in 0.9% alkaline denatured agarose gel at 20 volts overnight in 50mM NaOH/1 mM EDTA buffer. Following transfer to a Nylon membrane, Southern blotting was performed with a 32 P-labeled CFTR probe to visualize the viral DNA. For examination of 5' end genome deletions in the oversized rAAV vectors, 3.33x10 s DRP of each virus (quantitated by TaqMan PCR with probe/primer set against iCFTR cDNA) was loaded into a slot blotting Nylon membrane.
  • the blots were first hybridized to a set of three 32 P-iabeled oligonucleotide probes against the minus strand of the rAAV genome: at the 5' sequence of the tg83 promoter: taccctcgagaacggtgacgtg (SEQ ID NO:7); the center of ferret CFTR cDNA: ggagatgcgcctgtctcctggaatg (SEQ ID NQ:8): and the 3' sequence of the synthetic poiyA: gcatcgatcagagtgtgttggttttttgtgtg (SEQ ID NO:9). After exposure to X-fiim, the membranes were stripped of probe and hybridized again to another set of three 32 P-iabeled oligonucleotide probes
  • NIH Imaged software was used to quantify the signal intensity of hybridization to determine the corresponding number of genomes detected by each probe with serial dilutions of the provirai plasmid as standards.
  • DMEM Duibecco's modified Eagle medium
  • Primary ferret airway cells were isolated and cultured as non-polarized monolayer or at an AL! to generate polarized epithe!ia as described in Liu et ai. (2007).
  • Polarized primary HAE were generated from lung transplant airway tissue as described in Karp et al. (2002) by the Ceils and Tissue Core of The Center for Gene Therapy at the
  • Proteasome inhibitors were supplied in the culture medium throughout the period of infection to polarized cells, at 40 ⁇ LLnL (N- Acetyl-L-leucine-L-leucine-L-norleucine) and 5 ⁇ doxorubicin in the case of polarized human, and 10 ⁇ LLnL and 2 ⁇ doxorubicin in the case of CuFi ALI cultures and ferret ALI cultures. Epithelia were exposed to the viruses and chemicals for 16 hours and then removed. At this time, the Millicell inserts were briefly washed with a small amount USG medium and fresh USG medium was added to the bottom chamber only. Doxorubicin was from Sigma (St, Louis, MO) and LLnL was from Boston Biochem (Cambridge, MA).
  • rAAV Infection of Ferret Lungs All animal experimentation was performed according to protocols approved by the Institutional Animal Care and Use Committee of the University of Iowa, in vivo infection of ferret lungs was performed by intra-tracheal injection of a 300 ⁇ inoculum containing 2 x 10 M DRP of rAAV2/1 and 250 ⁇ doxorubicin. Prior to infection at 5 days of age, ferret kits were anesthetized by inhalation of a mixture of isofluorane and oxygen. At 8-day post-infection, ihe animals were euthanized with an overdose sodium pentobarbital intraperitoneal injection.
  • the ferret trachea and lung cassette was immediately frozen in liquid nitrogen and then pulverized using a cryogenic tissue pulverizer. 1 mi of Passive Lysis Buffer (Promega, Madison, Wi) was added to the pulverized tissue to extract protein. After four freeze-thaw cycles, the tissue extract was centrifuged at 15,000 rpm for 5 minutes, and the clarified tissue extract was used for luciferase assays with a luciferase assay kit from Promega.
  • Passive Lysis Buffer Promega, Madison, Wi
  • Transepitheliai short circuit currents were measured using an epithelial voltage clamp (Model EC-825) and a self- contained Ussing chamber system (both purchased from Warner instruments, inc., Hamden, CT) as described in Liu et ai. (2007). Throughout the experiment the chamber was kept at 37°C, and the chamber solution was aerated.
  • the basoiaterai side of the chamber was fiiied with buffered Ringer's solution containing 135 m NaCi, 1.2 mM CaC , 1 .2 mM MgC , 2.4 mM KH2PO4, 0.2 mM K2HPO4, and 5 mM Hepes, pH 7.4.
  • the apical side of the chamber was filled with a low-chloride Ringer's solution in which 135 mM Na-gluconate was substituted for NaCI.
  • Transepitheiial voltage was clamped at zero, with current pulses applied every 5 seconds and the short-circuit current recorded using a VGC MC8 multichannel voltage/current clamp (Physiologic instruments) with Quick DataAcq software.
  • RNA from rAAV-infected ceils was prepared using the RNeasy
  • RNA-specific method for PCR of the rAAV vector 6 was used to detect the vector-derived ferret CFTR mRNA.
  • the 1 st -strand cDNA synthesis was primed with an adapter (lower case)-linked, vector-specific primer that targets the synthetic polyadenylation signal sequence (upper cases).
  • the sequence of this primer is 5'- gcacgagggcgacugucaUGAUCGAUGCAUCUGAGCUCUUUAUUA-3' (SEQ ID NO:10), in which all dTs are replaced with dU.
  • a ferret CFT/ -specific primer (5'- TGCAGATGAGGTTGGACTCA-3'; SEQ ID NO:1 1) was used for synthesis of the 2 nd strand.
  • UNG uracyl-N-glycosylase
  • TaqMan PCR contained the ferret CFTR sequence 5'-CAAGTCTCGCTCTCAAATTGC- 3' (SEQ ID NO:12), and the adapter sequence 5'-GCACGAGGGCGACTGTCA-3' (SEQ ID NO:13).
  • the TaqMan probe used was 5'-FAM ⁇
  • This library comprised all possible 10-mer DNA sequences, printed on microarrays as 10 tandem repeats (for a total length of 100 bases each).
  • the best-performing 100-mer oligonucleotides enhanced the transcription of this 128 bp CMV IE minimal promoter to 75%-137% of that induced by the 600 bp wild type CMV IE promoter (Schlabach et al., 2010).
  • tg83 a 83 bp synthetic promoter sequence (tg83) was used to express the full-length CFTR gene from a rAAV vector (AV2.tg83-CF77?), and it was found to produce higher transgene expression in CF HAE cultures than the cryptic promoter of the AAV2 !TR (Zhang et al,, 2009),
  • the tg83 promoter consists of an ATF-1 /CREB site and an Sp1 -binding site from the promoter of the Na,K-ATPase ⁇ x1 subunit, and the TATA box and transcription start site from the CMV IE promoter.
  • gaattgacgcatatattgacgcatattgacgcaaattgacgcaaattgacgcaagattgacgcaaattgagcgcaaatt gacgcaaattaattgacgcat (SEQ ID NO:16)
  • the ig83 promoter was cloned into the promoter-less luciferase reporter piasmid pGL3-Basic Vector (Promega) to generate pGL3-tg83.
  • a series of luciferase reporter expression plasmids were constructed, in which one of the eight 100- mer enhancers was placed in front of the tg83 promoter of pGL3-tg83 ( Figure 1A)
  • Comparison of reporter expression from pGL3-tg83 and its enhancer-containing derivatives was conducted in monolayer (non-polarized) cultures of two human airway cell lines (A549 and IB3) and primary ferret airway cells ( Figures 1 B-1 D).
  • pAV2-CMV-luc contains the wild type, 600 bp CMV IE enhancer-promoter
  • pAV2-CBA-luc contains the CMV IE enhancer-chicken ⁇ -actin promoter, i.e., the CBA promoter
  • the F5 element most efficiently enhances tq83-driven transcription in polarized human and ferret airway epithelia in vitro, as well as in the ferret airway in vivo.
  • F1 , F5 and F10 enhancers were the most effective in activating tg83- d riven transcription in airway-ceil monolayer cultures, the abilities of these elements to promote transcription in the context of rAAV vector genomes was evaluated.
  • Four rAAV proviral vectors harboring a luciferase expression cassette were constructed, with expression driven by tg83 (enhancer-less), F1tg83, F5tg83 or F10tg83.
  • the pAV2-tg83- iCFTR proviral piasmid was used as the template vector for cloning, its promoter and the 5' portion of the iCFTR coding region were replaced with the 2.1 or 2.2 kb luciferase expression cassette.
  • the genome size was 4.75 kb in the case of rAV2.tg83luc, and 4.85 kb for the enhancer-containing vectors. This design was used for two reasons. First, retaining as much of the ICFTR sequence as possible ensured that the vector genome size would be similar to those of the rAAV-CFTR expression vectors that would ultimately be generated. Second, retaining regions of the iCFTR cDNA maximized the potential influences of the ferret CFTR sequence on enhancer function.
  • reporter expression from pGL3-tg83 and pAV2-tg83iuc plasmids was compared following transfection into monolayer cultures of A549 and primary ferret airway cells.
  • pAV2-tg83iuc piasmid was found to be 2.5-fold (in A549) and 2-fold (in primary ferret airway cells) more transcriptionally active than the pGL3-based plasmids ( Figure 2A), suggesting that inclusion of the AAV ITR and/or the 1CFTR stuffer sequences had an overall positive effects on activity of the tg83 promoter. Then reporter-gene expression for pAV2-F1 tg83luc, pAV2-F5tg83luc, pAV2-F1 Qig83luc, and pAV-tg83luc piasmids was compared.
  • the F1 , F5 and F10 enhancers significantly improved transcription from the tg83 promoter (about 10- to 19-fold) in both cell types ( Figure 2B).
  • the effectiveness of nearly all enhancers was significantly reduced (about 3- to 18-fold) within the rAAV provira! piasmids when compared to pGL3-tg83 piasmids lacking ITRs and the CFTR sequence ( Figure 2B solid bars vs. Figure 1 B; Figure 2B open bars vs Figure 1 D). This suggests that the sequences from the AAV ITR and/or portions of the ferret CFTR cDNA have an overall negative impact on enhancer function.
  • the F1 enhancer was most significantly influenced, with its activity in the rAAV proviral plasmid decreased by 18.1 -fold, whereas those of the F5 and F10 enhancers decreased by only 8.2-fold and 3.8-fold, respectively.
  • the F1 and F5 enhancers had 4.4 ⁇ foid and 2.8-fold decreased activity, respectively, in the context of the proviral plasmid, whereas the function of F10 was slightly enhanced (about 40%).
  • the differentiated state of ferret airway epithelial cells appeared to dramatically influence expression from the various enhancer/tg83 promoter combinations in the context of rAAV transduction; the F5 enhancer more effectively enhanced tg83 expression in the polarized epithelium (Figure 2E; 57.5-fold) than in undifferentiated monolayers ( Figure 2B; 16.6-fold); the F1 enhancer only marginally increased activity of the tg83 promoter in polarized cells, but increased transgene expression 13.8-fold in monolayer ceils.
  • a narrow limit for rAAV genome size significantly influences functionality of rAA V-CF7R vectors while not altering packaging efficiency.
  • the size of the expected AV.tg83fCFT genome if fully packaged is 4.937 kb
  • Polarized CF HAE Two rAAV2 vectors were produced (AV2/2.tg83-fCF7R and AV2/2.tg83-fCF7f?-HA; Figure 3A), and their ability to generate CFT -mediated chloride currents was evaluated in polarized CF HAE.
  • Vector yields for the two viruses were nearly equivalent (AV2/2,tg83-fCF7R about 5 x 10 9 DRP/fxL and AV2/2.tg83-fCF7R(HA) about 3 x 10 9 DRP/ ⁇ ).
  • Polarized CF HAE were cultured at an ALI and infected at the relatively high multiplicity of infection (MOi) of about 10 5 DRP/celi (10 11 DRP of each rAAV2 vector per insert).
  • FIG. 3B shows a typical Isc trace following infection of CF HAE with AV2/2.tg83-fCF7R or AV2/2.tg83-fCF7 : ?-HA.
  • Amiioride and DIDS were first applied to block non-CFT chloride channels and ENaC-mediated sodium currents, and then cA P agonists (iB X and forskolin) were used to induce CFTR activity.
  • CFTRAR human CFTR minigene with a 158 bp partial deletion of the R-domain (encoding amino acids 708-759) has been reported to retain most of the chloride-channel activity of the full-length protein (Ostedgaard et a!,, 2002; Ostedgaard et a!. , 201 1 ).
  • a 1CFTRAR minigene was created by deleting the 159 bp homologous sequence encoding amino acids 708-780 at the corresponding position of the human protein, and produced two additional vectors: AV2/2.tg83-f CFTRAR (4.778 kb) and AV2/2.tg83-fCFT : ?AR(HA) (4.877 kb).
  • This pair of vectors allowed for the examination not only the function of the 1CFTR minigene in CF HAE ALI cultures, but also the impact of the HA-iag insertion in the 1CFTR gene.
  • Analysis of AISCIBMX & Forek and Alscgiyn responses for these two viruses demonstrated that both AV2/2.tg83-fCF77 : ?
  • AV2/2.tg83-fCFTf?(HA) produced substantial CFTR-mediated CI " currents following infection of the CF HAE ALI cultures ( Figure 3C).
  • the HA-tagged form produced about 20% less CI " current than AV2/2.tg83-fCFT ?AR, This finding is consistent with rAAV vectors of 4.88 kb having only about 25% of the functional activity of vectors 4.68 kb (Dong et a!., 1996).
  • the HA-tag may itself influence CFTR function in the context of the R-domain deletion, although in the context of full- length CFTR this ECL4 HA-tag has no impact on CI " channel function (Glozman et ai.
  • the synthetic F5tg83 promoter improves rAAV-mediated CF7R complementation.
  • AV2/2.F5tg83-f CFTRAR following apical infection, but in this case the efficiency of transduction was significantly lower, as previously reported for this serotype.
  • AV2/2.F5tg83-fCF7RAR produced 89% of the CFTR current generated by this vector at a 5-fold higher MOI, suggesting that complementation of CFTR function approached saturation in the latter case.
  • RNA-specific reverse transcriptase PGR RNA-specific reverse transcriptase PGR
  • rAAV vectors have attracted considerable interest with respect to human gene therapy, but its inherently small genome (4.679 kb) is a significant challenge for the delivery of large genes such as CFTR.
  • CFTR large genes
  • several laboratories have attempted to rationally design short enhancers and promoters for use in rAAV vectors, this approach has yet to yield robust expression of CFTR in the airway.
  • an entirely empirical approach was taken by screening synthetic enhancers for their effectiveness in the delivery of reporter gene expression in step-wise fashion - in plasmids, proviral vectors, and viral vectors.
  • AAS/-CFTR vector instead employed a short synthetic promoter and poiy-A signal, and small deletions within these short transcriptional regulatory elements would be expected to greatly influence gene expression. Since DNase resistant particle titer is typically used to confirm effective packaging of rAAV genomes, small 5'-end deletions could have a significant impact on functionality of oversized rAAV vectors.
  • a 100 bp synthetic enhancer (F5) was identified that significantly improves the transcriptional activity of an 83 bp synthetic promoter (tg83), in polarized cultures of both primary human and ferret airway epithelial cells, as well as in ferret lung and trachea in vivo.
  • the ferret CFTR minigene lacking a 53 amino acid portion of the R domain (fCFTRAR) retained about 70% of wild type iCFTR function, similar to the 80% function retained by a previously reported, analogous hCFTRAR construct (Ostedgaard et al., 2002).
  • CFTR currents could reflect self-limiting cell biology (e.g., control over the total amount of CFTR on the plasma membrane), or aberrant trafficking of CFTR to the basolateral membrane at higher levels of expression (Farmen et al., 2005).
  • a rAAV-CFTR vector was generated that provides high-level expression suitable for use in lung gene therapy studies in the CF ferret model.
  • small synthetic enhancer/promoter combination can be used in rAAV vector to deliver effective transgene expression of a large transgene expression; in this study, the gene is CFTR.
  • the enhancer activity differs by cell lines and state of cell differentiation, as well as is influenced by the AAV !TRs and by the sequence of gene of interest.
  • the effects of an enhancer in the context of plasmid transfection may be different from that in the context of rAAV transduction.
  • the in vivo effects of a particular enhancer may not be predictable from its behaviors demonstrated in culture cell lines. This, the screening needs to be conducted in different ceil/tissue levels and in a step-wise fashion - in plasmids, provirai vectors, and rAAV vectors to warrant the success.
  • F1 , F5, and F10 Three of synthetic enhancers (F1 , F5, and F10) were found significantly increase the transcription of tg83p for luciferase transgene in the context of plasmid transfection.
  • the F5tg83 promoter the 183 bp combination of F5 enhancer and fg83p, was the most efficient promoter in human and ferret ALI cultures, leading to 19.8-fold and 57.5-fold increases reporter expression, respectively, over the enhancer-less counterpart.
  • the F5tg83 promoter also produced the highest level of transgene expression in the ferret airway in vivo.
  • F5tg83 promoter When used to transcribe the 4.2 kb CFTR minigene (CFTRAR) in a rAAV vector, it yielded an about 17-fold increase in vector derived CFTR mRNA transcription and significantly improved CI " currents in human CF ALI cultures, compared to the vector using tg83p only.
  • CFTRAR 4.2 kb CFTR minigene
  • the enhancer/promoter combinations for lung epithelium may not necessarily be as usef ul for other organs/tissue.
  • F5tg83 demonstrated the strongest promoter activity in pancreas, gallbladder and liver, whereas F10tg83 outperformed F5tg83 in small intestine ( Figures 7A-7B).
  • the screen approach can be used for any desired cell types, tissues and organs in vitro and in vivo.
  • short enhancer elements about 100-mer synthetic oligonucleotide sequences consisting of 10-mer repeats
  • IE immediate-early
  • tg83 promoter and 100 bp synthetic enhancers were tested, and one designated as F5 efficiently was found to enhance the transcription from the tg83 promoter in polarized airway ceils (in vitro) derived from both humans and ferrets, as well as in the ferret airway (in vivo).
  • F5tg83 promoter and the ferret CFTR minigene of partial deletion at R domain iCFTRAR
  • a rAAV vector AV2/2.F5tg83-fCFTRAR
  • AV,F5Tg83-hCFTRAR was tested for hCFTR expression in the newborn and mature ferret airway.
  • An endpoint of these analyses was the ratio of transgene-derived human CFTR (hCFTR) to that of endogenous ferret CFTR (fCFTR) mRNA. in 3 day old newborn ferrets ( Figure 9), AV.F5Tg83-CFTRAR led to 240% greater expression of human CFTR compared with endogenous (ferret) CFTR following gene delivery to the lung.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Confectionery (AREA)

Abstract

An isolated recombinant parvovirus vector comprising a synthetic enhancer comprising plurality of enhancer sequences operably linked to a promoter, and methods of using the vector, are provided.

Description

Cross-Reference to Related Applications
This application claims the benefit of the filing date of U.S. application Serial No.
82/304,656, filed on March 7, 2016, the disclosure of which is incorporated by reference herein
Statement of Government Rights
The invention was made with government support under grant HL108902 awarded by the National institutes of Health. The Government has certain rights in the invention.
Background
Cystic fibrosis (CF) is a lethal, autosomal-recessive disorder that affects at least 30,000 people in the U.S. alone (O'Sullivan et al., 2009), The genetic basis of CF is mutation of a single gene that encodes the cystic fibrosis transmembrane conductance regulator (CFTR) (Riordan et al., 1989; Rommens et al., 1989). This results in a defective CFTR protein and consequent abnormalities in ihe transport of electrolytes and fluids in multiple organs (Welsh, 1990; Rowe et al., 2005). The most life-threatening outcome is CF pulmonary disease, which is characterized by viscous mucous secretions and chronic bacterial infections (Welsh, 1990). With improvement in patient care and advances in pharmacologic therapies for CF, ihe lifespan of CF patients has steadily been extended over the past decades; however, the qualify of life for CF patients remains poor, and medications that alleviate pulmonary complications are expensive and efficacious only in select patients. Since lung disease is the major cause of mortality in CF patients and the genetic basis is a single-gene defect, gene therapy for CF lung disease has the potential to cure all CF patients, regardless of their CFTR mutation. Thus, clinical trials for CF lung gene therapy were initiated in the mid-1990s. However, ail trials to date have been unsuccessful (Sumner-Jones et al., 2010). The underlying reason is that the vectors available for gene transfer to the human airway epithelium (HAE) are inefficient (Mueller & Flute, 2008; Griesenbach & Alton, 2009; Griesenbach et al., 2010).
Adeno-associated virus (AAV), a member of the human parvovirus family, is a non-pathogenic virus that depends on helper viruses for its replication. For this reason, rAAV vectors are among the most frequently used in gene therapy pre-clinicai studies and clinical trials (Carter, 2005; Wu et al., 2006; Daya & Berns, 2008). Indeed, CF lung disease clinical trials with rAAV2 demonstrated both a good safety profile and long persistence of the viral genome in airway tissue (as assessed by biopsy) relative to other gene transfer agents (such as recombinant adenovirus). Nevertheless, gene transfer failed to improve lung function in CF patients because transcription of the rAAV vector-derived CFTR mRNA was not detected (Fiotte, 2001 ; Aitken et al., 2001 ; Wagner ei al., 20Q2; Moss et al., 2007; Duan et al., 20Q0). These observations are consistent
I with later studies on rAAV transduction using an in vitro model of the polarized HAE, in which the cells are grown at an air-liquid interface (ALi) (Flotte, 2001 ; Duan et al., 1998). The poor efficiency of rAAV2 as a vector for CFTR expression in the HAE is largely due to two major barriers: 1) inefficient post-entry processing of the virus, and 2) the limited packaging capacity of rAAV.
The initial preclinical studies with rAA V2-CF7T? that supported the first ciinical trial in CF patients were performed in rhesus monkeys. These studies demonstrated that viral DNA and transgene-derived CFTR mRNA persisted in the lung for long periods following rAAV2-mediated CFTR gene transfer (Conrad et al., 1996). However, later studies comparing the efficiency of rAAV2 transduction between human and rhesus monkey airway epithelial ALi cultures demonstrated that the tropism of rAAV2 for apical transduction was significantly higher in the rhesus monkeys cultures than in their human counterparts (Liu et al,, 2007), likely due to species-specific differences in the AAV2 receptors and co-receptors that exist on the apical surface. In studies of polarized HAE, the majority of AAV2 virions were internalized following apical infection, but accumulated in the cytoplasm rather than entering the nucleus (Duan et al., 2000; Ding et al., 2005). One obstacle to the intracellular trafficking required for productive viral transduction is the ubiquitin-proteasome pathway (Duan et al., 2000; Yan et al., 2002); transient inhibition of proteasome activity dramatically enhances transduction (700-fold) of rAA 2-lucif erase vectors from the apical surface by facilitating
translocation of the vector to the nucleus (Yan et al., 2006). However, the application of proteasome inhibitors to enhance transduction efficiency of rAAV-CFTT? vectors only marginally improves CFTR expression, most likely due to the low activity of the short promoter used in the rAAV-CFTT? vectors (Zhang et al., 2004). The open reading frame (ORF) of the CFTR gene is 4.443 kb, and thus approaches the size of the 4.679 kb AAV genome. Although the AAV capsid can accommodate content in excess of its native DNA genome, its maximum packaging capacity is approximately 5.0 kb (Dong et al., 1996), and transgene expression from vectors exceeding this limit result in significantly reduced function (Wu et al,, 1993). Given the requirements for 300 bp of c/'s-elements from the AAV genome (two ITR sequences at the termini) and the 4,443 bp CFTR coding sequence, there is little space left in the vector genome (257 bp) for a strong promoter and poiyadenyiation signal. Thus, the first-generation rAAV-CFTT? vector (AV2.tgCF) that was tested in clinical trials, relied on the cryptic promoter activity of the AAV2 ITR to drive transcription of the full-length CFTR cDNA with a synthetic poiyadenyiation signal (Flotte et al., 1993; Aitken et al., 2003).
More recently, a rAAV vector, A 2.tg83-CFTT? was developed, which uses an 83-bp synthetic promoter (tg83) (Zhang et al., 2004) to improve expression of the full- length human CFTR cDNA. The genome of this vector is 4.95 kb in size. Although this vector produced a 3-fold increase in cAMP-mediated CI" currents in CF HAE ALI cultures relative to AV2.tgCF, this level of expression remained suboptimal for application in CF gene therapy. Other groups have attempted to use a CFTR minigene ΐο create space for incorporating a better promoter into the rAAV vectors; this seemed justified based on earlier studies of CFTR gene function and structure indicating that the deletion of short, nonessential sequences from the C-terminus and regulatory domain (R-domasn) had only minimal effects on the chloride channel function of CFTR (Zhang et a!., 1998). One widely used CFTR minigene is CFTRAR, which lacks 156 bp encoding 52 amino acid residues (708-759) at the N-terminus of the R-domasn. Gene transfer with a recombinant adenoviral vector encoding CFTRAR in CF HAE ALi cultures demonstrated that this transgene retains at least 80% of the transepitheiial CI" transport supported by full-length CFTR (Ostedgaard et a!,, 2002). in addition, the expression of CFTRAR in CFTR'1' knockout mice rescued the lethal intestinal phenotype (Ostedgaard et al., 201 1). This 156 bp deletion made it possible to package a rAAV CFTR expression vector 4.94 kb in length, with expression driven by a minimal CMV promoter (173 bp), into an AAV5 capsid (Ostedgaard et al., 2005). Additional efforts were aimed at developing AAV variant vectors of higher apical tropism, through directed evolution of the AAV capsid in polarized HAE ALi cultures (Li et al., 2009). However, these rAAV vectors did not provide efficient CFTR expression because the minimal CMV promoter did not function well in fully differentiated airway epitheiia.
To circumvent the size limitation of the promoter in a recombinant adeno- associated viral (rAAV) vector that can be used to express certain transgenes, a set of 100-mer synthetic enhancer elements, composed of ten 10 bp repeats, were screened for the ability to augment CFTR transgene expression from a short 83 bp synthetic promoter in the context of a rAAV vector for application in cystic fibrosis (CF) gene therapy. Screening for the effectiveness of synthetic enhancers to augment transgene expression was conducted in a stepwise fashion-in piasmids without AAV sequences, proviral vectors in the form of piasmids with AAV sequences, and rAAV vectors. Both plasmid transfection and viral vector transduction in cultured ceil lines and whole animals in vivo were evaluated. Initial studies assessing transcriptional activity in monolayer (non-polarized) cultures of human airway cell lines and primary ferret airway cells revealed that three of these synthetic enhancers (F1 , F5, and F10) significantly promoted transcription of a luciferase transgene in the context of plasmid transfection. Further analysis in polarized cultures of human and ferret airway epitheiia at an air- liquid interface (ALi), as well as in the ferret airway in vivo, demonstrated that the F5 enhancer produced the highest level of transgene expression in the context of an AAV vector. Furthermore, it was demonstrated that increasing the size of the viral genome from 4.94 to 5.04 kb did not significantly affect particle yield of the vectors, but dramatically reduced the functionality of rAA \/-CFTR vectors because of small terminal deletions that extended into the CFTR expression cassette of the 5.04 kb oversized genome. Since rAA M-CFTR vectors greater than 5 kb in size are dramatically impaired with respect to vector efficacy, a shortened ferret CFTR minigene with a 159 bp deletion in the R-domain was utilizing to construct a rAAV vector (A V2/2.F5tg83-f CFTRAR). This vector yielded an about 17-fold increase in expression of CFTR and significantly improved Ci" currents in CF ALI cultures. This small enhancer/promoter combination may have broad utility for rAAV-mediated gene therapy, e.g., CF gene therapy, to the airway.
The disclosure provides a recombinant vector such as a parvovirus vector, e.g., a recombinant adeno-associated virus (rAAV) vector or a bocavirus (BoV), such as a human BoV, vector, comprising a synthetic enhancer having a plurality of synthetic enhancer sequences operably linked to a promoter, e.g., a synthetic promoter, in one embodiment, each of the plurality of enhancers has the same sequence. In one embodiment, at least 2 of the plurality of enhancers have a different sequence. In one embodiment, the synthetic enhancer is formed of different enhancer sequences, where each unique sequence may be represented once or more than once, and if more than once, may be in tandem or interspersed with other (different) enhancer sequences. For example, the synthetic enhancer may have five different enhancer sequences, each represented twice in the synthetic enhancer, and the repeated sequences may be in tandem (or not). In one embodiment, at least one of the enhancer sequences has a TP53 binding site, in one embodiment, at least one of the enhancer sequences has a CREB binding site, in one embodiment, at least one of the enhancer sequences has a NRF-1 binding site (CATGCGCAG). In one embodiment, plurality has a combination of one or more TP53 binding sites, one or more NRF-1 binding sites, and/or one or more CREB, e.g., CREB7, binding sites. In one embodiment, the enhancer sequence has a binding site shown in one of Figures 8A-8C. in one embodiment, the plurality has 2 up to 20 distinct synthetic enhancer sequences In one embodiment, at least one of the enhancer sequences has no more than 15 bp. in one embodiment, the plurality is up to about 150 nucleotides in length, e.g., from about 20, 30, 40, 50, 60, 70, 80, 90, 100,
1 10, 120, 130, or 140 nucleotides in length. In one embodiment, the synthetic enhancer comprises F1 , F5 or F10. in one embodiment, the enhancer has at least 80%, 85%, 90%, 92%, 95%, 98% or 99% nucleotide sequence identity to F1 , F5 or F10. in one embodiment, the linked promoter is a synthetic promoter. In one embodiment, the promoter is tg83. In one embodiment, the promoter is an AAV promoter. In one embodiment, the promoter is a heterologous promoter, e.g., from a different virus or from a mammalian genome, in one embodiment, the promoter is operably linked to an open reading frame, e.g., a heterologous open reading frame, in one embodiment, the open reading frame encodes a prophylactic or a therapeutic gene product, e.g., cystic fibrosis transmembrane conductance regulator, a-antitrypsin, β-globin, γ-globin, tyrosine hydroxylase, glucocerebrosidase, aryl sulfatase A, factor VIII, dystrophin or
erythropoietin. In one embodiment, the combination of the plurality of enhancer sequences and the promoter is no more than 300 nucleotides in length, e.g., no more than 125, 150, 175, 200, 250, or 275 nucleotides in length, in one embodiment, the combination of the plurality of enhancer sequences and the promoter is less than 500 nucleotides in length. In one embodiment, the vector is a parvovirus vector such as a rAAV vector, e.g., an AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 vector, or a human bocavirus vector, e.g., HBoV1 , HBoV2, HBoV3 or HBoV4, or an evolved AAV or HBoV vector that adapts a unique tropism, e.g., optionally one with slightly altered capsid sequences from known serotypes
This disclosure also relates to an approach to screen tissue-specific as well as ubiquitous synthetic promoter/enhancer combinations in a step-wise fashion, in plasmids, proviral vectors, and rAAV vectors, which can be used in the application of rAAV gene therapy for the delivery of large transgene cassette. Examples of use include but are not limited to express 4.3 kb B-domain deleted Factor-VIII in muscle and/or liver for hemophilia A, or to deliver the 4.2 kb the gene-editing tool of
Streptococcus pyogenes (SpCasQ) and a chimeric sgRNA together in any desired tissue and organ in vivo.
Further provided are methods of using the recombinant parvovirus vector to infect ceils, e.g., mammalian cells such as ferret, canine, feline, bovine, equine, caprine, or porcine cells, or primate ceils, e.g., human cells, for example, administering a composition comprising the recombinant parvovirus vector to a mammal. For example, the recombinant parvovirus genome may include an expression cassette encoding a heterologous gene product, e.g., which is a therapeutic protein such as cystic fibrosis transmembrane conductance regulator, α-antitrypsin, p-globin, γ-globin, tyrosine hydroxylase, glucocerebrosidase, aryl sulfatase A, factor Vili, dystrophin, erythropoietin, alpha 1 -antitrypsin, surfactant protein SP-D, SP-A or SP-C, erythropoietin,, or a cytokine, e.g., IFN-alpha, IFNv, TNF, IL-1 , IL-17, o lL-8, or a prophylactic protein that is an antigen such as viral, bacterial, tumor or fungal antigen, or a neutralizing antibody or a fragment thereof that targets an epitope of an antigen such as one from a human respiratory virus, e.g., influenza virus or RSV including but not limited to HBoV protein, influenza virus protein, RSV protein, or SARS protein.
Figures 1A-1 D. Effectiveness of synthetic oligonucleotide enhancers in augmenting activity of tg83-directed luciferase reporter plasmids in monolayer cultures. A) Schematic structure of the reporter vectors used to screen the enhancer library. The transcriptional motifs of the synthetic tg83 promoter are indicated. (B-D) Reporter activity in monolayer cultures of human airway cell lines (B) A549 and (C) IB3, and (D) ferret primary airway ceils, following transfection with the indicated plasmids. Luciferase assays were conducted 24 hours post-transfection. Data represent the mean (+/- SE , N=3) relative luciferase activity of each transfection normalized to that of the enhancer- less vector pGL3-tg83luc, whose value in each cell-type tested was set to 1 .
Figures 2A-2F. Effectiveness of enhancers F1 , F5 and F10 in augmenting activity of the tg83 promoter in the context of proviral plasmids and rAAV. A) Effect of the AAV2 ITR on transcription from the tg83 promoter, as evaluated following transfection of A549 and primary airway ferret cells with pGL3-tg83 or pAV2-ig83luc. Data represent the mean (+/- SEM, N=3) relative luciferase activity (RLU) 24 hours post-transfection. B) Effeciiveness of enhancers on transcription following transfection of A549 and primary ferret airway cells with the indicated AAV2 proviral plasmids. Data represent the mean (+/- SEM, N=3) relative luciferase activity of each transfection, normalized to the enhancer-less vector pAV2-tg83luc (set to 1 for each cell type), at 24 hours post-transfection. C) Effectiveness of enhancers on transcription following infection of A549 ceils with the indicated rAAV2 vectors at 24 hours post-infection. Data represent the mean (+/- SEM, N=3) relative luciferase activity for each infection, normalized to the enhancer-less vector pAV2-tg83!ue (set to 1). (D and E) Effectiveness of enhancers on transcription following basoiaterai infection of polarized (D) human and (E) ferret airway epitheiia infected with 2x1010 DRP of the indicated rAAV2 vectors. Data represent the mean (+/- SEM, N=4) relative luciferase activity (RLU) for each condition at. 2 days post-infection. (F) Effectiveness of enhancers on transcription in lung and tracheal tissue following infection of 5 day-old ferret pups with 2 x 1011 DRP of AV2/1 .F5tg83luc or AV2/1.F10tg83iuc, in the presence of proteasome inhibitors.
Luciferase activity was measured 8 days post-infection. Data represent the mean (+/- SEM, N=4) relative luciferase activity
Figure imgf000007_0001
protein).
Figures 3A-3C. Impact of (AAV-CFTR construct size on restoration of CFTR chloride currents in polarized CF airway epithelium. A) Schematic illustration of structures of rAAV2 vectors of distinct sizes that encode the full-length ferret CFTR open reading frame (ORF) and R domain-deleted variants, under the control of the same transcriptional elements: the 83 bp synthetic promoter (tg83), a 82 bp synthetic polyadenylation signal (pA), a 17 bp 5' untranslated region (UTR), and a 9 bp 3' UTR. The ORF of full-length ferret CFTR (fCFTR) is 4455 bp. The 99 bp 3xHA tag was inserted between amino acid residues S90Q and 1901 , bringing iCFTR{HA) to 4554 bp. The fCFTRAR has a shortened ORF (4,296 bp); 53 amino acid residues (1708-1760, 159 bp) are deleted from the R-domain. iCFTRAR{HA) is 4395 bp in length, having a 99 bp HA-tag insertion and a 159 bp deletion in the R-domain. The functionalities of these vectors on rescue of CFTR specific CI" transport (reflecting by transepitheliai short- circuit currents (isc)) were compared in differentiated CF HAE ALI cultures, following infection at 1011 DRP per Miliiceli insert (MOI of about 105 DRP/ceil) in the presence of the proteasome inhibitors LLnL (10 μΜ) and doxorubicin (2 μΜ). CF HAE ALI cultures were generated from a conditionally transformed human CF airway cell line (CuFi8; genotype AF508/AF508). B) Typical traces of the Isc changes from CF ALI cultures, infected indicated AAV-CFTR vectors, following the sequential addition of various inhibitors and agonists. Amiioride and DIDS were used to block ENaC-mediated sodium currents and non-CFTR chloride channels prior to addition of cAMP agonist (forskolin and IBMX), and GiyH101 was used to block CFTR-specific currents. Also (IBMX & Forsk) reflects the activation of CFTR-mediated chloride currents following induction with cAMP agonist, and Alsc (GlyH101) reflects the inhibition of CF77?-mediated chloride currents following addition of GlyH101 . C) Effects of vector size on rescue of chloride Isc currents. rAAV- CFTR vectors were increased by about 100 bp increments. Shown are the A!sc (IBMX & Forsk) and A!sc (GlyH101) responses, indicating the magnitude of CFTR-mediated chloride transport following basolaterai infection GF HAE AL!, as described in (B). CFTR currents generated from primary non-CF HAE (N=14) are provided for comparison. Data represent the mean (+/-SEM) for =3 independent Mi!iicel! inserts.
Figures 4A-4B. Analyses of integrity of the viral genome by denaturing gel electrophoresis and slot blot analysis. A) Viral DNA was extracted from 109 DRP of the indicated AAV-CF77? vectors, resolved on a 0.9% alkaline agarose gel, and transferred to a Nylon membrane. Southern blotting was performed with a 32P-!abeied CFTR probe to visualize the viral DNA. B) To assess potential deletion that may have occurred at the termini of positive and minus strand viral genomes, 3.33 x 108 DRP of each virus (titer determined by Taqlvlan PGR with probe/primer set against 1CFTR cDNA) were loaded in triplicate onto a Slot-Dot® SF Module (Bio-Rad, Hercules, CA) fitted with a Nylon membrane. 3-fold serial dilution of provirai plasmid (3 x 109 to 3.7 x 107 copies) was also loaded for generating the standard curves for quantitation. The blots were probed with 32P-labeled oligonucleotides against the tg83 promoter, CFTR cDNA, or polyA. (-) and (+) represent the probes hybridizing to the minus and positive strand of the single stranded rAAV genome. Hybridization was first conducted with the set of probes that hybridize to the minus strand, and then reprobed with the set of oligonucleotides that hybridize to the positive strand. The number of viral genome copies detected by each probe was determined (mean+/- S.E.M, N=3) based on measurement of the signal density using NIH ImageJ and comparison to standard curves.
Figure 5. Effects of the F5 enhancer on CFTR currents generated by CF HAE following infection with rAAV vectors. CF HAE ALI were infected with AV2/2.tg83- fCFTRAR or AV2/2.F5tg83-f CFTRAR, at the indicated MOIs, from the apical or basolaterai surface. Proteasome inhibitors were co-administrated during the 16 hours infection period, isc measurements of the infected ALI cultures were conducted at 2 weeks post-infection. The mean (+/- SEM) Aisc (IBMX & Forsk) and Also (GlyH101) are shown with the N for independent transwel!s assays indicated. Mock-infected CF and non-CF HAE cultures are shown for reference.
Figures 8A-6B. Effects of the F5 enhancer on CFTR currents and tg83-directed CFTR transcription following infection with rAAV vectors. CF HAE ALI v/ere infected with AV2/2.tg83-fC/=77¾\R or AV2/2.F5tg83-fCF7RAf? at an MGi of 2 x 104 DRP/celi from the basolaterai surface, in the presence of proteasome inhibitors. A) isc was measured in the infected ALI cultures at 3 and 10 days post-infection. A!sc (IBMX & Forsk) and A!se (GlyH101) values are presented. B) The abundance of vector-derived CFTR mRNAs in cultures evaluated in Panel a, as determined using RS-PCR and normalized to GAPDH transcripts in each sample. Data represent the mean (+/- SEM) for N=3 independent transwells in each panel. Figures 7A-7B. 5 day old ferrets were systemically infected with 2 x 1 Q11 DRP AAV2/9F5tg83iuc or AAV2/9F10tg83luc via jugular vein injection. Animals were euthanized 8 day post-infection, snap tissues from different organs were harvested and homogenized in reporter lysis buffer (Promega) for luciierase assays. A) Data compare the luciierase expression from the infections of AAV2/9F5tg83iuc or AAV2/9F10tg83iuc when the iucsferase expression from F5tg83 promoter was arbitrarily set as 100 in each tissue. B) Values represent the (mean ÷SE , n=3) relative luciierase activity (RLU/pg protein).
Figures 8A-8W. A-E) Binding sites in F5 which may be employed to prepare synthetic enhancers as described herein. F-P) Binding sites in F10 which may be employed to prepare synthetic enhancers as described herein. Q-W) Binding sites in F5tg83, which may be employed to prepare synthetic enhancers or promoter as described herein. SEQ ID NOs: 31 -68.
Figures 9A-D. Gene transfer efficiency of AV.F5Tg83-hCFTRAR to the ferret trachea and lung. Three day old ferrets were infected with a 100 μί. volume of 8 x 1011 DRP of AV.F5Tg83-hCFTRAR in 500 μΜ doxorubicin. Non-infected animals were given an equal volume of vehicle with doxorubicin. At 10 days post-infections the entire lung and trachea were harvested and snap frozen in liquid nitrogen. Tissue was pulverized and mRNA and cDNA generated for Q-PCR of human and ferret CFTR. (A and B) Copies of hCFTR and fCFTR mRNA in the (A) trachea and (B) lung. Copy number was determined using a standard curve generated from serial dilutions of plasmid CFTR cDNA for each species. (C and D) Ratio of transgene-derived hCFTR to endogenous fCFTR mRNA. C1 -C3 represent animals in the mock-infected group and A1 -A3 represent animals in the AAV-infected group. The average is also shown for the three AAV-infected animals. The dashed line represents endogenous levels of CFTR (ratio = 1). Data depicts the mean +/-SE for N=3 animals in each group.
Figures 10A-D. AV.F5Tg83-hCFTRAR effectively transduces the mature ferret airways. The lungs of 1 month old ferrets (N=3) were transduced with 7.5 x 1012 DRP of AV.F5Tg83-hCFTRAR harboring the hCFTRAR cDNA in a 500 μΙ_ volume of PBS in the presence of 250 μ doxorubicin. A mock-infected control animal (N=1) received 500 μL· PBS with no vector in the presence of 25Q μΜ doxorubicin. Vector was delivered to the lung with a PennCentury microsprayer through tracheal intubation. Nasal delivery in the same animals was also performed using 100 μΙ_ containing 1 .5 x 1012 DRP with 25Q μΜ doxorubicin by instillation of fluid. Mock-infected nasal delivery received PBS with 250 μΜ doxorubicin. At 12 days following infection, the lung lobes were harvested separately along with the trachea, carina, and nasal turbinates with surrounding adventitia. The tissues were snap frozen and pulverized samples were processed separately for mRNA and DNA. A) Taq an RNA-specific PGR (RS-PCR) for human CFTR mRNA and endogenous ferret GAPDH mRNA for vector and mock treated animals. Results show the ratio of hCFTR/fGAPDH mRNA. B) TaqMan RS-PCR for endogenous ferret CFTR mRNA and endogenous ferret GAPDH mRNA for vector and mock treated animals. Results show the ratio of fCFTR/fGAPDH mRNA. C) TaqMan Q- PCR for the number vector genomes in each sample per 100 ng DNA. D) The ratio of mRNA copies for hCFTR/fCFTR for each sample. 1 is equal to endogenous levels of CFTR (red dashed line). Lung samples contained on average 3.0+/-0.5 copies of transgene derived hCFTR mRNA per copy of fCFTR mRNA. Trachea and nasal tissue transduction was more variable, but averaged one copy of transgene derived hCFTR fCFTR mRNA. Results depict the mean +/-SE for the vector treated animals.
Detaijed Description
Gene therapy has been widely used in clinical trials since 1990s with many successful cases reported using viral or non-viral vectors to deliver therapeutic genes. rAAV is the most widely used one proven of high safety profile, broad tissue/organ tropism and persistence transgene expression. AAV is a small single stranded DNA virus of an inherently small 4.679 kb genome, thus the application of rAAV for gene therapy is restricted to delivering relative small transgenes. Although AAV capsid can house a rAAV genome slightly larger than its original size, 4.95 kb appears to be the maximal size for efficient transgene expression. Since a 300-bp sequence of an AAV essential ois element (terminal repeats at both termini) is included in a rAAV vector, the actual insertion of an exogenous gene expression cassette cannot exceed 4.6 kb. This is a challenge for delivering effective expression of a large gene whose size approaches to this limit.
One typical example is to deliver the CFTR gene (cystic fibrosis
transmembrane conductance regulator) for cystic fibrosis (CF) gene therapy using rAAV vector. The coding sequence for CFTR gene is as large as 4.443 kb. To construct a CFTR expressing AAV vector, with the necessity of minimal 5' and 3' UTR and the cloning sites, there is a room of less than 200 bp to incorporate promoter and
polyadenylation signal to direct the transcription of full-length CFTR cDNA.
Recently, a CFTR knockout ferret model was established that spontaneously develops a lung phenotype that mirrors key features of human CF disease, including spontaneous bacterial infection of the lung, defective secretion from submucosal glands, diabetes, and gastrointestinal disease (Sun et al. , 2008; Sun et ai. , 2010; Oliver et al. , 2012; Sun et al. , 2014; Yan et al. , 201 3. It has been demonstrated that the airways of newborn ferrets can be efficiently transduced by rAAV1 in the presence of proteasome inhibitors (Yan et ai., 201 3). Thus, preclinical studies in the CF ferret model can be initiated as soon as a rAAV vector that effectively expresses CFTR in airway epithelium is generated, rAAV inherently small 4,679 kb genome necessitates the use of a short but robust transcription regulatory element to effectively express a large transgene whose size approaches to the package limit, cassette was generated that efficiently expresses the ferret CFTR (fCFTR) gene.
The first-generation rAA\f-CFTR vector (AV2.tgCF), relied on the cryptic promoter activity of the AAV2 ITR, inefficiently expressed CFTR in clinical trials. To overcome this problem, another rAAV vector, AV2.tg83-CF7 which uses an 83-bp synthetic promoter (tg83) was used to improve expression. Although this vector produced a 3-iold higher in cA P-mediated CI- currents in CF HAE AL! cultures than AV2.tgCF, this level of expression remains suboptimal for application in CF gene therapy. So, there is an immediate need for a strong short promoter to direct the CFTR expression in the AAV vector for CF gene therapy. Similarly, to express the 4.3kb B- domain deleted Factor-Vill in muscle and/or liver for hemophilia gene therapy using rAAV, short promoter effective in muscle and liver is also needed.
Another example is to deliver the CRiSPR/Cas9 system for gene editing. The recent development of CRiSPR/Cas9 gene editing technique promotes a new human gene therapy strategy by correcting a defect gene at pre-chosen sites without altering the endogenous regulation of gene of interest. This system consists of two key components: Cas9 protein and sgRNA, as well as a correction template when needed. rAAV can be used to deliver these elements in vivo to various target organs, but the co- delivery of Cas9 protein and the a chimeriG sgRNA in the same cell is required while the duai-AAV vector delivery system is low efficient. Because the size of the expression cassette for Streptococcus pyogenes (SpCas9) and the transcription cassette sgRNA together exceeds 4.2 kb, to use a single rAAV vector to deliver the efficient expression SpCas9 protein, it necessitates the use of small but robust promoter/enhance sequence to direct the SpCas9 expression, thus, ubiquitous and/or tissue-specific enhancers are desired. Although Staphylococcus aureus Cas9 (SaCas9), which is about 1 .0 kb smaller in size, fits together with its sgRNA and relevant expression cassettes within a single AAV vector, using short synthetic promoter allows for the additional incorporation of the gene correction template for an all-in-one rAAV vector in the application of gene editing-based gene therapy.
As described below, short (less than 0.2 kb) synthetic enhancer/promoters provide a solution to solve the current problem of rAAV vector in delivering a large transgene cassette. This disclosure, in one embodiment, relates to the use of a 183-bp F5tg83 synthetic enhancer/promoter to rAAV vectors to deliver effective CFTR expression in lung airway tissue for CF gene therapy. This disclosure, in one embodiment, also provides an effective approach to screen and identify tissue-specific or ubiquitous synthetic promoter/enhancer combinations.
Since enhancer activity differs by cell lines and state of cell differentiation, as well as is influenced by the AAV ITRs and by the sequence of gene of interest, the screening was conducted in a step-wise fashion, e.g., in piasmids, proviral vectors, and rAAV vectors.
in one embodiment, the screening system includes a defined 83-mer synthetic core promoter (tg83p) and a set of random 100-mer synthetic sequence of potent enhancer activity. The screening approach can be used to screen the 100-mer synthetic sequences for their enhancer activity to enhance promoter transcription, e.g., the 83 bp tg83p promoter transcription, in different organ/tissue for different gene of interests, in a similar in a step-wise fashion: such as to direct the Factor VIII expression in muscle or liver, as well as to direct the Cas9 protein expression in any specific tissues or stem cells. Besides tissue-specific expression, the approach also can be used to identify an enhancer of ubiquitous effect to improve the tg83p promoter activity in a wide range of tissue/organ, through testing rAAV derived reporter gene
expressions at a multi-organ level.
Specifically, a set of vectors containing the synthetic tg83 promoter linked with different synthetic sequences (about 100 bp) of potent enhancer activity, was constructed for initial screening in monolayer (non-polarized) cultures of human airway cell lines and primary ferret airway cells, which as discussed below revealed that three of these synthetic enhancers (F1 , F5, and F10) significantly promoted transcription of a luciferase transgene from tg83p in the context of piasmid transfection. The next was to construct rAAV reporter vectors with pre-chosen candidates (F1 -, F5-, or F5~ tg83p enhancer/prompter combination). These vectors also incorporated a partial sequence of the gene of interest (CFTR here) that can maximally fit into the rAAV genome; this approach allows for the screening of cDNA sequences that will ultimately reside in the recombinant virus and also influences enhancer/promoter activity through unknown processes (likely secondary structure of the DNA), Analysis in polarized cultures of human and ferret airway epitheiia at an air-liquid interface (AL!) in the context of AAV vector infection found that the combination of F5tg83 (183 bp in length) was the most efficient promoter in both AL! cultures, leading to 19.6-fold and 57.5-foid increases in reporter (firefly luciferase) expression, respectively, over the enhancer-less counterpart. The F5tg83 promoter also produced the highest level of transgene expression in the ferret airway in vivo. Finally, the F5tg83 promoter was used the rfiAV-CFTR vector to direct the CFTR expression, the vector (AV.F5tg8ZCFTRAR) yielded an about 17-fold increase related to the enhancer-less vector (AV.tg83CF77¾ ) in vector derived CFTR mRNA transcription and significantly improved CI- currents in human CF ALI cultures.
Thus, expression from rAAV vectors having a large transgene was enhanced using small synthetic enhancer/promoter combinations having from a defined 83-mer synthetic core promoter and a set of random synthetic 100-mer synthetic enhancers, in particular, several short 183 bp synthetic promoter/enhancer combinations (F5tg83, F1tg83 and F10tg83) were capable to direct strong transgene expression in human as well as non-human mammalian (such as ferret) airway cells. In one embodiment, the robust F5tg83 promoter can be used in rAAV vector to deliver the 4.4 kb cystic fibrosis transmembrane conductance regulator (CFTR) for cystic fibrosis gene therapy.
The invention will be further described by the following non-limiting examples.
laterials and Methods
Production of rAAV Vectors. All rAAV vector stocks were generated in HEK293 cells triple piasmid co-transfection using an adenovirus-free system, and purified with two rounds of CsC! ultracentrifugation as reported in Yan ei ai. (2004). For ail viral vectors and provira! piasmids, rAAV2 genomes were used and packaged into AAV2 or AAV1 capsid to generate rAAV2/2 and rAAV2/1 viruses, respectively. TaqMan reai-time PGR was used to quantify the physical titer (DNase resistant particles, DRP) of the purified viral stocks as described in Yan et al. (2008) and Ding et al. (2006). The PCR primer/probe set used to titer luciferase vectors was: 5'- TTTTTGAAGCGAAGGTTGTGG-3' (forward primer) (SEQ ID NO:1), 5'- CACACACAGTTCGCCTCTTTG-3' (reverse primer) (SEQ ID NO:2) and 5 -FAM- ATCTGGATACCGGGAAAACGCTGGGCGTTAAT-TA RA-3' probe) (SEQ ID NO:3); the primer/probe set used for ferret CFTR vectors was 5'-
GACGATGTTGAAAGCATACCAC-3' (forward primer) (SEQ ID NO:4), 5'- CACAACCAAAGAAATAGCCACC -3' (reverse primer) (SEQ ID NQ:5) and 5 -FAM- AGTGACAACATGGAACACATACCTCCG -TA RA-3' (probe) (SEQ ID NO:6), A!i primers and probes were synthesized by IDT (Coraivilie, I A). The PCR reaction was performed and analyzed using a Bio-Rad My IQ™ Reai-time PCR detection system and software.
Analysis of Integrity of Viral Genomes. Viral DNA was extracted from 1 Q9 DRP of AA V-CFTR vectors and resolved in 0.9% alkaline denatured agarose gel at 20 volts overnight in 50mM NaOH/1 mM EDTA buffer. Following transfer to a Nylon membrane, Southern blotting was performed with a 32P-labeled CFTR probe to visualize the viral DNA. For examination of 5' end genome deletions in the oversized rAAV vectors, 3.33x10s DRP of each virus (quantitated by TaqMan PCR with probe/primer set against iCFTR cDNA) was loaded into a slot blotting Nylon membrane. The blots were first hybridized to a set of three 32P-iabeled oligonucleotide probes against the minus strand of the rAAV genome: at the 5' sequence of the tg83 promoter: taccctcgagaacggtgacgtg (SEQ ID NO:7); the center of ferret CFTR cDNA: ggagatgcgcctgtctcctggaatg (SEQ ID NQ:8): and the 3' sequence of the synthetic poiyA: gcatcgatcagagtgtgttggttttttgtgtg (SEQ ID NO:9). After exposure to X-fiim, the membranes were stripped of probe and hybridized again to another set of three 32P-iabeled oligonucleotide probes
complimentary to the positive strand. NIH Imaged software was used to quantify the signal intensity of hybridization to determine the corresponding number of genomes detected by each probe with serial dilutions of the provirai plasmid as standards.
Ceil Culture and Conditions for Transfections and Infections. Human airway ceil lines A549 and IB3, as well as HEK 293 ceils, were cultured as monolayers in
Duibecco's modified Eagle medium (DMEM), supplemented with 10% fetal bovine serum and penicillin-streptomycin, and maintained in a 37°C incubator at 5% CO2. Primary ferret airway cells were isolated and cultured as non-polarized monolayer or at an AL! to generate polarized epithe!ia as described in Liu et ai. (2007). Polarized primary HAE were generated from lung transplant airway tissue as described in Karp et al. (2002) by the Ceils and Tissue Core of The Center for Gene Therapy at the
University of Iowa. Polarization of cells of the CuFi8 line, a conditionally transformed cell line thai was generated from ΔΡ508/ΔΡ508 CF airway ceils (Zabner et al., 2003), were polarized at an ALI using conditions similar to those used for primary HAE (Yan et al., 2013). Ferret and human airway epithelia were grown on 12 mm Millicell membrane inserts (Millipore) and differentiated with USG medium of 2% Ultroser G supplement (Pail BioSepra, SA, France) at an ALI prior to use. Cell lines and primary monolayer cultures of airway cells were transfected with p!asmids using iipofectamine and 1 .0 μg of plasmid. For rAAV infections of A549 cells, polarized human or ferret airway epithelial cells, vectors were typically left in the culture medium for 24 hours (A549 cells) or 18 hours (polarized ceils). For apical infection of the polarized HAE ALI cultures, vectors were diluted in USG medium to a final volume of 50 μΙ_ and applied to the upper chamber of the Millicell insert. For basolateral infections, vectors were directly added to the culture medium in the bottom chamber. Proteasome inhibitors were supplied in the culture medium throughout the period of infection to polarized cells, at 40 μΜ LLnL (N- Acetyl-L-leucine-L-leucine-L-norleucine) and 5 μ doxorubicin in the case of polarized human, and 10 μΜ LLnL and 2 μ doxorubicin in the case of CuFi ALI cultures and ferret ALI cultures. Epithelia were exposed to the viruses and chemicals for 16 hours and then removed. At this time, the Millicell inserts were briefly washed with a small amount USG medium and fresh USG medium was added to the bottom chamber only. Doxorubicin was from Sigma (St, Louis, MO) and LLnL was from Boston Biochem (Cambridge, MA).
rAAV Infection of Ferret Lungs. All animal experimentation was performed according to protocols approved by the Institutional Animal Care and Use Committee of the University of Iowa, in vivo infection of ferret lungs was performed by intra-tracheal injection of a 300 μΙ inoculum containing 2 x 10 M DRP of rAAV2/1 and 250 μΜ doxorubicin. Prior to infection at 5 days of age, ferret kits were anesthetized by inhalation of a mixture of isofluorane and oxygen. At 8-day post-infection, ihe animals were euthanized with an overdose sodium pentobarbital intraperitoneal injection. For luciferase expression assays, the ferret trachea and lung cassette was immediately frozen in liquid nitrogen and then pulverized using a cryogenic tissue pulverizer. 1 mi of Passive Lysis Buffer (Promega, Madison, Wi) was added to the pulverized tissue to extract protein. After four freeze-thaw cycles, the tissue extract was centrifuged at 15,000 rpm for 5 minutes, and the clarified tissue extract was used for luciferase assays with a luciferase assay kit from Promega.
Measurement of Expression of the Firefly Luciferase Reporter. At the indicated times post-infection or transfection, ceils were iysed with luciferase ceil lysis buffer and luciferase enzyme activity in ceil lysates was determined using the Luciferase Assay System (Promega) in a 20/20 luminometer equipped with an automatic injector (Turner Biosystems, Sunnyvale, CA).
Measurement of Short-Circuit Currents. Transepitheliai short circuit currents (Isc) were measured using an epithelial voltage clamp (Model EC-825) and a self- contained Ussing chamber system (both purchased from Warner instruments, inc., Hamden, CT) as described in Liu et ai. (2007). Throughout the experiment the chamber was kept at 37°C, and the chamber solution was aerated. The basoiaterai side of the chamber was fiiied with buffered Ringer's solution containing 135 m NaCi, 1.2 mM CaC , 1 .2 mM MgC , 2.4 mM KH2PO4, 0.2 mM K2HPO4, and 5 mM Hepes, pH 7.4. The apical side of the chamber was filled with a low-chloride Ringer's solution in which 135 mM Na-gluconate was substituted for NaCI. Transepitheiial voltage was clamped at zero, with current pulses applied every 5 seconds and the short-circuit current recorded using a VGC MC8 multichannel voltage/current clamp (Physiologic instruments) with Quick DataAcq software. The following chemicals were sequentially added to the apical chamber: (1) amiioride (100 μΜ), to inhibit epithelial sodium conductance by ENaC; (2) 4,4'-diisothiocyanato-stilbene-2,2'-disulfonic acid (D!DS) (100 μΜ), to inhibit non-CFTR chloride channels; (3) the cAMP agonists forskolin (10 μΜ) and 3-isobutyi-l- methyixanthine (IBMX) (100 μΜ) to activate CFTR chloride channels; and (4) the CFTR inhibitor G!yH-101 (N-(2-naphthalenyl)-[(3,5-dibromo-2,4-dihydroxyphenyl) methylene] glycine hydrazide) (10 μΜ) to block CI" secretion through CFTR. Also was calculated by taking the difference of the plateau measurement average over 45 seconds before and after each change in conditions (chemical stimulus).
Quantitative Analysis of Vector-Derived CFTR mRNA Following Transduction with rAAV. The total RNA from rAAV-infected ceils was prepared using the RNeasy
Mini plus Kit (Qiagen). Since the residual ssDNA rAAV genome in the RNA sample can be an undesirable template for traditional Real Time PGR, a modified RNA-specific method for PCR of the rAAV vector 6 was used to detect the vector-derived ferret CFTR mRNA. in brief, the 1 st-strand cDNA synthesis was primed with an adapter (lower case)-linked, vector-specific primer that targets the synthetic polyadenylation signal sequence (upper cases). The sequence of this primer is 5'- gcacgagggcgacugucaUGAUCGAUGCAUCUGAGCUCUUUAUUA-3' (SEQ ID NO:10), in which all dTs are replaced with dU. After RNase H digestion was carried out to eliminate the RNA templates, a ferret CFT/ -specific primer (5'- TGCAGATGAGGTTGGACTCA-3'; SEQ ID NO:1 1) was used for synthesis of the 2nd strand. In order to avoid false amplification from cDNA produced from the single- stranded viral DNA, all of the dU components in the 1 sS~ and 2nd-strand cDNA products, as well as the excess adapter primers, were degraded by applying uracyl-N-glycosylase (UNG). Thus, a 2nd-strand cDNA product linked to the complementary sequence of the adapter derived exclusively from rAAV transcripts was produced. The primer set for
TaqMan PCR contained the ferret CFTR sequence 5'-CAAGTCTCGCTCTCAAATTGC- 3' (SEQ ID NO:12), and the adapter sequence 5'-GCACGAGGGCGACTGTCA-3' (SEQ ID NO:13). The TaqMan probe used was 5'-FAM~
ACCTCTTCTTCCGTCTCCTCCTTCA-TAMRA-3' (SEQ ID NO:14).
Results Synthetic oligonucleotide enhancers thai increase tg83 promoter-driven transcription in airway cells.
A previous unbiased screen evaluating short synthetic enhancers from a library containing 52,429 unique sequence identified enhancer elements capable of activating transcription from the 128 bp minimal cytomegalovirus (CMV) IE promoter (-53 to +75) in HeLa cells (Schlabach et al., 2010). This library comprised all possible 10-mer DNA sequences, printed on microarrays as 10 tandem repeats (for a total length of 100 bases each). The best-performing 100-mer oligonucleotides enhanced the transcription of this 128 bp CMV IE minimal promoter to 75%-137% of that induced by the 600 bp wild type CMV IE promoter (Schlabach et al., 2010). In previous studies, a 83 bp synthetic promoter sequence (tg83) was used to express the full-length CFTR gene from a rAAV vector (AV2.tg83-CF77?), and it was found to produce higher transgene expression in CF HAE cultures than the cryptic promoter of the AAV2 !TR (Zhang et al,, 2009), The tg83 promoter consists of an ATF-1 /CREB site and an Sp1 -binding site from the promoter of the Na,K-ATPase <x1 subunit, and the TATA box and transcription start site from the CMV IE promoter. It was hypothesized that combining the tg83 promoter with a synthetic enhancer identified through this library screen would produce transcriptional units of greater efficiency in polarized human and/or ferret airway epithelia in vitro and in vivo. To test this possibility, the top eight enhancer sequences identified by Schlabach et al. (F1 , F4, F5, F1 Q, C9, D3, CREB6 and CREB8; Schlabach et al., 2010) were evaluated for their ability to enhance tg83 transcription in human and ferret airway epithelium,
£1
AGTCAGGGCAAGTCAGTGGCAAGTCAGGGCAGTCAGGGCAGTCAGGGCAAGTC AGGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCA (SEQ ID NO:15)
£10
gaattgacgcatatattgacgcatattgacgcaaattgacgcaaatgacagcaagattgacgcaaattgagcgcaaatt gacgcaaattaattgacgcat (SEQ ID NO:16)
£4
CTG ATG CAATCTG ATG C AATCTG ATG C AATCTG ATG C AATCTG ATG C AATCTG AG C AATCTG ATG CAATCTG ATG C AATATG ATG AATGTG ATG C AAT (SEQ ID NO:17) £5
TGGTGAGCGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCGGG CATTCTGGGCGTCTGGGCATGTCTGGGCATGTCTGGGCA (SEQ ID NO: 18) C3
G CTG ATGC AATCTG ATG CAATCTG ATG CAATCTG ATG CAATCTG ATG CAATCTG AG CAATCTG ATG CAATCTG ATG C AATATG ATG AATGTG ATG C AATT (SEQ ID NO:19) D9
G CTG ATGC AATCTG ATG CAATCTG ATG CAATCTG ATG CAATCTG ATG CAATCTGAG CAATCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATT (SEQ ID NO:20) CREB6
ATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGA
CGCGG (SEQ ID NO:21)
CREB8
ATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGA CGCGGATTGACGCGGATTGACGCG (SEQ ID NO:22)
Enhancer/Promoter combinations:
tq83
GicgagaacggtgacgtgcacgcgtgggcggagGcatcacgcaggtigGtaiaiaagcagagctcgtttagigaacGgtG aga (SEQ ID NO:23)
F1tq83
AGTCAGGGCAAGTCAGTGGCAAGTCAGGGCAGTCAGGGCAGTCAGGGCAAGTCA GGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCAcicgagaacggtg acgtgcacgcgtgggcggagccaicacgcaggiigGiatataagcagagcicgiiiagtgaacGgtGaga (SEQ ID NO:24)
F10ta83
G A ATTG ACG CATAT ATTG ACG C ATATTG ACG C A AATTG ACG C A AATG AC AG C AAG A TTG ACG CAAATTG AG CG C AAATTG ACG C A AATTAATTG AC
ctGgagaaGggtgacgigcacgcgtgggGggagccatcacgcaggitgciataiaagcagagctcgittagigaaccgic aga (SEQ ID NO:25)
F41g83
CTG ATG CAATCTG ATG C AATCTG ATG C AATCTG ATG C AATCTG ATG C AATCTG AG C AATCTG ATG CAATCTG ATG C AATATG ATG AATGTG ATG C AAT
ctcgagaacggigacgtgcacgcgigggcggagccaicacgcaggttgciaiaiaagcagagctcgittagigaaccgic aga (SEQ ID NQ:26)
F5tg83
GTGGTGAGCGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCGG GCATTCTGGGCGTCTGGGCATGTCTGGGCATGTCTGGGCATcicgagaacggigacgigca cgcgigggcggagccatcacgcaggitgciatataageagagctcgtiiagtgaaccgtcaga (SEQ ID NQ:27) C3tg83
G CTG ATGC AATCTG ATG CAATCTG ATG CAATCTG ATG CAATCTG ATG CAATCTG AG CAATCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATTcicgagaacggtgacgtg cacgcgtgggcggagccaicaGgcaggttgctaiaiaagcagagctcgttiagtgaaGcgtcaga (SEQ ID NO:28)
D9tq83
G CTG ATG CAATCTG ATG CAATCTG ATG CAATCTG ATG CAATCTG ATG CAATCTG A GCAATCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATTctcgagaacggtgac gtgcacgcgtgggcggagccatcacgcaggttgctatataagcagagctcgtttagtgaaccgtcaga (SEQ ID NO:29)
CREB8tg83 ATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTG ACGCGGctcgagaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgctatataagcagagctcgttt agtgaaccgtcaga (SEQ ID NO:30)
The ig83 promoter was cloned into the promoter-less luciferase reporter piasmid pGL3-Basic Vector (Promega) to generate pGL3-tg83. Next a series of luciferase reporter expression plasmids were constructed, in which one of the eight 100- mer enhancers was placed in front of the tg83 promoter of pGL3-tg83 (Figure 1A), Comparison of reporter expression from pGL3-tg83 and its enhancer-containing derivatives was conducted in monolayer (non-polarized) cultures of two human airway cell lines (A549 and IB3) and primary ferret airway cells (Figures 1 B-1 D). Two additional luciferase expression plasmids, pAV2-CMV-luc (contains the wild type, 600 bp CMV IE enhancer-promoter) and pAV2-CBA-luc (contains the CMV IE enhancer-chicken β-actin promoter, i.e., the CBA promoter) were included as controls for high-level promoter activity. Assessment of luciferase expression following piasmid transfection
demonstrated that ail of the enhancers tested increased tg83-driven luciferase expression, and that their efficiencies varied by ceii line: in the human A459 ceil and the primary ferret airway ceil cultures, F1tg83 and F5tg83 exceeded the activity of the CBA and CMV promoters; and in the human IB3 cell cultures, F10tg83 was most effective but drove far less expression than the CMV promoter (Figures 1 B-1 D),
The F5 element most efficiently enhances tq83-driven transcription in polarized human and ferret airway epithelia in vitro, as well as in the ferret airway in vivo.
Since the F1 , F5 and F10 enhancers were the most effective in activating tg83- d riven transcription in airway-ceil monolayer cultures, the abilities of these elements to promote transcription in the context of rAAV vector genomes was evaluated. Four rAAV proviral vectors harboring a luciferase expression cassette were constructed, with expression driven by tg83 (enhancer-less), F1tg83, F5tg83 or F10tg83. The pAV2-tg83- iCFTR proviral piasmid was used as the template vector for cloning, its promoter and the 5' portion of the iCFTR coding region were replaced with the 2.1 or 2.2 kb luciferase expression cassette. The genome size was 4.75 kb in the case of rAV2.tg83luc, and 4.85 kb for the enhancer-containing vectors. This design was used for two reasons. First, retaining as much of the ICFTR sequence as possible ensured that the vector genome size would be similar to those of the rAAV-CFTR expression vectors that would ultimately be generated. Second, retaining regions of the iCFTR cDNA maximized the potential influences of the ferret CFTR sequence on enhancer function.
As a first step in investigating whether AAV ITRs and the portion of iCFTR transgene sequence to be tested (i.e., 3' half of the 1CFTR cDNA) influence transcription from the tg83 promoter, reporter expression from pGL3-tg83 and pAV2-tg83iuc plasmids was compared following transfection into monolayer cultures of A549 and primary ferret airway cells. pAV2-tg83iuc piasmid was found to be 2.5-fold (in A549) and 2-fold (in primary ferret airway cells) more transcriptionally active than the pGL3-based plasmids (Figure 2A), suggesting that inclusion of the AAV ITR and/or the 1CFTR stuffer sequences had an overall positive effects on activity of the tg83 promoter. Then reporter-gene expression for pAV2-F1 tg83luc, pAV2-F5tg83luc, pAV2-F1 Qig83luc, and pAV-tg83luc piasmids was compared. As expected, the F1 , F5 and F10 enhancers significantly improved transcription from the tg83 promoter (about 10- to 19-fold) in both cell types (Figure 2B). However, the effectiveness of nearly all enhancers was significantly reduced (about 3- to 18-fold) within the rAAV provira! piasmids when compared to pGL3-tg83 piasmids lacking ITRs and the CFTR sequence (Figure 2B solid bars vs. Figure 1 B; Figure 2B open bars vs Figure 1 D). This suggests that the sequences from the AAV ITR and/or portions of the ferret CFTR cDNA have an overall negative impact on enhancer function. However, this effect on the synthetic enhancers differed between the A549- and ferret primary airway-ceil monolayers. In A549 cells, the F1 enhancer was most significantly influenced, with its activity in the rAAV proviral plasmid decreased by 18.1 -fold, whereas those of the F5 and F10 enhancers decreased by only 8.2-fold and 3.8-fold, respectively. In primary ferret airway cells, the F1 and F5 enhancers had 4.4~foid and 2.8-fold decreased activity, respectively, in the context of the proviral plasmid, whereas the function of F10 was slightly enhanced (about 40%).
Next expression from the various enhancer elements was evaluated in the context of rAAV2/2 vectors, in A549 cells, similar increases in expressions from the enhancer/tg83 promoter combination were observed following the transfection with the proviral plasmid and infection with the corresponding rAAV vector (Figure 2B solid bars vs. Figure 2C). Primary human and ferret airway epithelial ALI culture were then infected with equal titers of each rAAV vector, and transgene expression was assessed at 2 days post-infection. These experiments demonstrated that F5tg83 is the most efficient promoter in both human and ferret ALI cultures (Figures 2D and 2E), leading to 19.6-fold and 57.5-fold increases, respectively, in tg83-driven transcription over that driven by the enhancer-less control (Figures 2D and 2E). Notably, the differentiated state of ferret airway epithelial cells appeared to dramatically influence expression from the various enhancer/tg83 promoter combinations in the context of rAAV transduction; the F5 enhancer more effectively enhanced tg83 expression in the polarized epithelium (Figure 2E; 57.5-fold) than in undifferentiated monolayers (Figure 2B; 16.6-fold); the F1 enhancer only marginally increased activity of the tg83 promoter in polarized cells, but increased transgene expression 13.8-fold in monolayer ceils.
Lastly, the in vivo activities of the F5tg83 and F10tg83 promoters were compared in the airways of newborn ferrets, using intratracheal injection of two rAAV1 capsid pseudotyped vectors (AV2/1 .F5tg83luc and A 2/1 ,F1 Gt.g83iuc; equal particle titers injected). This capsid serotype had previously been shown to be effective at transducing the ferret always in the presence of a proteasome inhibitor (Yan et ai,, 2013). Luciferase activity was measured in extracts prepared from tracheal and lung tissue ai 8-day post-infection, and F5tg83 was found to be more effective than F1 Qig3 in transducing both ferret lung and trachea (Figure 2F). These findings were consistent with those for polarized ferret airway epithelial ALI cultures (Figure 2E).
A narrow limit for rAAV genome size significantly influences functionality of rAA V-CF7R vectors while not altering packaging efficiency.
The size of the expected AV.tg83fCFT genome if fully packaged is 4.937 kb
(Figure 3A). Incorporation of the F5 enhancer would increase this to 5.040 kb. Although it is well accepted that AAV can encapsidate a rAAV genome slightly longer than its natural size (4.679 kb), gradually increasing the size of a rAAV vector from 4.675 kb to 4.883 kb and 5.083 kb results in 25% and 75%, respectively, decreases in transduction (Dong et al., 1996). Furthermore, single-molecule sequencing (SMS) of the two rAAV termini following packaging of a 5.8 kb proviral genome revealed that the 5' ITR was unstable and had incurred deletions (Kapranov et al., 2012). Given that the limits for functional genome packaging in the context of rAA V-CF7R vectors have yet to be defined, it was uncertain whether a 5.04 kb AV.F5tg83fCF77? genome would be compromised with respect to genome stability and function.
This question was addressed by constructing a 5.036 kb AV2.tg83-fCF7R(HA) vector in which the CFTR expression cassette was expanded by the addition of a 3xHA epitope tag (99 nucleotides) in the region encoding the fourth extracellular loop (ECL4) of ferret CFTR (previous studies had revealed that this insertion has no impact on chloride-channel function (Glozman et al., 2009; Fisher et al., 2012)). This vector allowed us to interrogate how size of the genome influences CFTR functionality in the absence of changes to transcription of the transgene. Two rAAV2 vectors were produced (AV2/2.tg83-fCF7R and AV2/2.tg83-fCF7f?-HA; Figure 3A), and their ability to generate CFT -mediated chloride currents was evaluated in polarized CF HAE. Vector yields for the two viruses were nearly equivalent (AV2/2,tg83-fCF7R about 5 x 109 DRP/fxL and AV2/2.tg83-fCF7R(HA) about 3 x 109 DRP/μΙ). Polarized CF HAE were cultured at an ALI and infected at the relatively high multiplicity of infection (MOi) of about 105 DRP/celi (1011 DRP of each rAAV2 vector per insert). At 10 days following infection, the level of CFTR expression was determined by measuring short circuit current (isc), as described in Zhang et al. (2004) and Fisher et al. (201 1). Figure 3B shows a typical Isc trace following infection of CF HAE with AV2/2.tg83-fCF7R or AV2/2.tg83-fCF7 :?-HA. Amiioride and DIDS were first applied to block non-CFT chloride channels and ENaC-mediated sodium currents, and then cA P agonists (iB X and forskolin) were used to induce CFTR activity. The changes in Isc following the addition of IBMX and forskolin (AlsciMBx & Forsk) and the subsequent addition of the CFTR inhibitor G yH101 (AlscgiyH) were used to evaluate the function of CFTR. These results clearly demonstrated that functional complementation of CFTR activity in CF HAE is greater following infection with AV2/2.tg83-fCF7R than with AV2/2.tg83-fCF7f?-HA (Figure 3B). The mean AlsciBMx & Fonsk and AlscgiyH values from these experiments are summarized in Figure 3C. CF7f?-mediated cAMP-inducible CI" currents produced by AV2/2.tg83-fCF7R(HA) were only 3.6% those in a non-CF HAE ALI cultures, but still above background levels (p<0.01 ). By contrast, infection with AV2/2.tg83-f CFTR produced 10-fold greater cAMP-inducible CI' currents than AV2/2.tg83-fCF7R(HA) and achieved about 30% CFTR activity of non-CF HAE ALI cultures. These results demonstrate that the cutoff for retaining CFTR function is very narrow when producing oversized rAAV genomes, and that vector functionality does not depend only on the efficiency of packaging DRPs. Furthermore, these studies suggest that incorporation of the 100 nucleotide F5 enhancer into AV2/2.tg83-fCFT :?, with a total genome size of 5.04 kb, may have a significant negative impact on function of the genome.
Effective packaging of a functional ferret CFTR mini gene into rAAV
Next, the possibility of using a shortened ferret CFTR minigene was explored, to further reduce the genome size of a rAA S/-CFTR vector, and to allow for incorporation of the F5 enhancer. A human CFTR minigene (CFTRAR) with a 158 bp partial deletion of the R-domain (encoding amino acids 708-759) has been reported to retain most of the chloride-channel activity of the full-length protein (Ostedgaard et a!,, 2002; Ostedgaard et a!. , 201 1 ). A 1CFTRAR minigene was created by deleting the 159 bp homologous sequence encoding amino acids 708-780 at the corresponding position of the human protein, and produced two additional vectors: AV2/2.tg83-f CFTRAR (4.778 kb) and AV2/2.tg83-fCFT :?AR(HA) (4.877 kb). This pair of vectors allowed for the examination not only the function of the 1CFTR minigene in CF HAE ALI cultures, but also the impact of the HA-iag insertion in the 1CFTR gene. Analysis of AISCIBMX & Forek and Alscgiyn responses for these two viruses demonstrated that both AV2/2.tg83-fCF77:? and AV2/2.tg83-fCFTf?(HA) produced substantial CFTR-mediated CI" currents following infection of the CF HAE ALI cultures (Figure 3C). However, the HA-tagged form produced about 20% less CI" current than AV2/2.tg83-fCFT ?AR, This finding is consistent with rAAV vectors of 4.88 kb having only about 25% of the functional activity of vectors 4.68 kb (Dong et a!., 1996). Alternatively, the HA-tag may itself influence CFTR function in the context of the R-domain deletion, although in the context of full- length CFTR this ECL4 HA-tag has no impact on CI" channel function (Glozman et ai. , 2009; Fisher et a!. , 201 1 ). Despite the larger genome size of AV2/2.tg83-fCFTR (4.9437 kb), this vector produced about 30% more CFTR-mediated current than its shorter counterpart AV2/2.tg83-fCFTRAR (4,778 kb) (Figure 3C). This reduction in CI" channel activity o1 1CFTRAR is similar to that reported for hCFTRAR (Ostedgaard et al., 2002), However, given the potential for reduced functionality of larger vector genomes, the impact of the R-domain deletion on the function of the ferret CFTR protein is likely greater than that for human CFTR.
To establish the impact of genome length on packaging of the rAAV vectors tested, the integrity of the viral genome was examined, using alkaline-denatured agarose gel electrophoresis followed by Southern blotting (Figure 4A), This analysis revealed that the smallest vector genome (i.e. that of AV2.tg83-fCFTRAR, 4.778 kb) could be distinguished from the other three viruses based on its faster migration through the gel (AV2.tg83-fCFTRAR is 99 nucleotides shorter than the AV2.tg83-fCFTRAR(HA) vector). However, AV2.tg83-fCF7/?(HA) (5.036 kb), AV2.tg83-fCF7R (4.937 kb) and AV2.tg83-fCFT/?A/:?(HA) (4.887 kb) could not be distinguished from one another on the basis of this analysis. Given thai it should be possible to visualize differences of both 149 nucleotides (AV2.ig83-fCF7 (HA) vs. AV2.tg83-fCFTRAf?(HA)) and 99 nucleotides (AV2.tg83-fCF7/?(HA) vs. AV2,ig83-fCF7RA/:?(HA), and AV2.ig83-fCF7f?(HA) vs. AV2.tg83-fCF7R), these findings were interpreted as support for the notion that viral genomes larger than that of AV2.tg83-f CFTRAR(HA) (4,887 kb) tend to incur deletions that compromise CFTR transgene expression.
The notion that deletion occurs in the context of longer genomes was further supported by the hybridization of viral genomes with two sets of plus and minus strand oligonucleotide probes at the center of CF7f? cDNA, the tg83 promoter, and synthetic poly-A sequences (Figure 4B). Results from this analysis demonstrated viral DNA from the largest AV2.tg83-fCFTR(HA) vector incurred deletions at both the 5' ends of positive and minus strand genomes. By contrast, the 3' end of positive and minus strand AV2.ig83-fCFTR(HA) genomes remained intact, consistent with packaging of single stranded AAV genomes from the 3' to 5' direction. The fact that the strength of hybridization at the tg83 promoter (for positive strand), and the polyA sequence (for minus strand), was lower than that of hybridization to the 1CFTR cDNA suggested that these deletions were not restricted to the !TR region (i.e., that the damage extended into the CF7R expression cassette). Such deletions were not observed in the second longest vector, AV2.tg83-fCF7R, therefore, the CFTR expression cassette in this vector most likely still remains intact, although partial deletions in the ITR region likely occur as suggested from the viral DNA migration on denatured agarose gel. While deletions in the ITR regions may not directly influence expression of the CFTR transgene, they may impact the stability of viral genomes and thus indirectly influence CFTR expression. These results, together with the functional analysis, led to the conclusion that the iCFTRAR cDNA without the HA-tag would be best suited for testing the impact of the F5 enhancer on rAAV-mediated CFTR complementation.
The synthetic F5tg83 promoter improves rAAV-mediated CF7R complementation.
Next, the pAV2,F5fg83-fCF7RAR provirai plasmid was generated and
AV2/2.F5tg83~fCFTRAR virus with a genome size of 4.87 kb was produced. The efficiency of this virus for complementing function of the CFTR channel following infection of polarized CF HAE was compared to that of the enhancer-less counterpart vector (AV2.tg83-f CFTRAR). Results from this analysis demonstrated that incorporation of the F5 enhancer greatly improved the CFTR-mediated CI" currents (Figure 5). At two weeks following basolateral infection at an MOI of 5x104 DRP/ceil, cAMP-induced
CFTR-mediated CI" currents were 3.5-fold greater for AV2/2.F5ig83-f CFTRAR than for AV2/2.ig83~fCFTRAR, and the former was 89% of those observed in non-CF primary HAE. A similar improvement in CFTR function (4.8-fold) was observed with
AV2/2.F5tg83-f CFTRAR following apical infection, but in this case the efficiency of transduction was significantly lower, as previously reported for this serotype. At the reduced MO! of 1 x 104 DRP/ceil basoiaieraily, AV2/2.F5tg83-fCF7RAR produced 89% of the CFTR current generated by this vector at a 5-fold higher MOI, suggesting that complementation of CFTR function approached saturation in the latter case. Thus, when one compares the effectiveness of AV2/2.F5tg83-f CFTRAR (1 x 1 Q4 DRP/cell) and AV2/2.tg83-fCF7RAR (5 x 104 DRP/cell) vectors in the context of optimal infection (i.e., basoiaterai) and non-saturating conditions, incorporation of the F5 enhancer improved the vector efficacy by 13.5-fold. This level of increase in current is consistent with the increase in expression observed with the analogous iuciferase expression vectors (Figure 2D, 19.6-fold).
Given the apparent saturation of CFTR currents at the highest MOI (5 x 1 Q4
DRP/cell) following basoiaterai infection with A V2/2.F5tg83f CFTRAR, the kinetics of CFTR expression were evaluated at an intermediate MOI (2 x 104 DRP/ceil),
Measurements were carried out 3 and 10 days following infection of CF HAE with AV2/2.F5tg83-f CFTRAR and AV2/2.tg83-fCF7RAR. Results from this analysis demonstrated that, in the context of the F5 enhancer, the onset of CF7R-mediated CI" currents was more rapid than in its absence (Figure 6A). in fact, CFTR currents were maximal by 3 days after infection with AV2/2.F5tg83-fCF7RAR, whereas currents increased 3.6-fold between 3 and 10 days after infection with A V2/2.tg83-f CFTRAR. To more directly compare transcriptional activity between these vectors, the ferret CFTR mRNA was examined by real-time RNA-specific reverse transcriptase PGR (RS-PCR), a method that prevents amplification of vector-derived DNA products and was previously applied in detecting the CFTR mRNA from rAAV-snfected cells and tissues (Zhang et al., 2004; Gerard et a!., 2003). Analyses of the RS-PCR results, after normalization to ferret GAPDH transcripts, demonstrated 6.4-fold and 17.1 -fold higher levels of fCFTR mRNA following infection with AV2.F5tg83-f CFTRAR vs. AV2/2.tg83- f CFTRAR, at the 3 and 10 day time points, respectively (Figure 6B). The 10-fold increase in CFTR mRNA observed between 3 and 10 days after infection confirms that CFTR currents were saturated by 3 days post-infection. Thus, at. the transcriptional level, incorporation of the F5 enhancer increased CFTR expression 17.1 -fold, closely mirroring the results observed with Iuciferase expression vectors (Figure 2D, 19.6-fold). Discussion
rAAV vectors have attracted considerable interest with respect to human gene therapy, but its inherently small genome (4.679 kb) is a significant challenge for the delivery of large genes such as CFTR. Although several laboratories have attempted to rationally design short enhancers and promoters for use in rAAV vectors, this approach has yet to yield robust expression of CFTR in the airway. In the present study, an entirely empirical approach was taken by screening synthetic enhancers for their effectiveness in the delivery of reporter gene expression in step-wise fashion - in plasmids, proviral vectors, and viral vectors. While the main goal was to develop rAAV vectors for delivering CFTR to the airway, a similar approach may prove useful for gene therapy efforts tackling the delivery of other large genes (e.g., Factor VIII and dystrophin) that necessitate the use of short promoters.
Production of an oversized rAAV genome is known to lead to random deletions at the 5' end of the encapsidated single stranded genomes (Kapranov ei ai., 2012), but the functional integrity of rAAV vector genomes that approach the accepted maximum capacity of rAAV (about 5.0 kb) has not been thoroughly investigated. The current study provides, in the context of CF7f?-expressing rAAV vectors, evidence that functionality of the rAAV genome begins to decline well below this 5.0 kb cut off. Evidence in support of this includes a reduction in CFTR function for 4.877 kb vs. 4.778 kb genomes (Figure 3C) and the lack of differences in the migration of 4.877-5.036 kb single-stranded genomes when visualized on alkaline gels (Figure 4A). Additionally, the largest CFTR vector (5.036 kb) incurred deletion in about 30% of genomes that extend beyond the 5' ITR and into the promoter (in the case of the positive strand) or poiyA region (in the case of the minus strand). This suggests that damage to the CFTR expression cassette may be responsible for the significant impairment of function of CFTR delivered by this vector. While the oligo probes used only detected deletions in 30% of genomes for this largest construct, the 90% reduction in CFTR chloride current between 4.937 vs 5.036 kb vectors suggests that a much larger percentage of genomes incur functional deletions and that ITR deletions may also impair vector performance.
The present findings seem inconsistent with previous observations of an only 4- fold change in transgene expression between rAAV vectors that are 4.7 kb and 5.2 kb in size (Wu et ai., 201 Q). However, in this earlier study the stuffer sequence used to expand the vector was positioned between the expression cassette and the ITR, and deletions of the stuffer sequence would likely have less of an impact on the
transcriptional activity of the transgene. The current study of the AAS/-CFTR vector instead employed a short synthetic promoter and poiy-A signal, and small deletions within these short transcriptional regulatory elements would be expected to greatly influence gene expression. Since DNase resistant particle titer is typically used to confirm effective packaging of rAAV genomes, small 5'-end deletions could have a significant impact on functionality of oversized rAAV vectors.
The empirical approach that was used to screen synthetic 100 bp enhancers for the ability to improve rAAV-mediated transgene expression in the airway yielded several important observations: 1) Enhancer activity differed by cell lines and also the state of cell differentiation. 2) Enhancer activity was influenced by the AAV ITRs and might also be influenced by the sequence of gene of interest (in this study, the 3' half of the ferret CFTR cDNA coding region). 3) Enhancer activity in the case of rAAV infection was generally similar to that in the context of proviral vector, though with subtle differences. 4) infection of human and ferret airways with viral vectors revealed some differences in enhancer function (most notably for AV2/2.F1tg83luc, Figures 2D and 2E). These results indicate that although transfection with proviral plasmid is suitable for initial screens of synthetic enhancers, performing such a screen in unpolarized primary airway cultures may not produce the same patterns of gene expression observed following AAV infection of polarized airway cultures.
Through this screen, a 100 bp synthetic enhancer (F5) was identified that significantly improves the transcriptional activity of an 83 bp synthetic promoter (tg83), in polarized cultures of both primary human and ferret airway epithelial cells, as well as in ferret lung and trachea in vivo. The ferret CFTR minigene lacking a 53 amino acid portion of the R domain (fCFTRAR) retained about 70% of wild type iCFTR function, similar to the 80% function retained by a previously reported, analogous hCFTRAR construct (Ostedgaard et al., 2002). Nevertheless, this was greatly compensated by the increased transgene expression from AV2.F5tg83-fCF7f?Af?, as the use of the shortened minigene spares 150 bp space to allow for the incorporation of the F5 enhancer, in the context of a rAAV vector, the F5 enhancer significantly improved tg83- driven CFTR mRNA expression (17.1 -fold) at 10 days post-infection of CF HAE relative to the AV2/2.tg83-fCF77?AR vector, which lacks this enhancer. This increase in CFTR mRNA expression from AV2/2.F5tg83-f CF RAf? correlated well with the 19.6-fold improvement in CFTR-mediated currents made possible by this vector, and resulted in production of about 89% of the cAMP-mediated CI currents observed in non-CF HAE. Of note, a ceiling on the level of functional correction that can be achieved with respect to the changes in isc was found. In the time-course studies, maximal correction of Isc in CF HAE was achieved by 3 days post-infection, with the about 10 fold increase in CFTR mRNA by 10 days post-infection yielding no improvement in CI" currents (Figure 6). These findings provide important insight into evaluating the functionality of rAAV-CFTR vectors: dose responses of the vector are needed for accurate comparison of vector designs. The ceiling on CFTR currents could reflect self-limiting cell biology (e.g., control over the total amount of CFTR on the plasma membrane), or aberrant trafficking of CFTR to the basolateral membrane at higher levels of expression (Farmen et al., 2005).
in summary, a rAAV-CFTR vector was generated that provides high-level expression suitable for use in lung gene therapy studies in the CF ferret model.
Moreover, the present findings suggest that small synthetic enhancers and promoters may be useful tools for optimizing the design of rAAV vectors for the delivery of large transgenes.
Summary
As discussed herein, small synthetic enhancer/promoter combination, sized about or less than 200 bp, can be used in rAAV vector to deliver effective transgene expression of a large transgene expression; in this study, the gene is CFTR. As also discussed herein, empirical approach to screen a set of 100-mer synthetic enhancer elements for their ability to augment reporter expression from a short 83-bp synthetic promoter (tg83p) in lung airway tissue. Partial sequence of the gene of interest (in the study is CFTR) is included to the reporter vector to maximize the effect to screen the best enhancer sequence. The screening was conducted in step-wise fashion - in plasmids, provira! vectors, and rAAV vectors, and in different cell/tissue levels- in monolayer (non-polarized) cultures of human airway cell lines and primary ferret airway cell, in polarized cultures of human and ferret airway epithelia at an air-liquid interface (ALI) and ferret airway in vivo. The enhancer activity differs by cell lines and state of cell differentiation, as well as is influenced by the AAV !TRs and by the sequence of gene of interest. Thus, the effects of an enhancer in the context of plasmid transfection may be different from that in the context of rAAV transduction. The in vivo effects of a particular enhancer may not be predictable from its behaviors demonstrated in culture cell lines. This, the screening needs to be conducted in different ceil/tissue levels and in a step-wise fashion - in plasmids, provirai vectors, and rAAV vectors to warrant the success.
Three of synthetic enhancers (F1 , F5, and F10) were found significantly increase the transcription of tg83p for luciferase transgene in the context of plasmid transfection. The F5tg83 promoter, the 183 bp combination of F5 enhancer and fg83p, was the most efficient promoter in human and ferret ALI cultures, leading to 19.8-fold and 57.5-fold increases reporter expression, respectively, over the enhancer-less counterpart. The F5tg83 promoter also produced the highest level of transgene expression in the ferret airway in vivo. When the F5tg83 promoter was used to transcribe the 4.2 kb CFTR minigene (CFTRAR) in a rAAV vector, it yielded an about 17-fold increase in vector derived CFTR mRNA transcription and significantly improved CI" currents in human CF ALI cultures, compared to the vector using tg83p only.
The enhancer/promoter combinations for lung epithelium (e.g., F5tg83) may not necessarily be as usef ul for other organs/tissue. For example, when AAV vectors harboring a luciferase reporter gene driven by F5tg83 or F10tg83 were used to infect different tissues/organs of the digestive system, F5tg83 demonstrated the strongest promoter activity in pancreas, gallbladder and liver, whereas F10tg83 outperformed F5tg83 in small intestine (Figures 7A-7B).
Although the studies were focused on identifying strong synthetic
enhancer/promoter sequence using for efficiently expressing CFTR in lung/airway tissue, the screen approach can be used for any desired cell types, tissues and organs in vitro and in vivo.
Thus, the use of short enhancer elements (about 100-mer synthetic oligonucleotide sequences consisting of 10-mer repeats) was found to enhance gene expression from a minimal promoter in rAAV vectors. These 100 bp enhancer elements were previously identified for their ability to activate transcription directed by the C V immediate-early (IE) minimal promoter in cell lines (Schlabach et a!., 2010). If was hypothesized that enhancers that are most potent in activating transcription could be used to enhance activity of the synthetic tg83 promoter in airway cells in the context of rAAV vectors. Eight combinations of the tg83 promoter and 100 bp synthetic enhancers were tested, and one designated as F5 efficiently was found to enhance the transcription from the tg83 promoter in polarized airway ceils (in vitro) derived from both humans and ferrets, as well as in the ferret airway (in vivo). Using the F5tg83 promoter and the ferret CFTR minigene of partial deletion at R domain (iCFTRAR), a rAAV vector (AV2/2.F5tg83-fCFTRAR) was found and its ability to correct CFTR-mediated CI" transport in CF ALI cultures tested.
Example 2
AV,F5Tg83-hCFTRAR was tested for hCFTR expression in the newborn and mature ferret airway. An endpoint of these analyses was the ratio of transgene-derived human CFTR (hCFTR) to that of endogenous ferret CFTR (fCFTR) mRNA. in 3 day old newborn ferrets (Figure 9), AV.F5Tg83-CFTRAR led to 240% greater expression of human CFTR compared with endogenous (ferret) CFTR following gene delivery to the lung.
Given that the phenotype of ferret airway epithelia and the secretions in the airway change as the lungs mature, it was evaluated whether AV.F5Tg83-CFTRAR transduces the mature ferret airway and the promoter remains active. To this end, the ability of AV.F5Tg83-CFTRAR to transduce the lung of 1 month old ferrets was evaluated. In 1 month old mature ferrets (Figure 10), AV.F5Tg83-CFTRAR led to 300% greater expression of human CFTR compared with endogenous (ferret) CFTR following gene delivery to the lung. Furthermore, the ratio of human to ferret CFTR was approximately one in the nasal passage. These findings from newborn and mature ferrets suggest that the F5Tg83 promoter robustly expresses the CFTR fransgene in the lung in vivo.
References
Aitken et a!., Chest. 123:792 (2003).
Aitken et a!., Hum Gene Ther., 12:1907 (2001).
Carter, Hum Gene Ther., 16:541 (2005).
Conrad et al., Gene Ther., 3:858 (1996).
Daya & Berns, Clin. icrob. Rev., 21:583 (2008).
Ding et al., Gene Ther., 12:873 (2005).
Ding et al., oi. Ther.. 13:671 (2006).
Dong et al., Hum. Gene Ther., 7:2101 (1996).
Duan et al., Hum. Gene Ther., 9:2761 (1998).
Duan et al., J. Clin, invest.. 105:1573 (2000).
Farmen et al.. Am. J. Physiol. Lung Ceil Moi. Physiol.. 289:1 123 (2005).
Fisher et al., J. Biol. Chem.. 287:21673 (2012).
Flotte et al., J. Biol. Chem.. 268:3781 (1993).
Flotte, Curr. Opin. Moi. Ther.. 3: 497 (2001).
Flotte, et al., J. Biol. Chem.. 268:3781 (1993).
Gerard et al., Gene Ther., 10:1744 (2003).
Glozman et al., J. Cell Biol.. 184:847 (2009).
Griesenbach et al., Virus Adapt. Treat., 2:159, (201 Q). Griesenback & Alton, Adv. Drug Deiiv. Rev., 61 "128 (2009).
Kapranov et al., Hum. Gene Ther., 23:46 (2012).
arp et al., Methods Mol. Biol., 188: 15 (2002).
Li et al., Mol. Ther., 17:2067 (2009).
Liu et al.. Am. J. Respir. Cell Mol. Biol.. 36:313 (2007).
Liu et a!., Gene Ther., 14: 543 (2007).
Liu et a!.. Mol. Ther., 15:21 14 (2007).
Moss et al., Hum. Gene Ther., 18:726 (2007).
Mueller & Flotte, Clin. Rev. Allergy Immunol., 35:164 (2008).
Olivier et al. , J. Clin, invest., 122:3755 (2012).
Ostedgaard et al., Proc. Natl. Acad. Sci. USA, 102:2952 (2005).
Ostedgaard et al., Proc. Natl. Acad. Sci. USA, 108:2921 (201 1).
Ostedgaard et al., Proc. Natl. Acad. Sci. USA. 99:3093 (2002).
O'SuHivan & Freedman, Lancet. 373:1891 (2009).
Riordan et al., Science. 245:1066 (1989),
Rommens et al., Science, 245:1059 ( 989).
Rowe et al., N. Enai. J. Med.. 352: 1992 (2005).
Schlabach et al., Proc. Natl. Acad. Sci. USA. 107:2538 (2010).
Summer-Jones et al., Gene Therapy for Cystic Fibrosis Lung Disease, Birkhauser Basel, Basel (2010).
Sun et al., Am. J. Pathol., 184:1309 (2014).
Sun et al., Am. J. Respir. Ceil Mol. Biol., 50:502 (2014).
Sun ei al., J. Clin, invest., 118:1578 (2008).
Sun et al., J. Clin, invest., 120:3149 (2010).
Wagner et al.. Hum. Gene Ther., 13.1349 (2002).
Welsch, FASEB. J., 4:2718 (1990).
Welsh et al., In The Metabolic and Molecular Bases of Inherited Disease, eds McGraw-Hill, New York, p. 3799 (1995).
Wu et al., Mol. Ther., 14:316 (2006).
Wu et al., Mol. Ther., 18:80 (2010).
Yan et al. , Hum. Gene Ther. , 24:786 (2013).
Yan et al. , Hum. Gene Ther,, 26:334 (2015).
Yan et al. , J. Virol.. 76:2043 (2002).
Yan et al., J. Virol.. 78:2863 (2004).
Yan et al. , Mol. Ther.. 21:2181 (2013).
Zabner et al, Am J. Ptwsiol. Luna Cell Mol. P vsioi., 284.844 (2003).
Zhang et al., Mol. Ther., 10:990 (2004).
Zhang et al., Proc. Natl. Acad. Sci. USA, 95:10158 (1998).
Ail publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification, this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details herein may be varied considerably without departing from the basic principles of the invention.

Claims

WHAT IS CLAIMED IS:
1 . An isolated recombinant parvovirus vector comprising a synthetic enhancer comprising plurality of enhancer sequences operabiy linked to a promoter.
2. The recombinant parvovirus vector of claim 1 , wherein each of the plurality of enhancer sequences has the same sequence.
3. The recombinant parvovirus vector of claim 1 , wherein at least two of the plurality of enhancer sequences have a different sequence.
4. The recombinant parvovirus vector of any one of claims 1 to 3, wherein the plurality of enhancer sequences has 2 up to 20, 2 up to 15 or 2 up to 10, of the enhancer sequences in tandem.
5. The recombinant parvovirus vector of any one of claims 1 to 4, wherein at least one of the enhancer sequences has no more than 15 bases,
8. The recombinant parvovirus vector of any one of claims 1 to 5, wherein the plurality of enhancer sequences has one or more P53 binding sites, one or more NRF-1 binding sites or one or more CREB binding sites, or a combination thereof.
7. The recombinant parvovirus vector of claim 1 , wherein the synthetic enhancer comprises F1 , F5 or F10.
8. The recombinant parvovirus vector of claim 1 , wherein the synthetic enhancer has at least one enhancer sequence with at least 80% nucleotide sequence identity to F1 , F5 o F10. 9. The recombinant parvovirus vector of claim 1 , wherein the synthetic enhancer has at least one enhancer sequence with at least 90% nucleotide sequence identity to F1 , F5 or F10.
10. The recombinant parvovirus vector of claim 1 , wherein the synthetic enhancer has at least one enhancer sequence with at least 95% nucleotide sequence identity to
F1 , F5 or F10.
1 1 , The recombinant parvovirus vector of any one of claims 1 to 10, wherein the plurality of enhancers is up to about 120 nucleotides in length.
12. The recombinant parvovirus vector oi any one of claims 1 to 10, wherein the plurality of enhancers is up to about 150 nucleotides in length.
13. The recombinant parvovirus vector of any one of claims 1 to 10, wherein the plurality of enhancers is up to about 100 nucleotides in length.
14. The recombinant parvovirus vector of any one of claims 1 to 13, wherein the promoter is a synthetic promoter. 15. The recombinant parvovirus vector of claim 14, wherein the promoter is tg83.
18. The recombinant parvovirus vector of any one of claims 1 to 13, wherein the promoter is a heterologous promoter. 17. The recombinant parvovirus vector of any one of claims 1 to 16 which is a bocavirus or an adeno-associated virus vector.
18. The recombinant parvovirus vector of any one of claims 1 to 17, wherein the promoter is operabiy linked to an open reading frame.
19. The recombinant parvovirus vector of claim 18, wherein the open reading frame encodes a prophylactic or therapeutic gene product.
20. The recombinant parvovirus vector of any one of claims 1 to 19, wherein the combination of the plurality of enhancer sequences and the promoter is no more than
200 nucleotides in length.
21 . The recombinant parvovirus vector of any one of claims 1 to 19, wherein the combination of the plurality of enhancer sequences and the promoter is no more than 150 nucleotides in length.
22. The recombinant parvovirus vector of any one of claims 1 to 19, wherein the combination of the plurality of enhancer sequences and the promoter is no more than 250 nucleotides in length.
23. The recombinant parvovirus vector of any one of claims 1 to 22 wherein the synthetic enhancer and promoter have at least 80%, 85%, 90%, 95%, 98% 99% or more nucleic acid sequence identity to one of SEQ ID Nos, 24-30. 24, A method to express a transgene in a ceil, comprising: introducing a composition comprising a recombinant parvovirus vector comprising a synthetic enhancer comprising a plurality of enhancer sequences operably linked to a promoter operably linked to a transgene to a eukaryotic cell so as to express the transgene in the cell. 25. A method to express a transgene in a mammal, comprising introducing to a mammal a composition comprising a recombinant parvovirus vector comprising a synthetic enhancer comprising a plurality of enhancer sequences operably linked to a promoter operably linked to a transgene so as to express the transgene in ceils of the mammal.
28. The method of claim 24 or 25, wherein the expression of the transgene is enhanced by at least 2-, 5-, 10-, or 15-fold or more relative to a corresponding parvovirus vector that lacks the synthetic enhancer. 27. The method of any one of claims 24 to 26 wherein the plurality of enhancer sequences has two or more P53 binding sites, two or more NRF-1 binding sites, or two or more CREB binding sites.
28. The method of any one of claims 25 to 27 wherein the composition is injected.
29. The method of any one of claims 25 to 27 wherein the composition is intranasally administered.
30. The method of any one of claims 24 to 29, wherein each of the plurality of enhancer sequences has the same sequence.
31 . The method of any one of claims 24 to 30, wherein at least two of the plurality of enhancer sequences have a different sequence.
32. The method of any one of claims 24 to 31 , wherein the plurality of enhancer sequences has 2 up to 20, 2 up to 15 or 2 up to 10, of the enhancer sequences in tandem.
33. The method of any one of claims 24 to 32, wherein at least one of the enhancer sequences has no more than 15 bases.
34, The method of any one of claims 24 to 33, wherein the synthetic enhancer comprises F1 , F5 or F10.
35. The method of any one of claims 24 to 33, wherein the synthetic enhancer has at least one enhance sequence with at least 80%, at least 90% nucleotide sequence identity to F1 , F5 or F10, or at least 95% nucleotide sequence identity to F1 , F5 or F10. 36. The method of any one of claims 24 to 35, wherein the plurality of enhancers is up to about 100, up to about 120 or up to about 150 nucleotides in length.
37. The method of any one of claims 24 to 36, wherein the promoter is a synthetic promoter.
38. The method of claim 37, wherein the promoter is tg83.
39. The method of any one of claims 24 to 36, wherein the promoter is a heterologous promoter.
40. The method of any one of claims 24 to 39, wherein the vector is a bocavirus or an adeno-associated virus vector.
41 . The method of any one of claims 24 to 40, wherein the fransgene encodes a prophylactic or therapeutic gene product.
42. The method of any one of claims 24 to 41 , wherein the combination of the plurality of enhancer sequences and the promoter is no more than 150, no more than 200 or no more than 250 nucleotides in length.
43. The method of any one of claims 24 to 42 wherein the synthetic enhancer and promoter have at least 80%, 85%, 90%, 95%, 98% 99% or more nucleic acid sequence identity to one of SEQ ID Nos.24-30. 44. An isolated vector comprising a synthetic enhancer comprising plurality of enhancer sequences operably linked to a promoter.
45, The vector of claim 44, wherein each of the plurality of enhancer sequences has the same sequence.
46, The vector of claim 44, wherein at least two of the plurality of enhancer sequences have a different sequence.
47, The vector of any one of claims 44 to 46, wherein the plurality of enhancer sequences has 2 up to 20, 2 up to 15 or 2 up to 10, of the enhancer sequences in tandem.
3?
48. The vector of any one of claims 44 to 47, wherein at least one of the enhancer sequences has no more than 15 bases. 49. The vector of any one of claims 44 to 48, wherein the plurality of enhancer sequences has one or more P53 binding sites, one or more NRF-1 binding sites or one or more CREB binding sites, or a combination thereof.
50. The vector of claim 44, wherein the synthetic enhancer has at least one enhancer sequence with at least 80%, 90% or 95% nucleotide sequence identity to F1 , F5 or F10.
51 . The vector of any one of claims 44 to 50, wherein the plurality of enhancers is up to about 100, 120 or 150 nucleotides in length.
52. The vector of any one of claims 44 to 51 , wherein the promoter is a synthetic promoter.
53. The vector of claim 52, wherein the promoter is tg83.
54. The vector of any one of claims 44 to 53, wherein the promoter is operabiy linked to an open reading frame.
55. The vector of claim 54, wherein the open reading frame encodes a prophylactic or therapeutic gene product.
56. The vector of any one of claims 44 to 55, wherein the combination of the
plurality of enhancer sequences and the promoter is no more than 150, 200 or 250 nucleotides in length. 57. The vector of any one of claims 44 to 56 wherein the synthetic enhancer and promoter have at least 80%, 85%, 90%, 95%, 98% 99% or more nucleic acid sequence identity to one of SEQ ID Nos.24-30.
58. The vector of any one of claims 44 to 57 which is a plasmid.
PCT/US2017/021124 2016-03-07 2017-03-07 Aav-mediated expression using a synthetic promoter and enhancer Ceased WO2017155973A1 (en)

Priority Applications (12)

Application Number Priority Date Filing Date Title
AU2017229347A AU2017229347A1 (en) 2016-03-07 2017-03-07 AAV-mediated expression using a synthetic promoter and enhancer
CA3016985A CA3016985C (en) 2016-03-07 2017-03-07 Aav-mediated expression using a synthetic promoter and enhancer
IL261642A IL261642B2 (en) 2016-03-07 2017-03-07 Aav-mediated expression using a synthetic promoter and enhancer
IL322737A IL322737A (en) 2016-03-07 2017-03-07 Aav-mediated expression using a synthetic promoter and enhancer
EA201892006A EA201892006A1 (en) 2016-03-07 2017-03-07 AAV-MEDIATED EXPRESSION USING THE SYNTHETIC PROMOTER AND ENCHANSER
EP17712339.5A EP3426787A1 (en) 2016-03-07 2017-03-07 Aav-mediated expression using a synthetic promoter and enhancer
US16/082,767 US11684679B2 (en) 2016-03-07 2017-03-07 AAV-mediated expression using a synthetic promoter and enhancer
MX2018010842A MX2018010842A (en) 2016-03-07 2017-03-07 Aav-mediated expression using a synthetic promoter and enhancer.
AU2020289851A AU2020289851B2 (en) 2016-03-07 2020-12-18 Aav-mediated expression using a synthetic promoter and enhancer
US18/139,661 US20240066147A1 (en) 2016-03-07 2023-04-26 Aav-mediated expression using a synthetic promoter and enhancer
AU2023263461A AU2023263461A1 (en) 2016-03-07 2023-11-08 Aav-mediated expression using a synthetic promoter and enhancer
US19/183,490 US20250381308A1 (en) 2016-03-07 2025-04-18 Aav-mediated expression using a synthetic promoter and enhancer

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201662304656P 2016-03-07 2016-03-07
US62/304,656 2016-03-07

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US16/082,767 A-371-Of-International US11684679B2 (en) 2016-03-07 2017-03-07 AAV-mediated expression using a synthetic promoter and enhancer
US18/139,661 Division US20240066147A1 (en) 2016-03-07 2023-04-26 Aav-mediated expression using a synthetic promoter and enhancer

Publications (1)

Publication Number Publication Date
WO2017155973A1 true WO2017155973A1 (en) 2017-09-14

Family

ID=58361143

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2017/021124 Ceased WO2017155973A1 (en) 2016-03-07 2017-03-07 Aav-mediated expression using a synthetic promoter and enhancer

Country Status (9)

Country Link
US (3) US11684679B2 (en)
EP (1) EP3426787A1 (en)
AU (3) AU2017229347A1 (en)
CA (2) CA3016985C (en)
EA (1) EA201892006A1 (en)
IL (2) IL261642B2 (en)
MA (1) MA43735A (en)
MX (1) MX2018010842A (en)
WO (1) WO2017155973A1 (en)

Cited By (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10335466B2 (en) 2014-11-05 2019-07-02 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of parkinson's disease
US10570395B2 (en) 2014-11-14 2020-02-25 Voyager Therapeutics, Inc. Modulatory polynucleotides
US10584337B2 (en) 2016-05-18 2020-03-10 Voyager Therapeutics, Inc. Modulatory polynucleotides
US10597660B2 (en) 2014-11-14 2020-03-24 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
WO2020214672A1 (en) * 2019-04-15 2020-10-22 University Of Iowa Research Foundation Methods and compositions for transgene expression
WO2020214668A1 (en) * 2019-04-15 2020-10-22 University Of Iowa Research Foundation Compositions and methods for treatment of cystic fibrosis
WO2022006253A3 (en) * 2020-06-30 2022-02-24 University Of Iowa Research Foundation Methods and compositions for administering recombinant viral vectors
EP4036238A1 (en) 2021-01-27 2022-08-03 The University Court of the University of Edinburgh Functional nucleic acid molecule and method
US11603542B2 (en) 2017-05-05 2023-03-14 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US11684679B2 (en) 2016-03-07 2023-06-27 University Of Iowa Research Foundation AAV-mediated expression using a synthetic promoter and enhancer
US11697825B2 (en) 2014-12-12 2023-07-11 Voyager Therapeutics, Inc. Compositions and methods for the production of scAAV
US11702672B2 (en) 2016-02-08 2023-07-18 University Of Iowa Research Foundation Methods to produce chimeric adeno-associated virus/bocavirus parvovirus
US11752181B2 (en) 2017-05-05 2023-09-12 Voyager Therapeutics, Inc. Compositions and methods of treating Huntington's disease
US11759506B2 (en) 2017-06-15 2023-09-19 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of Parkinson's disease
WO2024023530A1 (en) 2022-07-29 2024-02-01 The University Court Of The University Of Edinburgh Functional nucleic acid molecule and method
US11951121B2 (en) 2016-05-18 2024-04-09 Voyager Therapeutics, Inc. Compositions and methods for treating Huntington's disease
US11999965B2 (en) 2017-01-13 2024-06-04 University Of Iowa Research Foundation Bocaparvovirus small noncoding RNA and uses thereof
US12173305B2 (en) 2016-05-26 2024-12-24 University Of Iowa Research Foundation cis and trans requirements for terminal resolution of human bocavirus 1
US12281321B2 (en) 2018-09-28 2025-04-22 Voyager Therapeutics, Inc. Frataxin expression constructs having engineered promoters and methods of use thereof
US12319929B2 (en) 2018-05-15 2025-06-03 Voyager Therapeutics, Inc. Compositions and methods for the treatment of Parkinson's disease

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014168953A1 (en) * 2013-04-08 2014-10-16 University Of Iowa Research Foundation Chimeric adeno-associated virus/ bocavirus parvovirus vector

Family Cites Families (143)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4487934A (en) 1980-06-06 1984-12-11 Hoechst-Roussel Pharmaceuticals Inc. Method of preparing poly-substituted acylbenzenes
US4501729A (en) 1982-12-13 1985-02-26 Research Corporation Aerosolized amiloride treatment of retained pulmonary secretions
DE3326472A1 (en) 1983-07-22 1985-02-14 Hoechst Ag, 6230 Frankfurt NEW INSULIN DERIVATIVES, METHOD FOR THE PRODUCTION AND USE THEREOF AND PHARMACEUTICAL AGENTS FOR TREATING THE DIABETES MELLITUS
ATE39691T1 (en) 1984-04-06 1989-01-15 Zambon Spa OPTICALLY EFFECTIVE KETALS, PROCESSES FOR THEIR PREPARATION AND THEIR USE IN THE SYNTHESIS OF ALPHA-ARYL CANONIC ACIDS.
US5658772A (en) 1989-12-22 1997-08-19 E. I. Du Pont De Nemours And Company Site-specific recombination of DNA in plant cells
KR930701992A (en) 1990-10-05 1993-09-08 웨인 알.조운즈 How to get rid of mucus secretions that remain in the lungs of patients
US5173414A (en) 1990-10-30 1992-12-22 Applied Immune Sciences, Inc. Production of recombinant adeno-associated virus vectors
US5292498A (en) 1991-06-19 1994-03-08 The University Of North Carolina At Chapel Hill Method of treating lung disease with uridine triphosphates
US6083713A (en) 1992-08-31 2000-07-04 Bristol-Myers Squibb Company Cloning and expression of βAPP-C100 receptor (C100-R)
US5478745A (en) 1992-12-04 1995-12-26 University Of Pittsburgh Recombinant viral vector system
US5869305A (en) 1992-12-04 1999-02-09 The University Of Pittsburgh Recombinant viral vector system
US5686436A (en) 1993-05-13 1997-11-11 Hiv Diagnostics, Inc. Multi-faceted method to repress reproduction of latent viruses in humans and animals
US5512269A (en) 1993-06-09 1996-04-30 Burroughs Wellcome, Co. Method of treating retained pulmonary secretions
US5498531A (en) 1993-09-10 1996-03-12 President And Fellows Of Harvard College Intron-mediated recombinant techniques and reagents
WO1995013365A1 (en) 1993-11-09 1995-05-18 Targeted Genetics Corporation Generation of high titers of recombinant aav vectors
US5750398A (en) 1993-11-30 1998-05-12 David C. Johnson Vector, element and method for inhibiting immune recognition
AU1846695A (en) 1994-02-16 1995-09-04 Idun Pharmaceuticals Methods for controlling free radical generation by inflammatory cells
US5604090A (en) 1994-06-06 1997-02-18 Fred Hutchinson Cancer Research Center Method for increasing transduction of cells by adeno-associated virus vectors
US5656256A (en) 1994-12-14 1997-08-12 The University Of North Carolina At Chapel Hill Methods of treating lung disease by an aerosol containing benzamil or phenamil
US5843742A (en) 1994-12-16 1998-12-01 Avigen Incorporated Adeno-associated derived vector systems for gene delivery and integration into target cells
US6281010B1 (en) 1995-06-05 2001-08-28 The Trustees Of The University Of Pennsylvania Adenovirus gene therapy vehicle and cell line
US5635160A (en) 1995-06-07 1997-06-03 The University Of North Carolina At Chapel Hill Dinucleotides useful for the treatment of cystic fibrosis and for hydrating mucus secretions
US5853716A (en) 1995-07-28 1998-12-29 Yale University Genetically engineered chimeric viruses for the treatment of diseases associated with viral transactivators
US5628984A (en) 1995-07-31 1997-05-13 University Of North Carolina At Chapel Hill Method of detecting lung disease
CA2230195A1 (en) 1995-08-21 1997-02-27 Duke University A method to increase the density of antigen on antigen presenting cells
US5801030A (en) 1995-09-01 1998-09-01 Genvec, Inc. Methods and vectors for site-specific recombination
US5855918A (en) 1995-09-12 1999-01-05 Genentech, Inc. Cystic fibrosis therapy
US6083702A (en) 1995-12-15 2000-07-04 Intronn Holdings Llc Methods and compositions for use in spliceosome mediated RNA trans-splicing
ATE354957T1 (en) 1995-12-15 2006-03-15 Intronn Inc THERAPEUTIC MOLECULES OBTAINED BY TRANS-CLIPATION
DE19605279A1 (en) 1996-02-13 1997-08-14 Hoechst Ag Target cell-specific vectors for the introduction of genes into cells, drugs containing such vectors and their use
US6420347B1 (en) 1997-03-27 2002-07-16 Inspire Pharmaceuticals, Inc. Method of treating ciliary dyskinesia with uridine triphosphates and related compounds
US5939460A (en) 1996-07-08 1999-08-17 Idun Pharmaceuticals, Inc. Method of inhibiting NADPH oxidase
JP2001500497A (en) 1996-09-06 2001-01-16 トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア Methods of gene therapy directed by recombinant adeno-associated virus
WO1998009524A1 (en) 1996-09-06 1998-03-12 Chiron Corporation Methods and compositions for liver specific delivery of therapeutic molecules using recombinant aav vectors
US6110744A (en) 1996-11-13 2000-08-29 Board Of Regents, The University Of Texas System Diminishing viral gene expression by promoter replacement
AU5588298A (en) 1996-12-02 1998-06-29 Cell Genesys, Inc. Adeno-associated viral vector-mediated delivery of dna to cells of the liver
US6153436A (en) 1997-01-10 2000-11-28 The Board Of Trustees Of The University Of Arkansas Method of gene delivery using wildtype adeno associated viral (AAV) vectors with insertions
US6287569B1 (en) 1997-04-10 2001-09-11 The Regents Of The University Of California Vaccines with enhanced intracellular processing
FR2763845B1 (en) 1997-05-30 2003-04-18 Centre Nat Rech Scient ANTI-CANCER PRODUCTS FOR THE TREATMENT OF MUCOVISCIDOSIS
US6156303A (en) 1997-06-11 2000-12-05 University Of Washington Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
US6037177A (en) 1997-08-08 2000-03-14 Cell Genesys, Inc. Method for increasing the efficiency of recombinant AAV production
EP1011688B1 (en) 1997-08-29 2005-02-02 The University of North Carolina at Chapel Hill Use of uridine 5'-diphosphate and analogs thereof for the treatment of lung diseases
WO1999018227A1 (en) 1997-10-08 1999-04-15 Advanced Research And Technology Institute Chimeric parvovirus-based recombinant vector system that specifically targets the erythroid lineage
US6642051B1 (en) 1997-10-21 2003-11-04 Targeted Genetics Corporation Amplifiable adeno-associated virus(AAV) packaging cassettes for the production of recombinant AAV vectors
US6346415B1 (en) * 1997-10-21 2002-02-12 Targeted Genetics Corporation Transcriptionally-activated AAV inverted terminal repeats (ITRS) for use with recombinant AAV vectors
AU756827B2 (en) 1997-10-21 2003-01-23 Targeted Genetics Corporation Transcriptionally-activated AAV inverted terminal repeats (ITRs) for use with recombinant AAV vectors
NZ505325A (en) 1997-12-23 2003-07-25 Crucell Holland B Adeno-associated virus and adenovirus chimeric recombinant viruses useful for the integration of foreign genetic information into the chromosomal dna of target cells
US6436392B1 (en) 1998-05-20 2002-08-20 University Of Iowa Research Foundation Adeno-associated virus vectors
JP4633927B2 (en) 1998-05-22 2011-02-16 インスパイアー ファーマシューティカルズ,インコーポレイティド Therapeutic dinucleotides and derivatives
WO1999061601A2 (en) 1998-05-28 1999-12-02 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Aav5 vector and uses thereof
IL128017A0 (en) 1998-07-22 1999-11-30 Technion Res & Dev Foundation Method for detecting protein-protein interactions and a kit therefor
US6290951B1 (en) 1998-08-01 2001-09-18 Alfacell Corporation Alteration of the cell cycle in vivo, and particularly for inducing apoptosis of tumor cells
ES2140354B1 (en) 1998-08-03 2000-11-01 S A L V A T Lab Sa IMIDAZO (1,2A) AZINAS SUBSTITUTED AS SELECTIVE INHIBITORS OF COX-2.
US6200560B1 (en) 1998-10-20 2001-03-13 Avigen, Inc. Adeno-associated virus vectors for expression of factor VIII by target cells
EP1143896B1 (en) 1998-10-20 2006-12-13 The University of North Carolina at Chapel Hill Methods of hydrating the nasal mucosal surface
US6221349B1 (en) 1998-10-20 2001-04-24 Avigen, Inc. Adeno-associated vectors for expression of factor VIII by target cells
AU780231B2 (en) 1998-11-10 2005-03-10 University Of North Carolina At Chapel Hill, The Virus vectors and methods of making and administering the same
AU1344400A (en) 1998-11-18 2000-06-05 Incyte Pharmaceuticals, Inc. Inflammation-associated genes
US6855549B1 (en) 1998-11-23 2005-02-15 The University Of Iowa Research Foundation Methods and compositions for increasing the infectivity of gene transfer vectors
US6926911B1 (en) 1998-12-22 2005-08-09 The University Of North Carolina At Chapel Hill Compounds and methods for the treatment of airway diseases and for the delivery of airway drugs
US6512102B1 (en) 1998-12-31 2003-01-28 Chiron Corporation Compositions and methods of diagnosis and treatment using casein kinase I
EP1153612A4 (en) 1999-02-10 2003-06-18 Takashi Tsuruo ANTI-CANCER AGENT POTENTIALIZERS
US6306663B1 (en) 1999-02-12 2001-10-23 Proteinex, Inc. Controlling protein levels in eucaryotic organisms
US6893865B1 (en) 1999-04-28 2005-05-17 Targeted Genetics Corporation Methods, compositions, and cells for encapsidating recombinant vectors in AAV particles
CA2270795A1 (en) 1999-05-05 2000-11-05 Gestilab Inc. Neuroprotective compositions and uses thereof
US7122335B1 (en) 1999-06-08 2006-10-17 University Of Iowa Research Foundation Compounds and methods to enhance rAAV transduction
JP4969002B2 (en) 1999-06-08 2012-07-04 ユニバーシテイ・オブ・アイオワ・リサーチ・フアウンデーシヨン Compounds and methods for increasing rAAV transduction
HK1047091B (en) 1999-07-19 2008-07-04 University Of North Carolina At Chapel Hill Pharmacologically active compounds with two covalently linked active principles (sodium channel blocker/p2y2 receptor agonist) for the treatment of mucosal surfaces
US6475537B1 (en) 2000-07-27 2002-11-05 Rhodia Inc. Hops acid antibacterial compositions
CA2379166C (en) 1999-08-09 2013-03-26 Targeted Genetics Corporation Enhancement of expression of a single-stranded, heterologous nucleotide sequence from recombinant viral vectors by designing the sequence such that it forms instrastrand base pairs
US6416759B1 (en) 1999-09-30 2002-07-09 The Regents Of The University Of California Antiproliferative Sgk reagents and methods
EP1224313A1 (en) 1999-10-07 2002-07-24 University of Iowa Research Foundation Adeno-associated viruses and uses thereof
AU784420B2 (en) 1999-10-07 2006-03-30 University Of Iowa Research Foundation, The Adeno-associated viruses and uses thereof
US7241447B1 (en) 1999-10-07 2007-07-10 University Of Iowa Research Foundation Adeno-associated virus vectors and uses thereof
JP2003511082A (en) 1999-10-12 2003-03-25 ザ・ユニヴァーシティ・オヴ・ノース・キャロライナ・アト・チャペル・ヒル Adeno-associated virus vector encoding factor VIII and uses thereof
AU7895700A (en) 1999-10-15 2001-04-30 Dalhousie University Method and vector for producing and transferring trans-spliced peptides
US20020132770A1 (en) 1999-10-27 2002-09-19 Caplan Michael T. Conductance of improperly folded proteins through the secretory pathway and related methods for treating disease
AU2001240018A1 (en) 2000-03-03 2001-09-17 The Board Of Trustees Of The Leland Stanford Junior University Adeno-associated viral compositions and methods
CA2373110A1 (en) 2000-03-14 2001-09-20 Neurologix, Inc. Production of chimeric capsid vectors
CA2302627A1 (en) 2000-03-23 2001-09-23 Rashmi Kothary Constructs comprising the enac promoter sequence and a reporter gene for screening pharmaceuticals
US20020076754A1 (en) 2000-04-20 2002-06-20 Liangwu Sun Overcoming AAV vector size limitation through viral DNA hetero-dimerization
US7056502B2 (en) 2000-04-28 2006-06-06 The Trustees Of The University Of Pennsylvania Recombinant aav vectors with AAV5 capsids and AAV5 vectors pseudotyped in heterologous capsids
ATE318923T1 (en) 2000-06-01 2006-03-15 Univ North Carolina DOUBLE STRANDED PARVOVIRUS VECTORS
AU2001269923A1 (en) 2000-06-19 2002-01-02 Genzyme Corporation Combination enzyme replacement, gene therapy and small molecule therapy for lysosomal storage diseases
US6492429B1 (en) 2000-07-10 2002-12-10 N.V. Nutricia Composition for the treatment of osteoarthritis
US6485950B1 (en) 2000-07-14 2002-11-26 Council Of Scientific And Industrial Research Isozyme of autoclavable superoxide dismutase (SOD), a process for the identification and extraction of the SOD in cosmetic, food and pharmaceutical compositions
US6329181B1 (en) 2000-08-07 2001-12-11 Neurologix, Inc. Helper functions for recombinant vector production
WO2002014526A2 (en) 2000-08-10 2002-02-21 Neurologix, Inc. Replication competent aav helper functions
US20020128203A1 (en) 2000-09-20 2002-09-12 Laurent Schild Methods of identifying inhibitory compounds and uses thereof
AU2001289438A1 (en) 2000-09-22 2002-04-02 Galephar M/F Pharmaceutical semi-solid composition of isotretinoin
WO2002028348A2 (en) 2000-10-04 2002-04-11 The Children's Hospital Of Philadelphia Compositions and methods for treatment of cystic fibrosis
AU2002251844A1 (en) 2001-02-02 2002-10-03 Corixa Corporation Compositions and methods for the therapy and diagnosis of colon cancer
US20030013137A1 (en) 2001-03-13 2003-01-16 Barak Larry S. Automated methods of detecting receptor activity
CA2482124C (en) 2001-04-19 2008-10-07 Uab Research Foundation Methods of treatment using an epithelial sodium channel blocker and an inhibitor of the mineralocorticoid receptor
AU2002308481A1 (en) 2001-05-01 2002-11-11 Senomyx, Inc. High throughput cell-based assay for monitoring sodium channel activity and discovery of salty taste modulating compounds
US20030003583A1 (en) 2001-06-08 2003-01-02 Raphael Hirsch Regulation of transgene expression following AAV transduction
JP2004534955A (en) 2001-07-12 2004-11-18 エクセリクシス・インコーポレイテッド HADHs as Modifiers of the p21 Pathway and Methods of Use
CA2453405A1 (en) 2001-07-13 2003-01-23 University Of Iowa Research Foundation Pseudotyped adeno-associated viruses and uses thereof
US8241622B2 (en) 2001-07-13 2012-08-14 University Of Iowa Research Foundation Adeno-associated virus vectors with intravector heterologous terminal palindromic sequences
US20030108920A1 (en) 2001-09-07 2003-06-12 Wei Zhang Tumor suppressor-like proteins that bind IGFBP2
JP2003201255A (en) 2001-11-05 2003-07-18 Otsuka Pharmaceut Factory Inc Alzheimer's disease prevention and treatment agent
US6723551B2 (en) 2001-11-09 2004-04-20 The United States Of America As Represented By The Department Of Health And Human Services Production of adeno-associated virus in insect cells
WO2003042361A2 (en) 2001-11-09 2003-05-22 Government Of The United States Of America, Department Of Health And Human Services Production of adeno-associated virus in insect cells
AU2002367943A1 (en) 2001-12-18 2003-12-22 University Of North Carolina At Chapel Hill Improved reagents and methods for producing parvoviruses
EP1478655A4 (en) 2001-12-31 2006-05-10 Algos Therapeutics Inc METHODS AND MATERIALS FOR MODULATING ENaC-BETA
EP1499742B1 (en) 2002-04-17 2010-11-03 Glucox Biotech AB Nad(p)h oxidase inhibitors for increased glucose uptake and treatment of type ii diabetes
ATE405670T1 (en) 2002-05-13 2008-09-15 Arexis Ab AUTOIMMUNE DISEASES AND NADPH OXIDASE DEFECTS
EP1534990B1 (en) 2002-07-23 2006-10-25 Medi-Physics, Inc. Automated dynamic pressure-responsive hyperpolarized gas dispensing systems, and associated methods and computer program products
AU2003298020A1 (en) 2002-11-26 2004-06-18 Florida Atlantic University Catalytic antioxidants and methods of use
KR100522188B1 (en) 2003-01-20 2005-10-18 주식회사 뉴로테크 Method for inhibition of necrosis induced by neurotrophin
AU2004227358B8 (en) 2003-03-31 2009-12-10 Targeted Genetics Corporation Compounds and methods to enhance rAAV transduction
EP1486567A1 (en) 2003-06-11 2004-12-15 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Improved adeno-associated virus (AAV) vector for gene therapy
SI1633772T1 (en) 2003-06-19 2016-06-30 Genzyme Corporation Aav virions with decreased immunoreactivity and uses therefor
US7655467B2 (en) 2003-11-14 2010-02-02 The University Of Washington Compositions and methods for systemic nucleic acid sequence delivery
US7407801B2 (en) 2003-12-05 2008-08-05 University Of Iowa Research Foundation Truncated CMV promoters and vectors containing same
US7067659B2 (en) 2004-04-23 2006-06-27 Duke University Reactive oxygen generating enzyme inhibitor with nitric oxide bioactivity and uses thereof
WO2005116224A2 (en) 2004-05-18 2005-12-08 Children's Memorial Hospital Tetracycline-regulated adeno-associated viral (aav) vectors for gene delivery to the nervous system
EP1602926A1 (en) 2004-06-04 2005-12-07 University of Geneva Novel means and methods for the treatment of hearing loss and phantom hearing
US20060002913A1 (en) 2004-06-22 2006-01-05 Gehlsen Kurt R Use of histamine and related compounds to treat disorders affecting muscle function
WO2006116503A2 (en) 2005-04-26 2006-11-02 Irm Llc Methods and compositions for modulating wnt signaling pathway
WO2007057062A1 (en) 2005-11-17 2007-05-24 Karolinska Institutet Innovations Ab Human bocavirus and methods of diagnosis and treatment
CA2634670A1 (en) 2005-12-30 2007-07-12 University Of Iowa Research Foundation Method of identifying compounds useful to treat neuronal degenerative diseases
WO2007127464A2 (en) 2006-04-28 2007-11-08 University Of Iowa Research Foundation Methods and compounds to modulate parvovirus transduction of mammalian cells or to alter virus infection, method to identify a viral receptor or co-receptor
US20100113343A1 (en) 2006-09-22 2010-05-06 Julia Skokowa Methods involving lef-1 regulation and use of lef-1 or compounds altering lef-1 signalling for treating or preventing diseases
EP2798956A1 (en) 2007-04-23 2014-11-05 Stowers Institute for Medical Research Methods and compositions for hematopoeitic stem cell self-renewal
EP2184073A4 (en) 2007-08-24 2010-10-20 Kyowa Hakko Kirin Co Ltd Therapeutic agent for cancer with resistance to protease inhibitor
US20090241206A1 (en) 2008-03-04 2009-09-24 University Of Iowa Research Foundation Methods for cloning ferrets and transgenic ferret models for diseases
WO2009151697A2 (en) 2008-03-14 2009-12-17 The Government Of United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and processes relating to human bocavirus
US8071751B2 (en) 2008-04-17 2011-12-06 Blood Systems, Inc. Human parvovirus: bocavirus
US20110054247A1 (en) 2009-03-04 2011-03-03 University Of Iowa Research Foundation Methods for cloning ferrets and transgenic ferret models for diseases
US9169492B2 (en) 2010-02-05 2015-10-27 The University Of North Carolina At Chapel Hill Compositions and methods for enhanced parvovirus transduction
EP3134113A4 (en) 2014-04-25 2017-11-29 University of Florida Research Foundation, Inc. Methods of permitting a subject to receive multiple doses of recombinant adeno-associated virus
US10907130B2 (en) 2014-11-05 2021-02-02 Research Institute At Nationwide Children's Hospital Methods and materials for producing recombinant viruses in eukaryotic microalgae
WO2017139381A1 (en) 2016-02-08 2017-08-17 University Of Iowa Research Foundation Methods to produce chimeric adeno-associated virus/bocavirus parvovirus
CA3016985C (en) 2016-03-07 2023-07-04 University Of Iowa Research Foundation Aav-mediated expression using a synthetic promoter and enhancer
WO2017205739A1 (en) 2016-05-26 2017-11-30 University Of Iowa Research Foundation cis AND trans REQUIREMENTS FOR TERMINAL RESOLUTION OF HUMAN BOCAVIRUS 1
US11142775B2 (en) 2017-01-13 2021-10-12 University Of Iowa Research Foundation Bocaparvovirus small noncoding RNA and uses thereof
WO2019178267A2 (en) 2018-03-13 2019-09-19 University Of Iowa Research Foundation Inductive regeneration of the airway by transcriptional factor modulation of glandular myoepithelial stem cells
CN114641318A (en) 2019-04-15 2022-06-17 衣阿华大学研究基金会 Compositions and methods for treating cystic fibrosis
BR112021020706A2 (en) 2019-04-15 2022-03-15 Spirovant Sciences Inc Methods and compositions for transgene expression
EA202192819A1 (en) 2020-01-29 2022-02-18 Юниверсити Оф Айова Рисерч Фаундейшн METHODS AND COMPOSITIONS FOR TRANSGENE EXPRESSION
EA202192818A1 (en) 2020-01-29 2022-03-03 Юниверсити Оф Айова Рисерч Фаундейшн COMPOSITIONS AND METHODS FOR THE TREATMENT OF CYSTIC FISSIDOSIS
WO2022006253A2 (en) 2020-06-30 2022-01-06 University Of Iowa Research Foundation Methods and compositions for administering recombinant viral vectors

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014168953A1 (en) * 2013-04-08 2014-10-16 University Of Iowa Research Foundation Chimeric adeno-associated virus/ bocavirus parvovirus vector

Non-Patent Citations (56)

* Cited by examiner, † Cited by third party
Title
AITKEN, CHEST, vol. 123, 2003, pages 792
AITKEN, HUM GENE THER., vol. 12, 2001, pages 1907
CARTER, HUM GENE THER., vol. 16, 2005, pages 541
CONRAD ET AL., GENE THER., vol. 3, 1996, pages 658
DAYA; BERNS, CLIN. MICROB. REV., vol. 21, 2008, pages 583
DING ET AL., GENE THER., vol. 12, 2005, pages 873
DING ET AL., MOL. THER., vol. 13, 2006, pages 671
DONG ET AL., HUM. GENE THER., vol. 7, 1996, pages 2101
DUAN ET AL., HUM. GENE THER., vol. 9, 1998, pages 2761
DUAN ET AL., J. CLIN. INVEST., vol. 105, 2000, pages 1573
FARMEN ET AL., AM. J. PHYSIOL. LUNG CELL MOL. PHYSIOL., vol. 289, 2005, pages 1123
FISHER ET AL., J. BIOL. CHEM., vol. 287, 2012, pages 21673
FLOTTE ET AL., J. BIOL. CHEM., vol. 268, 1993, pages 3781
FLOTTE, CURR. OPIN. MOL. THER., vol. 3, 2001, pages 497
GERARD ET AL., GENE THER., vol. 10, 2003, pages 1744
GLOZMAN ET AL., J. CELL BIOL., vol. 184, 2009, pages 847
GRIESENBACH ET AL., VIRUS ADAPT. TREAT., vol. 2, 2010, pages 159
GRIESENBACK; ALTON, ADV. DRUG DEIIV. REV., vol. 61, 2009, pages 128
KAPRANOV ET AL., HUM. GENE THER., vol. 23, 2012, pages 46
KARP ET AL., METHODS MOL. BIOL., vol. 188, 2002, pages 115
LI ET AL., MOL. THER., vol. 17, 2009, pages 2067
LIU ET AL., AM. J. RESPIR. CELL MOL. BIOL., vol. 36, 2007, pages 313
LIU ET AL., GENE THER., vol. 14, 2007, pages 1543
LIU ET AL., MOL. THER., vol. 15, 2007, pages 2114
M. R. SCHLABACH ET AL: "Synthetic design of strong promoters", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 107, no. 6, 9 February 2010 (2010-02-09), pages 2538 - 2543, XP055064057, ISSN: 0027-8424, DOI: 10.1073/pnas.0914803107 *
MOSS ET AL., HUM. GENE THER., vol. 18, 2007, pages 726
MUELLER; FLOTTE, CLIN. REV. ALLERGY IMMUNOL., vol. 35, 2008, pages 164
OLIVIER ET AL., J. CLIN. INVEST., vol. 122, 2012, pages 3755
OSTEDGAARD ET AL., PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 2952
OSTEDGAARD ET AL., PROC. NATL. ACAD. SCI. USA, vol. 108, 2011, pages 2921
OSTEDGAARD ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 3093
O'SULLIVAN; FREEDMAN, LANCET, vol. 373, 2009, pages 1891
RIORDAN ET AL., SCIENCE, vol. 245, 1989, pages 1066
ROMMENS ET AL., SCIENCE, vol. 245, 1989, pages 1059
ROWE ET AL., N. ENGL. J. MED., vol. 352, 2005, pages 1992
SCHLABACH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 107, 2010, pages 2538
See also references of EP3426787A1
SUMMER-JONES ET AL.: "Gene Therapy for Cystic Fibrosis Lung Disease", 2010, BIRKHAUSER
SUN ET AL., AM. J. PATHOL., vol. 184, 2014, pages 1309
SUN ET AL., AM. J. RESPIR. CELL MOL. BIOL., vol. 50, 2014, pages 502
SUN ET AL., J. CLIN. INVEST., vol. 118, 2008, pages 1578
SUN ET AL., J. CLIN. INVEST., vol. 120, 2010, pages 3149
WAGNER ET AL., HUM. GENE THER., vol. 13, 2002, pages 1349
WELSCH, FASEB. J., vol. 4, 1990, pages 2718
WELSH ET AL.: "The Metabolic and Molecular Bases of Inherited Disease", 1995, MCGRAW-HILL, pages: 3799
WU ET AL., MOL. THER., vol. 14, 2006, pages 316
WU ET AL., MOL. THER., vol. 18, 2010, pages 80
YAN ET AL., HUM. GENE THER., vol. 24, 2013, pages 786
YAN ET AL., HUM. GENE THER., vol. 26, 2015, pages 334
YAN ET AL., J. VIROL., vol. 76, 2002, pages 2043
YAN ET AL., J. VIROL., vol. 78, 2004, pages 2863
YAN ET AL., MOL. THER., vol. 21, 2013, pages 2181
ZABNER ET AL., AM J. PHYSIOL LUNG CELL MOL PHYSIOL., vol. 284, 2003, pages 844
ZHANG ET AL., MOL. THER., vol. 10, 2004, pages 990
ZHANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, 1998, pages 10158
ZIYING YAN ET AL: "Optimization of Recombinant Adeno-Associated Virus-Mediated Expression for Large Transgenes, Using a Synthetic Promoter and Tandem Array Enhancers", HUMAN GENE THERAPY, vol. 26, no. 6, 1 June 2015 (2015-06-01), US, pages 334 - 346, XP055308423, ISSN: 1043-0342, DOI: 10.1089/hum.2015.001 *

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11027000B2 (en) 2014-11-05 2021-06-08 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of Parkinson's disease
US11975056B2 (en) 2014-11-05 2024-05-07 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of Parkinson's disease
US10335466B2 (en) 2014-11-05 2019-07-02 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of parkinson's disease
US11542506B2 (en) 2014-11-14 2023-01-03 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US12123002B2 (en) 2014-11-14 2024-10-22 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US10920227B2 (en) 2014-11-14 2021-02-16 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US10597660B2 (en) 2014-11-14 2020-03-24 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US12071625B2 (en) 2014-11-14 2024-08-27 Voyager Therapeutics, Inc. Modulatory polynucleotides
US11198873B2 (en) 2014-11-14 2021-12-14 Voyager Therapeutics, Inc. Modulatory polynucleotides
US10570395B2 (en) 2014-11-14 2020-02-25 Voyager Therapeutics, Inc. Modulatory polynucleotides
US11697825B2 (en) 2014-12-12 2023-07-11 Voyager Therapeutics, Inc. Compositions and methods for the production of scAAV
US11702672B2 (en) 2016-02-08 2023-07-18 University Of Iowa Research Foundation Methods to produce chimeric adeno-associated virus/bocavirus parvovirus
US11684679B2 (en) 2016-03-07 2023-06-27 University Of Iowa Research Foundation AAV-mediated expression using a synthetic promoter and enhancer
US12084659B2 (en) 2016-05-18 2024-09-10 Voyager Therapeutics, Inc. Modulatory polynucleotides
US11193129B2 (en) 2016-05-18 2021-12-07 Voyager Therapeutics, Inc. Modulatory polynucleotides
US10584337B2 (en) 2016-05-18 2020-03-10 Voyager Therapeutics, Inc. Modulatory polynucleotides
US11951121B2 (en) 2016-05-18 2024-04-09 Voyager Therapeutics, Inc. Compositions and methods for treating Huntington's disease
US12173305B2 (en) 2016-05-26 2024-12-24 University Of Iowa Research Foundation cis and trans requirements for terminal resolution of human bocavirus 1
US11999965B2 (en) 2017-01-13 2024-06-04 University Of Iowa Research Foundation Bocaparvovirus small noncoding RNA and uses thereof
US11752181B2 (en) 2017-05-05 2023-09-12 Voyager Therapeutics, Inc. Compositions and methods of treating Huntington's disease
US11603542B2 (en) 2017-05-05 2023-03-14 Voyager Therapeutics, Inc. Compositions and methods of treating amyotrophic lateral sclerosis (ALS)
US11759506B2 (en) 2017-06-15 2023-09-19 Voyager Therapeutics, Inc. AADC polynucleotides for the treatment of Parkinson's disease
US12319929B2 (en) 2018-05-15 2025-06-03 Voyager Therapeutics, Inc. Compositions and methods for the treatment of Parkinson's disease
US12281321B2 (en) 2018-09-28 2025-04-22 Voyager Therapeutics, Inc. Frataxin expression constructs having engineered promoters and methods of use thereof
US20220241436A1 (en) * 2019-04-15 2022-08-04 University Of Iowa Research Foundation Compositions and methods for treatment of cystic fibrosis
JP2022529457A (en) * 2019-04-15 2022-06-22 ユニヴァーシティ オブ アイオワ リサーチ ファウンデーション Compositions and Methods for the Treatment of Cystic Fibrosis
JP7731801B2 (en) 2019-04-15 2025-09-01 ユニヴァーシティ オブ アイオワ リサーチ ファウンデーション Recombinant adeno-associated viruses for the treatment of cystic fibrosis
WO2020214672A1 (en) * 2019-04-15 2020-10-22 University Of Iowa Research Foundation Methods and compositions for transgene expression
JP2022529470A (en) * 2019-04-15 2022-06-22 ユニヴァーシティ オブ アイオワ リサーチ ファウンデーション Methods and compositions for transgene expression
JP2023126658A (en) * 2019-04-15 2023-09-07 ユニヴァーシティ オブ アイオワ リサーチ ファウンデーション Methods and compositions for transgene expression
CN114340683A (en) * 2019-04-15 2022-04-12 衣阿华大学研究基金会 Methods and compositions for transgene expression
CN114641318A (en) * 2019-04-15 2022-06-17 衣阿华大学研究基金会 Compositions and methods for treating cystic fibrosis
WO2020214668A1 (en) * 2019-04-15 2020-10-22 University Of Iowa Research Foundation Compositions and methods for treatment of cystic fibrosis
WO2022006253A3 (en) * 2020-06-30 2022-02-24 University Of Iowa Research Foundation Methods and compositions for administering recombinant viral vectors
EP4036238A1 (en) 2021-01-27 2022-08-03 The University Court of the University of Edinburgh Functional nucleic acid molecule and method
WO2022162361A1 (en) 2021-01-27 2022-08-04 The University Court Of The University Of Edinburgh Functional nucleic acid molecule and method
EP4582541A2 (en) 2021-01-27 2025-07-09 The University Court Of The University of Edinburgh Functional nucleic acid molecule and method
WO2024023530A1 (en) 2022-07-29 2024-02-01 The University Court Of The University Of Edinburgh Functional nucleic acid molecule and method

Also Published As

Publication number Publication date
IL261642B1 (en) 2025-09-01
CA3198936A1 (en) 2017-09-14
CA3016985A1 (en) 2017-09-14
AU2020289851A1 (en) 2021-01-28
EA201892006A1 (en) 2019-04-30
US20250381308A1 (en) 2025-12-18
MA43735A (en) 2018-11-28
CA3016985C (en) 2023-07-04
IL261642B2 (en) 2026-01-01
AU2023263461A1 (en) 2023-11-30
AU2020289851B2 (en) 2023-08-10
US20240066147A1 (en) 2024-02-29
US11684679B2 (en) 2023-06-27
IL322737A (en) 2025-10-01
EP3426787A1 (en) 2019-01-16
MX2018010842A (en) 2019-07-04
AU2017229347A1 (en) 2018-11-01
IL261642A (en) 2018-10-31
US20190083657A1 (en) 2019-03-21

Similar Documents

Publication Publication Date Title
US20240066147A1 (en) Aav-mediated expression using a synthetic promoter and enhancer
CN105579465B (en) Variant AAVs and compositions, methods and uses for gene transfer into cells, organs and tissues
US6936466B2 (en) Transcriptionally-activated AAV inverted terminal repeats (ITRs) for use with recombinant AAV vectors
TWI811219B (en) High activity regulatory elements
EP3999642A1 (en) Recombinase compositions and methods of use
JP7558575B2 (en) Genome editing by directed non-homologous DNA insertion using retroviral integrase-Cas9 fusion proteins
JP2022505381A (en) Compositions and Methods for Treating Alpha-1 Antitrypsin Deficiency
US7060497B2 (en) Adeno-associated viral vector-based methods and compositions for introducing an expression cassette into a cell
WO2024120528A1 (en) Improved system for producing rna-packaged aav particles
CA3218209A1 (en) Multiplex crispr/cas9-mediated target gene activation system
US7407801B2 (en) Truncated CMV promoters and vectors containing same
EP3787694A1 (en) Raav-mediated nuclease-associated vector integration (raav-navi)
CN112041437A (en) Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof
EA043850B1 (en) AAV-MEDIATED EXPRESSION USING A SYNTHETIC PROMOTER AND ENHANCER
US20250188490A1 (en) Methods of raav packaging
US20220380812A1 (en) Crispr/cas9 system as an agent for inhibition of polyoma jc infection
WO2026064428A2 (en) Capsid polypeptides and methods of use thereof

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref document number: 3016985

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2018/010842

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 201892006

Country of ref document: EA

WWE Wipo information: entry into national phase

Ref document number: 2017712339

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017712339

Country of ref document: EP

Effective date: 20181008

ENP Entry into the national phase

Ref document number: 2017229347

Country of ref document: AU

Date of ref document: 20170307

Kind code of ref document: A

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17712339

Country of ref document: EP

Kind code of ref document: A1

WWD Wipo information: divisional of initial pct application

Ref document number: 322737

Country of ref document: IL