WO2017155973A1 - Aav-mediated expression using a synthetic promoter and enhancer - Google Patents
Aav-mediated expression using a synthetic promoter and enhancer Download PDFInfo
- Publication number
- WO2017155973A1 WO2017155973A1 PCT/US2017/021124 US2017021124W WO2017155973A1 WO 2017155973 A1 WO2017155973 A1 WO 2017155973A1 US 2017021124 W US2017021124 W US 2017021124W WO 2017155973 A1 WO2017155973 A1 WO 2017155973A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- vector
- promoter
- enhancer
- synthetic
- cftr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
- A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
- A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14041—Use of virus, viral particle or viral elements as a vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14041—Use of virus, viral particle or viral elements as a vector
- C12N2750/14043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- Cystic fibrosis is a lethal, autosomal-recessive disorder that affects at least 30,000 people in the U.S. alone (O'Sullivan et al., 2009),
- the genetic basis of CF is mutation of a single gene that encodes the cystic fibrosis transmembrane conductance regulator (CFTR) (Riordan et al., 1989; Rommens et al., 1989). This results in a defective CFTR protein and consequent abnormalities in ihe transport of electrolytes and fluids in multiple organs (Welsh, 1990; Rowe et al., 2005).
- CF pulmonary disease which is characterized by viscous mucous secretions and chronic bacterial infections (Welsh, 1990).
- CF pulmonary disease With improvement in patient care and advances in pharmacologic therapies for CF, ihe lifespan of CF patients has steadily been extended over the past decades; however, the qualify of life for CF patients remains poor, and medications that alleviate pulmonary complications are expensive and efficacious only in select patients.
- lung disease is the major cause of mortality in CF patients and the genetic basis is a single-gene defect
- gene therapy for CF lung disease has the potential to cure all CF patients, regardless of their CFTR mutation. Thus, clinical trials for CF lung gene therapy were initiated in the mid-1990s.
- Adeno-associated virus (AAV), a member of the human parvovirus family, is a non-pathogenic virus that depends on helper viruses for its replication. For this reason, rAAV vectors are among the most frequently used in gene therapy pre-clinicai studies and clinical trials (Carter, 2005; Wu et al., 2006; Daya & Berns, 2008). Indeed, CF lung disease clinical trials with rAAV2 demonstrated both a good safety profile and long persistence of the viral genome in airway tissue (as assessed by biopsy) relative to other gene transfer agents (such as recombinant adenovirus).
- the AAV capsid can accommodate content in excess of its native DNA genome, its maximum packaging capacity is approximately 5.0 kb (Dong et al., 1996), and transgene expression from vectors exceeding this limit result in significantly reduced function (Wu et al,, 1993).
- the requirements for 300 bp of c/ ' s-elements from the AAV genome (two ITR sequences at the termini) and the 4,443 bp CFTR coding sequence there is little space left in the vector genome (257 bp) for a strong promoter and poiyadenyiation signal.
- the first-generation rAAV-CFTT ?
- AV2.tgCF AV2.tgCF
- CFTR minigene ⁇ create space for incorporating a better promoter into the rAAV vectors; this seemed justified based on earlier studies of CFTR gene function and structure indicating that the deletion of short, nonessential sequences from the C-terminus and regulatory domain (R-domasn) had only minimal effects on the chloride channel function of CFTR (Zhang et a!., 1998).
- One widely used CFTR minigene is CFTRAR, which lacks 156 bp encoding 52 amino acid residues (708-759) at the N-terminus of the R-domasn.
- This 156 bp deletion made it possible to package a rAAV CFTR expression vector 4.94 kb in length, with expression driven by a minimal CMV promoter (173 bp), into an AAV5 capsid (Ostedgaard et al., 2005). Additional efforts were aimed at developing AAV variant vectors of higher apical tropism, through directed evolution of the AAV capsid in polarized HAE ALi cultures (Li et al., 2009). However, these rAAV vectors did not provide efficient CFTR expression because the minimal CMV promoter did not function well in fully differentiated airway epitheiia.
- adeno- associated viral (rAAV) vector that can be used to express certain transgenes
- rAAV adeno- associated viral
- CF cystic fibrosis
- a recombinant vector such as a parvovirus vector, e.g., a recombinant adeno-associated virus (rAAV) vector or a bocavirus (BoV), such as a human BoV, vector, comprising a synthetic enhancer having a plurality of synthetic enhancer sequences operably linked to a promoter, e.g., a synthetic promoter, in one embodiment, each of the plurality of enhancers has the same sequence. In one embodiment, at least 2 of the plurality of enhancers have a different sequence.
- a parvovirus vector e.g., a recombinant adeno-associated virus (rAAV) vector or a bocavirus (BoV), such as a human BoV
- a synthetic enhancer having a plurality of synthetic enhancer sequences operably linked to a promoter, e.g., a synthetic promoter
- each of the plurality of enhancers has the same sequence.
- the synthetic enhancer is formed of different enhancer sequences, where each unique sequence may be represented once or more than once, and if more than once, may be in tandem or interspersed with other (different) enhancer sequences.
- the synthetic enhancer may have five different enhancer sequences, each represented twice in the synthetic enhancer, and the repeated sequences may be in tandem (or not).
- at least one of the enhancer sequences has a TP53 binding site, in one embodiment, at least one of the enhancer sequences has a CREB binding site, in one embodiment, at least one of the enhancer sequences has a NRF-1 binding site (CATGCGCAG).
- plurality has a combination of one or more TP53 binding sites, one or more NRF-1 binding sites, and/or one or more CREB, e.g., CREB7, binding sites.
- the enhancer sequence has a binding site shown in one of Figures 8A-8C. in one embodiment, the plurality has 2 up to 20 distinct synthetic enhancer sequences In one embodiment, at least one of the enhancer sequences has no more than 15 bp. in one embodiment, the plurality is up to about 150 nucleotides in length, e.g., from about 20, 30, 40, 50, 60, 70, 80, 90, 100,
- the synthetic enhancer comprises F1 , F5 or F10. in one embodiment, the enhancer has at least 80%, 85%, 90%, 92%, 95%, 98% or 99% nucleotide sequence identity to F1 , F5 or F10. in one embodiment, the linked promoter is a synthetic promoter. In one embodiment, the promoter is tg83. In one embodiment, the promoter is an AAV promoter.
- the promoter is a heterologous promoter, e.g., from a different virus or from a mammalian genome, in one embodiment, the promoter is operably linked to an open reading frame, e.g., a heterologous open reading frame, in one embodiment, the open reading frame encodes a prophylactic or a therapeutic gene product, e.g., cystic fibrosis transmembrane conductance regulator, a-antitrypsin, ⁇ -globin, ⁇ -globin, tyrosine hydroxylase, glucocerebrosidase, aryl sulfatase A, factor VIII, dystrophin or
- a prophylactic or a therapeutic gene product e.g., cystic fibrosis transmembrane conductance regulator, a-antitrypsin, ⁇ -globin, ⁇ -globin, tyrosine hydroxylase, glucocerebrosidase, aryl sulfatase A
- the combination of the plurality of enhancer sequences and the promoter is no more than 300 nucleotides in length, e.g., no more than 125, 150, 175, 200, 250, or 275 nucleotides in length, in one embodiment, the combination of the plurality of enhancer sequences and the promoter is less than 500 nucleotides in length.
- the vector is a parvovirus vector such as a rAAV vector, e.g., an AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, or AAV9 vector, or a human bocavirus vector, e.g., HBoV1 , HBoV2, HBoV3 or HBoV4, or an evolved AAV or HBoV vector that adapts a unique tropism, e.g., optionally one with slightly altered capsid sequences from known serotypes
- This disclosure also relates to an approach to screen tissue-specific as well as ubiquitous synthetic promoter/enhancer combinations in a step-wise fashion, in plasmids, proviral vectors, and rAAV vectors, which can be used in the application of rAAV gene therapy for the delivery of large transgene cassette.
- Examples of use include but are not limited to express 4.3 kb B-domain deleted Factor-VIII in muscle and/or liver for hemophilia A, or to deliver the 4.2 kb the gene-editing tool of
- Streptococcus pyogenes (SpCasQ) and a chimeric sgRNA together in any desired tissue and organ in vivo.
- recombinant parvovirus vector to infect ceils, e.g., mammalian cells such as ferret, canine, feline, bovine, equine, caprine, or porcine cells, or primate ceils, e.g., human cells, for example, administering a composition comprising the recombinant parvovirus vector to a mammal.
- ceils e.g., mammalian cells such as ferret, canine, feline, bovine, equine, caprine, or porcine cells
- primate ceils e.g., human cells
- the recombinant parvovirus genome may include an expression cassette encoding a heterologous gene product, e.g., which is a therapeutic protein such as cystic fibrosis transmembrane conductance regulator, ⁇ -antitrypsin, p-globin, ⁇ -globin, tyrosine hydroxylase, glucocerebrosidase, aryl sulfatase A, factor Vili, dystrophin, erythropoietin, alpha 1 -antitrypsin, surfactant protein SP-D, SP-A or SP-C, erythropoietin,, or a cytokine, e.g., IFN-alpha, IFNv, TNF, IL-1 , IL-17, o lL-8, or a prophylactic protein that is an antigen such as viral, bacterial, tumor or fungal antigen, or a neutralizing antibody or a fragment thereof that targets an epitope of an
- Figures 1A-1 D Effectiveness of synthetic oligonucleotide enhancers in augmenting activity of tg83-directed luciferase reporter plasmids in monolayer cultures.
- A Schematic structure of the reporter vectors used to screen the enhancer library. The transcriptional motifs of the synthetic tg83 promoter are indicated.
- FIGS 2A-2F Effectiveness of enhancers F1 , F5 and F10 in augmenting activity of the tg83 promoter in the context of proviral plasmids and rAAV.
- A) Effect of the AAV2 ITR on transcription from the tg83 promoter, as evaluated following transfection of A549 and primary airway ferret cells with pGL3-tg83 or pAV2-ig83luc. Data represent the mean (+/- SEM, N 3) relative luciferase activity (RLU) 24 hours post-transfection.
- FIGS 3A-3C Impact of (AAV-CFTR construct size on restoration of CFTR chloride currents in polarized CF airway epithelium.
- the ORF of full-length ferret CFTR (fCFTR) is 4455 bp.
- the 99 bp 3xHA tag was inserted between amino acid residues S90Q and 1901 , bringing iCFTR ⁇ HA) to 4554 bp.
- the fCFTRAR has a shortened ORF (4,296 bp); 53 amino acid residues (1708-1760, 159 bp) are deleted from the R-domain.
- iCFTRAR ⁇ HA is 4395 bp in length, having a 99 bp HA-tag insertion and a 159 bp deletion in the R-domain.
- Amiioride and DIDS were used to block ENaC-mediated sodium currents and non-CFTR chloride channels prior to addition of cAMP agonist (forskolin and IBMX), and GiyH101 was used to block CFTR-specific currents. Also (IBMX & Forsk) reflects the activation of CFTR-mediated chloride currents following induction with cAMP agonist, and Alsc (GlyH101) reflects the inhibition of CF77?-mediated chloride currents following addition of GlyH101 . C) Effects of vector size on rescue of chloride Isc currents. rAAV- CFTR vectors were increased by about 100 bp increments.
- FIGS 4A-4B Analyses of integrity of the viral genome by denaturing gel electrophoresis and slot blot analysis.
- (-) and (+) represent the probes hybridizing to the minus and positive strand of the single stranded rAAV genome.
- Hybridization was first conducted with the set of probes that hybridize to the minus strand, and then reprobed with the set of oligonucleotides that hybridize to the positive strand.
- FIG. 5 Effects of the F5 enhancer on CFTR currents generated by CF HAE following infection with rAAV vectors.
- CF HAE ALI were infected with AV2/2.tg83- fCFTRAR or AV2/2.F5tg83-f CFTRAR, at the indicated MOIs, from the apical or basolaterai surface.
- Proteasome inhibitors were co-administrated during the 16 hours infection period, isc measurements of the infected ALI cultures were conducted at 2 weeks post-infection. The mean (+/- SEM) Aisc (IBMX & Forsk) and Also (GlyH101) are shown with the N for independent transwel!s assays indicated. Mock-infected CF and non-CF HAE cultures are shown for reference.
- FIGS 8A-6B Effects of the F5 enhancer on CFTR currents and tg83-directed CFTR transcription following infection with rAAV vectors.
- CF HAE ALI v/ere infected with AV2/2.tg83-fC/ 773 ⁇ 4 ⁇ R or AV2/2.F5tg83-fCF7RAf? at an MGi of 2 x 10 4 DRP/celi from the basolaterai surface, in the presence of proteasome inhibitors.
- A) isc was measured in the infected ALI cultures at 3 and 10 days post-infection.
- A!sc (IBMX & Forsk) and A!se (GlyH101) values are presented.
- B) Values represent the (mean ⁇ SE , n 3) relative luciierase activity (RLU/pg protein).
- FIGS 8A-8W A-E) Binding sites in F5 which may be employed to prepare synthetic enhancers as described herein.
- F-P Binding sites in F10 which may be employed to prepare synthetic enhancers as described herein.
- Q-W Binding sites in F5tg83, which may be employed to prepare synthetic enhancers or promoter as described herein. SEQ ID NOs: 31 -68.
- FIGS 9A-D Gene transfer efficiency of AV.F5Tg83-hCFTRAR to the ferret trachea and lung.
- Three day old ferrets were infected with a 100 ⁇ . volume of 8 x 10 11 DRP of AV.F5Tg83-hCFTRAR in 500 ⁇ doxorubicin.
- Non-infected animals were given an equal volume of vehicle with doxorubicin.
- the entire lung and trachea were harvested and snap frozen in liquid nitrogen. Tissue was pulverized and mRNA and cDNA generated for Q-PCR of human and ferret CFTR.
- FIGS 10A-D AV.F5Tg83-hCFTRAR effectively transduces the mature ferret airways.
- Vector was delivered to the lung with a PennCentury microsprayer through tracheal intubation.
- Nasal delivery in the same animals was also performed using 100 ⁇ _ containing 1 .5 x 10 12 DRP with 25Q ⁇ doxorubicin by instillation of fluid.
- Mock-infected nasal delivery received PBS with 250 ⁇ doxorubicin.
- the lung lobes were harvested separately along with the trachea, carina, and nasal turbinates with surrounding adventitia. The tissues were snap frozen and pulverized samples were processed separately for mRNA and DNA.
- rAAV Gene therapy has been widely used in clinical trials since 1990s with many successful cases reported using viral or non-viral vectors to deliver therapeutic genes.
- rAAV is the most widely used one proven of high safety profile, broad tissue/organ tropism and persistence transgene expression.
- AAV is a small single stranded DNA virus of an inherently small 4.679 kb genome, thus the application of rAAV for gene therapy is restricted to delivering relative small transgenes.
- AAV capsid can house a rAAV genome slightly larger than its original size, 4.95 kb appears to be the maximal size for efficient transgene expression.
- One typical example is to deliver the CFTR gene (cystic fibrosis
- CFTR cystic fibrosis
- polyadenylation signal to direct the transcription of full-length CFTR cDNA.
- the first-generation rAA ⁇ f-CFTR vector (AV2.tgCF), relied on the cryptic promoter activity of the AAV2 ITR, inefficiently expressed CFTR in clinical trials.
- AV2.tg83-CF7 which uses an 83-bp synthetic promoter (tg83) was used to improve expression.
- this vector produced a 3-iold higher in cA P-mediated CI- currents in CF HAE AL! cultures than AV2.tgCF, this level of expression remains suboptimal for application in CF gene therapy. So, there is an immediate need for a strong short promoter to direct the CFTR expression in the AAV vector for CF gene therapy.
- rAAV to express the 4.3kb B- domain deleted Factor-Vill in muscle and/or liver for hemophilia gene therapy using rAAV, short promoter effective in muscle and liver is also needed.
- Another example is to deliver the CRiSPR/Cas9 system for gene editing.
- the recent development of CRiSPR/Cas9 gene editing technique promotes a new human gene therapy strategy by correcting a defect gene at pre-chosen sites without altering the endogenous regulation of gene of interest.
- This system consists of two key components: Cas9 protein and sgRNA, as well as a correction template when needed.
- rAAV can be used to deliver these elements in vivo to various target organs, but the co- delivery of Cas9 protein and the a chimeriG sgRNA in the same cell is required while the duai-AAV vector delivery system is low efficient.
- Staphylococcus aureus Cas9 (SaCas9), which is about 1 .0 kb smaller in size, fits together with its sgRNA and relevant expression cassettes within a single AAV vector, using short synthetic promoter allows for the additional incorporation of the gene correction template for an all-in-one rAAV vector in the application of gene editing-based gene therapy.
- short (less than 0.2 kb) synthetic enhancer/promoters provide a solution to solve the current problem of rAAV vector in delivering a large transgene cassette.
- This disclosure in one embodiment, relates to the use of a 183-bp F5tg83 synthetic enhancer/promoter to rAAV vectors to deliver effective CFTR expression in lung airway tissue for CF gene therapy.
- This disclosure in one embodiment, also provides an effective approach to screen and identify tissue-specific or ubiquitous synthetic promoter/enhancer combinations.
- enhancer activity differs by cell lines and state of cell differentiation, as well as is influenced by the AAV ITRs and by the sequence of gene of interest
- the screening was conducted in a step-wise fashion, e.g., in piasmids, proviral vectors, and rAAV vectors.
- the screening system includes a defined 83-mer synthetic core promoter (tg83p) and a set of random 100-mer synthetic sequence of potent enhancer activity.
- the screening approach can be used to screen the 100-mer synthetic sequences for their enhancer activity to enhance promoter transcription, e.g., the 83 bp tg83p promoter transcription, in different organ/tissue for different gene of interests, in a similar in a step-wise fashion: such as to direct the Factor VIII expression in muscle or liver, as well as to direct the Cas9 protein expression in any specific tissues or stem cells.
- tissue-specific expression the approach also can be used to identify an enhancer of ubiquitous effect to improve the tg83p promoter activity in a wide range of tissue/organ, through testing rAAV derived reporter gene
- a set of vectors containing the synthetic tg83 promoter linked with different synthetic sequences (about 100 bp) of potent enhancer activity was constructed for initial screening in monolayer (non-polarized) cultures of human airway cell lines and primary ferret airway cells, which as discussed below revealed that three of these synthetic enhancers (F1 , F5, and F10) significantly promoted transcription of a luciferase transgene from tg83p in the context of piasmid transfection.
- the F5tg83 promoter also produced the highest level of transgene expression in the ferret airway in vivo. Finally, the F5tg83 promoter was used the rfiAV-CFTR vector to direct the CFTR expression, the vector (AV.F5tg8ZCFTRAR) yielded an about 17-fold increase related to the enhancer-less vector (AV.tg83CF773 ⁇ 4 ) in vector derived CFTR mRNA transcription and significantly improved CI- currents in human CF ALI cultures.
- F5tg83, F1tg83 and F10tg83 were capable to direct strong transgene expression in human as well as non-human mammalian (such as ferret) airway cells.
- the robust F5tg83 promoter can be used in rAAV vector to deliver the 4.4 kb cystic fibrosis transmembrane conductance regulator (CFTR) for cystic fibrosis gene therapy.
- rAAV Vectors All rAAV vector stocks were generated in HEK293 cells triple piasmid co-transfection using an adenovirus-free system, and purified with two rounds of CsC! ultracentrifugation as reported in Yan ei ai. (2004).
- rAAV2 genomes were used and packaged into AAV2 or AAV1 capsid to generate rAAV2/2 and rAAV2/1 viruses, respectively.
- TaqMan reai-time PGR was used to quantify the physical titer (DNase resistant particles, DRP) of the purified viral stocks as described in Yan et al. (2008) and Ding et al. (2006).
- the PCR primer/probe set used to titer luciferase vectors was: 5'- TTTTTGAAGCGAAGGTTGTGG-3' (forward primer) (SEQ ID NO:1), 5'- CACACACAGTTCGCCTCTTTG-3' (reverse primer) (SEQ ID NO:2) and 5 -FAM- ATCTGGATACCGGGAAAACGCTGGGCGTTAAT-TA RA-3' probe) (SEQ ID NO:3); the primer/probe set used for ferret CFTR vectors was 5'-
- Viral DNA was extracted from 1 Q 9 DRP of AA V-CFTR vectors and resolved in 0.9% alkaline denatured agarose gel at 20 volts overnight in 50mM NaOH/1 mM EDTA buffer. Following transfer to a Nylon membrane, Southern blotting was performed with a 32 P-labeled CFTR probe to visualize the viral DNA. For examination of 5' end genome deletions in the oversized rAAV vectors, 3.33x10 s DRP of each virus (quantitated by TaqMan PCR with probe/primer set against iCFTR cDNA) was loaded into a slot blotting Nylon membrane.
- the blots were first hybridized to a set of three 32 P-iabeled oligonucleotide probes against the minus strand of the rAAV genome: at the 5' sequence of the tg83 promoter: taccctcgagaacggtgacgtg (SEQ ID NO:7); the center of ferret CFTR cDNA: ggagatgcgcctgtctcctggaatg (SEQ ID NQ:8): and the 3' sequence of the synthetic poiyA: gcatcgatcagagtgtgttggttttttgtgtg (SEQ ID NO:9). After exposure to X-fiim, the membranes were stripped of probe and hybridized again to another set of three 32 P-iabeled oligonucleotide probes
- NIH Imaged software was used to quantify the signal intensity of hybridization to determine the corresponding number of genomes detected by each probe with serial dilutions of the provirai plasmid as standards.
- DMEM Duibecco's modified Eagle medium
- Primary ferret airway cells were isolated and cultured as non-polarized monolayer or at an AL! to generate polarized epithe!ia as described in Liu et ai. (2007).
- Polarized primary HAE were generated from lung transplant airway tissue as described in Karp et al. (2002) by the Ceils and Tissue Core of The Center for Gene Therapy at the
- Proteasome inhibitors were supplied in the culture medium throughout the period of infection to polarized cells, at 40 ⁇ LLnL (N- Acetyl-L-leucine-L-leucine-L-norleucine) and 5 ⁇ doxorubicin in the case of polarized human, and 10 ⁇ LLnL and 2 ⁇ doxorubicin in the case of CuFi ALI cultures and ferret ALI cultures. Epithelia were exposed to the viruses and chemicals for 16 hours and then removed. At this time, the Millicell inserts were briefly washed with a small amount USG medium and fresh USG medium was added to the bottom chamber only. Doxorubicin was from Sigma (St, Louis, MO) and LLnL was from Boston Biochem (Cambridge, MA).
- rAAV Infection of Ferret Lungs All animal experimentation was performed according to protocols approved by the Institutional Animal Care and Use Committee of the University of Iowa, in vivo infection of ferret lungs was performed by intra-tracheal injection of a 300 ⁇ inoculum containing 2 x 10 M DRP of rAAV2/1 and 250 ⁇ doxorubicin. Prior to infection at 5 days of age, ferret kits were anesthetized by inhalation of a mixture of isofluorane and oxygen. At 8-day post-infection, ihe animals were euthanized with an overdose sodium pentobarbital intraperitoneal injection.
- the ferret trachea and lung cassette was immediately frozen in liquid nitrogen and then pulverized using a cryogenic tissue pulverizer. 1 mi of Passive Lysis Buffer (Promega, Madison, Wi) was added to the pulverized tissue to extract protein. After four freeze-thaw cycles, the tissue extract was centrifuged at 15,000 rpm for 5 minutes, and the clarified tissue extract was used for luciferase assays with a luciferase assay kit from Promega.
- Passive Lysis Buffer Promega, Madison, Wi
- Transepitheliai short circuit currents were measured using an epithelial voltage clamp (Model EC-825) and a self- contained Ussing chamber system (both purchased from Warner instruments, inc., Hamden, CT) as described in Liu et ai. (2007). Throughout the experiment the chamber was kept at 37°C, and the chamber solution was aerated.
- the basoiaterai side of the chamber was fiiied with buffered Ringer's solution containing 135 m NaCi, 1.2 mM CaC , 1 .2 mM MgC , 2.4 mM KH2PO4, 0.2 mM K2HPO4, and 5 mM Hepes, pH 7.4.
- the apical side of the chamber was filled with a low-chloride Ringer's solution in which 135 mM Na-gluconate was substituted for NaCI.
- Transepitheiial voltage was clamped at zero, with current pulses applied every 5 seconds and the short-circuit current recorded using a VGC MC8 multichannel voltage/current clamp (Physiologic instruments) with Quick DataAcq software.
- RNA from rAAV-infected ceils was prepared using the RNeasy
- RNA-specific method for PCR of the rAAV vector 6 was used to detect the vector-derived ferret CFTR mRNA.
- the 1 st -strand cDNA synthesis was primed with an adapter (lower case)-linked, vector-specific primer that targets the synthetic polyadenylation signal sequence (upper cases).
- the sequence of this primer is 5'- gcacgagggcgacugucaUGAUCGAUGCAUCUGAGCUCUUUAUUA-3' (SEQ ID NO:10), in which all dTs are replaced with dU.
- a ferret CFT/ -specific primer (5'- TGCAGATGAGGTTGGACTCA-3'; SEQ ID NO:1 1) was used for synthesis of the 2 nd strand.
- UNG uracyl-N-glycosylase
- TaqMan PCR contained the ferret CFTR sequence 5'-CAAGTCTCGCTCTCAAATTGC- 3' (SEQ ID NO:12), and the adapter sequence 5'-GCACGAGGGCGACTGTCA-3' (SEQ ID NO:13).
- the TaqMan probe used was 5'-FAM ⁇
- This library comprised all possible 10-mer DNA sequences, printed on microarrays as 10 tandem repeats (for a total length of 100 bases each).
- the best-performing 100-mer oligonucleotides enhanced the transcription of this 128 bp CMV IE minimal promoter to 75%-137% of that induced by the 600 bp wild type CMV IE promoter (Schlabach et al., 2010).
- tg83 a 83 bp synthetic promoter sequence (tg83) was used to express the full-length CFTR gene from a rAAV vector (AV2.tg83-CF77?), and it was found to produce higher transgene expression in CF HAE cultures than the cryptic promoter of the AAV2 !TR (Zhang et al,, 2009),
- the tg83 promoter consists of an ATF-1 /CREB site and an Sp1 -binding site from the promoter of the Na,K-ATPase ⁇ x1 subunit, and the TATA box and transcription start site from the CMV IE promoter.
- gaattgacgcatatattgacgcatattgacgcaaattgacgcaaattgacgcaagattgacgcaaattgagcgcaaatt gacgcaaattaattgacgcat (SEQ ID NO:16)
- the ig83 promoter was cloned into the promoter-less luciferase reporter piasmid pGL3-Basic Vector (Promega) to generate pGL3-tg83.
- a series of luciferase reporter expression plasmids were constructed, in which one of the eight 100- mer enhancers was placed in front of the tg83 promoter of pGL3-tg83 ( Figure 1A)
- Comparison of reporter expression from pGL3-tg83 and its enhancer-containing derivatives was conducted in monolayer (non-polarized) cultures of two human airway cell lines (A549 and IB3) and primary ferret airway cells ( Figures 1 B-1 D).
- pAV2-CMV-luc contains the wild type, 600 bp CMV IE enhancer-promoter
- pAV2-CBA-luc contains the CMV IE enhancer-chicken ⁇ -actin promoter, i.e., the CBA promoter
- the F5 element most efficiently enhances tq83-driven transcription in polarized human and ferret airway epithelia in vitro, as well as in the ferret airway in vivo.
- F1 , F5 and F10 enhancers were the most effective in activating tg83- d riven transcription in airway-ceil monolayer cultures, the abilities of these elements to promote transcription in the context of rAAV vector genomes was evaluated.
- Four rAAV proviral vectors harboring a luciferase expression cassette were constructed, with expression driven by tg83 (enhancer-less), F1tg83, F5tg83 or F10tg83.
- the pAV2-tg83- iCFTR proviral piasmid was used as the template vector for cloning, its promoter and the 5' portion of the iCFTR coding region were replaced with the 2.1 or 2.2 kb luciferase expression cassette.
- the genome size was 4.75 kb in the case of rAV2.tg83luc, and 4.85 kb for the enhancer-containing vectors. This design was used for two reasons. First, retaining as much of the ICFTR sequence as possible ensured that the vector genome size would be similar to those of the rAAV-CFTR expression vectors that would ultimately be generated. Second, retaining regions of the iCFTR cDNA maximized the potential influences of the ferret CFTR sequence on enhancer function.
- reporter expression from pGL3-tg83 and pAV2-tg83iuc plasmids was compared following transfection into monolayer cultures of A549 and primary ferret airway cells.
- pAV2-tg83iuc piasmid was found to be 2.5-fold (in A549) and 2-fold (in primary ferret airway cells) more transcriptionally active than the pGL3-based plasmids ( Figure 2A), suggesting that inclusion of the AAV ITR and/or the 1CFTR stuffer sequences had an overall positive effects on activity of the tg83 promoter. Then reporter-gene expression for pAV2-F1 tg83luc, pAV2-F5tg83luc, pAV2-F1 Qig83luc, and pAV-tg83luc piasmids was compared.
- the F1 , F5 and F10 enhancers significantly improved transcription from the tg83 promoter (about 10- to 19-fold) in both cell types ( Figure 2B).
- the effectiveness of nearly all enhancers was significantly reduced (about 3- to 18-fold) within the rAAV provira! piasmids when compared to pGL3-tg83 piasmids lacking ITRs and the CFTR sequence ( Figure 2B solid bars vs. Figure 1 B; Figure 2B open bars vs Figure 1 D). This suggests that the sequences from the AAV ITR and/or portions of the ferret CFTR cDNA have an overall negative impact on enhancer function.
- the F1 enhancer was most significantly influenced, with its activity in the rAAV proviral plasmid decreased by 18.1 -fold, whereas those of the F5 and F10 enhancers decreased by only 8.2-fold and 3.8-fold, respectively.
- the F1 and F5 enhancers had 4.4 ⁇ foid and 2.8-fold decreased activity, respectively, in the context of the proviral plasmid, whereas the function of F10 was slightly enhanced (about 40%).
- the differentiated state of ferret airway epithelial cells appeared to dramatically influence expression from the various enhancer/tg83 promoter combinations in the context of rAAV transduction; the F5 enhancer more effectively enhanced tg83 expression in the polarized epithelium (Figure 2E; 57.5-fold) than in undifferentiated monolayers ( Figure 2B; 16.6-fold); the F1 enhancer only marginally increased activity of the tg83 promoter in polarized cells, but increased transgene expression 13.8-fold in monolayer ceils.
- a narrow limit for rAAV genome size significantly influences functionality of rAA V-CF7R vectors while not altering packaging efficiency.
- the size of the expected AV.tg83fCFT genome if fully packaged is 4.937 kb
- Polarized CF HAE Two rAAV2 vectors were produced (AV2/2.tg83-fCF7R and AV2/2.tg83-fCF7f?-HA; Figure 3A), and their ability to generate CFT -mediated chloride currents was evaluated in polarized CF HAE.
- Vector yields for the two viruses were nearly equivalent (AV2/2,tg83-fCF7R about 5 x 10 9 DRP/fxL and AV2/2.tg83-fCF7R(HA) about 3 x 10 9 DRP/ ⁇ ).
- Polarized CF HAE were cultured at an ALI and infected at the relatively high multiplicity of infection (MOi) of about 10 5 DRP/celi (10 11 DRP of each rAAV2 vector per insert).
- FIG. 3B shows a typical Isc trace following infection of CF HAE with AV2/2.tg83-fCF7R or AV2/2.tg83-fCF7 : ?-HA.
- Amiioride and DIDS were first applied to block non-CFT chloride channels and ENaC-mediated sodium currents, and then cA P agonists (iB X and forskolin) were used to induce CFTR activity.
- CFTRAR human CFTR minigene with a 158 bp partial deletion of the R-domain (encoding amino acids 708-759) has been reported to retain most of the chloride-channel activity of the full-length protein (Ostedgaard et a!,, 2002; Ostedgaard et a!. , 201 1 ).
- a 1CFTRAR minigene was created by deleting the 159 bp homologous sequence encoding amino acids 708-780 at the corresponding position of the human protein, and produced two additional vectors: AV2/2.tg83-f CFTRAR (4.778 kb) and AV2/2.tg83-fCFT : ?AR(HA) (4.877 kb).
- This pair of vectors allowed for the examination not only the function of the 1CFTR minigene in CF HAE ALI cultures, but also the impact of the HA-iag insertion in the 1CFTR gene.
- Analysis of AISCIBMX & Forek and Alscgiyn responses for these two viruses demonstrated that both AV2/2.tg83-fCF77 : ?
- AV2/2.tg83-fCFTf?(HA) produced substantial CFTR-mediated CI " currents following infection of the CF HAE ALI cultures ( Figure 3C).
- the HA-tagged form produced about 20% less CI " current than AV2/2.tg83-fCFT ?AR, This finding is consistent with rAAV vectors of 4.88 kb having only about 25% of the functional activity of vectors 4.68 kb (Dong et a!., 1996).
- the HA-tag may itself influence CFTR function in the context of the R-domain deletion, although in the context of full- length CFTR this ECL4 HA-tag has no impact on CI " channel function (Glozman et ai.
- the synthetic F5tg83 promoter improves rAAV-mediated CF7R complementation.
- AV2/2.F5tg83-f CFTRAR following apical infection, but in this case the efficiency of transduction was significantly lower, as previously reported for this serotype.
- AV2/2.F5tg83-fCF7RAR produced 89% of the CFTR current generated by this vector at a 5-fold higher MOI, suggesting that complementation of CFTR function approached saturation in the latter case.
- RNA-specific reverse transcriptase PGR RNA-specific reverse transcriptase PGR
- rAAV vectors have attracted considerable interest with respect to human gene therapy, but its inherently small genome (4.679 kb) is a significant challenge for the delivery of large genes such as CFTR.
- CFTR large genes
- several laboratories have attempted to rationally design short enhancers and promoters for use in rAAV vectors, this approach has yet to yield robust expression of CFTR in the airway.
- an entirely empirical approach was taken by screening synthetic enhancers for their effectiveness in the delivery of reporter gene expression in step-wise fashion - in plasmids, proviral vectors, and viral vectors.
- AAS/-CFTR vector instead employed a short synthetic promoter and poiy-A signal, and small deletions within these short transcriptional regulatory elements would be expected to greatly influence gene expression. Since DNase resistant particle titer is typically used to confirm effective packaging of rAAV genomes, small 5'-end deletions could have a significant impact on functionality of oversized rAAV vectors.
- a 100 bp synthetic enhancer (F5) was identified that significantly improves the transcriptional activity of an 83 bp synthetic promoter (tg83), in polarized cultures of both primary human and ferret airway epithelial cells, as well as in ferret lung and trachea in vivo.
- the ferret CFTR minigene lacking a 53 amino acid portion of the R domain (fCFTRAR) retained about 70% of wild type iCFTR function, similar to the 80% function retained by a previously reported, analogous hCFTRAR construct (Ostedgaard et al., 2002).
- CFTR currents could reflect self-limiting cell biology (e.g., control over the total amount of CFTR on the plasma membrane), or aberrant trafficking of CFTR to the basolateral membrane at higher levels of expression (Farmen et al., 2005).
- a rAAV-CFTR vector was generated that provides high-level expression suitable for use in lung gene therapy studies in the CF ferret model.
- small synthetic enhancer/promoter combination can be used in rAAV vector to deliver effective transgene expression of a large transgene expression; in this study, the gene is CFTR.
- the enhancer activity differs by cell lines and state of cell differentiation, as well as is influenced by the AAV !TRs and by the sequence of gene of interest.
- the effects of an enhancer in the context of plasmid transfection may be different from that in the context of rAAV transduction.
- the in vivo effects of a particular enhancer may not be predictable from its behaviors demonstrated in culture cell lines. This, the screening needs to be conducted in different ceil/tissue levels and in a step-wise fashion - in plasmids, provirai vectors, and rAAV vectors to warrant the success.
- F1 , F5, and F10 Three of synthetic enhancers (F1 , F5, and F10) were found significantly increase the transcription of tg83p for luciferase transgene in the context of plasmid transfection.
- the F5tg83 promoter the 183 bp combination of F5 enhancer and fg83p, was the most efficient promoter in human and ferret ALI cultures, leading to 19.8-fold and 57.5-fold increases reporter expression, respectively, over the enhancer-less counterpart.
- the F5tg83 promoter also produced the highest level of transgene expression in the ferret airway in vivo.
- F5tg83 promoter When used to transcribe the 4.2 kb CFTR minigene (CFTRAR) in a rAAV vector, it yielded an about 17-fold increase in vector derived CFTR mRNA transcription and significantly improved CI " currents in human CF ALI cultures, compared to the vector using tg83p only.
- CFTRAR 4.2 kb CFTR minigene
- the enhancer/promoter combinations for lung epithelium may not necessarily be as usef ul for other organs/tissue.
- F5tg83 demonstrated the strongest promoter activity in pancreas, gallbladder and liver, whereas F10tg83 outperformed F5tg83 in small intestine ( Figures 7A-7B).
- the screen approach can be used for any desired cell types, tissues and organs in vitro and in vivo.
- short enhancer elements about 100-mer synthetic oligonucleotide sequences consisting of 10-mer repeats
- IE immediate-early
- tg83 promoter and 100 bp synthetic enhancers were tested, and one designated as F5 efficiently was found to enhance the transcription from the tg83 promoter in polarized airway ceils (in vitro) derived from both humans and ferrets, as well as in the ferret airway (in vivo).
- F5tg83 promoter and the ferret CFTR minigene of partial deletion at R domain iCFTRAR
- a rAAV vector AV2/2.F5tg83-fCFTRAR
- AV,F5Tg83-hCFTRAR was tested for hCFTR expression in the newborn and mature ferret airway.
- An endpoint of these analyses was the ratio of transgene-derived human CFTR (hCFTR) to that of endogenous ferret CFTR (fCFTR) mRNA. in 3 day old newborn ferrets ( Figure 9), AV.F5Tg83-CFTRAR led to 240% greater expression of human CFTR compared with endogenous (ferret) CFTR following gene delivery to the lung.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Confectionery (AREA)
Abstract
Description
Claims
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2017229347A AU2017229347A1 (en) | 2016-03-07 | 2017-03-07 | AAV-mediated expression using a synthetic promoter and enhancer |
| CA3016985A CA3016985C (en) | 2016-03-07 | 2017-03-07 | Aav-mediated expression using a synthetic promoter and enhancer |
| IL261642A IL261642B2 (en) | 2016-03-07 | 2017-03-07 | Aav-mediated expression using a synthetic promoter and enhancer |
| IL322737A IL322737A (en) | 2016-03-07 | 2017-03-07 | Aav-mediated expression using a synthetic promoter and enhancer |
| EA201892006A EA201892006A1 (en) | 2016-03-07 | 2017-03-07 | AAV-MEDIATED EXPRESSION USING THE SYNTHETIC PROMOTER AND ENCHANSER |
| EP17712339.5A EP3426787A1 (en) | 2016-03-07 | 2017-03-07 | Aav-mediated expression using a synthetic promoter and enhancer |
| US16/082,767 US11684679B2 (en) | 2016-03-07 | 2017-03-07 | AAV-mediated expression using a synthetic promoter and enhancer |
| MX2018010842A MX2018010842A (en) | 2016-03-07 | 2017-03-07 | Aav-mediated expression using a synthetic promoter and enhancer. |
| AU2020289851A AU2020289851B2 (en) | 2016-03-07 | 2020-12-18 | Aav-mediated expression using a synthetic promoter and enhancer |
| US18/139,661 US20240066147A1 (en) | 2016-03-07 | 2023-04-26 | Aav-mediated expression using a synthetic promoter and enhancer |
| AU2023263461A AU2023263461A1 (en) | 2016-03-07 | 2023-11-08 | Aav-mediated expression using a synthetic promoter and enhancer |
| US19/183,490 US20250381308A1 (en) | 2016-03-07 | 2025-04-18 | Aav-mediated expression using a synthetic promoter and enhancer |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662304656P | 2016-03-07 | 2016-03-07 | |
| US62/304,656 | 2016-03-07 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US16/082,767 A-371-Of-International US11684679B2 (en) | 2016-03-07 | 2017-03-07 | AAV-mediated expression using a synthetic promoter and enhancer |
| US18/139,661 Division US20240066147A1 (en) | 2016-03-07 | 2023-04-26 | Aav-mediated expression using a synthetic promoter and enhancer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2017155973A1 true WO2017155973A1 (en) | 2017-09-14 |
Family
ID=58361143
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2017/021124 Ceased WO2017155973A1 (en) | 2016-03-07 | 2017-03-07 | Aav-mediated expression using a synthetic promoter and enhancer |
Country Status (9)
| Country | Link |
|---|---|
| US (3) | US11684679B2 (en) |
| EP (1) | EP3426787A1 (en) |
| AU (3) | AU2017229347A1 (en) |
| CA (2) | CA3016985C (en) |
| EA (1) | EA201892006A1 (en) |
| IL (2) | IL261642B2 (en) |
| MA (1) | MA43735A (en) |
| MX (1) | MX2018010842A (en) |
| WO (1) | WO2017155973A1 (en) |
Cited By (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10335466B2 (en) | 2014-11-05 | 2019-07-02 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of parkinson's disease |
| US10570395B2 (en) | 2014-11-14 | 2020-02-25 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US10584337B2 (en) | 2016-05-18 | 2020-03-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US10597660B2 (en) | 2014-11-14 | 2020-03-24 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| WO2020214672A1 (en) * | 2019-04-15 | 2020-10-22 | University Of Iowa Research Foundation | Methods and compositions for transgene expression |
| WO2020214668A1 (en) * | 2019-04-15 | 2020-10-22 | University Of Iowa Research Foundation | Compositions and methods for treatment of cystic fibrosis |
| WO2022006253A3 (en) * | 2020-06-30 | 2022-02-24 | University Of Iowa Research Foundation | Methods and compositions for administering recombinant viral vectors |
| EP4036238A1 (en) | 2021-01-27 | 2022-08-03 | The University Court of the University of Edinburgh | Functional nucleic acid molecule and method |
| US11603542B2 (en) | 2017-05-05 | 2023-03-14 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US11684679B2 (en) | 2016-03-07 | 2023-06-27 | University Of Iowa Research Foundation | AAV-mediated expression using a synthetic promoter and enhancer |
| US11697825B2 (en) | 2014-12-12 | 2023-07-11 | Voyager Therapeutics, Inc. | Compositions and methods for the production of scAAV |
| US11702672B2 (en) | 2016-02-08 | 2023-07-18 | University Of Iowa Research Foundation | Methods to produce chimeric adeno-associated virus/bocavirus parvovirus |
| US11752181B2 (en) | 2017-05-05 | 2023-09-12 | Voyager Therapeutics, Inc. | Compositions and methods of treating Huntington's disease |
| US11759506B2 (en) | 2017-06-15 | 2023-09-19 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| WO2024023530A1 (en) | 2022-07-29 | 2024-02-01 | The University Court Of The University Of Edinburgh | Functional nucleic acid molecule and method |
| US11951121B2 (en) | 2016-05-18 | 2024-04-09 | Voyager Therapeutics, Inc. | Compositions and methods for treating Huntington's disease |
| US11999965B2 (en) | 2017-01-13 | 2024-06-04 | University Of Iowa Research Foundation | Bocaparvovirus small noncoding RNA and uses thereof |
| US12173305B2 (en) | 2016-05-26 | 2024-12-24 | University Of Iowa Research Foundation | cis and trans requirements for terminal resolution of human bocavirus 1 |
| US12281321B2 (en) | 2018-09-28 | 2025-04-22 | Voyager Therapeutics, Inc. | Frataxin expression constructs having engineered promoters and methods of use thereof |
| US12319929B2 (en) | 2018-05-15 | 2025-06-03 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of Parkinson's disease |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014168953A1 (en) * | 2013-04-08 | 2014-10-16 | University Of Iowa Research Foundation | Chimeric adeno-associated virus/ bocavirus parvovirus vector |
Family Cites Families (143)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4487934A (en) | 1980-06-06 | 1984-12-11 | Hoechst-Roussel Pharmaceuticals Inc. | Method of preparing poly-substituted acylbenzenes |
| US4501729A (en) | 1982-12-13 | 1985-02-26 | Research Corporation | Aerosolized amiloride treatment of retained pulmonary secretions |
| DE3326472A1 (en) | 1983-07-22 | 1985-02-14 | Hoechst Ag, 6230 Frankfurt | NEW INSULIN DERIVATIVES, METHOD FOR THE PRODUCTION AND USE THEREOF AND PHARMACEUTICAL AGENTS FOR TREATING THE DIABETES MELLITUS |
| ATE39691T1 (en) | 1984-04-06 | 1989-01-15 | Zambon Spa | OPTICALLY EFFECTIVE KETALS, PROCESSES FOR THEIR PREPARATION AND THEIR USE IN THE SYNTHESIS OF ALPHA-ARYL CANONIC ACIDS. |
| US5658772A (en) | 1989-12-22 | 1997-08-19 | E. I. Du Pont De Nemours And Company | Site-specific recombination of DNA in plant cells |
| KR930701992A (en) | 1990-10-05 | 1993-09-08 | 웨인 알.조운즈 | How to get rid of mucus secretions that remain in the lungs of patients |
| US5173414A (en) | 1990-10-30 | 1992-12-22 | Applied Immune Sciences, Inc. | Production of recombinant adeno-associated virus vectors |
| US5292498A (en) | 1991-06-19 | 1994-03-08 | The University Of North Carolina At Chapel Hill | Method of treating lung disease with uridine triphosphates |
| US6083713A (en) | 1992-08-31 | 2000-07-04 | Bristol-Myers Squibb Company | Cloning and expression of βAPP-C100 receptor (C100-R) |
| US5478745A (en) | 1992-12-04 | 1995-12-26 | University Of Pittsburgh | Recombinant viral vector system |
| US5869305A (en) | 1992-12-04 | 1999-02-09 | The University Of Pittsburgh | Recombinant viral vector system |
| US5686436A (en) | 1993-05-13 | 1997-11-11 | Hiv Diagnostics, Inc. | Multi-faceted method to repress reproduction of latent viruses in humans and animals |
| US5512269A (en) | 1993-06-09 | 1996-04-30 | Burroughs Wellcome, Co. | Method of treating retained pulmonary secretions |
| US5498531A (en) | 1993-09-10 | 1996-03-12 | President And Fellows Of Harvard College | Intron-mediated recombinant techniques and reagents |
| WO1995013365A1 (en) | 1993-11-09 | 1995-05-18 | Targeted Genetics Corporation | Generation of high titers of recombinant aav vectors |
| US5750398A (en) | 1993-11-30 | 1998-05-12 | David C. Johnson | Vector, element and method for inhibiting immune recognition |
| AU1846695A (en) | 1994-02-16 | 1995-09-04 | Idun Pharmaceuticals | Methods for controlling free radical generation by inflammatory cells |
| US5604090A (en) | 1994-06-06 | 1997-02-18 | Fred Hutchinson Cancer Research Center | Method for increasing transduction of cells by adeno-associated virus vectors |
| US5656256A (en) | 1994-12-14 | 1997-08-12 | The University Of North Carolina At Chapel Hill | Methods of treating lung disease by an aerosol containing benzamil or phenamil |
| US5843742A (en) | 1994-12-16 | 1998-12-01 | Avigen Incorporated | Adeno-associated derived vector systems for gene delivery and integration into target cells |
| US6281010B1 (en) | 1995-06-05 | 2001-08-28 | The Trustees Of The University Of Pennsylvania | Adenovirus gene therapy vehicle and cell line |
| US5635160A (en) | 1995-06-07 | 1997-06-03 | The University Of North Carolina At Chapel Hill | Dinucleotides useful for the treatment of cystic fibrosis and for hydrating mucus secretions |
| US5853716A (en) | 1995-07-28 | 1998-12-29 | Yale University | Genetically engineered chimeric viruses for the treatment of diseases associated with viral transactivators |
| US5628984A (en) | 1995-07-31 | 1997-05-13 | University Of North Carolina At Chapel Hill | Method of detecting lung disease |
| CA2230195A1 (en) | 1995-08-21 | 1997-02-27 | Duke University | A method to increase the density of antigen on antigen presenting cells |
| US5801030A (en) | 1995-09-01 | 1998-09-01 | Genvec, Inc. | Methods and vectors for site-specific recombination |
| US5855918A (en) | 1995-09-12 | 1999-01-05 | Genentech, Inc. | Cystic fibrosis therapy |
| US6083702A (en) | 1995-12-15 | 2000-07-04 | Intronn Holdings Llc | Methods and compositions for use in spliceosome mediated RNA trans-splicing |
| ATE354957T1 (en) | 1995-12-15 | 2006-03-15 | Intronn Inc | THERAPEUTIC MOLECULES OBTAINED BY TRANS-CLIPATION |
| DE19605279A1 (en) | 1996-02-13 | 1997-08-14 | Hoechst Ag | Target cell-specific vectors for the introduction of genes into cells, drugs containing such vectors and their use |
| US6420347B1 (en) | 1997-03-27 | 2002-07-16 | Inspire Pharmaceuticals, Inc. | Method of treating ciliary dyskinesia with uridine triphosphates and related compounds |
| US5939460A (en) | 1996-07-08 | 1999-08-17 | Idun Pharmaceuticals, Inc. | Method of inhibiting NADPH oxidase |
| JP2001500497A (en) | 1996-09-06 | 2001-01-16 | トラステイーズ・オブ・ザ・ユニバーシテイ・オブ・ペンシルベニア | Methods of gene therapy directed by recombinant adeno-associated virus |
| WO1998009524A1 (en) | 1996-09-06 | 1998-03-12 | Chiron Corporation | Methods and compositions for liver specific delivery of therapeutic molecules using recombinant aav vectors |
| US6110744A (en) | 1996-11-13 | 2000-08-29 | Board Of Regents, The University Of Texas System | Diminishing viral gene expression by promoter replacement |
| AU5588298A (en) | 1996-12-02 | 1998-06-29 | Cell Genesys, Inc. | Adeno-associated viral vector-mediated delivery of dna to cells of the liver |
| US6153436A (en) | 1997-01-10 | 2000-11-28 | The Board Of Trustees Of The University Of Arkansas | Method of gene delivery using wildtype adeno associated viral (AAV) vectors with insertions |
| US6287569B1 (en) | 1997-04-10 | 2001-09-11 | The Regents Of The University Of California | Vaccines with enhanced intracellular processing |
| FR2763845B1 (en) | 1997-05-30 | 2003-04-18 | Centre Nat Rech Scient | ANTI-CANCER PRODUCTS FOR THE TREATMENT OF MUCOVISCIDOSIS |
| US6156303A (en) | 1997-06-11 | 2000-12-05 | University Of Washington | Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom |
| US6037177A (en) | 1997-08-08 | 2000-03-14 | Cell Genesys, Inc. | Method for increasing the efficiency of recombinant AAV production |
| EP1011688B1 (en) | 1997-08-29 | 2005-02-02 | The University of North Carolina at Chapel Hill | Use of uridine 5'-diphosphate and analogs thereof for the treatment of lung diseases |
| WO1999018227A1 (en) | 1997-10-08 | 1999-04-15 | Advanced Research And Technology Institute | Chimeric parvovirus-based recombinant vector system that specifically targets the erythroid lineage |
| US6642051B1 (en) | 1997-10-21 | 2003-11-04 | Targeted Genetics Corporation | Amplifiable adeno-associated virus(AAV) packaging cassettes for the production of recombinant AAV vectors |
| US6346415B1 (en) * | 1997-10-21 | 2002-02-12 | Targeted Genetics Corporation | Transcriptionally-activated AAV inverted terminal repeats (ITRS) for use with recombinant AAV vectors |
| AU756827B2 (en) | 1997-10-21 | 2003-01-23 | Targeted Genetics Corporation | Transcriptionally-activated AAV inverted terminal repeats (ITRs) for use with recombinant AAV vectors |
| NZ505325A (en) | 1997-12-23 | 2003-07-25 | Crucell Holland B | Adeno-associated virus and adenovirus chimeric recombinant viruses useful for the integration of foreign genetic information into the chromosomal dna of target cells |
| US6436392B1 (en) | 1998-05-20 | 2002-08-20 | University Of Iowa Research Foundation | Adeno-associated virus vectors |
| JP4633927B2 (en) | 1998-05-22 | 2011-02-16 | インスパイアー ファーマシューティカルズ,インコーポレイティド | Therapeutic dinucleotides and derivatives |
| WO1999061601A2 (en) | 1998-05-28 | 1999-12-02 | The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Aav5 vector and uses thereof |
| IL128017A0 (en) | 1998-07-22 | 1999-11-30 | Technion Res & Dev Foundation | Method for detecting protein-protein interactions and a kit therefor |
| US6290951B1 (en) | 1998-08-01 | 2001-09-18 | Alfacell Corporation | Alteration of the cell cycle in vivo, and particularly for inducing apoptosis of tumor cells |
| ES2140354B1 (en) | 1998-08-03 | 2000-11-01 | S A L V A T Lab Sa | IMIDAZO (1,2A) AZINAS SUBSTITUTED AS SELECTIVE INHIBITORS OF COX-2. |
| US6200560B1 (en) | 1998-10-20 | 2001-03-13 | Avigen, Inc. | Adeno-associated virus vectors for expression of factor VIII by target cells |
| EP1143896B1 (en) | 1998-10-20 | 2006-12-13 | The University of North Carolina at Chapel Hill | Methods of hydrating the nasal mucosal surface |
| US6221349B1 (en) | 1998-10-20 | 2001-04-24 | Avigen, Inc. | Adeno-associated vectors for expression of factor VIII by target cells |
| AU780231B2 (en) | 1998-11-10 | 2005-03-10 | University Of North Carolina At Chapel Hill, The | Virus vectors and methods of making and administering the same |
| AU1344400A (en) | 1998-11-18 | 2000-06-05 | Incyte Pharmaceuticals, Inc. | Inflammation-associated genes |
| US6855549B1 (en) | 1998-11-23 | 2005-02-15 | The University Of Iowa Research Foundation | Methods and compositions for increasing the infectivity of gene transfer vectors |
| US6926911B1 (en) | 1998-12-22 | 2005-08-09 | The University Of North Carolina At Chapel Hill | Compounds and methods for the treatment of airway diseases and for the delivery of airway drugs |
| US6512102B1 (en) | 1998-12-31 | 2003-01-28 | Chiron Corporation | Compositions and methods of diagnosis and treatment using casein kinase I |
| EP1153612A4 (en) | 1999-02-10 | 2003-06-18 | Takashi Tsuruo | ANTI-CANCER AGENT POTENTIALIZERS |
| US6306663B1 (en) | 1999-02-12 | 2001-10-23 | Proteinex, Inc. | Controlling protein levels in eucaryotic organisms |
| US6893865B1 (en) | 1999-04-28 | 2005-05-17 | Targeted Genetics Corporation | Methods, compositions, and cells for encapsidating recombinant vectors in AAV particles |
| CA2270795A1 (en) | 1999-05-05 | 2000-11-05 | Gestilab Inc. | Neuroprotective compositions and uses thereof |
| US7122335B1 (en) | 1999-06-08 | 2006-10-17 | University Of Iowa Research Foundation | Compounds and methods to enhance rAAV transduction |
| JP4969002B2 (en) | 1999-06-08 | 2012-07-04 | ユニバーシテイ・オブ・アイオワ・リサーチ・フアウンデーシヨン | Compounds and methods for increasing rAAV transduction |
| HK1047091B (en) | 1999-07-19 | 2008-07-04 | University Of North Carolina At Chapel Hill | Pharmacologically active compounds with two covalently linked active principles (sodium channel blocker/p2y2 receptor agonist) for the treatment of mucosal surfaces |
| US6475537B1 (en) | 2000-07-27 | 2002-11-05 | Rhodia Inc. | Hops acid antibacterial compositions |
| CA2379166C (en) | 1999-08-09 | 2013-03-26 | Targeted Genetics Corporation | Enhancement of expression of a single-stranded, heterologous nucleotide sequence from recombinant viral vectors by designing the sequence such that it forms instrastrand base pairs |
| US6416759B1 (en) | 1999-09-30 | 2002-07-09 | The Regents Of The University Of California | Antiproliferative Sgk reagents and methods |
| EP1224313A1 (en) | 1999-10-07 | 2002-07-24 | University of Iowa Research Foundation | Adeno-associated viruses and uses thereof |
| AU784420B2 (en) | 1999-10-07 | 2006-03-30 | University Of Iowa Research Foundation, The | Adeno-associated viruses and uses thereof |
| US7241447B1 (en) | 1999-10-07 | 2007-07-10 | University Of Iowa Research Foundation | Adeno-associated virus vectors and uses thereof |
| JP2003511082A (en) | 1999-10-12 | 2003-03-25 | ザ・ユニヴァーシティ・オヴ・ノース・キャロライナ・アト・チャペル・ヒル | Adeno-associated virus vector encoding factor VIII and uses thereof |
| AU7895700A (en) | 1999-10-15 | 2001-04-30 | Dalhousie University | Method and vector for producing and transferring trans-spliced peptides |
| US20020132770A1 (en) | 1999-10-27 | 2002-09-19 | Caplan Michael T. | Conductance of improperly folded proteins through the secretory pathway and related methods for treating disease |
| AU2001240018A1 (en) | 2000-03-03 | 2001-09-17 | The Board Of Trustees Of The Leland Stanford Junior University | Adeno-associated viral compositions and methods |
| CA2373110A1 (en) | 2000-03-14 | 2001-09-20 | Neurologix, Inc. | Production of chimeric capsid vectors |
| CA2302627A1 (en) | 2000-03-23 | 2001-09-23 | Rashmi Kothary | Constructs comprising the enac promoter sequence and a reporter gene for screening pharmaceuticals |
| US20020076754A1 (en) | 2000-04-20 | 2002-06-20 | Liangwu Sun | Overcoming AAV vector size limitation through viral DNA hetero-dimerization |
| US7056502B2 (en) | 2000-04-28 | 2006-06-06 | The Trustees Of The University Of Pennsylvania | Recombinant aav vectors with AAV5 capsids and AAV5 vectors pseudotyped in heterologous capsids |
| ATE318923T1 (en) | 2000-06-01 | 2006-03-15 | Univ North Carolina | DOUBLE STRANDED PARVOVIRUS VECTORS |
| AU2001269923A1 (en) | 2000-06-19 | 2002-01-02 | Genzyme Corporation | Combination enzyme replacement, gene therapy and small molecule therapy for lysosomal storage diseases |
| US6492429B1 (en) | 2000-07-10 | 2002-12-10 | N.V. Nutricia | Composition for the treatment of osteoarthritis |
| US6485950B1 (en) | 2000-07-14 | 2002-11-26 | Council Of Scientific And Industrial Research | Isozyme of autoclavable superoxide dismutase (SOD), a process for the identification and extraction of the SOD in cosmetic, food and pharmaceutical compositions |
| US6329181B1 (en) | 2000-08-07 | 2001-12-11 | Neurologix, Inc. | Helper functions for recombinant vector production |
| WO2002014526A2 (en) | 2000-08-10 | 2002-02-21 | Neurologix, Inc. | Replication competent aav helper functions |
| US20020128203A1 (en) | 2000-09-20 | 2002-09-12 | Laurent Schild | Methods of identifying inhibitory compounds and uses thereof |
| AU2001289438A1 (en) | 2000-09-22 | 2002-04-02 | Galephar M/F | Pharmaceutical semi-solid composition of isotretinoin |
| WO2002028348A2 (en) | 2000-10-04 | 2002-04-11 | The Children's Hospital Of Philadelphia | Compositions and methods for treatment of cystic fibrosis |
| AU2002251844A1 (en) | 2001-02-02 | 2002-10-03 | Corixa Corporation | Compositions and methods for the therapy and diagnosis of colon cancer |
| US20030013137A1 (en) | 2001-03-13 | 2003-01-16 | Barak Larry S. | Automated methods of detecting receptor activity |
| CA2482124C (en) | 2001-04-19 | 2008-10-07 | Uab Research Foundation | Methods of treatment using an epithelial sodium channel blocker and an inhibitor of the mineralocorticoid receptor |
| AU2002308481A1 (en) | 2001-05-01 | 2002-11-11 | Senomyx, Inc. | High throughput cell-based assay for monitoring sodium channel activity and discovery of salty taste modulating compounds |
| US20030003583A1 (en) | 2001-06-08 | 2003-01-02 | Raphael Hirsch | Regulation of transgene expression following AAV transduction |
| JP2004534955A (en) | 2001-07-12 | 2004-11-18 | エクセリクシス・インコーポレイテッド | HADHs as Modifiers of the p21 Pathway and Methods of Use |
| CA2453405A1 (en) | 2001-07-13 | 2003-01-23 | University Of Iowa Research Foundation | Pseudotyped adeno-associated viruses and uses thereof |
| US8241622B2 (en) | 2001-07-13 | 2012-08-14 | University Of Iowa Research Foundation | Adeno-associated virus vectors with intravector heterologous terminal palindromic sequences |
| US20030108920A1 (en) | 2001-09-07 | 2003-06-12 | Wei Zhang | Tumor suppressor-like proteins that bind IGFBP2 |
| JP2003201255A (en) | 2001-11-05 | 2003-07-18 | Otsuka Pharmaceut Factory Inc | Alzheimer's disease prevention and treatment agent |
| US6723551B2 (en) | 2001-11-09 | 2004-04-20 | The United States Of America As Represented By The Department Of Health And Human Services | Production of adeno-associated virus in insect cells |
| WO2003042361A2 (en) | 2001-11-09 | 2003-05-22 | Government Of The United States Of America, Department Of Health And Human Services | Production of adeno-associated virus in insect cells |
| AU2002367943A1 (en) | 2001-12-18 | 2003-12-22 | University Of North Carolina At Chapel Hill | Improved reagents and methods for producing parvoviruses |
| EP1478655A4 (en) | 2001-12-31 | 2006-05-10 | Algos Therapeutics Inc | METHODS AND MATERIALS FOR MODULATING ENaC-BETA |
| EP1499742B1 (en) | 2002-04-17 | 2010-11-03 | Glucox Biotech AB | Nad(p)h oxidase inhibitors for increased glucose uptake and treatment of type ii diabetes |
| ATE405670T1 (en) | 2002-05-13 | 2008-09-15 | Arexis Ab | AUTOIMMUNE DISEASES AND NADPH OXIDASE DEFECTS |
| EP1534990B1 (en) | 2002-07-23 | 2006-10-25 | Medi-Physics, Inc. | Automated dynamic pressure-responsive hyperpolarized gas dispensing systems, and associated methods and computer program products |
| AU2003298020A1 (en) | 2002-11-26 | 2004-06-18 | Florida Atlantic University | Catalytic antioxidants and methods of use |
| KR100522188B1 (en) | 2003-01-20 | 2005-10-18 | 주식회사 뉴로테크 | Method for inhibition of necrosis induced by neurotrophin |
| AU2004227358B8 (en) | 2003-03-31 | 2009-12-10 | Targeted Genetics Corporation | Compounds and methods to enhance rAAV transduction |
| EP1486567A1 (en) | 2003-06-11 | 2004-12-15 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Improved adeno-associated virus (AAV) vector for gene therapy |
| SI1633772T1 (en) | 2003-06-19 | 2016-06-30 | Genzyme Corporation | Aav virions with decreased immunoreactivity and uses therefor |
| US7655467B2 (en) | 2003-11-14 | 2010-02-02 | The University Of Washington | Compositions and methods for systemic nucleic acid sequence delivery |
| US7407801B2 (en) | 2003-12-05 | 2008-08-05 | University Of Iowa Research Foundation | Truncated CMV promoters and vectors containing same |
| US7067659B2 (en) | 2004-04-23 | 2006-06-27 | Duke University | Reactive oxygen generating enzyme inhibitor with nitric oxide bioactivity and uses thereof |
| WO2005116224A2 (en) | 2004-05-18 | 2005-12-08 | Children's Memorial Hospital | Tetracycline-regulated adeno-associated viral (aav) vectors for gene delivery to the nervous system |
| EP1602926A1 (en) | 2004-06-04 | 2005-12-07 | University of Geneva | Novel means and methods for the treatment of hearing loss and phantom hearing |
| US20060002913A1 (en) | 2004-06-22 | 2006-01-05 | Gehlsen Kurt R | Use of histamine and related compounds to treat disorders affecting muscle function |
| WO2006116503A2 (en) | 2005-04-26 | 2006-11-02 | Irm Llc | Methods and compositions for modulating wnt signaling pathway |
| WO2007057062A1 (en) | 2005-11-17 | 2007-05-24 | Karolinska Institutet Innovations Ab | Human bocavirus and methods of diagnosis and treatment |
| CA2634670A1 (en) | 2005-12-30 | 2007-07-12 | University Of Iowa Research Foundation | Method of identifying compounds useful to treat neuronal degenerative diseases |
| WO2007127464A2 (en) | 2006-04-28 | 2007-11-08 | University Of Iowa Research Foundation | Methods and compounds to modulate parvovirus transduction of mammalian cells or to alter virus infection, method to identify a viral receptor or co-receptor |
| US20100113343A1 (en) | 2006-09-22 | 2010-05-06 | Julia Skokowa | Methods involving lef-1 regulation and use of lef-1 or compounds altering lef-1 signalling for treating or preventing diseases |
| EP2798956A1 (en) | 2007-04-23 | 2014-11-05 | Stowers Institute for Medical Research | Methods and compositions for hematopoeitic stem cell self-renewal |
| EP2184073A4 (en) | 2007-08-24 | 2010-10-20 | Kyowa Hakko Kirin Co Ltd | Therapeutic agent for cancer with resistance to protease inhibitor |
| US20090241206A1 (en) | 2008-03-04 | 2009-09-24 | University Of Iowa Research Foundation | Methods for cloning ferrets and transgenic ferret models for diseases |
| WO2009151697A2 (en) | 2008-03-14 | 2009-12-17 | The Government Of United States Of America, As Represented By The Secretary, Department Of Health And Human Services | Compositions and processes relating to human bocavirus |
| US8071751B2 (en) | 2008-04-17 | 2011-12-06 | Blood Systems, Inc. | Human parvovirus: bocavirus |
| US20110054247A1 (en) | 2009-03-04 | 2011-03-03 | University Of Iowa Research Foundation | Methods for cloning ferrets and transgenic ferret models for diseases |
| US9169492B2 (en) | 2010-02-05 | 2015-10-27 | The University Of North Carolina At Chapel Hill | Compositions and methods for enhanced parvovirus transduction |
| EP3134113A4 (en) | 2014-04-25 | 2017-11-29 | University of Florida Research Foundation, Inc. | Methods of permitting a subject to receive multiple doses of recombinant adeno-associated virus |
| US10907130B2 (en) | 2014-11-05 | 2021-02-02 | Research Institute At Nationwide Children's Hospital | Methods and materials for producing recombinant viruses in eukaryotic microalgae |
| WO2017139381A1 (en) | 2016-02-08 | 2017-08-17 | University Of Iowa Research Foundation | Methods to produce chimeric adeno-associated virus/bocavirus parvovirus |
| CA3016985C (en) | 2016-03-07 | 2023-07-04 | University Of Iowa Research Foundation | Aav-mediated expression using a synthetic promoter and enhancer |
| WO2017205739A1 (en) | 2016-05-26 | 2017-11-30 | University Of Iowa Research Foundation | cis AND trans REQUIREMENTS FOR TERMINAL RESOLUTION OF HUMAN BOCAVIRUS 1 |
| US11142775B2 (en) | 2017-01-13 | 2021-10-12 | University Of Iowa Research Foundation | Bocaparvovirus small noncoding RNA and uses thereof |
| WO2019178267A2 (en) | 2018-03-13 | 2019-09-19 | University Of Iowa Research Foundation | Inductive regeneration of the airway by transcriptional factor modulation of glandular myoepithelial stem cells |
| CN114641318A (en) | 2019-04-15 | 2022-06-17 | 衣阿华大学研究基金会 | Compositions and methods for treating cystic fibrosis |
| BR112021020706A2 (en) | 2019-04-15 | 2022-03-15 | Spirovant Sciences Inc | Methods and compositions for transgene expression |
| EA202192819A1 (en) | 2020-01-29 | 2022-02-18 | Юниверсити Оф Айова Рисерч Фаундейшн | METHODS AND COMPOSITIONS FOR TRANSGENE EXPRESSION |
| EA202192818A1 (en) | 2020-01-29 | 2022-03-03 | Юниверсити Оф Айова Рисерч Фаундейшн | COMPOSITIONS AND METHODS FOR THE TREATMENT OF CYSTIC FISSIDOSIS |
| WO2022006253A2 (en) | 2020-06-30 | 2022-01-06 | University Of Iowa Research Foundation | Methods and compositions for administering recombinant viral vectors |
-
2017
- 2017-03-07 CA CA3016985A patent/CA3016985C/en active Active
- 2017-03-07 MA MA043735A patent/MA43735A/en unknown
- 2017-03-07 IL IL261642A patent/IL261642B2/en unknown
- 2017-03-07 CA CA3198936A patent/CA3198936A1/en active Pending
- 2017-03-07 EA EA201892006A patent/EA201892006A1/en unknown
- 2017-03-07 AU AU2017229347A patent/AU2017229347A1/en not_active Abandoned
- 2017-03-07 EP EP17712339.5A patent/EP3426787A1/en active Pending
- 2017-03-07 MX MX2018010842A patent/MX2018010842A/en unknown
- 2017-03-07 US US16/082,767 patent/US11684679B2/en active Active
- 2017-03-07 IL IL322737A patent/IL322737A/en unknown
- 2017-03-07 WO PCT/US2017/021124 patent/WO2017155973A1/en not_active Ceased
-
2020
- 2020-12-18 AU AU2020289851A patent/AU2020289851B2/en active Active
-
2023
- 2023-04-26 US US18/139,661 patent/US20240066147A1/en not_active Abandoned
- 2023-11-08 AU AU2023263461A patent/AU2023263461A1/en active Pending
-
2025
- 2025-04-18 US US19/183,490 patent/US20250381308A1/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014168953A1 (en) * | 2013-04-08 | 2014-10-16 | University Of Iowa Research Foundation | Chimeric adeno-associated virus/ bocavirus parvovirus vector |
Non-Patent Citations (56)
| Title |
|---|
| AITKEN, CHEST, vol. 123, 2003, pages 792 |
| AITKEN, HUM GENE THER., vol. 12, 2001, pages 1907 |
| CARTER, HUM GENE THER., vol. 16, 2005, pages 541 |
| CONRAD ET AL., GENE THER., vol. 3, 1996, pages 658 |
| DAYA; BERNS, CLIN. MICROB. REV., vol. 21, 2008, pages 583 |
| DING ET AL., GENE THER., vol. 12, 2005, pages 873 |
| DING ET AL., MOL. THER., vol. 13, 2006, pages 671 |
| DONG ET AL., HUM. GENE THER., vol. 7, 1996, pages 2101 |
| DUAN ET AL., HUM. GENE THER., vol. 9, 1998, pages 2761 |
| DUAN ET AL., J. CLIN. INVEST., vol. 105, 2000, pages 1573 |
| FARMEN ET AL., AM. J. PHYSIOL. LUNG CELL MOL. PHYSIOL., vol. 289, 2005, pages 1123 |
| FISHER ET AL., J. BIOL. CHEM., vol. 287, 2012, pages 21673 |
| FLOTTE ET AL., J. BIOL. CHEM., vol. 268, 1993, pages 3781 |
| FLOTTE, CURR. OPIN. MOL. THER., vol. 3, 2001, pages 497 |
| GERARD ET AL., GENE THER., vol. 10, 2003, pages 1744 |
| GLOZMAN ET AL., J. CELL BIOL., vol. 184, 2009, pages 847 |
| GRIESENBACH ET AL., VIRUS ADAPT. TREAT., vol. 2, 2010, pages 159 |
| GRIESENBACK; ALTON, ADV. DRUG DEIIV. REV., vol. 61, 2009, pages 128 |
| KAPRANOV ET AL., HUM. GENE THER., vol. 23, 2012, pages 46 |
| KARP ET AL., METHODS MOL. BIOL., vol. 188, 2002, pages 115 |
| LI ET AL., MOL. THER., vol. 17, 2009, pages 2067 |
| LIU ET AL., AM. J. RESPIR. CELL MOL. BIOL., vol. 36, 2007, pages 313 |
| LIU ET AL., GENE THER., vol. 14, 2007, pages 1543 |
| LIU ET AL., MOL. THER., vol. 15, 2007, pages 2114 |
| M. R. SCHLABACH ET AL: "Synthetic design of strong promoters", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 107, no. 6, 9 February 2010 (2010-02-09), pages 2538 - 2543, XP055064057, ISSN: 0027-8424, DOI: 10.1073/pnas.0914803107 * |
| MOSS ET AL., HUM. GENE THER., vol. 18, 2007, pages 726 |
| MUELLER; FLOTTE, CLIN. REV. ALLERGY IMMUNOL., vol. 35, 2008, pages 164 |
| OLIVIER ET AL., J. CLIN. INVEST., vol. 122, 2012, pages 3755 |
| OSTEDGAARD ET AL., PROC. NATL. ACAD. SCI. USA, vol. 102, 2005, pages 2952 |
| OSTEDGAARD ET AL., PROC. NATL. ACAD. SCI. USA, vol. 108, 2011, pages 2921 |
| OSTEDGAARD ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 3093 |
| O'SULLIVAN; FREEDMAN, LANCET, vol. 373, 2009, pages 1891 |
| RIORDAN ET AL., SCIENCE, vol. 245, 1989, pages 1066 |
| ROMMENS ET AL., SCIENCE, vol. 245, 1989, pages 1059 |
| ROWE ET AL., N. ENGL. J. MED., vol. 352, 2005, pages 1992 |
| SCHLABACH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 107, 2010, pages 2538 |
| See also references of EP3426787A1 |
| SUMMER-JONES ET AL.: "Gene Therapy for Cystic Fibrosis Lung Disease", 2010, BIRKHAUSER |
| SUN ET AL., AM. J. PATHOL., vol. 184, 2014, pages 1309 |
| SUN ET AL., AM. J. RESPIR. CELL MOL. BIOL., vol. 50, 2014, pages 502 |
| SUN ET AL., J. CLIN. INVEST., vol. 118, 2008, pages 1578 |
| SUN ET AL., J. CLIN. INVEST., vol. 120, 2010, pages 3149 |
| WAGNER ET AL., HUM. GENE THER., vol. 13, 2002, pages 1349 |
| WELSCH, FASEB. J., vol. 4, 1990, pages 2718 |
| WELSH ET AL.: "The Metabolic and Molecular Bases of Inherited Disease", 1995, MCGRAW-HILL, pages: 3799 |
| WU ET AL., MOL. THER., vol. 14, 2006, pages 316 |
| WU ET AL., MOL. THER., vol. 18, 2010, pages 80 |
| YAN ET AL., HUM. GENE THER., vol. 24, 2013, pages 786 |
| YAN ET AL., HUM. GENE THER., vol. 26, 2015, pages 334 |
| YAN ET AL., J. VIROL., vol. 76, 2002, pages 2043 |
| YAN ET AL., J. VIROL., vol. 78, 2004, pages 2863 |
| YAN ET AL., MOL. THER., vol. 21, 2013, pages 2181 |
| ZABNER ET AL., AM J. PHYSIOL LUNG CELL MOL PHYSIOL., vol. 284, 2003, pages 844 |
| ZHANG ET AL., MOL. THER., vol. 10, 2004, pages 990 |
| ZHANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, 1998, pages 10158 |
| ZIYING YAN ET AL: "Optimization of Recombinant Adeno-Associated Virus-Mediated Expression for Large Transgenes, Using a Synthetic Promoter and Tandem Array Enhancers", HUMAN GENE THERAPY, vol. 26, no. 6, 1 June 2015 (2015-06-01), US, pages 334 - 346, XP055308423, ISSN: 1043-0342, DOI: 10.1089/hum.2015.001 * |
Cited By (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11027000B2 (en) | 2014-11-05 | 2021-06-08 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US11975056B2 (en) | 2014-11-05 | 2024-05-07 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US10335466B2 (en) | 2014-11-05 | 2019-07-02 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of parkinson's disease |
| US11542506B2 (en) | 2014-11-14 | 2023-01-03 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US12123002B2 (en) | 2014-11-14 | 2024-10-22 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US10920227B2 (en) | 2014-11-14 | 2021-02-16 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US10597660B2 (en) | 2014-11-14 | 2020-03-24 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US12071625B2 (en) | 2014-11-14 | 2024-08-27 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US11198873B2 (en) | 2014-11-14 | 2021-12-14 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US10570395B2 (en) | 2014-11-14 | 2020-02-25 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US11697825B2 (en) | 2014-12-12 | 2023-07-11 | Voyager Therapeutics, Inc. | Compositions and methods for the production of scAAV |
| US11702672B2 (en) | 2016-02-08 | 2023-07-18 | University Of Iowa Research Foundation | Methods to produce chimeric adeno-associated virus/bocavirus parvovirus |
| US11684679B2 (en) | 2016-03-07 | 2023-06-27 | University Of Iowa Research Foundation | AAV-mediated expression using a synthetic promoter and enhancer |
| US12084659B2 (en) | 2016-05-18 | 2024-09-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US11193129B2 (en) | 2016-05-18 | 2021-12-07 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US10584337B2 (en) | 2016-05-18 | 2020-03-10 | Voyager Therapeutics, Inc. | Modulatory polynucleotides |
| US11951121B2 (en) | 2016-05-18 | 2024-04-09 | Voyager Therapeutics, Inc. | Compositions and methods for treating Huntington's disease |
| US12173305B2 (en) | 2016-05-26 | 2024-12-24 | University Of Iowa Research Foundation | cis and trans requirements for terminal resolution of human bocavirus 1 |
| US11999965B2 (en) | 2017-01-13 | 2024-06-04 | University Of Iowa Research Foundation | Bocaparvovirus small noncoding RNA and uses thereof |
| US11752181B2 (en) | 2017-05-05 | 2023-09-12 | Voyager Therapeutics, Inc. | Compositions and methods of treating Huntington's disease |
| US11603542B2 (en) | 2017-05-05 | 2023-03-14 | Voyager Therapeutics, Inc. | Compositions and methods of treating amyotrophic lateral sclerosis (ALS) |
| US11759506B2 (en) | 2017-06-15 | 2023-09-19 | Voyager Therapeutics, Inc. | AADC polynucleotides for the treatment of Parkinson's disease |
| US12319929B2 (en) | 2018-05-15 | 2025-06-03 | Voyager Therapeutics, Inc. | Compositions and methods for the treatment of Parkinson's disease |
| US12281321B2 (en) | 2018-09-28 | 2025-04-22 | Voyager Therapeutics, Inc. | Frataxin expression constructs having engineered promoters and methods of use thereof |
| US20220241436A1 (en) * | 2019-04-15 | 2022-08-04 | University Of Iowa Research Foundation | Compositions and methods for treatment of cystic fibrosis |
| JP2022529457A (en) * | 2019-04-15 | 2022-06-22 | ユニヴァーシティ オブ アイオワ リサーチ ファウンデーション | Compositions and Methods for the Treatment of Cystic Fibrosis |
| JP7731801B2 (en) | 2019-04-15 | 2025-09-01 | ユニヴァーシティ オブ アイオワ リサーチ ファウンデーション | Recombinant adeno-associated viruses for the treatment of cystic fibrosis |
| WO2020214672A1 (en) * | 2019-04-15 | 2020-10-22 | University Of Iowa Research Foundation | Methods and compositions for transgene expression |
| JP2022529470A (en) * | 2019-04-15 | 2022-06-22 | ユニヴァーシティ オブ アイオワ リサーチ ファウンデーション | Methods and compositions for transgene expression |
| JP2023126658A (en) * | 2019-04-15 | 2023-09-07 | ユニヴァーシティ オブ アイオワ リサーチ ファウンデーション | Methods and compositions for transgene expression |
| CN114340683A (en) * | 2019-04-15 | 2022-04-12 | 衣阿华大学研究基金会 | Methods and compositions for transgene expression |
| CN114641318A (en) * | 2019-04-15 | 2022-06-17 | 衣阿华大学研究基金会 | Compositions and methods for treating cystic fibrosis |
| WO2020214668A1 (en) * | 2019-04-15 | 2020-10-22 | University Of Iowa Research Foundation | Compositions and methods for treatment of cystic fibrosis |
| WO2022006253A3 (en) * | 2020-06-30 | 2022-02-24 | University Of Iowa Research Foundation | Methods and compositions for administering recombinant viral vectors |
| EP4036238A1 (en) | 2021-01-27 | 2022-08-03 | The University Court of the University of Edinburgh | Functional nucleic acid molecule and method |
| WO2022162361A1 (en) | 2021-01-27 | 2022-08-04 | The University Court Of The University Of Edinburgh | Functional nucleic acid molecule and method |
| EP4582541A2 (en) | 2021-01-27 | 2025-07-09 | The University Court Of The University of Edinburgh | Functional nucleic acid molecule and method |
| WO2024023530A1 (en) | 2022-07-29 | 2024-02-01 | The University Court Of The University Of Edinburgh | Functional nucleic acid molecule and method |
Also Published As
| Publication number | Publication date |
|---|---|
| IL261642B1 (en) | 2025-09-01 |
| CA3198936A1 (en) | 2017-09-14 |
| CA3016985A1 (en) | 2017-09-14 |
| AU2020289851A1 (en) | 2021-01-28 |
| EA201892006A1 (en) | 2019-04-30 |
| US20250381308A1 (en) | 2025-12-18 |
| MA43735A (en) | 2018-11-28 |
| CA3016985C (en) | 2023-07-04 |
| IL261642B2 (en) | 2026-01-01 |
| AU2023263461A1 (en) | 2023-11-30 |
| AU2020289851B2 (en) | 2023-08-10 |
| US20240066147A1 (en) | 2024-02-29 |
| US11684679B2 (en) | 2023-06-27 |
| IL322737A (en) | 2025-10-01 |
| EP3426787A1 (en) | 2019-01-16 |
| MX2018010842A (en) | 2019-07-04 |
| AU2017229347A1 (en) | 2018-11-01 |
| IL261642A (en) | 2018-10-31 |
| US20190083657A1 (en) | 2019-03-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20240066147A1 (en) | Aav-mediated expression using a synthetic promoter and enhancer | |
| CN105579465B (en) | Variant AAVs and compositions, methods and uses for gene transfer into cells, organs and tissues | |
| US6936466B2 (en) | Transcriptionally-activated AAV inverted terminal repeats (ITRs) for use with recombinant AAV vectors | |
| TWI811219B (en) | High activity regulatory elements | |
| EP3999642A1 (en) | Recombinase compositions and methods of use | |
| JP7558575B2 (en) | Genome editing by directed non-homologous DNA insertion using retroviral integrase-Cas9 fusion proteins | |
| JP2022505381A (en) | Compositions and Methods for Treating Alpha-1 Antitrypsin Deficiency | |
| US7060497B2 (en) | Adeno-associated viral vector-based methods and compositions for introducing an expression cassette into a cell | |
| WO2024120528A1 (en) | Improved system for producing rna-packaged aav particles | |
| CA3218209A1 (en) | Multiplex crispr/cas9-mediated target gene activation system | |
| US7407801B2 (en) | Truncated CMV promoters and vectors containing same | |
| EP3787694A1 (en) | Raav-mediated nuclease-associated vector integration (raav-navi) | |
| CN112041437A (en) | Adeno-associated virus compositions for restoring F8 gene function and methods of use thereof | |
| EA043850B1 (en) | AAV-MEDIATED EXPRESSION USING A SYNTHETIC PROMOTER AND ENHANCER | |
| US20250188490A1 (en) | Methods of raav packaging | |
| US20220380812A1 (en) | Crispr/cas9 system as an agent for inhibition of polyoma jc infection | |
| WO2026064428A2 (en) | Capsid polypeptides and methods of use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| ENP | Entry into the national phase |
Ref document number: 3016985 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2018/010842 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201892006 Country of ref document: EA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2017712339 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2017712339 Country of ref document: EP Effective date: 20181008 |
|
| ENP | Entry into the national phase |
Ref document number: 2017229347 Country of ref document: AU Date of ref document: 20170307 Kind code of ref document: A |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 17712339 Country of ref document: EP Kind code of ref document: A1 |
|
| WWD | Wipo information: divisional of initial pct application |
Ref document number: 322737 Country of ref document: IL |