EA043850B1 - AAV-MEDIATED EXPRESSION USING A SYNTHETIC PROMOTER AND ENHANCER - Google Patents

Description

Cross reference to related applications

The invention claims priority to U.S. Application Serial No. 62/304,656, filed March 7, 2016, the disclosure of which is incorporated herein by reference.

Government Rights Statement

The invention was made with government support under grant HL108902 allocated to the National Institutes of Health. The government has certain rights to an invention.

Prerequisites

Cystic fibrosis (CF) is a lethal autosomal recessive disorder that affects at least 30,000 people in the United States alone (O'Sullivan et al., 2009). The genetic basis of CF is a mutation in a single gene that encodes the cystic fibrosis transmembrane conductance regulator (CFTR) (Riordan et al., 1989; Rommens et al., 1989). It leads to a defective CFTR protein and resulting abnormalities in the transport of electrolytes and fluids in many organs (Welsh, 1990; Rowe et al., 2005). The most life-threatening outcome is CF lung disease, which is characterized by viscous mucous secretions and chronic bacterial infections (Welsh, 1990). Along with improvements in patient care and advances in pharmacological therapy for CF, the life expectancy of patients with CF has been steadily increasing over the past decades; however, the quality of life of patients with CF remains poor, and medications that alleviate pulmonary complications are expensive and effective only in selected patients. Because lung disease is the leading cause of death in CF patients and the genetic basis is a monogenic defect, gene therapy for CF lung disease has the potential to cure all CF patients, regardless of their CFTR mutation. Thus, clinical trials for CF pulmonary gene therapy began in the mid-1990s. However, all studies to date have been unsuccessful (Sumner-Jones et al., 2010). The reason behind this is that the vectors available for gene transfer into human airway epithelium (HAE) are not efficient (Mueller & Flute, 2008; Griesenbach & Alton, 2009; Griesenbach et al., 2010).

Adeno-associated virus (AAV), a member of the human parvovirus family, is a non-pathogenic virus that depends on helper viruses for replication. For this reason, rAAV vectors are among the most commonly used in preclinical and clinical gene therapy studies (Carter, 2005; Wu et al., 2006; Daya & Berns, 2008). Indeed, clinical studies of CF lung disease using rAAV2 have demonstrated a good safety profile and long-term persistence of the viral genome in airway tissue (as assessed by biopsy) relative to other means of gene transfer (such as recombinant adenovirus). However, gene transfer did not improve lung function in CF patients because transcription of CFTR mRNA extracted from the rAAV vector was not detected (Flotte, 2001; Aitken et al., 2001; Wagner et al., 2002; Moss et al. , 2007; Duan et al., 2000). These observations are consistent with recent studies of rAAV transduction using an in vitro polarized HAE model in which cells are grown at an air-liquid interface (ALI) ( Flotte, 2001 ; Duan et al., 1998 ). The low efficiency of rAAV2 as a vector for CFTR expression in HAE is mainly due to two major obstacles: 1) inefficient post-entry viral processing and 2) limited packaging capacity of rAAV.

Initial preclinical studies using rAAV2-CFTR, which supported the first clinical studies in patients with CF, were performed in rhesus monkeys. These studies demonstrated that viral DNA and transgene-derived CFTR mRNA persisted in the lungs for long periods after rAAV2-mediated CFTR gene transfer (Conrad et al., 1996). However, more recent studies comparing the efficiency of rAAV2 transduction between ALI cultures of human and rhesus monkey airway epithelium showed that rAAV2 tropism for apical transduction is significantly higher in rhesus monkey cultures than in their human counterparts (Liu et al., 2007). , likely due to species-specific differences in AAV2 receptors and co-receptors that exist on the apical surface. In studies of polarized HAE, most AAV2 virions were internalized after apical infection but accumulated in the cytoplasm instead of passing into the nucleus (Duan et al., 2000; Ding et al., 2005). One obstacle to the intracellular directional migration required for fruitful viral transduction is the ubiquitin-proteasome pathway (Duan et al., 2000; Yan et al., 2002); transient inhibition of proteasome activity significantly enhances transduction (700-fold) of rAAV2-luciferase vectors from the apical surface by promoting vector translocation into the nucleus (Yan et al., 2006). However, the use of proteasome inhibitors to increase the transduction efficiency of rAAV-CFTR vectors will only slightly improve CFTR expression, most likely due to the low activity of the short promoter used in rAAV-CFTR vectors (Zhang et al., 2004). The open reading frame (ORF) of the CFTR gene is 4,443 kb, and thus approaches the AAV genome size of 4,679 kb. Although the AAV capsid can accommodate contents larger than its native DNA genome, its maximum packaging capacity is approximately 5.0 kb. (Dong et al., 1996), and transgene expression from vectors exceeding this limit leads to significantly reduced function (Wu et al., 1993).

- 1 043850

Taking into account the need for cis-elements of 300 bp. from the AAV genome (two ITR sequences at the ends) and the 4443 bp CFTR coding sequence, there is little room (257 bp) in the vector genome for a strong promoter and polyadenylation signal. Thus, the first generation rAAV-CFTR vector (AV2.tgCF) that was tested in clinical studies relies on the cryptic promoter activity of the AAV2 ITR to drive transcription of the full-length CFTR cDNA with a synthetic polyadenylation signal (Flotte et al., 1993; Aitken et al. ., 2003).

The rAAV vector AV2.tg83-CFTR, which uses a synthetic 83-bp promoter, was developed not long ago. (tg83) (Zhang et al., 2004) to improve the expression of full-length human CFTR cDNA. The genome size of this vector is 4.95 kb. Although this vector produced a 3-fold increase in cAMP-mediated Cl ^- currents in CF HAE ALI cultures relative to AV2.tgCF, this level of expression remained suboptimal for use in CF gene therapy. Other groups have tried to use the CFTR minigene to create space for insertion of a better promoter into rAAV vectors; this seemed reasonable based on earlier studies of CFTR gene function and structure, which show that deletion of short non-essential sequences from the C-terminus and regulatory domain (R-domain) had only minimal effects on chloride channel function in CFTR (Zhang et al. , 1998). One widely used CFTR minigene is CFTRAR, which has lost 156 bp encoding 52 amino acid residues (708-759) at the N-terminus of the R domain. Gene transfer using a recombinant adenoviral vector encoding CFTRAR into CF HAE ALI cultures showed that this transgene retains at least 80% of the transepithelial Cl ^- transport provided by full-length CFTR (Ostedgaard et al., 2002). Additionally, expression of CFTRAR in CFTR−/− knockout mice rescued the lethal intestinal phenotype (Ostedgaard et al., 2011). This deletion is 156 bp. allowed the 4.94 kb rAAV CFTR expression vector, with expression driven by the minimal CMV promoter (173 bp), to be packaged into the AAV5 capsid (Ostedgaard et al., 2005). Additional efforts have been directed toward developing variant AAV vectors with higher apical tropism through directed evolution of the AAV capsid in HAE-polarized ALI cultures (Li et al., 2009). However, these rAAV vectors did not efficiently express CFTR because the CMV minimal promoter did not function well in fully differentiated airway epithelium.

The essence of the invention

To overcome the promoter size limitation in a recombinant adeno-associated virus (rAAV) vector that can be used to express specific transgenes, a set of 100-mer synthetic enhancer elements consisting of ten 10-bp repeats was screened for the ability to increase expression of the CFTR transgene from a short synthetic promoter of 83 bp. in the context of an rAAV vector for use in gene therapy for cystic fibrosis (CF). Screening for the effectiveness of synthetic enhancers to enhance transgene expression was carried out stepwise in plasmids without AAV sequences, proviral vectors in the form of plasmids with AAV sequences and rAAV vectors. Plasmid transfection and viral vector transduction were assessed in cultured cell lines and in whole animals in vivo. Initial studies assessing transcriptional activity in monolayer (non-polarized) cultures of human airway cell lines and primary ferret airway cells found that three of these synthetic enhancers (F1, F5 and F10) significantly promoted luciferase transgene transcription in the context of plasmid transfection. Additional analysis in polarized cultures of human and ferret airway epithelium at the air-liquid interface (ALI), as well as in ferret airways in vivo, demonstrated that the F5 enhancer gave the highest level of transgene expression in the context of an AAV vector. In addition, it was demonstrated that an increase in the size of the viral genome from 4.94 to 5.04 kb. had no significant effect on vector particle yield, but significantly reduced the functionality of rAAV-CFTR vectors due to small terminal deletions that extended into the oversized 5.04 kb CFTR expression cassette. Since rAAV-CFTR vectors larger than 5 kb. have a significantly weakened vector effect, a shortened ferret CFTR minigene with a 159 bp deletion. in the R domain was used to construct the rAAV vector (AV2/2.F5tg83-fCFTRAR). This vector produced an approximately 17-fold increase in CFTR expression and significantly improved Cl ^currents in CF ALI cultures. This small enhancer/promoter combination may have broad utility for rAAV-mediated gene therapy, such as CF gene therapy, in the airways.

The disclosure relates to a recombinant vector, such as a parvovirus vector, such as a recombinant adeno-associated virus (rAAV) vector or a bocavirus (BoV) vector, such as a human BoV, that contains a synthetic enhancer having a plurality of synthetic enhancer sequences operably linked to a promoter, e.g. synthetic promoter. In one embodiment, each of the plurality of enhancers has the same sequence. In one embodiment, at least 2 of the plurality of enhancers have a different sequence. In one embodiment, the synthetic enchan

- 2 043850 sers are formed from different enhancer sequences, where each unique sequence may be present once or more than once, and if more than once, may be in tandem or alternate with other (different) enhancer sequences. For example, a synthetic enhancer may have five different enhancer sequences, each present twice in the synthetic enhancer, and the repeat sequences may be in tandem (or not). In one embodiment, at least one of the enhancer sequences has a TP53 binding site. In one embodiment, at least one of the enhancer sequences has a CREB binding site. In one embodiment, at least one of the enhancer sequences has an NRF-1 binding site (CATGCGCAG). In one embodiment, the plurality has a combination of one or more TP53 binding sites, one or more NRF-1 binding sites, and/or one or more CREB binding sites, eg, CREB7. In one embodiment, the enhancer sequence has a binding site shown in one of FIGS. 8A-8C. In one embodiment, the plurality has from 2 to 20 different synthetic enhancer sequences. In one embodiment, at least one of the enhancer sequences is no more than 15 bp. In one embodiment, the plurality is up to about 150 nucleotides in length, such as about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, or 140 nucleotides in length. In one embodiment, the synthetic enhancer comprises F1, F5 or F10. In one embodiment, the enhancer has at least 80, 85, 90, 92, 95, 98, or 99% nucleotide sequence identity with F1, F5, or F10. In one embodiment, the associated promoter is a synthetic promoter. In one embodiment, the promoter is tg83. In one embodiment, the promoter is an AAV promoter. In one embodiment, the promoter is a heterologous promoter, for example, from the genome of another virus or mammal. In one embodiment, the promoter is operably linked to an open reading frame, for example, a heterologous open reading frame. In one embodiment, the open reading frame encodes a prophylactic or therapeutic gene product, for example, cystic fibrosis transmembrane conductance regulator, α-antitrypsin, β-globin, γ-globin, tyrosine hydroxylase, glucocerebrosidase, arylsulfatase A, factor VIII, dystrophy, or erythropoietin. In one embodiment, the combination of multiple enhancer sequences and a promoter is no more than 300 nucleotides in length, such as no more than 125, 150, 175, 200, 250, or 275 nucleotides in length. In one embodiment, the combination of multiple enhancer sequences and a promoter is less than 500 nucleotides in length. In one embodiment, the vector is a parvovirus vector, such as an rAAV vector, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or AAV9 vector, or a human bocavirus vector, for example, HBoV1, HBoV2, HBoV3 or HBoV4, or an evolved AAV or HBoV vector that adapts a unique tropism, for example, optionally using slightly modified capsid sequences from known serotypes

The present disclosure also relates to a stepwise screening approach for tissue-specific as well as ubiquitous synthetic promoter/enhancer combinations in plasmids, proviral vectors and rAAV vectors that can be used in the application of rAAV gene therapy to large transgene cassette delivery. Examples of use include, but are not limited to, expression of factor VIII 4.3 kb. with deleted B domain in muscle and/or liver for hemophilia A or delivery of a 4.2 kb gene editing tool. from Streptococcus pyogenes (SpCas9) and chimeric sgRNA together into any desired tissue and organ in vivo.

The invention further relates to methods of using a recombinant parvovirus vector to infect cells, for example mammalian cells, such as ferret, dog, cat, cow, horse, goat or pig cells, or primate cells, for example human cells, for example, administering a composition containing the recombinant parvovirus vector to a mammal. For example, the genome of a recombinant parvovirus may contain an expression cassette encoding a heterologous gene product, for example, that is a therapeutic protein such as cystic fibrosis transmembrane conductance regulator, α-antitrypsin, β-globin, γglobin, tyrosine hydroxylase, glucocerebrosidase, arylsulfatase A factor VIII, dystrophies, erythropoietin, α1-antitrypsin, surfactant protein SP-D, SP-A or SP-C, erythropoietin or cytokine, for example IFN-α, IFNy, TNF, IL-1, IL-17 or IL- 6, or a prophylactic protein that is an antigen, such as a viral, bacterial, tumor or fungal antigen, or a neutralizing antibody or fragment thereof, that is directed to an epitope of an antigen, such as that of a human respiratory virus, such as influenza virus or RSV including, but not limited to, HBoV protein, influenza virus protein, RSV protein, or SARS protein.

Brief description of the figures

Fig. 1A-1D. The effectiveness of synthetic oligonucleotide enhancers in increasing active

- 3 043850 sti tg83-controlled luciferase reporter plasmids in monolayer cultures. A) Schematic structure of reporter vectors used to screen enhancer libraries. Transcription motifs of the synthetic tg83 promoter are shown. (B-D) Reporter activity in monolayer cultures of human airway cell lines: (B) A549 and (C) IB3 and (D) primary ferret airway cells after transfection with the indicated plasmids. Luciferase assay was performed 24 h after transfection. Data represent the mean (±SEM, N=3) relative luciferase activity for each transfection, normalized to that of the enhancerless pGL3-tg83luc vector, which was set to 1 in each cell type tested.

Fig. 2A-2F. Efficiency of enhancers F1, F5 and F10 in increasing tg83 promoter activity in the context of proviral plasmids and rAAV. A) The effect of AAV2 ITR on transcription from the tg83 promoter as assessed after transfection of A549 and primary ferret airway cells with pGL3-tg83 or pAV2-tg83luc. Data represent mean (±SEM, N=3) relative luciferase activity (RLU) 24 h posttransfection. B) Transcriptional efficiency of enhancers following transfection of A549 and primary ferret airway cells with the indicated AAV2 proviral plasmids. Data represent mean (±SEM, N=3) relative luciferase activity for each transfection, normalized to the enhancerless vector pAV2tg83luc (set as 1 for each cell type), 24 h posttransfection. C) Transcriptional efficiency of enhancers following infection of A549 cells with the indicated rAAV2 vectors 24 h postinfection. Data represent mean (±SEM, N=3) relative luciferase activity for each infection, normalized to the enhancerless vector pAV2-tg83luc (set as 1). (D and E) Transcriptional efficiency of enhancers following basolateral infection of (D) human and (E) ferret polarized airway epithelia that were infected using 2x10 ¹⁰ DRP of the indicated rAAV2 vectors. Data represent mean (±SEM, N=4) relative luciferase activity (RLU) for each condition 2 days postinfection. (F) Transcriptional efficiency of enhancers in lung and tracheal tissue following infection of 5-day-old ferret pups using 2x1011 DRP AV2/1.F5tg83luc or AV2/1.F10tg83luc, in the presence of proteasome inhibitors. Luciferase activity was measured on day 8 postinfection. Data represent mean (±SEM, N=4) relative luciferase activity (RLU/μg protein).

Fig. 3A-3C. Effect of rAAV-CFTR construct size on restoration of CFTR chloride currents in CF-polarized airway epithelium. A) Schematic illustration of the structures of rAAV2 vectors of various sizes that encode the open reading frame (ORF) of full-length ferret CFTR and R-domain deleted variants driven by the same transcription elements: an 83-bp synthetic promoter. (tg83), synthetic 62 bp polyadenylation signal. (pA), 5'-untranslated region 17 bp. (UTR) and 3' UTR 9 bp. The ORF of full-length ferret CFTR (fCFTR) is 4455 bp. Mark 3xHA 99 p.o. inserted between amino acid residues S900 and I901, bringing fCFTR(HA) to 4554 bp. fCFTRAR has a shortened ORF (4296 bp); 53 amino acid residues (I708-I760, 159 bp) were removed from the R-domain. fCFTRAR(HA) is 4395 bp long, with a 99 bp HA tag insertion. and deletions of 159 bp. in the R domain. The functionality of these vectors in restoring CFTR-specific Cl ^- transport (reflected in transepithelial short circuit currents (Isc)) was compared in CF differentiated HAE ALI cultures following infection using 10 ¹¹ DRP per Millicell insert (MOI approximately 105 DRP/cell). in the presence of proteasome inhibitors LLnL (10 µM) and doxorubicin (2 µM). CF HAE ALI cultures were created from a conditionally transformed human airway cell line with CF (CuFi8; genotype AF508/AF508). B) Typical curves of Isc changes in CF ALI cultures infected with the indicated AAV-CFTR vectors after sequential addition of various inhibitors and agonists. Amiloride and DIDS were used to block ENaC-mediated sodium currents and non-CFTR chloride channels before the addition of a cAMP agonist (forskolin and IBMX), and GlyH101 was used to block CFTR-specific currents. AIsc (IBMX & Forsk) reflects the activation of CFTR-mediated chloride currents after administration of the agonist cAMP, and AIsc (GlyH101) reflects the inhibition of CFTR-mediated chloride currents after the addition of GlyH101. C) Effects of vector size on the recovery of chlorine Isc currents. rAAV-CFTR vectors were expanded in approximately 100 bp increments. AIsc (IBMX & Forsk) and AIsc (GlyH101) responses are shown showing the magnitude of CFTR-mediated chloride transport following basolateral CF HAE ALI infection as described in (B). CFTR currents that occurred in primary non-CF HAEs (N=14) are shown for comparison. Data represent the mean (±SEM) of N=3 independent Millicell inserts.

Fig. 4A, 4B. Analysis of viral genome integrity by denaturing gel electrophoresis and slot blot analysis. A) Viral DNA was extracted from 10 ⁹ DRP of the indicated AAV-CFTR vectors resolved on a 0.9% alkaline agarose gel and transferred to a nylon membrane. Southern blotting was performed using a ³² P-labeled CFTR probe to visualize viral DNA. B) In order to evaluate possible deletion that may occur at the ends of the plus and minus strands of viral genomes, 3.33x108 DRP of each virus (titer determined by Taq PCR

- 4 043850

Man using fCFTR cDNA probe/primer) was loaded in triplicate into a Slot-Dot® SF Module (Bio-Rad, Hercules, CA) equipped with a nylon membrane. A 3-fold serial dilution of the proviral plasmid (3x109 to 3.7x107 copies) was also loaded to generate calibration curves for quantitation. The blot was probed with ³² P-labeled oligonucleotides to the tg83 promoter, CFTR cDNA, or polyA. (−) and (+) represent probes that form hybrids with the minus and plus strands of the single-stranded rAAV genome. Hybridization was first performed using a set of probes that form minus-strand hybrids and then reprobed using a set of oligonucleotides that form plus-strand hybrids. The copy number of viral genomes detected by each probe was determined (mean ±SEM, N=3) based on signal density measurements using NIH ImageJ and comparison with calibration curves.

Fig. 5. Effects of the F5 enhancer on CFTR currents occurring in CF HAE following infection with rAAV vectors. CF HAE ALI were infected with AV2/2.tg83-fCFTRAR or AV2/2.F5tg83fCFTRAR, at the indicated MOIs, from the apical or basolateral surface. Proteasome inhibitors were co-administered during the 16-h infection period. Isc measurements in ALI-infected cultures were performed 2 weeks postinfection. Mean (±SEM) AIsc (IBMX & Forsk) and AIsc (GlyH101) are presented along with N for the indicated independent Transwell analysis. CF and non-CF HAE mock-infected cultures are presented for comparison.

Fig. 6A, 6B. Effects of the F5 enhancer on CFTR currents and tg83-driven CFTR transcription following infection with rAAV vectors. CF HAE ALI were infected with AV2/2.tg83fCFTRAR or AV2/2.F5tg83-fCFTRAR at an MOI of 2x10 ⁴ DRP/cell from the basolateral surface, in the presence of proteasome inhibitors. A) Isc was measured in infected ALI cultures at 3 and 10 days postinfection. AIsc (IBMX & Forsk) and AIsc (GlyH101) values are presented. B) Relative abundance of vector-derived CFTR mRNA in cultures assessed in panel a, as determined using RS-PCR and normalized to GAPDH transcripts in each sample. Data represent the mean (±SEM) of N=3 independent Transwells in each plot.

Fig. 7A, 7B. Ferrets at 5 days of age were systemically infected with 2x1011 DRP AAV2/9F5tg83luc or AAV2/9F10tg83luc via jugular vein injection. Animals were sacrificed on day 8 postinfection, and instant tissues from various organs were collected and homogenized in reporter lysis buffer (Promega) for luciferase assay. A) Data comparing luciferase expression after AAV2/9F5tg83luc or AAV2/9F10tg83luc infections, where luciferase expression from the F5tg83 promoter was arbitrarily set to 100 in each tissue. B) Values represent (mean ±SEM, n=3) relative luciferase activity (RLU/μg protein).

Fig. 8A-8W. A-E) Binding sites in F5 that can be used to produce synthetic enhancers as disclosed herein. F-P) Binding sites in F10 that can be used to produce synthetic enhancers as disclosed herein. Q-W) Binding sites in F5tg83 that can be used to generate synthetic enhancers or a promoter as disclosed herein. SEQ ID NO: 31-68.

Fig. 9A-D. Efficiency of AV.F5Tg83-hCFTRAR gene transfer into the trachea and lungs of the ferret. Ferrets aged 3 days were infected with a 100 μl volume of 6x1011 DRP AV. F5Tg83-hCFTRAR in 500 μM doxorubicin. Uninfected animals received an equal volume of vehicle plus doxorubicin. On day 10 after infection, the entire lungs and trachea were collected and snap-frozen in liquid nitrogen. The tissue was powdered and mRNA and cDNA were obtained for human and ferret CFTR qPCR. (A and B) hCFTR and fCFTR mRNA copies in (A) trachea and (B) lungs. Copy number was determined using a calibration curve generated from serial dilutions of plasmid CFTR cDNA for each species. (C and D) Ratio of transgenic-derived hCFTR mRNA to endogenous fCFTR. C1-C3 represent animals in the mock-infected group and A1-A3 represent animals in the AAV-infected group. The average for three AAV-infected animals is also shown. The dashed line represents endogenous CFTR levels (ratio=1). Data describe the mean ±SEM of N=3 animals in each group.

Fig. 10A-D. AV.F5Tg83-hCFTRAR effectively transduces the airways of adult ferrets. Lungs from 1 month old ferrets (N=3) were transduced with 7.5x10 ¹² DRP AV.F5Tg83-hCFTRAR carrying hCFTRAR cDNA in a 500 μl volume of PBS in the presence of 250 μM doxorubicin. A mock-infected control animal (N=1) received 500 μl of vector-free PBS in the presence of 250 μM doxorubicin. The vector was delivered to the lungs using a PennCentury micronebulizer via tracheal intubation. The same animals were also nasally delivered using 100 μl containing 1.5x10 ¹² DRP with 250 μM doxorubicin via fluid instillation. For nasal mock infection delivery, PBS containing 250 μM doxorubicin was given. On day 12 after infection, the lung lobes were collected separately, along with the trachea, carina, and turbinates with adjacent adventitia. Tissues were snap frozen and powdered samples were processed separately for mRNA and DNA. A) RNA-specific PCR (RS-PCR) TaqMan with mRNA

- 5 043850

Human CFTR and endogenous ferret GAPDH mRNA for vector and mock treated animals. The results show the hCFTR/fGAPDH mRNA ratio. B) TaqMan RS-PCR with endogenous ferret CFTR mRNA and endogenous ferret GAPDH mRNA for vector and mock treated animals. The results show the fCFTR/fGAPDH mRNA ratio. C) TaqMan qPCR for the number of vector genomes in each sample per 100 ng of DNA. D) mRNA copy ratio for hCFTR/fCFTR in each sample. Endogenous CFTR levels were taken as 1 (red dashed line). Lung samples contained an average of 3.0 ± 0.5 copies of transgenic-derived hCFTR mRNA per copy of fCFTR mRNA. Transduction of tracheal and nasal tissues was more variable, but averaged one copy of hCFTR mRNA of transgenic origin/fCFTR. Results represent the mean ±SEM of vector-treated animals.

Detailed description

Gene therapy has been widely used in clinical research since the 1990s, and many successful cases have been reported using viral or non-viral vectors to deliver therapeutic genes. rAAV is the most widely used and has a proven high safety profile, broad tissue/organ tropism, and persistent transgene expression. AAV is a small single-stranded DNA virus with an essentially small genome of 4,679 kb, thus the use of rAAV for gene therapy is limited to the delivery of relatively small transgenes. Although the AAV capsid can accommodate the rAAV genome slightly larger than its original size, 4.95 kb. appears to be the maximum size for efficient transgene expression. Because the sequence of the 300 bp obligatory AAV cis element. (terminal repeats at both ends) are included in the rAAV vector, the actual insertion with the exogenous gene expression cassette cannot exceed 4.6 kb. This is a challenge for delivering efficient expression of a large gene that approaches this size limit.

One typical example is to deliver the CFTR (cystic fibrosis transmembrane conductance regulator) gene for cystic fibrosis (CF) gene therapy using an rAAV vector. The coding sequence of the CFTR gene is as much as 4,443 kb. To construct a CFTR-expressing AAV vector with the required minimum 5' and 3' UTRs and cloning sites, there is less than 200 bp of space. to insert a promoter and polyadenylation signal to drive transcription of the full-length CFTR cDNA.

Recently, a CFTR knockout model in ferrets has been developed that spontaneously develops a lung phenotype that reflects key features of human CF disease, including spontaneous bacterial lung infection, defective secretion from submucosal glands, diabetes, and gastrointestinal disease (Sun et al. , 2008; Sun et al., 2010; Oliver et al., 2012; Sun et al., 2014; Yan et al., 2013. It has been shown that the respiratory tract of newborn ferrets can be effectively transduced with rAAV1 in the presence of proteasome inhibitors (Yan et al., 2013) Thus, preclinical studies in the ferret model of CF can begin as soon as an rAAV vector that efficiently expresses CFTR in the airway epithelium is generated. The inherently small 4,679 kb genome of rAAV requires the use of a short, but a robust transcriptional regulatory element for efficient expression of a large transgene whose size approaches the packaging limit.A cassette was created that efficiently expresses the ferret CFTR (fCFTR) gene.

The first generation rAAV-CFTR vector (AV2.tgCF), dependent on the activity of the cryptic AAV2 ITR promoter, did not efficiently express CFTR in clinical studies. To overcome this problem, another rAAV vector, AV2.tg83-CFTR, which uses a synthetic 83-bp promoter, was used. (tg83) to refine expression. Although this vector induced 3-fold higher cAMP-mediated Cl ^- currents in CF HAE ALI cultures than AV2.tgCF, this expression level remains suboptimal for use in CF gene therapy. Therefore, there is an urgent need for a strong short promoter to drive CFTR expression in an AAV vector for CF gene therapy. Similarly, to express factor VIII at 4.3 kb. with the B domain deleted in muscle and/or liver for hemophilia gene therapy using rAAV, a short promoter effective in muscle and liver is also required.

Another example is to deliver the CRISPR/Cas9 system for gene editing. The current development of the CRISPR/Cas9 gene editing technique facilitates a new gene therapy strategy in humans by correcting the defective gene at preselected sites without altering the endogenous regulation of the gene of interest. This system consists of two key components: the Cas9 protein and sgRNA, as well as a correction matrix when necessary. rAAV can be used to deliver these elements in vivo to various target organs, but co-delivery of the Cas9 protein and chimeric sgRNA into the same cell is required, since the dual AAV vector delivery system is not very efficient. Since the size of the Streptococcus pyogenes (SpCas9) expression cassette and sgRNA transcription cassette together exceeds 4.2 kb, using a single rAAV vector to deliver efficiently expressed SpCas9 protein requires the use of a small but robust promoter/enhancer sequence to control

- 6 043850 to express SpCas9, and thus ubiquitous and/or tissue-specific enhancers are desirable. Although Staphylococcus aureus Cas9 (SaCas9), which is approximately 1.0 kb smaller in size, is placed along with its sgRNA and relevant expression cassettes in a single AAV vector, the use of a short synthetic promoter allows for additional insertion of a correction template genes for rAAV all-in-one vector for application to gene editing-based gene therapy.

As described below, short (less than 0.2 kb) synthetic enhancer/promoters provide a solution to the current rAAV vector problem in delivering a large transgene cassette. This disclosure, in one embodiment, relates to the use of a synthetic 183 bp F5tg83 enhancer/promoter. in rAAV vectors to deliver efficient CFTR expression to lung airway tissue for CF gene therapy. This disclosure, in one embodiment, also provides an effective approach for screening and identifying tissue-specific or ubiquitous synthetic promoter/enhancer combinations.

Because enhancer activity varies among cell lines and cell differentiation state, and is also influenced by the AAV ITR and gene sequence of interest, screening was done in a stepwise fashion, for example, in plasmids, proviral vectors, and rAAV vectors.

In one embodiment, the screening system includes a specific 83-mer synthetic core promoter (tg83p) and a set of random 100-mer synthetic sequences with high enhancer activity. The screening approach can be used to screen 100-mer synthetic sequences for their enhancer activity to enhance transcription of a promoter, e.g. transcription of the 83 bp tg83p promoter, in another organ/tissue for other genes of interest in a similar stepwise manner: e.g. to control factor VIII expression in muscle or liver, and to control Cas9 protein expression in any specific tissues or stem cells. In addition to tissue-specific expression, the approach can also be used to identify an enhancer with a ubiquitous effect to enhance tg83p promoter activity across a wide range of tissues/organs, through testing the expression of rAAV-derived reporter genes at the multi-organ level.

Specifically, a set of vectors containing the synthetic tg83 promoter linked to various synthetic sequences (approximately 100 bp) with high enhancer activity were constructed for initial screening in monolayer (non-polarized) cultures of human airway cell lines and primary airway cells ferret, which, as discussed below, revealed that three of these synthetic enhancers (F1, F5 and F10) significantly contributed to transcription of the tg83p luciferase transgene in the context of plasmid transfection. The next step was to construct rAAV reporter vectors with preselected candidates (F1, F5, or the tg83p enhancer/promoter combination and F5). These vectors also included a partial sequence of the gene of interest (here CFTR) that could fit into the rAAV genome as much as possible; this approach allows screening of cDNA sequences that will ultimately be found in the recombinant virus and also influences enhancer/promoter activity through unknown processes (likely DNA secondary structure). Analysis in polarized cultures of human and ferret airway epithelium at the air-liquid interface (ALI) in the context of AAV vector infection revealed that the combination F5tg83 (183 bp in length) was the most effective promoter in both ALI cultures, leading to 19.6-fold and 57.5-fold increases in reporter expression (firefly luciferase), respectively, relative to the enhancerless counterpart. The F5tg83 promoter also caused the highest level of transgene expression in the ferret airway in vivo. Finally, the F5tg83 promoter was used in the rAAV-CFTR vector to drive CFTR expression, the vector (AV. F5tg83CFTRAR) gave an approximately 17-fold increase relative to the enhancerless vector (AV.tg83CFTRR) in vector-driven transcription of CFTR mRNA and significantly improved Cl ^- currents in CF ALI -human cultures.

Thus, expression was increased from rAAV vectors having a large transgene using small synthetic enhancer/promoter combinations having a specific 83-mer synthetic core promoter and a set of random synthetic 100-mer synthetic enhancers. In particular, several combinations of short synthetic promoters/enhancers of 183 bp. (F5tg83, F1tg83 and F10tg83) are capable of detecting strong transgene expression in human airway cells as well as non-human mammals (such as the ferret). In one embodiment, the robust F5tg83 promoter can be used in an rAAV vector to deliver the 4.4 kb cystic fibrosis transmembrane conductance regulator (CFTR). for gene therapy of cystic fibrosis.

The invention is further described using the following non-limiting examples.

Example 1.

Materials and methods.

Preparation of rAAV vectors. All rAAV vector stocks were generated in HEK293 cells by

- 7 043850 taccctcgagaacggtgacgtg (SEQ ID No. 7). ggagatgcgcctgtctcctggaatg (SEQ ID No. 8) triple co-plasmid transfection using an adenovirus-free system and purified by two rounds of CsCl ultracentrifugation as given in Yan et al. (2004). For all viral vectors and proviral plasmids, rAAV2 genomes were used and packaged into the AAV2 or AAV1 capsid to generate rAAV2/2 and rAAV2/1 viruses, respectively. TaqMan real-time PCR was used to quantify the physical titer (DNase-resistant particles, DRPs) of purified viral stocks as described in Yan et al. (2006) and Ding et al. (2006). The PCR primer/probe set used to titrate the luciferase vectors is:

5'-TTTTTGAAGCGAAGGTTGTGG-3' (forward primer) (SEQ ID No. 1),

5'-CACACACAGTTCGCCTCTTTG-3' (reverse primer) (SEQ ID No. 2) and

5'-FAM-ATCTGGATACCGGGAAAACGCTGGGCGTTAAT-TAMRA-3' probe) (SEQ ID No. 3);

the primer/probe set used for ferret CFTR vectors is 5'-GACGATGTTGAAAGCATACCAC-3' (forward primer) (SEQ ID #4),

5'-CACAACCAAAGAAATAGCCACC-3' (reverse primer) (SEQ ID No. 5) and

5'-FAM-AGTGACAACATGGAACACATACCTCCG-TAMRA-3' (probe) (SEQ ID NO: 6).

All primers and probes were synthesized using IDT (Coralville, IA). The PCR reaction was performed and analyzed using a real-time PCR detection system and Bio-Rad My IQTM B software.

Analysis of the integrity of viral genomes. Viral DNA was extracted from 10 ⁹ DRP AAV-CFTR vectors and resolved on a 0.9% alkaline denaturing agarose gel at 2 0 volts overnight in 50 mM NaOH/1 mM EDTA buffer. After transfer to a nylon membrane, Southern blotting was performed with a ³² P-labeled CFTR probe to visualize viral DNA. To test for 5' terminal genomic deletions in oversized rAAV vectors, 3.33 x 10 ⁸ DRPs of each virus (quantified by TaqMan PCR with fCFTR cDNA probe/primer set) were loaded onto a nylon membrane for slot blotting. First, the blots were hybridized with a set of three ³² P-labeled oligonucleotide probes for the minus strand of the rAAV genome: in the 5' sequence of the tg83 promoter: the center of the ferret CFTR cDNA: ; and the 3' sequence of the synthetic LiA: gcatcgatcagagtgtgttggttttttgtgtg (SEQ ID No. 9). After exposure to X-film, the membranes were stripped of probe and hybridized again with another set of three ³² P-labeled oligonucleotide probes complementary to the plus strand. NIH ImageJ software was used to quantify hybridization signal intensity to determine the appropriate number of genomes detected by each probe using serial dilutions of the proviral plasmid as standards.

Cell culture and transfection and infection conditions. Human airway cell lines A549 and IB3, as well as HEK293 cells, were cultured as monolayers in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and penicillin streptomycin and maintained in a 37°C incubator with 5% CO ₂ . Primary ferret airway cells were isolated and cultured as a non-polarized monolayer or on ALI to generate polarized epithelium as described in Liu et al. (2007). Polarized primary HAE was generated from lung graft airway tissue as described by Karp et al. (2002) with the help of the Cells and Tissue Core of the Center for Gene Therapy at the University of Iowa. CuFi8 cells, a conditionally transformed cell line that was generated from ΔF508/ΔF508 CF airway cells (Zabner et al., 2003), were polarized on ALI using conditions similar to those used for primary HAE (Yan et al., 2003). 2013). Ferret and human airway epithelia were grown on 12 mm Millicell membrane inserts (Millipore) and differentiated using USG medium supplemented with 2% Ultroser G (Pall BioSepra, SA, France) on ALI before use. Cell lines and primary monolayer cultures of airway cells were transfected with plasmids using Lipofectamine and 1.0 μg of plasmid. For rAAV infections of A549 cells, polarized human or ferret airway epithelial cells, vectors were typically left in culture medium for 24 h (A549 cells) or 16 h (polarized cells). For apical infection of polarized HAE ALI cultures, vectors were diluted in USG medium to a final volume of 50 μl and added to the upper chamber of a Millicell insert. For basolateral infection, vectors were added directly to the culture medium in the lower chamber. Proteasome inhibitors were added to the culture medium throughout the period of infection of polarized cells, 40 μM LLnL (N-acetyl-L-leucine-L-leucine-L-norleucine) and 5 μM doxorubicin in the case of human polarized cells and 10 μM LLnL and 2 µM doxorubicin in CuFI ALI and ferret ALI cultures. Epithelia were exposed to viruses and chemical compounds for 16 hours and then removed. At this point, the Millicell inserts were quickly washed with a small amount of USG medium and only fresh USG medium was added to the bottom chamber. Doxorubicin was obtained from Sigma (St. Louis, MO) and LLnL was obtained from Boston Biochem (Cambridge, MA).

- 8 043850 rAAV infection of ferret lungs. All animal experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committee of the University of Iowa. In vivo infection of ferret lungs was accomplished by intratracheal injection of 300 μl of inoculum containing 2x1011 DRP rAAV2/1 and 250 μM doxorubicin. Before infection at 5 days of age, ferret pups were anesthetized by inhalation of a mixture of isoflurane and oxygen. On day 8 postinfection, animals were sacrificed by intraperitoneal injection of an excessive dose of sodium pentobarbital. For luciferase expression analysis, a container containing ferret trachea and lungs was immediately frozen in liquid nitrogen and then ground into powder using a cryogenic tissue grinder. 1 ml Passive Lysis Buffer (Promega, Madison, WI) was added to the powdered tissue to extract protein. After four freeze-thaw cycles, the tissue extract was centrifuged at 15,000 rpm for 5 min, and the clarified tissue extract was used for luciferase assay using a luciferase assay kit from Promega.

Measurement of firefly luciferase reporter expression. At the indicated times after infection or transfection, cells were lysed using luciferase cell lysis buffer, and luciferase enzymatic activity in cell lysates was determined using the Luciferase Assay System (Promega) in a 20/20 luminometer equipped with an auto-injector (Turner Biosystems, Sunnyvale, CA).

Short circuit current measurement. Transepithelial short circuit currents (Isc) were measured using an epithelial voltage clamp (Model EC-825) and a Ussing self-contained chamber system (both purchased from Warner Instruments, Inc., Hamden, CT) as described in Liu et al. (2007). Throughout the experiment, the chamber was kept at 37°C and the solution in the chamber was aerated. The basolateral side of the chamber was filled with Ringer's buffer solution containing 135 mM NaCl, 1.2 mM CaCl ₂ , 1.2 mM MgCl ₂ , 2.4 mM KH2PO4, 0.2 mM K2HPO4 and 5 mM Hepes, pH 7.4. The apical side of the chamber was filled with low chloride Ringer's solution in which NaCl was replaced by 135 mM sodium gluconate. The transepithelial voltage was fixed at zero, current pulses were applied every 5 s, and the short-circuit current was recorded using a VCC MC8 multichannel voltage/current clamp (Physiologic Instruments) and Quick DataAcq software. The following chemicals were sequentially added to the apical chamber: (1) amiloride (100 μM) to inhibit epithelial sodium conductance by ENaC; (2) 4,4'diisothiocyanato-stilbene-2,2'-disulfonic acid (DIDS) (100 μM) to inhibit non-CFTR chloride channels; (3) cAMP agonists forskolin (10 μM) and 3-isobutyl-1-methylxanthine (IBMX) (100 μM) to activate CFTR chloride channels; and (4) CFTR inhibitor GlyH-101 (N-(2ligroinlenyl)-[(3,5-dibromo-2,4-dihydroxyphenyl)methylene]glycine hydrazide) (10 μM) to block Cl ⁻ secretion through CFTR. ΔIsc was calculated from the differences in the Cl ⁻ plateau measurement averaged over the 45 s before and after each change in condition (chemical stimulus).

Quantitative analysis of vector-derived CFTR mRNA after transduction with rAAV. Total RNA from rAAV-infected cells was prepared using the RNeasy Mini plus Kit (Qiagen). Because residual ssDNA rAAV genome in an RNA sample may represent an undesirable template for conventional real-time PCR, a modified rAAV vector-derived RNA-specific PCR method ⁴⁶ was used to detect vector-derived ferret CFTR mRNA. Briefly, 1st-strand cDNA synthesis was initiated using an adapter-linked (lowercase) vector-specific primer that targets a synthetic polyadenylation signal sequence (uppercase). The sequence of this primer is

5'-gcacgagggcgacugucaUGAUCGAUGCAUCUGAGCUCUUUAUUA-3' (SEQ ID No. 10), where all dT are replaced with dU. After RNase H digestion was performed to eliminate the RNA templates, a ferret CFTR-specific primer (5-TGCAGATGAGGTTGGACTCA-3; SEQ ID NO: 11) was used to synthesize the 2nd strand. To avoid spurious amplification with cDNA derived from single-stranded viral DNA, all dU components in the 1st and 2nd strand cDNA products, as well as redundant adapter primers, were digested using uracil-N-glycosylase (UNG). This produced a 2nd strand cDNA product linked to a complementary adapter sequence that was derived exclusively from rAAV transcripts. The TaqMan PCR primer set contained the ferret CFTR sequence 5'-CAAGTCTCGCTCTCAAATTGC-3' (SEQ ID no. 12) and the adapter sequence 5'-GCACGAGGGCGACTGTCA-3' (SEQ ID no. 13).

The TaqMan probe used was

5'-F^-ACCTCTTCTTCCGTCTCCTCCTTCA-TAMRA-3' (SEQ ID No. 14) .

Results Synthetic oligonucleotide enhancers that enhance tg83 promoter-driven transcription in airway cells.

A previous unbiased screen evaluating short synthetic enhancers from a library containing 52,429 unique sequences identified enhancer elements capable of activating transcription from the minimal cytomegalovirus (CMV) IE promoter

- 9 043850 torus in 128 p.o. (-53 to +75) in HeLa cells (Schlabach et al., 2010). This library contained all possible 10-mer DNA sequences printed on microarrays in the form of 10 tandem repeats (total length 100 bases each). The most effective 100-mer oligonucleotides enhanced transcription of this minimal 128-bp CMV IE promoter. up to 75-137% of that induced by the CMV IE wild-type 600 bp promoter. (Schlabach et al., 2010). In previous studies, the 83-bp synthetic promoter sequence (tg83) was used to express the full-length CFTR gene from the rAAV vector (AV2.tg83-CFTR), and was found to induce higher transgene expression in CF HAE cultures than the cryptic promoter from the AAV2 ITR (Zhang et al., 2009). The tg83 promoter consists of an ATF-1/CREB site and a Sp1 binding site from the Na subunit α1 promoter, K-ATPase and TATA box, and a transcription initiation site from the CMV IE promoter. It is hypothesized that combining the tg83 promoter with a synthetic enhancer identified through library screening will produce transcription units with higher efficiency in polarized human and/or ferret airway epithelium in vitro and in vivo. To test this possibility, the top eight enhancer sequences identified by Schlabach et al. (F1, F4, F5, F10, C9, D3, CREB6 and CREB8; Schlabach et al., 2010) were assessed for their ability to enhance tg83 transcription in human and ferret airway epithelium.

Fl

AGTCAGGGCAAGTCAGTGGCAAGTCAGGGCAGTCAGGGCAGTCAGGGCAAGTCAGGGCA

AGTCAGGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCA (SEQ ID No. 15)

F10 gaattgacgcatatattgacgcatattgacgcaaattgacgcaaatgacagcaagattg acgcaaattgagcgcaaattgacgcaaattaattgacgcat (SEQ ID No. 16) F4

CTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGAGCAAT CTGATGCAATCTGATGCAATATGATGAATGTGATGCAAT (SEQ ID No. 17)

F5

TGGTGAGCGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCGGGCATTC

TGGGCGTCTGGGCATGTCTGGGCATGTCTGGGCA (SEQ ID No. 18)

C3

GCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGAGCAA TCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATT (SEQ ID No. 19)

D9

GCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGAGCAA TCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATT (SEQ ID No. 20)

CREB6

ATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCG

G (SEQ ID No. 21)

CREB8

ATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCG

GATTGACGCGGATTGACGCG (SEQ ID No. 22)

Enhancer/Promoter Combinations: tg83 ctcgagaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgctatataagca gagctcgtttagtgaaccgtcaga (SEQ ID no. 23)

Fltg83

AGTCAGGGCAAGTCAGTGGCAAGTCAGGGCAGTCAGGGCAGTCAGGGCAAGTCAGGGCA

AGTCAGGGCAAGTCAGGGCAAGTCAGGGCAAGTCAGGGCActcgagaacggtgacgtgcacgcg tgggcggagccatcacgcaggttgctatataagcagagctcgtttagtgaaccgtcaga (SEQ ID No. 24)

F10tg83

GAAT T GAC GCATATAT T GACGCATAT T GACGCAAAT T GACGCAAAT GACAGCAAGAT T G

ACGCAAATTGAGCGCAAATTGACGCAAAATTAATTGAC

- 10 043850 ctcgagaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgctatataagcagagct cgtttagtgaaccgtcaga (SEQ ID No. 25) F4tg83 CTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGAGCAAT C T GAT GCAAT C T GAT G CAATAT GAT GAAT G T GAT GCAAT ctcgagaacggtgacgtgcacgcgtgggcggagccatcacgcaggttgctatataagcagagct cgtttagtgaaccgtcaga (SEQ ID no. 26) F5tg83 GTGGTGAGCGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCTGGGCATGTCGGGCATT CTGGGCG TCTGGGCATGTCTGGGCATGTCTGGGCATctcgagaacggtgacgtgcacgcgtggg cggagccatcacgcaggttgctatataagcagagctcgtttagtgaaccgtcaga (SEQ ID No. 27) C3tg83

GCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGAGCAA

TCTGATGCAATCTGATGCAATATGATGAATGTGATGCAATTctcgagaacggtgacgtgcacgc gtgggcggagccatcacgcaggttgetatataagcagagctcgtttagtgaaccgtcaga (SEQ ID no. 28) D9tg83 GCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGATGCAATCTGAGCAA TCTGATG CAATCTGATGCAATATGATGAATGTGATGCAATTctcgagaacggtgacgtgcacgc gtgggcggagccatcacgcaggttgetatataagcagagctcgtttagtgaaccgtcaga (SEQ ID #29) CREB6tg83 ATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCGGATTGACGCG Gctcgagaacggt gacgtgcacgcgtgggcggagccatcacgcaggttgctatataagcagagc tcgtttagtgaaccgtcaga (SEQ ID No. 30)

The tg83 promoter was cloned into the promoterless luciferase reporter plasmid pGL3Basic Vector (Promega) to generate pGL3-tg83. A series of luciferase reporter expression plasmids were then constructed into which one of the eight 100-mer enhancers upstream of the tg83 promoter was placed in pGL3-tg83 (Fig. 1A). Comparison of reporter expression with pGL3-tg83 and its enhancer-containing derivatives was performed in monolayer (non-polarized) cultures of two human airway cell lines (A549 and IB3) and primary ferret airway cells (Fig. 1B-1D). Two additional luciferase expression plasmids, pAV2-CMV-luc (contains the wild-type CMV IE enhancer-promoter, 600 bp) and pAV2-CBA-luc (contains the CMV IE enhancer-chicken β-actin promoter, i.e., CBA promoter) were included as controls for high-level promoter activity. Assessment of luciferase expression after plasmid transfection showed that all enhancers tested increased tg83-driven luciferase expression and that their efficiencies varied depending on the cell line: in cultures of human A459 cells and primary ferret airway cells, F1tg83 and F5tg83 exceeded the activity of the CBA and CMV promoters; and in human IB3 cell cultures, F10tg83 was most effective but produced significantly less expression than the CMV promoter (Fig. 1B-1D).

The F5 element most effectively enhances tg83-driven transcription in polarized human and ferret airway epithelia in vitro and in ferret airways in vivo.

Because the F1, F5, and F10 enhancers are most effective at activating tg83-driven transcription in monolayer cultures of airway cells, the ability of these elements to promote transcription was assessed in the context of rAAV vector genomes. Four rAAV proviral vectors carrying a luciferase expression cassette were constructed with expression under the control of tg83 (enhancerless), F1tg83, F5tg83, or F10tg83. The proviral plasmid pAV2-tg83-fCFTR was used as a template vector for cloning, its promoter and the 5' part of the fCFTR coding region were replaced with a 2.1 or 2.2 kb luciferase expression cassette. The genome size was 4.75 kb. in the case of rAV2.tg83luc and 4.85 kb. for enhancer-containing vectors. This design was used for two reasons. First, maintaining as much fCFTR sequence as possible ensured that the vector genome size would be similar to that of the rAAV-CFTR expression vectors that would eventually be generated. Second, conservation of fCFTR cDNA regions maximized the potential impact of the ferret CFTR sequence on enhancer function.

As a first step to investigate the effect of the AAV ITR and the portion of the fCFTR transgene sequence to be tested (i.e., the 3' half of the fCFTR cDNA) on transcription from the tg83 promoter, reporter expression from the pGL3-tg83 and pAV2-tg83luc plasmids were compared after transfection into monolayer cultures of A549 and primary ferret airway cells. Plasmid pAV2-tg83luc was found to be 2.5-fold (in A549) and 2-fold (in primary ferret airway cells) trans

- 11 043850 transcriptionally more active than the pGL3-based plasmids (Fig. 2A), suggesting that inclusion of the AAV ITR and/or extra fCFTR sequences had an overall positive effect on tg83 promoter activity. Reporter gene expression was then compared for plasmids pAV2F1tg83luc, pAV2-F5tg83luc, pAV2-F10tg83luc, and pAV-tg83luc. As expected, the F1, F5, and F10 enhancers significantly enhanced transcription from the tg83 promoter (approximately 10- to 19-fold) in both cell types (Fig. 2B). However, the efficiency of almost all enhancers was significantly reduced (approximately 3- to 18-fold) in rAAV proviral plasmids compared to pGL3-tg83 plasmids, which lack the ITR and CFTR sequence (Fig. 2B, filled bars versus Fig. 1B; Fig. 2B, open bars compared to Fig. 1D). This suggests that sequences from the AAV ITR and/or portions of the ferret CFTR cDNA have an overall negative effect on enhancer function. However, this effect on synthetic enhancers differed between monolayers of A549 and primary ferret airway cells. In A549 cells, the F1 enhancer experienced the most significant effect, with its activity in the rAAV proviral plasmid decreasing by 18.1 times, while that of the F5 and F10 enhancers decreased only by 8.2 times and 3.8 times, respectively. In primary ferret airway cells, the F1 and F5 enhancers were 4.4-fold and 2.8-fold decreased in activity, respectively, in the context of a proviral plasmid, whereas F10 function was slightly increased (approximately 40%).

Expression from various enhancer elements was then assessed in the context of rAAV2/2 vectors. In A549 cells, similar increases in expression from the tg83 enhancer/promoter combination were observed following transfection with a proviral plasmid and infection with the corresponding rAAV vector (Fig. 2B, filled bars versus Fig. 2C). Primary ALI cultures of human and ferret airway epithelium were then infected with equal titers of each rAAV vector, and transgene expression was assessed at 2 days postinfection. These experiments demonstrated that F5tg83 was the most efficient promoter in both human and ferret ALI cultures (Figures 2D and 2E), resulting in 19.6-fold and 57.5-fold increases, respectively, in tg83-driven transcription relative to that driven by enhancerless control (Figs. 2D and 2E). It is noteworthy that the differentiated state of ferret airway epithelial cells appears to have a significant impact on expression from different tg83 enhancer/promoter combinations in the context of rAAV transduction; the F5 enhancer more effectively increased tg83 expression in polarized epithelium (Fig. 2E; 57.5-fold) than in undifferentiated monolayers (Fig. 2B; 16.6-fold); The F1 enhancer only slightly increased tg83 promoter activity in polarized cells, but increased transgene expression by 13.8-fold in monolayer cells.

Finally, the in vivo activities of the F5tg83 and F10tg83 promoters were compared in the respiratory tract of newborn ferrets using intratracheal injection of two rAAV1 pseudotyped capsid vectors (AV2/1.F5tg83luc and AV2/1.F10tg83luc; equal particle titers were injected). This capsid serotype was previously shown to be effective in transducing ferret airways in the presence of a proteasome inhibitor (Yan et al., 2013). Luciferase activity was measured in extracts obtained from tracheal and lung tissue at day 8 postinfection, and F5tg83 was found to be more efficient than F10tg3 in transducing both ferret lungs and trachea (Fig. 2F). These findings were consistent with those of polarized ALI cultures of ferret airway epithelium ( Fig. 2E ).

Narrow limits on rAAV genome size have a significant impact on the functionality of rAAV-CFTR vectors without affecting packaging efficiency.

The expected genome size of AV.tg83fCFTR if fully packaged is 4.937 kb. (Fig. 3A). Incorporation of the F5 enhancer increases it to 5,040 kb. Although the ability of AAV to encapsid the rAAV genome slightly longer than its natural size (4.679 kb) is generally accepted, the gradual increase in the size of the rAAV vector from 4.675 kb. up to 4.883 t.o. and 5.083 t.o. leads to a 25 and 75%, respectively, reduction in transduction (Dong et al., 1996). In addition, single-molecule sequencing (SMS) of the two ends of rAAV after packaging the proviral genome into 5.8 kb. showed that the 5' ITR is unstable and has costs in the form of deletions (Kapranov et al., 2012). Given that the limits for packaging a functional genome in the context of rAAV-CFTR vectors have not yet been determined, it was not clear whether the 5.04 kb AV.F5tg83fCFTR genome would be. compromised with respect to genome stability and function.

This question was examined by constructing the 5,036 kb vector AV2.tg83-fCFTR(HA), in which the CFTR expression cassette was extended by adding a 3xHA epitope tag (99 nucleotides) to the region encoding the fourth extracellular loop (ECL4) of ferret CFTR ( previous studies have shown that this insertion has no effect on chloride channel function (Glozman et al., 2009; Fisher et al., 2012). This vector allowed the inventors to test how genome size affects CFTR functionality in the absence of changes in transgene transcription. Two rAAV2 vectors (AV2/2.tg83-fCFTR and AV2/2.tg83-fCFTR-HA; Fig. 3A) were generated and their ability to generate CFTR-mediated chloride currents in polarized CF HAEs was assessed. The vector yield for the two viruses was almost the same (AV2/2.tg83-fCFTR approximately 5x109 DRP/μl and AV2/2.tg83

- 12 043850 fCFTR(HA) approximately 3x10 ⁹ DRP/µl). Polarized CF HAE were cultured on ALI and infected at a relatively high multiplicity of infection (MOI) of approximately 10 ⁵ DRP/cell (10 ¹¹ DRP of each rAAV2 vector per insert). At day 10 postinfection, the expression level of CFTR was determined by measuring the short circuit current (Isc) as described in Zhang et al. (2004) and Fisher et al. (2011). In fig. 3B shows a typical Isc curve following CF HAE infection using AV2/2.tg83-fCFTR or AV2/2.tg83-fCFTR-HA. Amiloride and DIDS were first used to block non-CFTR chloride channels and ENaC-mediated sodium currents, and then cAMP agonists (IBMX and forskolin) were used to induce CFTR activity. Changes in Isc after addition of IBMX and forskolin (AIscIMBX & Forsk) and subsequent addition of the CFTR inhibitor GlyH101 (AIscglyH) were used to assess CFTR function. These results clearly showed that functional complementation of CFTR activity in CF HAE is higher following infection with AV2/2.tg83-fCFTR than with AV2/2.tg83-fCFTR-HA (Fig. 3B). The average AIscIBMX & Forsk and AIscglyH values from these experiments are summarized in FIG. 3C. CFTR-mediated cAMP-inducible Cl- currents produced by AV2/2.tg83-fCFTR(HA) were only 3.6% of those in non-CF HAE ALI cultures, but still above background levels (p<0. 01). In contrast, infection with AV2/2.tg83-fCFTR generated 10-fold higher cAMP-inducible Cl ⁻ currents than AV2/2.tg83-fCFTR(HA) and achieved approximately 30% CFTR activity in non-CF HAE ALI cultures. These results demonstrate that the limits for maintaining CFTR function are very narrow when overly large rAAV genomes are produced and that vector functionality does not depend solely on the efficiency of DRP packaging. In addition, these studies indicate that insertion of the 100-nucleotide F5 enhancer into AV2/2.tg83-fCFTR, with a total genome size of 5.04 kb, may have a significant negative impact on genome function.

Efficient packaging of a functional ferret CFTR minigene into rAAV.

We next explored the possibility of using a truncated ferret CFTR minigene to further reduce the genome size of the rAAV-CFTR vector and allow insertion of the F5 enhancer. It has been reported that the human CFTR minigene (CFTRAR) With a partial deletion of the R domain at 156 bp. (encoding amino acids 708–759) retains most of the chloride channel activity of the full-length protein (Ostedgaard et al., 2002; Ostedgaard et al., 2011). The fCFTRAR minigene was created by deleting the 159 bp homologous sequence encoding amino acids 708-760 at the corresponding position of the human protein, yielding two additional vectors: AV2/2.tg83-fCFTRAR (4,778 kb) and AV2/2. tg83-fCFTRAR(HA) (4.877 kb). This pair of vectors made it possible to study not only the function of the fCFTR minigene in CF HAE ALI cultures, but also the effect of insertion of the HA tag into the fCFTR gene. Analysis of the responses of AIscIBMX & Forsk and AIscglyH to these two viruses showed that both AV2/2.tg83-fCFTR and AV2/2.tg83-fCFTR(HA) created significant CFTR-mediated Cl ^- currents after infection of CF HAE ALI cultures (Fig. .3C). However, the HA-labeled form produced approximately 20% less Cl current than AV2/2.tg83-fCFTRAR. This finding is consistent with 4.88-kb rAAV vectors, which have only approximately 25% of the functional activity of 4.68-kb vectors. (Dong et al., 1996). Alternatively, the HA tag itself may influence CFTR function in the context of R domain deletion, although in the context of full-length CFTR the ECL4 HA tag has no effect on ^Cl channel function (Glozman et al., 2009; Fisher et al., 2009). al., 2011). Despite the larger genome size of AV2/2.tg83-fCFTR (4.9437 kb), this vector generated approximately 30% greater CFTR-mediated current than its shorter counterpart AV2/2.tg83-fCFTRAR (4.778 kb). thus) (Fig. 3C). This decrease in fCFTRAR Cl ^channel activity is similar to that of hCFTRAR (Ostedgaard et al., 2002). However, given the potential for reduced functionality in larger vector genomes, the impact of R domain deletion on ferret CFTR protein function is likely greater than that on human CFTR.

To determine the effect of genome length on the packaging of the rAAV vectors tested, the integrity of the viral genome was examined using alkaline denaturing agarose gel electrophoresis followed by Southern blotting (Fig. 4A). This analysis showed that the smallest vector genome (i.e., from AV2.tg83-fCFTRAR, 4,778 kb) could be distinguished from the other three viruses based on its faster migration through the gel (AV2.tg83-fCFTRAR is 99 nucleotides shorter than the vector AV2.tg83-fCFTRΔR(HA)). However, AV2.tg83-fCFTR(HA) (5.036 kb), AV2.tg83-fCFTR (4.937 kb) and AV2.tg83-fCFTRΔR(HA) (4.887 kb) cannot be distinguished from each other based on this analysis. Considering that, it may be possible to visualize differences of both 149 nucleotides (AV2.tg83-fCFTR(HA) versus AV2.tg83-fCFTRΔR(HA)) and 99 nucleotides (AV2.tg83-fCFTR(HA) versus AV2.tg83fCFTRΔR (HA) and AV2.tg83-fCFTR(HA) versus AV2.tg83-fCFTR), these findings were interpreted as supporting the view that viral genomes that are larger than those of AV2.tg83fCFTRΔR(HA) (4,887 kb .), are prone to undergo deletions that compromise expression of the CFTR transgene.

The view that the deletion occurs in the context of longer genomes was further supported by hybridization of viral genomes with two sets of plus and minus oligonucleotide probes

- 13,043,850 strands in the center of the CFTR cDNA, tg83 promoter and synthetic polyA sequences (Fig. 4B). The results of this analysis showed that viral DNA from the largest vector AV2.tg83-fCFTR(HA) was subject to deletions at the 5' ends of the plus and minus strand genomes. In contrast, the 3′ ends of the AV2.tg83-fCFTR(HA) plus- and minus-strand genomes remained intact, consistent with the packaging of single-stranded AAV genomes in a 3′ to 5′ direction. The fact that the hybridization strength at the tg83 promoter (for the plus strand) and the polyA sequence (for the minus strand) was lower than that for fCFTR cDNA hybridizations suggested that these deletions were not limited to the ITR region (i.e., that the damage was spreading into a CFTR expression cassette). Such deletions were not observed in the second longest vector, AV2.tg83-fCFTR, therefore the CFTR expression cassette in this vector most likely still remains intact, although partial deletions in the ITR region are likely to occur as predicted by viral DNA migration in a denaturing agarose gel. Although deletions in ITR regions may not directly affect CFTR transgene expression, they may affect the stability of viral genomes and thus indirectly affect CFTR expression. These results, together with the functional analysis, lead to the conclusion that the fCFTRAR cDNA without the HA tag is best suited to test the effect of the F5 enhancer on rAAV-mediated addition of CFTR.

The synthetic F5tg83 promoter improves rAAV-mediated addition of CFTR.

Next, the proviral plasmid pAV2.F5tg83-fCFTRAR was created and the AV2/2.F5tg83fCFTRAR virus with a genome size of 4.87 kb was obtained. The effectiveness of this virus to complement CFTR channel function following infection of polarized CF HAE was compared with that of a similar enhancerless vector (AV2.tg83-fCFTRAR).

The results of this analysis showed that integration of the F5 enhancer significantly improved CFTR-mediated Cl ^- currents (Fig. 5). Two weeks after basolateral infection at an MOI of 5x10 ⁴ DRP/cell, cAMP-induced CFTR-mediated Cl currents for AV2/2.F5tg83fCFTRAR were 3.5 times higher than AV2/2.tg83-fCFTRAR, and the former accounted for 89% of that , which was observed in non-CF primary HAE. A similar enhancement of CFTR function (4.8-fold) was observed using AV2/2.F5tg83-fCFTRAR following apical infection, but in this case the transduction efficiency was significantly lower as previously reported for this serotype. At a reduced MOI of 1x104 DRP/cell basolaterally, AV2/2.F5tg83-fCFTRAR caused 69% of the CFTR current generated by this vector at a 5-fold increased MOI, suggesting that in the latter case the addition of CFTR function had reached saturation. Thus, when the efficiency of the AV2/2.F5tg83-fCFTRAR (lx 104 DRP/cell) and AV2/2.tg83-fCFTRAR (5x104 DRP/cell) vectors is compared in the context of optimal infection (i.e., basolateral) and non-saturating conditions, insertion of the F5 enhancer improved the vector effect by 13.5 times. This level of increase in current is consistent with the increase in expression observed using similar luciferase expression vectors (Fig. 2D, 19.6-fold).

Given the apparent saturation of CFTR currents at the highest MOI (5x104 DRP/cell) after basolateral infection with AV2/2.F5tg83fCFTRAR, CFTR expression kinetics were assessed at an intermediate MOI (2x104 DRP/cell). Measurements were performed on days 3 and 10 after CF HAE infection using AV2/2.F5tg83-fCFTRAR and AV2/2.tg83-fCFTRAR. The results of this analysis showed that, in the context of the F5 enhancer, the onset of CFTR-mediated Cl ^- currents was more rapid than in its absence (Fig. 6A). In fact, CFTR currents were maximal at day 3 postinfection using AV2/2. F5tg83-fCFTRAR, while currents increased 3.6-fold between 3 and 10 days after infection using AV2/2.tg83-fCFTRAR. To more directly compare the transcriptional activity between these vectors, ferret CFTR mRNA was examined using RNA-specific real-time reverse transcriptase PCR (RS-PCR), a method that prevents amplification of DNA products of vector origin and has previously been used to detect CFTR mRNA from rAAV-infected cells and tissues (Zhang et al., 2004; Gerard et al., 2003). Analyzes of RS-PCR results, after normalization to ferret GAPDH transcripts, showed 6.4-fold and 17.1-fold increased fCFTR mRNA levels following infection with AV2.F5tg83-fCFTRAR compared with AV2/2.tg83-fCFTRAR, at time on days 3 and 10, respectively (Fig. 6B). The 10-fold increase in CFTR mRNA that was observed between days 3 and 10 postinfection confirms that CFTR currents were saturated by day 3 postinfection. Thus, at the transcriptional level, insertion of the F5 enhancer increased CFTR expression by 17.1-fold, closely mirroring the results observed using luciferase expression vectors ( Fig. 2D , 19.6-fold).

Discussion.

rAAV vectors have received significant attention in human gene therapy, but their inherently small genome (4,679 kb) poses a significant challenge for delivery of large genes such as CFTR. Although several laboratories have attempted to rationally engineer short enhancers and promoters for use in rAAV vectors, this approach has yet to yield reliable expression of CFTR in the airways. This study took a completely empirical approach by screening synthetic enhancers for their effectiveness in delivering reporter gene expression in a stepwise manner - in plasmids, proviral vectors and viral vectors. Although the primary goal was to develop rAAV vectors to deliver CFTR to the airways, a similar approach may be effective in gene therapy efforts aimed at delivering other large genes (eg, factor VIII and dystrophin) that necessitate the use of short promoters.

It is known that making an rAAV genome too large leads to random deletions at the 5' ends of single-stranded capsid genomes (Kapranov et al., 2012), but the functional integrity of rAAV vector genomes that approach the generally accepted maximum rAAV capacity (approximately 5.0 thus), has not been thoroughly studied. This study provides, in the context of CFTR-expressing rAAV vectors, evidence that the functionality of the rAAV genome begins to decline well below this 5.0 kb threshold. Evidence supporting this includes a reduction in CFTR function for a 4,877 kb genome. compared to a genome of 4,778 kb. (Fig. 3C) and no differences in the migration of single-stranded genomes at 4,877-5,036 kb. when visualized on alkaline gels (Fig. 4A). Additionally, the largest CFTR vector (5,036 kb) is subject to deletion in approximately 30% of genomes that extends beyond the 5' ITR and into the promoter (in the case of the plus strand) or polyA region (in the case of the minus strand). This suggests that damage to the CFTR expression cassette may be responsible for the significant attenuation of CFTR function delivered by this vector. Although the oligoprobes used detected only deletions in 30% of the genomes for this largest construct, a 90% reduction in CFTR chlorine current between the 4.937 and 5.036 kb vectors. suggests that a significantly higher percentage of genomes are susceptible to functional deletions and that ITR deletions may also impair vector efficiency.

These findings appear inconsistent with the previous observation of only a 4-fold change in transgene expression between 4.7-kb rAAV vectors. and 5.2 t.o. (Wu et al., 2010). However, in this earlier study, the extra sequence used to extend the vector was located between the expression cassette and the ITR, and deletions of the extra sequence would likely have less of an impact on the transcriptional activity of the transgene. In this study, the AAV-CFTR vectors used a short synthetic promoter and polyA signal instead, and small deletions in these short transcriptional regulatory elements would have expected to have a significant effect on gene expression. Since the titer of DNase-resistant particles is typically used to confirm efficient packaging of rAAV genomes, small 5'-terminal deletions will have a significant impact on the functionality of oversized rAAV vectors.

The empirical approach used to screen synthetic 100 bp. enhancers in their ability to enhance rAAV-mediated transgene expression in the airways provided several important observations: 1) enhancer activity varied depending on cell lines as well as the differentiation state of the cells; 2) enhancer activity was influenced by the AAV ITR and also possibly influenced by the sequence of the gene of interest (in this study, the 3' half of the coding region of the ferret CFTR cDNA); 3) enhancer activity in the context of rAAV infection is generally similar to that in the context of a proviral vector, although with minor differences; 4) infection of human and ferret respiratory tracts using viral vectors showed some differences in enhancer function (most notable for AV2/2.F1tg83luc, Figs. 2D and 2E). These results indicate that although proviral plasmid transfection is suitable for initial screening of synthetic enhancers, performing such screens in nonpolarized primary airway cultures may not produce the same gene expression patterns observed following AAV infection of polarized airway cultures.

Using this screen, a 100 bp synthetic enhancer was identified. (F5), which significantly improves the transcriptional activity of the 83 bp synthetic promoter. (tg83), in polarized cultures of both primary human and ferret airway epithelial cells, and in ferret lungs and trachea in vivo. The ferret CFTR minigene lacking part of the 53 amino acid R domain (fCFTRAR) retained approximately 70% of the function of wild-type fCFTR, similar to the 80% retention of function in a similar hCFTRAR construct reported previously (Ostedgaard et al., 2002). However, this is significantly offset by increased transgene expression with AV2.F5tg83-fCFTRAR, since the use of a truncated minigene saves 150 bp of space to allow insertion of the F5 enhancer. In the context of the rAAV vector, the F5 enhancer significantly enhanced tg83-driven CFTR mRNA expression (17.1-fold) at 10 days post-CF HAE infection relative to the AV2/2.tg83-fCFTRAR vector, which does not contain this enhancer. This increase in CFTR mRNA expression with AV2/2.F5tg83-fCFTRAR correlated well with the 19.6-fold improvement in CFTR-mediated currents that this vector enabled and resulted in approximately 89% of the cAMP-mediated Cl ^- currents that were observed in not CF HAE.

- 15 043850

It is worth noting that a ceiling was found at the level of functional correction that can be achieved in relation to changes in Isc. In dynamic studies, the maximum correction of Isc in CF HAE was achieved at 3 days postinfection, with an approximately 10-fold increase in CFTR mRNA at 10 days postinfection, which did not bring about an improvement in Cl ^- currents (Fig. 6). These findings provide important insight for assessing the functionality of rAAV-CFTR vectors: dose-dependent vector effects are necessary to accurately compare vector designs. The ceiling of CFTR currents may be a reflection of self-limiting cell biology (eg, control of the total amount of CFTR at the plasma membrane), or aberrant directional migration of CFTR to the basolateral membrane at higher expression levels (Farmen et al., 2005).

Briefly, an rAAV-CFTR vector was generated that provides high-level expression suitable for use in lung gene therapy studies in a ferret model of CF. In addition, these findings suggest that small synthetic enhancers and promoters may be effective tools for optimizing the design of rAAV vectors for delivery of large transgenes.

Summary.

As discussed herein, a small synthetic enhancer/promoter combination of approximately 200 bp. or smaller, can be used in an rAAV vector to deliver efficient transgene expression to express a large transgene; in this study the genome is CFTR. Also discussed herein is an empirical approach for screening a set of 100-mer synthetic enhancer elements for their ability to enhance reporter expression from a short 83-bp synthetic promoter. (tg83p) in the tissue of the respiratory tract of the lungs. A partial sequence of the gene of interest (in this study, CFTR) is included in the reporter vector in order to maximize the effect of screening for the best enhancer sequence. Screening was carried out stepwise - in plasmids, proviral vectors and rAAV vectors, as well as at various cellular/tissue levels - in monolayer (non-polarized) cultures of human airway cell lines and primary ferret airway cells, in polarized cultures of human and ferret airway epithelium at the air-liquid interface (ALI) and the ferret airway in vivo. Enhancer activity varies among cell lines and cell differentiation state, and is also influenced by the AAV ITR and the sequence of the gene of interest. Thus, enhancer effects in the context of plasmid transfection may differ from those in the context of rAAV transduction. The effects of a particular enhancer in vivo may not be predictable based on its behavior demonstrated in cultured cell lines. Thus, screening must be performed at various cellular/tissue levels and in a stepwise manner across plasmids, proviral vectors, and rAAV vectors to ensure success.

Three synthetic enhancers (F1, F5 and F10) were found to significantly increase tg83p transcription for the luciferase transgene in the context of plasmid transfection. The F5tg83 promoter, a 183-bp combination of the F5 enhancer and tg83p, was the most efficient promoter in human and ferret ALI cultures, resulting in 19.6-fold and 57.5-fold increases in reporter expression, respectively, relative to the enhancerless counterpart. The F5tg83 promoter also produced the highest level of transgene expression in the ferret airway in vivo. When the F5tg83 promoter was used to transcribe the 4.2 kb CFTR minigene. (CFTRAR) In the rAAV vector, it produced an approximately 17-fold increase in vector-derived CFTR mRNA transcription and significantly improved Cl ^- currents in human CF ALI cultures compared to a vector using tg83p alone.

Enhancer/promoter combinations for lung epithelium (eg F5tg83) may not necessarily be also effective for other organs/tissues. For example, when AAV vectors carrying a luciferase reporter gene driven by F5tg83 or F10tg83 were used to infect various tissues/organs of the digestive system, F5tg83 showed the strongest promoter activity in the pancreas, gall bladder and liver, while F10tg83 was superior in efficiency F5tg83 in the small intestine (Fig. 7A-7B).

Although studies have focused on identifying a strong synthetic enhancer/promoter sequence used for efficient expression of CFTR in lung/airway tissue, the screening approach can be used for any desired cell types, tissues and organs in vitro and in vivo.

Thus, the use of short enhancer elements (approximately 100-mer synthetic oligonucleotide sequences consisting of 10-mer repeats) was found to enhance gene expression from a minimal promoter in rAAV vectors. These 100 p.o. enhancer elements were previously identified by their ability to activate transcription under the control of the CMV immediate early (IE) minimal promoter in cell lines ( Schlabach et al., 2010 ). A hypothesis has been proposed that enhancers that are most powerful in activating transcription can be used to enhance the activity of the synthetic tg83 promoter in respiratory cells

- 16,043,850 pathways in the context of rAAV vectors. Eight combinations of the tg83 promoter and 100 bp synthetic enhancers were tested. and found that one designated F5 effectively enhanced transcription from the tg83 promoter in polarized airway cells (in vitro) derived from both humans and ferrets, as well as in ferret airways (in vivo). Using the F5tg83 promoter and the ferret CFTR minigene with a partial deletion in the R domain (fCFTRΔR), an rAAV vector (AV2/2.F5tg83-fCFTRAR) was found, which was tested for its ability to correct CFTR-mediated ^Cl transport in CF ALI cultures.

Example 2.

AV.F5Tg83-hCFTRAR was tested for hCFTR expression in the airways of neonatal and adult ferrets. The endpoint of these analyzes was the ratio of transgenic human CFTR (hCFTR) to endogenous ferret CFTR (fCFTR) mRNA. In newborn ferrets at 3 days of age (Fig. 9), AV.F5Tg83-CFTRΔR led to 240% higher expression of human CFTR compared to endogenous (ferret) CFTR after gene delivery to the lungs.

Given that ferret airway epithelial phenotype and airway secretion change with lung development, we assessed whether AV.F5Tg83-CFTRAR transduces the adult ferret airway and whether the promoter remains active. For this purpose, the ability of AV.F5Tg83-CFTRAR to transduce the lungs of 1 month old ferrets was assessed. In adult ferrets at 1 month of age (Fig. 10), AV.F5Tg83-CFTRAR led to 300% higher expression of human CFTR compared to endogenous (ferret) CFTR after gene delivery to the lungs. In addition, the ratio of human to ferret CFTR was approximately one in the nasal passage. These findings in neonatal and adult ferrets suggest that the F5tg83 promoter reliably expresses the CFTR transgene in the lung in vivo.

Literature

Aitken et al., Chest, 123:792 (2003).

Aitken et al., Hum Gene Then., 12:1907 (2001).

Carter, Hum Gene Ther., 16:541 (2005).

Conrad et al., Gene Ther., 3:658 (1996).

Daya & Berns, Clin. Microb. Rev., 21:583 (2008).

Ding et al., Gene Ther., 12:873 (2005).

Ding et al., Mol. Ther., 13:671 (2006).

Dong et al., Hum. Gene Ther., 7:2101 (1996).

Duan et al., Hum. Gene Ther., 9:2761 (1998).

Duan et al., J. Clin. Invest., 105:1573 (2000).

Farmen et al., Am. J. Physiol. Lung Cell Mol. Physiol., 289:1123 (2005).

Fisher et al., J. Biol. Chem., 287:21673 (2012).

Flotte et al., J. Biol. Chem., 268:3781 (1993).

Flotte, Curr. Opin. Mol. Ther., 3: 497 (2001).

Flotte, et al., J. Biol. Chem., 268:3781 (1993).

- 17 043850

Gerard et al., Gene Ther., 10:1744 (2003).

Glozman et al., J. Cell Biol., 184:847 (2009).

Griesenbach et al., Virus Adapt. Treat., 2:159, (2010).

Griesenback & Alton, Adv. Drug Deliv. Rev., 61:128 (2009)

Kapranov et al., Hum. Gene Ther., 23:46 (2012).

Karp et al., Methods Mol. Biol., 188:115 (2002).

Li et al., Mol. Ther., 17:2067 (2009).

Liu et al., Am. J. Respira. Cell Mol. Biol., 36:313 (2007)

Liu et al., Gene Ther., 14:1543 (2007).

Liu et al., Mol. Ther., 15:2114 (2007).

Moss et al., Hum. Gene Ther., 18:726 (2007)

Mueller & Fit stte, Clin. Rev. Allergy at Immunol. , 35:164 (2008). Olivier et al., , J. Clin. Invest., 122:3755 (2012). Ostedgaard et al., Proc. Natl. Acad. Sci. USA, 102:2952 (2005). Ostedgaard et al., Proc. Natl. Acad. Sci. USA, 108:2921 (2011) Ostedgaard et al., Proc. Natl. Acad. Sci. USA, 99:3093 (2002). 0'Sullivan & Freedman, Lancet, 373:1891 (2009) • Riordan et Rommens et Rowe et al. al. , al., . , N , Science, 245:1066 (1989) , Science, 245:1059 (1989) . Engl. J Med 352:1992 (2005) Schlabach et al., Proc. Natl. Acad. Sci. USA, 107:2538

(2010).

Summer-Jones et al., Gene Therapy for Cystic Fibrosis Lung

Disease Birkhauser Basel, Basel (2010). Sun et al., Am. . J. Pathol., 184:1309 (2014). Sun et al., Am. . J. Respira. Cell Mol. Biol., 50:502 (2014) Sun et al.,J. Clin. Invest., 118:1578 (2008). Sun et al.,J. Clin. Invest., 120:3149 (2010).

Wagner et al., Hum. Gene Ther., 13:1349 (2002).

Welsch, FASEB. J., 4:2718 (1990).

Welsh et al., In The Metabolic and Molecular Bases of

Inherited Disease, eds. McGraw-Hill, New York, p. 3799 (1995) Wu et al. Mol. Ther., 14:316 (2006). Wu et al. Yan et al. Yan et al. Yan et al. Yan et al. Yan et al., Zabner et Mol. Ther., Hum. Gene Hum. Gene J. Virol., J. Virol., Mol. Ther. al. , AmJ 18:80 (2010) . Ther., 24:786 (2013). Ther., 26:334 (2015). 76:2043 (2002). 78:2863 (2004). , 21:2181 (2013). . Physiol. Lung Cell Mol. Physiol 284:844 (2003). Zhang et al Zhang et al ., Mol. Ther., 10:990 (2004). .,Proc. Natl. Acad. Sci. USA, 95: :10158 (1998)

All publications, patents and patent applications are incorporated herein by reference. Although the above description has described this invention in relation to certain preferred embodiments and many details have been set forth for illustrative purposes, it will be apparent to those skilled in the art that the invention is capable of additional embodiments and certain details in the present specification are subject to significant modification. without departing from the basic principles of the invention.

Claims (33)

CLAIM 1. An isolated recombinant parvovirus vector containing an enhancer operably linked to a promoter, wherein the enhancer and promoter have at least 90% nucleotide sequence identity with SEQ ID NO: 27. 2. Recombinant parvovirus vector according to claim 1, in which the enhancer contains F5. 3. The recombinant parvovirus vector according to claim 1 or 2, wherein the enhancer and promoter have at least 95, 98, 99% or greater nucleic acid sequence identity with SEQ ID NO: 27. 4. The recombinant parvovirus vector according to claim 3, wherein the promoter and enhancer comprise the sequence of SEQ ID NO: 27. 5. Recombinant parvovirus vector according to any one of claims 1-4, in which the promoter is tg83. 6. Recombinant parvovirus vector according to any one of claims 1-5, which is a bocavirus or adeno-associated viral vector. 7. Recombinant parvovirus vector according to claim 6, which is an adeno-associated viral vector. 8. Recombinant parvovirus vector according to any one of claims 1 to 7, wherein the promoter is operably linked to the open reading frame. 9. The recombinant parvovirus vector of claim 8, wherein the open reading frame encodes a prophylactic or therapeutic gene product. 10. The recombinant parvovirus vector of claim 9, wherein the therapeutic gene product is a cystic fibrosis transmembrane conductance regulator (CFTR) or CFTRAR. 11. The recombinant parvovirus vector according to claim 10, wherein CFTR or CFTRAR. represents human CFTR or human CFTRAR. 12. A method of expressing a transgene in a cell, comprising: introducing a composition containing a recombinant parvovirus vector according to any one of claims 1 to 11 into a eukaryotic cell so as to express the transgene in the cell. 13. A method of expressing a transgene in a mammal, comprising administering to the mammal a composition comprising a recombinant parvovirus vector according to any one of claims 1 to 11 to express the transgene in cells of the mammal. 14. The method according to claim 12 or 13, wherein the expression of the transgene is enhanced by at least 2, 5, 10 or 15 or more times relative to the corresponding parvovirus vector that does not contain an enhancer. 15. The method according to any one of claims 12 to 14, wherein the composition is administered by injection. 16. The method according to any one of claims 12-14, in which the composition is administered intranasally. 17. The method according to any one of claims 12 to 16, wherein the mammal is a human. 18. An isolated vector containing an enhancer operably linked to a promoter, wherein the enhancer and promoter have at least 90% nucleotide sequence identity with SEQ ID NO: 27. 19. The vector according to claim 18, in which the enhancer contains F5. 20. The vector according to claim 18 or 19, wherein the promoter is tg83. 21. The vector according to any one of claims 18 to 20, wherein the promoter is operably linked to the open reading frame. 22. The vector of claim 21, wherein the open reading frame encodes a prophylactic or therapeutic gene product. 23. The vector of claim 22, wherein the therapeutic gene product is CFTR or CFTRAR. 24. The vector of claim 23, wherein the CFTR or CFTRAR is human CFTR or human CFTRAR. 25. The vector according to any one of claims 18 to 24, wherein the enhancer and promoter have at least 95, 98, 99% or greater nucleotide sequence identity with SEQ ID NO: 27. 26. The vector according to any one of claims 18-25, which is a plasmid. 27. A recombinant adeno-associated vector comprising (i) an enhancer operably linked to a promoter, the enhancer and promoter comprising the sequence SEQ ID NO: 27; and (ii) a human CFTRAR transgene operably linked to a promoter. 28. Use of a recombinant parvovirus vector according to any of claims 1-11, a vector according to any of claims 18-26 or a recombinant adeno-associated vector according to claim 27 for gene therapy of cystic fibrosis in humans. 29. Use according to claim 28, where the vector is intended for injection. 30. Use according to claim 28, where the vector is intended for intranasal administration. 31. A method of gene therapy for cystic fibrosis in humans, including administering to the subject recombinant - 19 043850 nant parvovirus vector according to claim 11, vector 24 or recombinant adeno-associated vector according to claim 27. 32. The method of claim 31, wherein the recombinant parvovirus vector, vector or recombinant adeno-associated vector is administered by injection. 33. The method according to claim 31, wherein the recombinant parvovirus vector, vector or recombinant adeno-associated vector is administered intranasally.