WO2017153606A1 - Constructions d'acides nucléiques et vecteurs d'expression oncosélective d'un transgène - Google Patents

Constructions d'acides nucléiques et vecteurs d'expression oncosélective d'un transgène Download PDF

Info

Publication number
WO2017153606A1
WO2017153606A1 PCT/EP2017/055836 EP2017055836W WO2017153606A1 WO 2017153606 A1 WO2017153606 A1 WO 2017153606A1 EP 2017055836 W EP2017055836 W EP 2017055836W WO 2017153606 A1 WO2017153606 A1 WO 2017153606A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
vector
acid construct
cell
polynucleotide
Prior art date
Application number
PCT/EP2017/055836
Other languages
English (en)
Inventor
Raúl MÉNDEZ DE LA IGLESIA
Cristina Fillat Fonts
Eneko VILLANUEVA VERDEJO
Original Assignee
Fundació Institut De Recerca Biomèdica (Irb Barcelona)
Institució Catalana De Recerca I Estudis Avançats
Institut D’Investigacions Biomèdiques August Pi I Sunyer (Idibaps)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fundació Institut De Recerca Biomèdica (Irb Barcelona), Institució Catalana De Recerca I Estudis Avançats, Institut D’Investigacions Biomèdiques August Pi I Sunyer (Idibaps) filed Critical Fundació Institut De Recerca Biomèdica (Irb Barcelona)
Publication of WO2017153606A1 publication Critical patent/WO2017153606A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/76—Viruses; Subviral particles; Bacteriophages
    • A61K35/761—Adenovirus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10332—Use of virus as therapeutic agent, other than vaccine, e.g. as cytolytic agent
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/10011—Adenoviridae
    • C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
    • C12N2710/10341—Use of virus, viral particle or viral elements as a vector
    • C12N2710/10345—Special targeting system for viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/24—Vectors characterised by the absence of particular element, e.g. selectable marker, viral origin of replication
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/007—Vectors comprising a special translation-regulating system cell or tissue specific
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00—Vectors comprising a special translation-regulating system
    • C12N2840/10—Vectors comprising a special translation-regulating system regulates levels of translation
    • C12N2840/102—Vectors comprising a special translation-regulating system regulates levels of translation inhibiting translation

Definitions

  • the invention relates to the field of nucleic acid constructs for the selective expression of a gene in a tumor cell.
  • transgene and viral protein expression is required to increase the safety and efficacy of gene and viral therapies. Delivery and expression of transgenes with anti-cancer activity or the use of conditionally replicating viruses for cancer therapy must be specific for tumors to avoid side effects on healthy tissues. Most efforts to achieve such selective control have been based on the use of tumor- specific promoters and more recently by the engineering of target sites recognizing tissue- specific miRNA. Although both strategies highly contribute to tumor selectivity, it is becoming evident that the post-transcriptional regulation of specific mRNA subpopulations contributes substantially to the broad expression changes of genes responsible for the cancer phenotype. Thus, the translational reprogramming of tumor cells has been proposed as a potential target for tumor specific drugs. These tumor specific translational profiles could, therefore, be used to generate tumor specificity to transgene and viral protein expression.
  • the inventors of the present invention have developed a system for the selective expression of a transgene in tumor cells using the tumor reprogramming of CPE- mediated translational regulation.
  • the inventors have engineered a particular CPE arrangement that activates translation in tumor cells while promotes translational repression in non-transformed cells ( Figure 1).
  • the inventors have generated a modified adenovirus where the expression of the El A protein is regulated by CPEBs to obtain oncoselectivity and attenuated toxicity in non-transformed tissues ( Figure 2).
  • This novel targeting modality increases the therapeutic index of oncolytic adenovirus and provides a new paradigm for its applicability to gene-transfer based therapeutic approaches.
  • polynucleotides generated in the present invention also show extensive stability along successive replication cycles (as shown in figure 9). This extreme stability, which was also unexpected, is also advantageous as it overcomes the limitations of other methods known in the art for tissue-specific expression of target genes using viruses, such as those methods based on tissue-specific destabilization of viral genomes by miRNA target insertion as these methods often accumulate errors over successive replication cycles and generate escape mutants
  • the invention relates to a nucleic acid construct comprising i. a polynucleotide of interest and
  • an untranslated sequence in 3' position with respect to the polynucleotide of interest wherein said untranslated sequence is heterologous with respect to the polynucleotide of interest and wherein said untranslated region a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides,
  • b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element and
  • c. does not include an adenylate-uridylate-rich element, wherein the polynucleotide of interest is not a gene encoding the protein luciferin-4-monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
  • the invention in a second aspect, relates to a vector comprising the nucleic acid construct according to the first aspect.
  • the invention relates to a viral particle comprising a lentiviral vector or an adenoviral vector according to the second aspect.
  • the invention relates to an in vitro method for inducing selective expression of a polynucleotide of interest in a tumor cell comprising
  • the tumor cell i. contacting the tumor cell with the nucleic acid construct according to the first aspect, the vector according to the second aspect or the viral particle according to the third aspect under suitable conditions for the entry of the nucleic acid construct, vector or viral particle into the tumor cell and ii. maintaining the tumor cell under conditions suitable for the expression of the polynucleotide of interest.
  • the invention relates to the nucleic acid construct according to the first aspect, the vector according to the second aspect or the viral particle according to the third aspect for use in medicine.
  • the invention relates to the nucleic acid construct according to the first aspect, the vector according to the second aspect or the viral particle according to the third aspect for use in the treatment of cancer.
  • FIG. 1 CPEs containing 3'-UTR confer in vitro oncoselectivity to engineered transgenes.
  • the upper panel shows representative western blots showing CPEB1 and CPEB4 expression in pancreatic primary fibroblasts, normal cells (HPDE) and tumor cells (RWP-1, MIA PaCa-2 and PANC-1).
  • the lower panel shows quantification of CPEB1 and CPEB4 signals normalized to GAPDH.
  • FIG. 1 (a) Experimental workflow of the d2EGFP/dRFP expression analysis from the different 3 * UTRs in HPDE, RWP-1, PANC-1 and MIA PaCa-2 cells, (b) cBl 3 * UTR reduces d2EGFP mRNA in HPDE cells but not in tumoral cells. Quantification of relative d2EGFP/dRFP mRNA levels in the indicated cell lines transduced with the indicated lentiviruses and relative to the mRNA content of d2EGFP/dRFP from Lv-WT 3'UTR transduced cells. Data is shown as mean ⁇ SEM of three independent experiments, * p ⁇ 0.05.
  • Adwt C- and AdCPE C- correspond to an RNA mix from non-infected cells amplified with specific primers for Adwt and AdCPE, respectively,
  • qPCR Data is shown as mean ⁇ SEM of five independent experiments. ** P ⁇ 0.01 and *** P ⁇ 0.001.
  • IC50 Half-growth inhibitory concentration
  • FIG. 4 CPEB4 regulates AdCPE E1A expression and viral fitness,
  • (b) Representative western blot of El A expression in RWP-1 shNT and RWP-1 sh4, infected with Adwt and AdCPE 72 h PI. Quantification of the El A signal was normalized to GAPDH and expressed as relative values of AdCPE/Adwt (n 4). * ⁇ 0.05.
  • the left panel shows a representative western blot of the E1A protein in non-tumor HPDE cells transduced with a lentivirus expressing CPEB4 (Lv-CPEB4) or a control lentivirus (Lv-empty) and infected with Adwt or AdCPE. E1A content was evaluated 72 h PI.
  • *** p ⁇ 0.001 Tukey contrast test on the lineal mixed model fitted by REML).
  • AdCPE replication is attenuated in mouse tissue and displays reduced toxicity.
  • Adwt and AdCPE were intravenously delivered to wild-type C57BL/6 mice at
  • FIG. 8 AdCPE replication is attenuated in primary human hepatocytes.
  • (a) Representative western blot of human hepatocytes infected with Adwt or AdCPE at 72 h PI. El A signal has been normalized to GAPDH and expressed relative to Adwt values. (n 5). *p ⁇ 0.05.
  • FIG. 1 CPE elements in the El A 3'UTR of AdCPE remain stable after 20 consecutive viral replicative cycles. Sanger sequencing representation and sequence alignment of the El A 3'UTR of AdCPE, between the purified virus and AdCPE isolated after 20 consecutive replicative cycles in HPDE (H) and RWP-1 (R) cells.
  • FIG. 10 AdDUC dual ElA-regulated virus with the uPAR promoter and the CPE elements display an oncoselective additive effect. qPCR quantification of viral particles in the supernatant of tumoral RWP-1 and non-tumoral HPDE cells at 72 h PI. Data is shown as mean ⁇ SEM of five independent biological replicates. ** p ⁇ 0.01 (one sample t-test).
  • the invention in a first aspect, relates to a nucleic acid construct comprising i. a polynucleotide of interest and ii. an untranslated sequence in 3' position with respect to the polynucleotide of interest, wherein said untranslated sequence is heterologous with respect to the polynucleotide of interest and wherein said untranslated region a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides,
  • b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element and
  • c. does not include an adenylate-uridylate-rich element, wherein the polynucleotide of interest is not a gene encoding the protein luciferin-4-monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
  • nucleic acid construct refers to a man-made nucleic acid molecule resulting from the use of recombinant DNA technology.
  • a nucleic acid construct is a nucleic acid molecule, either single- or double-stranded, which has been modified to contain segments of nucleic acids, which are combined and juxtaposed in a manner, which would not otherwise exist in nature.
  • a nucleic acid construct usually is a "vector", i.e. a nucleic acid molecule which is used to deliver exogenously created DNA into a host cell.
  • untranslated sequence in 3' position with respect to the polynucleotide of interest refers to an untranslated region which appears after the stop codon.
  • heterologous with respect to the polynucleotide of interest means that the 3'UTR sequence is not naturally found in association with said polynucleotide.
  • the 3'UTR of the nucleic acid construct of the first aspect is the 3'UTR of the nucleic acid construct of the first aspect:
  • a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides
  • b. comprises a citoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the second cytoplasmic polyadenylation element and
  • CPE cytoplasmic polyadenylation element
  • CPE cytoplasmic polyadenylation element
  • CPE refers to a sequence which is found in the 3'UTR of messenger RNAs. CPEs usually have the sequence 5'-UUUUAi_ 2 U-3' (also called consensus sequence), although other variants are possible, for example, non-consensus sequences: UUUUACU, UUUCAU and UUUUCCU.
  • CPE are bound by CPE binding proteins (CPEBs), which promotes the extension of the existing polyadenylation tail and, in general, the translation of the mRNA.
  • CPEBs CPE binding proteins
  • the first CPE has the consensus sequence 5'- UUUUAi_ 2 U-3' when the nucleic acid construct is an RNA molecule.
  • the CPE comprises a sequence which, when transcribed, results in the above sequence.
  • the second CPE has the consensus sequence 5'- UUUUAi_ 2 U-3' when the nucleic acid construct is an RNA molecule.
  • the CPE comprises the sequence which, when transcribed, results in the above sequence.
  • the first and second CPE has the consensus sequences 5'-UUUUAi_ 2 U-3' when the nucleic acid construct is a RNA molecule.
  • the CPE comprises the sequence which, when transcribed, results in the above sequence.
  • the first CPE has the consensus sequence 5'- UUUUUAA-3 * .
  • the second CPE has the consensus sequence 5 * -UUUUAAU-3 * .
  • the first CPE has the consensus sequence 5'-UUUUUAA-3' and the second CPE has the consensus sequence 5'- UUUUAAU-3' when the nucleic acid construct is a RNA molecule or, when the nucleic acid construct is a DNA molecule, a sequence that, when transcribed, results in the above sequence.
  • the 3'UTR of the polynucleotide of the invention further comprises a third CPE.
  • the third CPE has a non-consensus sequence.
  • the third CPE has the non-consensus sequence 5'-UUUUACU-3' when the nucleic acid construct is a R A molecule or, when the nucleic acid construct is a DNA molecule, a sequence that, when transcribed, results in the above sequence.
  • the third CPE is located in a 3' position with respect to the first CPE but in a 5' position with respect to the cytoplasmic polyadenylation signal. In another particular embodiment, the third CPE is located in a 5' position with respect to the first CPE and to the cytoplasmic polyadenylation signal. In another particular embodiment, the third CPE is located between the first and second CPE and in a 3' position with respect to the cytoplasmic polyadenylation signal.
  • the first CPE has the consensus sequence 5'-
  • the second CPE has the consensus sequence 5'-UUUUAAU-3' and the 3'UTR further comprises a third CPE with the non-consensus sequence 5'-UUUUACU- 3' when the nucleic acid construct is a RNA molecule or, when the nucleic acid construct is a DNA molecule, a sequence that, when transcribed, results in the above sequence.
  • nucleic acid construct When the nucleic acid construct is a RNA molecule, said nucleic acid construct further comprises a polyadenine tail.
  • the 3'UTR of the nucleic acid construct of the first aspect comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the second CPE.
  • cytoplasmic polyadenylation signal refers to a nucleic acid sequence which is present in the 3'UTR of mRNA and promotes the cytoplasmic polyadenlylation of the mRNA.
  • the cytoplasmic polyadenylation signal is the hexanucleotide AAUAAA.
  • the expression "separated by less than 100 nucleotides from the first or second CPE” means that the number of nucleotides between the last nucleotide of the first or second CPE and the first nucleotide of the cytoplasmic polyadenylation signal is less than 100 nucleotides. In a particular embodiment, the number of nucleotides between the first or second CPE and the cytoplasmic polyadenylation signal is less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 30, less than 20, less than 10, less than 5 nucleotides. In a more particular embodiment, the distance between the first or second CPE and the cytoplasmic polyadenylation signal is 25 nucleotides. In particular embodiment, there is no nucleotide between the second CPE and the cytoplasmic polyadenylation signal. In another particular embodiment, the second CPE and the cytoplasmic polyadenylation signal partially overlap.
  • the cytoplasmic polyadenylation signal is located in a 3' position with respect to the first and second CPE.
  • the second cytoplasmic polyadenylation element can overlap with the cytoplasmic polyadenylation signal.
  • the second CPE overlaps at least one, at least 2, at least 3, at least 4, at least 5, or at least 6 nucleotides with the cytoplasmic polyadenylation signal.
  • the cytoplasmic polyadenlylation signal is located in a 3' position with respect to the third CPE.
  • the 3'UTR of the nucleic acid construct of the first aspect does not include an adenylate-urydilate-rich element.
  • adenylate-uridyl ate-rich element or "AU- rich element” or "ARE”, as used herein, refers to a nucleic acid sequence found in the 3' UTR regions of many messenger RNAs which is rich in adenine and uridine bases and which opposes CPE-mediated polyadenylation. AREs can be divided in three classes:
  • Class I AREs have a core sequence of AUUUA within or near uridine rich regions.
  • Example of class I AREs is the ARE of the c-fos gene.
  • Class II AREs have overlapping AUUUA motifs within or near uridine rich regions.
  • Example of class II AREs is the ARE of the GM-CSF gene.
  • Class III AREs have uridine rich regions but no AUUUA motifs.
  • Example of class III AREs is the ARE of the c-jun gene.
  • the AU-rich element is not 5' with respect to the first CPE. In another embodiment, the AU-rich element is not between the first and second CPE. In another embodiment, the AU-rich element is not between the second CPE and the cytoplasmic polyadenylation signal. In another element, the AU-rich element is not 3' with respect to the cytoplasmic polyadenylation signal.
  • the 3'UTR of the nucleic acid construct of the first aspect does not include the ARE of the 3'UTR from the TNF-a gene.
  • the 3'UTR of the nucleic acid construct of the firs aspect does not include the ARE of the 3'UTR of the tissue plasminogen activator (tPA).
  • the 3'UTR of the nucleic acid construct of the invention comprises, from 5' to 3': a first CPE, a third CPE, a second CEP and a cytoplasmic polyadenylation signal.
  • the 3'UTR of the nucleic acid construct of the invention has the nucleotide sequence of SEQ ID NO: 1 when said nucleic acid is a RNA molecule or, if the nucleic acid construct is a DNA molecule, a sequence that, once transcribed, results in SEQ ID NO: 1, or a functionally equivalent variant thereof.
  • the term "functionally equivalent variant”, as used herein, refers to a nucleic acid sequence which derives from the sequence of SEQ ID NO: 1 by insertion, deletion or substitution of one or more nucleotides and which substantially preserves the functional activity of the original sequence.
  • Suitable variants encompassed within the present invention include those nucleic acid sequences showing at least 99%, at least 98%>, at least 97%, at least 96%, at least 95%, at least 94%, at least 93%, at least 92%, at least 92%, at least 91%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%o, at least 60%> or less identity with the sequence of SEQ ID NO: 1.
  • Suitable methods for determining the identity of two nucleic acid sequences are known by the skilled person, for example those methods that use computer algorithms well known to persons having ordinary skill in the art. Such algorithms include Align or the BLAST algorithm (see, e.g., Altschul, J. Mol. Biol.
  • nucleic acid sequences which are capable of promoting both translational repression by unphosphorylated CPEBl and translational activation by CPEB4, as described in the examples below.
  • a nucleic acid sequence is considered as a functionally equivalent to sequence of SEQ ID NO: 1 if it shows at least 100%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%>, at least 65%, at least 60%> or at least 50%> of the activity of the sequence of SEQ ID NO: 1.
  • polynucleotide of interest refers to any polynucleotide whose expression in a cell is desirable.
  • the polynucleotide of interest of the nucleic acid construct of the first aspect is not a gene encoding luciferin-4- monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein.
  • luciferin-4-monooxygenase from Photinus pyralis refers to a protein with the sequence identified by the UniProtKB/Swiss-Prot accession number P08659 (Uniprot version 101 as of 14 October 2015).
  • fluorescent protein refers to a polypeptide with the capacity to emit light in response to the absorption of light or other electromagnetic radiation.
  • fluorescent proteins include green fluorescent protein (GFP or wtGFP), GFP variants for different emission wavelengths, emission intensity and/or protein stability such as Superfolder GFP, EGFP variants for different emission wavelengths (colors) such as blue fluorescent protein (EBFP), cyan fluorescent protein (ECFP), and yellow fluorescent protein (YFP), GFPuv (characterized by having mutations F99S, M153T and V163A in the GFP sequence), Emerald, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, YFP, EYFP, mCitrine, Venus, YPet, CyPet, CFP, ECFP, mCFPm, Cerulean, and T-Sapphire.
  • Other fluorescent polypeptides include red
  • green fluorescent protein refers to a protein consisting of 239 amino acids with a molecular weight of 26.9 kDa and showing bright green fluorescence when exposed to blue ultraviolet light.
  • GFP traditionally refers to the first protein isolated from jellyfish A. victoria.
  • A. victoria GFP has a major excitation maximum at a wavelength of 395 nm and a minor one at 475 nm. The emission maximum thereof is at 509 nm. The fluorescence quantum yield of GFP is 0.79.
  • GFP transduces blue chemiluminescence of aequorin to green fluorescent light by means of energy transfer.
  • the polynucleotide of interest is not a gene encoding the 2dEGF, a EGFP protein modified by destabilizaton with 422-461 residues of mouse ornithine decarboxylase giving an in vivo half-life of 2 hours.
  • polynucleotide of interest is selected from the group consisting of:
  • cytotoxic polypeptide refers to an agent that is capable of inhibiting cell function.
  • the agent may inhibit proliferation or may be toxic to cells.
  • Any polypeptide that when internalized by a cell interfere with or detrimentally alter cellular metabolism or in any manner inhibit cell growth or proliferation are included within the ambit of this term, including, but are not limited to, agents whose toxic effects are mediated when transported into the cell and also those whose toxic effects are mediated at the cell surface.
  • Useful cytotoxic polypeptides include proteinaceous toxins and bacterial toxins.
  • Useful type one plant RIPs include, but are not limited to, dianthin 30, dianthin 32, lychnin, saporins 1-9, pokeweed activated protein (PAP), PAP II, PAP-R, PAP-S, PAP-C, mapalmin, dodecandrin, bryodin-L, bryodin, Colicin 1 and 2, luffin-A, luffin-B, luffin-S, 19K-protein synthesis inhibitory protein (PSI), 15K-PSI, 9K-PSI, alpha-kirilowin, beta-kirilowin, gelonin, momordin, momordin-II, momordin-Ic, MAP-30, alpha-momorcharin, beta-momorcharin, trichosanthin, TAP-29
  • Useful type two RIPs include, but are not limited to, volkensin, ricin, nigrin-b, CIP-29, abrin, modeccin, ebulitin- [alpha], ebulitin-[beta], ebultin- [gamma], vircumin, porrectin, as well as the biologically active enzymatic subunits thereof (Stirpe et al, Bio/Technology 10:405-12, 1992; Pastan et al, Annu. Rev. Biochem. 61 :331-54; Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994; and Sandvig and Van Deurs, Physiol. Rev. 76:949-66, 1996).
  • bacterial toxins useful as cell toxins include, but are not limited to, shiga toxin and shiga-like toxins (i.e., toxins that have the same activity or structure), as well as the catalytic subunits and biologically functional fragments thereof. These bacterial toxins are also type two RIPs (Sandvig and Van Deurs, Physiol. Rev. 76:949- 66, 1996; Armstrong, J. Infect. Dis., 171 : 1042-5, 1995; Kim et al, Microbiol. Immunol. 41 :805-8, 1997, and Skinner et al, Microb. Pathog. 24: 117-22, 1998).
  • useful bacterial toxins include, but are not limited to, Pseudomonas exotoxin and Diphtheria toxin (Pastan et al, Annu. Rev. Biochem. 61 :331-54; and Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994). Truncated forms and mutants of the toxin enzymatic subunits also can be used as a cell toxin moiety (Pastan et al., Annu. Rev. Biochem. 61 :331-54; Brinkmann and Pastan, Biochim. et Biophys. Acta 1198:27-45, 1994; Mesri et al, J.
  • Targets include, but are not limited to the more than 34 described Colicin family of RNase toxins which include colicins A, B, D, El -9, cloacin DF13 and the fungal RNase, [alpha] -sarcin (Ogawa et al. Science 283: 2097-100, 1999; Smarda et al, Folia Microbiol (Praha) 43:563-82, 1998; Wool et al, Trends Biochem. Sci., 17: 266-69, 1992).
  • RNase toxins include colicins A, B, D, El -9, cloacin DF13 and the fungal RNase, [alpha] -sarcin (Ogawa et al. Science 283: 2097-100, 1999; Smarda et al, Folia Microbiol (Praha) 43:563-82, 1998; Wool et al, Trends Biochem. Sci., 17: 266-69, 1992).
  • antiangiogenic polypeptide denotes a polypeptide capable of inhibiting angiogenesis.
  • Suitable antiangiogenic polypeptides include, without limitation, angiostatin, endostatin, anti-angiogenic anti-thrombin III, sFRP- 4 as described in WO2007115376, an anti-VEGF antibody such as anibizumab, bevacizumab (avastin), Fab IMC 1121 and F200 Fab.
  • tumor suppressor is a gene or gene product that has a normal biological role of restraining unregulated growth of a cell.
  • the functional counterpart to a tumor suppressor is an oncogene.
  • Genes that promote normal cell growth may be known as “protooncogenes”.
  • a mutation that activates such a gene or gene product further converts it to an "oncogene", which continues the cell growth activity, but in a dysregulated manner.
  • tumor suppressor genes and gene products are well known in the literature and may include PTC, BRCA1, BRCA2, pi 6, APC, RB, WT1, EXT1, p53, NF1, TSC2, NF2, VHL, ST7, ST14, PTEN, APC, CD95 or SPARC.
  • polypeptide which is capable of activating the immune response towards the cell expressing said polypeptide include any immunostimulatory polypeptide agent such as flagellin, muramyl dipeptide), cytokines including interleukins (e.g., IL-2, IL-7, IL- 15 (or superagonist/mutant forms of these cytokines), IL-12, IFN-gamma, IFN-alpha, GM-CSF, FLT3-ligand, etc.), immunostimulatory antibodies (e.g., anti-CTLA-4, anti-CD28, anti-CD3, or single chain/antibody fragments of these molecules), and the like.
  • immunostimulatory polypeptide agent such as flagellin, muramyl dipeptide
  • cytokines including interleukins e.g., IL-2, IL-7, IL- 15 (or superagonist/mutant forms of these cytokines)
  • IL-12 e.g., IFN-gamma, IFN-alpha,
  • a polypeptide which is capable of activating the production of a cytopathic virus refers to a polypeptide which promotes the production of a virus which upon infection of a cell causes the lysis of the cell or the death of the cell due to an inability to reproduce.
  • Illustrative non limitative examples of polypeptides that are capable activating the production of a cytopathic virus are the polypeptides encoded by the EIA and E4 transcription units from adenovirus, the B5R glycoprotein of vaccinia virus and the ICP4 protein from Herpes simplex virus- 1.
  • the polypeptide which is capable of activating the production of a cytopathic virus is the polypeptide encoded by the EIA gene from an adenovirus.
  • EIA gene from an adenovirus or adenovirus early region 1 A
  • the 289R protein can transcriptionally activate all of the early viral genes, as well as several host genes, and this activity requires its unique 46-amino-acid domain.
  • the 243R protein can induce transcription of certain host cell genes, and in cooperation with cyclic AMP, it can efficiently induce both viral and cellular transcription units.
  • adenovirus refers to any virus pertaining to the Adenoviridae family characterized by being a non-enveloped virus with an pseudo-icosahedral nucleocapsid containing a double stranded DNA genome. This term includes any adenovirus capable of infecting a human or an animal, including all groups, subgroups, and serotypes that use CAR, CD46 or desmoglein-2 as receptor for infection of target cells.
  • the term adenovirus includes, without limitation, avian, canine, equine, bovine, ovine, porcine, human or frog adenovirus.
  • the adenovirus is a human adenovirus, i.e. an adenovirus capable of infecting humans.
  • a "serotype" is each of the immunologically different types of adenovirus. There are at least 57 serotypes of human adenovirus that are classified into several subgroups (A to G).
  • the adenovirus is a type 5 adenovirus or serotype 5 adenovirus.
  • the El A protein from a type 5 adenovirus is the protein identified by the UniProtKB/Swiss-Prot accession number P03255 (Uniprot version 112 as of 20 January 2016).
  • the polynucleotide of interest is a polynucleotide that once transcribed gives rise to a RNA capable of modulating the expression of a target gene.
  • RNA capable of modulating the expression of a target gene examples of said polynucleotides are polynucleotides that once transcribed generate an RNA which is capable of inhibiting the expression of a target gene, such us a microRNA (miRNA), a small interfering (siRNA) or a short hairpin RNA (shRNA).
  • miRNA microRNA
  • siRNA small interfering
  • shRNA short hairpin RNA
  • the invention relates to nucleic acid construct comprising i. a polynucleotide of interest and
  • a. comprises at least two cytoplasmic polyadenylation elements which are separated by less than 50 nucleotides
  • b. comprises a cytoplasmic polyadenylation signal which is separated by less than 100 nucleotides from the first or second cytoplasmic polyadenylation element
  • polynucleotide of interest is not a gene encoding the protein luciferin-4- monooxygenase from Photinus pyralis or a gene encoding a fluorescent protein and wherein the polynucleotide of interest is a reporter gene.
  • reporter gene refers to a gene which allows identifying those cells that have been incorporated the nucleic acid construct after having been put in contact with it.
  • useful reporter genes in the context of the present invention include lacZ, thymidine kinase, and the like.
  • the invention in a third aspect, relates to a vector comprising the nucleic acid construct of the first or second aspect.
  • vector refers to a construct capable of delivering, and preferably additionally expressing, one or more polynucleotides of interest into a host cell.
  • vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmid, cosmid or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.
  • This term also relates to targeting constructs which allow for random or site-directed integration of the targeting construct into genomic DNA.
  • targeting constructs preferably, comprise DNA of sufficient length for either homologous recombination or heterologous integration.
  • the vector is an expression vector.
  • expression vector refers to a replicative DNA construct used for expressing the nucleic acid construct of the invention in a cell, preferably a eukaryotic cell, more preferably a mammalian cell.
  • the expression vector also preferably contains an origin of replication in prokaryotes, necessary for vector propagation in bacteria.
  • the expression vector can also contain a selection gene for bacteria, for example, a gene encoding a protein conferring resistance to an antibiotic, for example, ampicillin, kanamycin, chloramphenicol, etc.
  • the expression vector can also contain one or more multiple cloning sites.
  • the expression vector is a lentiviral vector or an adenoviral vector.
  • lentiviral vector refers to a vector based on a group (or scientific genus) of retroviruses that in nature give rise to slowly developing disease due to their ability to incorporate into a host genome. Modified lentiviral genomes are useful as viral vectors for the delivery of a nucleic acid sequence to a cell. An advantage of lentiviruses for infection of cells is the ability for sustained transgene expression.
  • viruses include in particular Human Immunodeficiency Virus type 1 (HIV-1), Human Immunodeficiency Virus type 2 (HIV-2), Simian Immunodeficiency Virus (SIV), Feline Immunodeficiency Virus (FIV), Equine Infectious Anaemia Virus (EIAV), Bovine Immunodeficiency Virus (BIV), Visna Virus of sheep (VISNA) and Caprine Arthritis-Encephalitis Virus (CAEV).
  • Recombinant lentiviral vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences.
  • lentivirus capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat is described in U.S. Pat. No. 5,994,136, incorporated herein by reference.
  • One may target the recombinant virus by linkage of the envelope protein with an antibody or a particular ligand for targeting to a receptor of a particular cell-type.
  • a sequence (including a regulatory region) of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target-specific.
  • the lentiviral vectors according to the invention may be genetically modified in such a way that certain genes constituting the native infectious virus are eliminated and replaced with a nucleic acid sequence of interest to be introduced into the target cells.
  • adenoviral vector refers to a vector based on an adenovirus, which has been previously defined.
  • the viral vector is a vector based on a virus or the Parvoviridae family, preferably from the Parvovirinae subfamily, more preferably from the Dependoparvovirus genus, and yet even more preferably an adeno-associated virus.
  • AAV adeno-associated virus
  • AAV serotypes have genomic sequences of significant homology at the amino acid and the nucleic acid levels, provide an identical set of genetic functions, produce virions which are essentially physically and functionally equivalent, and can be engineered to express transgenes that require tissue-specific regulation.
  • the invention may be carried out using to AAV serotype 1 (AAV1), AAV2, AAV3 (including types 3 A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered.
  • AAV serotype 1 AAV1
  • AAV2 AAV3 (including types 3 A and 3B)
  • AAV4 AAV5, AAV6, AAV7, AAV8, AAV9, AAV 10, AAV11, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, and any other AAV now known or later discovered.
  • the genomic sequences of the various serotypes of AAV and the autonomous parvoviruses, as well as the sequences of the terminal repeats, Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank.
  • NC_002077 See, e.g., GenBank Accession Numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC 001701, NC 001510, NC 006152, NC 006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, NC_001358, NC_001540, AF513851, AF513852, AY530579; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences.
  • the viral vector is a vector based on a virus of the Reoviridae family. In yet another embodiment, the viral vector is a vector based on a virus of the Picornaviridae family, preferably from the enterovirus genus, more preferably a Coxsackievirus and even more preferably on a Coxsackievirus A21 virus. In a fourth aspect, the invention relates to a viral particle comprising the lentiviral vector or adenoviral vector of the third aspect.
  • viral particle refers to a whole viral particle and not to a protein subunit or peptide.
  • Viral particles consist of two or three parts: the genetic material of the virus made from either DNA or RNA; a protein coat that protects these genes; and, in some cases, an envelope of lipids that surrounds the protein coat when they are outside a cell.
  • the shape of the viral particle ranges from simple helical and icosahedral forms to more complex structures, depending on the virus.
  • the invention in a fifth aspect, relates to a cell comprising the nucleic acid construct of the first or second aspect or the vector of the third aspect.
  • the cell can be of any origin.
  • the cell is a eukaryotic cell.
  • the cell is a mammal cell.
  • the cell is a human cell.
  • the invention in a sixth aspect, relates to a pharmaceutical composition
  • a pharmaceutical composition comprising the nucleic acid construct of the first aspect, or a vector, viral particle or cell comprising said nucleic acid construct and a pharmaceutically acceptable carrier.
  • composition refers to a composition comprising a therapeutically effective amount of the nucleic acid construct according to the present invention (or the vector, viral particle or cell comprising said nucleic acid construct) and at least one pharmaceutically acceptable excipient.
  • Pharmaceutical compositions according to the invention can be prepared, for instance, as injectables such as liquid solutions, suspensions, and emulsions.
  • pharmaceutically acceptable excipient or “pharmaceutically acceptable carrier,” “pharmaceutically acceptable diluent,”, or “pharmaceutically acceptable vehicle,” used interchangeably herein, refer to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any conventional type.
  • a pharmaceutically acceptable carrier is essentially non-toxic to recipients at the dosages and concentrations employed, and is compatible with other ingredients of the formulation. Suitable carriers include, but are not limited to water, dextrose, glycerol, saline, ethanol, and combinations thereof.
  • the carrier can contain additional agents such as wetting or emulsifying agents, pH buffering agents, or adjuvants which enhance the effectiveness of the formulation.
  • Adjuvants could be selected from the group consisting of sterile liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and similars.
  • Water or saline aqueous solutions and aqueous dextrose and glycerol solutions, particularly for injectable solutions, are preferably used as vehicles.
  • Suitable pharmaceutical vehicles are described in "Remington's Pharmaceutical Sciences” by E.W. Martin, 21st Edition, 2005.
  • nucleic acid construct according to the present invention or the vector, viral particle or cell comprising said nucleic acid construct
  • pharmaceutical composition of the invention relates to the sufficient amount of nucleic acid construct according to the present invention (or the vector, viral particle or cell comprising said nucleic acid construct) to provide the desired effect, i.e. to achieve an appreciable prevention, cure, delay, reduction of severity or amelioration of one or more symptoms derived from a disease, and will generally be determined by, among other causes, the characteristics of the agent itself and the therapeutic effect to be achieved. It will also depend on the subject to be treated, the severity of the disease suffered by said subject, the chosen dosage form, etc. For this reason, the doses mentioned in this invention must be considered only as guides for the person skilled in the art, who must adjust the doses depending on the aforementioned variables.
  • the effective amount produces the amelioration of one or more symptoms of the disease that is being treated.
  • compositions for intravenous or intraventricular administration are solutions in sterile isotonic aqueous buffer.
  • compositions containing the compounds according to the invention can occur at any pharmaceutical form of administration considered appropriate for the selected administration route, for example, by systemic, oral, parenteral, intradermal, subcutaneous, intramuscular, intravenous or topical administration, for which it will include the pharmaceutically acceptable excipients necessary for formulation of the desired method of administration.
  • the effective quantity of the compounds of the invention can vary within a wide range and, in general, will vary depending on the particular circumstances of application, duration of the exposure and other considerations.
  • Injectable preparations for example, aqueous or oleaginous suspensions
  • sterile injectable may be formulated according with the technique known using suitable dispersing agents, wetting agents and/or suspending agents.
  • suitable dispersing agents wetting agents and/or suspending agents.
  • suitable vehicles and solvents water, Ringer's solution and isotonic sodium chloride solution.
  • Sterile oils are also conventionally used as solvents or suspending media.
  • Several drug delivery systems are known and can be used to administer the compounds or compositions of the invention, including, for example, encapsulation in liposomes, microbubbles, emulsions, microparticles, microcapsules and similars.
  • the required dosage can be administered as a single unit or in a sustained release form.
  • the dosage needed to provide an effective amount of such compound which can be adjusted by one expert in the art will vary depending on age, health, fitness, sex, diet, weight, degree of alteration of the receptor, frequency of treatment and the nature and extent of impairment or illness, medical condition of the patient, route of administration, pharmacological considerations such as activity, efficacy, pharmacokinetic and toxicology profile of the particular compound used, if using a system drug delivery, and if the compound is administered as part of a combination of drugs.
  • the invention in a seventh aspect, relates to an in vitro method for inducing selective expression of a polynucleotide of interest in a tumor cell comprising i. contacting the tumor cell with the nucleic acid construct according to the first or second aspect, the vector according to any the third aspect or the viral particle according to the fourth aspect under suitable conditions for the entry of the nucleic acid construct, vector or viral particle into the tumor cell and
  • in vitro refers to the fact that the method is not carried out on the body of a human or animal subject, but rather on cells isolated from said subject.
  • tumor cell refers to a cell that can grow and divide at an unregulated, quick pace. Tumor cells can be identified by methods well known by the person skilled in the art, for example by using specific antibodies able to recognize specific tumoral markers such as EpCAM, Her 2, CK19 or PSA.
  • the tumor cell expresses increased levels of CPEB4 and decreased levels of non-phosphorylated CPEB1 compared to a reference sample.
  • CPEB4 or cytoplasmic polyadenylation element binding protein 4" refers to a RNA binding protein which in humans has the sequence identified by the UniProtKB/Swiss-Prot accession number Q17RY0 (Uniprot version 85 as of 20 January 2016).
  • CPEB1 or "cytoplasmic polyadenylation element binding protein 1" refers to a RNA binding protein which in humans has the sequence identified by the UniProtKB/Swiss-Prot accession number Q9BZB8 (Uniprot version 119 as of 20 January 2016).
  • the expression "level of CPEB4" refers to the level of the protein.
  • the level of a protein can be determined by any method known in the art suitable for the determination and quantification of a protein in a sample.
  • the level of a protein can be determined by means of a technique which comprises the use of antibodies with the capacity for binding specifically to the assayed protein (or to fragments thereof containing the antigenic determinants) and subsequent quantification of the resulting antigen-antibody complexes, or alternatively by means of a technique which does not comprise the use of antibodies such as, for example, by techniques based on mass spectroscopy.
  • the antibodies can be monoclonal, polyclonal or fragment thereof, Fv, Fab, Fab' and F(ab') 2 , scFv, diabodies, triabodies, tetrabodies and humanized antibodies. Similarly, the antibodies may be labeled. Illustrative, but non-exclusive, examples of markers that can be herein used include radioactive isotopes, enzymes, fluorophores, chemo luminescent reagents, enzyme cofactors or substrates, enzyme inhibitors, particles, or dyes.
  • test there is a wide variety of known test that can be used according to the present invention, such as combined application of non-labeled antibodies (primary antibodies) and labeled antibodies (secondary antibodies), Western blot or immunoblot, ELISA (enzyme- linked immunosorbent assay), RIA (radioimmunoassay), competitive EIA (enzyme immunoassay), DAS- ELISA (double antibody sandwich ELISA), two-dimensional gel electrophoresis, capillary electrophoresis, immunocytochemical and immunohistochemical techniques, immunoturbidimetry, immunofluorescence, techniques based on the use of biochips or protein microarrays including specific antibodies or assays based on the colloidal precipitation in formats such as reagent strips and assays based on antibody-linked quantum dots.
  • Non-phosphorylated CPEBl refers to the quantity of non-phosphorylated CPEBl .
  • Non-phosphorylated levels of CPEBl can be determined directly by any suitable technique known in the art or indirectly by comparing the total amount of CPEBl to the amount of phosphorylated CPEBl .
  • Phosphorylated CPEBl can be determined by techniques using unlabeled antibodies (primary antibody) that recognize the phosphorylated CPEBl (phospho- CPEBl) and labeled antibodies (secondary antibodies) or, alternatively, primary antibodies recognizing phospho- CPEB1 and are marked.
  • reference value relates to a predetermined criteria used as a reference for evaluating the values or data obtained from the samples collected from a subject.
  • the reference value or reference level can be an absolute value, a relative value, a value that has an upper or a lower limit, a range of values, an average value, a median value, a mean value, or a value as compared to a particular control or baseline value.
  • a reference value can be based on an individual sample value, such as for example, a value obtained from a sample from the subject being tested, but at an earlier point in time.
  • the reference value can be based on a large number of samples, such as from population of subjects of the chronological age matched group, or based on a pool of samples including or excluding the sample to be tested.
  • the reference value is obtained from a sample which does not comprise tumor cells.
  • the reference value is obtained from a sample containing, consisting or substantially consisting of pancreatic normal HPDE cells.
  • the level of CPEB4 is considered "increased" when said level in a sample is higher than its reference value.
  • the level of CPEB4 is considered to be higher than its reference value when it is at least 1.5%, at least 2%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more higher than its reference value.
  • the level of non-phosphorylated CPEB1 is considered "decreased" when said level in a sample is lower than its reference value.
  • the level of non-phosphorylated CPEB1 is considered to be lower than its reference value when it is at least 1.5%, at least 2%, at least 5%, at least 10%>, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 110%, at least 120%, at least 130%, at least 140%, at least 150%, or more lower than its reference value.
  • the suitable conditions for the entry of the nucleic acid construct, vector or viral particle in the tumor cell are known by the skilled person and include, for example, known conditions for transfection, transduction or transformation of the cell.
  • the suitable conditions for the expression of the polynucleotide of interest are also known by the skilled person.
  • the skilled person can determine if a cell is expressing a polynucleotide of interest by any known method for detecting expression of a particular protein by a cell, such as Western blot or immunoblot, ELISA (enzyme- linked immunosorbent assay), RIA (radioimmunoassay), competitive EIA (enzyme immunoassay), DAS-ELISA (double antibody sandwich ELISA), two-dimensional gel electrophoresis, capillary electrophoresis, immunocytochemical and immunohistochemical techniques, immunoturbidimetry, immunofluorescence, etc.
  • the invention relates to the nucleic acid construct according to the first aspect, or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for use in medicine. Alternatively, the invention relates to the use of the nucleic acid construct according to the first aspect, or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for the manufacture of a medicament. In a ninth aspect, the invention relates to the nucleic acid construct according to the first aspect, the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for use in the treatment of cancer. Alternatively, the invention relates to the use of the nucleic acid construct according to the first aspect, the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct for the manufacture of a medicament for treating cancer. Alternatively, the invention relates to a method of treating cancer comprising administering to a subject a therapeutically effective amount of the nucleic acid construct according to the first aspect or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct.
  • treatment refers to any process, action, application, therapy, or the like, wherein a subject (or patient), including a human being, is provided medical aid with the object of improving the subject's condition, directly or indirectly, or slowing the progression of a condition or disorder in the subject, or ameliorating at least one symptom of the disease or disorder under treatment.
  • patient refers to any animal, preferably a mammal and includes, but is not limited to, domestic and farm animals, primates and humans, for example, human beings, non-human primates, cows, horses, pigs, sheep, goats, dogs, cats, or rodents.
  • the subject is a human being of any age or race.
  • the subject suffers from cancer.
  • cancer refers to a disease characterized by uncontrolled cell division (or by an increase of survival or apoptosis resistance) and by the ability of said cells to invade other neighboring tissues (invasion) and spread to other areas of the body where the cells are not normally located (metastasis) through the lymphatic and blood vessels, circulate through the bloodstream, and then invade normal tissues elsewhere in the body.
  • tumors are classified as being either benign or malignant: benign tumors are tumors that cannot spread by invasion or metastasis, i.e., they only grow locally; whereas malignant tumors are tumors that are capable of spreading by invasion and metastasis.
  • cancer includes, without limitation, lung cancer, sarcoma, malignant melanoma, pleural mesothelioma, bladder carcinoma, prostate cancer, pancreas carcinoma, gastric carcinoma, ovarian cancer, hepatoma, breast cancer, colorectal cancer, kidney cancer, esophageal cancer, suprarenal cancer, parotid gland cancer, head and neck carcinoma, cervix cancer, endometrial cancer, liver cancer, mesothelioma, multiple myeloma, leukaemia, and lymphoma.
  • the cancer is renal cell carcinoma (RCC), breast cancer, or colorectal cancer.
  • RCC renal cell carcinoma
  • breast cancer or colorectal cancer.
  • the cancer is selected from pancreatic cancer, glioblastoma, glioma colorectal cancer, ductal breast carcinoma, astrocytic tumor.
  • pancreatic cancer refers to refers to abnormal or unregulated cell growth affecting the pancreas.
  • pancreatic carcinoma includes exocrine carcinoma, endocrine carcinoma and neuroendocrine carcinoma.
  • Illustrative non- limitative examples of pancreatic carcinoma are pancreatic adenocarcinoma, acinar cell carcinoma, cystadenocarcinomas and pancreatic mucinous cystic neoplasms.
  • the pancreatic cancer is pancreatic ductal adenocarcinoma.
  • PDAC pancreatic ductal adenocarcinoma
  • PDAC refers to a pancreatic cancer that displays a ductal-like morphology.
  • glioma refers to a type of cancer that starts in the brain or spine and which arises from glial cells and/or its precursors including Ependymomas (gliomas derived from ependymal cells), astrocytomas (also known as astrocytic tumours, which are gliomas derived from astrocytes and which includes glioblastoma multiforme), oligodendrogliomas (gliomas derived from oligodendrocytes) and mixed gliomas, such as oligoastrocytomas (derived from cells from different types of glia).
  • the glioma is a glioblastoma or an astrocytic tumor.
  • glioblastoma also known as “glioblastoma multiforme” or “GBM” as used, herein, refers to a type of primary brain tumor.
  • GBM is an anaplastic, highly cellular tumor with poorly differentiated, round, or pleomorphic cells, occasional multinucleated ceils, nuclear atypia, and anaplasia. Variants of the tumor include gliosarcoma, mult ifocal GBM, or gliomatosis cerebri (in which the entire brain may be infiltrated with tumor ceils).
  • GBM seldom I y metastasizes to the spinal cord or outside the nervous system.
  • GBM is graded by their microscopic and histological appearance. Generally, grade I (pilocytic astrocytomas) and grade 11 (benign astrocytomas) tumors grow slowly over many years while grade IV (GBM) grows rapidly, invading and altering brain function.
  • colon cancer also called “colorectal cancer” or "bowel cancer,” refers to a malignancy that arises in the large intestine (colon) or the rectum (end of the colon), and includes cancerous growths in the colon, rectum, and appendix, including adenocarcinoma.
  • breast cancer relates to any malignant proliferative disorder of breast cells, most commonly from the inner lining of milk ducts or the lobules that supply the ducts with milk. Cancers originating from ducts are known as ductal carcinomas, while those originating from lobules are known as lobular carcinomas.
  • the cancer contains cells that expressed increased levels of CPEB4 and decreased levels of non-phosphorylated CPEB1 compared to a reference sample.
  • the expressions "increased levels of CPEB4", "decreased levels of CPEB1" and reference sample” as well as preferred and particular embodiments have been previously defined and apply to the eighth and ninth aspects.
  • the nucleic acid construct, vector, viral particle, cell or pharmaceutical composition can be administered by any suitable route, for example, by systemic, oral, parenteral, intradermal, subcutaneous, intramuscular, intravenous or topical administration.
  • nucleic acid construct, vector, viral particle, cell or pharmaceutical composition is administered intravenously.
  • the invention relates to the use of the nucleic acid construct according to the second aspect, or the viral particle, cell or pharmaceutical composition comprising said nucleic acid construct in a diagnostic method of cancer or to aid in cancer surgery.
  • diagnosis method refers to a method wherein the properties of selective expression of the construct of the invention are used to confirm the presence of cancer in a subject or in a sample taken from said subject.
  • the selective expression of the gene of the construct in the tumour cells serves to confirm their cancerous nature, therefore helping to diagnose the subject as a patient of cancer.
  • the method would be suitable in vivo to identify and locate masses of cancerous cells, helping the surgeon to determine the tissue/s to be removed or the amount thereof.
  • Non-limiting examples of genes suitable to be used in the diagnostic method of the invention comprise reporter genes which transform substrates into colored reactives such as the gene lacZ, which encodes the enzyme ⁇ -galactosidase, or the GUS reporter system, enconding ⁇ -glucuronidase.
  • reporter genes suitable are those encoding proteins which can be detected through the use of Positron Emission Tomography, such as the gene encoding the protein Herpes Simplex Virus 1 Thymidine Kinase (HSV1-TK), the gene encoding the hypoxanthine phosphoribosil transferase, and the gene of L-amino acid decarboxylase.
  • Pancreatic cell lines PANC-1 and MIA PaCa-2, and embryonic kidney cell lines HEK293 and 293 T, were obtained from the American Type Culture Collection (ATCC, Manasas, VA).
  • RWP-1 cells were derived from human pancreatic adenocarcinoma biopsies perpetuated as xenograft in nude mice 37 .
  • Non-tumor fibroblasts were kindly provided by Dr. Eva Vaquero (Institut d'investigacions Biomediques Atust Pi i Sunyer, Barcelona, Spain). All cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Gibco BRL, Carlsbad, CA).
  • Immortal human pancreatic duct epithelial HPDE cells kindly provided by Dr. F.X. Real (CNIO, Madrid, Spain), were cultured and maintained as reported (Ouyang, H., et al. Immortal human pancreatic duct epithelial cell lines with near normal genotype and phenotype. Am J Pathol 157, 1623-1631 (2000)).
  • Human hepatocytes were obtained form Biopredic International (St Gregoire, France) and maintained according to the provider instructions RWP-1 shNT, Sh2 and Sh4 were previously described Ortiz-Zapater, E., et al. Key contribution of CPEB4-mediated translational control to cancer progression. Nat Med 18, 83-90 (2011).
  • HPDE-CPEB4- expressing cells were established by transducing parental cells with CPEB4 recombinant lentivirus.
  • Lentiviral constructs with a modified 3' UTR Lentiviral constructs with a modified 3' UTR.
  • the polyadenylation sequences (4193- 4199 and 4423-4429) from the pLS-CG lentiviral vector (Addgene, #12161) were mutagenized with the help of the QuickChange II Site-Directed Mutagenesis Kit (Stratagene, Wilmington, NC) according to the manufacturer's instructions (see Table 1 for primers). Mutagenized sequences were verified by DNA sequencing.
  • Table 1 Primer sequences d2EGFP and d2RFP genes were cloned by PCR with specific primers incorporating the Agel and Xhol restriction sites.
  • the 3'-UTR of tPA was PCR amplified using specific primers with sequences for the Xhol restriction enzyme at both ends.
  • the 3'-UTR of cBl was designed in the reverse primer of d2EGFP gene with a sequence for the Xhol restriction enzyme.
  • the 3 '-UTR with the TNF-a ARE sequences was generated by amplifying the previously generated cBl 3'-UTR with a primer containing the TNF- a main ARE sequence upstream of the CPE sites.
  • Lentiviral production Lentiviral particles were generated by cotransfection of plasmids pCMVAR8.91, pVSV-G and the pLS-CG-derived constructs, or a lenitiviral plasmid expressing CPEB4, in 293T cells by the calcium/phosphate DNA precipitation method (Clontech, Mountain View, CA). Supernatants from 293T-transfected cells were collected at 24 h and 48 h, filtered and processed for purification by ultracentrifugation for 2 h at 12°C at 20,200 r.p.m. After ultracentrifugation, the pellet was resuspended in PBS for 16 h at 4°C under constant agitation, aliquoted and frozen at -80°C for later use.
  • Flow cytometry assays were performed in HPDE, RWP-1, PANC-1 and MIA PaCa-2 cells. Forty thousand cells were plated per well in 12-multiwell plates and, 24 h post- seeding, cells were transduced with the indicated lentiviruses at 12 MOI per virus. Transduction was facilitated by spinning for 2 h at 12,000 r.p.m. Two days post- transduction, d2EGFP and dRFP levels were analyzed by flow cytometry using BD LSR II (Becton Dickinson). Flow cytometry results were analyzed using FlowJo 8.7 for Macintosh. Adenovirus generation.
  • the AdCPE genome was generated by the following steps: First, the El A polyA sequence of the pEND-K plasmid was mutated from AATAAA to ACTCGA, generating a new Xhol restriction site with the primer 5'-GCTGAATGAGATTGATGTAAGTTTACTCGAGGGTGAGATAATGTTTAACT TGC-3'
  • AduPAR was previously described (Huch, M., et al. Urokinase-type plasminogen activator receptor transcriptionally controlled adenoviruses eradicate pancreatic tumors and liver metastasis in mouse models. Neoplasia 11, 518-528, 514 p following 528 (2009)).
  • AdDUC genome was generated by incorporating the CPE containing 3'UTR of E1A into the Boxl and Aflll restriction sites of the pSH-DM-UPAR-ElA plasmid followed by recombination of the resulting plasmid with the Adwt genome in BJ5183 cells.
  • Adwt was obtained from ATCC (Manasas, VA).
  • Adwt, AdCPE, AduPAR and AdDUC were propagated in A549 cells and purified by cesium chloride banding.
  • concentration of viral particles vp/mL was determined by means of optical density; and infectious particles (pfu/mL) by hexon immunostaining in HEK293 cells (Cascante, A., et al.
  • GCV modulates the antitumoural efficacy of a replicative adenovirus expressing the Tat8-TK as a late gene in a pancreatic tumour model. Gene Ther 14, 1471-1480 (2007)). Both viruses presented equal vp/pfu ratio.
  • Protein extracts were obtained with lysis buffer (50 mM Tris- HC1 at pH 6.8, 2% SDS) containing 1% Complete Mini Protease Inhibitor (Roche Diagnostics GmbH, Basel, Switzerland).
  • BCA Protein Assay Kit (Pierce-Thermo Fisher Scientific, Waltham, MA) was used to determine the protein concentration, and total proteins (35 ⁇ g) were resolved by electrophoresis on 7.5% gels and transferred to nitrocellulose membranes by standard methods.
  • Membranes were immunoblotted with rabbit anti-adenovirus-2/5 El A polyclonal antibody (1 :200; clone 13 S-5; Santa Cruz Biotechnology, Dallas, TX) or anti-CPEB4 antibody (1 :200; Abeam, Cambridge, UK) or anti-CPEBl (1 :200; 13274-1-AP, ProteinTech, IL, USA) 1 h at room temperature (RT). Blots were rinsed with TBS-T and incubated for 45 min at RT with HRP- conjugated goat anti-rabbit IgG (DakoCytomation, Glostrup, Denmark). Antibody labeling was detected by the enhanced chemiluminescent method (Amersham Biosciences, Amersham, UK).
  • Quantitative expression data were normalized to Gdx Fw 5 '-GGCAGCTGATCTCCAAAGTCCTGG-3 '(SEQ ID NO: 24) and Gdx Rev 5 '-AACGTTCGATGTCATCCAGTGTTA-3 '(SEQ ID NO: 25).
  • d2EGFP and dRFP were detected with the primers: d2EGFP Fw 5'- CAACAGCCACAACGTCTATATCAT-3 '(SEQ ID NO: 26) and d2EGFP Rv: 5 '- ATGTTGTGGCGGATCTTGAAG-3 '(SEQ ID NO: 27); and dRFP Fw 5 '- GCCCTTCGCCTGGGACAT-3 '(SEQ ID NO: 28) and dRFP Rv 5 '- GGTGCTTCACGTACACCTTGGA-3 '(SEQ ID NO: 29).
  • Quantitative expression data were normalized using the primers ACTB Fw 5 '-CTGGAACGGTGAAGGTGACA- 3 '(SEQ ID NO: 30) and ACTB Rv 5 '-GGGAGAGGACTGGGCCATT-3'(SEQ ID NO: 31).
  • Viral genome quantification Viral DNA was obtained from supernatants, cellular extracts or frozen tissues using the UltraClean BloodSpin DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA) according to the manufacturer's instructions.
  • Viral genomes were determined by real-time qPCR using the SYBER Green I Master plus mix (Roche Diagnostics, Basel, Switzerland) and the primers hexon Fw 5 '- GCCGCAGTGGTCTTACATGCACATC-3 ' (SEQ ID NO: 32) and hexon Rv 5 '- CAGCACGCCGCGGATGTCAAAG-3 ' (SEQ ID NO: 33).
  • Adenoviral copy number was relativized to the cellular DNA content using the albumin intron 12 primers of Fw 5 '-CTGTCATCTCTTGTGGGCTGT-3 ' (SEQ ID NO: 34) and Rv 5'- GGCTATCCAAACTCATGGGAG-3 ' (SEQ ID NO: 35).
  • Polyadenylation Assays Polyadenylation patterns were evaluated using a modified version of the RNA ligation-coupled RT-PCR presented previously (Rassa, J.C., Wilson, G.M., Brewer, G.A. & Parks, G.D. Spacing constraints on reinitiation of paramyxovirus transcription: the gene end U tract acts as a spacer to separate gene end from gene start sites. Virology 274, 438-449 (2000).
  • RNA was ligated to 0 ⁇ of PI anchor primer (5'-P-GGTCACCTTGATCTCAAGC-NH2-3') (SEQ ID NO: 36) in 10 ⁇ reaction using T4 RNA ligase I (New England Biolabs, Ipswich, MA) according to manufacturer's instructions.
  • Half of the reaction product was used in a 50 ⁇ reverse transcription reaction with PrimeScript RT-PCR (Takara Bio, Mountain View, CA) according to manufacturer's instructions, using 0.1 ⁇ g of ⁇ as a reverse primer (5 '-GCTTCAGATCAAGGTGACCTTTTT-3 ') (SEQ ID NO: 37).
  • CPEs provide oncoselectivity to replication-competent adenoviruses.
  • chimeric mRNAs with three combinations of 3 ' UTRs fused to the d2EGFP open reading frame were tested. These mRNAs were expressed in a battery of pancreatic normal (HPDE) and tumor (RWP-1, PANC-1 and MIA PaCa-2) cells expressing variable levels of CPEBl and CPEB4 (Fig. la).
  • the first UTR was derived from Xenopus cyclin Bl (cBl) 3' UTR mRNA and contained two consensus CPEs and one nonconsensus CPE.
  • This CPE arrangement promotes both translational repression by unphosphorylated CPEBl and translational activation by CPEB4 (Igea, A. & Mendez, R. EMBO J 29, 2182-2193 (2010); Novoa, I. et al, Nat Cell Biol 12, 447-456 (2010), Belloc, E. et al. Biochem Soc Trans 36, 665-670 (2008).
  • the second UTR was synthetized by combining cBl CPEs with an ARE sequence that opposes CPE-mediated polyadenylation and translational activation from the TNF-a 3 ' UTR mRNA (TNF-a- CB1).
  • the third UTR was generated from a fragment of the tissue plasminogen activator (tPA) 3' -UTR mRNA that contains two CPEs and two ARE sequences (Ortiz- Zapater, E., et al.. Nat Med 18, 83-90 (2011)).
  • tPA tissue plasminogen activator
  • Fig. lb Table 1
  • Lentiviruses expressing the d2EGFP with the indicated 3'-UTRs or a control WT 3'- UTR (without CPEs) and a lentivirus with a destabilized dRFP bearing a control 3 '- UTR (WT) were used to co-infect the non-tumor HPDE cells and the pancreatic cancer cell lines (Fig. 2a).
  • the resulting d2EGFP- to-dRFP expression ratio indicated that cBl was the only 3'-UTR promoting a differential translational control in normal cells compared to cancer cells.
  • CB1-3'- UTR repressed the expression of d2EGFP in HPDE cells as compared to the dRFP control 3 ' -UTR, whereas it promoted activation in the cancer cells, with a stronger effect in PANC-1 (Fig. lc).
  • the d2EGFP/dRFP ratio was proportional to the CPEB4/CPEB1 ratio (Fig. la).
  • the specific regulation promoted by the CBl-3'-UTR was used to generate an oncoselective replication-competent adenovirus Ad5.
  • viral replication was target by designing a virus in which the translation of El A mRNA was regulated by CPEBs.
  • the adenoviral immediate early E1A gene was selected because it is the first gene transcribed after an adenoviral infection and thus acts as a master transcriptional regulator of further early viral genes and modifies several cell host functions required for viral DNA replication.
  • the WT 3'-UTR of the viral E1A coding sequence was replaced with the cBl 3 '-UTR to give us AdCPE (Fig. 3a).
  • the poly(A) tail length of the different E1A transcripts was measured in the four cell lines by RNA ligation-coupled RT-PCR analysis (Fig. 3c). It was found that the CPE-mediated destabilization of the ElA-cBl mRNA in HPDE cells was associated with a shorter poly(A) tail (Fig. 3d), which resulted in reduced El A protein expression from the cBl 3 '-UTR mRNA as compared with the WT 3'-UTR (Fig. 3e).
  • AdCPE-infected non-transformed cells showed a strong reduction in viral genome copy numbers (Fig. 3f) and decreased cytotoxicity (increased IC50; Fig. 3g) as compared to the control virus Adwt.
  • the lowest performance of AdCPE was also observed in human primary fibroblasts.
  • cBl 3'-UTR was as efficient as the WT 3'-UTR in supporting optimum levels of viral driven El A expression (Fig. 3e), which in turn resulted in equal viral genome copy numbers and IC50 from both 3'-UTRs (Fig. 3f,g).
  • the similar effects of Adwt and AdCPE in cancer cells also highlight that the small size of the cBl 3'-UTR did not compromise virus fitness and packaging efficiency.
  • CPE-mediated oncoselectivity is provided by CPEB4.
  • AdCPE activity is highly impaired in normal tissues when compared to Adwt.
  • liver damage-associated toxicity which is one of the major side effects of Ad-expressing El A
  • body weight, macroscopic liver appearance and serum parameters were analyzed in mice after intravenous delivery of Adwt or AdCPE.
  • Adwt caused a progressive loss of weight, whereas AdCPE led to a decrease in body weight by day 1 that then remained stable for the following days (Fig. 6d).
  • Livers injected with Adwt showed a steatotic appearance that was not observed in AdCPE livers (Fig. 6e).
  • Oncolytic viruses are advancing to clinical trials and are envisioned as important agents in oncology in the near future. Accordingly, optimized engineered viruses are under development to maximize their anticancer effects. However as their potency increases potential associated toxicities grow proportionally, pointing the need to develop highly tumor-specific viruses. It is shown that engineering adenoviruses with CPE regulatory elements, to control El A expression post transcriptionally, result in attenuated viral activity in normal cells while maintaining, or even increasing, potency in cancer cells. The specificity of the antitumoral response is directly derived from the ectopic expression of CPEB4 in tumors. Thus, depletion of CPEB4 attenuates viral activity in tumoral cells while overexpression of CPEB4 in non-transformed cells increases viral replication.
  • the levels of CPE-mediated expression may be further increased by reduced levels of CPEBl .
  • CPEBl levels are reduced while CPEB4 levels increase promoting cytoplasmic polyadenylation, with the result of increased mR A stability and translation of CPE regulated transcripts.
  • viral genome replication dependent on CPEB4 activity, is restricted to tumoral cells, resulting in an attenuated virus in healthy tissues but a full competent virus in cancer cells.
  • the CPE regulated virus maintains its oncolytic capacity while significantly reducing damage to non-tumoral tissues, mainly in the liver since it is the target organ of adenovirus sequestration upon intravascular delivery.
  • This increased selectivity allows for enhanced therapeutic index since increased antitumoral capacity is obtained after AdcBl treatment at viral doses that Adwt injection compromises mice survival.
  • the alternative post-entry strategy to regulate viral replication is a negative targeting approach based on the miRNA expression in normal tissues to restrict viral replication of miRNA-target sites engineered viruses. Indeed, this is a very versatile approach for many different viruses and highly efficient. However, the evolution of escape mutants in miRNA targeted viruses or the potential off-target effects on the host miRNA machinery have been proposed as potential caveats. Interestingly, no mutations were found in the CPE-regulated adenovirus under evolutionary pressure (Fig. 9). To achieve a tight restriction of replication to tumor cells, it should be possible to combine different targeting strategies such as regulation by more than one viral gene(Bofill-De Ros, X., et al.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne une construction d'acides nucléiques comprenant un polynucléotide d'intérêt et une séquence en position 3 non traduite comprenant au moins deux éléments de polyadénylation cytoplasmiques. L'invention concerne également des vecteurs, des particules virales, des cellules et des compositions pharmaceutiques comprenant ladite construction d'acides nucléiques, et leur utilisation pour induire l'expression sélective d'un polynucléotide dans une cellule cancéreuse. Elle concerne ladite construction d'acides nucléiques destinée à une utilisation en médecine et dans le traitement du cancer.
PCT/EP2017/055836 2016-03-11 2017-03-13 Constructions d'acides nucléiques et vecteurs d'expression oncosélective d'un transgène WO2017153606A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16382108.5 2016-03-11
EP16382108 2016-03-11

Publications (1)

Publication Number Publication Date
WO2017153606A1 true WO2017153606A1 (fr) 2017-09-14

Family

ID=55699589

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2017/055836 WO2017153606A1 (fr) 2016-03-11 2017-03-13 Constructions d'acides nucléiques et vecteurs d'expression oncosélective d'un transgène

Country Status (1)

Country Link
WO (1) WO2017153606A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114081966A (zh) * 2021-11-26 2022-02-25 中山大学附属第一医院 Aav9-cpeb3在制备治疗胃癌的药物中的应用
WO2023025275A1 (fr) * 2021-08-26 2023-03-02 The Hong Kong University Of Science And Technology Compositions, procédés d'évaluation et méthodes de traitement de pathologies liées à l'âge
WO2023081885A1 (fr) * 2021-11-08 2023-05-11 Kernal Biologics, Inc. Thérapie anticancéreuse oncosélective
EP4273243A1 (fr) 2022-05-02 2023-11-08 Fundació Hospital Universitari Vall d'Hebron - Institut de Recerca Constructions d'acide nucléique et vecteurs pour l'expression spécifique aux podocytes

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050095632A1 (en) * 2002-01-23 2005-05-05 Macnicol Angus M. Human cytoplasmic polyadenylation element binding protein and uses thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050095632A1 (en) * 2002-01-23 2005-05-05 Macnicol Angus M. Human cytoplasmic polyadenylation element binding protein and uses thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
AHMED A ET AL: "A conditionally replicating adenovirus targeted to tumor cells through activated RAS/P- MAPK-selective mRNA stabilization", NATURE BIOTECHNOLOGY, GALE GROUP INC, US, vol. 21, no. 7, 1 July 2003 (2003-07-01), pages 771 - 777, XP002977838, ISSN: 1087-0156, DOI: 10.1038/NBT835 *
D. M. KOCHANEK ET AL: "CPEB1 Regulates the Expression of MTDH/AEG-1 and Glioblastoma Cell Migration", MOLECULAR CANCER RESEARCH, vol. 11, no. 2, 29 January 2013 (2013-01-29), US, pages 149 - 160, XP055295452, ISSN: 1541-7786, DOI: 10.1158/1541-7786.MCR-12-0498 *
ELENA ORTIZ-ZAPATER ET AL: "Key contribution of CPEB4-mediated translational control to cancer progression", NATURE MEDICINE., vol. 18, no. 1, 1 January 2012 (2012-01-01), US, pages 83 - 90, XP055295464, ISSN: 1078-8956, DOI: 10.1038/nm.2540 *
MARIA PIQUÉ ET AL: "A Combinatorial Code for CPE-Mediated Translational Control", CELL, vol. 132, no. 3, 1 February 2008 (2008-02-01), pages 434 - 448, XP055000279, ISSN: 0092-8674, DOI: 10.1016/j.cell.2007.12.038 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023025275A1 (fr) * 2021-08-26 2023-03-02 The Hong Kong University Of Science And Technology Compositions, procédés d'évaluation et méthodes de traitement de pathologies liées à l'âge
WO2023081885A1 (fr) * 2021-11-08 2023-05-11 Kernal Biologics, Inc. Thérapie anticancéreuse oncosélective
CN114081966A (zh) * 2021-11-26 2022-02-25 中山大学附属第一医院 Aav9-cpeb3在制备治疗胃癌的药物中的应用
CN114081966B (zh) * 2021-11-26 2023-09-08 中山大学附属第一医院 Aav9-cpeb3在制备治疗胃癌的药物中的应用
EP4273243A1 (fr) 2022-05-02 2023-11-08 Fundació Hospital Universitari Vall d'Hebron - Institut de Recerca Constructions d'acide nucléique et vecteurs pour l'expression spécifique aux podocytes
WO2023213738A1 (fr) 2022-05-02 2023-11-09 Fundació Hospital Universitari Vall D’Hebron – Institut De Recerca Constructions d'acides nucléiques et vecteurs pour l'expression spécifique des podocytes

Similar Documents

Publication Publication Date Title
WO2017153606A1 (fr) Constructions d'acides nucléiques et vecteurs d'expression oncosélective d'un transgène
JP2023115125A (ja) フェニルケトン尿症を処置するための、プロモーターとエンハンサーの組み合わせを有するベクター
AU2018272095A1 (en) Recombinant adenoviruses carrying transgenes
US20180057839A1 (en) Therapeutic compositions comprising transcription factors and methods of making and using the same
WO2019191494A1 (fr) Vaccins anticancéreux personnalisés
Dempe et al. SMAD4: a predictive marker of PDAC cell permissiveness for oncolytic infection with parvovirus H‐1PV
Han et al. Targeted suicide gene therapy for liver cancer based on ribozyme-mediated RNA replacement through post-transcriptional regulation
Villanueva et al. Translational reprogramming in tumour cells can generate oncoselectivity in viral therapies
JP4660486B2 (ja) ヒトアポリポ蛋白質（ａ）クリングルＬＫ６８またはＬＫ８遺伝子を有効成分として含有する抗癌治療剤及びそれを使用した癌治療方法
Geekiyanage et al. MiR-31 and miR-128 regulates poliovirus receptor-related 4 mediated measles virus infectivity in tumors
Budzik et al. Oncolytic foamy virus: generation and properties of a nonpathogenic replicating retroviral vector system that targets chronically proliferating cancer cells
Luo et al. A triple-regulated oncolytic adenovirus carrying microRNA-143 exhibits potent antitumor efficacy in colorectal cancer
Huch et al. Urokinase-type plasminogen activator receptor transcriptionally controlled adenoviruses eradicate pancreatic tumors and liver metastasis in mouse models
Lopez et al. Tumor associated stromal cells play a critical role on the outcome of the oncolytic efficacy of conditionally replicative adenoviruses
Zou et al. Gene therapy for hepatocellular carcinoma using adenoviral vectors delivering a gene encoding IL-17A-neutralizing antibody fragments
US20190367944A1 (en) Recombinant virus vectors for the treatment of glycogen storage disease
Wang et al. Engineered TCR T-cell therapy targeting mass spectrometry-identified natural epitope in PDAC
EP3743094B1 (fr) Variants sécrétoires de mda-7/il-24 et procédés d'utilisation
EP2421542A1 (fr) Vecteurs de virus spumeux et leurs procédés d'utilisation
US20120141440A1 (en) Foamyvirus vectors and methods of use
Meumann et al. Hepatocellular Carcinoma Is a Natural Target for Adeno-Associated Virus (AAV) 2 Vectors. Cancers 2022, 14, 427
Liu et al. Novel strategies to augment genetically delivered immunotoxin molecular therapy for cancer therapy
EP2734219B1 (fr) Fragments e1a d'adénovirus utilisés dans des traitements antinéoplasiques
WO2007127882A2 (fr) Fragment d'adn isolé du promoteur humain a33 et son utilisation pour réguler l'expression d'un gène hétérologue dans des cellules tumorales
JP2005538697A (ja) 新規前立腺腫瘍特異的プロモーター

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 17710273

Country of ref document: EP

Kind code of ref document: A1

122 Ep: pct application non-entry in european phase

Ref document number: 17710273

Country of ref document: EP

Kind code of ref document: A1